Datasets:

tsharish

/

pubmed-summarization-1k

like 0

[ { "content": "You are a medical writer. Summarize the following article: volleyball is a sport played in a relatively small court ( 9 m9 m ) , inside which the players perform fast movement and repeated high vertical jumping in a very short time . during a volleyball match , the players are required to serve , pass , and set the ball , as well as to spike and attack . among those actions , spiking and attacking demand intense vertical jumping and landing . during volleyball matches , when numerous repetitions of the aforementioned movements are performed \n , the anaerobic type of exercise is the most frequently performed activity , with a ratio to aerobic exercises of 7:3 ( lamb , 1984 ) . playing volleyball also requires agility and fast reaction time in order to prevent the ball from touching the floor . \n a good muscle strength ratio between dominant and nondominant sides , and between antagonist and agonist muscles , especially of the knee joint , is ultimately important for sports in order to have stability of the lower limbs and to prevent knee injury ( agaard et al . , 1998 ; \n bahr and krosshang , 2005 ) . since muscle imbalance is one of the main causes of sport injuries , the assessment of the muscle function is very important for designing injury prevention programs . \n the hamstrings ( flexion ) and the quadriceps femoris ( extension ) muscles are the key effectors during high performance activities during sports , such as running and jumping ( jespersen et al . , 2000 ) . \n most of the lower limb movements require strong bilateral muscle contractions ( maclaren , 1990 ) . for volleyball \n it is important to have balanced muscle strength development in both legs ( brooks and fahey , 1987 ; thorstensson et al . , 1976 ) , with minimal differences regarding muscle strength between the dominant and nondominant legs . \n further , the ratio between the muscle strengths of the hamstring and of the quadriceps ( h / q ) should be low for volleyball . \n moreover , during a spike action , the muscles of the legs , lower back , and knees are used in an explosive manner in order to generate a strong force , which requires effective control of the entire body in order to prevent injury . \n in other words , an ideal training method for volleyball would have to train the simultaneous control of the lower back , knees , and legs . as it was previously reported , the spike and serving motions of volleyball require such dynamic stabilization in order to maintain the integrity of the glenohumeral joint ( aagaard and jrgensen , 1996 ; bahr and krosshang , 2005 ) . \n stability of the glenohumeral joint during the acceleration , deceleration , and follow - through phases of striking is maintained by the rotator cuff muscles acting eccentrically , compressing the humeral head . \n thus , active and passive mechanisms work to maintain dynamic stability and compression of the humeral head within the glenoid fossa during spiking and serving . a study by aagaard et al . \n ( 1997 ) investigated knee injury in 295 danish volleyball players and found that 55% of the players had experienced knee injury at least once , while 48% responded as having chronic knee injury . \n players with 11.5 years of experience are in a group with increased risk of overuse injuries ( seminati and minetti , 2013 ) . \n further , a previous study showed that , for achieving good performances during powerful spikes and servings , cooperative harmony between the hamstrings , quadriceps , shoulder , and lower back muscles ( chung et al . \n specially , volleyball attackers exhibit increased risk for back injuries due to increased spinal twisting , flexing , lateral bending , and asymmetrical movements . in general , low back injuries \n are associated with dysfunctions regarding trunk muscle coactivation or recruitment patterns , not with reduced strength ( seminati and minetti , 2013 ) . \n isokinetic assessment can be used to measure torque values at several joint of the body . \n isokinetic testing evaluates the torque generated during the exercise , allowing for an assessment of strength and functional ability , for a comparison of different muscles . \n the objective of the present study was to assess isokinetic muscle functions in male volleyball players of the korean national volleyball who is preparing for the 2020 tokyo olympics . \n we thus aim to accurately evaluate their muscle functions , and identify the best training strategy to achieve optimal muscle strength balance in future training programs . \n the participants in the present study consisted of 14 male volleyball players , aged 1626 years , who are members of the korean national volleyball team preparing for the tokyo olympics in 2020 . \n the participants self - reported their play position , dominant leg and shoulder , length of their volleyball career , and age . \n anthropometric measurements ( table 1 ) included height , body weight ( bw ) , muscle mass , and body composition , and were performed using inbody2 ( inbody 670 , seoul , korea ) . \n the mean volleyball playing experience among the study participants was 103.1439.6 months ( range , 17148 months ) . \n the mean height , weight , and age were 193.697.6 cm ( range , 182.9207.8 cm ) , 84.767.47 kg ( range , 76.3100 kg ) , and 20.71.8 years ( range , 1825 years ) , respectively . \n , the participants completed a nonspecific , 5-min warm - up on a stationary bicycle ergometer at a self - regulated , low - to - moderate intensity , followed by 10 min of dynamic stretching that targeted the main muscle group being tested . \n the warm - up routine was performed under the supervision of a examiner . in the present study \n , new york , ny , usa ) at the department of exercise rehabilitation and welfare , gachon university . all measurements were performed by a examiner with 5 years of experience , during a single test session . \n muscle strength was evaluated in terms of peak torque and average power , calculated from five repeated measurements at an angular speed of 60/sec . to allow comparisons in terms of maximum muscle strength in the shoulder , knee , and lumbar joints , the peak torque was normalized by bw ( ptbw , percent of torque produced per kg of bw ) . \n muscle strength in the shoulder was measured on the dominant side , while the shoulder s internal rotation and external rotation ( peak torque , expressed in units of nm ) were measured for the striking arm , i.e. , the shoulder that the participant reported to be using most frequently for hitting or serving the ball during the game ( stickley et al . , 2008 ) . \n the measurements were taken with the participants in a seated modified neutral position , with 90 of elbow flexion , 30 of glenohumeral joint flexion , and 30 of glenohumeral abduction ; during the measurements , the participants wore stabilization straps across the hip and upper body . \n the h / q ratios for the right and left knee were measured on an adjustable dynamometer chair , with the participants comfortably seated with the hip joint at approximately 75 of flexion ( where 0 represents full extension ) . \n the participants wore straps , and the shoulders were fixed in ventral - dorsal and cranial - caudal direction using shoulder pads . for further stabilization of the upper body during the test session , the participants were instructed to hold the handgrips located on the side of the chair . \n the measurement was taken with the participants performing concentric flexion and extension with their knees . \n trunk strength was measured between the 4th and 5th lumbar vertebrae , where the extension of the iliac crest meets the spine . \n using this position as the reference , the footplate of the isokinetic dynamometer was adjusted to accommodate comfortable depth and height for each participant . \n the participants stood on the footplate , and pads were placed and fixed on the chest ( below the clavicle ) , thighs , and below the knees . \n subsequently , the participants were instructed to hold both handgrips located in front of their chest . \n the dynamometer used in our study was designed to enable trunk flexion and extension movements in an up - right position , with the feet positioned on two horizontal footplates , and the knees in a slightly flexed position ( 1020 ) . \n we measured trunk strength during trunk flexion from 10 to 50 , and during trunk extension from 50 to 10 ( davies and gould , 1982 ; guilhem et al . , 2014 ) . \n the raw data for assessment and diagnosis of isokinetics and function of the shoulders , lower back , and knees were organized using excel 2010 ( microsoft corp . , \n the participants in the present study consisted of 14 male volleyball players , aged 1626 years , who are members of the korean national volleyball team preparing for the tokyo olympics in 2020 . \n the participants self - reported their play position , dominant leg and shoulder , length of their volleyball career , and age . \n anthropometric measurements ( table 1 ) included height , body weight ( bw ) , muscle mass , and body composition , and were performed using inbody2 ( inbody 670 , seoul , korea ) . \n the mean volleyball playing experience among the study participants was 103.1439.6 months ( range , 17148 months ) . \n the mean height , weight , and age were 193.697.6 cm ( range , 182.9207.8 cm ) , 84.767.47 kg ( range , 76.3100 kg ) , and 20.71.8 years ( range , 1825 years ) , respectively . \n , the participants completed a nonspecific , 5-min warm - up on a stationary bicycle ergometer at a self - regulated , low - to - moderate intensity , followed by 10 min of dynamic stretching that targeted the main muscle group being tested . \n in the present study , muscle strength was measured using the isokinetic dynamometer ( cybex international inc . \n , new york , ny , usa ) at the department of exercise rehabilitation and welfare , gachon university . all measurements were performed by a examiner with 5 years of experience , during a single test session . \n muscle strength was evaluated in terms of peak torque and average power , calculated from five repeated measurements at an angular speed of 60/sec . to allow comparisons in terms of maximum muscle strength in the shoulder , knee , and lumbar joints \n , the peak torque was normalized by bw ( ptbw , percent of torque produced per kg of bw ) . \n muscle strength in the shoulder was measured on the dominant side , while the shoulder s internal rotation and external rotation ( peak torque , expressed in units of nm ) were measured for the striking arm , i.e. , the shoulder that the participant reported to be using most frequently for hitting or serving the ball during the game ( stickley et al . , 2008 ) . \n the measurements were taken with the participants in a seated modified neutral position , with 90 of elbow flexion , 30 of glenohumeral joint flexion , and 30 of glenohumeral abduction ; during the measurements , the participants wore stabilization straps across the hip and upper body . \n the h / q ratios for the right and left knee were measured on an adjustable dynamometer chair , with the participants comfortably seated with the hip joint at approximately 75 of flexion ( where 0 represents full extension ) . \n the participants wore straps , and the shoulders were fixed in ventral - dorsal and cranial - caudal direction using shoulder pads . for further stabilization of the upper body during the test session , the participants were instructed to hold the handgrips located on the side of the chair . \n the measurement was taken with the participants performing concentric flexion and extension with their knees . \n trunk strength was measured between the 4th and 5th lumbar vertebrae , where the extension of the iliac crest meets the spine . \n using this position as the reference , the footplate of the isokinetic dynamometer was adjusted to accommodate comfortable depth and height for each participant . \n the participants stood on the footplate , and pads were placed and fixed on the chest ( below the clavicle ) , thighs , and below the knees . \n subsequently , the participants were instructed to hold both handgrips located in front of their chest . \n the dynamometer used in our study was designed to enable trunk flexion and extension movements in an up - right position , with the feet positioned on two horizontal footplates , and the knees in a slightly flexed position ( 1020 ) . \n we measured trunk strength during trunk flexion from 10 to 50 , and during trunk extension from 50 to 10 ( davies and gould , 1982 ; guilhem et al . , 2014 ) . \n the raw data for assessment and diagnosis of isokinetics and function of the shoulders , lower back , and knees were organized using excel 2010 ( microsoft corp . , \n tables 2 , 3 , and 4 show the results regarding muscle strength of the shoulders , knees , and lower back in members of the male korean national volleyball team preparing for the tokyo olympics in 2020 . with respect to the isokinetic muscle function in the shoulder , \n the lowest ptbw was noted for the athletes with the shortest volleyball experience ( ptbw was 101 and 104 nm / kg for participants v10 and v14 , respectively ) , while the highest ptbw ( 149 nm / kg ) was noted for participant v13 . when considering the playing position , \n the participants with highest ptbw values were v13 ( ptbw=143 nm / kg ) , v12 ( ptbw=116 nm / kg ) , and v8 ( ptbw=134 nm / kg ) for the left , center , and right position , respectively , while participant v7 had the highest ptbw ( 137 nm / kg ) among setters and libero players . \n therefore , playing in the left position was associated with the highest ptbw of the shoulder , while playing in the center position was associated with the lowest ptbw . \n participant v1 exhibited a low ratio ( 31% ) between internal and external rotation of the shoulder , while participants v3 and v14 exhibited a high ratio ( 75% and 69% , respectively ) , suggesting muscle imbalance . among these , \n with respect to the isokinetic muscle function in the lumbar joints , participant v4 had the lowest power ( ptbw=301 nm / kg ) , while participant v4 had the highest power ( ptbw=468 nm / kg ) . when considering the playing position , \n the participants with the highest ptbw were v4 ( ptbw=468 nm / kg ) , v8 ( ptbw=456 nm / kg ) , and v10 ( ptbw=402 nm / kg ) for the left , right , and center position , respectively , while participant v6 had the highest ptbw among setters and libero players ( ptbw= 447 nm / kg ) . \n therefore , playing in the left position was associated with the highest ptbw of the lumbar joints , while playing in the center position was associated with the lowest ptbw . \n a total of 4 out of 14 participants ( v4 , v5 , v8 , and v11 ) exhibited a low ratio ( < 80% ) of extension and flexion in the lower back , suggesting muscle imbalance . \n with respect to isokinetic muscle function in the knee , we found that the ptbw was generally higher in the right knee than in the left . \n participant v4 had the highest ptbw ( 378 nm / kg ) of the right knee , while participant v10 had the lowest ptbv ( 148 nm / kg ) . \n when considering the playing position , the participants with the highest ptbw were v4 ( ptbw=378 nm / kg ) , v8 ( ptbw=313 nm / kg ) , and v12 ( ptbw=250 nm / kg ) for the left , right , and center position , respectively , while participant v7 had the highest ptbw among setters and libero players ( ptbw= 319 nm / kg ) . \n therefore , playing in the left position was associated with the highest ptbw , while playing in the center position was associated with the lowest ptbw . of the 14 participants , a total of 8 ( v1 , v2 , v4 , v5 , v10 , v12 , v13 , and v14 ) had left - right extension deviation of > 10% , while 4 ( v1 , v4 , v7 , and v13 ) had left - right flexion deviation . moreover , considering that the normal extension and flexion ratio is 50%70% , a total of 4 participants ( v1 , v5 , v10 , and v11 ) , showed imbalance on the right side , while 5 participants ( v1 , v2 , v5 , v11 , and v14 ) showed imbalance on the left side . among these \n , there were two participants with ptbw of < 200 nm / kg , specifically : participant v10 among center position players ( ptbw=149 nm / kg ) , and participant v1 among left position players ( ptbw=188 nm / kg ) . \n assessments of muscle strength have been conducted using various isometric , isotonic , and isokinetic exercise methods . \n it was suggested that isokinetic exercise using an isokinetic dynamometer allows for a more objective and accurate assessment ( hislop and perrine , 1967 ) this was later proven by thistle et al . \n , when the muscle strength is too high , or the exercise speed exceeds the limit predefined in the machine , the machine applies a resistance force equivalent to the surpassing amount . \n this resistance force is considered to expresses the force generated in the muscles , and is stored in the machine as torque force . moreover , unlike isometric or isotonic exercises , the isokinetic exercise has the advantage of generating maximum contraction for the entire range of motion ( rom ) ( hislop and perrine , 1967 ) . \n thus , isokinetic exercise can objectively and accurately compare the bilateral muscle strengths of a particular joint , as well as the agonistic and antagonistic muscle strengths of a single joint . \n moreover , the exercise speed can be increased as the muscle strength increases in order to allow for a gradually increasing intensity during exercise and training ( gilliam et al . , 1979 ; james et al . \n the optimal ratio between internal and external rotation in the shoulder was shown to be 3:2 ; the optimal ration between trunk flexion and extension was shown to be 1:1 ; and the optimal ratio between knee flexion and extension was shown to be 2:3 ( dvir , 2004 ; rosene et al . , 2001 ) . however , the ranges of ideal muscle strength ratio vary depending on the study . for the knees , \n the ratio of forces involved in extension to those involved in flexion should be at least 50%70% . \n further , the force ratio between the dominant and nondominant sides should be of 1:1 ; however , a difference of 10% is considered as being within a normal range ( andrade mdos et al . , 2012 ; cheung et al . , 2012 \n ( 1985 ) used flexion range of 3040 and extension range of 1520 , while kim and shin ( 1999 ) and newton et al . \n ( 1993 ) applied flexion range of 80 , and davies and gould ( 1982 ) applied a rom of 90. however , the most effective rom for studying trunk muscle strength and trunk exercise has not been suggested yet . in the present study , rom \n was set to 80 for flexion and 15 for extension , in order to induce peak isokinetic flexion and extension . \n particularly , with respect to the speed of isokinetic trunk flexion and extension , parnianpour et al . \n ( 1988 ) stated that trunk flexion and extension speed of 60/sec is appropriate for activities of daily living , while a speed of 30/sec is appropriate for patients with lower back pain ( marras and wongsam , 1986 ) ; if lower back injury is incomplete , measuring at 60/sec would not represent a fully functional activity . \n ( 1993 ) stated that the ideal measurement should account for the exercise speeds of 60/sec , 90/sec , and 120/sec . in the present study , \n the speed was set to 60/sec for measuring the maximum muscle strength of the volleyball players . \n there have been many studies on the extension and flexion strength of the trunk muscles , and the reported results have indicated that extension was stronger than flexion ( flint , 1958 ; guilhem et al , 2014 ; mayer et al . , 1985 ; mcneill et al . , 1980 ; \n the reason for this is that the cross section during trunk extension is bigger than during flexion . \n therefore , although the trunk extension to flexion ratio is known to be from 1.1:1 to 2.7:1 ( dvir , 2004 ; smith et al . , 1985 ; wessel et al . , 1992 ) \n , in the case of volleyball players , at the moment of bending the lower back backwards and engaging in position for spiking or serving , maximum power is generated by the combination of power from flexion motion of the lower back and of the shoulders . \n therefore , it would be possible to assume that the appropriate flexion to extension ratio for preventing lower back injury and for drawing out peak sports performance would be 1:1 . however , the results of the present study showed that 13 of the 14 players exhibited greater strength for extension than for flexion . \n moreover , results from measurements of 5 repetitions performed at the speed of 60/sec showed that 4 of the 14 players had a difference of 20% in the trunk flexion - to - extension ratio , showing a relative imbalance regarding the strengths for extension and flexion . \n this result supports the need for training programs focused on balance control . in order to understand which ratios would allow for better spike and serving skills during matches , studies on reference values for ptbw and extension and flexion strength ratio \n most volleyball players use one arm the dominant to practice a lot of forceful spike and overhead serves during the training season . \n bahr and krosshaug ( 2005 ) indicated that muscle imbalance causes damages to the joints by pulling down on the joints in an asymmetric manner ( meister and andrews , 1993 ) . \n based on this , it is possible that having unbalanced internal to external rotation ratios is associated with higher risk of injury . \n ( 1987 ) compared the external and internal rotation muscle strengths of healthy korean adults and found that the muscles responsible for internal rotation had higher strength than those responsible for external rotation . \n ( 1994 ) indicated that normal ratios of external to internal rotation strengths for the general population for 60/sec testing were 0.57 for the dominant side and 0.61 for the nondominant side in a concentric test . \n wang et al . ( 2000 ) measured shoulder muscle strength of players on the english national volleyball team and found that the ratio of strength of the external rotator to that of the internal rotator muscle were approximately 1 for the dominant side and 0.67 for the non - dominant side in a concentric test . in the present study , the difference in shoulder internal and external rotation ratio was 53.2% , with internal rotation showing . \n imbalance in shoulder internal - to - external rotation strength ratio was observed in 3 of the 14 players . in the results of the present study and in those of precedent studies , \n internal - to - external rotation strength ratios of volleyball players shoulders were 3:2 for the dominant side , but 1:1 for the nondominant side . \n accordingly , studies regarding internal and external rotation ratios are warranted in order to facilitate the prevention of shoulder injuries . \n further , such studies , when focused on game performance , could help identify the minimal value of ptbw required for performing volleyball actions such as powerful spike and serving ( james et al . , 2014 ; wang et al . \n the major agonistic muscles recruited for those movements are the hamstrings and the quadriceps , with the back of the legs and the tibialis anterior also serving as contributors . moreover , for spike actions , a greater coordination between the major back muscles and the muscles of the shoulder area must be achieved ( reeser et al . , 2006 ; seminati and minetti , 2013 ) imbalance signifies possible additional risk , such as soft tissue damage , regardless of the various causes of injury ( zakas et al . \n . of course , there are limitations in relating the isokinetic muscle strength , measured mechanically , to the possibility of injury in an actual match or during practice situations . however , in the field of sports medicine , this relation is commonly very high . \n ( 1998 ) claimed that having an isokinetic muscle strength ratio of 60% at low angular speed increased the risk of injury , while ayala et al . \n ( 2012 ) reported that increased quadriceps strength from training can reduce activation of antagonistic muscles of the hamstrings . \n such low isokinetic balance ratio can be a cause of increased risk of knee injury by exerting tensional stress on the anterior cruciate ligament due to a decrease in joint stabilizing muscle strength ( cheung et al . , 2012 ; rosen et al . , 2001 ) . \n three out of 14 players had a shoulder flexion - to - extension ratio of 2:3 . \n when considering the knees , shoulders , and lower back , the region for which the highest number of players exhibited imbalance was the knee joints . \n players of the left position exhibited the highest peak torque values for the shoulders , knees , and lower back , while players of the center position exhibited the lowest peak torque for all regions . in a study by chae et al . \n ( 2002 ) , the mean knee kinetic 60/sec ptbw of volleyball players who play on attacking positions was 329 , while those of setters and libero players were 310 and 314 , respectively . \n however , in the present study , left side attackers exhibited a ptbw of 291 , while the highest value of ptbw was 378 , for the participant v4 , which indicates significant variation among attackers . in a study by kim and choi ( 2007 ) , \n the national team players showed normal reference values , with a ptbw of 270 , left - right deviation of < 10% , and an extension / flexion ratio of 55% . in the present study , 8 out of 14 participants had left - right deviation 10% , while 4 out of 14 had muscle imbalance ( i.e. , an extension / flexion ratio outside the range 50%70% ) . we may conclude that the volleyball players included in the present study should undergo a rehabilitation program to recover from knee injury . \n participating in elite sports competitions requires continuous , quantitative improvement in the angular torque and angle for which maximum muscle strength is manifested , as these parameters allow superior execution of actions during which maximum muscle strength needs to be generated quickly . \n ( 1976 ) , and involve force , muscle contraction speed , and muscle fiber relationships . \n specifically , the maximum force generated depends on the number and type of muscle fibers recruited , as well as on the speed and cooperativity of nerve impulses . \n moreover , recruitment of the nerve - muscle unit is very important for increasing the efficiency of movement , and this is reported to be highly associated with the angle at which maximum muscle strength is manifested ( moffroid et al , 1969 ) . taken together , these results suggest that the angle at which maximum muscle strength is manifested plays a very important role in sports performance . \n since power represents the value of work divided by time , muscle strength ( i.e. , force ) must be increased above all others , and must be generated in the initial stage of the effort in order to achieve increased power . in the present study , an isokinetic dynamometer was used to assess the shoulder , lower back , and knee muscle functions of male players of the korean national volleyball team . \n the results showed that the number of volleyball players with differences between the strength of the bilateral knee muscles , and between the strength of the hamstrings and quadriceps muscles was higher than the number of players with differences between the strength of the shoulder internal and external rotation muscles , and higher than the number of players with differences between the strength of the lower back extension and flexion muscles . \n these findings may suggest that the risk of knee injury is greater than that of shoulder or lower back injury . \n with respect to player positions , players who play in the center position exhibited the lowest muscle function for all the 3 studied categories ( shoulders , knees , and lower back ) . \n future studies are warranted to research the reference values of optimal ptbw , which can be used for injury prevention and for executing powerful spikes and servings .", "role": "user" }, { "content": "volleyball players performed numerous repetitions of spike actions , which uses and requires strong and explosive force , and control of the muscles of the shoulder , lower back , and legs . \n muscle imbalance is one of the main causes of sport injuries . \n the purpose of this study was to assess isokinetic muscle functions in male volleyball players . \n we thus aim to accurately evaluate their muscle functions , and identify the best training strategy to achieve optimal muscle strength balance in future training programs . \n the participants in this study consisted of 14 male volleyball players . \n muscle strength was measured using the isokinetic dynamometer . \n muscle strength was evaluated in terms of peak torque and average power , calculated from five repeated measurements at an angular speed of 60/sec . \n three players who were left attackers showed shoulder imbalance , four players showed trunk joint imbalance , nine players had knee joint of extension / flexion imbalance and four players showed left / right imbalance . \n the results showed that the number of volleyball players with differences between the strength of the bilateral knee muscles , and between the strength of the hamstrings and quadriceps muscles was higher than the number of players with differences between the strength of the shoulder internal and external rotation muscles , and higher than the number of players with differences between the strength of the lower back extension and flexion muscles .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: medicines are taken to address specific health challenges and their appropriate ingestion or usage is the key to eliciting the desired pharmacological effect . medicines could be described as double - edged sword , having the capacity to alleviate pain when properly administered and causing much harm when improperly used . \n the pharmaceutical manufacturers are responsible for the manufacture of safe , effective , and quality pharmaceutical products appropriate for the intended use . good manufacturing practices , when carefully followed , can be of much help in achieving consistent production of safe , efficacious , and quality pharmaceutical products . \n except when such a pharmaceutical product is appropriately administered , it would fail to achieve the desired effects . \n many things can go wrong even after a product has been meticulously prepared according to specified standards that can rubbish the intended purpose . \n patients and their representatives are usually not learned in the science of pharmacy to be able to make right judgment concerning their medications , which may be prescription or over - the - counter ( otc ) medicines . \n patients and their representatives must necessarily rely on the information and guidance provided by the pharmacist or the physician and sometimes by the manufacturers to enable them make appropriate and good use of the medicines in order to address their health conditions . \n often , the health professionals may need supplementary information specific to the product from the manufacturer to be able to advise the patient or the representative on the product . \n a package insert or prescribing information is a document provided along with a prescription medication to provide useful information on the drug and the condition of use as well as what the patient may observe or look out for in the course of using the medication . \n packing inserts are necessary tools to achieving dissemination of basic information on the product to a professional or a patient . \n the packaging inserts is a source of information to the professionals and the patient or the patients representative and contribute to the safe and effective use of medications . \n many nations of the world recognize the role packaging insert could play in the effective and safe use of medicines and have placed demands on the manufacturers to enclose the same . \n the world health organization states that product information must help patients and other users to understand the medication . \n the patient package insert , together with the label , provides the patient with key information concerning the proper use of the product , potential adverse drug reactions and interactions , storage conditions and the expiry date . in otc medicinal products , \n the package insert , together with the label , may constitute the only pharmaceutical advice that the patient receives . most often , preparations for children are in liquid form or in ready to be reconstituted oral formulations and therefore require some form of measurement for the dose from the stock . \n oral pharmaceutical formulations are widely used and preferred in pediatric and geriatric patients because of the difficulty in swallowing tablets or capsules by these groups of individuals . \n accurate dosing of the medication , which is dependent on the device used , is very important to achieve the desired therapeutic objectives . if a dose it to be dispensed , for example , in a measurable 2.5 ml or multiple of this , it would require just that to achieve the desired effects \n this is particularly important when one considers the anti - microbial agents that doses outside the optimal could lead to untoward effects of toxicity or ineffectiveness . while it is not a guarantee that the provision of accurate dosing devices would automatically lead to compliance and that other factors are also recognized , this step is the key to the process . \n it has been recognized that administering the right doses of oral liquid medications is crucial to achieve therapeutic goals . \n these doses are measured with the device that the manufacturer provided , but when this does not happen , the patient or caregiver may use any other similar , but equivalent device that would deliver doses outside that desired . \n most of the household spoons that are used in administering medicines to pediatric patients have been shown not to be the same in accuracy . \n it behooves the manufacturers of particularly pediatric preparations to include packaging inserts such as information leaflets and measuring devices to ensure that their medications are appropriately measured out and administered . \n about 3 years ago , the national agency for food and drug administration and control ( nafdac ; the agency saddled with the responsibility of controlling the manufacture and distribution , among other things , of pharmaceuticals and related products in nigeria ) stressed on the need for manufacturing of pharmaceutical products to enclose measuring devices for liquid preparations and information leaflets for all products . \n this was aimed at ensuring that the products distributed to consumers are safe and effective . \n the purpose of this study was to assess the extent of inclusion or otherwise of packaging inserts and measuring devices in pediatric formulations in nigeria . \n the study was carried out between august 2010 and february 2011 and involved visiting registered pharmaceutical premises in jos metropolis . \n jos is central to many commercial cities in nigeria , serving either as a depot to service northern states or is within 3 hours drive from the major commercial cities in the north , namely kaduna and kano , as well as to federal capital territory , abuja . \n jos is a suitable city for this kind of study because of its unique location in the middle belt of nigeria and the presence or access of pharmaceutical manufacturers from where many other northern states are serviced . \n the major pharmaceutical distributors were visited , and samples of common remedies such as anti - malarials , antibiotics , analgesic , and anti - inflammatory , as well as anti - tussive were obtained from the shelves at random according to the number of companies manufacturing the product . if there was no package insert , more packs from the manufacturer were opened to rule out the chances that it was an omission in the one sampled . \n the information that was looked for included identifiable address of the manufacturer , the presence , or otherwise of information leaflet , inclusion or otherwise of measuring device , wherever applicable . \n a total of 127 oral liquid formulations from 31 manufacturers were sampled in the survey . of the 31 companies , \n nigeria has over a hundred registered pharmaceutical companies engaging in secondary or tertiary manufacture of pharmaceuticals of different dosage forms . \n the packaged pediatric formulations that were provided with leaflet , measuring device , and stated storage conditions were respectively 88 ( 69.3% ) , 98 ( 77.2% ) , and 114 ( 89.8% ) as shown in figure 1 . \n histogram of the package inserts in pediatric oral formulations in nigerian market table 1 shows the summary on packaging information insert , measuring devices , and statement on the storage conditions of the formulation as provided by the manufacturers . \n eighty six percent ( 86% ) of the anti - microbial agents group of pediatric formulations had packaging information leaflet and the corresponding value for anti - malarial agent was 76% . \n the order of decreasing provision of packaging information leaflet was anti - microbial > anti - malarial > analgesic = anti - tussive . \n the table also shows the data on the provision of measuring devices by the manufacturers . \n all the anti - malarial agents sampled had measuring devices in their packages . on the other hand , the analgesic , anti - tussive , and anti - microbial preparations with measuring devices were , respectively , 90 , 82 , and 56% of the number sampled . \n data generated from the survey on the inclusion or otherwise of packing insert and measuring devices in pediatric oral liquid preparation packages by pharmaceutical manufactures \n the high level of inclusion of packaging information inserts is an indication of the awareness of the manufacturers of the importance of the supplementary information to proper use , safety , and effectiveness of their products . in nigeria , \n the national agency for food and drug administration and control is the body charged with the responsibility of registering pharmaceutical products intended to be advertised or sold for human and animal use . \n such products are registered with a unique number against set protocols which include the provision of appropriate packaging information insert among others . \n the presence of this number in all the products sampled indicated that manufacturers had once substantially complied with the regulatory requirements for them to be licensed to manufacture , advertise , distribute and sell the pediatric formulations . \n it is unlikely that the manufacturers of the products without the packing information leaflets were unaware of the need to include them , indicating a deliberate attempt to undermine the safety of their products . \n pharmaceutical manufacturers must be self - motivated and go beyond merely meeting regulatory requirements at product registration point to ensure that they do all that is possible to assure safety and effectiveness of their products . \n the importance of information to effective and safe use of medicines can not be overemphasized and relevant packaging information plays a key role . \n it may be argued that the manufacturer do provide information on the outer ( folding box or the secondary package ) and sometimes on the label . \n the secondary packaging is usually limited in space to contain all the drug related information that may be required . \n the present study identified missing gaps in the information provided on the folding boxes that would have been complemented in the package information leaflet . \n none of the defaulting manufacturer was of the public liability company category , and the defaulting companies spread across the country from their addresses . \n it is not clear why many manufacturers failed to include the measuring device with their products , particularly the anti - microbial formulations . \n it has been observed that many of the household spoons do not have the same accuracy . \n it would be a great risk to allow the patient to use whatever measuring device they have to take their anti - microbial medication . \n it is obvious that duly packaged products were presented to the regulatory agency at the time of registration of the products and it would be a breach of trust to present something different to the public . on the other hand , the regulatory agencies should continually carry out post marketing surveillance and apply the appropriate actions on the defaulting pharmaceutical manufacturers so as to assure safety of the products to the users . \n a survey of level of inclusion of packaging inserts such as the package information leaflet and measuring devices of pediatric formulations marketed in nigeria was carried out . \n manufacturers of pharmaceuticals in nigeria are aware of the importance of the packaging inserts in the safe and efficacious use of their medicines ; few of them are yet to apply this knowledge to the benefit of the users of their products . \n manufacturers should be deliberate in their intention to contribute to the wellbeing of the consumers of their products rather than merely meet the regulatory requirements . \n on the other hand , the regulatory agency should intensify their post - marketing surveillance to ensure that manufacturers consistently adhere to the rule of the game .", "role": "user" }, { "content": "objectives : the purpose of this study was to obtain data and understand how pharmaceuticals manufacturers care for safety and efficacy of the products distributed for consumption in nigeria . \n the study was based on a survey of wholesale pharmacies that distribute pharmaceuticals for manufacturers . \n the study was carried out in jos city , a central point in the north - central nigeria.materials and methods : samples of pediatric formulations in pharmacies were obtained based on the product and the manufacturer . the packages were inspected for packing information leaflet and measuring devices . in addition , the manufacturing date , expiry date , storage conditions , product registration status , and the address of the manufacturer were also noted . \n simple statistic was used to analyze the data.results:one hundred and twenty seven oral liquid formulations from 31 manufacturers were anayzed . \n the results showed that leaflet and measuring device as well as statement on storage conditions were available in 88 ( 69.3% ) , 98 ( 77.2% ) , and 114 ( 89.8% ) , respectively , in the samples studied . \n all products had registration numbers , suggesting that the products were authorized for distribution ; this implies that some manufacturers deliberately distribute their products in forms other than the approved form.conclusions:manufacturers of pharmaceutical products need to be more committed to the safety and efficacy of their products at all times . \n regulatory agency should increase surveillance to ensure that manufacturers consistently provide in their final packages what was declared and approved for registration .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: over the past few decades there has been an increasing prevalence of obese patients presenting to emergency departments and requiring medical imaging for acute and chronic conditions.1,2 obesity is a complex issue in health care because of extensive indirect effects and associated medical conditions such as type 2 diabetes , coronary artery disease , hypertension , asthma , stroke , gout , venous insufficiency , degenerative joint disease and sleep apnoea.25 in addition , obesity has a large economic impact with reported direct costs in australia estimated at $ 830 million.6,7 obese patients require a tailored standard of care as radiographers must compensate for issues arising from both technical and patient care considerations . \n these include patients exceeding the weight limits of imaging equipment , motion artefacts due to increased exposure factors requiring elongated exposure time , insufficient coverage of the image receptor , difficulty in palpating anatomical landmarks and potential patient embarrassment . \n the adipose tissue also complicates the balance between adequate radiation exposure and penetration and keeping the dose to as low as reasonably achievable ( alara).1,2,7,8 failure to accommodate these issues results in sub - optimal imaging , possibly impeding an accurate and timely diagnosis . \n this is highlighted by a study by katz in 2006 , which found that radiologists reported greater difficulty in diagnosing cases involving obese patients.9 the purpose of this article is to review the current literature regarding the impact of obesity on imaging departments , the technical difficulties of imaging obese patients and the associated attitudes and perceptions of radiographers . \n databases including pubmed , scopus , medline and cinahl were accessed and key words were used to extract entries . \n key words included but were not limited to : obese , obesity , radiography , medical imaging , patients , perceptions , attitudes , education , physics , radiation , challenges , experiences , impact , equipment , students , practitioners and bias . due to limited studies found in the medical imaging discipline , \n the scope was widened to include the attitudes and perceptions of allied health care professions , nursing and medical practitioners . by better understanding these attitudes and perceptions , \n a full in - depth review of factors and trends in the rising proportion of overweight and obese individuals in society is beyond the scope of this review . \n however , a brief overview will be provided for context and definition . the body mass index ( bmi ) \n is a common measure for determining the weight class of individuals and populations ( underweight , normal , overweight , obese or morbidly obese ) . \n it is calculated by a formula of weight ( kg ) and height ( cm ) in a ratio of kg / m . \n obesity is defined as a chronic condition of excess body fat disproportionate to one 's height , quantified with a bmi higher than 30.2,4,10,11 however , using bmi as a definition of obesity has several limitations . \n the key limitation is that it uses absolute weight and does not consider the type of fat , location of fat or the density of lean muscle mass . \n it provides a more accurate measure of body fat proportion than weight alone , but due to these limitations it may incorrectly under , or overestimate measurements in certain people.1113 this point aside , bmi is widely accepted in the literature , including the limited literature in medical imaging , as a good descriptor of obesity at a population level.12 obesity is a major health issue , reaching epidemic proportions in the western world.3 the u.s population saw a 74% increase in prevalence of obesity between 1991 and 2001 and 65% of the adult american population is now overweight or obese,1 although a recent usa national health and nutrition examination survey has suggested a plateau of rates.14 these us trends are reflected in the australian population with data collected between 1999 and 2000 estimating 60% of the adult population being either overweight or obese.6 there has been a steady increase in the mean bmi of the australian population over the past two decades.6,15 these findings coincide with official census data from the australian bureau of statistics ( abs ) from 2011 to 2012 which classified 62.8% of australian adults as either overweight or obese.16,17 additionally , these census statistics confirm an increase in the prevalence of obesity across all age groups between 1995 and 2008 , rising from 56.3% to 61.2% . \n the correlation between an increased prevalence of obesity and a rise in the number of obese patients requiring medical imaging has been explored in a study by uppot et al . in 200618 where dictated radiology reports over a 3-year period were assessed retrospectively for the phrase limited due to body habitus . \n this was correlated with the prevalence of obesity in the usa using a pearson 's correlation coefficient . \n the authors concluded that there was a positive correlation with a progressive increase in the number of obesity - compromised reports . \n furthermore , studies explored obesity challenges across multiple modalities and found that general radiography was the second most commonly affected modality for poor image quality behind ultrasound.18,19 the increased prevalence of obesity places additional strain on imaging departments as doctors increasingly turn to medical imaging for efficient diagnosis.2,2021 obesity is an important issue in health care due to extensive associated secondary conditions , especially venous insufficiency and degenerative joint disease , which are often the clinical context for plain radiography referrals.25 the strain of carrying additional weight is especially prevalent on the knee and hip joints . \n the likelihood of developing osteoarthritis is up to seven times higher for obese individuals , compared with normal weight or underweight people.22 there are also economic impacts to population obesity with pressure on health facility resources , including departments requiring equipment to accommodate the wider girths and increased weight in beds , chairs , operating tables , floating radiology tables , and wheelchairs.21,23 the aperture size of the gantry and table weight limits in computed tomography ( ct ) and magnetic resonance imaging ( mri ) must also be considered otherwise alternative arrangements to another suite / imaging facility with the appropriate wide bore equipment may be required.2425 physical strain and injury to health care workers attending to the transportation requirements of obese patients maybe a consideration if correct procedures are not followed.3 extended hospital stays are also a costly factor , and although the exact cost is not known , obese individuals tend to have longer stays than non - obese patients . the reasons for this increased length of stay are suggested to arise from the extra complexity from secondary conditions . \n shorter stays in hospitals for obese patients may be negated by a higher probability requiring a transfer to another department with weight - appropriate equipment and specialist care incurring additional transportation costs.26,27 \n despite technical advancements in medical imaging , obese patients still present challenges in image quality and viable alternative imaging options are limited . \n the size of the patient and the anatomical region to be imaged ( such as the abdominal and pelvic regions ) have been found to be more important than weight or bmi alone in determining when protocols and techniques need to be adjusted.2,7 radiographic image quality of obese patients is mainly compromised by an inadequate signal to noise ratio due to additional radiation scatter caused by the thicker layer of adipose tissue.2 the common difficulties experienced by radiographers when imaging obese patients has been explored by several authors . \n summary of the common radiographic challenges as identified in the literature the skill set used in radiography is heavily reliant on visual and tactile senses to locate and palpate structures for imaging . \n a thick layer of adipose tissue obscuring bony landmarks hinders accurate positioning , making repeat projections due to positioning error more likely.1 it is suggested that this particular error is becoming increasingly common as the proportion of obese patients presenting to the imaging department rises.6 consideration of technique modification and adjusting exposure parameters often comes with experience , however , very few adaptive techniques are listed in the literature or through learning resources , with the bulk of the professional literature being commentary in nature . \n common successful techniques in imaging obese patients , as discussed in table1 , include increasing the mas , employment of grids or use of the automated exposure control to overcome reduced image receptor signal \n . however , these techniques come with an increased radiation dose to the patient and the literature does not give comprehensive information on how changes to exposures can be optimised to reduce dose for obese patients . \n al.12 make the point that dose reference levels ( drls ) are standardised to a 70 kg person with an upper limit of 90 kg . \n however in 2008 , the bmi of the average european was classified as overweight and the consideration may be made that separate drls for obese patients may be warranted due to the increasing presentation of bariatric patients . \n a method for overcoming poor photon penetration as itemised in table1 is to increase the kvp . \n again , however , the trade - off is the reduction in image contrast that may mean this technique is unsuitable to answer the clinical question . the holistic question of whether altering kvp in combination with mas has not been adequately explored , as previous studies have only considered each parameter in isolation . \n furthermore , in the same way that paediatric exposures are studied and modified to optimise technique and reduce dose , a standardised approach to obesity needs to be considered due to the increasing presentation of bariatric patients . for student radiographers without experience , \n the problem of positioning obese patients can be exacerbated by the exemplars of correct positioning technique . \n common textbooks used throughout australian diagnostic radiography / medical imaging degree programs , such as textbook of radiographic positioning and anatomy33 and merrill 's atlas of radiographic positioning and procedures,34 use thin patients in their photographic illustrations of positioning . \n the latter includes a chapter on imaging obese patients in its latest edition , but it is not comprehensive and does not discuss the limits of physics of imaging modalities . \n these resources become less applicable as anatomical landmarks are increasingly obscured by adipose fat and patient mobility becomes limited . \n overall the current theoretical teaching of radiographic positioning based on physically fit , thin patients does not reflect the increasing proportion of obese patients presenting to medical imaging departments.35,36 some adjustments to positioning via surface anatomy landmarks are suggested in table1 for areas such as the abdomen and these articles may be useful for educational purposes although they do not have a sound evidence base . \n these include the use of adjacent structures where the location of the structure ( e.g. the elbow crease ) is unaffected but approximately close to desired positioning landmark which is obscured ( such as the iliac crest ) . \n overall , there are limited peer - reviewed publications that focus on optimising radiography for obese patients from a radiographer 's perspective , a medical - physics perspective or a patient perspective . \n obesity has underlying psychosocial dimensions and it is essential that radiographers and students are able to customise their approach to obese patients . \n health care professionals may hold their own attitudes and weight bias and how explicitly these attitudes are perceived in practice have important impact on patient satisfaction.19,2831 a study by destounis found that 53% of obese mammography patients believed they had experienced inappropriate comments directed towards them.23 further studies have shown that self - conscious obese or overweight patients who experience embarrassment in health care scenarios may choose to avoid subsequent medical examinations , essentially placing their health at risk.13,32 table2 provides a summary of the literature regarding the attitudes and perceptions of health professionals and health professional students towards obese patients . due to the lack of studies within radiography / medical imaging \n , the scope of the search was expanded to include allied health disciplines , nursing and medicine . \n studies published post-2000 have been included to coincide with abs data on the marked increase in the prevalence of obesity in australia . \n some meta - analyses of obesity perceptions by health practitioners raise the awareness of the wider issue of obesity , with these reviews noting weaknesses in the reported literature methodology and failure to utilise robust testing and standardised , consistent measures when considering attitudes and perceptions.4752 for example , the review by vitolins et al.52 found only five studies that included interventional and evaluation methodologies , hence the ability to translate evidence into practice and care for obese patients is lacking literature review ( post-2000 ) on the attitude and perception of student and qualified health professionals on obesity and their impacts in australia and many similar western counties , there is an association between attractiveness and slimness which is reinforced through mass media.29,44 being overweight or obese can be seen as a \n liability28 and obese patients are more commonly stereotyped and associated with negative traits such as laziness and having low motivation and will power.39,53,48 some studies have found that even overweight or obese individuals share these views of themselves.54 the majority of the articles in table2 found health care professionals held negative weight biases , including those professionals who specialise in obese patient care.39,42,47,51 interestingly , research has shown that many health care practitioners may not even be aware of these implicit attitudes.40 it is important that health providers can empathetically address weight issues with patients as they can have a significant impact on overweight and obese patients instigating healthier lifestyles and seeking health care.55,56 again , if these biases lead to an insensitive experience , patients may decide to seek an alternative physician or delay treatment.5760 despite weight biases being prevalent , it is unclear exactly how these attitudes affect patient treatment . \n forhan39 describes how weight biases reduce the quality of care by providers spending less time with obese patients , reduced patient engagement and recommending fewer interventional procedures than non - obese patients . \n however , budd42 stated that despite the existence of these biases most of the studies exploring the impacts of obesity in practice did not demonstrate a lower level of care outcome . \n most of the studies in table2 confined their research to a single geographic location and it is unknown to what extent these findings could be applied to different groups or can be generalised across health professions . \n the visual and tactile skill set employed by radiographers is unique , includes more emphasis on diagnosis and has a shorter care time than other allied health professions . \n thus , while cross reference to other health practice is often useful for comparisons and enlightenment , the issue of weight bias is difficult to generalise . \n radiographic learning is more practical in nature , for example , accredited radiography degrees in australia have many more weeks of clinical placement ( approximately 4860 ) than other similar health degrees such as physiotherapy ( approximately 2025 weeks ) ( http://www.medicalradiationpracticeboard.gov.au/accreditation.aspx , http://www.physiotherapyboard.gov.au/accreditation.aspx ) . \n a recent australian pilot study has suggested that student radiographers are influenced by negative weight biases from qualified radiographers and often observe degrading behaviour and dialogue towards obese patients.61 this study , giving preliminary qualitative data , demonstrates the need for an in - depth investigation of how radiographers perceive and act towards obese patients in order to highlight any poor practices and enhance good practices . \n further research is required in identify the degree of weight bias in the radiographic community , how practitioner attitudes / skills influence care and imaging approaches , and what are the available education and training resources . \n although the intention of this review was to identify current literature on the perceptions and attitudes of qualified and student radiographers , no articles were found . \n the literature is more established in other health disciplines although these studies were also noted to be insufficient . \n although a number of specific radiology / radiographic articles were found that highlighted the difficulties of imaging obese patients , these were generally commentary in nature and lack explicit and robust evidence . \n ", "role": "user" }, { "content": "obesity is a global health issue with obese patients requiring specialised diagnosis , treatment and care through the health service . \n the practical and social difficulties associated with medical imaging of obese patients are an increasingly common problem and it is currently unknown how student and qualified radiographers perceive and respond to these challenges . by better understanding challenges presented in providing quality imaging and care of imaging obese patients , education for both qualified and student radiographers can be enhanced . \n radiographers are heavily reliant on visual and tactile senses to locate the position of anatomical structures for diagnostic imaging and determine radiation exposure through a delicate consideration of dose , image quality and anatomical attenuation . however , obese patients require modifications to routine radiographic practice in terms of movement / assisted positioning , equipment capabilities to take increased weight or coverage \n . these patients may also be subject to compromised radiological diagnosis through poor visualisation of structures . in this paper , the professional and educational literature was narratively reviewed to assess gaps in the evidence base related to the skill and care knowledge for obese patients . \n literature was sourced relating to discrete radiographic considerations such as the technical factors of imaging obese patients , exposure and the impact of obesity on imaging departments service provisions . \n the recent literature ( post-2000 to coincide with the sharp increase in global obesity ) on the perceptions of health professionals and student health practitioners has also been explored because there are no specific radiographer studies to report . by understanding the research in similar fields \n , we may identify what common attitudes qualified and student radiographer 's hold and what challenges , technical and care related , can be prepared for .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: dr . londoo : drafting / critically revising the manuscript , study concept or design . \n \n mora is a member of the data & safety monitoring board for a ninds / nih study .", "role": "user" }, { "content": "to date , biomarkers based on nonconventional mri have not been standardized for diagnosis and follow - up of patients with multiple sclerosis ( ms ) . \n the sequential monitoring of pathogenesis in ms by imaging of the normal appearing brain tissue is an important research tool in understanding the early stages of ms . in this review , \n we focus on the importance of deciphering the physiopathogenesis of the disease cascade in vivo based on imaging biomarkers that allow a correlation with immunohistochemistry and molecular biology findings in order to provide earlier clinical diagnosis and better individualization of treatment and follow - up in patients with ms . among the nonconventional imaging techniques available , \n we remark on the importance of proton magnetic resonance spectroscopy imaging because of its ability to assist in the simultaneous evaluation of different events in the pathogenesis of ms that can not be determined by conventional mri . nonconventional mri and the use of novel contrast agents \n are expected to elucidate the process of neuroinflammation and excitotoxicity in vivo that characterizes ms , thus leading to more specific neuroprotective and immunomodulatory therapies and reducing progression toward disability .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cancer dormant cell theory takes the view that activation of resting cells is the key factor causing cancer metastasis . \n recent studies indicate that resting cells can be activated through escaping immune surveillance when immune function is weakened and that energy used for cell revivals can be provided by the newborn vessels [ 13 ] . \n therefore , the study on improving body immune surveillance and restraining the energy of tumor growth will be an emergent mission as well as a breakthrough in the field of clinical treatment of cancer . chlorogenic acid ( ca ) , extracted from folium cortex eucommiae and the flower bud of lonicera confusa , is a kind of depside formed by caffeic acid and quinic acid . \n a large number of studies on ca have demonstrated that ca has a wide range of biological activities including inhibition of tumor cells . according to preliminary studies \n , we recognize that ca is able to inhibit tumor in mouse except for these with t - cells defect , which suggests that immune system can be one of the targets of tumor suppression . \n meanwhile , in vivo studies of our group indicate that ca also changes the advantage state of th2 drift of balb / c emt-6 mice . \n it significantly enhance the activities of balb / c emt-6 mice cytotoxic t lymphocyte and natural killer cells as well as strengthening macrophage phagocytosis activity and lymphocyte transcription activity , thus boosting specific and nonspecific cellular immune function to tumor cells . \n recent studies show that antitumor property of ca may have a connection with its ability of enhancing the activities of aryl hydrocarbon hydroxylase , suppressing formation of 8-oh - dg , carcinogen - dna adduct , and oxygen radical [ 5 , 6 ] . meanwhile \n , ca can guard against gastric cancer and colon cancer and even suppress related carcinogenic factors [ 7 , 8 ] . in vitro studies revealed that ca can enhance t - cell proliferation caused by influenza virus antigen and can induce the generation of ifn- and ifn- by human lymphocytes and peripheral blood leukocytes [ 9 , 10 ] . \n additionally , we find that ca can also activate neurocalcin to strengthen the activity of macrophagocyte . \n although much evidence has proved the anticancer property of ca , little is known about its exact targets on molecular level . \n base on the principle of complementary base pairing , microarray technology can distinguish particular genes from the mixture of genes by taking advantage of gene probes . \n . meanwhile , its sensitivity , accuracy , and specificity are better than those of normal pcr . to explore the expression level of genes in tumor cells \n , we utilized a microarray technique to detect balb / c emt-6 mice after treatment with ca , docetaxel , interferon , normal saline separately , and the differences in expression level were confirmed by rt - qpcr . \n time - series analysis , go analysis , and pathway analysis were used to screen out common genes and analyze the relationship between putative genes and anticancer process of ca . \n our data has suggested that ca is able to inhibit the growth of tumor through regulating immune system . \n female spf mice ( balb / c ) used in this experiment weigh 17 - 18 g on average , provided by the animal center of sichuan university . \n emt-6 sarcoma cells were provided by west china hospital of sichuan university department of health engineering key laboratory of transplantation and transplantation immunity . \n we took emt-6 cell line out of the 152c ultra low temperature refrigerator . after thawing , centrifuging , and primary culturing , we used 0.25% trypsin for digestion twice and \n all the collected cells were diluted with phosphate - buffered saline ( pbs ) in the end . \n we homogenized the tumor taken from the body of balb / c tumor - bearing mice to cell suspension and then inoculated the cell suspension to other balb / c mice . \n mice used for microarray analysis were injected with high - dose ca ( experimental group ) , docetaxel ( control group ) , and normal saline ( negative control group ) . \n gene expression of experimental group was analyzed at six time points ( 3rd , 6th , 9th , 12th , 15th , and 18th days , resp . \n , after administration ) , while the control group and negative control group were both analyzed at the 12th days after administration . \n rt - qpcr took mice injected with low , medium , and high - dose ca ( 5 mg / kg , 10 mg / kg , 20 mg / kg ) as experimental group , docetaxel and interferon as control group , and normal saline as negative control group . \n all extracted samples had an a260/280 ratio of between 2.0 and 2.1 and a 28s/18s ratio of 2 . \n agilent 2100 bioanalyzer was used for further verification and qualified rna had an rin greater than 7.0 . \n total rna was transcribed to double - stranded cdna using revertaid first strand cdna synthesis kit ( fermentas ) , with t7 promoter primer . \n crna was dyed with cy3 and purified using rneasy mini kit ( qiagen , valencia , ca , usa ) according to the protocol of the rneasy plus mini kit . \n cy3 crna must be fragmented in a buffer of 11 l 10 blocking agent , 2.2 l 25 fragmentation buffer and a certain amount of nuclease - free water at 60c for half an hour before hybridization . \n we added 55 l 2 gex hybridization buffer to the denatured and fragmented crna and then transfered them to microarrays at 65c for 17 h with constant rotation . \n after hybridization , the microarrays were washed twice with buffer 1 for 1 minute followed by buffer 2 at 37c for 1 minute too . in the end \n , the microarrays were autoscanned twice in 100% and 10% pmt , respectively , at 5 m resolution . \n the data was analyzed by agilent feature extraction software and the quantile normalization was finished by genespring 10.0 . \n after acquisition of raw data , agilent feature extraction software kit was used to eliminate the effect of background signals through automatic gridding . \n we took the log 2 of the normalized background adjusted values to narrow the threshold of fluorescence signal strength before quantile normalization by genespring 10.0 and then used a linear model to estimate expression values on the log scale . \n we chose a standard among the microarray samples thus the whole microarray data varied on it to obtain the same baseline of average density . \n differentially expressed genes are submitted to student 's t - test and p 0.05 . \n we inputted the data of probes used for gene expressing analysis into sbc analysis system ( v2010.05 ) . \n rna extracted from experimental group of ca , positive control group of docetaxel , and interferon , negative control group were used to measure expression of selected genes of interest by rt - qpcr . \n genes can , nfatc2 , nfatc3 , and nfatc2ip showed a different expression level following treatment with low , medium , and high - dose ca , respectively . \n primers used for rt - qpcr validation were designed according to each gene sequence and finished by sbc . \n the rna integrity was verified with rna formaldehyde electrophoresis and the quality was detected by spectrophotometry . \n the rna samples had an a260/280 ratio of greater than 2 and a 20srna/18srna ratio of greater than 1.1 . \n reverse transcription reactions were conducted at 42c for 30 min and at 85c for 5 min at a 20 l total reaction volume containing the following reagents : 2 l rna , 1 l oligo , 2 l ( 10 mm ) dntp mixture , 1 l ribolock rnase inhibitor , 4 l 5 reaction buffer , 9 l water , and 1 l revertaid m - mulv . \n pcr reaction should be taken at a temperature gradient in the range of annealing temperature of can , nfatc2 , nfatc3 , and nfatc2ip . \n rt - qpcr analysis was conducted to obtain crossing point ( ct ) values of each gene and standard curve was established through the linearity between ct value and log 2 of expression values . before carrying out rt - qpcr analysis , cdna and primers should be diluted in 20 l reagents containing the following : 9 l mix , 8 l h2o , 1 l sense primer ( f ) , 1 l antisense primer ( r ) , and 1 l cdna . \n relative content of mrna extracted from experimental group of ca , positive control group of docetaxel , and interferon negative control group was calculated by rt - qpcr detection system biorad iq5 . \n we carried out a student 's t - test of these probes to select differentially expressed genes ( p 0.05 ) and then drew curves reflecting different expression tendency of them at 6 time points . \n the smaller the p value is , the more similar each gene trend fits the curve . \n no.21 fitting curve had a p value close to 0 and the expression profiles of genes covered in this fitting curve were analyzed systematically here . as shown in figure 1 , each inflection point corresponds to gene expression at different time points after administration . \n genes covered in this curve were upregulated as seen from the whole time cycle ; in other word , ca is capable of upregulating certain genes of tumor - bearing mice . \n data of genes covered in no.21 was put into sbc analysis system ( v2010.05 ) and compared with kegg ( kyoto encyclopedia of genes and genomes ) database . as shown in table 2 , 96 pathways are found to be related to upregulated genes and 29 of them are found to be statistically significant including t - cell receptor signaling pathway , b - cell receptor signaling pathway , and natural killer cell mediated cytotoxicity . \n immune - related genes expression is speculated - changed after treatment with ca and probably have a trend of upregulation . \n previous studies on ca immune function verified that ca could increase the carbon clearance index and the content of serum hemolysin and enhance the phagocytic function . \n the release of tumor necrosis factor ( tfn ) was found reduced while the activation of cytotoxic t lymphocyte ( ctl ) which aimed at lewis lung cancer was boosted . \n nk cells activation and lymphocyte transformation rate of lewis lung cancer bearing mice were both significantly improved through the determination of immune function indexes . to sum up , ca has been proved capable of strengthening cellular immune functions to tumor . \n when 3 immune related pathways were found including upregulated genes , we inferred that the immunity of mouse had been improved after treatment of ca . \n gsk3b , nfatc2 , nfatc3 , can , vav2 , and nck1 were found upregulated in the 3 immune related pathways as listed in table 3 . according to the functions , \n genes covered in no.21 can be classified into 312 different go ( gene ontology ) and 6 of them has a p value less than 0.05 as listed in table 4 . \n go of statistical significance includes the following genes : cyp2a4 , cyp2c37 , cyp2c38 , cyp27b1 , cyp51 , e4f1 , fdps , gata4 , eif2ak1 , myt1l , rarg , sod1 , sp1 , taf3 , nr2c2 , hnf4 g , zdhhc3 , phf6 , mynn , zfp386 , zfp617 , zfp114 , zfp238 , zfp174 , zfp113 , zfp109 , zfp263 , pcdhb6 , pcdhb15 , pcdhb20 , pcdhb21 , cdyl , nfatc3 , pbx2 , rest , smarca5 , and nfatc2 . after doing some queries on the function of genes covered in statistically significant pathways and \n go , we found out immune related genes and common genes of pathway and go . \n nfatc2 , nfatc3 , nfatc2ip , and can were found through combing raw analysis data of gene expression profile , as shown in table 5 . \n relative expression level of the target genes nfatc2 , nfatc3 , nfatc2ip , and can on average is shown in table 6 . relative expression level of nfatc2 , nfatc3 , nfatc2ip , and can in high - dose ca group , nfatc2ip and can in medium - dose ca group , and can in low - dose ca group significantly improved compared with negative control group . the exact expression quantity is shown in figure 2 . as shown in figure 2 , relative expression level of nfatc2ip , nfatc3 , nfatc2 , and can in high - dose ca group improved compared with negative control group , which corresponds to the result of microarray analysis . here , a whole mouse genome oligo microarray ( 444k ) was used to analyze gene expression level of female balb / c mice and to compare the expression of corresponding target genes of each group on the time series . systematic error or accidental error \n can affect the accuracy of microarray analysis to some extent and the errors may come from the processes of rna extraction , rna reverse transcription , and hybridization as well as the quality of gene chips and rna . \n while the results of microarray analysis can reflect expressing pattern at body 's internal gene level quickly , false positive results possibly caused by systematic error or accidental error must be taken into consideration . \n verifying experiments like elisa test , western blot test , and pcr test should be taken for further confirmation . here , \n the results of pcr test help completing the study as well as making it more convincing . through the analysis of genes included in no.21 , expression of critical genes in t - cell receptor signaling pathway , b - cell receptor signaling pathway , and natural killer cell mediated cytotoxicity had changed and immune related genes nfatc2ip , nfatc3 , nfatc2 , and can were found . \n nfat ( nuclear factor of activated t cells ) which consists of 4 components nfatc1 , nfatc2 , nfatc3 , and nfatc4 has been proved important in lymphocyte activation and development . \n nfatc2 existing in cytoplasm translocates to the nucleus upon t - cell receptor stimulation and then becomes a member of the nuclear factor of activating t - cells transcription . \n when the body lacks nfatc2 , lymphocyte apoptosis will be significantly reduced which suggests lymphangiectasia and th2-type response . \n immune regulatory function will disorder when th1/th2 balance is destroyed and tumor occurrence shows the preponderance state tendency of th2 \n . this state will weaken antitumor immune function and will induce tumor cells free from immune surveillance and immune attack . \n this may be one of the immune mechanisms of tumor development and provides a new idea of tumor treating . \n the reverse of th1/th2 abnormal drift is in favor of recovering antitumor immunocompetence and reducing tumor recurrence and metastasis to improve long - term survival rate finally . \n nfatc2 and nfatc3 have been proved to synergistically regulate the reaction of t cell receptor , cell division , and th2 differentiation . \n th2-type reaction which suggests the secretion of il-4 , il-5 , and il-6 is increased whereas the decrease il-2 , ifn- , tnf- , and il-10 happens when the body lacks nfatc2 and nfatc3 [ 1416 ] . when b cell and t - cell lack nfatc2 and nfatc3 simultaneously , the function of t cell will be weakened but the ability of t cell receptor mediating cell proliferation still exists , while b cells over - activate and show excessive differentiation . \n the fact that expression of nfatc2 and nfatc3 is improved after treatment of ca indirectly indicates that ca could reverse th1/th2 drift . \n meanwhile , secretion of il-2 , ifn- , tnf- , and il-10 is connected to ca too . \n high expression of nfatc2 and nfatc3 is in favor of the secretion of these cytokines which have already been used as nonspecific immunity treatment to cancer . \n nfatc2ip can induce the expression of t - cell cytokines , especially enhancing il production . \n three splice variants existing in nfatc2ip are able to methylate nfatc2ip after its translation to produce nfatc2ip regulatory factor . \n expression of th1-type and th2-type cell factors will be suppressed when the methylation process is inhibited . \n therefore , methylation process of nfatc2ip is an important controlling point of manipulating expression of nfat - dependent cell factors but it will not have any influence on general transcription factor of th1 and th2 nor nfat activation . \n can ( calcineurin ) is known as the only serine / threonine protein phosphatase regulated by ca()-calmodulin so far and mainly aims at catalyzing dephosphorylation of phosphatidylserine and phosphatidyl threonine . \n it is a multifunctional signaling enzyme involved in function regulation of many cells and distributes in a wide range of tissues especially nerve tissue , t lymphocytes , heart , and skeletal muscle [ 18 , 19 ] . \n nfat regulates many genes expression as well as influencing many cells differentiation through can / nfat signaling pathway . \n can is able to make nfat existing in cytoplasm move into cell nucleus after dephosphorylation to finish following transcription and translation , and then nfatc can combine with ap-1 family members alone or in groups to stimulate secretion of cell factors in certain areas such as il-2 . \n transcription induction of il-2 is a sign of t - cells activation . as mentioned above \n , nfat is very important in regulating immunoreaction ; meanwhile , nfatc3 and nfatc2 play a particularly key role in correcting body 's immune function . \n thus , high expression of can is a benefit to dephosphorylation of nfat and indirectly has an effect upon immune system . \n the result of microarray analysis of differentially expressed genes of female balb / c emt-6 mice has indicated that the antitumor mechanism of ca is closely related to body 's immune system . through upregulating , \n the expression of can , nfatc2 , nfatc2ip , and nfatc3 , ca is able to improve the transcription of immune factors like il-2r and ifn- , stimulate proliferation and activation of t cells , nk cells , and macrophage , strengthen monitoring and killing abilities of cancer cells , and inhibit growth of tumor finally . \n the understanding of the anticancer mechanism of ca has provided a reliable evidence of taking advantage of ca to fight against cancer .", "role": "user" }, { "content": "persistently increasing incident of cancer in human beings has served to emphasize the importance of studies on mechanism of antitumor substances . \n chlorogenic acid ( ca ) , extracted from folium cortex eucommiae , has been confirmed to have lots of biological activities encompassing inhibition of tumor . \n however , the anticancer mechanism of ca remains unclear . \n here , we have utilized a whole mouse genome oligo microarray ( 444k ) to analyze gene expression level of female balb / c mice ( implanted with emt-6 sarcoma cells ) after treatment with low , medium , and high - dose ca ( 5 mg / kg , 10 mg / kg , and 20 mg / kg ) , docetaxel , interferon , and normal saline separately at 6 time points ( 3rd , 6th , 9th , 12th , 15th , and 18th days after administration ) . \n differentially expressed genes screened out by time - series analysis , go analysis , and pathway analysis , and four immune - related genes were selected for further confirmation using rt - qpcr . \n the results demonstrated that ca is able to change gene expression and that the responsive genes ( can , nfatc2 , nfatc2ip , and nfatc3 ) involved in immune pathways had been significantly upregulated by ca . \n expression of immune factors such as il-2r and ifn- can be improved by ca to promote activation and proliferation of t cells , macrophages , and nk cells , thus enhancing their surveillance and killing abilities , further suppressing the growth rate of tumor cells .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: candida albicans is an opportunistic fungal pathogen that can cause life - threatening infections in severely immunocompromised individuals . however , c. albicans is a frequent coloniser of mucosal surfaces in the majority of healthy humans without causing disease . \n this commensal behaviour has been associated with host immune tolerance [ 1 , 2 ] . \n key immune surveillance cells in the mucosa that recognise and respond to c. albicans are resident macrophages , such as the langerhans cells of mucosal and dermal skin [ 3 , 4 ] . \n m1 macrophages may control candida infection through phagocytosis and also induction of inflammation in the skin by producing inflammatory cytokines , such as tumour necrosis factor alpha ( tnf ) [ 68 ] . \n m2 macrophages may also kill candida by phagocytosis , but , importantly , can also produce anti - inflammatory cytokines and growth factors leading to immune tolerance to candida [ 1 , 9 ] . \n -glucan is a major cell wall component of c. albicans and binds to toll - like receptor ( tlr ) 2 and dectin-1 receptors on m1 macrophages to trigger downstream cell signaling for tnf production [ 1012 ] . \n we have previously reported the granulocyte - macrophage colony - stimulating factor ( gm - csf ) mediated stimulation of dectin-1 expression by human peripheral blood monocytes . \n this in turn promoted m1 macrophage maturation , candida phagocytosis , and tnf production [ 14 , 15 ] . \n m1 macrophages are normally found at sites of inflammation of the skin and are associated with gm - csf expression by infiltrating and reactive cd4 t cells , resulting in higher levels of tnf [ 1 , 16 , 17 ] . \n we have also shown that denture stomatitis involving c. albicans is associated with higher levels of tnf in fluids from the oral palatal mucosa . \n il-34 is a recently identified cytokine that binds to the macrophage colonisation factor ( m - csf ) receptor ( c - fms or cd115 ) to stimulate macrophage expansion and maturation . \n il-34 expression occurs predominantly in the skin and brain where it is produced by keratinocytes and neuronal cells , respectively . \n importantly , mice devoid of il-34 exhibit a loss of langerhans cells in the skin and have a reduced number of microglia in the brain [ 20 , 21 ] . the langerhans cells and resident macrophages in mucosal and dermal skin of healthy individuals \n do not normally respond to c. albicans or other commensal microorganisms and in these cases there is no inflammation . \n such tolerance could arise through the presence of locally produced cytokines , such as il-34 . in the present study \n , we have examined the potential role of il-34 in inducing immune tolerance by resident macrophages towards heat killed candida ( hkc ) . \n the results have demonstrated , for the first time , that il-34 acts as an immune suppressing cytokine which may maintain mucosal and dermal skin tolerance to c. albicans by downregulating tlr2 and dectin-1 expression by m1 macrophages , resulting in lower tnf production . \n bone marrow derived macrophages ( bmms ) were isolated from 6- to 8-week - old c57bl/6 mice as previously described and cultured with 10 ng / ml gm - csf ( r&d ) for 7 days to drive m1 macrophage maturation . \n the mouse macrophage cell line , raw264.7 , was also treated with gm - csf ( 10 ng / ml ) for 2 days to induce m1-like macrophages . \n all cells were maintained at 37c in a 5% ( v / v ) co2 enriched atmosphere in rpmi 1640 medium , supplemented with 10% ( v / v ) fetal bovine serum ( fbs ) containing penicillin and streptomycin . \n to investigate tnf production by mouse macrophages , mature m1 bmms or raw264.7 cells were first seeded at levels of 2 10 cells in the wells of a 24-well tissue culture plate . \n to these cells , il-34 ( r&d systems ) was added at 0 , 10 , or 100 ng / ml , and cells were then incubated with the added presence of 10 ng / ml gm - csf for 5 ( mature m1 bmms ) or 2 ( raw264.7 cells ) days . \n after incubation , 1 10 hkc , which had been prepared as previously described [ 1 , 13 ] , was added . \n cell culture supernatants were collected 24 h after stimulation and tnf was detected using an enzyme - linked immunosorbent assay ( elisa ) . to detect tlr2 and dectin-1 expression by m1 bmms and raw264.7 , \n cells were treated with il-34 at 10 or 100 ng / ml for m1 bmms and raw264.7 , respectively , in the presence of gm - csf . \n m1 bmms were harvested at 0 , 24 , 48 , 72 , and 96 h of culture , whilst raw264.7 cells were harvested at 6 , 12 , and 24 h. total rna was extracted from all harvested cells and tlr2 and dectin-1 expression was then measured by real - time reverse transcription - polymerase chain reaction ( rt - pcr ) and in the case of raw264.7 cells also by fluorescence - activated cell sorting ( facs ) . \n tnf in cell culture medium was measured by elisa according to the manufacturer 's ( ebioscience ) instructions . \n briefly , the wells of high protein bound 96-well plates ( nunc ) were coated overnight at 4c with 50 l of anti - mouse tnf specific antibody ( 0.5 g / ml ) in phosphate buffered saline ( pbs ) . after blocking nonspecific binding using an assay diluent ( supplied in the elisa kit ) for 2 h at room temperature ( rt ) , cell - free supernatants ( 50 l ) and mouse recombinant tnf standards ( from 4 ng / ml in two - fold dilutions ) \n were added to the plate in triplicate prior to overnight incubation at 4c to capture tnf. after thoroughly washing the plate with pbs containing 0.05% ( v / v ) tween-20 , specific bound tnf was detected using a biotin - conjugated anti - mouse tnf antibody ( 0.5 g / ml ) ( 1 h at rt ) , followed by incubation with 50 l of streptavidin - hrp for 30 min at rt . a 50-l volume of 3,3,5,5-tetramethylbenzidine ( tmb ) peroxidase substrate was added to each well and incubated at room temperature for 1020 min for color development . \n the enzyme reaction was terminated by adding 50 l of a stop solution ( supplied with the kit ) . \n the optical density of each well was then measured with a spectrometer at 450 nm wavelength and the tnf concentration in the supernatants determined using a standard curve . \n total rna was purified using the rneasy mini kit with qiashredder spin columns ( qiagen ) and transcribed into cdna following the manufacturer 's recommended protocol using avian myeloblastosis virus reverse transcriptase ( amv rt ) ( promega ) and 50 ng of random primers in a total volume of 25 l for 1 h at 37c . the sybr green qpcr kit ( sigma ) \n was used to quantify mrna levels of tlr2 , tlr4 , dectin-1 , and mannose receptor ( mr ) using the abi prism 7000 sequence detection system ( applied biosystems ) . \n table 1 lists the primer pairs that were used to measure mouse receptor mrna levels compared with the mouse housekeeping -actin gene ( table 1 ) . all samples were run in triplicate . \n the cycle threshold ( ct ) value of each sample was determined by calculation of 2ct , and the data was presented as an expression - fold relative to control . \n raw264.7 cells , with or without il-34 treatment , were harvested at specific time points and fixed in 300 l of facs buffer containing 2% ( v / v ) paraformaldehyde for 30 min at 4c . after blocking nonspecific binding with 5% ( v / v ) rabbit serum for 20 min at 4c \n , cells were incubated either with fitc - conjugated anti - tlr2 antibody ( ebioscience ) , phycoerythrin- ( pe- ) conjugated anti - dectin-1 antibody ( ebioscience ) , or isotype control antibodies diluted in facs buffer for 30 min at 4c . \n samples were analysed by collecting 10,000 events using the facscanto ii flow cytometer ( bd biosciences ) . \n the change in percentage of both tlr2 and dectin-1 positive cells after treatment with il-34 was determined and compared to cells without il-34 treatment . \n statistical significance was determined using two - tailed student 's t - test and tukey - kramer or bonferroni multiple comparisons post - tests to analyse differences between groups ; p < 0.05 and p < 0.01 were considered significant . \n hkc stimulated tnf production by m1 macrophages , which is one of the phenotypic features of m1 macrophages . to assess the effect of il-34 on the inflammatory m1 macrophage \n , m1 macrophages were pretreated with different concentrations of il-34 for 5 days in the presence of gm - csf , prior to the cells being stimulated with hkc . \n decreased tnf production in culture supernatant was determined by elisa in a hkc dose dependent manner ( figure 1(a ) ) . \n however , treatment of raw264.7 cells with gm - csf for two days , followed by 2 days treatment with il-34 , demonstrated suppression towards hkc induced tnf production in an il-34 dose dependent manner ( figure 1(b ) ) . \n this result showed that il-34 was acting as an immune suppressing cytokine that was able to inhibit tnf production by inflammatory m1 macrophages in response to candida stimulation . \n the recognition of candida cell wall components by macrophages involves toll - like receptors ( tlrs , mainly tlr2 and tlr4 ) and c - type lectin receptors ( dectin-1 and mannose receptor ) . to investigate the molecular mechanism of il-34 suppression of candida induced tnf production by m1 macrophages , \n the mrnas of tlr2 , tlr4 , dectin-1 , and mannose receptor were measured by rt - pcr . \n il-34 treated cells expressed significantly lower mrna for tlr2 and dectin-1 ( p < 0.01 ) ( figure 2(a ) ) . \n there was , however , no significant decrease in the expression of mrna for tlr4 ( figure 2(b ) ) . \n interestingly , mannose receptor was significantly upregulated by il-34 in m1 macrophages ( figure 2(b ) ) . \n il-34 suppression of tlr2 and dectin-1 mrna was confirmed using raw264.7 cells ( figure 2(c ) ) . \n these results showed that il-34 suppression of hkc stimulated tnf production was via the downregulation of tlr2 and dectin-1 expression by m1 macrophages and not by the downregulation of tlr4 or mannose receptor . \n tlr2 and dectin-1 cell surface expression can be detected by facs analysis using anti - tlr2 and anti - dectin-1 receptor specific antibodies . \n dectin-1 following il-34 stimulation , m1 macrophages treated with different concentrations of il-34 were stained with fitc - conjugated anti - tlr2 and pe - conjugated anti - dectin-1 . \n a dose dependent decrease in tlr2 ( figure 3(a ) ) and dectin-1 ( figure 3(b ) ) positive cell populations of m1 macrophages was demonstrated by facs analysis . \n these results further demonstrated that il-34 treatment of m1 macrophage cell cultures reduced cell surface expression of tlr2 and dectin-1 , resulting in inhibition of candida induced tnf production by m1 macrophages . \n mucosal and dermal skin provides a physical and biological barrier against insult from both the environment and pathogens . \n these surfaces also exhibit tolerance to commensal microorganisms such as c. albicans that colonise them . \n this immune tolerance arises as a result of a complex interaction of cell components including tissue resident macrophages such as langerhans cells in the epidermal layers of skin [ 22 , 23 ] . \n gm - csf induces an inflammatory m1 macrophage phenotype in vitro and in vivo , and m1 macrophages produce tnf in response to c. albicans stimulation [ 68 ] . in this study \n , we demonstrated that il-34 , a cytokine constitutively produced in the skin , was able to suppress inflammatory m1 macrophages for hkc induced tnf production . \n this suppressing activity was demonstrated for m1 macrophages cultured in the presence of gm - csf , which indicated that il-34 was an antagonist of gm - csf . \n recent studies have shown that langerhans cells exhibit immune tolerance and do not normally induce an immune response even after activation and migration to a draining lymph node . \n this immune tolerance may be the result of an il-34 rich environment in the skin . \n the evidence for the immune tolerant phenotype of langerhans cells and il-34 inducing non - tnf producing macrophages suggests that il-34 is an immune suppressing cytokine of the skin . \n however , studies of autoimmune rheumatoid arthritis have indicated that il-34 may be a proinflammatory cytokine with expression associated with joint inflammation [ 2428 ] . \n il-34 shares the receptor for m - csf , which is a key factor in inducing osteoclast formation . indeed \n , it has been demonstrated that il-34 has involvement in cartilage and bone erosion by promoting osteoclastogenesis in rheumatoid arthritis [ 25 , 26 ] . \n although it has been shown that increasing il-34 levels is associated with synovitis severity of rheumatoid arthritis patients , il-34 expression could suppress joint inflammation as a negative feedback instead of promoting inflammation . \n it has been demonstrated that cd14 macrophages in synovial tissue are a major source of tnf . \n the role of il-34 in joint inflammation may need to be analysed with greater focus given to the impact of this cytokine on m1 macrophages in synovial tissues of patients . \n we have recently demonstrated that higher tnf production and inflammation in oral mucosa was associated with c. albicans infection in denture stomatitis . following sufficient control of c. albicans colonisation in such patients , a reduction of m1 macrophage activity using il-34 \n candida albicans stimulation of macrophages leading to tnf production requires expression of the pattern recognition receptors , tlr2 and dectin-1 [ 1012 , 31 ] . in the current study , we have shown for the first time that il-34 can suppress both tlr2 and dectin-1 mrna transcription , but not transcription of tlr4 and mannose receptor . \n both cell surface tlr2 and dectin-1 expression was also suppressed by il-34 in a dose dependent manner . \n these findings indicate that tlr2 and dectin-1 ( but not tlr4 and mannose receptor ) are the cell surface receptors responsible for tnf production by m1 macrophages . \n il-34 expression is restricted to the epidermal layers of skin and certain areas of the brain . \n regeneration of langerhans cells in mucosal and dermal skin is entirely dependent on il-34 production in keratinocytes . \n loss of langerhans cells occurs in il-34 deficient mice indicating that the function of il-34 can not be undertaken by m - csf , despite il-34 and m - csf sharing a common receptor ( c - fms or cd115 ) in macrophage precursor cells . \n the results of the present study provide evidence that constitutive expression of il-34 in the skin may maintain an environment of immune tolerance for tissue resident macrophages . in this study \n , il-34 stimulated a significantly higher mannose receptor ( cd206 ) expression , which is a cell marker for m2 macrophages and responsible for phagocytosis . \n this result further demonstrated that il-34 was able to promote m1 to m2 macrophage transformation , which could be of benefit in generating immune tolerance and wound healing in the skin . in conclusion , this study demonstrated that il-34 suppresses c. albicans induced tnf production by gm - csf induced m1 macrophages . \n the mechanism of inhibition was through the downregulation of tlr2 and dectin-1 expression by m1 macrophages , but not tlr4 and mannose receptor . \n constitutive il-34 expression in keratinocytes in both mucosal skin and dermal skin may play a key role in maintaining immune tolerance toward commensal colonising microorganisms .", "role": "user" }, { "content": "candida albicans is a fungus that is an opportunistic pathogen of humans . \n normally , c. albicans exists as a harmless commensal and does not trigger inflammatory responses by resident macrophages in skin mucosa , which may be caused by a tolerance of skin macrophage to c. albicans . \n il-34 is a recently discovered cytokine , constitutively expressed by keratinocytes in the skin . \n il-34 binds to the receptor of m - csf , thereby stimulating tissue macrophage maturation and differentiation . \n resident macrophages exhibit phenotypic plasticity and may transform into inflammatory m1 macrophages for immunity or anti - inflammatory m2 macrophages for tissue repair . \n m1 macrophages produce higher levels of inflammatory cytokines such as tnf in response to c. albicans stimulation . in this study \n , it was demonstrated that il-34 attenuated tnf production by m1 macrophages challenged with heat killed candida ( hkc ) . \n the molecular mechanism of il-34 mediated suppression of hkc induced tnf production by m1 macrophages was by the inhibition of m1 macrophage expression of key c. albicans pattern recognition receptors ( pprs ) , namely , toll - like receptor ( tlr ) 2 and dectin-1 . \n the results of this study indicated that constitutive il-34 expressed by skin keratinocytes might suppress resident macrophage responses to c. albicans colonisation by maintaining low levels tlr2 and dectin-1 expression by macrophages .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: goal - directed reaching movements involve representative sensorimotor control , planning , and execution , both sequentially and cyclically . throughout these processes , the trajectory of smooth reaching movement is generally not straight but curved , as observed in previous studies.1,2 a precise curve trajectory is necessary to minimize jerk,3 torque change,4 variance,5 interaction torques,6 and combinations of these.7 movement disorders such as parkinson s disease and cerebellar ataxia disturb goal - directed reaching movement.8,9 acute experimental pain in healthy subjects has also been found to disturb goal - directed reaching movement.10,11 however , few studies have investigated reaching control in patients with chronic pain in an upper limb . \n complex regional pain syndrome ( crps ) type 1 is one of the strongest examples of chronic pain in a limb.12 crps is usually preceded by a trauma and is characterized not only by pain but also by sensory dysfunction ( i.e. , decreased tactile and proprioceptive sensitivity ) , motor disturbances such as dystonia and decreased maximal force , and mental disorders ( e.g. , fear of movements , depression , and anxiety).12,13 although a previous kinematic analysis of crps patients revealed signs of tremor,14 the degree of smooth or efficient reaching movement has not been yet analyzed in detail . \n the lateral curve of trajectories can modulate the execution of smooth and efficient goal - directed movements . \n thus , in the present study , we focused on lateral curve trajectories in addition to tremor in a crps patient . \n the patient was a 46-year - old female who had undergone a partial mastectomy and a sentinel lymph node biopsy for right breast cancer 1 year prior to the present experiment . \n after the surgical wound had healed , she continued to experience pain and numbness in the right upper limb . \n one year after surgery , diffuse muscle weakness and bradykinesia were still observed in the right upper limb , and edema and decreased range of joint motion had emerged in her right hand . \n her clinical symptoms met the diagnostic criteria for crps15 without neurological deficit , and as she did not exhibit signs of overt nerve injury in the limb , she was diagnosed with crps type 1 . \n she developed an extreme fear of contact between the affected hand and any objects owing to hyperalgesia and allodynia . \n although her anxiety and fear regarding pain aggravation were treated with pregabalin , she clinically maintained her catastrophic thinking in relation to the present pain experience . throughout the study period , \n therefore , any effects of pregabalin should be canceled out when comparing the present kinematic data . \n the ethical review board of the faculty of medicine , the university of tokyo , approved this study . \n we explained the protocol of this study to the patient and obtained a written informed consent to publish the case report . \n we collected kinematic data from both the intact hand ( left hand ) and the affected hand ( right hand ) . \n two columnar bars ( with a diameter of 5 cm and height of 10 cm and 30 cm , respectively ) were placed on the table . \n the start bar was placed 20 cm away from the participant and the goal bar was located 30 cm further from the start bar ( i.e. , 50 cm away from the participant ) . \n the participant was required to first pinch the tip of the start bar with her thumb and index finger , which was oriented in an anteroposterior direction ( starting position ) , and then moved her hand from the start position to reach and pinch the tip of the goal bar ( goal position ) . \n the participant was asked to repeat this sequential - movement process 10 times at a comfortable pace . \n we first obtained kinematic data for both the intact and affected hands and then repeated the measurement of kinematic data from the affected hand after inducing a regional intravenous nerve blockade ( bier block : 1% lidocaine at 20 ml for the affected forearm ) that alleviated pain . creating an intravenous nerve blockade using lidocaine \n is known to be an effective treatment for severe pain , allodynia , and edema.16 this treatment had an immediate analgesic effect on the patient . using the nerve blockade enabled us to compare motor control between pain and painless conditions and thus ascertain whether pain contributed to abnormal motor control in the affected limb . in order to minimalize the effect of hemostasis during intravenous nerve blockade , \n kinematic data in pain alleviation condition were measured in about half an hour after the release of tourniquet . \n the kinematic data comprised reaching trajectories that were captured using a magnetic measurement system with six degrees of freedom ( 3 space fastrak ; polhemus inc . ) . \n this system generated a hemispherical electromagnetic field with a radius of 76 cm , which is sufficiently large to measure upper limb movement . \n the system measured the three - dimensional position and orientation of sensors that were attached to the tips of the index fingers and thumb and to the lateral epicondylus of the wrist . \n the location of the sensors in the field was collected at a sampling rate of 40 hz and the data were stored on a personal computer . \n the recorded data were visualized and analyzed using matlab ( mathworks , natick , ma , usa ) . to analyze the tremor of the limb , we divided the reaching trajectory into two phases : the acceleration phase and the deceleration phase . according to a previous report,14 we defined the acceleration phase as the period starting when the forward velocity of the wrist exceeded 5 cm / s and ending when the velocity of the limb reached a maximum value . \n the acceleration phase is considered to reflect the feedforward ( ff ) control of goal - directed limb movement.1719 the deceleration phase was defined as starting immediately after the acceleration phase and lasting until the velocity fell below 5 cm / s . \n the deceleration phase is considered to reflect the feedback ( fb ) control of limb movement.18,20,21 to quantify the degree of tremor in each phase , we generated an arbitrary tremor index by calculating the difference between the length of straight lines connecting successive landmarks ( i.e. , the three - dimensional start and goal positions ) and the real movement trajectory of the hand . to distinguish efficient limb movements from tremor , we set another time frame , termed the initial movement phase , which started at the first motion and ended at the maximum peak acceleration . in this phase , \n the smooth circular curve of the trajectory was considered to reflect the simple ff control.19 to analyze this , we measured the area under the curve ( auc ) of each trajectory by calculating the root mean square value in the initial movement phase . \n further , we measured the angle between the sagittal body - midline axis and the initial direction of the trajectory as a reflection of the naturally curved smoothness of each trajectory . \n these parameters were averaged in the respective conditions ( i.e. , the intact limb , and the affected limb before and after pain alleviation ) . \n we analyzed the maximum velocity of reaching movements among three conditions and analyzed the tremor index during the acceleration and deceleration phases across the three conditions using the friedman test . \n we also used the friedman test to analyze the averaged auc and trajectory angle during the initial movement phase . \n subsequently , we used the wilcoxon signed - rank test to compare differences in the maximum velocity , the tremor index , and the efficient limb movement analyses among the three conditions . \n bonferroni correction was used for the three conditions and the significance level was set at p < 0.0167 . \n we used spss version 20.0 ( ibm corporation , armonk , ny , usa ) for all statistical processes . \n we collected kinematic data from both the intact hand ( left hand ) and the affected hand ( right hand ) . \n two columnar bars ( with a diameter of 5 cm and height of 10 cm and 30 cm , respectively ) were placed on the table . \n the start bar was placed 20 cm away from the participant and the goal bar was located 30 cm further from the start bar ( i.e. , 50 cm away from the participant ) . \n the participant was required to first pinch the tip of the start bar with her thumb and index finger , which was oriented in an anteroposterior direction ( starting position ) , and then moved her hand from the start position to reach and pinch the tip of the goal bar ( goal position ) . \n the participant was asked to repeat this sequential - movement process 10 times at a comfortable pace . \n we first obtained kinematic data for both the intact and affected hands and then repeated the measurement of kinematic data from the affected hand after inducing a regional intravenous nerve blockade ( bier block : 1% lidocaine at 20 ml for the affected forearm ) that alleviated pain . creating an intravenous nerve blockade using lidocaine \n is known to be an effective treatment for severe pain , allodynia , and edema.16 this treatment had an immediate analgesic effect on the patient . using the nerve blockade enabled us to compare motor control between pain and painless conditions and thus ascertain whether pain contributed to abnormal motor control in the affected limb . in order to minimalize the effect of hemostasis during intravenous nerve blockade , \n kinematic data in pain alleviation condition were measured in about half an hour after the release of tourniquet . \n the kinematic data comprised reaching trajectories that were captured using a magnetic measurement system with six degrees of freedom ( 3 space fastrak ; polhemus inc . ) . \n this system generated a hemispherical electromagnetic field with a radius of 76 cm , which is sufficiently large to measure upper limb movement . \n the system measured the three - dimensional position and orientation of sensors that were attached to the tips of the index fingers and thumb and to the lateral epicondylus of the wrist . \n the location of the sensors in the field was collected at a sampling rate of 40 hz and the data were stored on a personal computer . \n the recorded data were visualized and analyzed using matlab ( mathworks , natick , ma , usa ) . to analyze the tremor of the limb , we divided the reaching trajectory into two phases : the acceleration phase and the deceleration phase . according to a previous report,14 we defined the acceleration phase as the period starting when the forward velocity of the wrist exceeded 5 cm / s and ending when the velocity of the limb reached a maximum value . \n the acceleration phase is considered to reflect the feedforward ( ff ) control of goal - directed limb movement.1719 the deceleration phase was defined as starting immediately after the acceleration phase and lasting until the velocity fell below 5 cm / s . \n the deceleration phase is considered to reflect the feedback ( fb ) control of limb movement.18,20,21 to quantify the degree of tremor in each phase , we generated an arbitrary tremor index by calculating the difference between the length of straight lines connecting successive landmarks ( i.e. , the three - dimensional start and goal positions ) and the real movement trajectory of the hand . to distinguish efficient limb movements from tremor , we set another time frame , termed the initial movement phase , which started at the first motion and ended at the maximum peak acceleration . in this phase , \n the smooth circular curve of the trajectory was considered to reflect the simple ff control.19 to analyze this , we measured the area under the curve ( auc ) of each trajectory by calculating the root mean square value in the initial movement phase . \n further , we measured the angle between the sagittal body - midline axis and the initial direction of the trajectory as a reflection of the naturally curved smoothness of each trajectory . \n these parameters were averaged in the respective conditions ( i.e. , the intact limb , and the affected limb before and after pain alleviation ) . \n we analyzed the maximum velocity of reaching movements among three conditions and analyzed the tremor index during the acceleration and deceleration phases across the three conditions using the friedman test . \n we also used the friedman test to analyze the averaged auc and trajectory angle during the initial movement phase . \n subsequently , we used the wilcoxon signed - rank test to compare differences in the maximum velocity , the tremor index , and the efficient limb movement analyses among the three conditions . \n bonferroni correction was used for the three conditions and the significance level was set at p < 0.0167 . \n we used spss version 20.0 ( ibm corporation , armonk , ny , usa ) for all statistical processes . \n visual inspection of the data indicated that two trials with the affected hand under the pain alleviation condition were not recorded correctly . \n the time series of the reaching velocity in each condition is demonstrated in figure 1 . \n the friedman test demonstrated a significant difference in the maximum velocity among the conditions ( = 14.25 , p = 0.001 ) and the wilcoxon signed - rank test revealed significant differences between the intact limb ( mean 51.891.91 cm / s standard deviation ) and the affected limb before and after pain alleviation ( before : 14.581.53 cm / s ; after : 17.643.72 cm / s , p < 0.02 ) . \n further , the maximum velocity of the affected limb after pain alleviation tended to improve compared with that before pain alleviation , but this result did not reach significance ( p = 0.069 ) . during the acceleration phase , \n the friedman test demonstrated no significant differences in the tremor indexes among the three conditions ( = 1.00 , p = 0.61 ; figure 2 ) . \n however , during the deceleration phase , the friedman test reached significance ( = 12.25 , p = 0.002 ) and the tremor index of the intact limb was significantly lower than that of the affected hand before and after pain alleviation ( wilcoxon , p < 0.0167 ; figure 2 ) . \n the friedman test revealed significant differences in the auc of trajectories among the conditions ( = 12.25 , p = 0.002 ) . \n additionally , the auc of the intact limb was significantly larger than that of the affected limb both before and after pain alleviation ( p < 0.016 ; figure 3 , lower left section ) . \n the averaged trajectory direction was significantly different among the conditions ( = 7.75 , p = 0.021 ) . \n the wilcoxon signed - rank test demonstrated that the trajectory direction of the intact limb was consistently larger than that of the affected limb before pain alleviation ( p = 0.0001 ) but not after pain alleviation ( p = 0.119 ; figure 3 , lower right section ) . \n the time series of the reaching velocity in each condition is demonstrated in figure 1 . the friedman test demonstrated a significant difference in the maximum velocity among the conditions ( = 14.25 , p = 0.001 ) and the wilcoxon signed - rank test revealed significant differences between the intact limb ( mean 51.891.91 cm / s standard deviation ) and the affected limb before and after pain alleviation ( before : 14.581.53 cm / s ; after : 17.643.72 cm / s , p < 0.02 ) . \n further , the maximum velocity of the affected limb after pain alleviation tended to improve compared with that before pain alleviation , but this result did not reach significance ( p = 0.069 ) . \n during the acceleration phase , the friedman test demonstrated no significant differences in the tremor indexes among the three conditions ( = 1.00 , p = 0.61 ; figure 2 ) . \n however , during the deceleration phase , the friedman test reached significance ( = 12.25 , p = 0.002 ) and the tremor index of the intact limb was significantly lower than that of the affected hand before and after pain alleviation ( wilcoxon , p < 0.0167 ; figure 2 ) . \n the friedman test revealed significant differences in the auc of trajectories among the conditions ( = 12.25 , p = 0.002 ) . additionally , the auc of the intact limb was significantly larger than that of the affected limb both before and after pain alleviation ( p < 0.016 ; figure 3 , lower left section ) . \n the averaged trajectory direction was significantly different among the conditions ( = 7.75 , p = 0.021 ) . \n the wilcoxon signed - rank test demonstrated that the trajectory direction of the intact limb was consistently larger than that of the affected limb before pain alleviation ( p = 0.0001 ) but not after pain alleviation ( p = 0.119 ; figure 3 , lower right section ) . \n in case of our crps patient , the velocity of reaching movements performed using the affected limb was slower than that with the intact limb . \n this reflects bradykinesia in individuals with crps , which was reported in a previous study.22 in the present study , we expected that pain or pain - related fear would affect such bradykinesia given the tendency for the velocity to increase after pain alleviation . \n we mainly used these velocity data to divide reaching movements into those that occurred in the ff versus fb control phases . as a result , visualization of goal - directed movement trajectories of the affected and intact upper limbs revealed that tremor was not prominent in the affected limb during the ff control period compared to the intact limb . \n however , the trajectory observed during initial movement of the affected limb was rectilinear , unlike the smooth circular - curved trajectory of the intact limb . immediately after pain alleviation by a neural blockade \n further , during fb control of goal - directed movement , tremor of the affected limb was prominent . \n the ff control of goal - directed movement in the affected limb was similar to that in the intact limb . \n this is compatible with previous reports.14 however , in the more precise initial time frame , the ff control in the affected limb impaired smooth circular - curved trajectories , making them rectilinear instead . \n first , excessive motor adjustments during ff control would be required to compensate tremor during fb control . \n motor control during the fb period might thus be substantially influenced by somatosensory fb context.18,20,21 capsaicin - induced tonic pain has been found to disrupt proper fb motor controls . \n additionally , pain stimulants have been found to interfere with ff control in preparation for movement . \n this minimizes trajectory corrections in the fb control period.11 considering that we observed impaired motor control during the ff and fb periods in our participant , pathological pain might first disrupt precise goal - directed movements during the fb control period . \n the majority of previous reports suggest that crps patients have impaired multimodal sensory integration ( especially with respect to visual and somatosensory inputs ) , and movement disorders are also common.2326 thus , our participant might have compensated for impaired fb motor control by executing excessive motor adjustments during the ff control period . \n this notion is supported by a recent pivotal review stated that crps patients exhibit a disruption in the sensorimotor loop associated with the affected hand and that visuo - motor rehabilitation strategies can be successful in ameliorating pain and associated movement disorders.27 the other potential mechanism that may explain our results is illustrated by the finding that pain - related fear induces abnormal rectilinear trajectories associated with avoidance of movement - related pain and minimization of the trajectory lengths of goal - directed movements . \n crps patients , like our participant , usually adopt a guarded position with respect to the affected limb and keep it immobilized . \n when such avoidant behavior is based on fear , a lack of pain increase may reinforce this behavior ( classically known as the fear - avoidance model).28 in fact , an anxious personality is considered to be a potential risk factor for developing crps.29 further , operant pain - related fear conditioning can modulate the trajectory pattern of goal - directed movements.30 therefore , the psychological circumstance of our participant might have contributed to the initial unnatural rectilinear movements . when the neural blockade ameliorated the pain and the related fear , the natural smooth circular - curved movements tended to be restored . \n this restorative tendency might represent collateral evidence for the effect of pain - related fear on the ff control , but this did not reach statistical significance . \n we considered not only pain - related fear but also the sensorimotor incongruence of the affected ff control . \n we discussed two explanatory mechanisms for our results : sensorimotor incongruence in the crps - affected limb and fear - related abnormal motor control . following the pain ( and fear ) \n an alternative contributing factor might be related to our previous finding that pain alleviation by neural blockade did not normalize but led to over adjustments with respect to visual and somatosensory integration.15 from this view , disturbance of sensorimotor incongruence in the affected limb is still sustained , at least partly , after pain alleviation . \n loss of the smooth circular - curved trajectory is a sign of disrupted ff motor control.1,2 this notion could explain why the ff motor control did not recover statistical significance after pain alleviation in our participant . \n our present findings indicate that disturbances in both ff and fb motor control in crps patients could be explained simply by sensorimotor incongruence . \n however , the reliability of our conclusion , which was derived from a single patient , should be verified in future studies with larger sample sizes . \n overall , taken together with previous studies , our data indicate that visuo - motor rehabilitation strategies should focus on the reestablishment of sensorimotor integration in the affected limb.27,31,32 \n first , we sought to clarify the cause of motor abnormality by dividing goal - directed movement into two components ( i.e. , acceleration and deceleration phase ) . \n however , we did clarify the mechanism on the basis of the distorted sensorimotor integration or the pain - related fear . \n second , we did not record kinematic data from the intact limb after the nerve block . in the future \n , we plan to investigate the effect of a nerve block on the intact limb to further clarify the mechanisms of disturbed sensorimotor integration . despite these limitations \n , we visualized the distorted sensorimotor integration and pain - related fear in crps patients using specific kinematic measures . \n thus , our kinematic evaluation strategies might be useful in clarifying these factors in further crps patients .", "role": "user" }, { "content": "objectivedisturbance of goal - directed motor control may cause or exacerbate pathological pain in patients with complex regional pain syndrome ( crps ) . \n we conducted a single - case study about motor control involved in reaching with a patient with crps in an upper limb.methodsusing a three - dimensional measurement system , we recorded reaching movement trajectories of the intact and affected hand before and after pain alleviation by therapeutic nerve blockade . \n we assessed degrees of tremor in the acceleration phase ( from start until maximum peak velocity ) and the deceleration phase ( from maximum peak velocity until goal ) . to quantify the smoothness of reaching movements \n , we analyzed the curves of the trajectories during the initial movement phase ( from start and maximum peak acceleration).resultsthe results showed that the tremor of the affected hand was greater than that of the intact hand during the deceleration phase , both before and after pain alleviation . reaching trajectories of the intact hand smoothly traced curves convexed toward the intact side , while those of the affected hand represented unnaturally rectilinear functions associated with the loss of smooth movements . \n further , these unnatural trajectories partially recovered after pain alleviation.conclusiondisturbance of sensorimotor integration and pain - related fear might affect goal - directed motor control in crps patients .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cutaneous melanoma is a highly aggressive malignant tumor of melanocytic origin with increasing incidence in most countries of the world over the last few decades . in caucasian populations \n the incidence rates for cutaneous melanoma have risen faster than those for any other malignant entity over the last 30 years . \n v ) or mutations of tumor - suppressor genes ( e.g. , cdkn2a , encoding for cyclin - dependent kinase inhibitor 2a ) , which might be reflected by a positive family history of melanoma . \n when a patient s risk for melanoma needs to be assessed during daily clinical routine , the personal and family history of melanoma , number of common and atypical nevi , skin type , presence of freckles , eye color , hair color , and the presence of non - melanoma skin cancer lesions should be considered . \n the overall number of nevi induced by ultraviolet radiation in early infancy was shown to be an especially important predisposing risk factor for the development of melanoma . \n individuals with a high nevus count are endangered notably , whereby the risk of melanoma development increases almost linearly with rising numbers of melanocytic nevi on the whole body . \n although cutaneous melanoma is less common than other skin cancers , it causes the majority ( approximately 90 percent ) of deaths related to skin cancer . \n an advanced tumor thickness ( breslow s depth ) is strongly associated with an increased mortality . \n therefore , the early detection of melanoma at early and curable stages is critical for the patients survival . \n in contrast to many other tumor entities , cutaneous melanoma may already develop metastases at a low tumor volume . \n once distant metastases have occurred , the median survival is approximately nine months and the five - year survival rate is less than 10 percent . on the contrary , for thin melanomas with a tumor thickness of less than 0.76 mm , \n these rates markedly decrease to 48 percent for lesions with more than 3 mm tumor thickness . until today , the most common method for detecting melanoma is visual diagnosis . to make a correct diagnosis , \n the most frequent form of cutaneous melanoma is superficial spreading melanoma ( ssm , figure 1 ) . \n it grows slowly and initially in a horizontal plane and subsequently , in more advanced cases , it will reach a vertical growth phase . with naked eye examination , lesions are often sharply demarcated , polycyclic and multicolored . \n in contrast , nodular melanoma ( nm ) , a much more aggressive form , exhibits an early vertical growth phase . \n nm emerges primarily and is then often detected late , at an advanced tumor thickness , or it develops secondarily within a ssm ( figure 2 ) . \n the nodes often grow rapidly , are vulnerable with a tendency to ulceration and bleeding , or might appear non - pigmented . \n lentigo maligna melanoma ( lmm , figure 3 ) characteristically occurs at older age and is localized in areas of chronically sun - exposed skin , like the face or dorsa of the hands . \n similar to ssm , it appears polycyclic , sharp - bounded and often shows multiple brown spots . \n a rare growth variant of cutaneous melanoma , the acral - lentiginous melanoma ( alm , figure 4 ) is localized in palmoplantar skin but may also involve the nail unit . \n alm represents the most common growth variant in dark - skinned ( e.g. , asian ) populations . due to the architecture of palmoplantar skin with parallel ridges and furrows , the margins are often not clearly defined and the pigmentation is incoherent . \n moreover , special forms like mucosal and ocular malignant melanoma exist . in summary , the most effective approach to improve the prognosis of cutaneous melanoma \n the identification and the screening of high - risk patients is an important prerequisite to further enhance efforts to lower the mean tumor - thickness at the time of diagnosis . \n excisional biopsies of suspicious lesions with subsequent histopathologic examination of specimens will allow for a definite classification . \n the application of the clinical abcd rule ( table 1 ) devised by friedman et al in 1985 is a common method for the clinical diagnostics of cutaneous melanoma . \n the criteria asymmetry , irregular margin , multiple colors and a diameter over 6 mm , cutaneous melanoma has to be considered . \n however , the abcd rule is characterized by a low specificity as other benign skin lesions such as seborrheic keratosis may also fulfill the aforementioned criteria . \n moreover , it is not applicable for pigmented lesions on the palms , soles or face due to the particular skin anatomy at these sites . \n small melanomas with a diameter of 6 mm or less or rare non - pigmented subtypes of melanoma will also not be detected by the abcd rule . \n certain dynamic changes within melanocytic lesions are also suggestive of cutaneous melanoma , for instance , asymmetrical changes in size , shape or color , or itching and bleeding . in consequence , \n e for evolving or evolution to the abcde rule . before examination of selected nevi in more detail , it is useful to get an overview of recurrent and predominant patterns of a patient s nevi . \n nevi in the same individual tend to resemble one another , so - called signature lesions , indicating benign nevi on a regular basis . \n in contrast , melanomas often deviate from the individual s nevus pattern , so - called ugly duckling sign . recently \n , a high sensitivity for the early detection of melanoma with the help of the ugly duckling sign could be demonstrated . \n medical total body photography is often used in dermatology to support the clinical surveillance of high - risk patients . \n photographically assisted follow - up images help clinicians and patients to detect new and changing pigmented lesions with the unaided eye . \n in contrast to digital dermoscopy , which allows for monitoring of a few lesions only , full body photography permits monitoring of all lesions of a patient . \n dermoscopy ( also known as epiluminescence microscopy , dermatoscopy , or amplified surface microscopy ) allows for a significant improvement in the preoperative diagnostic accuracy of pigmented skin lesions . \n dermoscopy is a non - invasive technique for the in vivo examination of melanocytic and non - melanocytic skin lesions . \n the handheld dermoscope traditionally consists of a magnifier , a non - polarized light source and a transparent plate . \n a liquid medium , for instance , immersion oil or spray for skin disinfection , is needed between the instruments contact plate and the skin to reduce the reflection of light . with the help of dermoscopy further information about the architecture , \n e.g. , the pigmented network , the vascular pattern and the distribution of color of a single lesion is obtained . today \n , many different dermoscopes are commercially available ( e.g. , dermatoscope by heine optotechnik ; episcope by welch allyn ; dermogenius by rodenstock przisionsoptik ) . \n more recently dermoscopes that emit polarized light to eliminate skin surface reflection entered the market . \n these instruments do not require skin contact and a liquid medium can be omitted ( e.g. , dermlite 3 gen ) . \n this procedure for classification of pigmented skin lesions was agreed on at an international consensus meeting . in the first step it has to be determined whether a melanocytic or non - melanocytic \n , the differentiation between benign or malignant / suspicious lesions follows in a second step . for this \n most algorithms ( e.g. , the abcd rule of dermoscopy , the 7-point checklist of dermoscopy , or menzies scroring method ) use a number of criteria associated with the presence of melanoma as first described for the pattern analysis by pehamberger et al . \n especially , three algorithmic methods ( qualitative pattern analysis , the abcd rule of dermoscopy , and the 7-point checklist ) were shown to be valid and reliable in distinguishing benign and malignant melanocytic tumors . \n the pattern analysis is based on a detailed , qualitative assessment of numerous dermoscopic criteria , and a high rate of diagnostic accuracy could be obtained by experienced investigators after a significant degree of formal training ( 19 ) . \n the abcd - rule of dermoscopy uses a semiquantitative scoring system based on a complex evaluation of asymmetry , border , color , and different dermoscopic structures within the lesion . \n the 7-point checklist ( table 2 ) was developed as a quantitative scoring system with three major criteria ( score of 2 points ) and four minor criteria ( score of 1 point ) . \n the 7-point checklist can be learned and applied more easily and in comparative studies allowed the best sensitivity in the hands of non - experts . \n two unsuspicious melanocytic nevi are shown in figures 5 and 6 , while three superficial spreading melanomas with their typical criteria for malignancy are demonstrated in figures 79 . \n a systematic overview of medline publications between 1983 and 1997 showed that dermoscopy leads to a 1027% increase in sensitivity as compared to the clinical diagnosis with the unaided eye . \n dermoscopy not only allows for an earlier detection of melanoma but was also shown to avoid unnecessary excisions of benign nevi . depending on the individual experience of the clinician , \n a sensitivity of up to 92%and a specificity of up to 99% were documented for the detection of cutaneous melanoma by dermoscopy . among dermatologists \n , dermoscopy has become a routine examination technique in europe and is with gaining acceptance worldwide . \n when computer hardware became more and more available and affordable , digital dermoscopy devices were developed and rapidly integrated into the clinical setting . \n digital overview and dermoscopic images offer the advantage of computer storage and retrieval during later examinations of patients . \n some digital dermoscopy devices even offer a computer - assisted diagnosis [ 2426 ] . despite a higher impact on financial and personnel resources , \n the sequential digital dermoscopic examination offers a number of advantages for patients with a high number of atypical nevi and a personal and/or family history of melanoma . due to the multitude of atypical pigmented lesions in these high - risk patients , it is often difficult to detect melanoma at an early stage without excising hundreds of benign nevi ( figure 10 ) . by comparison of dermoscopic follow - up images with baseline images \n a range of studies have proven that digital dermoscopy follow - up of high - risk patients allows for the early detection of melanomas that have not yet acquired melanoma - typical dermoscopic features , thus increasing the sensitivity [ 2729 ] . with the help of sequential digital dermoscopy \n , incipient melanomas can be identified by detection of intralesional changes , for instance asymmetrically enlargement or architectural changes ( figure 11 a c ) . \n this applies especially for melanomas without suspicious dermoscopic features , so - called featureless melanoma . \n another strategy of sequential dermoscopic follow - up is the short - term follow - up ( three - month interval ) , which targets a restricted number of highly atypical nevi , which should be removed whenever dynamic changes become apparent . \n numerous systems for sequential digital dermoscopy imaging are commercially available ( e.g. , molemax , fotofinder , solarscan ) . \n the need for a further improved diagnostic accuracy for the assessment of skin tumors has led to the development and investigation of new imaging tools . \n an innovative technique is the in - vivo confocal laser scanning microscopy ( clsm ) , which represents a relatively novel imaging tool allowing for non - invasive examination of skin morphology in real time and at a near - histopathologic resolution . \n multiple studies have evaluated the use of reflectance mode clsm for the diagnosis of melanoma in the past decade . in this \n regard , two different algorithms for melanoma diagnosis have been developed by two independent groups from modena and barcelona , showing similar sensitivity and specificity values for several clsm criteria . the relative simple two - step method developed by segura et al uses protective , as well as risk factors , whereby the presence of two risk factors results in a sensitivity of 86.1% and a specificity of 95.3% for the diagnosis of melanoma . \n pellacani et al identified six criteria , two major and four minor criteria , as independently correlated with a melanoma diagnosis . \n the two major criteria corresponded to the presence of atypical melanocytic cells within the epidermal basal layer and the papillary dermis or within the basal layer of non - edged papillae . \n the four minor criteria were represented by the presence of roundish cells in superficial layers spreading upward in a pagetoid fashion , pagetoid cells widespread throughout the lesion , cerebriform clusters within the papillary dermis and bright nucleated cells in the upper dermis . \n the presence of at least two features , one major and one minor criterion , was essential for melanoma diagnosis . \n on the other hand , regular dermo - epidermal architecture and absence of pagetoid infiltration and atypical cells were indicative of benign lesions . \n the evaluation of skin lesions by clsm is based on illumination of the tissue by a point laser light source and reflectance of individual skin structures , of which melanin is providing the strongest contrast [ 3537 ] . \n specific morphological pattern can be observed by clsm in nevi and melanoma allowing for differentiation of benign and malignant , but also for differentiating melanocytic from non - melanocytic lesions such as pigmented basal cell carcinoma ( figure 12 ) . due to scanning mode of clsm an area of up to \n 8 8 mm may be evaluated on horizontal sections and on different skin levels ( e.g. , stratum corneum , stratum spinosum , dermo - epidermal junction , dermis ) . \n thereby , the great advantage of clsm lies in the immediate diagnosis that may guide the clinician s decision for further management of a lesion . \n furthermore , clsm provides the clinician and the researcher with the possibility of monitoring of pigmented lesions over time and may change the way we evaluate melanocytic lesions in the future . to implement the clsm in the clinical setting , \n the multispectral digital dermoscopy , a new development of conventional dermoscopy , has recently entered the european market ( melafind ) and offers a fully automated differentiation of melanoma from atypical melanocytic nevi . \n light of different wavelengths is transmitted and the degree of reflection or absorption by the different components of human skin ( e.g. , collagen , melanocytes , and blood vessels ) is analyzed by a computer algorithm . \n a diagnosis is made by the assessment of the distribution of melanin , collagen and hemoglobin in a given lesion . \n a prospective multicenter trial , which led to the approval by the european agencies , showed a high sensitivity of 98.4% , but a low specificity of approximately 10% . \n however , as reported in the study by monheit et al , the specificity was superior to that of clinicians formally trained in the use of dermoscopy . \n another novel non - invasive optical biomedical imaging technique is the optical coherence tomography ( oct ) . \n the basic principle relies on low - coherence interferometry enabling high resolution , two- or three - dimensional , cross - sectional imaging of microstructural morphology in biological tissue . using conventional oct , the stratum corneum , the epidermis , and upper dermis and blood vessels can be visualized . \n however , with most of the present devices , it is not possible to investigate skin tissue on the cellular level , whereas the architecture of a pigmented lesion and the distribution of blood vessels can be assessed . \n cutaneous melanomas often show marked architectural disarray , the dermo - epidermal border is blurred and exhibits finger - shaped elongated rete ridges . \n more precise data concerning sensitivity and specificity of oct for the diagnosis of cutaneous melanoma are missing . of note , for the diagnosis of intraocular tumors , optical coherence tomography was shown to provide valuable information . \n early detection of cutaneous melanoma is one of the most effective ways of reducing mortality rates from this disease . \n in addition to the clinical assessment with the unaided eye , dermoscopy has become a standard examination technique throughout most european countries , as it was shown to significantly improve the diagnostic accuracy of the clinical examination . \n total body photography notably facilitates the detection of newly developed pigmented lesions in patients with a high nevi count . with the help of sequential digital dermoscopy imaging , even subtle dynamic changes are detectable , which is shown to improve the differentiation of atypical nevi and early melanomas in high - risk patients . \n a novel imaging tool is the confocal laser scanning microscopy , allowing examination of skin tumor morphology on a cellular level in real time . in the near future \n the recently approved melafind device will probably be applied for difficult - to - diagnose melanocytic lesions in selected centers . above all \n , it has to be emphasized that none of the aforementioned examination techniques are currently able to provide a definite and final diagnosis or to replace excisional biopsy of suspicious lesions followed by histological analysis .", "role": "user" }, { "content": "cutaneous melanoma is a highly aggressive malignant tumor of skin melanocytes with an increasing incidence in most countries of the world , especially in the fair - skinned populations . despite all preventive and therapeutic efforts , \n malignant melanoma is still the most lethal skin cancer . \n a delayed diagnosis results in an advanced stage and worsened prognosis . \n once distant metastases are present , the five - year survival rate is less than 10 percent . at the same time \n , patients may be cured by an early diagnosis of cutaneous melanoma followed by a wide excision . \n therefore , the early detection of melanoma at curable stages is crucial for the patients survival . besides the investigation of pigmented lesions with the unaided eye , a wide range of examination techniques for improved diagnostic accuracy have been developed and validated in clinical trials . \n however , none of these techniques are able to provide a definite and final diagnosis or to replace an excisional biopsy of suspicious lesions followed by histological analysis . \n this review provides a concise overview of general principles as well as current and future strategies for an improved early diagnosis of cutaneous melanoma", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: paroxysmal nocturnal hemoglobinuria ( pnh ) is a disease characterized by intra - vascular hemolysis , thrombosis , and bone marrow failure . \n the disease is associated with mutations in the pig - a gene in hematopoietic stem cells , resulting in a deficiency of glycosylphosphatidylinositol ( gpi)-anchored proteins.1 this deficiency results in loss of cd55 and cd59 , which are believed to be the main gpi - anchored proteins that serve to protect red blood cells ( rbcs ) from complement - mediated destruction.2 this rare disease , estimated at two to five new cases per million us inhabitants , has led to the development of multiple hypotheses that seek to explain the role of pig - a gene mutations and the survival , and clonal expansion , of cd55/cd59 cells ( pnh cells).1 these hypotheses seek to understand whether there is either an extrinsic permissive environment or an intrinsic survival benefit to pnh cells that allows for the clonal expansion within the bone marrow compartment.1,3,4 additionally , the identification of cd55/cd59 cells is not pathognomonic for clinical pathology , as pnh cells have been identified in normal individuals , thus further complicating the understanding of pnh and the role of pig - a.5,6 while early hypotheses of pnh pathophysiology considered the entity as part of a myelofibrosis ( mf)/myelodysplastic syndrome , these conceptualizations largely fell out of favor until recently with the advent of new high - throughput genetics and deep sequencing.7 deep sequencing studies have identified acquired somatic mutations in genes associated with myeloid neoplasms not only in hematologic malignancies but also in aging and in nonmalignant hematologic diseases such as aplastic anemia , suggesting that the development of a malignant process is bridged by the acquisition of multiple genetic mutations.8,9 recent data have identified the concurrence of pig - a mutations with genetic mutations associated with myeloproliferative disorders such as jak2 , hmga2 , and bcr - abl , thus further supporting the hypothesis that in some occurrences of pnh , the development of clinically significant pnh is the result of a stepwise progression of multiple genetic mutations similar to other myelodysplastic or myeloproliferative syndromes.1012 \n here , we report for the first time in the literature the development of clinically significant pnh in a patient with jak2v617f - negative , calr - positive essential thrombocythemia ( et ) . the patient was initially diagnosed with et in 2005 following the incidental finding of elevated platelets . \n the patient s initial bone marrow examination was consistent with a myeloproliferative neoplasm ( mpn ) . in 2011 , \n the patient was noted to have ongoing thrombocytosis ( platelets 795 k / mm ) but developed anemia ( hgb 9.0 g / dl ) , elevated lactate dehydrogenase ( 1,440 u / l ) , and marked reticulocytosis ( absolute reticulocyte count 197.3 k / mm ) ( figure 1c ) . \n a repeat bone marrow biopsy showed megakaryocyte hyperplasia with myelofibrosis , consistent with post - et myelofibrosis . \n the patient had a normal karyotype and a negative jak2v617f mutation but was found to have calr p.k385fs*47 , an acquired somatic mutation strongly associated with the development of mpn.13 his hemoglobin improved following iron supplementation , but hemolysis persisted with ongoing elevated lactate dehydrogenase , reduced haptoglobin , and reticulocytosis . \n urinalysis , which had previously been normal , revealed hemoglobinuria , 56 rbc/l , and 4 + hemosiderin . \n high - resolution karyotype with a single - nucleotide polymorphism array revealed hemizygous loss of xp22.2 , an area of the genome that contains the pig - a gene ( figure 1a ) . \n this microdeletion , which has been previously described , is a genetic aberration associated with the development of pnh.14 peripheral blood samples were used for multiparametric flow cytometry analysis based on fluorescent inactive aerolysin and the gpi - anchored proteins cd59 on rbcs and cd14 on monocytes and granulocytes . \n flow cytometry identified loss of gpi - anchored proteins ( pnh clone ) comprising 14% of rbcs , 60% of granulocytes , and 73% of monocytes , thus confirming his diagnosis of pnh ( figure 1b ) . \n though the development of pnh has been documented to be associated with a number of genetic aberrations associated with mpn and myelodyplasia , this is the first description of the development of pnh in a patient with a calr mutation.14 the progressive quality of his disease , initially from et to post - et myelofibrosis with eventual evolution of clinically significant pnh driven by microdeletion of xp22.2 , which encompassed the pig - a gene , illustrates the evolving nature of myelodysplastic / myeloproliferative conditions and supports the hypothesis that multiple genomic hits may occur in order to develop clinically significant pnh . \n while not fully elucidated , the calr mutation has been shown to lead to excessive cell proliferation.15 we hypothesize that the calr mutation conferred the survival benefit needed for clonal expansion and survival benefit within the bone marrow stem cell compartment of pig - a mutant cells , thus cooperating to generate the pnh phenotype . \n this case also importantly illustrates the utility of genomic testing outside the research setting and its utility in diagnosis when embedded within the clinical milieu . \n this patient s normal karyotype coupled with his calr mutation status allowed for appropriate identification of disease driving lesions and prognostication in et . as his disease continued to evolve , \n single - nucleotide polymorphism microarray appropriately identified the etiologic cause of his worsening anemia and changing clinical presentation , thus demonstrating how the clinical availability of sensitive genetic testing leads to more accurate diagnosis , pathogenic understanding of disease process , and the development of more targeted and personalized treatments.16", "role": "user" }, { "content": "paroxysmal nocturnal hemoglobinuria ( pnh ) , a disease characterized by intravascular hemolysis , thrombosis , and bone marrow failure , is associated with mutations in the pig - a gene , resulting in a deficiency of glycosylphosphatidylinositol - anchored proteins . \n many hypotheses have been posed as to whether pnh and pig - a mutations result in an intrinsic survival benefit of cd55/cd59 cells or an extrinsic permissive environment that allows for their clonal expansion within the bone marrow compartment . \n recent data have identified the concurrence of pig - a mutations with additional genetic mutations associated with myeloproliferative disorders , suggesting that some presentations of pnh are the result of a stepwise progression of genetic mutations similar to other myelodysplastic or myeloproliferative syndromes . \n we report for the first time in the literature the development of clinically significant pnh in a patient with jak2v617f - negative , calr - positive essential thrombocythemia , providing further support to the hypothesis that the development of pnh is associated with the accumulation of multiple genetic mutations that create an intrinsic survival benefit for clonal expansion . \n this case study additionally highlights the utility of genomic testing in diagnosis and the understanding of disease progression in the clinical setting .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: during the outbreak , we examined 11 diseased ducks ( 7 pekin ducks , 3 cherry valley pekin ducks , and 1 shaoxing duck ) from 5 duck farms in 4 provinces . at necropsy , \n viscera samples ( e.g. , brain , heart , liver , spleen , lung , theca folliculi ) were collected and placed in 10% buffered formalin . \n the theca folliculi from each duck were also used for virus isolation or detection by pcr . \n the main pathologic changes observed consistently in almost all diseased ducks were found in the ovaries : hyperemia , hemorrhage , degeneration , distortion , macrophage and lymphocyte infiltration , and hyperplasia ; in the liver , interstitial inflammation was found in the portal area ( figure 1 , panels a c ) . on the basis of these changes , \n b ) ovary with hemorrhage ( gold arrow ) , macrophage and lymphocyte infiltration and hyperplasia ( green arrow ) . \n f ) liver from healthy duck . a , c ) original magnification 40 ; b , c , e , f ) scale bars = 90 m . \n after samples underwent several rounds of screening and identification attempts , we concluded that a new virus infection was the most likely cause of the disease . \n one virus strain , designated yy5 , was isolated from the shaoxing duck after inoculation of clarified theca folliculus suspension into the allantoic cavities of 9-day - old specific pathogen \n the embryos died 72120 hours after inoculation , and severe cutaneous hemorrhages were observed . because eastern equine encephalitis ( eee ) virus has been shown to cause paralysis in pekin ducks ( 1 ) , we performed eee virus specific nested reverse transcription pcr ( rt - pcr ) ( 2 ) to detect the isolate . \n rna was extracted by using the tranzol rna extraction kit ( transgen biotech , beijing , china ) . \n the primer pairs used to amplify the e2 gene of eee virus ( eee-4 and ceee-7 , eee-5 and ceee-6 ) have been described ( 2 ) . \n a clear pcr product ( 268 bp ) resulted and was then sequenced ; the deduced amino acid sequence was compared with other sequences by using a blastp ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) search in genbank . \n hq641388 ) was shown to encode the nonstructural ( ns ) 1 protein of flavivirus , which exhibited 73%85% identity to flaviviruses in the ntaya virus and japanese encephalitis virus groups , such as bagaza virus ( genbank accession no . \n abn11829 ) . the result demonstrated the possible presence of a flavivirus in ducks . to further confirm flavivirus as the causative agent of duck hemorrhagic ovaritis , we used pcr to test the isolate and clinical samples with forward primer usu5454f ( 5-atggatgaagcycatttcac-3 ) ( 5 ) and a newly designed reverse primer 5861r ( 5-ccaaagttggcycccatctc-3 ) . \n the primers were located in the conserved regions of the ns3 sequences of bagaza virus , st . \n louis encephalitis virus , and usutu virus ( 35 ) and were predicted to produce an 400-bp amplicon . \n the reaction conditions were as follows : 5 min at 94c ; followed by 38 cycles of denaturation at 94c for 40 s , annealing at 47c for 35 s , and extension at 72c for 1 min ; and a final extension of 72c for 10 min . \n rt - pcr was optimized by using the following controls , including nucleic acids extracted from theca folliculi of healthy pekin ducks : avian influenza virus , newcastle disease virus , egg drop syndrome virus , anatid herpesvirus 1 , muscovy duck parvovirus , goose parvovirus , duck reovirus , goose reovirus , duck hepatitis a virus , duck astrovirus , duck circovirus , and goose hemorrhagic polyomavirus . \n all 11 theca folliculus samples and the isolate were positive for flavivirus by rt - pcr , which was confirmed by amplicon sequencing . the 367-nt sequence ( genbank accession no . \n hq641389 ) of part of the ns3 genomic region obtained from the isolate was 66%77% identical to the corresponding sequence of viruses in the ntaya virus and japanese encephalitis virus groups . \n the amplicon sequences from the 11 theca folliculus samples shared 98%100% identity with the yy5 isolate . \n pcr testing of another 52 samples from diseased ducks from the 4 provinces detected flavivirus - specific rna in 29 samples . \n flavivirus - specific rna was most frequently detected in theca folliculi , followed by intestinal mucosa , uterus , spleen , trachea , cloaca ( swab ) , and liver ( table ) . \n subsequently , the yy5 isolate was injected intramuscularly into nine 55-week - old pekin ducks and ten 30-week - old shaoxing ducks . at day \n the flavivirus rna was detected by ns3-based rt - pcr , and the virus was again isolated from theca folliculi . to investigate the genetic relationship of the isolate with flaviviruses \n , we obtained the genomic sequence of a 1,035-bp segment at the 3 terminus of the ns5 gene ( genbank accession no . \n hq641390 ) from strain yy5 by rt - pcr and primers fu1 and cfd3 as described ( 6 ) . phylogenetic analysis showed that yy5 was more closely related to tmuv than to other flaviviruses ( figure 2 ) . comparative sequence analysis showed that yy5 was 87%91% identical to different strains of tmuv ; therefore , we classified the flavivirus isolated from ducks as a new genotype of tmuv , a mosquito - borne flavivirus of the ntaya virus group . \n phylogenetic analysis of isolate yy5 ( in boldface ) from an ill shaoxing duck in the people s republic of china and selected other flaviviruses obtained by using an 1-kb nt sequence in the nonstructural 5 genomic region . \n the tree was constructed by the neighbor - joining method of mega ( 7 ) . \n numbers at nodes indicate bootstrap percentages obtained after 1,000 replicates ; only bootstrap values > 70% are shown . \n the sequences used in the phylogenetic analysis are as follows : af013374 , gadgets gully virus ( ggyv ) ; af013385 , kyasanur forest disease virus ( kfdv ) ; m86650 , langat virus ( lgtv ) ; y07863 , louping ill virus ( liv ) ; af013393 , omsk hemorrhagic fever virus ( ohfv ) ; l06436 , powassan virus ( powv ) ; af013398 , royal farm virus ( rfv ) ; u27495 , tick - borne encephalitis virus ( tbev ) ; af013380 , kadam virus ( kadv ) ; af013386 , meaban virus ( meav ) ; af013403 , saumarez reef virus ( srev ) ; af013410 , tyuleniy virus ( tyuv ) ; af013362 , aroa virus ( aroav ) ; nc_001477 , dengue virus 1 ( denv-1 ) ; af013382 , kedougou virus ( kedv ) ; af013367 , cacipacore virus ( cpcv ) ; u15763 , japanese encephalitis virus ( jev ) ; af013384 , koutango virus ( kouv ) ; af013360 , alfuy virus ( alfv ) ; af013389 , murray valley encephalitis virus ( mvev ) ; af013416 , st . louis encephalitis virus ( slev ) ; af013412 , usutu virus ( usuv ) ; m12294 , west nile virus ( wnv ) ; d00246 , kunjin virus ( kunv ) ; af013413 , yaounde virus ( yaov ) ; af013383 , kokobera virus ( kokv ) ; af013363 , bagaza virus ( bagv ) ; af013376 , ilheus virus ( ilhv ) ; af013397 , rocio virus ( rocv ) ; af013377 , israel turkey meningoencephalomyelitis virus ( itv ) ; af013392 , ntaya virus ( ntav ) ; af013408 , tembusu virus strain mm1775 ( tmuv - mm1775 ) ; af013409 , tmuv strain thcar ( tmuv - thcar ) ; ab026994 , tmuv strain sitiawan ( tmuv - sitiawan ) ; af013415 , zika virus ( zikv ) ; af013406 , spondweni virus ( spov ) ; l40951 , banzi virus ( banv ) ; af013364 , bouboui virus ( bouv ) ; af013372 , edge hill virus ( ehv ) ; af013378 , jugra virus ( jugv ) ; af013400 , saboya virus ( sabv ) ; af013404 , sepik virus ( sepv ) ; af013411 , uganda s virus ( ugsv ) ; eu707555 , wesselsbron virus ( wessv ) ; \n x03700 , yellow fever virus ( yfv ) ; af013373 , entebbe bat virus ( entv ) ; af013414 , yokose virus ( yokv ) ; af013361 , apoi virus ( apoiv ) ; af013370 , cowbone ridge virus ( crv ) ; af013379 , jutiapa virus ( jutv ) ; af013387 , modoc virus ( modv ) ; af013401 , sal vieja virus ( svv ) ; \n af013402 , san perlita virus ( spv ) ; af013365 , bukalasa bat virus ( bbv ) ; af013368 , carey island virus ( civ ) ; af013371 , dakar bat virus ( dbv ) ; af013388 , montana myotis leukoencephalitis virus ( mmlv ) ; af013394 , phnom penh bat virus ( ppbv ) ; af013396 , rio bravo virus ( rbv ) ; m91671 , cell fusing agent virus ( cfav ) ; nc_003996 , tamana bat virus ( tabv ) ; and eu159426 , nounan virus ( nouv ) . \n the nucleotide sequence of isolate yy5 used in the phylogenetic analysis has been deposited in genbank under accession no . \n we have demonstrated the presence of a mosquito - borne flavivirus in ducks . on the basis of criteria for species of the members of the genus flavivirus ( 6 ) and phylogenetic analysis \n , we consider the isolate to belong to a new genotype of tmuv . in this study , we found tmuv - specific rna in 63.5% samples from diseased ducks in different provinces . \n in particular , it was found in 14 ( 93.3% ) of 15 theca folliculus samples , suggesting that reproductive tissues may be a major site for viral persistence , replication , or both . \n because tmuv belongs to the mosquito - borne virus cluster of flaviviruses , mosquitoes might be involved in the spread of this virus . \n detection of the virus in cloacal swab samples suggests probable horizontal transmission through ingestion or inhalation of feces - contaminated material . \n tmuv was originally isolated from mosquitoes of the genus culex , but the disease associated with tmuv infection was not known . however , a chick - origin tmuv isolate , originally named sitiawan virus , can cause encephalitis and retarded growth in broiler chicks ( 8) . in conclusion , this study shows that duck - origin tmuv is highly pathogenic for pekin ducks , cherry valley pekin ducks , and shaoxing ducks .", "role": "user" }, { "content": "in china in 2010 , a disease outbreak in egg - laying ducks was associated with a flavivirus . \n the virus was isolated and partially sequenced . \n the isolate exhibited 87%91% identity with strains of tembusu virus , a mosquito - borne flavivirus of the ntaya virus group . \n these findings demonstrate emergence of tembusu virus in ducks .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: alzheimer 's disease ( ad ) is the most common form of dementia ; it is the sixth leading cause of death in the united states . \n more than 10% of americans over age 65 suffer from ad , and it is predicted that the prevalence of ad will triple within next 50 years [ 13 ] . currently , no known medicine exists for curing ad , but a number of medications are believed to delay the symptoms and the causes of the disease . \n the progression of ad can be categorized into three different stages : mild , moderate , and severe ad ; there is also a stage known as mild cognitive impairment ( mci ) or predementia , that characterizes a population of elderly subjects who are not compromised in their daily living , but have a subclinical and isolated cognitive deficit and are potentially at risk of developing alzheimer 's disease [ 46 ] . \n mci may develop into mild ad and next moderate ad ; in those stages , cognitive deficits become more severe , and the patients become more dependent on caregivers . in the final stage known as severe ad , \n the personality of patients may change dramatically , and patients are entirely dependent on caregivers . diagnosing mci and mild \n alzheimer 's disease is hard , because most symptoms are often dismissed as normal consequences of aging . to diagnose mci or mild ad , extensive testing \n tests include psychological evaluations such as mini - mental state examination ( mmse ) , blood tests , spinal fluid , neurological examination , and imaging techniques [ 8 , 9 ] . \n several research groups have investigated the potential of electroencephalograms ( eegs ) for diagnosing ad in recent years . \n since eeg recording systems are nowadays relatively inexpensive and mobile , eeg may potentially be used in the future as a tool to screen a large population for the risk of ad , before proceeding to any expensive imaging or invasive procedures . to date , however , eeg does not have sufficiently high specificity and sensitivity to assume the role of reliable and reproducible method of screening ad . in recent years \n , several studies have shown that ad has at least three major effects on eeg ( see [ 10 , 11 ] for an in - depth review ) : slowing , reduced complexity , and loss of synchrony . \n however , these effects tend to vary across patients , which makes diagnosis of ad a difficult task . many recent studies are devoted to improving the sensitivity of eeg for diagnosing ad . \n we refer to for a detailed review on various eeg statistics that have been used in this context . in this paper \n however , since low - frequency signals are more regular than signals with high - frequency components , one would expect that slowing and reduced complexity in ad eeg are strongly related to each other . \n nevertheless no study so far has analyzed the relation between both phenomena on a statistical basis though . in order to investigate the slowing effect in ad eeg , we compute relative power in the standard eeg frequency bands ( see table 1 ) . \n when relative power is larger than usual in low - frequency bands ( delta and/or theta ) , it is said that the eeg is slower and that eeg slowing occurs . \n we quantify the irregularity of eeg by a standard measure , that is , lempel - ziv complexity ( see table 1 ) . \n we also apply several lossless compression algorithms to the eeg , and we use the resulting compression ratios ( reduction in data size after compression ) as regularity measures ( see table 1 ) . \n regular signals are more compressible than irregular signals , and therefore , they result in larger compression ratios ; as a consequence , compression ratios are a measure of the regularity of signals . \n we consider two eeg datasets : ( 1 ) eeg of predementia patients ( a.k.a . \n mild cognitive impairment ; mci ) and control subjects ; ( 2 ) eeg of mild ad patients and control subjects . \n the two datasets are from different patients , different hospitals and obtained through different recording systems . \n we will show that the theta band ( ) relative power is significantly larger in both groups of patients compared to age - matched control subjects and that the lossless compression ratios are significantly larger in miad patients than in the age - matched control subjects ; however , no significant perturbation of lempel - ziv complexity and the lossless compression ratios is observed for the mci patients . \n interestingly , our numerical analysis will reveal strong correlation between theta relative power on the one hand and lempel - ziv complexity and the lossless compression ratios on the other hand ; in other words , the effects of slowing and loss of complexity in ad eeg seem to be significantly coupled , at least in the two eeg datasets at hand . \n , we describe the lempel - ziv complexity measure and the lossless compression schemes used in this study . in section 4 \n we discuss the two eeg datasets , and in section 5 we present our results . \n readers who are not interested in the technical and mathematical details of our data analysis may skip sections 2 and 3 and may directly proceed to section 4 . \n the eeg spectrum is commonly divided in specific frequency bands : 0.54 hz ( delta ) , 48 hz ( theta ) , 810 hz ( alpha 1 ) , 1012 hz ( alpha 2 ) , 1230 hz ( beta ) , and 30100 hz ( gamma ) . \n ( see and references therein ) , corresponding to an increase of power in low - frequency bands ( delta and theta band , 0.58 hz ) and a decrease of power in higher - frequency bands ( alpha and beta , 830 hz ) . \n the eeg spectrum can be computed by means of the discrete fourier transform ( dft ) of the eeg . \n the dft x(fn ) of the sequence x is usually computed at multiples fn of ft = 1/t , where t refers to the length of the signal . for computational convenience , \n the length of the sequence x is often extended to the nearest power of two by zero padding . as in , \n let us consider an example with t = 20 s and the sampling frequency 200 hz , then dft is computed at 0 hz , 0.05 hz , 0.1 hz, \n ,200 hz . the nyquist theorem states that only one half the spectrum is of interest , while the other half is the mirror image of the first half ; hence for the above example , it is enough to retain the dft values at 0 hz , 0.05 hz , 0.1 hz, \n ,100 hz . the dft values x(fn ) are complex , and we are mostly interested in their absolute magnitude |x(f)| . \n the relative power of a frequency band is computed by summing |x(fn)| over the frequencies fn in that band and next by dividing the resulting intraband sum by the sum of |x(f)| over all dft frequencies fn . \n a variety of complexity measures have been used to quantify eeg complexity , stemming from several areas ranging from statistical physics to information theory . \n earlier studies have reported that the eeg of mci and ad patients seems to be more regular ( i.e. , less complex ) than in age - matched control subjects . \n it is conjectured that due to mci / ad - induced loss of neurons and perturbed anatomical and/or functional coupling , fewer neurons interact with each other , and the neural activity patterns and dynamics become simpler and more predictable . \n as mentioned earlier , we quantify eeg complexity by a standard measure , that is , lempel - ziv complexity . \n in addition , we use lossless compression ratios as regularity measures . in the following , \n we describe lempel - ziv complexity , and next we elaborate on lossless compression and its use as measure for regularity . \n the lempel - ziv complexity measure ( lz complexity ) computes the number of different patterns present in a sequence of symbols ; if the number of different patterns is large , the sequence is complex and hence difficult to compress . \n lz complexity is obtained by dividing the number of different patterns by the maximum complexity of a sequence of length n. for more details we refer to . to compute lz complexity , \n the time series is first reduced to a symbol list . for the sake of simplicity , \n we convert the eeg signals into binary sequences s = s(1 ) , s(2 ) , , s(n ) , where s(i ) = 0 if x(i ) < td and s(i ) = 1 otherwise ; that approach was also followed in . \n the threshold td is chosen as the median of x , since the latter is robust to outliers . in this section , \n we briefly explain the lossless compression algorithms applied in this study ( see figure 2 ) ; we will consider three different algorithms , which were all proposed in [ 14 , 15 ] . \n the aim of compression is to reduce the size of a given data source ( e.g. , eeg data ) . in lossless compression \n ( e.g. , zip compression algorithm ) , no information in the original data source is lost after compression , in contrast to lossy compression , where the original can only approximately be constructed after compression ( e.g. , jpeg compression algorithm for images ) . \n biomedical signals such as eeg often have a decaying spectrum : the energy is mostly concentrated at low frequencies , and it decays with increasing frequency . \n therefore , the spectral components are close to zero at high frequencies ; the same holds for coefficients in the time - frequency representation corresponding to high frequencies . to exploit this phenomenon , compression algorithms often subject the given data source to a transform ( e.g. , time - frequency transform ) , which results in an alternative representation of the data . \n the three algorithms used in this study all map the signals into another domain , that is , time - frequency domain ; the sparseness of the time - frequency representation is then exploited to form a compact code . \n first the eeg signal is preprocessed , that is , the dc component ( average value of eeg signal ) is removed by applying backward difference ; the resulting zero - mean signal is then arranged as a 1d vector ( see figure 2(a ) ; algorithm a ) or 2d matrix ( see figures 2(b ) and 2(c ) ; algorithms b and c ) . the resulting structure is then decomposed into different frequency bands via integer lifting wavelet transform , which maps the signals to integers on several time scales ; at last , a set partitioning coding scheme converts the ( integer ) wavelet coefficients into a compact representation . in the following sections we describe those different steps in more detail , \n and then we elaborate on the differences between the three algorithms ( algorithms a , b , and c ) . \n first the eeg signal x is preprocessed , that is , the dc component ( average value of eeg signal ) is removed ; this is performed via backward difference operation \n\t\t\t\t\t\t\t\t\t\t ( 1)x(n)=x(n)x(n1 ) , \n\t\t\t\t\t\t\t\t\t where x(n ) is the signal obtained by applying the backward difference . \n next the eeg is arranged as a vector of size n ( 1d compression ) or as a matrix of size n n ( 2d compression ) ; the latter matrix is filled starting at the top left - hand side , from left to right on the odd rows , and from right to left on the even rows . in matrices , \n each entry has 8 nearest neighbors ( except for entries in the first / last row / column ) , compared to two nearest neighbors in vectors ( except for first and last entries ) . in the present application , neighboring entries are adjacent eeg samples , which are highly correlated . by leveraging on the additional nearest neighbors ( 8 instead of 2 ) , 2d compression often yields better compression ratios than 1d compression . \n a wavelet transform decomposes a given signal into different frequency bands ; it allows to represent the signal in multiple resolutions ( coarse to fine ) . \n wavelets are usually realized by a set of filters , operating in parallel ( filter banks ) . \n an alternative method of realizing wavelets is a lifting scheme , which consists of a cascade of simple filters ; it may be viewed as the factorization of a filter bank into elementary filters . \n one such simple filter is depicted in figures 1(a ) and 1(b ) ) . \n the former shows the forward lifting transformation ; the signal x is first split into odd and even phases xo and xe , respectively , containing the odd and even samples , respectively , of input signal x. the odd and even phases contain adjacent samples ; in natural signals such as eeg , adjacent samples are highly correlated . \n therefore , the odd phase may be predicted from the even phase ( and vice versa ) . by subtracting the prediction x^o \n = p(xe ) from the odd phase , we are left with a high - frequency residue signal ( hf ) of the odd phase . \n the latter is used in another lifting step , to predict the even phase xe ( update u ) ; the resulting prediction is subtracted from the even phase xe , which leaves the low - frequency component ( lf ) of the even phase xe ; this also ensures the complete frequency separation between an lf and hf component . \n the forward transform of figure 1(a ) is easily invertible by reversing the steps and flipping the signs ( see figure 1(b ) ) . \n we implement the prediction p and update u by means of the widely used biorthogonal 5/3 filter , as we did in our previous study on eeg compression . in a lifting scheme \n , the pair of lifting steps , that is , prediction p and update u , is repeated several times , leading to multiscale representation of the input signal x ( wavelet ) ; the nature and number of lifting steps p and u depend on the type of wavelets . \n integer wavelet transforms can easily be realized by systematic rounding and truncation of the intermediate results , that is , output of p and u . \n the lifting wavelet transform provides a sparse , multiresolution representation , that is well suited for effective compression ( e.g. , by means of spiht , to be explained in next section ) ; integer lifting in particular enables convenient and simple implementations of lossless compression . as the last step in the process , the wavelet - transformed signals are compressed . \n we use a widely known wavelet - based compression scheme , that is , set partitioning in hierarchical trees ( spiht ) . \n the underlying idea is set partitioning : sets of samples are recursively split , guided by a series of threshold tests . \n this approach is particularly well suited for wavelet - transformed data , as wavelet coefficients are naturally clustered . in spiht \n the sample sets are non - overlapping , and they are organized by means of a tree each set is rooted in a subset of low - frequency coefficients , and branches successively to subsets of high - frequency coefficients in the same orientation ( see figure 3 ) . \n the search for coefficients associated with a particular threshold usually starts at the root node and proceeds successively towards the leaves of the tree , until all significant coefficients are listed . \n such tree - based search , starting at coarse resolution at the root and ending with the finest resolution at the leaves , results in output signals of increasing quality and resolution . \n the integer wavelet transform , in conjunction with spiht , yields a quality and resolution scalable bitstream : the quality and resolution of the signal improve as bitstream progresses . \n moreover , the output bitstream is embedded : the bitstream can be truncated at any point to approximately reconstruct the signal . \n though this coding scheme is specifically developed for images , it can be applied to all data sources with decaying spectrum . \n the three compression algorithms are depicted in figure 2 : ( 1 ) 1d spiht compression , where the eeg is arranged as a vector ( figure 2(a ) ) , ( 2 ) 2d spiht compression , where the eeg is arranged as a matrix ( figure 2(b ) ) , and ( 3 ) 2d spiht compression ( at optimal rate ro ) , followed by arithmetic coding for the residuals ( figure 2(c ) ) . in the 1d spiht compression scheme , \n the 2d spiht compression scheme arranges the eeg as a matrix instead of a vector . in the two - stage 2d spiht compression scheme , \n arithmetic coding is applied to the residuals of 2d spiht compression : first spiht encodes the wavelet coefficients till the source loses its memory and behaves as independent and identically distributed ( corresponding to the optimal bit - rate ro ) ; next the residuals are encoded by means of single - context arithmetic coding . \n the first eeg data set has been analyzed in previous studies concerning early diagnosis of ad [ 2327 ] . \n ag / agcl electrodes ( disks of diameter 8 mm ) were placed on 21 sites according to 1020 international system , with the reference electrode on the right earlobe . \n eeg was recorded with biotop 6r12 ( nec san - ei , tokyo , japan ) at a sampling rate of 200 hz , with analog bandpass filtering in the frequency range 0.5250 hz and online digital bandpass filtering between 4 and 30 hz , using a third - order butterworth filter . \n we used a common reference for the data analysis ( right earlobe ) and did not consider other reference schemes ( e.g. , average or bipolar references ) . \n these subjects were diagnosed as suffering from mild cognitive impairment ( mci ) when the eeg recordings were carried out . \n the criteria for inclusion into the mci group were a mini - mental state exam ( mmse ) score = 24 , though the average score in the mci group was 26 ( sd of 1.8 ) . \n the other group is a control set consisting of 56 age - matched , healthy subjects who had no memory or other cognitive impairments . \n the ages of the two groups are 71.9 10.2 and 71.7 8.3 , respectively . \n finally , it should be noted that the mmse scores of the mci subjects studied here are quite high compared to a number of other studies . \n for example , in the inclusion criterion was mmse = 20 , with a mean value of 23.7 , while in , the criterion was mmse = 22 ( the mean value was not provided ) ; thus , the disparity in cognitive ability between the mci and control subjects is comparatively small , making the classification task relatively difficult . \n the second eeg data set also has been analyzed in previous studies [ 30 , 31 ] ; these data were obtained using a strict protocol from derriford hospital , plymouth , uk , and had been collected using normal hospital practices . \n eegs were recorded during a resting period with various states : awake , drowsy , alert , and resting states with eyes closed and open . \n all recording sessions and experiments proceeded after obtaining the informed consent of the subjects or the caregivers and were approved by local institutional ethics committees . \n eeg dataset is composed of 24 healthy control subjects ( age : 69.4 11.5 years old ; 10 males ) and 17 patients with mild ad ( age : 77.6 10.0 years old ; 9 males ) . \n the patient group underwent full battery of cognitive tests ( mini - mental state examination , rey auditory verbal learning test , benton visual retention test , and memory recall tests ) . \n the eeg time series were recorded using 19 electrodes positioned according to maudsley system , similar to the 1020 international system , at a sampling frequency of 128 hz . \n eegs were bandpass filtered with digital third - order butterworth filter ( forward and reverse filtering ) between 0.5 and 30 hz . in both datasets , \n all recording sessions were conducted with the subjects in an awake but resting state with eyes closed , and the length of the eeg recording was about 5 minutes , for each subject . \n indeed , eeg recordings are prone to a variety of artifacts , for example , due to electronic smog , head movements , and muscular activity . for each patient , an eeg expert selected one segment of 20 s artifact - free eeg by visual inspection , blinded from the results of the present study . only those subjects were retained in the analysis whose eeg recordings contained at least 20 s of artifact - free data . \n based on this requirement , the number of subjects of eeg dataset 1 was further reduced to 22 mci patients and 38 control subjects ; in eeg dataset 2 no such reduction was required . from each subject in the two datasets , one artifact - free eeg segment of 20 s was analyzed . \n we compute relative power , compression ratios , and lz complexity for the eeg signals of all subjects . \n more specifically , we calculate those measures for all individual eeg channels , and then the measures are averaged over all channels ; this results in average measures for all subjects . \n our results are summarized in tables 2 and 3 and figures 6 and 7 . in the analysis \n we also include two measures of eeg synchrony : stochastic event synchrony ( ) [ 32 , 33 ] and a granger causality measure , that is , full frequency directed transfer function ( ffdtf ) ; in an earlier hat study we observed that those two measures indicated statistically significant differences between mci / miad and age - matched control subjects , for the datasets described in section 4 [ 26 , 27 , 30 , 31 ] . since the two datasets ( mci and miad ) were obtained through different recording systems and at different hospitals , a direct comparison of the results obtained from mci with those from mild ad is not straightforward . in table 2 \n we list statistics of the average measures , including the average computed across the entire subject groups and the standard deviation . \n we apply the mann - whitney test for the average measures between mci and the reference subjects ( dataset 1 ) and miad and reference subjects ( dataset 2 ) . \n the mann - whitney test allows us to investigate whether the statistics at hand ( eeg measures ) take different values between two subject populations . \n we adopt bonferroni postcorrection and multiply the p values by the number of tests ( 11 ) . in table 2 \n theta relative power is significantly larger in mci patients compared to reference subjects , whereas beta power is significantly smaller . in the miad patients the perturbations on eeg relative power are stronger : \n delta and theta relative power is significantly larger than in the reference subjects , whereas alpha and beta power is significantly smaller . in other words , slowing occurs in both the mci and miad patients , which is in agreement with earlier studies ( see for a review ) . \n the slowing effect can also readily be seen from the ( normalized ) eeg spectra , shown in figures 4 and 5 for datasets 1 and 2 , respectively . \n the effect of slowing in the miad subjects is very clear from figure 5 : power is obviously more concentrated in theta band in miad patients than in the age - matched control subjects . for \n the mci patients ( see figure 4 ) , no such clear effect can be observed from the spectra ; this is no surprise , since mci is a less severe disease state than miad . \n however , one may notice a slight increase ( decrease ) in theta ( beta ) relative power in mci patients . in both the mci patients and control subjects , power is concentrated in low - frequency bands ( delta and theta band ) and in high - frequency band ( beta band ) ; high - frequency power ( beta band ) is much smaller in the miad patients . in summary , as in earlier studies ( see for a review ) , we observe slowing in mci and miad eeg . \n no significant effect on the complexity and regularity measures can be observed in mci patients . on the other hand , \n the regularity measures and complexity measures are significantly larger and smaller , respectively , for miad patients than for control subject ; in other words , the eeg signals of miad patients are significantly less complex than in healthy subjects . \n this observation is in agreement with several earlier studies ( see for a review ) . \n we also try to classify patients versus control subjects by means of the most discriminative eeg measures ( p < .05 ) . \n table 3 shows the resulting classification performance with linear and quadratic discriminant analysis and support vector machine , determined through leaving - one - out cross - validation . \n we can see that theta band relative power yields good performance when used separately and results in even better performance when combined with the most discriminative lossless compression ratio and synchrony measure . \n the other relative power measures are less discriminative , for both datasets ( not shown here ) ; this observation is in agreement with the p values listed in table 3 . the compression ratios and lz complexity fail to discriminate mci patients from control subjects ( not shown here ) . however , those measures yield good classification performance for the miad patients . \n interestingly , the lossless compression ratios result in better classification rates than lz complexity ; this may be explained as follows : lz complexity is based on binary approximations of the continuous eeg signals , whereas the former are derived from accurate representations of the eeg , associated with lossless compression . in order to gain more insight in the relationship between the different measures , \n the correlation coefficient among each pair of measures is calculated as follows : \n\t\t\t\t\t\t ( 2)rij=1nsubjectk=1nsubjectmi(k)miimj(k)mjj , \n where mi(k ) and mj(k ) the average value of eeg measure i and j , respectively , for subject k , the sum is computed over all subjects , and mi , mj , i , and j are the mean and standard deviation of mi and mj , respectively . \n the resulting correlation coefficients are displayed in figure 6 , for dataset 1 and dataset 2 separately . \n we also conduct the pearson correlation test , to verify whether the correlations or anticorrelations are statistically significant . \n again we adopt bonferroni postcorrection and multiply the p values by the number of tests ( 55 ) . \n as expected , the compression measures are significantly mutually correlated as all the schemes are based on the same principle ; they are also significantly anticorrelated with lz complexity in the miad dataset ( dataset 2 ) . \n interestingly , the compression ratios are significantly correlated with low - frequency relative power ( delta and theta ; miad ) and anticorrelated with high - frequency relative power ( beta ; both datasets ) . likewise lz complexity is strongly anticorrelated with low - frequency relative power ( delta and theta ; both datasets ) and correlated with high - frequency relative power ( beta ; miad ) . taken together \n , this observation strongly suggests that slowing and loss of complexity in ad eeg are not independent phenomena but are strongly related ; to the best of our knowledge , this observation has not been reported before in the literature . \n perhaps surprisingly , granger causality ( ffdtf ) is significantly correlated with lz complexity and high - frequency relative power ( miad ) and significantly anticorrelated with lossless compression ratios ( miad ) and low - frequency relative power ( both datasets ) . \n we conjecture that the observed statistical ( anti)correlation between ffdtf and the other measures is an artefact of the multivariate model underlying granger causality ( and ffdtf in particular ) . \n more specifically , granger causality is derived from a multivariate autoregressive model ( mvar ) . \n the order of the latter needs to be kept low , since the coefficients of the mvar need to be inferred from a short eeg segment ; high - order mvars contain many coefficients , which can not be reliably inferred from the limited amount of data . \n low - order mvars have short memory and can not capture low - frequency components in the eeg . \n consequently granger causality may underestimate the correlation among brain signals when the eeg contains strong low - frequency components . \n stochastic event synchrony ( ) [ 32 , 33 ] seems to be uncorrelated with the other measures ( both datasets ) , and therefore , it may provide complementary information . \n in this study , we investigated the use of relative power , lz complexity , and lossless compression ratio as eeg markers for mci and mild ad . \n lossless compression ratio is shown to be discriminative for mild ad , whereas it is not discriminative for mci . \n on the other hand , theta band relative power was observed to be statistically larger in mci and mild ad patients than in control subjects . \n maximum discrimination is obtained by combining the compression ratio , relative power , and synchrony measures ( granger causality and/or stochastic event synchrony ) . \n we would like to reiterate , however , that the two datasets analyzed ( mci and miad ) were obtained through different recording systems and at different hospitals ; a direct comparison of the results obtained from mci with those from mild ad is therefore difficult . on the other hand , \n since the datasets are independent , our observations are probably not dependent on particularities of the recording systems and/or procedures at the hospitals . \n interestingly , compression ratios were found to be significantly correlated to delta and theta band relative power , showing their strong correlation with relative power at low frequencies ; also strong anti - correlation between compression ratios and beta relative power was observed . \n therefore , slowing and loss of complexity in the eeg of mci and miad patients may be strongly related phenomena . \n more generally , this study also underlines the importance of analyzing mci and ad eeg by means of a variety of statistical measures ( relative power , complexity / regularity measures , synchrony measures ) , in order to detect potential correlations between various observed phenomena associated with mci and ad .", "role": "user" }, { "content": "medical studies have shown that eeg of \n alzheimer 's disease ( ad ) patients is slower \n ( i.e. , contains \n more low - frequency power ) and is less complex compared to \n age - matched healthy subjects . \n the relation between those two \n phenomena has not yet been studied , and they are often silently \n assumed to be independent . in this paper \n , it is shown that \n both phenomena are strongly related . \n strong correlation between \n slowing and loss of complexity is observed in two independent \n eeg datasets : ( 1 ) eeg of predementia patients ( a.k.a . \n mild \n cognitive impairment ; mci ) and control subjects ; ( 2 ) eeg of \n mild ad patients and control subjects . \n the two data sets are \n from different patients , different hospitals and obtained through \n different recording systems . \n the paper also investigates the potential of eeg slowing and \n loss of eeg complexity as indicators of ad onset . \n in particular , \n relative power and complexity measures are used as features to \n classify the mci and miad patients versus age - matched control \n subjects . when combined with two synchrony measures ( granger causality and stochastic event \n synchrony ) , classification rates of 83% ( mci ) and \n 98% ( miad ) \n are obtained . by including the compression ratios as features , \n slightly better classification rates \n are obtained than with relative \n power and synchrony measures alone .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: success of root canal treatment relies on the proper removal of pulpal remnant , bacteria and their byproducts from the root canal system . \n irrigation of the root canal system is one of the essential steps for the elimination of the bacteria and their byproducts effectively . \n therefore , ideal irrigation solution has to be a proper antibacterial and tissue dissolving effect on the necrotic pulp remnant and minimum toxic effect on the periapical tissue . \n sodium hypochlorite ( naocl ) has been used for root canal irrigation for a long time because of its good antibacterial and tissue dissolving effects . \n chlorhexidine gluconate ( chx ) has been suggested as an irrigation solution due to it has antimicrobial effect and binding on soft tissue and hydroxyapatite crystal . \n however , the main disadvantage of chx is the lack of organic tissue dissolution capabilities . \n hence , different materials had been experimented alternatively to naocl and chx as irrigation solutions . \n origanum minutiflorum is a plant and widespread in the eastern mediterranean region and southwestern of anatolia especially in isparta , turkey . \n its extract especially its oil and solution has an antimicrobial effect to a lot of microorganisms . \n dadalioglu and evrendilek have reported that o. minutiflorum oil has an antimicrobial effect to escherichia coli , listeria monocytogenes , salmonella typhimurium and staphylococcus aureus and simalary . \n baydar et al . has found 1% and 2% origanum oil has an antimicrobial effect on enterococcus faecalis ( e. faecalis ) . \n ok tried origanum extract solution ( oes ) , which is mainly rich in carvacrol and thymol , and concluded that oes has an antibacterial effect against e. faecalis within the root canals alternative to naocl and chx . \n he also reported that oes has dissolving effect on the organic compound of smear layer . \n the aim of this in vitro study was to evaluate and compare the cytotoxicity of 0.54.5% oes with 5.25% naocl and 2% chx using wst-1 test on human periodontal ligament ( hpdl ) fibroblasts . \n origanum minutiflorum plant materials were dried in drying cupboard at 35c , then they distillated in clevenger apparatus for 3 h and origanum oil was obtained . \n oes , which 0.5% , 1% , 1.5% , 2% , 2.5% , 3% , 3.5% , 4% , 4.5% concentration , was obtained from mixing 100 ml distilled water and 0.5% , 1% , 1.5% , 2% , 2.5% , 3% , 3.5% , 4% , 4.5% origanum oil respectively . \n gas chromatography ( gc ) analysis of the essential oil was performed using a perkin elmer autosystem gc - type ( perkin elmer auto system xl , ma , usa ) chromatograph . \n experimental groups in the present study were composed of different concentrations ( 0.54.5% ) of oes , 2% chx ( drogsan , ankara , turkiye ) , 5.25% naocl ( wizard , ankara , turkiye ) and a control group containing only culture medium . \n chemical composition of the oregano solution ( percentage of total peak area ) cytotoxicity of solutions was evaluated on cultured hpdl fibroblast cells in research laboratory , selcuk university , faculty of dentistry , konya , turkey . \n the cells were grown in 96-well polystyrene plates containing dulbecco 's modified eagle 's medium ( dmem ) ( biological industries , kibbutz beik haemek , israel ) , supplemented with 10% fetal bovine serum ( fbs ) ( biological industries , kibbutz beik haemek , israel ) , 250 g / ml gentamycin sulfate , ( biological industries , kibbutz beik haemek , israel ) , 5 g / ml amphotericin b ( biological industries , kibbutz beik haemek , israel ) , and were incubeted in a humidified atmosphere , 95% air and 5% co2 at 37c for 24 h in water based incubator ( nuaire , fernbrook lane n plymouth , usa ) . \n the cells were seeded in 96-well culture polystyrene plates at a fixed number of 20 10 cells per well . \n then the cells were treated with 0.5% , 1% , 1.5% , 2% , 2.5% , 3% , 3.5% , 4% , 4.5% oes concentrations , 2% chx and 5.25% naocl were placed into 96-well culture polystyrene plates \n . then the cells were incubated for 24 h before applying the wst-1 cell proliferation assay reagent according to the recommendation of the manufacturer . \n viability of hpdl cells was evaluated with wst-1 ( roche , basel , switzerland ) test at 1 , 24 and 72 h. the test was carried out according to the protocol described by babich et al . \n wst-1 ( 4- [ 3-(4-iodophenyl)-2-(4-nitrophenyl)-2h-5-tetrazolio]- 1,3-benzene disulfonate ) test is based on the cleavage of the tetrazolium salt wst-1 ( slightly red ) to formazan ( dark red ) by different mitochondrial dehydrogenase enzymes . \n 18.9 ml dmem with 5% fbs and 2.1 ml wst-1 was mixed , and totally 22 ml solution was prepared . \n after 1 h incubation , 200 l rate of 1:10 wst-1 including 5% fbs dmem added to each well . \n the plates were wrapped with aluminum foil , placed into the incubator for 2 h , and then shaken for 1 min at room temperature . \n the absorbance values were read in optical density at a wavelength of 480 nm by an elisa plate reader spectrophotometer ( quant bio - tek instruments inc . , winooski , usa ) . \n the other plates of the prepared cell culture were held in an incubator and repeated at the end of the 24 and 72 h. the results revealed the percentage of the mean optical density of the treated negative controls , and this was set to show 100% viability . \n the significance of the differences between the means was evaluated using a one - way anova , post - hoc duncan 's multiple range test with sas9.2 ( cary software , north carolina sas institute inc . \n origanum minutiflorum plant materials were dried in drying cupboard at 35c , then they distillated in clevenger apparatus for 3 h and origanum oil was obtained . \n oes , which 0.5% , 1% , 1.5% , 2% , 2.5% , 3% , 3.5% , 4% , 4.5% concentration , was obtained from mixing 100 ml distilled water and 0.5% , 1% , 1.5% , 2% , 2.5% , 3% , 3.5% , 4% , 4.5% origanum oil respectively . \n gas chromatography ( gc ) analysis of the essential oil was performed using a perkin elmer autosystem gc - type ( perkin elmer auto system xl , ma , usa ) chromatograph . \n experimental groups in the present study were composed of different concentrations ( 0.54.5% ) of oes , 2% chx ( drogsan , ankara , turkiye ) , 5.25% naocl ( wizard , ankara , turkiye ) and a control group containing only culture medium . \n cytotoxicity of solutions was evaluated on cultured hpdl fibroblast cells in research laboratory , selcuk university , faculty of dentistry , konya , turkey . \n the cells were grown in 96-well polystyrene plates containing dulbecco 's modified eagle 's medium ( dmem ) ( biological industries , kibbutz beik haemek , israel ) , supplemented with 10% fetal bovine serum ( fbs ) ( biological industries , kibbutz beik haemek , israel ) , 250 g / ml gentamycin sulfate , ( biological industries , kibbutz beik haemek , israel ) , 5 g / ml amphotericin b ( biological industries , kibbutz beik haemek , israel ) , and were incubeted in a humidified atmosphere , 95% air and 5% co2 at 37c for 24 h in water based incubator ( nuaire , fernbrook lane n plymouth , usa ) . \n the cells were seeded in 96-well culture polystyrene plates at a fixed number of 20 10 cells per well . \n then the cells were treated with 0.5% , 1% , 1.5% , 2% , 2.5% , 3% , 3.5% , 4% , 4.5% oes concentrations , 2% chx and 5.25% naocl were placed into 96-well culture polystyrene plates \n . then the cells were incubated for 24 h before applying the wst-1 cell proliferation assay reagent according to the recommendation of the manufacturer . \n viability of hpdl cells was evaluated with wst-1 ( roche , basel , switzerland ) test at 1 , 24 and 72 h. the test was carried out according to the protocol described by babich et al . \n wst-1 ( 4- [ 3-(4-iodophenyl)-2-(4-nitrophenyl)-2h-5-tetrazolio]- 1,3-benzene disulfonate ) test is based on the cleavage of the tetrazolium salt wst-1 ( slightly red ) to formazan ( dark red ) by different mitochondrial dehydrogenase enzymes . \n 18.9 ml dmem with 5% fbs and 2.1 ml wst-1 was mixed , and totally 22 ml solution was prepared . \n after 1 h incubation , 200 l rate of 1:10 wst-1 including 5% fbs dmem added to each well . \n the plates were wrapped with aluminum foil , placed into the incubator for 2 h , and then shaken for 1 min at room temperature . \n the absorbance values were read in optical density at a wavelength of 480 nm by an elisa plate reader spectrophotometer ( quant bio - tek instruments inc . , winooski , usa ) . \n the other plates of the prepared cell culture were held in an incubator and repeated at the end of the 24 and 72 h. the results revealed the percentage of the mean optical density of the treated negative controls , and this was set to show 100% viability . \n the significance of the differences between the means was evaluated using a one - way anova , post - hoc duncan 's multiple range test with sas9.2 ( cary software , north carolina sas institute inc . \n figure 1 shows the effect on cellular viability of 1 h diluted oes concentrations , 2% chx and 5.25% naocl . \n there was a dose - dependent increase in viability of cells that treated with oes . \n 0.5% oes were showed the least cytotoxic effect and oes was more dependable in lower concentrations . \n there was nt found any statistical significance between 1% oes and 2% chx ( p > 0.001 ) . \n 5.25% naocl showed cytotoxic effect , and there were nt found any statistical significance between 5.25% naocl and other ( 1.54.5% ) concentrations of oes ( p > 0.001 ) . \n figure 1 also shows the effect of the cellular viability of 24 and 72 h of irrigation solutions . according to the results at 24 and 72 h , all solutions showed similar cytotoxic effect . \n the inverted microscope analysis showed that numerical reduction and morphological differences have been identified in periodontal ligament cells [ figures 2 and 3 ] . \n the result of wst-1 assay of the human periodontal ligament cells cultured with scaffolds for 1 , 24 and 72 h image of periodontal ligament cells after application of 4% origanum extract solution ( oes ) with an inverted microscope . \n after application of oes , it makes a point out that cell density was decreased . \n ( a ) control group ; human periodontal ligament ( hpdl ) inverted microscope image ( img 10 ) that taken from unapplied oes . \n ( b - e ) hpdl image ( img 10 ) that taken 1 h interval after 4% oes application . \n ( f - i ) hpdl image ( img 10 ) that taken 1 h intervals after 24 h 4% oes application image of periodontal ligament ( pdl ) cells after application of 2% chlorhexidine gluconate ( chx ) with an inverted microscope . \n ( a ) control group ; human periodontal ligament ( hpdl ) inverted microscope image ( img 10 ) that taken from unapplied chx ( b - e ) hpdl image ( img 10 ) that taken 1 h intervals after chx application . \n ( f - i ) hpdl image ( img 10 ) that taken 1 h intervals after 24 h chx application \n a lot of in vitro and in vivo tests have been used to evaluate cytotoxicity of root canal irrigant solutions . \n laboratory studies especially cell culture tests have often been used lately to evaluate cytotoxicity of materials . because these tests are cheap , fast and acceptable . \n cell culture tests are more sensitive than in vivo tests but must be evaluated within the limitations of acute toxicity tests . in this kind of studies , \n permanent cell lines such as hela or 3t3 cells and primary diploid cells or oral fibroblasts are widely used . in our study \n pdl fibroblasts were used . because pdl cells are major cells that involve reaction of endodontic materials in apical tissue and are first cells that may encounter when irrigation solutions extrude to apical tissue . \n cytotoxicity assays have been developed based on different parameters like metabolic activity and dna synthesis associated with cell viability and cell proliferation . \n metabolic activity - based assays measure mitochondrial activity of cultured cells related with energy metabolism of cells and cell growth . \n the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) measures mitochondrial activity of liability cells . with changing metabolic activity of biomaterials \n ( sodium5-(2,4-disulfophenyl)-2-(4-iodophenyl)-3-(4-nitrophenyl)-2h - tetrazoliuminner salt ) works similarly with mtt by reacting with the mitochondrial succinate - tetrazolium reductase forming the formazan dye . \n the wst-1 test can be quantified in 0.54 h without an additional solubilization step ( roche ) . \n test was used to evaluate the effects of different irrigation solutions on the viability of pdl fibroblasts in vitro . \n biocompatibility with its antimicrobial and tissue solvent effect should be considered while choosing an irrigation solution . \n chemical injury occurs when periapical tissue exposed to irrigation solution that is not biocompatible , and also the tissue reaction to the root canal irrigation solution is influenced by type , volume and concentration of the irrigant . \n naocl has been widely recommended in root canal irrigation for a long time because of its necrotic and vital tissue solvent capacity and its antimicrobial activity . \n it has been stated that its antimicrobial effect and cytotoxic effect increases with its concentration . \n evaluated the toxic effect of 0.5% , 2.5% and 5.25% naocl solutions cytotoxicity at 2 h , 2 days and 2 weeks and indicated that 5.25% naocl cause destructive reactions when it introduced to the root apex . \n evaluated 5.25% naocl , cetrimide ( cetrexidine ; vebas , san giuliano , milan , italy ) and 2% chx solutions cytotoxicity and found that 5.25% naocl had more cytotoxic effect than cetrexidine , chx and control groups . in their study , in the 5.25% naocl group , they found no statistical significant difference between the 3-time periods ( 2 h , 48 h , and 2 weeks ) . \n there was no statistical significant difference between the 3-time periods ( 1 h , 24 h , and 72 h ) in naocl groups . \n also evaluated chx and found moderate inflammation after 2 days and reported that the formation of foreign body granuloma 2 weeks later . \n tatnall et al . evaluated naocl , h2o2 , and chx to fibroblast cells and they found all solutions showed cytotoxic effect but chx showed the least cytotoxic effect . \n 1 h results of the present study revealed that chx showed less cytotoxic effect than 5.25% naocl and 1.54.5% oes ( p < 0,001 ) , and there were not found any statistically significance between 2% chx and 1% oes ( p > 0,001 ) . at 24 and 72 \n h cytotoxicity evaluation , there were no statistical significance between irrigation solutions ( p > 0,001 ) , and all solutions showed cytotoxic effect . \n the present study showed that the cytotoxicity of the solutions depends on the concentrations used . \n 1% oes and 2% chx showed similar results and showed less cytotoxic effect than 5.25% naocl . \n it can be considered as a favorable solution concentration when oes was used as irrigation solution .", "role": "user" }, { "content": "objective : the purpose of this in vitro study was to compare the cytotoxicity of 0.54.5 origanum extract solution ( oes ) , 2% chlorhexidine gluconate ( chx ) and 5.25% sodium hypochlorite ( naocl ) with wst-1 test on human periodontal ligament ( hpdl ) fibroblasts.materials and methods : about 0.54.5% oes , 2% chx and 5.25% naocl solutions cytotoxicity was evaluated with cell culture test using pdl fibroblasts . \n viability of hpdl cells was evaluated with wst-1 ( cell proliferation reagent wst-1 roche ) test at 1 , 24 and 72nd h. hpdl cells were plated at 20 103 cells per well in 96-well plates . \n absorbance values were read in optical density 480 nm by elisa plate reader spectrophotometer . the statistical differences between various groups \n were evaluated using one - way anova , post - hoc duncan 's multiple range test using sas software . \n statistically , a significant difference was considered at p < 0.001.results:according to the 1-h cytotoxicity results , 0.5% oes showed the least cytotoxic effect in test groups . there were not found any statistical significance between 1% oes and 2% chx . \n about 5.25% naocl showed more cytotoxic effect than 1% oes and 2% chx . in 24 and 72 h , different concentrations of oes , 5.25% naocl , 2% chx solutions showed similar cytotoxic effect.conclusions:based on these results , 1% oes and 2% chx showed similar results and less cytotoxic effect than 5.25% naocl . \n it could be considered as a favorable solution concentration when oes was used as root canal irrigation solution .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the recent international agency for research on cancer ( iarc ) monograph on asbestos suggests that familial mesothelioma is a rather rare event \n we describe a couple of brothers with pleural mesothelioma . both the patients had histories of severe occupational exposure to asbestos . \n a 45-year - old man was admitted to a hospital in central italy in august 2000 for right pleural effusion . \n three - months later , a diagnosis of malignant mesothelioma , epithelial type , was made on the basis of multiple pleural biopsies obtained at right thoracotomy . \n the patient died in june 2003 . in the period 1974 - 1981 , the patient had intermittently worked as an insulator at a sodium carbonate factory for a total of about 3 years . \n moreover , in the period 1977 - 1986 , he was intermittently employed in various sugar refineries for a total of nearly 3 years . \n a 56-year - old man , the brother of the case 1 , was admitted to a hospital in northern italy in march 2006 . a thoracic computed tomography ( ct ) showed two nodules adjacent to pleura in the right lung . \n one year previously the patient had been treated with oral anticoagulants for pulmonary thromboembolism . at the right videothoracoscopy , \n multiple neoplastic pleural nodules were visible , associated with hyaline pleural plaques . at the histological examination , malignant mesothelioma , epithelial type , \n the patient had worked as an insulator for some 20 years ( 1967 - 1986 ) . \n his work took place in thermoelectric plants and chemical industries in italy as well as in foreign countries ( algeria , libya , saudi arabia ) . \n their parents came from a town of sicily ; some degree of blood relationship existed between the parents , they being second cousins . \n a 45-year - old man was admitted to a hospital in central italy in august 2000 for right pleural effusion . \n three - months later , a diagnosis of malignant mesothelioma , epithelial type , was made on the basis of multiple pleural biopsies obtained at right thoracotomy . \n the patient died in june 2003 . in the period 1974 - 1981 , the patient had intermittently worked as an insulator at a sodium carbonate factory for a total of about 3 years . \n moreover , in the period 1977 - 1986 , he was intermittently employed in various sugar refineries for a total of nearly 3 years . \n a 56-year - old man , the brother of the case 1 , was admitted to a hospital in northern italy in march 2006 . a thoracic computed tomography ( ct ) showed two nodules adjacent to pleura in the right lung . \n one year previously the patient had been treated with oral anticoagulants for pulmonary thromboembolism . at the right videothoracoscopy , \n multiple neoplastic pleural nodules were visible , associated with hyaline pleural plaques . at the histological examination , malignant mesothelioma , epithelial type , \n the patient had worked as an insulator for some 20 years ( 1967 - 1986 ) . \n his work took place in thermoelectric plants and chemical industries in italy as well as in foreign countries ( algeria , libya , saudi arabia ) . \n their parents came from a town of sicily ; some degree of blood relationship existed between the parents , they being second cousins . \n the exposure was different in duration ( about 6 years in the case 1 and 20 years in the case 2 ) . \n latency periods also differed markedly , being unexpectedly short in the case 1 ( 26 years ) and longer in the case 2 ( 38 years ) . in the case 2 , the pulmonary thomboembolism presented by the patient in 2005 may be considered as the first manifestation of the tumor , given the low frequency of thromboembolism in the general population and the high incidence in mesotheliomas . \n there is no doubt that the two cases have to be considered as induced by asbestos . \n nevertheless , the fact that only a relatively low percentage of people exposed to asbestos develop mesothelioma indicates that cofactors play a role in the genesis of asbestos - related mesothelioma . \n mesotheliomas arising in blood - related people suggest a genetic predisposition to develop this rare malignancy . \n it is difficult to form an idea about the frequency of such an occurrence . in a large majority of the familial mesotheliomas reported in the literature \n , there is no reference to a denominator . in two studies conducted in italy a denominator \n is reported , with different findings . in a series of 610 pleural mesotheliomas examined in the trieste - monfalcone area , italy \n , the percentage of familial cases with blood relationship reached the value of 3.8% . a percentage \n somewhat lower , 22 cases in a series of 1,954 pleural mesotheliomas , was observed by examining the data collected by three italian mesothelioma registries . \n recently , de klerk et al . , have investigated the familial aggregation of malignant mesothelioma in former workers and residents of wittenoom , western australia . \n the researchers observed 369 family groups with at least one mesothelioma case and 25 cases of mesothelioma among relatives in the same families . \n after the authors , these findings suggest an important , but not large , genetic component in mesothelioma . in a study regarding 1,403 people hired at the shipyards of monfalcone in the period 1950 - 59 , 35 cases of mesothelioma were observed . \n of the 33 men with pleural mesothelioma in this group , four had a blood relative with the same tumor . \n on the whole , the aforementioned data show that the occurrence of more mesothelioma cases among blood - related persons is not rare . \n such occurrence may indicate a genetic predisposition to develop mesothelioma , even if asbestos exposure remains the principal cause .", "role": "user" }, { "content": "malignant mesotheliomas of the pleura , epithelial type , were observed in two brothers . \n both the patients had histories of severe exposure to asbestos , having worked as insulators . \n the latency periods in the two cases were 26 and 38 years , respectively . \n available literature data suggest that mesothelioma occurrence among blood - related people is favored by a genetic predisposition .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: degenerative stenosis of the aortic valve ( as ) is the most prevalent adult valvular heart disease in developed countries . \n the progressive lv pressure overload induced by as is responsible for a complex process of myocardial remodeling with mechanostructural , geometric , hemodynamic , metabolic , and electrophysiological manifestations . \n lv hypertrophy secondary to pressure overload , although long considered beneficial for its mechanical effects of normalization of wall stress and , presumably , systolic function , has been progressively unmasked as an ominous prognostic predictor of death , poor clinical status , decreased lv function , and heart failure . \n moreover , in patients with pure severe as , hypertrophy independently predicts lv systolic dysfunction and heart failure regardless of the degree of flow restriction imposed by the valve pathology . \n surgical aortic valve replacement ( avr ) is the only therapy that provides a survival benefit for these patients and , at present , no medical therapy can consistently delay the inevitability of surgery . \n regression of lv hypertrophy in hypertensive patients under pharmacologic treatment has been proven to have a beneficial independent prognostic value for the risk of subsequent major cardiovascular events , irrespective of the type of drug and the blood pressure . in as patients , the consistent relationship between quantitative lv mass change and longterm rates of morbid events after aortic valve replacement remains to be determined . \n however , in line with the preoperative epidemiological evidence , a lack of reverse remodeling after valve replacement in patients with as has been identified as one of the postoperative threats to a positive longterm outcome for these patients , and it also results in both decreased short and longterm survival and poorer clinical status . \n preoperative monitoring of a variable that is able to predict the potential for regression of the myocardial hypertrophy could help both in the timing of the valve replacement surgery and in the improvement of postoperative outcomes . \n micrornas ( mirnas ) are single stranded , short length ( 21 to 23 nucleotides ) , noncoding rnas that act as negative posttranscriptional modulators of target mrnas . \n mirnas play a major regulatory role in a myriad of mechanisms in developmental biology , physiology , and pathology of almost every organ including the cardiovascular system . \n one further characteristic of mirnas that make them particularly attractive in clinical medicine is their presence in human body fluids incorporated in microvesicles and protein mirna complexes . \n circulating mirnas display a marked stability and can be detected with high sensitivity and specificity in plasma and serum . \n these characteristics raise novel questions concerning the potential merits of circulating mirnas as bedside biomarkers for therapeutic stratification and for diagnostic or prognostic purposes . \n mir133a is a musclespecific mirna that , in the heart , is exclusively expressed by cardiomyocytes . \n several studies have reported that downregulation of mir133a promotes rodent and human cardiomyocyte hypertrophy and that , conversely , the forced expression of mir133a promotes cardiac hypotrophy in transgenic mice and inhibits agonistinduced hypertrophy in cultured cardiac myocytes . \n targets of mir133a , which may be responsible for its antihypertrophic effect , include wolfhirschhorn syndrome candidate 2/negative elongation factor a ( whsc2/nelfa ) , inositol 1,4,5triphosphate receptor ii ( ip3rii ) , calcineurin , serum response factor ( srf ) , ras homologue gene family member a ( rhoa ) , cell division control protein 42 ( cdc42 ) , and nuclear factor of activated t cells calcineurindependent 4 ( nfatc4 ) . in patients with pure severe as \n , we have previously shown that the lv myocardial expression of mir133a at surgery , together with additional remodelingrelated genes and clinical parameters , predicts the amount and completeness of lv reverse remodeling 1 year after avr . \n taking advantage of the presence of this mirna in plasma , we hypothesized that preoperative circulating mir133a level might estimate the potential for postoperative lv mass ( lvm ) absolute loss and/or the normalization of the lvm in as patients , with a predictive power similar to its myocardial expression . \n the involvement of major mir133a targets related with the control of cardiomyocyte trophic state was assessed . \n we prospectively studied 74 consecutive patients ( 42 men and 32 women ) with pure severe as who were undergoing avr surgery in the university hospital marqus de valdecilla in santander , spain . \n demographic and clinical characteristics of the patients and their preoperative pharmacological treatments are shown in table 1 . \n patients with aortic or mitral regurgitation greater than mild , major coronary stenosis > 50% , previous cardiac operations , malignancies , or poor renal or hepatic function were ineligible for the study . \n the study cohort represents the average population of patients with pure aortic stenosis undergoing conventional open surgical treatment in western europe . \n the institutional ethics and clinical research committee of the hospital universitario marqus de valdecilla approved the study , and all patients gave written informed consent . \n clinical characteristics of the patients a 2dimensional transthoracic echocardiogram ( philipshewlett packard , ie 33 ) , together with clinical and blood analytical evaluation , was performed preoperatively and 1 year after surgery . \n internal lv enddiastolic and endsystolic diameters and wall thicknesses were measured according to the american society of echocardiography guidelines , using bidimensional or mmode images depending on the image quality and the angulation between the ultrasound beam and the lv . \n lv mass was estimated according to the devereux formula and indexed to patient height in meters to the 2.7th power . \n the threshold value defining lv hypertrophy was , irrespective of gender , a lvm index ( lvmi ) of 51 g / m . in all patients ( n=74 ) , \n lv subepicardial biopsies ( 4 to 10 mg ) were taken from the lateral wall with a trucut needle during the surgical procedure and snap frozen in liquid nitrogen . to determine the plasma levels of mir133a , a blood sample was drawn 24 hours before surgery from an antecubital vein without tourniquet , using a syringe with a widegauge needle . the specific cardiac contribution to total mir133a \n was assessed using coronary sinus blood samples withdrawn from 29 patients during the insertion of a cannula for retrograde cardioplegia , and prior to the initiation of extracorporeal circulation . \n simultaneously , a right atrial blood sample was also taken to measure the systemic ( including muscular and cardiac contributions ) circulating mir133a . \n blood was harvested into 10 ml edtacontaining tubes and centrifuged at 1389 g for 30 minutes at room temperature within 1 hour after collection . \n total rna , including the small rna fraction , was extracted from myocardial biopsies using trizol reagent ( invitrogen ) . \n reverse transcription was performed using random primers for mrna ( fermentas ) ; tissue mir133a and rnu6b were reverse transcribed with specific primers ( applied biosystems ) . \n realtime pcr was conducted in an mx3000p thermocycler ( stratagene ) using specific taqman assays ( applied biosystems ) . \n we determined the myocardial transcript levels of a number of mir133a target genes ( srf , rhoa , whsc2/nelfa , cdc42 , nfatc4 ) that were previously validated and found to be associated with the pathophysiology of cardiovascular disorders , including myocardial hypertrophy . \n the expression levels of the myocardial genes were normalized to the housekeeping gene 18s ribosomal rna , which was measured in parallel for each sample . \n twentyfive femtomoles of a caenorhabditis elegans oligonucleotide ( celmir39 ) were added to the samples after trizol addition as a spikein control . \n reverse transcription was performed using specific mir133a and celmir39 primers and a taqman microrna transcription kit ( applied biosystems ) . \n plasma mir133a levels were normalized to celmir39 . to ensure that the isolation efficiency was consistent between the samples , the extraction procedure was repeated , if necessary , until the qpcr threshold for celmir39 fell within the range of 23.01.0 cycles . \n graphpad prism 5.01 , pasw statistics 18 ( spss , inc ) and stata 10 ( statacorp lp ) packages were used . \n continuous variables were expressed as the meansd if gaussian and as median ( 25th and 75th iqr ) if nongaussian . \n variables that were not normally distributed were transformed to their natural logarithm . to assess the relationships between myocardial and plasma levels of mir133a , linear regression and pearson 's correlation analyses were performed . \n differences between coronary sinus and peripheral venous mir133a levels within patients were assessed by the wilcoxon test for paired samples . \n a multiple linear regression analysis was used to identify predictors of lvm regression 1 year after avr . \n the variables introduced into the regression equation were assessed for multicollinearity and excluded when appropriate . \n predictors of postoperative lvmi normalization were identified with a forward stepwise logistic regression analysis , and the hosmerlemeshow test was used to evaluate goodness of fit of the model . \n a posthoc assessment of the regression model was performed with the bootstrapping method , with 2000 iterations . the receiver operator characteristic ( roc ) curve \n was calculated to assess the capability of the model to discriminate patients who would normalize lvm 1 year after avr from those who would maintain residual hypertrophy . \n a 2dimensional transthoracic echocardiogram ( philipshewlett packard , ie 33 ) , together with clinical and blood analytical evaluation , was performed preoperatively and 1 year after surgery . \n internal lv enddiastolic and endsystolic diameters and wall thicknesses were measured according to the american society of echocardiography guidelines , using bidimensional or mmode images depending on the image quality and the angulation between the ultrasound beam and the lv . \n lv mass was estimated according to the devereux formula and indexed to patient height in meters to the 2.7th power . \n the threshold value defining lv hypertrophy was , irrespective of gender , a lvm index ( lvmi ) of 51 g / m . \n in all patients ( n=74 ) , lv subepicardial biopsies ( 4 to 10 mg ) were taken from the lateral wall with a trucut needle during the surgical procedure and snap frozen in liquid nitrogen . to determine the plasma levels of mir133a , a blood sample was drawn 24 hours before surgery from an antecubital vein without tourniquet , using a syringe with a widegauge needle . the specific cardiac contribution to total mir133a \n was assessed using coronary sinus blood samples withdrawn from 29 patients during the insertion of a cannula for retrograde cardioplegia , and prior to the initiation of extracorporeal circulation . \n simultaneously , a right atrial blood sample was also taken to measure the systemic ( including muscular and cardiac contributions ) circulating mir133a . \n blood was harvested into 10 ml edtacontaining tubes and centrifuged at 1389 g for 30 minutes at room temperature within 1 hour after collection . \n total rna , including the small rna fraction , was extracted from myocardial biopsies using trizol reagent ( invitrogen ) . \n reverse transcription was performed using random primers for mrna ( fermentas ) ; tissue mir133a and rnu6b were reverse transcribed with specific primers ( applied biosystems ) . \n realtime pcr was conducted in an mx3000p thermocycler ( stratagene ) using specific taqman assays ( applied biosystems ) . \n we determined the myocardial transcript levels of a number of mir133a target genes ( srf , rhoa , whsc2/nelfa , cdc42 , nfatc4 ) that were previously validated and found to be associated with the pathophysiology of cardiovascular disorders , including myocardial hypertrophy . \n the expression levels of the myocardial genes were normalized to the housekeeping gene 18s ribosomal rna , which was measured in parallel for each sample . \n twentyfive femtomoles of a caenorhabditis elegans oligonucleotide ( celmir39 ) were added to the samples after trizol addition as a spikein control . \n reverse transcription was performed using specific mir133a and celmir39 primers and a taqman microrna transcription kit ( applied biosystems ) . \n plasma mir133a levels were normalized to celmir39 . to ensure that the isolation efficiency was consistent between the samples , the extraction procedure was repeated , if necessary , until the qpcr threshold for celmir39 fell within the range of 23.01.0 cycles \n graphpad prism 5.01 , pasw statistics 18 ( spss , inc ) and stata 10 ( statacorp lp ) packages were used . \n continuous variables were expressed as the meansd if gaussian and as median ( 25th and 75th iqr ) if nongaussian . \n variables that were not normally distributed were transformed to their natural logarithm . to assess the relationships between myocardial and plasma levels of mir133a , linear regression and pearson 's correlation analyses were performed . \n differences between coronary sinus and peripheral venous mir133a levels within patients were assessed by the wilcoxon test for paired samples . \n a multiple linear regression analysis was used to identify predictors of lvm regression 1 year after avr . \n the variables introduced into the regression equation were assessed for multicollinearity and excluded when appropriate . \n predictors of postoperative lvmi normalization were identified with a forward stepwise logistic regression analysis , and the hosmerlemeshow test was used to evaluate goodness of fit of the model . \n a posthoc assessment of the regression model was performed with the bootstrapping method , with 2000 iterations . \n the receiver operator characteristic ( roc ) curve was calculated to assess the capability of the model to discriminate patients who would normalize lvm 1 year after avr from those who would maintain residual hypertrophy . \n the preoperative levels of circulating mir133a ( figure 1a ) were significantly higher in the cohort of as patients who normalized lvm ( lvmi < 51 g / m ) after pressure overload release ( n=30 ; median=113.2 , interquartile range=80.9 to 523.3 ) compared with those who maintained residual hypertrophy ( lvmi > 51 g / m ) ( n=44 ; median=71.3 , interquartile range=29.3 to 150.7 ) ( p=0.012 , mann whitney u test ) . preoperative levels of mir133a in systemic venous plasma and lv myocardium . a , preoperative antecubital plasma levels of mir133a in patients who maintained residual hypertrophy left ventricular mass index ( lvmi > 51 g / m ) 1 year after aortic valve replacement and patients who normalized lvmi < 51 g / m . \n the boxes represent the 25th , 50th , and 75th percentiles , while the whiskers represent the 10th and 90th percentiles . \n b , linear regression and pearsons correlation analyses show a positive correlation between systemic venous ( antecubital ) plasma and lv myocardial tissue levels of mir133a . \n re indicates relative expression normalized to rnu6b ; r , pearson 's correlation coefficient ; ln , natural logarithm . we initially sought to assess the relationship between the preoperative levels of circulating mir133a and its myocardial expression . \n we found a direct , positive and significant correlation between both variables ( figure 1b ) , suggesting that the myocardium is among the sources that contribute to the levels of circulating mir133a . to further investigate this possibility , we assessed the existence of a mir133a concentration gradient between the coronary and the systemic venous blood in 29 as patients . \n plasma levels of mir133a in the coronary sinus ( median=140.4 , interquartile range=63.4 to 193.3 ) were significantly higher than those in the right atrium ( median=72.3 , interquartile range=29.3 to 113.2 ) ( figure 2a ) , indicating a net contribution of the heart to the systemic levels of mir133a . \n accordingly , coronary sinus mir133a levels exhibited significant positive correlations with both the myocardial expression levels ( figure 2b ) and the systemic venous levels of mir133a ( figure 2c ) . \n a , comparison of mir133a plasma levels in the coronary sinus and right atrial blood in patients with severe aortic stenosis . \n the boxes represent the 25th , 50th , and 75th percentiles , while the whiskers represent the 10th and 90th percentiles . \n b , linear regression and pearsons correlation analyses of lv myocardial tissue and coronary sinus plasma expression levels of mir133a . \n c , linear regression and pearson 's correlation analyses of coronary sinus and right atrium venous plasma expression levels of mir133a . * * p<0.01 , wilcoxon matched pairs test . \n lv indicates left ventricular ; re , relative expression normalized to rnu6b ; ln , natural logarithm ; r , pearsons correlation coefficient . \n stepwise multiple linear regression models were used to assess the value of preoperative mir133a plasma level together with several clinical variables ( age , sex , preoperative lvm , body mass index [ bmi ] , hypertension , diabetes mellitus ) for estimating the extent of lvm regression 1 year after avr in as patients . \n the variables entered in the regression equation were evaluated for multicollinearity and proved independent of each other . \n the models developed are shown in table 2 . among the variables tested , the preoperative plasma levels of mir133a together with lvm arose as significant positive predictors of the lvm absolute reduction after surgery , whereas bmi appeared to be a significant negative predictor ( table 2 , model 1 ) . \n the adjusted r ( 0.49 ; p<0.0001 ) indicated that 49% of the variance in lvm reduction 1year after avr can be estimated from this model . \n significant preoperative predictors of quantitative lvm loss 1 year after surgery in as patients undergoing aortic valve replacement two multiple linear regression models were calculated using a bootstrap validated analysis : one excluding whscd2 expression ( model 1 : adjusted r : 0.49 ; p<0.0001 ) and one including whscd2 expression ( model 2 : adjusted r : 0.61 ; p<0.0001 ) . \n re : relative expression normalized to spikedin caenorhabditis elegans oligonucleotide ( celmir39 ) for circulating mir133a , or to the ribosomal subunit 18s for myocardial whscd2 . \n further , we assessed whether entering the myocardial mrna expression levels of several validated mir133a targets ( whsc2/nelfa , srf , rhoa , cdc42 , nfatc4 ) as independent variables in the equation would improve the predictive power of the resulting equation . \n as shown in table 2 ( model 2 ) , whsc2/nelfa constituted , together with the bmi , a significant negative predictor of 1year postoperative lvm reduction . \n the bootstrapping validated regression model was as follows : lvm=16.8 + 0.51 ( lvm ) + 12.9 ( plasma mir133a ) 10.1 ( whscd2/nelfa ) 2.7 ( bmi ) . \n the adjusted r ( 0.61 ; p<0.0001 ) indicated that inclusion of whsc2/nelfa improved substantially the predictive power of the model . on the other hand , srf , rhoa , cdc42 or nfatc4 \n we next evaluated by logistic regression analysis the value of circulating mir133a levels , in conjunction with the same clinical parameters , to predict lvm normalization ( lvmi < 51 g / m ) 1 year after avr . as shown in table 3 , \n preoperative circulating mir133a was identified as positive predictor of lvmi normalization , whereas bmi , lvm , and hypertension were negatively associated with the probability of lvm normalization . \n bootstrapping validation of the logistic regression model revealed a sensitivity of 87.9% and a specificity of 76.9% . \n the accuracy of this model to discriminate the patients who maintained residual lv hypertrophy from those who normalized the lvm 1 year after surgery was determined by the roc curve analysis . as shown in figure 3 , the prognostic accuracy of the model yielded an area under the roc curve of 0.89 ( ci 95% 0.81 to 0.97 , p<0.001 ) . \n when the same analysis was performed using preoperative mir133a circulating level as the only independent predictor , the area under the roc curve was 0.64 ( ci 95% 0.49 to 0.79 , p=0.035 ) . \n significant preoperative predictors of lvmi normalization 1 year after surgery in as patients undergoing aortic valve replacement the goodness of fit of the logistic regression analysis ( =2.63 ; significance=0.96 ) was assessed using the hosmerlemeshow test . \n re : relative expression of circulating mir133a normalized to spikedin caenorhabditis elegans oligonucleotide ( celmir39 ) . \n lvmi indicates left ventricular mass index ; as , aortic stenosis ; se , standard error of the mean \n the roc curve for preoperative plasma mir133a ( dashed line ) and for the complete logistic model ( mir133a , body mass index , preoperative lvm , systemic hypertension ) ( solid line ) depict discrimination between patients who normalize lvm by 1 year after surgery from those who maintain residual hypertrophy . \n the preoperative levels of circulating mir133a ( figure 1a ) were significantly higher in the cohort of as patients who normalized lvm ( lvmi < 51 g / m ) after pressure overload release ( n=30 ; median=113.2 , interquartile range=80.9 to 523.3 ) compared with those who maintained residual hypertrophy ( lvmi > 51 g / m ) ( n=44 ; median=71.3 , interquartile range=29.3 to 150.7 ) ( p=0.012 , mann whitney u test ) . \n a , preoperative antecubital plasma levels of mir133a in patients who maintained residual hypertrophy left ventricular mass index ( lvmi > 51 g / m ) 1 year after aortic valve replacement and patients who normalized lvmi < 51 g / m . \n the boxes represent the 25th , 50th , and 75th percentiles , while the whiskers represent the 10th and 90th percentiles . \n b , linear regression and pearsons correlation analyses show a positive correlation between systemic venous ( antecubital ) plasma and lv myocardial tissue levels of mir133a . \n re indicates relative expression normalized to rnu6b ; r , pearson 's correlation coefficient ; ln , natural logarithm . \n we initially sought to assess the relationship between the preoperative levels of circulating mir133a and its myocardial expression . \n we found a direct , positive and significant correlation between both variables ( figure 1b ) , suggesting that the myocardium is among the sources that contribute to the levels of circulating mir133a . to further investigate this possibility , we assessed the existence of a mir133a concentration gradient between the coronary and the systemic venous blood in 29 as patients . \n plasma levels of mir133a in the coronary sinus ( median=140.4 , interquartile range=63.4 to 193.3 ) were significantly higher than those in the right atrium ( median=72.3 , interquartile range=29.3 to 113.2 ) ( figure 2a ) , indicating a net contribution of the heart to the systemic levels of mir133a . \n accordingly , coronary sinus mir133a levels exhibited significant positive correlations with both the myocardial expression levels ( figure 2b ) and the systemic venous levels of mir133a ( figure 2c ) . \n a , comparison of mir133a plasma levels in the coronary sinus and right atrial blood in patients with severe aortic stenosis . \n the boxes represent the 25th , 50th , and 75th percentiles , while the whiskers represent the 10th and 90th percentiles . \n b , linear regression and pearsons correlation analyses of lv myocardial tissue and coronary sinus plasma expression levels of mir133a . \n c , linear regression and pearson 's correlation analyses of coronary sinus and right atrium venous plasma expression levels of mir133a . * * p<0.01 , wilcoxon matched pairs test . \n lv indicates left ventricular ; re , relative expression normalized to rnu6b ; ln , natural logarithm ; r , pearsons correlation coefficient . \n stepwise multiple linear regression models were used to assess the value of preoperative mir133a plasma level together with several clinical variables ( age , sex , preoperative lvm , body mass index [ bmi ] , hypertension , diabetes mellitus ) for estimating the extent of lvm regression 1 year after avr in as patients . \n the variables entered in the regression equation were evaluated for multicollinearity and proved independent of each other . \n the models developed are shown in table 2 . among the variables tested , the preoperative plasma levels of mir133a together with lvm arose as significant positive predictors of the lvm absolute reduction after surgery , whereas bmi appeared to be a significant negative predictor ( table 2 , model 1 ) . \n the adjusted r ( 0.49 ; p<0.0001 ) indicated that 49% of the variance in lvm reduction 1year after avr can be estimated from this model . \n significant preoperative predictors of quantitative lvm loss 1 year after surgery in as patients undergoing aortic valve replacement two multiple linear regression models were calculated using a bootstrap validated analysis : one excluding whscd2 expression ( model 1 : adjusted r : 0.49 ; p<0.0001 ) and one including whscd2 expression ( model 2 : adjusted r : 0.61 ; p<0.0001 ) . \n re : relative expression normalized to spikedin caenorhabditis elegans oligonucleotide ( celmir39 ) for circulating mir133a , or to the ribosomal subunit 18s for myocardial whscd2 . \n further , we assessed whether entering the myocardial mrna expression levels of several validated mir133a targets ( whsc2/nelfa , srf , rhoa , cdc42 , nfatc4 ) as independent variables in the equation would improve the predictive power of the resulting equation . \n as shown in table 2 ( model 2 ) , whsc2/nelfa constituted , together with the bmi , a significant negative predictor of 1year postoperative lvm reduction . \n the bootstrapping validated regression model was as follows : lvm=16.8 + 0.51 ( lvm ) + 12.9 ( plasma mir133a ) 10.1 ( whscd2/nelfa ) 2.7 ( bmi ) . \n the adjusted r ( 0.61 ; p<0.0001 ) indicated that inclusion of whsc2/nelfa improved substantially the predictive power of the model . on the other hand , srf , rhoa , cdc42 or nfatc4 \n we next evaluated by logistic regression analysis the value of circulating mir133a levels , in conjunction with the same clinical parameters , to predict lvm normalization ( lvmi < 51 g / m ) 1 year after avr . \n as shown in table 3 , preoperative circulating mir133a was identified as positive predictor of lvmi normalization , whereas bmi , lvm , and hypertension were negatively associated with the probability of lvm normalization . \n bootstrapping validation of the logistic regression model revealed a sensitivity of 87.9% and a specificity of 76.9% . \n the accuracy of this model to discriminate the patients who maintained residual lv hypertrophy from those who normalized the lvm 1 year after surgery was determined by the roc curve analysis . \n as shown in figure 3 , the prognostic accuracy of the model yielded an area under the roc curve of 0.89 ( ci 95% 0.81 to 0.97 , p<0.001 ) . \n when the same analysis was performed using preoperative mir133a circulating level as the only independent predictor , the area under the roc curve was 0.64 ( ci 95% 0.49 to 0.79 , p=0.035 ) . \n significant preoperative predictors of lvmi normalization 1 year after surgery in as patients undergoing aortic valve replacement the goodness of fit of the logistic regression analysis ( =2.63 ; significance=0.96 ) was assessed using the hosmerlemeshow test . \n re : relative expression of circulating mir133a normalized to spikedin caenorhabditis elegans oligonucleotide ( celmir39 ) . \n lvmi indicates left ventricular mass index ; as , aortic stenosis ; se , standard error of the mean \n . receiveroperating characteristic ( roc ) plots . the roc curve for preoperative plasma mir133a ( dashed line ) and for the complete logistic model ( mir133a , body mass index , preoperative lvm , systemic hypertension ) ( solid line ) depict discrimination between patients who normalize lvm by 1 year after surgery from those who maintain residual hypertrophy . \n based on intraoperative lv biopsies harvested at the time of avr , we have previously shown in patients with pure severe as that the myocardial expression of mir133a predicts the amount and completeness of lv reverse remodeling 1 year after avr . \n this predictive information , albeit important , is of little clinical utility as it can not be obtained easily in everyday practice . finding bedside biomarkers that help in estimating the postoperative reversibility of lv hypertrophy in potential surgical candidate as patients is warranted . in the present study , which was performed using the same cohort of as patients , \n we show that mir133a is released by the myocardium into the circulation in the pressure overload situation and , most importantly , that the preoperative plasma levels of mir133a can predict the reversibility of lv hypertrophy after avr . \n thus , patients who normalized the lvm 1 year after surgery had significantly higher preoperative levels of circulating mir133a compared with patients who exhibited residual hypertrophy at this time mark . \n moreover , bootstrappingvalidated multiple linear regression and logistic regression analyses indicate that the preoperative level of circulating mir133a constitutes a significant positive predictor for both absolute lvm reduction and lvm normalization 1 year after valve replacement . \n the present study supports the notion that preoperative circulating mir133a represents a potential biomarker for the prognosis of postoperative lvm regression , with a predictive power similar to its myocardial expression . \n it is critically involved in the control of cardiomyocyte proliferation during embryonic heart development in the mouse . \n recent reports indicate that mir133 , together with mir1 and a few cardiac transcription factors , play important roles in generating cardiomyocytes from embryonic stem cells and in reprogramming human fibroblasts to cardiaclike myocytes . additionally , the regenerative capacity of the adult zebrafish heart in response to major cardiac injury is under the repressive control of mir133 . \n downregulation of mir133 is related to the hypertrophic growth of cultured cardiomyocytes . also , the pathological hypertrophic growth and extracellular matrix remodeling of the heart that occurs in response to pathological signaling is under the control of mir133 , both in mouse experimental models and in human pathologies . \n thus , it appears that mir133 plays a key role in the control of the trophic state of the heart under normal conditions and that , when mir133 is downregulated ( such as in the pressure overload condition ) , the transcriptional derepression of genes encoding proteins that regulate cardiac structure likely contributes to the adverse remodeling response . \n mir133 is preferentially expressed in striated muscle and , therefore , apart from the heart it might also be released into the blood by the skeletal muscle . in the present study , linear regression analysis identified a significant , positive correlation between the myocardial expression of mir133a and its levels in the circulating blood . \n a paired comparison of mir133a levels in coronary sinus and peripheral venous blood identified a significant concentration gradient across the coronary circulation . \n a transcoronary concentration gradient of muscleenriched mirnas , including mir133a , has been previously reported to be suggestive of a release into the coronary circulation during myocardial injury . \n taken together , these data support a substantial contribution of the heart to the systemic plasma levels of mir133a and reinforce its value as a biomarker for pathological cardiac processes . in this regard , it is interesting to note that plasma levels of mir133 have been reported recently to be helpful in the diagnosis and prognosis of coronary artery disease and acute myocardial infarction , and of heart failure . \n in addition to mir133a , the preoperative lvm also arose as a strong , positive , significant predictor of absolute lvm regression in our predictive equation . \n these data further support our own and others ' findings suggesting that a greater excess of preoperative lvm is associated with a quantitatively greater mass loss after palliation of the pressure overload condition but also with a lesser overall probability of mass normalization at the 1year mark . \n obesity and hypertension are known to be risk factors for the development of lv hypertrophy and both have a negative impact on postoperative lv reverse remodeling after avr . \n accordingly , herein both obesity and hypertension arose as negative predictors of postoperative lvm normalization . \n the logistic regression model indicates that , in this particular cohort of patients and with the variables analyzed , the reduction in 1 unit of bmi would increase the probability of lvm normalization by 27% ( or : 0.73 , 95% ci : 0.58 to 0.94 ) , regardless of the values of the other predictors . \n conversely , hypertension ( or : 0.13 , 95% ci : 0.03 to 0.65 ) would be associated with a 7.7fold lower likelihood of lvm normalization . \n overall , these findings underscore the need for ancillary therapeutic interventions acting on these factors prior to and after surgical treatment of as patients . \n one of the main difficulties for the treatment of as patients is the proper timing of the avr in such a way as to achieve an adequate equilibrium between surgical risk and prospects of survival and good functional status . \n surgical indication for avr in asymptomatic patients is a particularly controversial issue that has , in the past , led to the inclusion and subsequent withdrawal of some indications in successive versions of the intersocietal guidelines for the management of patients with valvular heart disease . in this \n regard , evolution towards irreversible hypertrophy should favor earlier surgery in asymptomatic as patients with excessive or rapidly growing lvm for the sake of postoperative lvm normalization . \n the discovery of biomarkers that are informative , prior to surgery , with regard to the postoperative prognosis could represent a significant advance for the identification of patients who would benefit most from earlier surgery . \n aside from the merit of circulating mirnas as clinically relevant biomarkers , today , thanks to clinical profiling and gainandloss of function experimental studies , it is widely recognized that mirnas play a major role in many physiological and pathophysiological processes . \n the development of mirnabased therapeutics has sprouted as a logical next step and , despite the recent discovery of mirnas , several candidates have already progressed into clinical development . \n the therapeutic aim is the normalization of mirna expression , by either silencing with antimirs those mirnas that become inappropriately overexpressed , or by replacing with mirna mimics those that become downregulated . \n cardiac mir133a downregulation has been reported to be involved in the pathogenesis of myocardial hypertrophy in rodent models of cardiac disease and in as patients . \n overexpression of this mirna attenuates hypertrophy in mice through repression of cardiomyocyte targets from hypertrophyrelated signaling cascades . \n conversely , derepression of these targets by mir133a lossoffunction plays a key role in the cardiomyocyte growth response . collectively , these studies suggest that mir133based therapies directed at manipulating the trophic state of the heart could be a reality in the near future . \n mir133a mimics would synergize with conventional medical and surgical measures to achieve reverse remodeling of the overloaded lv . on the other end of the spectrum , \n the induction of therapeutic hypertrophy with antimir133a in patients with advanced heart failure under mechanical circulatory support might be of help as part of a bridge to recovery strategy . \n our present findings support the notion that the level of circulating mir133a , in conjunction with clinical parameters , could help to create an individual preoperative risk profile disclosing the potential for regression of lv myocardial hypertrophy in as patients . \n this information could help the clinician not only to make decisions about the timing of avr surgery for asymptomatic patients but also in the reinforcement of adjuvant measures ( weight loss , arterial pressure control , etc ) aimed at improving the postoperative outcome in all as patients . \n our results support a role for whsc2/nelfa in the mir133adependent regulation of myocardial trophic state . \n we thank the statistical advice of javier llorca , professor of epidemiology and biostatistics at the university of cantabria medical school . \n we acknowledge the excellent technical assistance of nieves garca , ana cayn , begoa ubilla , amalia cavay , elena martn , rn , roberto moreta , rn , and ana sandoval .", "role": "user" }, { "content": "backgroundmyocardial microrna133a ( mir133a ) is directly related to reverse remodeling after pressure overload release in aortic stenosis patients . herein , we assessed the significance of plasma mir133a as an accessible biomarker with prognostic value in predicting the reversibility potential of lv hypertrophy after aortic valve replacement ( avr ) in these patients.methods and resultsthe expressions of mir133a and its targets were measured in lv biopsies from 74 aortic stenosis patients . \n circulating mir133a was measured in peripheral and coronary sinus blood . \n lv mass reduction was determined echocardiographically . \n myocardial and plasma levels of mir133a correlated directly ( r=0.46 , p<0.001 ) supporting the myocardium as a relevant source of plasma mir133a . accordingly , a significant gradient of mir133a was found between coronary and systemic venous blood . \n the preoperative plasma level of mir133a was higher in the patients who normalized lv mass 1 year after avr than in those exhibiting residual hypertrophy . \n logistic regression analysis identified plasma mir133a as a positive predictor of the hypertrophy reversibility after surgery . \n the discrimination of the model yielded an area under the receiver operator characteristic curve of 0.89 ( p<0.001 ) . \n multiple linear regression analysis revealed plasma mir133a and its myocardial target wolfhirschhorn syndrome candidate 2/negative elongation factor a as opposite predictors of the lv mass loss ( g ) after avr.conclusionspreoperative plasma levels of mir133a reflect their myocardial expression and predict the regression potential of lv hypertrophy after avr . \n the value of this bedside information for the surgical timing , particularly in asymptomatic aortic stenosis patients , deserves confirmation in further clinical studies .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: hysterectomy is the most frequently performed major gynaecological surgical procedure . vaginal hysterectomy ( vh ) \n , if vh hysterectomy is not possible , laparoscopic hysterectomy ( lh ) may avoid the need of a laparotomy in a large proportion of cases . since the first description of lh by reich et al . in 1989 , \n , however , the implementation of laparoscopic hysterectomy seems to develop at a slow pace . \n reported that laparoscopic - assisted vaginal hysterectomy ( lavh ) was performed in only 58% of hospitals and only 4% of hysterectomies were lavhs . \n lack of laparoscopic training and experience during residency could be a factor of importance on this matter . with less experience , gynaecologists who plan hysterectomies \n may judge lh as too difficult and therefore may have a tendency to perform an abdominal hysterectomy when vaginal hysterectomy is not possible . \n several factors may influence the estimated level of difficulty of hysterectomy : uterine size on bimanual palpation , patients weight and bmi , previous abdominal surgery and surgeon s experience with the planned approach to hysterectomy . \n furthermore , the estimated level of difficulty itself may have an impact on the scheduled amount of time for surgery . in order to optimize the logistic patterns of operating theatre , next to accurate day case management , it is mandatory that surgeons planning hysterectomy make adequate estimations of the difficulty of surgery [ 68 ] . until now \n , it is not known whether surgeons experience abdominal and laparoscopic hysterectomy as equally difficult . \n the main objective of this study was to assess whether there was a difference in estimated and experienced difficulty between abdominal and laparoscopic hysterectomy . \n between august 2002 and january 2005 , a randomized controlled trial was conducted , in which women were randomized to either abdominal or laparoscopic hysterectomy . for benign indications , \n a vaginal hysterectomy was performed when the size of the uterus did not exceed 12 weeks gestation with the cervix descending until at least halfway the vagina under cervical traction with a tenaculum forceps . in cases \n in which these conditions for vaginal hysterectomy were not met and the size of the uterus did not exceed 18 weeks gestation , patients were eligible for the study . \n exclusion criteria were suspicion of malignancy other than endometrial carcinoma , a previous lower midline incision , the need for simultaneous interventions like prolapse repair and inability to speak dutch . written informed consent was required . \n we recorded body mass index ( bmi ) , uterine size on bimanual palpation , the surgeons number of previously performed hysterectomies , operation time , conversions in case of lhs and pre- and postoperative complication rate . \n the surgeon s number of previously performed hysterectomies was used as a measure of surgical experience . \n preoperatively , all gynaecologists were asked to rate the estimated level of difficulty on a 110 visual analogue scale ( vas ) with the patient under anaesthesia . \n . a difference of three or more points between the estimated and experienced score ( vas 3 ) was considered as clinically relevant . \n furthermore , we analysed factors that could possibly be related to these cases of vas 3 and factors related to cases in which a complication occurred . as a measure of the surgeon s ability to perform accurate estimations , we analysed the correlation between the estimated uterine size on bimanual palpation and the actual uterine weight on pathological examination . \n statistical analysis was performed using statistical package for the social sciences ( spss ) 16.0 . \n data are detailed as mean and standard deviation or median and interquartile range and analysed by mann \n out of 76 patients randomised , both pre- and postoperative vas scores were recorded by gynaecologists in 72 patients ( 95% ) . \n as expected , lh required a longer surgery time and was accompanied with less blood loss . compared with ah , \n a subgroup analysis revealed that surgical experience ( number of previous hysterectomies ) was inversely related to the estimated level of difficulty in ah ( spearman s rho 0.365 ; p = 0.031 ) , but not in lh . \n table 1baseline patients characteristics and surgical parametersah ( n = 35)lh ( n = 37)page ( years)48.1 9.550.0 9.20.208parity1.5 1.31.9 1.20.137bmi ( kg / m)26.4 3.926.7 5.80.774uterine size ( weeks)9.2 4.29.7 5.20.875estimated difficulty3.0 \n 1.64.3 2.40.023experienced difficulty3.4 2.24.8 2.50.018surgery time ( min)82 32121 31<0.01blood loss ( ml)402 299204 172<0.01data are presented as mean standard deviationah abdominal hysterectomy , lh laparoscopic hysterectomyestimated and experienced difficulty rated on a 010 visual analogue scale , where a higher score denotes a higher difficulty level baseline patients characteristics and surgical parameters data are presented as mean standard deviation ah abdominal hysterectomy , lh laparoscopic hysterectomy estimated and experienced difficulty rated on a 010 visual analogue scale , where a higher score denotes a higher difficulty level in 13 patients ( 18% ) , there was a vas 3 ( surgery was estimated as significantly less or more difficult compared to the actual experienced difficulty ; see fig . 1 ) . \n these 13 cases were equally divided between the laparoscopic ( n = 6 ) and abdominal ( n = 7 ) approach . in 11 out of 13 ( 85% ) cases \n , there was a positive vas 3 ( surgery was experienced as more difficult than it was estimated ) . \n the two patients in whom experienced difficulty was significantly lower compared to estimated difficulty were both ahs . conversion from laparoscopy to laparotomy did not occur in these 11 patients . \n 1difference between estimated and experienced difficulty level in laparoscopic ( lh ) and abdominal hysterectomy ( ah ) . \n a positive difference indicates that surgery was experienced as more difficult than it was estimated difference between estimated and experienced difficulty level in laparoscopic ( lh ) and abdominal hysterectomy ( ah ) . \n a positive difference indicates that surgery was experienced as more difficult than it was estimated table 2 shows the cases of positive vas 3 in relation to bmi , operation time , intubation time , total time in operating room , blood loss , uterine weight , surgeons number of previously performed hysterectomies and complication rate . \n surgery time , intubation time and total time in operating room were longer in more difficult cases ( with positive vas 3 ) , although 95% confidence intervals crossed zero . \n table 2factors possibly related to vasvas < 3 ( n = 59)vas 3 ( n = 11)mean difference ( 95% ci)bmi ( kg / m)26.5 5.226.7 4.4natime of surgery ( min)99 37119 3520 ( 5 to 44)time of intubation ( min)120 40142 3422 ( 4 to 47)time on or ( min)129 43150 3121 ( 2 to 44)blood loss ( cc)288 269382 22794 ( 70 to 257)uterine weight ( gram)220 182215 154nasurgeon s experience30 ( 9100)30 ( 13100)nacomplications ( % ) 8 ( 13.6)1 ( 9.1)nadata presented as mean standard deviation . surgeon s experience refers to the number of previously performed hysterectomiesonly 11 cases with a positive vas 3 were used for this analysis ( cases where experienced difficulty was higher than estimated difficulty)95% confidence intervals of the mean difference ( independent sample t - test)data presented as median ( range)data presented as number ( percentage ) factors possibly related to vas data presented as mean standard deviation . \n surgeon s experience refers to the number of previously performed hysterectomies only 11 cases with a positive vas 3 were used for this analysis ( cases where experienced difficulty was higher than estimated difficulty ) 95% confidence intervals of the mean difference ( independent sample t - test ) data presented as median ( range ) data presented as number ( percentage ) figure 2 shows the correlation between the estimated uterine size on bimanual palpation and the actual uterine weight on pathological examination . with spearman s rho = 0.702 ( p \n < 0.001 ) , the estimated size of the uterus correlated well with the actual weight . \n fig . 2scatter box plot showing the correlation between estimated uterine size and actual uterine weight . \n . line was assigned using curve fitting in spss 16.0 scatter box plot showing the correlation between estimated uterine size and actual uterine weight . \n line was assigned using curve fitting in spss 16.0 in nine patients ( 12.5% ) , a complication occurred ( four conversions and one bladder lesion in lh ; two bleedings > 1,000 cc , one severe allergic reaction and one unintentionally subtotal hysterectomy in ah ) . in these cases , bmi and \n table 3factors possibly related to surgical complicationscomplication ( n = 9)no complication ( n = 63)ppreoperative vas score6.9 2.83.2 1.6<0.01postoperative vas score7.3 2.73.6 2.1<0.01bmi ( kg / m)30.4 8.426.0 4.10.014size of uterus ( gr)316 368205 1230.812surgeon s experience9 ( 3100)20 ( 0100)0.315data presented as mean standard deviation . \n surgeon s experience refers to a surgeon s number of previously performed hysterectomiesvas 110 visual analogue scale , where higher scores denote a higher difficulty level.data presented as median ( range ) factors possibly related to surgical complications data presented as mean standard deviation . \n surgeon s experience refers to a surgeon s number of previously performed hysterectomies vas 110 visual analogue scale , where higher scores denote a higher difficulty level . \n to our knowledge , this is the first study in which the estimated and the experienced level of difficulty of hysterectomy , respectively , have been compared . \n we have found that laparoscopic hysterectomy is estimated and experienced as more difficult compared to abdominal hysterectomy . \n we also observed that the level of difficulty in about one out of five operations is not correctly estimated . \n the subjective higher level of difficulty of lh versus ah may have a substantial role in the slow implementation of laparoscopic hysterectomy in the netherlands . as mentioned by kolkman et al . in 2002 , \n laparoscopic - assisted vaginal hysterectomy was performed in only 58% of hospitals and only 4% of hysterectomies were lavhs . \n more laparoscopic training and experience during residency may partly melt away this subjective higher level of difficulty . \n many initiatives have already been taken to enhance the practise hours on virtual reality and box trainers . \n results from a dutch nationwide study on laparoscopic hysterectomy will soon reveal its current implementation . \n more surgical experience with ah seems to be associated with a lower estimated level of difficulty . \n this association was not observed in lh , which might be due to the fact that all lhs were performed by experienced laparoscopic surgeons , whereas ahs were also performed by residents in training . \n many authors have reported on the learning curve for lh [ 1013 ] and , in general , concluded that , with increasing experience , operation time and complication rate decreased . in literature , \n concluded that from 25 ahs and onwards blood loss is reduced and surgical time reduces from 75 ahs and onwards . \n stated that an increased experience had no effect on complication rates in ahs , but a decrease of 44% was seen in lhs . \n previous studies have reported on factors that may influence operating room planning [ 68 , 16 , 17 ] . \n although adequate estimation of surgery time for a specific procedure is frequently mentioned as an important factor , refinement of or allocations a few months before the day of surgery as well as management decisions on the day of surgery appear to be more relevant in preventing over- or underutilization of operating rooms [ 7 , 16 ] . in a large observational study , average underestimation of the required surgery time by surgeons and \n schedulers was 22 min for each 8 h of or time . in our study , patients in which surgery was estimated less difficult than it was experienced ( positive vas 3 ) required on average 21 min longer or time . however , as confidence intervals just crossed zero and this short overutilization of an operating room is likely to be levelled by underutilization of other ors and up - to - date day case management , no strict conclusions can be drawn from this result . \n furthermore , as our study concerned a randomized trial in which the scheduler was not necessarily the surgeon , reticence on extrapolating these findings to every day practise seems argumentative . \n this might be an indication for surgeons being capable of predicting the risk of complications . \n others have studied the possibility of predicting the risk of complications in gynaecologic ( laparoscopic ) surgery . \n found that , besides the type of laparoscopic surgery , increasing age was the most important predictor of complications . in our study , age was not related to the occurrence of complications ( data not shown ) . \n myers et al . developed a model to predict the medical and the surgical complications of hysterectomy ; they incorporated demographic , diagnostic and procedural data . \n however , they concluded that the use of routinely collected administrative data for risk adjustment of hysterectomy complication rates can not be recommended . \n dean et al . concluded that the mean length of hospital stay was longer and complication rate was higher in patients with two or more co - morbidities , age above 60 and higher american society of anesthesiologists classification score . \n several other groups tried to predict which patients were at risk for postoperative infection in ah [ 21 , 22 ] ; they concluded that bacterial vaginosis and trichomoniasis vaginitis are risk factors for the development of posthysterectomy cuff cellulitis . \n firstly , the preoperative estimation of level of difficulty was performed with the patient under anaesthesia . \n this may have led to a slightly different estimation as compared to judgement in the outpatient setting . \n secondly , the scheduler was not necessarily the surgeon who performed the hysterectomy and multiple surgeons scheduled and performed the hysterectomies . \n furthermore , in cases with high estimated and experienced vas scores , the reason for these high scores was not reported by surgeons . \n finally , the difference in vas score of three units is a chosen cutoff point . in conclusion \n , we have found that laparoscopic hysterectomy was estimated and experienced as more difficult compared to abdominal hysterectomy . \n this may be a matter of importance in the slow implementation of lh in the netherlands .", "role": "user" }, { "content": "the level of difficulty of various types of hysterectomy differs and may influence the choice of either approach . when surgeons consider one specific approach to hysterectomy as more difficult , they may be reluctant to perform this type of hysterectomy . \n the main objective of this study was to investigate the potential different levels of difficulty for laparoscopic and abdominal hysterectomy . \n furthermore , the accuracy of estimating the level of difficulty was examined . in a randomized controlled trial between laparoscopic hysterectomy ( lh ) and abdominal hysterectomy ( ah ) , gynaecologists were asked to record the preoperatively estimated and postoperatively experienced level of difficulty on a visual analogue scale ( vas ) . \n differences between lh and ah were examined and the correlation between the estimated uterine weight on bimanual palpation and the actual uterine weight was calculated . a difference on the vas of three points or more \n ( vas 3 ) was considered clinically relevant . in 72 out of 76 cases , \n both vas scores were recorded . \n lh was estimated and experienced as significantly more difficult as compared with ah . in 13 ( 18% ) cases , \n vas was 3 , equally distributed between lh ( n = 6 ) and ah ( n = 7 ) . \n eleven of these 13 cases had a positive vas 3 , meaning that surgery was experienced as more difficult than it was estimated . \n surgeon s estimation of uterine size correlated well with the actual uterine weight . \n lh is considered as more difficult than ah , which might be a reason for its slow implementation . in a large proportion of cases , gynaecologists seem to be able to estimate the level of difficulty of hysterectomy accurately .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cyperaceae is a family of monocotyledonous graminoid flowering plants known as sedges , which superficially resemble grasses or rushes . \n cyperus esculentus provides edible tubers commonly called tigernut , chufa sedge , nut grass , yellow nutsedge , tigernut sedge , or earth almond . \n tigernut is a perennial crop cultivated particularly in tropical and subtropical areas worldwide and extensively in africa , asia , and some european countries for their sweetish tubers . in africa , \n tigernut is mostly cultivated in the west , ivory coast , ghana , mali , niger , nigeria , senegal and togo where they are used primarily uncooked as a side dish . \n they are also grinded into flour and used as a thickener , for bread and cakes or mixed with water as drink . the tubers are often considered as health food because they have excellent nutritional properties and prevent heart diseases and thrombosis . \n tigernut is known to activate blood circulation , to reduce risk of colon cancer and diabetes , and to favor weight loss . \n tigernut is also known to have aphrodisiac , carminative , diuretic , emmenagogue , stimulant , and tonic effects and even some medicinal uses such as treatment of flatulence , indigestion , diarrhea , dysentery , and excessive thirst . \n tigernut is used as livestock food and is in southern usa ranked among the top 10 most important waterfowl foods . \n tigernut flour is a rich source of carbohydrate , oil , and some useful mineral elements such as iron and calcium which are necessary for body growth and development [ 6 , 7 ] . \n three varieties have been reported on the basis of their color , namely , yellow , black , and brown varieties . \n tigernut was reported to be rich in carbohydrates , dietary fiber , lipids , and oleic acid [ 3 , 9 ] . despite its great potentialities \n most of the studies focused on the yellow variety while very little information exists on the physical characteristics of tigernut tubers \n . a better understanding of morphological parameters of the tigernut tubers as well as their link to the nutrition composition will help to identify valuable varieties and promote their use . \n so , this crop could contribute to the poverty alleviation among vulnerable populations , particularly rural women , in western africa . \n the aim of this study was to determine the physical traits as well as the chemical characteristics of the tubers from the three morphotypes of tigernut grown in burkina faso . \n tubers of cyperus esculentus l. were sampled in january and february 20072009 , in 5 villages located in western and southwestern burkina faso : loropni ( 1018n , 332w ) , mangodara ( 954n , 421w ) , oulni ( 1051n , 521w ) , tangora ( 1038n , 445w ) , and tifora ( 1038n , 433w ) . \n five kilograms of tubers was collected in each village , immediately hand - sorted to eliminate damaged ones , and taken to the laboratory . \n prior to any analysis , the samples were washed with distilled water , drained , and air - dried . \n each village sample was split into two parts ; one part was finely ground with a moulinex grinder robot ( gt550 , zurich , switzerland ) . \n both parts were packing in an airtight container and stored at 18c until analysis . to determine the mean length and width of the tubers , 100 tubers were per village randomly picked and \n their two linear dimensions were measured using a vernier caliper with an accuracy of 0.01 mm ( canon instruments , japan ) . \n the thousand dried tubers weight ( tsw ) was obtained by counting 1000 dried tubers and weighted on an electronic balance to 0.001 g accuracy ( ohaus , usa ) . \n the variation in tubers size and color was used to classify the tigernut into different morphotypes . \n the official methods of the association of official analytical chemists were used to determine moisture , protein , crude oil , and ash contents of the tubers . moisture ( g water 100 g sample ) was determined by drying a 3 g ground sample at 105c to constant weight . \n nitrogen content was determined by using the kjeldahl method and multiplied by a factor of 6.25 to determine the crude protein content ( g protein 100 g sample ) . \n crude fat ( g fat 100 g sample ) was obtained by exhaustively extracting 5.0 g of each sample in a soxhlet apparatus using petroleum ether ( boiling point range 4060c ) as the extractant . mineralization was performed on 3 g samples by combustion in a muffle furnace at 550c for 8 h ( g ash 100 g sample ) ( aoac 920.39c ) . \n carbohydrate content was estimated by difference of mean values : 100 ( sum of percentages of ash , protein , and lipids ) . \n aoac method 996.11 was used to determine starch content of cyperus esculentus tuber flours . the assay consisted of using thermostable alpha - amylase and amyloglucosidase to enzymatically hydrolyze starch into glucose that was then quantified with a spectrophotometer ( quant , bioteck instruments inc , usa ) . \n glucose , sucrose fructose , and maltose were analyzed by hplc according to the aoac official method 982.14 . \n samples for hplc sugars analysis were prepared by homogenizing 0.3 g of cyperus esculentus flour in 3 ml distilled water and 7 ml 95% alcohol and shaken before being centrifuged at 10 000 rpm for 20 min . \n the clear supernatant was filtered through 0.45 m filter and degasified before analysis by hplc . \n filtered solution ( 20 l ) was injected into hplc 1100 series ( agilent , waldbronn , germany ) equipped with a g1362a refractive index detector . \n sugars were separated using a commercially packed with zobax - nh2 column ( 250 4.6 mm ( dupont , wilmington , de , usa ) ) with a particle size of 5 m and thermostatized at 30c . \n the filtered and degasified mixture of acetonitrile / water ( 80/20 ) was used as mobile phase at a flow rate of 1 ml / min for 30 min run time . \n the sugars peaks were identified by comparing their retention times with individual standard sucrose , maltose , glucose , and fructose approximately 99% pure ( sigma - aldrich , steinheim , germany ) and the chromatograms analyzed using the agilent technologies chemstation software . \n an aliquot of 25 g of tigernut was added to 25 ml of a solution containing 45 g / l metaphosphoric acid and 7.2 g / l of dl-1,4-dithiotreitol ( dtt ) . the mixture was homogenized and centrifuged at 22,100 g for 15 min at 4c . \n the supernatant was vacuum - filtered through whatman no . 1 filter . prior to hplc analysis \n , the vacuum - filtered samples ( 10 ml ) were passed through a millipore 0.45 m membrane . \n then , 20 l was injected into a hplc system fitted with a reversed - phase column , c18 spherisorb ods2 ( 5 m ) stainless - steel column ( 4.6 mm 250 cm ) . \n the mobile phase was a 0.01% sulphuric acid solution adjusted to a ph of 2.6 , at a flow rate of 1 ml / min at room temperature . \n detection was performed at 245 nm with 486 absorbance detector ( waters , milford , ma ) . \n vitamin c was quantified through a calibration curve built with acs grade ascorbic acid ( > 99% pure , sigma - aldrich , steinheim , germany ) pure standards in the range of 0.250 g / ml . to determine vitamin e ( -tocopherol ) and -carotene , approximately 5 g of ground samples \n the mixture was then vortexed for 5 min and filtered using 0.2 m pore size ptfe membrane . \n the filtered hexane fraction was directly injected into rp - hplc system for -carotene and vitamin e analysis . \n the rp - hplc system ( shimadzu ) consisted of an autosampler and column oven equipped with inertsil ods-3v ( 250 4.6 mm , 5 m ) reversed - phase column . \n for -carotene analysis , mobile phase was acetonitrile ( 6 : 4 , v / v , containing 0.05 : bha as antioxidant ) ( eluent a ) and meoh ( eluent b ) . the following gradient was used : initial condition was 70% ( a ) and 30% ( b ) for 5 min , followed by 80% ( a ) and 20% ( b ) for 5 min , at a flow rate of 1.5 ml / min . \n elution was monitored using a photodiode - array detector at 472 nm . for vitamin e content , \n methanol mobile phase was used at a flow rate of 1.0 ml / min . \n the -tocopherol was detected by a shimadzu spd-10a ( uv / vis ) detector ( 292 nm wavelength ) . \n standards of -carotene ( 97.0% purity , sigma - aldrich , steinheim , germany ) and dl--tocopherol ( 96% purity , sigma - aldrich , steinheim , germany ) ranging from 0.5 to 6.0 g / ml and from 0.02 to 1.0 g / ml were used for calibration . \n fatty acid methyl esters were determined according to international union of pure and applied chemistry ( iupac ) method ii.d.19 . on hundred milligrams of extracted oils was saponified in a volumetric flask , with 1.2 ml of 0.5 m koh in meoh by heating and stirring under reflux for 5 min . \n after saponification oils were esterified by adding 1.2 ml 20% borontrifluoride through condenser and boiled for 2 min and then the flask was moved from the magnetic stirrer and fatty acid methyl esters were extracted by adding 1 ml of n - hexane . \n saturated nacl solution was added until the n - hexane is in the neck of volumetric flask , mixed carefully , flipped once or twice , and let settle for about 30 min . after separation \n the n - hexane phase was transferred to a vial for fatty acid methyl esters analysis . \n gas chromatography ( gc ) of fatty acid methyl esters was performed using a perkin elmer gc - autosystem xl with a programmable temperature vaporizer ( ptv ) split - injector and a flame ionization detector ( fid ) . \n the column temperature was initially maintained at 100c for 2 min and then raised by 5c / min to 225c and finally held at 225c for 16 min . \n the injection volume was 0.2 l with a 1 : 100 split . \n the ptv injector was initially maintained at 50c and immediately after the injection raised to 270c . \n the capillary column employed was cp sil 88 ( chrompak , varian instruments , walnut creek , ca ; 50.0 m 0.25 mm and 0.2 m film thickness ) . \n quantification was based on the area under each fatty acid peak as compared to the total area of all fatty acid peaks . \n the elements , mg , p , cr , fe , mn , cu , zn , sr , ca , k , and cd , in digests were measured using an atomic absorption spectrophotometer ( analyst 800 , perkin - elmer ) and/or a coupled plasma mass spectrophotometer ( elan drcii axial field technology , perkin - elmer ) . about 0.2 g of powered tuber was digested with 3 ml of hno3 ( 65% ) and 0.5 ml of h2o2 ( 30% ) in a closed vessel microwave digestion system ( mls - ethos plus ) and diluted to 50 ml with millipore water . \n digestion conditions for the microwave system were applied as follows : 2 min for 250 w , 2 min for 0 w , 6 min for 250 w , 5 min for 400 w , 8 min for 550 w , and vent for 8 min . \n al , si , s , and cl were analysis by polarized energy dispersive x ray fluorescent ( edxrf ) , spectro x - lab 2000 . \n prior to analysis , 4 g of ground dried samples triplicate was pelleted by 5 tons using spectropess ( chemplex industries , inc . ) and then pellets were analyzed using different excitation conditions with an edxrf spectrometer . \n standard reference material 1568a rice flour was obtained from national institute of standards and technology , gaithersburg , usa , and was used as food reference material to evaluate the analytical methods . \n comparison of means was performed by one - way analysis of variance ( anova ) followed by wilcoxon 's multiple comparison tests . principal component analysis ( pca ) \n was performed to compare the physical and chemical data of 3 morphotypes of cyperus esculentus tubers . \n pca was carried out using the 33 physical and chemical variables which differed significantly between morphotypes . principal component analysis ( pca ) \n it gives graphical representations of intersample and intervariable relationships and provides a way to reduce the complexity of the data . \n statistical significance was set at the 5% level of probability using jmp in 5.1 software ( sas institute , cary , nc , usa ) . \n tubers from five collection sites were grouped into three morphological variants on the basis of their color ( yellow or black ) and size ( big or small tuber ) . then three variants were identified : ( 1 ) yellow and big ( morphotype 1 ) , yellow and small ( morphotype 2 ) , and black and big ( morphotype 3 ) ( table 1 ) . \n thus , tuber samples from mangodara and tifora were classified as morphotype 1 , those from loropni and oulni as morphotype 2 , and those from tangora as morphotype 3 ( figure 1 ) . \n the tuber characteristics of the three morphotypes of cyperus esculentus are shown in table 1 . \n the moisture content was not significantly different ( p > 0.05 ) among the three morphotypes . \n morphotypes 1 and 3 had slightly bigger tubers than approximate average length ( 0.63 to 1.21 cm ) found for tigernuts from other countries . \n the width of the tuber and one thousand dried tuber weights varied from 0.90 0.08 to 1.19 0.05 cm and from 598.00 115.00 to 1044.00 394.60 g , respectively . \n both morphotypes 1 and 3 had higher one - thousand - tuber weight than morphotype 2 . \n the one - thousand - tuber weight seems to be more influenced by tuber width than length . \n one thousand weights of investigated tubers were far higher than those obtained for brown tubers by cokuner et al . that showed how genetic diverse is c. esculentus cultivated around the world . \n crude oil contents of the three morphotypes varied from 24.91 0.94 to 28.94 0.37 \n crude oil content was higher in morphotypes 2 followed by morphotype 1 , with morphotype 3 as the lowest ( table 1 ) . \n crude oil content of the three morphotypes reported in this paper is lower than those reported for black and brown tubers from cameroon . \n however , the lipid content values are similar to those of white tubers and higher than the content of tigernut genotype from spain reported by alegra - torn and farr - rovira . the data reported indicate that the lipid content of tigernut is influenced by genetic material and geographical location . \n protein levels in the three morphotypes ranged from 3.3 0.26 to 4.33 0.6 g 100 g. the morphotype 2 protein content was significantly higher than morphotype 3 . \n the protein content for the three morphotypes from burkina faso was very low compared to tubers from cameroon , nigeria , and turkey . \n the ash content of the three morphotypes was ranged between 1.81 0.24 and 2.21 0.39 g 100 g. morphotype 3 had significantly higher ash content than morphotype 2 . \n the ash content of the three morphotypes is lower than those reported for black , brown , and yellow tubers [ 5 , 20 , 21 ] . \n morphotypes 1 and 3 had similar carbohydrate content which was higher than that of morphotype 2 . \n tubers from burkina faso are richer in carbohydrates than those from nigeria and spain . \n starch , sucrose , fructose , and glucose contents of three morphotypes are reported in table 2 . \n the starch content of the three morphotypes ranged from 30.54 2.75 to 33.21 1.1 g 100 g. it appeared that starch content was not significantly different among morphotypes . \n however , the values for the three morphotypes were slightly higher than those reported by cokuner et al . and similar to data of linssen et al . \n the tigernuts from burkina faso displayed 1.6 0.69 to 3.59 0.72 g 100 g of fructose with no significant difference among morphotypes . \n the sucrose and glucose contents of the three morphotypes ranged from 17.98 1.03 to 20.39 1.15 g 100 g and from 0 to 6.79 1.34 g 100 g , respectively . \n morphotype 3 had significantly higher sucrose than morphotype 1 and morphotype 2 , while glucose content was not detected . \n karacali reported that the amount and composition of sugars vary according to fruit species , varieties , and ecological conditions , and technical and cultural practices affect the flavour . \n in addition , irrigation , harvest time , and storage conditions also affect the sugar composition of almond kernel [ 2729 ] . regarding the taste of sugars , sucrose is sweeter than glucose , and fructose is sweeter than sucrose . \n balta et al . reported a positive correlation between glucose and fructose contents and the sweet taste of almond . \n yellow morphotypes ( morphotypes 1 and 2 ) had higher glucose and fructose contents than black ones ; they should be sweeter . \n the ascorbic acid , tocopherol , and -carotene contents of the three morphotypes are shown in table 3 . \n the ascorbic acid levels varied from 5.48 1.05 to 26.78 2.51 mg 100 g and were within the usual range for tubers and lower than that of nuts [ 32 , 33 ] . \n the highest content of ascorbic acid was recorded with morphotype 2 , followed by morphotypes 3 and 1 . \n tocopherol content of three morphotypes ranged from 149.86 1.94 to 270.56 8.33 g 100 g. the morphotype 2 tocopherol content was significantly higher than that of morphotype 1 , which was also significantly higher than that of morphotype 3 . \n the tocopherol content obtained in this study is lower than that reported in tigernut oil from ghana . \n -carotene content of three morphotypes varied from 6.13 0.62 to 10.05 1.79 g 100 g. morphotypes 2 and 3 had the lowest and the highest content , respectively . \n oils of the three morphotype tubers contained high amounts of monounsaturated fatty acids ( mufas ) ( 65.91 1.7567.75 1.41% ) , followed by saturated fatty acids ( sufas ) ( 20.65 0.3822.03 1.11% ) and polyunsaturated fatty acids ( pufas ) ( 10.2 0.3612.53 0.73% ) ( table 4 ) . \n the sufa content of morphotype 2 was significantly lower than that of morphotypes 1 and 3 . \n however the tigernut studied here had better sufa and pufa content than those reported by snchez - zapata et al . . \n a total of seventeen fatty acids have been identified in each morphotype . among the fatty acids , oleic acid ( 64.25 1.9965.76 1.8% ) , palmitic acid ( 15.22 0.5515.83 0.32% ) , linoleic acid ( 10.04 0.3712.39 0.72% ) , and stearic acid ( 3.89 0.155.36 0.26% ) were the most abundant fatty acids , in three morphotypes , as previously reported [ 5 , 35 ] . \n the three cyperus esculentus morphotypes tubers appeared to be important sources of mineral ( table 5 ) . \n the most abundant minerals were k , p , si , cl , s , and mg and their content was significantly different at p < 0.05 except for s and mg . some contaminants such cr , sr , and cd were detected at low amounts . \n morphotype 1 was found to be richer in ca , cu , and mn contents . \n al , mg , p , s , and si were most abundant in morphotype 2 . \n the mineral compositions of the three morphotypes in the present study are different from those recorded with accessions from niger , nigeria , and turkey [ 22 , 35 , 36 ] . \n field observations of the soil type where the tigernuts are mainly growing showed that morphotype 1 is grown on more sandy soil , whereas morphotypes 2 and 3 are cultivated on soil with , respectively , more reddish and brownish clay . \n therefore different mineral content can be due to differences in soil composition which can influence mineral uptake and storage in the tuber . \n principal component analysis ( pca ) is used in exploratory analysis , which gives an overview of multivariate data . \n a pca using 33 physical and chemical variables showed clear differences among the three morphological types of tubers and gives a good overview of the characteristics of each type ( figure 2 ) . \n the first three principal components accounted for 82.27% of the total variation among the accessions . \n most of the variation was explained by the first principal component ( 52% ) , followed by the second ( 22% ) and the third ( 9% ) ( table 6 ) . \n loadings of the variables on the first two principal components show that the first component had high positive loadings from length , width , carbohydrate , sucrose , -carotene , stearic acid , stearic acid , linoleic acid , total saturated fatty acids , and zn and high negative loadings from lipids , linolenic acid , and mn . \n morphotype 1 had negative loadings in pc2 and was characterized by high ca , sr , cu , and fe contents whereas morphotype 2 showed positive scores in pc2 and had high protein , lipid , vitamin c , vitamin e , and p contents . \n morphotype 3 was located in the positive side of pc1 and was characterized by the highest content of ash , -carotene , and myristic , arachidic , and linolenic acids . \n we present in this study the physical and chemical variability of tigernuts ( cyperus esculentus ) cultivated in burkina faso . \n the data revealed that three cyperus esculentus morphotypes are important source of macronutrients ( starch , fat , and sucrose ) and minerals ( potassium , phosphorus , silicon , chlorine , sulfur , and magnesium ) . \n some interesting differences were noticed such as the content of carbohydrates , starch , saturated fatty acids , and polyunsaturated fatty acids . \n the yellow morphotypes showed the highest content of fructose , glucose , and crude oil . \n black morphotype was richer in carbohydrates with high content in sucrose whereas the yellow are source of fructose and glucose . \n these data revealed genetic variability among cultivated tigernuts from burkina faso and from others grown worldwide . \n thus , tigernuts from burkina faso displayed particular composition which could be of great interest for nutritional quality and food processing .", "role": "user" }, { "content": "tuber characteristics and nutrient composition of three morphotypes of cyperus esculentus tubers and tuber oils were determined . the mean value for length and width of the tuber and one thousand dried tuber weights ranged from 0.98 to 1.31 cm , 0.90 to 1.19 cm , and 598 to 1044 g , respectively . \n tubers displayed high level of starch ( 30.5433.21 g 100 g1 ) , lipid ( 24.9128.94 g 100 g1 ) , and sucrose ( 17.9820.39 g 100 g1 ) . \n the yellow tubers had significantly higher content in lipid compared to black ones . \n levels of ascorbic acid , tocopherol , and -carotene of the three morphotypes differed significantly . \n yellow ones ( morphotypes 1 and 2 ) were the richest in tocopherol and the poorest in -carotene . \n saturated fatty acid content of morphotype 2 was significantly lower than that of morphotypes 1 and 3 . \n morphotype 3 had the significantly lowest pufa content compared to morphotypes 1 and 2 . \n morphotype 1 was found to be richer in ca , cu , and mn contents . \n al , mg , p , s , and si were most abundant in morphotype 2 . \n morphotype 3 had the highest content of cl , k , and zn .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: irritable bowel syndrome ( ibs ) is a common gastrointestinal disorder affecting approximately 1015% of the people in western world . \n the patient group is very heterogeneous and characterized by abdominal pain , discomfort and abnormal bowel habits . \n the pathophysiology of ibs is unknown , it would appear that the due to the heterogeneous patient material there are multiple explanations for the symptom development . \n currently , patients are subdivided according to their main symptom that have been proposed in the so called rome criteria ; ibs with diarrhea ( ibs - d ) , ibs with constipation ( ibs - c ) or ibs with mixed bowel habits ( ibs - m ) . \n no single unifying cause for ibs has been reported but several factors have been associated with the disease etiology , including genetic predisposition , anxiety and depression as well as female gender . moreover , there is strong evidence indicating that changes in the intestinal microbiota and their function could be one of the contributing factors in the development of ibs . \n several studies have reported differences in the intestinal microbiota composition of ibs patients and healthy controls , however the results show little overlap from study to study . \n this is likely caused by different methodological approaches in the analysis steps as well as the heterogeneity of the ibs patients . \n regardless of the lack of coherent changes in the microbial composition , there is clear evidence for the role of the microbiota in the pathogenesis of ibs . \n for one , the patients report improved symptoms after consuming agents targeted to modify the intestinal microbiota , including probiotics , antibiotics or changing diet , such as avoidance of fodmap carbohydrates . moreover , the strongest predictor for ibs is a prior gastroenteritic episode , which will increase the risk of developing ibs by 7-fold . \n it has been estimated that about 10% of the ibs cases begin after an episode of gastroenteritis , causing post - infectious ( pi ) ibs , indicating a cause and effect relationship . \n this is in line with a previously proposed model in which an event , such as an infection , affects the intestinal microbiota and generates an alternative stable state . \n recently , a number of bistable microbial groups , i.e. microbes with two stable homeostatic states , have been identified that could act as tipping points in this well known ecological process that is associated with resilience . in our recent study by jalanka and colleagues \n the differences in the microbial composition of pi - ibs patients were addressed by analyzing the faecal microbiota of the study subjects with a previously validated and benchmarked phylogenetic microarray , detecting the abundance of over 1000 bacterial phylotypes found in the human intestine . the studied cohort consisted of 57 british subjects divided into 5 study groups ; patients with a pi - ibs diagnosis ( group 1 , rome ii ) , patients whom 6 months after the gastroenteritic episode had a persisting bowel dysfunction , which however did not qualify for ibs ( pi - bd ) ( group 2 ) or did not experience any bowel dysfunction anymore ( pi - nonbd ) ( group 3 ) . \n the results were benchmarked against ibs - d patients ( group 4 , rome ii ) and healthy controls ( group 5 ) . \n our aim was to determine the microbial compositional differences and to address associations between the faecal microbiota and the clinical features of ibs from patients with a varying degree of symptoms . \n as the development of ibs is multifactorial , we hypothesized that the observed symptoms and development of pi - ibs may arise from the interplay between the faecal microbiota , the host immune response , and psychological factors . \n therefore , we analyzed in parallel the detailed records of the participants ' psychological well - being , intestinal symptoms , systemic immunological markers as well as the levels of host gene expression on rectal mucosa . this integrated approach , addressing the associations between clinical phenotype and the faecal microbiota allowed us to address the complex relationships between the host and microbiota in the pathogenesis of ibs and pi - ibs . \n since the intestinal microbiota is very heterogeneous and subject - specific , we hypothesized that instead of limiting the comparative microbiota analysis to individual taxa , it would be more relevant to search for a microbial signature that potentially differs between the patients and healthy controls . \n by using a novel bioinformatic approach ( bootstrap aggregated rda method ; baggedrda ) we identified a combination of 27 genus - like bacterial groups that significantly separated healthy controls and patients with ibs symptoms . \n moreover , we found that the microbial profile of the pi - ibs and pi - bd groups resembled those suffering from ibs - d . \n the major difference in the patients ' microbiota was the 12-fold increase of bacteroidetes phylum and the 35-fold decrease of uncultured clostridiales belonging to the firmicutes phylum . \n furthermore , when all participants were ranked according to the abundance of the discriminating bacterial taxa , a specific ordering was obtained , the so - called index of microbial dysbiosis ( imd ) . this rank ordering reflected the patient 's health status as it correlated with the increase of several immunological markers and intestinal complaints , where as no such associations were observed when subdividing the patients according to their clinical status . \n interestingly , there were no significant correlations between the imd and any of the psychological symptoms often associated with ibs . \n our results corroborate the previous reports that the microbial composition could be used to further stratify ibs patients and thus complement the clinical subgroupings . in a recent study \n it was estimated that circa 33% of the ibs patients exhibit anxiety and 13% suffer from depression . \n in addition , it was found that somatisation was significantly increased in the ibs patients compared to controls with gastrointestinal symptoms but without ibs . \n although the intestinal microbiota of these patients was not studied , in the light of the recent evidence it could be hypothesized that the etiology of the disease in the patients with psychological symptoms differs from those with microbial aberrations . \n taken together , these results suggest that the discriminant microbial profile could be used as an objective measure of disturbed bowel functions and therefore a potential novel way of stratifying this heterogeneous patient material in future studies and in clinical practise . to verify our findings in a larger patient material \n we combined the microbiota data form the british subjects with that of a swedish pi - ibs cohort reported recently by sundin and colleagues . \n both studies were conducted with an identical analysis pipeline , including the well established mechanical lysis for extraction of faecal dna , the hitchip phylogenetic microarray platform , and the normalization and analysis software suite . \n the combined data aimed to determine whether the pi - ibs patients from 2 countries share similarities in their microbiota compared to healthy controls . \n the swedish cohort introduced new subjects to both healthy controls ( n=16 ) and pi - ibs patients ( n=13 , rome iii ) therefore doubling the sample size to a total of 51 subjects . \n remarkably , the significant difference in the microbiota profiles between the healthy and pi - ibs patients was replicated ( p < 0.05 , fig . 1 ) . \n the strongest difference was observed with the significant increase in the bacteroides ssp . and decrease of members of the uncultured clostridiales in the pi - ibs patients . \n interestingly , both bacteroides fragilis and uncultured clostridiales have been identified as bistable microbial groups and predicted to act as tipping points of the gut ecosystem in opposite ways . \n however , not all of the imd taxa reported in the original study appeared as significantly different between the patients and controls , and there were new taxa that were significantly increased in the combined pi - ibs patient group . \n one of them was dialister , which was recently identified as bistable i.e. , being either abundant or nearly absent in contrast to most other bacteria that show gradual abundance distribution . \n this highlights the need of conducting the future research in large cohorts in order to verify the separating species between pi - ibs and healthy controls . \n figure 1.intestinal microbiota of pi - ibs patients is significantly different form that of healthy controls ( hc ) . the difference was measured with baggedrda that was used to identify a microbial signature that separates hc from pi - ibs patients from the two study cohorts . \n abundance of the discriminating taxa creates the so - called index of microbial dysbiosis ( imd ) . \n intestinal microbiota of pi - ibs patients is significantly different form that of healthy controls ( hc ) . \n the difference was measured with baggedrda that was used to identify a microbial signature that separates hc from pi - ibs patients from the two study cohorts . \n abundance of the discriminating taxa creates the so - called index of microbial dysbiosis ( imd ) . \n the role of bacteroides spp . in the pathophysiology of ibs is controversial , probably reflecting the heterogeneity of the patients as well as the genus bacteroides . \n previous studies have reported opposing results regarding the relevance of bacteroides genera in ibs , as there is evidence for both increased as well as decreased abundance in the patients . \n interestingly , elevated levels of bacteroides spp were among the microbiota changes that have been associated with susceptibility to enteric pathogens in mice . \n it has been suggested that susceptibility to infections could increase due to a imbalanced microbial composition , since complex interactions between the microbiota and host immune system might reduce the resistance to episodes of gastroenteritis . \n recently , similar observations were made in humans by dicksved and colleagues who followed abattoir workers who have a high risk of contracting c. jejuni infection . \n the participants donated faecal samples at the start of employment and were then regularly followed . \n the subjects who became c. jejuni infected had increased levels of bacteroides species prior the infection , as opposed to those individuals who did not contract the disease during the follow - up period . \n similar to these findings , it was recently shown that the subjects contracting a gastroenteritis had increased levels of bacteroides spp . and decreased levels of firmicutes immediately after the infection . \n although the infectious agents in this study were diverse , the differences in the microbiota profile were similar to what we found . \n altogether , these data from several studies allow to hypothesize that the subjects with a microbial profile resembling the imd could be more susceptible for contracting a gastrointestinal infection and later developing pi - ibs . \n more studies on patients before and after gastroenteritis are required to verify this hypothesis . moreover \n recent experiments in mice have indicated that innate and mucosal immune system play a deterministic role in shaping the gut microbiota . \n hence , the observed imd may be a reflection of the activity of the host 's immune system . \n while this alternative explanation may offer new insight in the etiology of ibs , it confirms the significance and application potential of imd in stratifying ibs subjects . \n to further analyze the crosstalk between the host and the microbiota , we concentrated on the 27 bacterial taxa of imd and separately studied the associations between bacterial abundance and the host gene expression in mucosal surface of rectum , the last part of large intestine . \n we mapped the microarray - derived gene expression data from rectal biopsies to known biological functions using gene set analysis ( gsa ) . \n there were numerous statistically significant associations between the abundance of the ibs - type microbiota and the level of expressed host genes that suggested an association between the discriminant microbiota and the physical barrier integrity of the host . \n the most prominent negative correlation was observed between 7 bacteroides ssp and the expression of glycine , serine and threonine metabolism pathway . in general , glycine , serine and threonine \n are known to be important in the maintenance of gut integrity and the structure of the mucin layer . \n for example , the majority of the dietary threonine is utilized for synthesising the secretory mucin and its dietary restriction results into impaired gut barrier . moreover , the mucus structure and the extent of its glycosylation shape the microbiota composition and similar compositional changes have also been previously associated with barrier function abnormalities . \n fucosyltransferase-2 is involved in the formation of the abo - blood groups and its activity also creates adhesion receptor for several microbes . \n therefore , it is interesting that fut2 deficient mice ( fut2 ) have been shown to display similar differences in their microbiota composition to what was found in our study , i.e. increased amounts of several bacteroides species and decreased levels of clostridiales . \n in addition to alterations in the mucosal barrier genes , we identified several other pathways , including those that regulate cell junctions and inflammatory responses , to be associated with the imd bacterial taxa . \n the results led us to hypothesize that both the physical and immunological gut barrier of subjects with an ibs - type microbiota has been compromised resulting in a low - grade inflammation , a feature of some ibs patients . \n changes in the inflammatory response , barrier function and microbiota composition could therefore lead into changes in the other host parameters such as gut - brain axis receiving signals from these systems . \n moreover , we observed that the imd correlated with the ibs symptoms and clinical features whereas the scores of anxiety and depression did not correlate with the imd , indicating that patients with a more psychological basis for the disease have a rather undisturbed microbiota . \n this is in line with previous findings and of great significance as it allows proposing a model in which some subjects with a relatively healthy microbiota report ibs symptoms while others with a microbiota resembling that of the ibs patients have no complaints as they have compensating factors that overcome the microbial component and hence are scored healthy ( fig . 2 ) . \n the pi - ibs patients can be stratified according to the imd ( or more generally the microbial composition ) to those with ibs - like microbiota ( red ) and those with a composition resembling healthy individuals ( turquoise ) . \n objective measurements such as low - grade inflammation and altered gene expression correlated with the imd . \n psychological aspects , such as depression or anxiety do not correlate with the imd and these patients , though diagnosed with ibs , show a healthy - like microbiota profile . \n the correlations between host response and microbiota aberration identified in our study are indicated in bold . \n proposed model on how microbial aberrations could explain the disease etiology in ibs . \n the pi - ibs patients can be stratified according to the imd ( or more generally the microbial composition ) to those with ibs - like microbiota ( red ) and those with a composition resembling healthy individuals ( turquoise ) . \n objective measurements such as low - grade inflammation and altered gene expression correlated with the imd . \n psychological aspects , such as depression or anxiety do not correlate with the imd and these patients , though diagnosed with ibs , show a healthy - like microbiota profile . \n the correlations between host response and microbiota aberration identified in our study are indicated in bold . \n ibs has a heavy impact on the health care system and currently the patient diagnosis is based on subjective symptoms and exclusion of other gastrointestinal diseases . \n results from our study as well as from others suggest that diagnosis based on symptoms alone is not optimal and should be accompanied with objective markers , such as the microbiota composition . \n we introduced an index of microbial dysbiosis ( imd ) that can potentially be used to objectively stratify patients into smaller groups where the patients with psychological basis of the syndrome could be separated from those with a peripheral gut abnormality . by using a relatively small but carefully phenotyped cohort we identified several associations between the imd taxa , hosts ' gene expression and clinical markers suggesting that impairment of intestinal barrier may underlie both immunological and microbiological deviations often associated with pi - ibs . here \n we show that the microbial signatures that were observed in our british pi - ibs cohort were reproduced in an independent swedish pi - ibs cohort ( fig . 1 ) . \n this testifies for the robustness of these signatures in different cohorts and countries as well of the used microbial analysis pipeline . \n the main observed microbial aberration included an increased level of bacteroides spp and decreased level of uncultured clostridiales , both recently identified as contrasting tipping point taxa that reflect alternative stable states of the gut ecosystem . \n recently , similar bacterial signatures have been also detected in subjects prior to gastroenteritis , suggesting that perhaps the microbial composition already at the time of the initial infection predisposes certain subjects for pi - ibs . \n this is of significance as it allows not only to diagnose these subjects but also may provide basis for treatment . \n dietary corrections represent the major approach in managing the ibs symptoms and it is expected that their efficacy depends on the individual 's gut microbiota as microbial activity on food metabolism directly or indirectly contributes to many ibs symptoms . \n this hypothesis is supported by a pilot study among pediatric ibs patients in us . of note , \n those children whose symptoms decreased during the test diet had lower abundance of bacteroides and dialister spp . that we found to typify the pi - ibs microbiota , further stressing the relevance of these organisms in ibs . \n we believe that the proposed model ( fig . 2 ) built on microbiota - based patient stratification will not only give insight into the observed microbiota heterogeneity among ibs patients as well as its partial overlap with healthy controls , but also represents a concrete step toward improved diagnostics and novel treatment options with improved efficacy . \n \n we are grateful to our collaborators , notably prof robin spiller md and prof robert jan brummer md , for helpful discussions . \n this work was partly supported by the finland academy of sciences ( grants 137389 , 141140 and 1272870 ) and the unrestricted spinoza of the netherlands organization for scientific research .", "role": "user" }, { "content": "irritable bowel syndrome ( ibs ) is a multifactorial and heterogeneous disorder estimated to affect over 10% of the western population . \n a subset of the patients reports the start of the disease after an episode of gastroenteritis . \n the alterations in the intestinal microbiota of the post - infectious ibs ( pi - ibs ) patients were recently investigated in a british cohort and shown to differentiate from the healthy controls and resemble that of diarrhea - predominant ibs ( ibs - d ) patients . \n the altered 27 genus - like groups created a microbial signature , which could be used to objectively stratify patients and healthy controls . in this addendum \n , we combine the microbiota data derived from the british cohort with that of a recently reported swedish pi - ibs cohort . \n remarkably , robust and reproducible microbiota signatures were observed in these pi - ibs patients . \n we discuss these results with attention on the emerging role of microbiota in the classification , development and treatment of pi - ibs .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: it has been well established that being born preterm ( < 37 weeks gestational age ) is associated with adverse health and development outcomes for the infant that extend into the early childhood and beyond . \n these include neonatal morbidities , delays in motor , cognitive , and behavioral functioning during early childhood , and increased risk for chronic disease later in life [ 14 ] . \n preterm births , however , comprise a heterogeneous group with accepted designations of risk comprising very early ( < 32 weeks ) , early ( 3233 weeks ) , and late preterm births ( 3436 weeks ) . \n late preterm ( lp ) was introduced by the national institute of child health and human development in 2005 to replace the previous descriptor , near term , to more accurately capture this high risk group as preterm , requiring individual treatment according to their specific needs . in the united states , \n lp births account for approximately 70 % of all preterm deliveries , with canadian data reporting a similarly high proportion ( 74 % ) . \n recent trends have shown an overall increase in the preterm birth rate ; especially conspicuous in the united states , the preterm birthrate has increased by 36 % in 25 years , with increases in lp births accounting for much of this rise . \n indeed , between 1990 and 2005 , us statistics show that while the rate of births before 34 weeks gestation has remained unchanged , the lp birthrate has increased during the same time period [ 9 , 10 ] . \n although a slight decline in the lp birth rate in 2007 in the us has been reported , overall , lp births are both the fastest growing and largest subgroup of preterm births in north america . \n often comparable in birth weight and appearance to term infants , lp infants lag in development across a number of domains rendering them medically vulnerable [ 12 , 13 ] . \n lp newborns are frequently cared for in the general postpartum care units despite their higher risk of physiological issues such as feeding difficulties , weight loss , respiratory distress , hypoglycemia , hypothermia , hyperbilirubinemia , postural instability , immature oro - motor development , and lethargy compared to term infants [ 1318 ] . \n many of these physiological dangers place lp infants at increased risk of morbidity and mortality compared to their term counterparts [ 1921 ] . \n these lp infants often require additional observation time in the hospital , continued therapies , and are more likely to be re - admitted , or have a longer initial length of stay post delivery [ 21 , 22 ] , all of which translate into increased demands on the healthcare system , as well as to mothers , families , and caregivers . \n while the extant literature in this area suggests that short - term medical risks are common for lp infants , more research is needed to examine long - term outcomes . \n there are only a limited number of reports documenting later - life outcomes for lp infants , and more prospectively collected data is required to validate existing observations . one recent prospective investigation , drawing from a longitudinal study of cognitive and behavioral outcomes associated with low birth weight , found that at 6 years of age , children that were born lp were more likely to have lower iq and behavior problems compared to term counterparts even after controlling for maternal iq and socioeconomic status . \n these findings align with an earlier population - based study which found increased risk for adverse school - age outcomes for lp infants [ 26 , 27 ] . \n although null findings have also been reported , a recent systematic review on early childhood development of lp infants concluded that lp infants are at increased risk of poor developmental outcomes ( e.g. , neurodevelopmental disabilities , poor educational ability , early - intervention requirements ) up to school age compared to term infants . \n potential mediators and moderators of threats to development are also understudied for children born lp ; these outcomes include maternal and family health factors and emotional responses . \n some researchers have suggested that mothers of lp infants are at risk of persistent anxiety and depression . \n this is of particular concern given the influence of maternal mental health after birth on infant and child development [ 3034 ] . \n reports on maternal symptomatology associated with early preterm births have noted increased rates of depression , anxiety , and stress in both the short and long - term [ 3539 ] . \n of the few studies that have examined maternal mental health with respect to the lp infant , similar findings have been reported [ 29 , 40 ] , yet given differences in study design , timing of assessment , control for confounding variables , and source of sample population , more research is needed to inform the evidence base that drives clinical practice and policy recommendations . one small study that examined maternal mental health on day \n 34 postpartum found increased levels of anxiety , depression , and stress among mothers of lp infants compared to term infants , which , in turn , led to earlier cessation of breastfeeding . \n a recent study examined emotional distress among mothers of lp infants up to 1 month postpartum and found increased levels of anxiety , depression , post - traumatic stress , and worry compared to mothers of term infants , yet limitations noted by the authors such as small sample size , lack of baseline emotional distress , and high - risk referral source , indicate that further research is required . in summary , lp births constitute a growing public health concern yet knowledge gaps remain concerning long - term outcomes for infants and their families . in particular , postpartum mental health constitutes a significant area of investment for further research to identify effective prevention and intervention strategies to support these families . \n this study evaluated the independent influence of lp birth on maternal symptoms of anxiety , depression , and stress , while controlling for maternal demographic factors and mental health history . \n furthermore , this study examined parenting morale among lp mothers , a measure of psychological well - being that taps into a mother s internal coping resources . \n finally , this study compared immediate postnatal experiences including breastfeeding experiences and health care utilization between a group of lp maternal - infant pairs and their term counterparts . \n the all our babies ( aob ; n = 1,654 ) study is a community - based prospective pregnancy cohort study in calgary , alberta that began in 2008 . \n the overall aims were to examine maternal well - being during the perinatal period and infant outcomes such as preterm birth , and to identify the current barriers and facilitators to accessing prenatal care . \n participation in the study involved the completion of three mailed questionnaires ( < 24 weeks , 3436 weeks , 4-months postpartum ) and consent for linkage to medical records . \n the response rate across the three time points was over 80 % , with pregnancy loss or lost to follow - up constituting the most common reasons for attrition . \n the questionnaires , which included standardized scales and investigator derived questions , inquired about socio - demographics , lifestyle , heath care utilization , stress , depression , anxiety , birth outcomes , parenting morale , and breastfeeding , among other variables . \n data were cleaned to align with pre - existing data coding and cleaning guidelines [ 42 , 43 ] . for the present study \n for the purposes of the present study , we restricted the sample ( n = 1,227 ) to women giving birth to a singleton infant and excluded those with a self - reported gestational age of 37 weeks in order to limit the potential for misclassification of term status . \n two groups of women were compared : a group of mothers who self - reported a gestational age at delivery between 34 and 36 weeks ( late - preterm ; n = 77 ) and those who delivered at 38 weeks or more ( n = 1,150 ) . \n for the present analysis , the following validated instruments were used : the edinburgh postnatal depression scale ( epds ) , the cohen perceived stress scale ( pss ) , the spielberger state anxiety index ( ssai ) , and the parenting morale index , to measure maternal symptoms of depression , stress , anxiety , and parenting morale , respectively . \n example items for each standardized scale and other variables of interest for the present study are shown in section appendix . \n lp and term groups were compared on maternal characteristics as well as prenatal and immediate postpartum experiences , using chi square test / fisher s exact test for categorical variables and independent samples t test / mann whitney u for continuous variables . \n distributional assumptions were checked prior to analysis to ensure test appropriateness ( parametric vs. non - parametric ) . \n multivariable logistic regression models were performed to examine the extent to which birth status was a significant independent predictor of excessive symptoms of anxiety , depression , stress , and parenting morale at 4-months postpartum , controlling for known risk factors and confounding variables . \n demographics , prepregnancy maternal characteristics , and select pregnancy variables that were significant at the bivariate level ( p < 0.1 ) were considered for inclusion in the multivariable analyses as confounding variables . \n excluded predictors or variables not significant at the bivariate level were added to the final models , one at a time , to ensure that important confounding variables were not missed . \n factors that were considered to be intermediate variables on the causal pathway between birth status and postpartum mental health outcomes ( e.g. , breastfeeding experiences , health care utilization ) were not included in multivariable models as confounding variables as their inclusion could lead to bias of the association between birth status and mental health outcomes ( i.e. , \n blocks of variables were manually entered in a hierarchal fashion : demographic variables were entered first , followed by prepregnancy characteristics , prenatal mental health variables , and , finally , birth status . \n this study was approved by the conjoint health research ethics board of the university of calgary . \n participants provided informed consent at the time of recruitment and were provided copies for their records . \n comparison of birth status indicated that mothers of lp infants were significantly more likely to be non - caucasian ( 37.3 vs. 22.2 % ; p = 0.003 ) , to report lower household income levels ( 27.4 vs. 16.9 % ; p = 0.02 ) , and to have had a previous preterm birth ( 12.0 vs. 9.1 % ; p = 0.01 ) ( table 1 ) . \n there were no significant differences between the two groups in terms of the other demographic and prepregnancy maternal characteristics examined . \n table 2 shows comparisons between the two groups on pregnancy variables , delivery and health care utilization variables , and breastfeeding outcomes . \n significant differences between the two groups were found for all factors that were compared except for substance use during pregnancy and delivery method . \n as expected , lp singleton infants were significantly more likely than term singleton infants to be in the low birth weight category ( < 2,500 g ) ( 29.9 vs. 1.0 % ; p < 0.001 ) , and to have experienced a longer median length of stay in the hospital after birth ( 4 vs. 1.5 days ; p < 0.001 ) . \n additionally , mothers of lp infants were more likely to have reported excessive prenatal anxiety ( 40.0 vs. 27.0 % ; p = 0.015 ) and prenatal depression symptoms ( 19.5 vs. 10.0 % ; p = 0.009 ) , and to have experienced breastfeeding difficulties . in terms of the latter , \n lp infants were less likely to have breastfed within 24 h after birth ( 78.7 vs. 97.5 % ; p < \n 0.001 ) as well as before leaving the hospital ( 78.1 vs. 90.8 % ; p < 0.001 ) , and to be breastfeeding at 4 months ( 69.3 vs. 81.7 % ; p = 0.008 ) . mothers of lp infants were more likely to report being unsuccessful on their first attempt at breastfeeding ( 50.7 vs. 75.0 % ; p < 0.001 ) and to have consulted with a lactation professional before leaving the hospital ( 73.0 vs. 39.6 % ; p < 0.001 ) . \n finally , lp infants were significantly more likely than term infants to be re - hospitalized before 4 months ( 14.5 vs. 3.8 % ; p < 0.001).table 1comparison of demographic and maternal characteristics ( prepregnancy ) between the late - preterm and full - term groupscharacteristictotal sample(n = 1,227)n ( % ) lps(n = 77)n ( % ) \n terms(n = 1,150)n ( % ) \n\n p value \n maternal age \n < 25 years75 ( 6.3)8 ( 11.0)67 ( 6.0)0.242534 years871 ( 73.3)51 ( 69.9)820 ( 73.5)35 + years243 ( 20.4)14 ( 19.2)229 ( 20.5 ) \n education \n high school or less123 ( 10.1)7 ( 9.3)116 ( 10.1)0.72college , trade , university893 ( 73.3)53 ( 70.7)840 ( 73.4)grad school203 ( 16.7)15 ( 20.0)188 ( 16.4 ) \n household income \n < 60,000207 ( 17.5)20 ( 27.4)187 ( 16.9)0.0260,000 + 974 ( 82.5)53 ( 72.6)921 ( 83.1 ) \n marital status \n married / common - law1,156 ( 94.9)73 ( 97.3)1,083 ( 94.8)0.58other62 ( 5.1)2 ( 2.7)60 ( 5.2 ) \n ethnic origin \n white / caucasian937 ( 76.9)47 ( 62.7)890 ( 77.8)0.003other282 ( 23.1)28 ( 37.3)254 ( 22.2 ) \n born in canada \n yes942 ( 77.2)53 ( 70.7)889 ( 77.6)0.16no278 ( 22.8)22 ( 29.3)256 ( 22.4 ) \n history of depression \n no841 ( 68.9)56 ( 74.7)785 ( 68.7)0.27yes379 ( 31.1)19 ( 25.3)360 ( 31.4 ) \n history of other mental health problems \n no1,128 ( 91.9)69 ( 92.0)1,059 ( 92.7)0.84yes90 ( 7.4)6 ( 8.0)84 ( 7.3 ) \n history of abuse \n no851 ( 71.7)47 ( 67.1)804 ( 72.0)0.38yes336 ( 28.3)23 ( 32.9)313 ( 28.0 ) \n parity \n 0626 ( 51.6)43 ( 57.3)583 ( 51.2)0.301 + 588 ( 48.4)32 ( 42.7)556 ( 48.8 ) \n previous preterm birth \n no1,155 ( 94.7)66 ( 88.0)1,089 ( 95.2)0.01yes64 ( 15.3)9 ( 12.0)55 ( 9.1 ) \n previous lbw birth \n no1,183 ( 97.0)29 ( 85.3)578 ( 94.9)0.07yes36 ( 3.0)5 ( 14.7)31 ( 5.1 ) \n used active method to get pregnant \n no1,151 ( 94.4)74 ( 98.7)1,077 ( 94.1)0.12yes68 ( 5.6)1 ( 1.3)67 ( 5.9 ) \n lbw low birth weight \n denominator varies due to missing values for some variablestable 2comparison of pregnancy , delivery , and breastfeeding experiences between the late - preterm and full - term groupscharacteristiclps(n = 77)n ( % ) /median ( iqr ) \n terms(n = 1,150)n ( % ) /median ( iqr ) \n\n p value \n pregnancy \n smoked during pregnancy8 ( 11.0)98 ( 8.7)0.50consumed alcohol during pregnancy27 ( 37.0)454 ( 40.0)0.61prenatal depression15 ( 19.5)115 ( 10.0)0.009prenatal anxiety30 ( 40.0)309 ( 27.0)0.015 \n delivery and health care utilization \n c - section delivery19 ( 24.7)243 ( 21.2)0.47birth weight < 2,500 g23 ( 29.9)11 ( 1.0)<0.001length of infant hospital stay ( days)4.00 ( 8.24)1.50 ( 1.00)<0.001infant rehospitalization rate between discharge and 4-months11 ( 14.5)42 ( 3.8)<0.001 \n breastfeeding \n breastfeeding within 24 h after delivery59 ( 78.7)1,096 ( 97.5)<0.001successful breastfeeding on first attempt38 ( 50.7)841 ( 75.0)<0.001breastfeeding before leaving hospital57 ( 78.1)957 ( 90.8)<0.001saw a lactation consultant before leaving hospital54 ( 73.0)434 ( 39.6)<0.001still breastfeeding at 4-months postpartum52 ( 69.3)919 ( 81.7)0.008 \n denominator varies due to missing values for some variables comparison of demographic and maternal characteristics ( prepregnancy ) between the late - preterm and full - term groups \n lbw low birth weight \n denominator varies due to missing values for some variables comparison of pregnancy , delivery , and breastfeeding experiences between the late - preterm and full - term groups \n denominator varies due to missing values for some variables we performed four separate multivariable logistic regression models for each maternal mental health outcome at 4 months postpartum . we categorized mothers as reporting either excessive symptoms or not , according to validated or accepted cut - offs as per the literature ( 40 and above for anxiety ) and 13 and above for depression . for perceived stress symptoms and parenting morale at 4-months postpartum , we considered scoring above the 80th percentile ( stress ) or below the 20th percentile ( parenting morale ) of the distribution as manifestation of excessive stress and low parenting morale , respectively . each multivariable model controlled for confounding variables , a number which are also established risk factors for poor postpartum mental health ( e.g. , history of depression , prenatal depression and prenatal anxiety ) [ 4951 ] . \n final models are shown in table 3 ; each model presents the odds ratios and 95 % confidence intervals for term status as well as those covariates that remained significant at p < 0.05 . \n excluded predictors were added , one at a time , back into the final models to ensure that important confounding variables were not missed in the presence of other variables in the model . \n the final multivariable logistic regression analysis for anxiety symptoms at 4-months postpartum showed that mothers of lp infants were significantly more likely than mothers of term infants to report excessive anxiety ( or = 2.07 , 95 % ci = 1.08,3.98 ) , even after controlling for prenatal anxiety and depression , a history of depression , and household income ( table 3 ) . \n lp status was not an independent risk factor in multivariable logistic regression models for depression , stress , or parenting morale at 4-months postpartum ( table 3).table 3final multivariable logistic regression models examining the independent contribution of birth status to parenting morale , maternal anxiety , depression , and stress symptomatology at 4-months postpartumindependent variableanxietyor ( 95 % ci)depressionor ( 95 % ci)stressor ( 95 % ci)parenting moraleor ( 95 % ci)household income ( < $ 60,000)1.55 ( 1.00,2.42)1.60 ( 1.06,2.42)nulliparous0.58 ( 0.42,0.80)history of depression2.90 ( 1.99,4.24)2.79 ( 1.55,5.03)2.24 ( 1.57 , 3.20)2.36 ( 1.69,3.30)prenatal anxiety5.16 ( 3.44,7.74)3.95 ( 2.01,7.78)3.88 ( 2.66,5.66)3.54 ( 2.49,5.03)prenatal depression2.64 ( 1.64,4.27)3.60 ( 1.92,6.75)3.13 ( 1.97,4.97)1.82 ( 1.15,2.88)ever experienced abuse1.50 ( 1.07,2.10)lp birth status \n 2.07 ( 1.08,3.98 ) \n 0.73 ( 0.24,2.23)1.34 ( 0.69,2.611.23 ( 0.65,2.35)only those variable that remained significant at p < 0.05 in the final multivariable model for each respective outcome are shownsignificance value for bolded or is p = 0.029 final multivariable logistic regression models examining the independent contribution of birth status to parenting morale , maternal anxiety , depression , and stress symptomatology at 4-months postpartum only those variable that remained significant at p < 0.05 in the final multivariable model for each respective outcome are shown significance value for bolded or is p = 0.029 \n using data from a community - based prospective pregnancy cohort in calgary , alberta , we compared maternal characteristics , postnatal experiences , and symptoms of maternal anxiety , depression , stress , and parenting morale at 4-months postpartum between a group of mothers of lp infants ( n = 77 ) and a group of mothers of term infants ( n = 1,150 ) . \n the demographic profile of the aob sample , in general , is representative of the urban pregnant and parenting population in canada . \n controlling for baseline measures of distress , lp birth was associated with excessive anxiety symptoms at 4-months postpartum but not with depressive symptoms , stress , or with parenting morale . \n in addition , immediate postnatal healthcare utilization and breastfeeding outcomes were significantly different between the two groups . \n the results corroborate previous studies that suggested that lp infants and their mothers are at risk of a number of poor outcomes both immediately after delivery and the months following birth . a recent review article reported increased hospitalization rates and delayed hospital discharge due to \n poor feeding as compared to term infants or non - breastfeeding lp infants . in our study \n we found similar results in terms of increased hospitalization rates and longer hospital stay after birth for lp infants compared to term births , findings consistent with previous reports for lp infants [ 21 , 22 , 54 ] . \n our study did not allow for examination of specific reasons for delayed discharge or re - hospitalization , yet given their low breastfeeding initiation and success rates , poor feeding could be a contributing factor . \n there is some evidence to suggest earlier breastfeeding cessation rates for lps compared to terms . at 4 months postpartum \n , 69 % of the lp group was still breastfeeding compared to 82 % of the term group . \n our lower rates of breastfeeding initiation and success as reported by mothers of lp infants are in line with reports that lp infants present challenges for breastfeeding success and duration due to inadequate milk transfer , physiological issues in the infant ( e.g. , cardio respiratory insufficiency , metabolic disturbances , uncoordinated suck - swallow - breathe mechanism ) , and nicu admission and consequent maternal - infant separation [ 5 , 17 , 53 , 56 ] . given the longitudinal design of the aob study , planned analyses include examining trajectories of feeding experiences across the early life course among lps . \n longitudinal data will help to further understand feeding trajectories , including exclusive breastfeeding rates according to the world health organization criteria ( until 6 months of age and continuing for up to 2 years ) . \n maternal anxiety and depression are often co - morbid conditions that occur in the postpartum [ 5860 ] . \n given the limited number of investigations on maternal mental health outcomes for mothers of lp infants , our community - based study is a welcome addition to supplement the current evidence base . \n the multivariable regression results of our study identified increased anxiety compared to other symptoms of poor mental health at 4-months post - delivery for mothers of lp infants , which is in contrast to a recent report of emotional responses of mothers of lp and term infants . \n the authors of the latter found that mothers of lp infants had greater emotional distress on standardized measures for anxiety , depression , posttraumatic stress , and worry immediately following delivery and at one - month postpartum . \n as our follow - up time frame extended to 4-months postpartum , it is possible that initial levels of depressive and stress symptoms decrease over time . \n yet this suggestion is in contrast to another recent study that reported elevated levels of both anxiety and depression 6-months after delivery among mothers of lp infants compared to term infants . \n indeed , the interplay between stress , anxiety , depression and parenting morale as well as the specificity for long - term anxiety beyond 4-months is an area for further investigation . \n our study , in contrast to the few previous studies examining postpartum mental health among mothers of lp infants , had the advantage of having collected information on , and therefore controlling for , a history of mental health difficulties and prenatal anxiety and depression in multivariable models for postpartum distress . \n it could be that significant associations between lp birth status and postpartum maternal depression and posttraumatic stress ( for example ) previously reported were due to residual confounding , as this type of information was unavailable in those studies . \n additional strengths of the present study include its prospective design and population - based sample . by comparing a lp group to a term group with a lower bound for gestational age at 38 weeks versus the standard 37 weeks , we minimized misclassification of group status . \n given that all factors measured in the current study were based on maternal self - report , some error may have been introduced . \n we dichotomized mental health symptomatology as high or low ; although previous studies have examined symptoms in continuous form , they also present categorical findings according to clinical cut - offs and in the top quartile of the distribution . \n the continuous scores showed evidence of skewness in our sample ; for this reason and given the presence of established cut - offs in the literature for most of the scales , we used multivariable logistic regression to build the final models . \n of note , a similar pattern of results was seen when linear regression modeling was done using transformed scores ( results not shown ) . \n regardless of how these scores are ultimately handled in analyses , all studies to date share the limitation imposed by the self - report nature of maternal mental health symptoms and therefore conclusions on caseness or diagnostic classification can not be made . \n however , the prospective nature of data collection in our study minimizes the risk of recall bias of mental health at each data collection time point . \n an avenue for further research would be to examine the gradient of gestational age with maternal mental health symptomatology . \n on early childhood outcomes of lp infants concluded that lp infants fall between very preterm infants and term infants on a developmental outcome continuum , suggesting a scale of prematurity , and an inverse , linear association between gestational age and risk of longer - term disability . \n similarly , results from a recent population based cohort study suggest a dose response effect of prematurity on health outcomes at 3 and 5 years of age . \n other possible reasons for discrepant results for postpartum mental health between our study and previous ones may concern the demographic and socioeconomic profile of study participants , as our study tended to attract women with higher than average education and household incomes . given differences in the demographic profile of our participants , compared to the target populations of the relatively few studies on postpartum mental health among lp mothers [ 29 , 40 ] , which tend to be more diverse and/or characterized by low socioeconomic status , this data suggest that trajectories of maternal mental health among lp mothers of relatively affluent socioeconomic status may also differ . in summary , results from our study suggest that lp infants are a vulnerable group , impacting both infant and maternal mental health , in particular , immediate breastfeeding challenges and excessive anxiety at 4-months postpartum . \n given the unique challenges of lp birth , it is imperative that further research into the precursors , correlates , and outcomes associated with a lp birth continue in order to best support their specific maternal and infant needs . \n see table 4.table 4select variables assessed in the aob study used in the present studycandidate variable ( data collection time point ) \n source / phrasingscoring and/or coding information \n standardized scales \n prenatal and postnatal depressive symptoms ( t1t3):edinburgh postnatal depression scale10 item questionnaire . \n after reverse scoring for some items , a total score is derived ( range 030 ) . \n we used a standard cut - off as per the literature ( 13 and above ) to identify high depressive symptoms . \n participants are instructed to respond to each item with respect to the past 7 days . \n example items include : in the past 7 days , i have felt sad or miserable ; in the past 7 days , i have been so unhappy that i have been cryingprenatal and postnatal stress symptoms ( t1t3):perceived stress scale10 item questionnaire . \n after reverse scoring for some items , a total score is derived ( range 040 ) . \n a cut - off at the 80th percentile of the sample distribution was used to classify women as manifesting high stress symptoms . \n example items include : felt unable to cope with all the things you had to do ; felt that difficulties were piling up so high that you could nt overcome themprenatal and postnatal anxiety symptoms ( t1t3):spielberger state anxiety inventory20 item questionnaire . \n after reverse scoring for some items , a total score is derived ( range 2080 ) . \n we used an established cut - off of 40 or more to classify women as experiencing high anxiety symptoms . \n participants are instructed to respond to each item as of right now ( in this moment ) . \n after reverse scoring for some items , a total score is derived ( range 1050 ) . \n higher scores reflect better parenting morale . a cut - off at the 20th percentile of the sample distribution was used to classify women as reporting low parenting morale . \n participants are instructed to respond to each item with respect to their daily life as a parent . \n select single - item questions \n parity ( t1):combination of the following : have you been pregnant before ? \n ; have you ever experienced a miscarriage , stillbirth , abortion , neonatal death or live birth?yes / nohistory of depression ( t1):have you ever experienced feeling sad , blue , depressed or down for most of the time for at least 2 weeks?yes / noever experienced abuse ( t2):based on 5 questions : have you ever experienced physical abuse ; emotional abuse ; sexual abuse ; financial abuse ; or neglect?yes / noterm / birth status ( t3):how many weeks pregnant were you when your baby was born?number of weeks . \n we categorized gestational age at birth into two groups : late preterms ( 3436weeks gestational age at birth ) and terms ( 38 + weeks gestational age at birth)length of infant hospital stay ( days ; t3):after your baby was born , how long was their hospital stay?number of daysinfant rehospitalization rate between discharge and 4-months ( t3):has your baby stayed overnight in the hospital ( not including when he / she was first born nor nicu ) ? \n this variable was dichotomized into none versus at least oncebreastfeeding within 24 h after delivery ( t3):was your first attempt at breastfeeding your baby within 24 h of giving birth?yes / nosuccessful breastfeeding on first attempt ( t3):were you able to successfully breastfeed on your first attempt?yes / nobreastfeeding before leaving the hospital ( t3):were you able to breastfeed before you went home from the hospital?yes / nosaw a lactation consultant before leaving hospital ( t3):did you see a lactation consultant before you went home from the hospital?yes / nostill breastfeeding at 4-months postpartum ( t3):are you still breastfeeding your baby?yes / no \n t1 < 24 weeks gestational age , t2 3436 weeks gestational age , t3 4-months postpartum select variables assessed in the aob study used in the present study \n t1 < 24 weeks gestational age , t2 3436 weeks gestational age , t3 4-months postpartum", "role": "user" }, { "content": "the objective of this study was to compare breastfeeding , postpartum mental health , and health service utilization between a group of late preterm ( lp ) maternal infant pairs and term counterparts . \n data was drawn from a prospective community - based cohort in calgary , alberta . \n bivariate and multivariable analyses were performed . \n lp infants were more likely to have had a longer median length of stay after birth ( p < 0.001 ) and a higher re - hospitalization rate at 4-months ( p < 0.001 ) compared to term infants . \n mothers of lp infants were more likely to report immediate breastfeeding difficulties ( p < 0.001 ) and earlier cessation of breastfeeding at 4-months postpartum ( p = 0.008 ) . \n multivariable analyses revealed that lp status was an independent risk factor for excessive symptoms of maternal anxiety ( or = 2.07 ; 95 % ci = 1.08,3.98 ) , but not for depression , stress , or low parenting morale . lp \n infants and their families are a vulnerable population with unique developmental trajectories . \n further longitudinal research is required .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: liver cirrhosis is a leading cause of death in patients with chronic hepatitis b ( chb ) and can lead to portal hypertension , which causes end - stage liver diseases such as oesophageal variceal bleeding ( 1 ) and hepatic encephalopathy ( 2 ) . \n the 5-year survival rate was 80% - 85% in patients with compensated cirrhosis , while 14% - 35% in patients with decompensated cirrhosis ( 3 , 4 ) . \n since antiviral therapy can reduce progression of cirrhosis and prevent hepatic decompensation in patients with compensated cirrhosis ( 5 - 7 ) , an early diagnosis of compensated cirrhosis is critical for improving patient prognosis . \n the specificity of ultrasonography , computed tomography ( ct ) and magnetic resonance imaging ( mri ) to detect cirrhosis is high . \n imaging reveals an inhomogeneous hepatic texture or surface , a rarefied hepatic central vein , an enlarged caudate lobe and splenomegaly or collateral veins . \n however , these imaging modalities are not sensitive enough to detect cirrhosis ( 8) and liver biopsy is still the gold standard for diagnosis . given the invasive nature of liver biopsy , several noninvasive indices have been developed for prediction of cirrhosis in chb ( 9 - 11 ) . \n transient electrograph ( fibroscan ) is a method for assessing liver cirrhosis , but is limited due to its expensive cost ( 12 ) . \n thus , who suggested to use aminotransferase / platelet ratio index ( apri ) for the assessment of liver cirrhosis in developing countries ( 13 ) . nonetheless , apri has only a moderate diagnostic accuracy ( 14 - 16 ) . \n therefore , it is reasonable to explore other serum - based noninvasive tests to predict compensated cirrhosis . \n recent studies revealed that serum hepatitis b surface antigen ( hbsag ) levels are inversely correlated with fibrosis scores ( 17 , 18 ) and high serum hbsag levels can identify insignificant fibrosis in treatment - naive hepatitis b e antigen ( hbeag)-positive hepatitis b virus ( hbv ) carriers ( 19 - 22 ) . due to the above reasons , serum hbsag levels \n in this study , we aimed to determine the performance of serum hbsag level as a biomarker for compensated cirrhosis in hbeag - positive chb patients . \n patients with hbeag - positive chb and treatment - naive were included in this retrospective study . \n patients were recruited from huashan hospital , fudan university and xixi hospital of hangzhou , zhejiang province during june 2007 to may 2014 . \n all patients were hbsag and hbeag positive for at least six months before enrollment in the study . \n exclusion criteria were concomitant liver diseases including chronic hepatitis c or d infection , wilson s disease , autoimmune hepatitis and primary biliary cirrhosis . \n patients with decompensated cirrhosis or those consuming a significant amount of alcohol were excluded ( 30 g / day for men , 20 g / day for women ) as well . \n in addition , patients with inadequate serum for analysis or different opinions on liver biopsy were excluded . according to the inclusion and exclusion criteria , \n the study was approved by the ethical committee of huashan hospital ( 200705 ) and xixi hospital of hangzhou ( 201309 ) . \n relevant clinical variables included age , sex , serum alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , albumin ( a ) , and globulin ( g ) levels , platelet ( plt ) counts . \n alt , ast , a and total protein levels were measured in unicel dxc 800 using synchron system kits ( beckman coulter ) , and g levels were determined by subtracting the amount of albumin levels from the total protein levels . in addition , plt counts were measured in sysmex xt-1800i using its corresponding commercially available kit ( sysmex corporation ) . \n serum hbv dna levels were measured in lightcycle using the cobas taqman assay ( roche diagnostics ) , with a linear range of 20 - 1.98 10 iu / ml . \n samples with hbv dna levels higher than 1.98 10 iu / ml were diluted at 1:100 for retesting . \n serum hbsag , hbeag and antibody to hepatitis b e antigen ( anti - hbe ) were measured using commercially available immunoassays ( abbott laboratories , chicago , il ) . \n serum hbsag level detection value ranged from 0.05 to 250 iu / ml and samples with an hbsag level > 250 iu / ml required a 1:500 or greater dilution . \n furthermore , our laboratory passed the certificate from the college of american pathologists ( cap ) . \n ast to platelet ratio index ( apri ) was evaluated for grading the extent of liver fibrosis . \n apri = ( ast [ iu / l])/(uln , 40 at our laboratory)/(plt [ 10/l ] ) 100 ( 23 ) . \n liver biopsy was performed using a 16-gauge menghini needle and specimens were fixed in formalin and embedded in paraffin . \n hematoxylin - eosin and reticular fibre staining or masson staining were performed on each section . \n grading of inflammation ( g ) and staging of fibrosis ( s ) were determined using the modified scheuer scoring system ( 24 ) and scored as g0 - g4 and s0 - s4 , respectively . \n if there were different opinions on the stage of liver biopsy , the patient was excluded . \n all data were processed using stata 10.0 software ( stata corporation , college station , tx , usa ) . \n parametric variables were expressed as mean standard deviation ( sd ) and nonparametric were expressed as median ( p25 , p75 ) , assessed by student t - test ( parameter ) or mann - whitney ( non - parameter ) test as appropriate . \n additionally , independent factors associated with compensated cirrhosis were identified using multivariate logistic regression analysis . \n furthermore , area under receiver - operator curve ( auc ) was used to calculate the diagnostic accuracy of serum hbsag and apri and detailed information including sensitivity , specificity , positive predictive values ( ppvs ) and negative predictive values ( npvs ) for relevant cut - offs were also displayed . \n the youden index , defined as sensitivity plus specificity minus one , was used to identify the optimal level of prediction . \n patients with hbeag - positive chb and treatment - naive were included in this retrospective study . \n patients were recruited from huashan hospital , fudan university and xixi hospital of hangzhou , zhejiang province during june 2007 to may 2014 . \n all patients were hbsag and hbeag positive for at least six months before enrollment in the study . \n exclusion criteria were concomitant liver diseases including chronic hepatitis c or d infection , wilson s disease , autoimmune hepatitis and primary biliary cirrhosis . \n patients with decompensated cirrhosis or those consuming a significant amount of alcohol were excluded ( 30 g / day for men , 20 g / day for women ) as well . \n in addition , patients with inadequate serum for analysis or different opinions on liver biopsy were excluded . according to the inclusion and exclusion criteria , \n the study was approved by the ethical committee of huashan hospital ( 200705 ) and xixi hospital of hangzhou ( 201309 ) . \n relevant clinical variables included age , sex , serum alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , albumin ( a ) , and globulin ( g ) levels , platelet ( plt ) counts . \n alt , ast , a and total protein levels were measured in unicel dxc 800 using synchron system kits ( beckman coulter ) , and g levels were determined by subtracting the amount of albumin levels from the total protein levels . in addition , plt counts were measured in sysmex xt-1800i using its corresponding commercially available kit ( sysmex corporation ) . \n serum hbv dna levels were measured in lightcycle using the cobas taqman assay ( roche diagnostics ) , with a linear range of 20 - 1.98 10 iu / ml . \n samples with hbv dna levels higher than 1.98 10 iu / ml were diluted at 1:100 for retesting . \n serum hbsag , hbeag and antibody to hepatitis b e antigen ( anti - hbe ) were measured using commercially available immunoassays ( abbott laboratories , chicago , il ) . \n serum hbsag level detection value ranged from 0.05 to 250 iu / ml and samples with an hbsag level > 250 iu / ml required a 1:500 or greater dilution . \n furthermore , our laboratory passed the certificate from the college of american pathologists ( cap ) . \n ast to platelet ratio index ( apri ) was evaluated for grading the extent of liver fibrosis . \n apri = ( ast [ iu / l])/(uln , 40 at our laboratory)/(plt [ 10/l ] ) 100 ( 23 ) . \n liver biopsy was performed using a 16-gauge menghini needle and specimens were fixed in formalin and embedded in paraffin . \n hematoxylin - eosin and reticular fibre staining or masson staining were performed on each section . \n grading of inflammation ( g ) and staging of fibrosis ( s ) were determined using the modified scheuer scoring system ( 24 ) and scored as g0 - g4 and s0 - s4 , respectively . \n if there were different opinions on the stage of liver biopsy , the patient was excluded . \n all data were processed using stata 10.0 software ( stata corporation , college station , tx , usa ) . \n parametric variables were expressed as mean standard deviation ( sd ) and nonparametric were expressed as median ( p25 , p75 ) , assessed by student t - test ( parameter ) or mann - whitney ( non - parameter ) test as appropriate . \n additionally , independent factors associated with compensated cirrhosis were identified using multivariate logistic regression analysis . \n furthermore , area under receiver - operator curve ( auc ) was used to calculate the diagnostic accuracy of serum hbsag and apri and detailed information including sensitivity , specificity , positive predictive values ( ppvs ) and negative predictive values ( npvs ) for relevant cut - offs were also displayed . \n the youden index , defined as sensitivity plus specificity minus one , was used to identify the optimal level of prediction . \n only three patients with compensated cirrhosis were classified in child - pugh class b and the remainder were in class a. patients with compensated cirrhosis were categorized as cc group ( n = 62 ) and those without cirrhosis were categorized as non - cirrhotic group ( n = 139 ) . \n all of the variables were nonparametric . nevertheless , when we changed hbv dna and hbsag to log10 hbv dna and log10 hbsag , they both accorded with normal distribution . \n comparison of patients with cc group and non - cirrhotic group showed that patients in the cc group were older , had lower alt , albumin and plt levels , higher ast levels and lower hbsag and hbv dna levels ( p < 0.05 ) . in our research , 24 patients had fibrosis stage s0 , and 38 , 43 , 34 , 62 patients had stages s1 , s2 , s3 , s4 , respectively . \n in addition , nine patients had inflammation grading g0 and 31 , 39 , 66 , 56 patients had g1 , g2 , g3 , g4 , respectively . there was a strong inverse correlation between serum hbsag and fibrosis ( r = -0.668 , p < 0.001 ) , while no correlation between serum hbsag and inflammation ( r = -0.129 , p = 0.201 ) ( figure 2 ) . \n abbreviations : a , serum albumin ; alt , alanine aminotransferase ; ast , aspartate aminotransferase ; cc group , patients with compensated cirrhosis ; g , serum globulin ; hbsag , hepatitis b surface antigen ; and plt , platelet count . \n serum hbsag were expressed as mean standard deviation , the results showed that serum hbsag decreased with the process of fibrosis . \n there was a strong inverse correlation between serum hbsag and fibrosis ( r = -0.668 , p < 0.001 ) . \n serum hbsag level ( log10 iu / ml ) for the cc group and non - cirrhotic group were 3.27 0.71 and 4.17 0.57 ( p < 0.001 ) , respectively ( figure 3 ) . \n serum hbsag levels were significantly lower for cc group compared to non - cirrhotic group . \n cc group : patients with compensated cirrhosis ; non - cirrhotic group : patients without cirrhosis . \n the univariate and multivariate analyses of factors predictive of cirrhosis in hbeag positive chb patients are shown in table 2 . \n older age , lower platelet count , lower albumin level , higher ast level , lower hbsag and hbv dna level were all associated with compensated cirrhosis in the univariate analysis . \n abbreviations : 95% ci , 95% confidence interval ; alt , alanine aminotransferase ; ast , aspartate aminotransferase ; hbsag , hepatitis b surface antigen ; hbv , hepatitis b virus ; or , odds ratio ; and plt , platelet . after adjusting for different clinical parameters , independent factors associated with compensated cirrhosis included lower albumin level ( or 0.938 ; 95% ci 0.894 to 0.990 ; p = 0.011 ) , lower serum hbsag level ( or 0.100 ; 95% ci 0.037 to 0.272 \n ; p < 0.001 ) and lower plt count ( or 0.973 ; 95% ci 0.959 - 0.986 ; p \n < 0.001 ) ( table 2 ) . as an independent factor associated with compensated cirrhosis , \n the roc curves of serum hbsag levels in predicting compensated cirrhosis are depicted in figure 4 ( roc , 0.856 ; standard error , 0.028 , p < 0.001 ; 95% confidence interval , 0.799 - 0.914 ) . \n based on the youden index , the optimal cutoff level of serum hbsag to predict cc was 3.60 log10 iu / ml ( 4000 iu / ml ) , which was able to predict compensated cirrhosis with a sensitivity of 80.3% , specificity of 82.4% , positive predictive value of 66.2% and negative predictive value of 90.7% . \n serum hbsag < 500 iu / ml ( 2.70 log10 iu / ml ) was 100% predictive of compensated cirrhosis . \n for the purpose identifying but not excluding cirrhosis , thereby reciprocal of the serum hbsag ( 1/hbsag ) was made in roc curves . \n abbreviations : hbsag , hepatitis b surface antigen ; and apri , aspartate aminotransferase to platelet ratio index . \n previous studies had identified apri as a predictor of cirrhosis . in the current study , \n the roc curves of apri in predicting compensated cirrhosis are depicted in figure 4 ( roc , 0.699 ; standard error , 0.038 , p < 0.001 ; 95% confidence interval 0.625 - 0.772 ) . \n 43.2% of patients with apri more than 2 had compensated cirrhosis ( figure 5 ) . \n moreover , we examined the rates of compensated cirrhosis among patients with hbsag below 3.6 log10 iu / ml and apri more than 2 and taking into account their proportion of compensated cirrhosis . \n the results showed that among the above subgroups , 75.0% ( 15/20 ) achieved compensated cirrhosis ( figure 5 ) . \n abbreviations : apri , aspartate aminotransferase to platelet ratio index ; and hbsag , hepatitis b surface antigen . \n only three patients with compensated cirrhosis were classified in child - pugh class b and the remainder were in class a. patients with compensated cirrhosis were categorized as cc group ( n = 62 ) and those without cirrhosis were categorized as non - cirrhotic group ( n = 139 ) . \n all of the variables were nonparametric . nevertheless , when we changed hbv dna and hbsag to log10 hbv dna and log10 hbsag , they both accorded with normal distribution . \n comparison of patients with cc group and non - cirrhotic group showed that patients in the cc group were older , had lower alt , albumin and plt levels , higher ast levels and lower hbsag and hbv dna levels ( p < 0.05 ) . in our research , 24 patients had fibrosis stage s0 , and 38 , 43 , 34 , 62 patients had stages s1 , s2 , s3 , s4 , respectively . \n in addition , nine patients had inflammation grading g0 and 31 , 39 , 66 , 56 patients had g1 , g2 , g3 , g4 , respectively . there was a strong inverse correlation between serum hbsag and fibrosis ( r = -0.668 , p < 0.001 ) , while no correlation between serum hbsag and inflammation ( r = -0.129 , p = 0.201 ) ( figure 2 ) . \n abbreviations : a , serum albumin ; alt , alanine aminotransferase ; ast , aspartate aminotransferase ; cc group , patients with compensated cirrhosis ; g , serum globulin ; hbsag , hepatitis b surface antigen ; and plt , platelet count . \n serum hbsag were expressed as mean standard deviation , the results showed that serum hbsag decreased with the process of fibrosis . \n there was a strong inverse correlation between serum hbsag and fibrosis ( r = -0.668 , p < 0.001 ) . \n serum hbsag level ( log10 iu / ml ) for the cc group and non - cirrhotic group were 3.27 0.71 and 4.17 0.57 ( p < 0.001 ) , respectively ( figure 3 ) . \n serum hbsag levels were significantly lower for cc group compared to non - cirrhotic group . \n cc group : patients with compensated cirrhosis ; non - cirrhotic group : patients without cirrhosis . \n the univariate and multivariate analyses of factors predictive of cirrhosis in hbeag positive chb patients are shown in table 2 . \n older age , lower platelet count , lower albumin level , higher ast level , lower hbsag and hbv dna level were all associated with compensated cirrhosis in the univariate analysis . \n abbreviations : 95% ci , 95% confidence interval ; alt , alanine aminotransferase ; ast , aspartate aminotransferase ; hbsag , hepatitis b surface antigen ; hbv , hepatitis b virus ; or , odds ratio ; and plt , platelet . after adjusting for different clinical parameters , independent factors associated with compensated cirrhosis included lower albumin level ( or 0.938 ; 95% ci 0.894 to 0.990 ; p = 0.011 ) , lower serum hbsag level ( or 0.100 ; 95% ci 0.037 to 0.272 ; p < 0.001 ) and lower plt count ( or 0.973 ; 95% ci 0.959 - 0.986 ; p < 0.001 ) ( table 2 ) . \n as an independent factor associated with compensated cirrhosis , the roc curves of serum hbsag levels in predicting compensated cirrhosis are depicted in figure 4 ( roc , 0.856 ; standard error , 0.028 , p < 0.001 ; 95% confidence interval , 0.799 - 0.914 ) . based on the youden index , \n the optimal cutoff level of serum hbsag to predict cc was 3.60 log10 iu / ml ( 4000 iu / ml ) , which was able to predict compensated cirrhosis with a sensitivity of 80.3% , specificity of 82.4% , positive predictive value of 66.2% and negative predictive value of 90.7% . \n serum hbsag < 500 iu / ml ( 2.70 log10 iu / ml ) was 100% predictive of compensated cirrhosis . for the purpose identifying but not excluding cirrhosis , thereby reciprocal of the serum hbsag ( 1/hbsag ) was made in roc curves . \n abbreviations : hbsag , hepatitis b surface antigen ; and apri , aspartate aminotransferase to platelet ratio index . \n previous studies had identified apri as a predictor of cirrhosis . in the current study , \n the roc curves of apri in predicting compensated cirrhosis are depicted in figure 4 ( roc , 0.699 ; standard error , 0.038 , p < 0.001 ; 95% confidence interval 0.625 - 0.772 ) . \n 43.2% of patients with apri more than 2 had compensated cirrhosis ( figure 5 ) . moreover , we examined the rates of compensated cirrhosis among patients with hbsag below 3.6 log10 iu / ml and apri more than 2 and taking into account their proportion of compensated cirrhosis . \n the results showed that among the above subgroups , 75.0% ( 15/20 ) achieved compensated cirrhosis ( figure 5 ) . \n abbreviations : apri , aspartate aminotransferase to platelet ratio index ; and hbsag , hepatitis b surface antigen . \n although liver biopsy is a gold standard for the diagnosis of liver cirrhosis , it is an expensive and invasive procedure associated with patient discomfort , a small risk of serious bleeding and requires specialist histological examination for accurate staging ( 13 ) . \n we performed this study in a treatment - naive chinese cohort of hbeag - positive chb patients . \n serum hbsag was analyzed in patients with or without cirrhosis and was evaluated as a predictive marker of compensated cirrhosis . \n the results indicated that hbsag level could predict compensated cirrhosis independently ( or 0.100 ; p < 0.001 ) . \n in addition , plt count and albumin level were independently related to compensated cirrhosis as expected , which were similar with previous studies ( 25 , 26 ) . in our study , the optimal cut - off level of serum hbsag to predict cirrhosis was 3.60 log10 iu / ml ( 4000 iu / ml ) , which may be used to distinguish compensated cirrhotic patients from non - cirrhotic patients . \n our results suggest that hbeag - positive patients with hbsag below 3.60 log10 iu / ml ( 4000 iu / ml ) were at high risk of developing compensated cirrhosis . moreover , serum hbsag below 2.70 log10 iu / ml ( 500 iu / ml ) was 100% predictive of compensated cirrhosis in our research group . \n thus , hbeag - positive patients with hbsag below 2.70 log10 iu / ml ( 500 iu / ml ) are more likely to have compensated cirrhosis even with no evidence in imaging scan . in previous studies , \n several indices have been proposed as potential noninvasive predictors of cirrhosis in chb patients , including fib-4 , apri and fibroscan . \n fib-4 index , first characterized in an hiv - hcv co - infected population and subsequently evaluated in hcv - infected subjects , may perform favorably to determine the extent of fibrosis in patients with chb ( 27 ) . \n nonetheless , it has been developed and validated for detection of fibrosis stages s3 but not cirrhosis ( 13 , 28 ) . \n apri is based on two indirect markers of fibrosis , a single high cut - off more than 2 is used for identifying patients with cirrhosis . \n however , an apri score more than 2 could detect only one third of patients with cirrhosis ( 29 ) . \n fibroscan had a relatively high auroc in predicting cirrhosis compared to apri while is limited by its high cost ( 30 ) . \n in addition , the expenses for preventive , corrective maintenance and trained operators are high . \n therefore , the new who treatment guideline for hbv recommended that apri could be used to predict cirrhosis ( 13 ) in developing countries . in our research \n , we evaluated the predictive value among subgroups of patients stratified by apri and serum hbsag . \n the results showed that the rate of compensated cirrhosis increased from 66.2% to 75.0% after combining the apri > 2 and hbsag < 3.6 log10 iu / ml . the above results indicated that apri combined with hbsag could further improve the predictive value to some extent . \n many studies have shown that serum hbsag level decreased with fibrosis progress ( 20 - 22 , 31 ) , which were similar with our finding ( cc group 3.27 log10 iu / ml vs. non - cirrhotic group 4.17 log10 iu / ml , p < 0.001 ) . \n the mechanism of the association between hbsag and cirrhosis may be related to the fact that patients with cirrhosis have a diminished ability to support viral replication ( 18 ) . \n ( 17 ) concluded that during disease escalation , active host immunity would be triggered against hbv replication and possibly results in chronic liver injury , which leads to decrease of hbsag and develop of liver fibrosis . \n ( 32 ) demonstrated that pres / s hbv mutants were positively correlated with cirrhosis , which decreased the level of serum hbsag . \n it is advised that chb patients with compensated cirrhosis should be treated to prevent further clinical events , even if the hbv dna level is low or undetectable ( 13 ) . \n serum hbsag measuring is less expensive , largely automatic and requires only phlebotomy . according to our results , hbsag combined with apri \n firstly , information on hbv genotypes was not available . whereas , the major hbv genotypes in china are b and c , which are virtually indistinguishable for hbsag expression pattern ( 33 ) and have similar prediction of fibrosis severity ( 21 , 34 ) . \n therefore , randomized prospective studies with larger sample size are needed to validate our results . in conclusion , patients with compensated cirrhosis caused by chb have significantly lower hbsag levels compared to those without cirrhosis . \n serum hbsag level less than 3.60 log10 iu / ml ( 4000 iu / ml ) may serve as a noninvasive candidate biomarker for compensated cirrhosis . \n thus , this special population should be closely monitored to receive proper treatment timely . \n abbreviations : hbsag , hepatitis b surface antigen ; lr+ , positive likelihood rate ; lr- , negative likelihood rate ; npv , negative predictive value ; and ppv , positive predictive value .", "role": "user" }, { "content": "backgrounds : serum hepatitis b surface antigen ( hbsag ) levels are associated with fibrosis in patients with chronic hepatitis b ( chb ) infection.objectives:the aim of our study was to evaluate serum hbsag level as a biomarker for compensated cirrhosis in hepatitis b e antigen ( hbeag ) positive chb patients.patients and methods : two - hundred and one hbeag - positive chinese chb patients with or without cirrhosis were enrolled in this retrospective study . \n cirrhosis was diagnosed based on liver biopsy . \n furthermore , patients with decompensated cirrhosis were excluded . \n a statistical analysis was performed regarding the association between serum hbsag level and compensated cirrhosis.results:patients with compensated cirrhosis had a significantly lower mean serum hbsag level compared to those without cirrhosis ( 3.27 log10 iu / ml vs 4.17 log10 iu / ml , p < 0.001 ) . \n furthermore , examining the correlation with compensated cirrhosis revealed that lower level of serum hbsag was a significant factor in multivariate analysis . \n the area under the receiver operating characteristics curve of serum hbsag was 0.856 for compensated cirrhosis . \n a positive predictive value of 66.2% and negative predictive value of 90.7% were obtained with a cut - off value of < 3.60 log10 iu / ml ( 4000 iu / ml ) of serum hbsag . moreover \n , the rate of compensated cirrhosis increased to 75.0% after combining with apri > 2.conclusions:in hbeag positive chb patients , low serum hbsag level is a useful predictor of compensated cirrhosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: vitamin and mineral deficiencies adversely affect a third of the world 's population ( 49 ) , and it is estimated that one in five people worldwide lack sufficient dietary zinc ( 41 ) . \n adolescent girls may be more prone to zinc deficiency because physiological requirements for zinc peak during adolescence at the time of the pubertal growth spurt , which generally occurs in girls between 10 and 15 years ( 50 ) . \n especially , adolescents from developing countries such as india are at high risk because of low zinc intakes and poor bioavailability of zinc from vegetarian diets , which leads to low zinc status . in adolescents , a wide range of disturbances \n occur due to zinc deficiency , including impaired growth , defects in the immune system , dermatitis , diarrhoea , delayed sexual and bone maturation , impaired taste acuity and behavioural changes ( 41 ) . \n simple measures such as diet quality index are used to assess adherence to dietary guidelines . to identify micronutrient deficiencies in adolescents , in particular that of zinc \n , a simple tool needs to be devised , which can judge the micronutrient quality of diet \n . such an index would be of vital importance for identifying at - risk individuals and targeting the intervention programmes . \n guidelines by who have recommended food - based approaches to resolve micronutrient deficiencies ( 49 ) . \n moreover , zinc - rich dietary supplement has a potential to revert bad health effects of low zinc status . \n therefore , increasing consumption of foods with a high content of absorbable zinc can become a long - term sustainable strategy to overcome zinc deficiency . \n considering the enhancers and inhibitors in vegetarian diets ( 18 ) , low - cost food recipes need to be devised to provide high bio - available zinc . \n studies have documented positive effects of zinc supplements in infants and children for morbidity and growth ( 51 ) . \n however , research on the beneficial effects of improved zinc nutrition for behaviour and cognitive function in school - age children is critically needed because zinc deficiency continues to be a modern health concern in both developing and developed countries ( 46 , 52 ) . \n the present research aimed to study zinc status and its association with profile of other micronutrients , and to examine the effect of zinc supplementation on functional indices of zinc in adolescent girls . \n the specific objectives of the study were : to study zinc status and its association with the profile of other micronutrients , cognitive performance and taste acuity of the adolescent girls.to examine the diet patterns of vegetarian adolescent girls for zinc adequacy and devise recipes to improve bio - available zinc intakes.to develop and validate a nutrient quality index to assess micronutrient sufficiency of diets using statistical techniques and bioavailability of micronutrients.to examine efficacy of dietary supplementation on blood micronutrient levels and functional indices of zinc . \n to study zinc status and its association with the profile of other micronutrients , cognitive performance and taste acuity of the adolescent girls . to examine the diet patterns of vegetarian adolescent girls for zinc adequacy and devise recipes to improve bio - available zinc intakes . to develop and validate a nutrient quality index to assess micronutrient sufficiency of diets using statistical techniques and bioavailability of micronutrients . to examine efficacy of dietary supplementation on blood micronutrient levels and functional indices of zinc . \n the study was conducted in two secondary schools from pune city , maharashtra state , in western india , during 20052007 . in all , 662 girls participated in the study . a physician conducted clinical examinations to assess health status of the girls . \n girls who were currently suffering or those who had suffered the previous fortnight from any illness such as fever , respiratory or gastro - intestinal infections or those undergoing medical treatment or taking multi - vitamin mineral supplements as per a physician 's recommendation were excluded . \n thus in all , 630 apparently healthy girls aged 1016 years from the participating schools were recruited for the study . \n details of the procedures involved in the study were explained to the parents . after giving consent , \n the study protocol was reviewed and approved by the ethics committee of zensar foundation of india , pune , under the chairmanship of a retired professor of the international institute of population sciences , mumbai . \n all of the parents gave their written informed consent , and the girls voluntarily participated in the study . \n nutrient intakes were estimated using cooked foods database ( 53 ) and nutritive value tables ( 54 ) . \n venous blood samples ( 10 ml ) were collected at 7.30 am after an overnight fast for each girl . \n haemoglobin ( hb ) was estimated using automated cell counter ( actdiff ii , beckman coulter , fullerton , ca , usa ) . \n plasma levels of zinc , vitamin c , -carotene and retinol were measured as per the methods in the manual by national institute of nutrition , india ( 55 ) , and erythrocyte zinc was measured as per the method described by kenny et al . \n reference serum ( randox laboratories , india ) was used as a standard for blood estimations . \n cognitive performance was evaluated using a group of four tests standardised on indian children ; simple reaction time ( srt ) , recognition reaction time ( rrt ) , raven 's progressive matrices ( rpm ) and visual memory on each participant ( 5759 ) . srt and rrt measure the cognitive speed concerning perception , processing and motor response organisation for reaction tasks and visual search . \n srt and rrt were measured using a visual reaction time apparatus ( anand agencies , pune , india ) designed as per the procedure given by woodworth et al . \n rpm is a nonverbal test of performance that measures a person 's ability to form perceptual relations and reason by analogy in research settings and form comparisons ( 58 ) . \n a short - term visual memory test was carried out for measuring the ability of the girls to retain and reproduce information within a short time span . \n this test was adopted from the subtest of pgi memory scale developed by the post graduate institute of medical education and research , chandigarh , india , for children and adolescents ( 59 ) . \n taste acuity was assessed by identifying recognition threshold for salt ( rts ) using 10 different salt solutions ranging from 0 to 25 \n more details of the measurements and methods used in the study are presented in five research papers ( 6064 ) . \n the study was conducted in two secondary schools from pune city , maharashtra state , in western india , during 20052007 . in all , 662 girls participated in the study . a physician conducted clinical examinations to assess health status of the girls . \n girls who were currently suffering or those who had suffered the previous fortnight from any illness such as fever , respiratory or gastro - intestinal infections or those undergoing medical treatment or taking multi - vitamin mineral supplements as per a physician 's recommendation were excluded . \n thus in all , 630 apparently healthy girls aged 1016 years from the participating schools were recruited for the study . \n details of the procedures involved in the study were explained to the parents . after giving consent , \n the study protocol was reviewed and approved by the ethics committee of zensar foundation of india , pune , under the chairmanship of a retired professor of the international institute of population sciences , mumbai . \n all of the parents gave their written informed consent , and the girls voluntarily participated in the study . \n girls who were currently suffering or those who had suffered the previous fortnight from any illness such as fever , respiratory or gastro - intestinal infections or those undergoing medical treatment or taking multi - vitamin mineral supplements as per a physician 's recommendation were excluded . \n thus in all , 630 apparently healthy girls aged 1016 years from the participating schools were recruited for the study . \n details of the procedures involved in the study were explained to the parents . after giving consent , \n the study protocol was reviewed and approved by the ethics committee of zensar foundation of india , pune , under the chairmanship of a retired professor of the international institute of population sciences , mumbai . \n all of the parents gave their written informed consent , and the girls voluntarily participated in the study . \n nutrient intakes were estimated using cooked foods database ( 53 ) and nutritive value tables ( 54 ) . \n venous blood samples ( 10 ml ) were collected at 7.30 am after an overnight fast for each girl . \n haemoglobin ( hb ) was estimated using automated cell counter ( actdiff ii , beckman coulter , fullerton , ca , usa ) . \n plasma levels of zinc , vitamin c , -carotene and retinol were measured as per the methods in the manual by national institute of nutrition , india ( 55 ) , and erythrocyte zinc was measured as per the method described by kenny et al . \n reference serum ( randox laboratories , india ) was used as a standard for blood estimations . \n cognitive performance was evaluated using a group of four tests standardised on indian children ; simple reaction time ( srt ) , recognition reaction time ( rrt ) , raven 's progressive matrices ( rpm ) and visual memory on each participant ( 5759 ) . \n srt and rrt measure the cognitive speed concerning perception , processing and motor response organisation for reaction tasks and visual search . \n srt and rrt were measured using a visual reaction time apparatus ( anand agencies , pune , india ) designed as per the procedure given by woodworth et al . \n rpm is a nonverbal test of performance that measures a person 's ability to form perceptual relations and reason by analogy in research settings and form comparisons ( 58 ) . \n a short - term visual memory test was carried out for measuring the ability of the girls to retain and reproduce information within a short time span . \n this test was adopted from the subtest of pgi memory scale developed by the post graduate institute of medical education and research , chandigarh , india , for children and adolescents ( 59 ) . \n taste acuity was assessed by identifying recognition threshold for salt ( rts ) using 10 different salt solutions ranging from 0 to 25 mmol / l ( 40 ) . \n more details of the measurements and methods used in the study are presented in five research papers ( 6064 ) . \n average age , weight , height and body mass index of the girls were 12.21 1.11 years , 33.05 7.22 kg , 143.74 8.24 cm and 15.81 2.62 kg / m , respectively . \n twenty - four percent of the girls were below the 5th percentile and 2.1% were above the 85th percentile of the indian reference bmi for age ( 65 ) . \n family size of the girls ranged from 2 to 11 persons in the household , with an average of 5 2 persons . amongst fathers , \n parents educational status indicated that 13.8% of the fathers and 9.0% of the mothers completed high school , and 18.7% of the fathers and 13.2% of the mothers completed a college education . \n the mean intake of energy and protein was 1373 381 kcal / d and 30.4 9.6 g / d , respectively . \n comparison with age sex - specific reference intake indicated that these intakes were 68.7 and 60% of recommendation ( 24 ) . \n average calcium , iron , -carotene and vitamin c intakes were 289 146 , 6.9 2.3 , 619 564 and 25.6 14.5 mg / d , respectively . \n thus , average intakes of micronutrients were 3060% of the respective rdi , indicating dietary deficiencies of these minerals and vitamins in the girls \n . the present study has offered estimates of prevalence of dietary micronutrient deficiencies in indian urban adolescent girls , which are in agreement with previous findings on rural indian adolescents ( 13 , 16 ) and available studies on urban slum adolescents ( 14 , 15 ) . \n however , data on zinc intake are missing in these studies and the current literature . \n we have observed that average zinc intake ( 3.6 1.2 mg / d ) of the girls was low , around 40% of the indian rdi for zinc ( 66 ) , with almost all girls having their zinc intake below rdi . \n plasma zinc levels were low ( < 0.7 mg / l ) ( 41 ) in 72.4% , and erythrocyte zinc levels were low ( < 8 g / g of packed cells ) ( 56 ) in 23.6% of the girls . \n prevalence of anemia ( hb < 12 g / dl ) was 27.2% , and 26.6% girls had low serum ferritin lpar ; ( < 12 g / l ) ( 67 ) . \n plasma retinol was below the normal cutoff of 200 g / l ( 68 ) in 65.4% girls . \n plasma vitamin c level of 10.8% girls was below the normal cut - off of 0.2 mg / dl ( 69 p. 534 ) , and 67.6% of the girls had low plasma vitamin c status . \n this high prevalence of micronutrient deficiencies confirmed inadequate dietary intakes of micronutrients by the girls from the study group . \n paper i described the cognitive performance and assessed its relation with status of zinc and other micronutrients ( 60 ) . \n the data on cognitive scores in our girls indicated that 60% of the girls were slow in simple reaction tasks , 71.5% of the girls had their rpm scores below 50th percentile and memory deficits were seen in 44% girls ( 60 ) . \n reaction time and rpm percentiles of majority of the girls were below the normal range , indicating deficits in the cognitive performance of the girls . to explore the relative significance of dietary nutrient intakes with cognitive performance , weighted multiple regression adjusted for energy intake \n the analysis revealed that intakes of -carotene , iron and zinc were significant predictors for srt ( p<0.01 ) . \n further , our study also examines association of biomarkers of iron and zinc with cognitive scores of the girls . \n we have noted that plasma zinc and erythrocyte zinc were negatively correlated with srt and rrt and positively with memory and rpm ( p<0.05 ) , whereas hb was significantly correlated with rrt ( p<0.05 ) in girls with iron deficiency anaemia . \n taste rts was found to be high in 45.2% girls , indicating impaired taste function . \n rts showed significant negative correlation with erythrocyte zinc ( r = 0.25 , p<0.05 ) , implying that lower the zinc status higher would be the salt concentration for taste perception . \n thus , our data indicated high prevalence of micronutrient deficiencies including zinc in adolescent girls . \n moreover , we observed improvement in cognitive performance and taste perception with increased blood zinc levels in the girls . \n therefore , an attempt has been made to develop zinc - rich recipes to improve total and bio - available zinc intake of the girls . in paper ii ( 61 ) , dietary food intakes on three random days by 24-hour recall were analysed for investigating prevailing diet patterns in the girls . \n it was observed that the girls were consuming rice - legumes meals , wheat - legumes / vegetables , mixed meals or bakery items . in all , the consumption of 86 different food items was reported by the girls during the 3 days diet recall . \n of these , 19 foods were different cereals preparations comprising rice , wheat or millets , ; 16 were legume preparations ; seven different bakery products ; five leafy vegetables ; 14 other vegetables ; 13 fried foods ; six fruits ; and six milk and milk products . \n these foods were categorised into 12 food groups based on their major ingredients , such as rice , whole wheat , pearl millet , sorghum , bakery products , fried foods , sprouts , un - sprouted legumes , leafy vegetables , other vegetables , milk and milk products and fruits . \n for example , plain rice , rice flakes and puffed rice were categorised under the rice food group , or foods such as unleavened pancakes ( chapatti , paratha , roti ) were categorised under the wheat group . \n food intake data from 12 food subgroups were used to identify diet patterns of the girls . \n principal component analysis was performed to identify diet patterns using orthogonal rotation method ( varimax ) . \n food subgroups with factor loading > 0.3 , eigenvalues and percentage of variance explained by each of the major dietary patterns identified in adolescent girls is given in table 1 . \n the factor loading indicated the degree to which the girls diet conformed to one of the dietary patterns identified . \n five patterns with eigenvalues greater than one were identified , which explained about 55.1% of the variance ( table 1 ) . \n the patterns were characterised by typical combination of major cereal with food subgroups , namely ( 1 ) rice meal , ( 2 ) snack type meal , ( 3 ) wheat meal , ( 4 ) pearl millet meal and ( 5 ) sorghum meal ( 61 ) . \n food subgroups , eigenvalues and percentage of variance explained by major dietary patterns identified adolescent girls \n extraction method : principle component analysis . \n the results indicated that consumption of healthy foods mainly whole grains , sprouts and vegetables were high in wheat , pearl millet or sorghum - based patterns than the rice meal and the snacks type meal ( p<0.05 ) . \n in general , girls with the rice meal and the snacks type meal had low micronutrient intakes and low intake of bio - available zinc and iron than girls from other diet patterns ( p<0.05 ) . \n however , all diet patterns were deficient in micronutrients including zinc when compared with the rdi ( 24 , 66 ) ; mainly due to low intakes of healthy foods by the girls . \n recipes were devised considering the dietary habits of the girls and representing each of the five diet patterns . \n recipes were formulated ( 1 ) using foods that have high zinc contents such as pearl millet , chick peas , soybean , rajma , green gram , amaranthus seeds and onion stalks ( 54 ) . amongst the zinc - rich foods , \n selection was made on the basis of higher bio - availability ( 32 ) and local availability ; ( 2 ) zinc density of the recipes was increased by using small amounts of sesame , amaranthus and pumpkin seeds ; and ( 3 ) using methods like sprouting / fermentation , which increase the bio - availability of recipes . \n dialysability of the recipes was determined by simulating gastrointestinal conditions and atomic absorption spectrometry ( model 3110 , perkin elmer , norwalk , ct , usa ) . \n contents of -carotene and vitamin c were measured by spectrophotometry ( beckman coulter , inc . \n energy , protein , calcium and iron contents were computed using the indian national database of nutrient composition of raw foods ( 54 ) and adjusting for observed moisture contents of cooked recipes . \n average energy and protein content per 100 g of cooked weight of the recipes was 205 kcal and 2.5 mg , respectively . \n average content of zinc was 1.5 mg/100 g of cooked weight , which was three times more than the observed average daily intake ( 0.47 mg/ 100 g cooked weight ) of the girls . \n average zinc dialysability of the recipes was 18.3% , which was observed to be higher than 11% dialysability of the diets consumed by the girls . \n the zinc - rich snacks containing meat developed for kenyan schoolchildren provided 2.89 mg/225 g of zinc ( 37 ) , which was similar to the zinc content of proposed study ( 3.3 mg/225 g ) . \n thus , consumption of these new recipes as a supplement to the existing diet has potential to improve zinc intake of the vegetarian girls . \n contents of iron , calcium , -carotene and vitamin c were 6.2 g , 105 mg , 716 g and 4.4 mg , respectively . \n wallis test indicated that the mean content of micronutrients such as iron , -carotene , vitamin c of new recipes were significantly higher than the observed intakes of the girls ( p<0.01 ) . \n therefore , modification in the existing diet using these recipes can increase micronutrient intakes of the girls . for assessing dietary inadequacies of zinc and other micronutrients , especially in vegetarian populations , a simple tool such as micronutrient quality index is required to identify at - risk individuals . \n it is important to consider the content as well as bio - availability of micronutrients for evaluation of dietary adequacy . \n we have developed adolescent micronutrient quality index ( amqi ) to classify an individual with nutritional deficiencies ( paper iii ) ( 62 ) using the indian dietary guidelines ( 24 ) and the recent us dietary guidelines for choice of healthy foods and habits ( 23 ) . \n food intake data collected through 24-hour recall method for 3 days were utilised to develop the amqi . \n information about frequency of consuming sprouts , fermented foods and habit of taking tea with meals was utilised to judge bio - available intakes . \n efficacy of the amqi was assessed by studying its associations with nutrient intakes , micronutrient adequacy ratio , body mass index and plasma biomarkers of -carotene , vitamin c and zinc . \n the amqi is divided into 13 components , where each component represents a specific grouping of foods . \n seven components measured the degree of compliance , with recommendations for the major food groups such as cereals and millets , legumes , milk and milk products , vegetables , fruits , sugar and visible fats / oils . \n six components relate to healthy eating and micronutrient bio - availability such as adherence to at least 50% consumption of whole grains and micronutrient - dense legumes ( i.e. chick pea , moth beans , lentil ) , food variety ( 23 , 26 , 70 , 71 ) , use of practices enhancing bio - availability and component to evaluate excess fried food intake ( 71 ) . \n each component was scored from zero indicating lack of adherence to its maximum score for full adherence , with intermediate scores calculated to indicate the degree of adherence with dietary recommendations . \n the mean amqi score was 41.59.4 , and 86.8% girls had the amqi score lower than 50 , indicating inadequate dietary nutrient intakes by the girls . \n the majority of the girls showed adherence to three of the healthy choice components , i.e. at least 50% grains as whole grains , low frequency of consuming fried foods and greater food variety . \n adherence by the girls to the consumption of micronutrient dense pulses , sprouts , salad and fermented foods and not consuming tea with meals was poor . \n association of socio - demographic variables with amqi was evaluated using the data on family size , mother 's and father 's education and occupation . in our data , mother 's education and occupation were significantly associated with amqi . a logistic regression analysis of the amqi with socio - demographic factors revealed that age , mother 's education and occupation were significantly and positively associated with the amqi ( r \n = 0.07 , p<0.01 ) . \n partial correlations of the micronutrient intakes with the amqi scores after adjusting for energy intake and socio - demographic factors were at the range of 0.40.5 and were statistically significant ( p<0.01 ) , which demonstrated the concurrent validity of the new index . \n higher amqi scores were associated with higher concentrations of plasma vitamin c ( r=0.26 ) , -carotene ( r=0.34 ) and zinc ( r=0.12 ) after controlling for socio - demographic factors ( p<0.05 ) . \n thus , the amqi provides an updated measure to evaluate micronutrient quality of diets of lacto - vegetarian indian adolescent girls . \n our index is the first of its kind to consider bio - availability aspects of diet in the evaluation of diet quality . \n we anticipate that such concept of emphasising adequate contents and bio - availability of micronutrients while constructing the diet quality index can be widely applicable to different lacto - vegetarian population groups , although some of the components of the index may require modification with respect to nutrient requirements of different age sex groups and food habits . \n dietary intervention strategies have been identified as the principal approach to tackle nutritional problems in the population . \n we have developed diet supplements in the form of zinc - rich recipes to improve intake of zinc and other micronutrients . \n an intervention trial was conducted to determine the efficacy of proposed recipes in improving zinc and other micronutrient status ( paper iv ) ( 63 ) and functional indices of zinc ( paper v ) ( 64 ) . \n effect of the diet supplementation was viewed in light of supplementing ayurvedic zinc ( jasad bhasma ) tablet . \n diet and jasad supplementation both showed a significant increase in plasma zinc ( 9.9 and 61.3% , respectively ) ( p<0.01 ) ( 63 ) . \n further , the diet supplement showed significant increase in blood status of -carotene and vitamin c as compared to control group ( p<0.01 ) . \n thus , devising such recipes would prove a better sustainable strategy for promoting micronutrient status of adolescents . \n our results demonstrated the beneficial effects of zinc supplementation on cognitive scores of the girls by reducing reaction time ( 613% ) and improving in memory ( 25% ) and rpm scores ( 15% ) than the control group ( 64 ) . \n median recognition threshold for salt taste reduced significantly from 5 to 2.5 mmol / l after both diet and zinc supplementation ( p<0.01 ) ; however , it remained same in the control group . \n this suggests a positive effect of supplementation on cognitive performance and taste acuity of the girls . \n as observed in our study , decrease in reaction time has been reported by pennland et al . \n furthermore , our study demonstrated that zinc supplementation improved memory and non - verbal intelligence in adolescent girls as well as established positive effect of zinc supplementation on taste perception . \n thus , zinc supplementation through diet or ayurvedic jasad tablet not only improves zinc status of the girls but also was a useful strategy for improving cognitive performance and taste acuity function in adolescent girls . \n the mean intake of energy and protein was 1373 381 kcal / d and 30.4 9.6 g / d , respectively . \n comparison with age sex - specific reference intake indicated that these intakes were 68.7 and 60% of recommendation ( 24 ) . \n average calcium , iron , -carotene and vitamin c intakes were 289 146 , 6.9 2.3 , 619 564 and 25.6 14.5 mg / d , respectively . \n thus , average intakes of micronutrients were 3060% of the respective rdi , indicating dietary deficiencies of these minerals and vitamins in the girls . \n the present study has offered estimates of prevalence of dietary micronutrient deficiencies in indian urban adolescent girls , which are in agreement with previous findings on rural indian adolescents ( 13 , 16 ) and available studies on urban slum adolescents ( 14 , 15 ) . \n however , data on zinc intake are missing in these studies and the current literature . \n we have observed that average zinc intake ( 3.6 1.2 mg / d ) of the girls was low , around 40% of the indian rdi for zinc ( 66 ) , with almost all girls having their zinc intake below rdi . \n plasma zinc levels were low ( < 0.7 mg / l ) ( 41 ) in 72.4% , and erythrocyte zinc levels were low ( < 8 g / g of packed cells ) ( 56 ) in 23.6% of the girls . \n prevalence of anemia ( hb < 12 g / dl ) was 27.2% , and 26.6% girls had low serum ferritin lpar ; ( < 12 g / l ) ( 67 ) . \n plasma retinol was below the normal cutoff of 200 g / l ( 68 ) in 65.4% girls . \n plasma vitamin c level of 10.8% girls was below the normal cut - off of 0.2 mg / dl ( 69 p. 534 ) , and 67.6% of the girls had low plasma vitamin c status . \n this high prevalence of micronutrient deficiencies confirmed inadequate dietary intakes of micronutrients by the girls from the study group . \n paper i described the cognitive performance and assessed its relation with status of zinc and other micronutrients ( 60 ) . \n the data on cognitive scores in our girls indicated that 60% of the girls were slow in simple reaction tasks , 71.5% of the girls had their rpm scores below 50th percentile and memory deficits were seen in 44% girls ( 60 ) . reaction time and rpm percentiles of majority of the girls were below the normal range , indicating deficits in the cognitive performance of the girls . to explore the relative significance of dietary nutrient intakes with cognitive performance , weighted multiple regression adjusted for energy intake \n the analysis revealed that intakes of -carotene , iron and zinc were significant predictors for srt ( p<0.01 ) . \n further , our study also examines association of biomarkers of iron and zinc with cognitive scores of the girls . \n we have noted that plasma zinc and erythrocyte zinc were negatively correlated with srt and rrt and positively with memory and rpm ( p<0.05 ) , whereas hb was significantly correlated with rrt ( p<0.05 ) in girls with iron deficiency anaemia . \n taste rts was found to be high in 45.2% girls , indicating impaired taste function . \n rts showed significant negative correlation with erythrocyte zinc ( r = 0.25 , p<0.05 ) , implying that lower the zinc status higher would be the salt concentration for taste perception . \n thus , our data indicated high prevalence of micronutrient deficiencies including zinc in adolescent girls . \n moreover , we observed improvement in cognitive performance and taste perception with increased blood zinc levels in the girls . \n therefore , an attempt has been made to develop zinc - rich recipes to improve total and bio - available zinc intake of the girls . \n in paper ii ( 61 ) , dietary food intakes on three random days by 24-hour recall were analysed for investigating prevailing diet patterns in the girls . \n it was observed that the girls were consuming rice - legumes meals , wheat - legumes / vegetables , mixed meals or bakery items . in all , the consumption of 86 different food items was reported by the girls during the 3 days diet recall . of these , \n 19 foods were different cereals preparations comprising rice , wheat or millets , ; 16 were legume preparations ; seven different bakery products ; five leafy vegetables ; 14 other vegetables ; 13 fried foods ; six fruits ; and six milk and milk products . \n these foods were categorised into 12 food groups based on their major ingredients , such as rice , whole wheat , pearl millet , sorghum , bakery products , fried foods , sprouts , un - sprouted legumes , leafy vegetables , other vegetables , milk and milk products and fruits . \n for example , plain rice , rice flakes and puffed rice were categorised under the rice food group , or foods such as unleavened pancakes ( chapatti , paratha , roti ) were categorised under the wheat group . \n food intake data from 12 food subgroups were used to identify diet patterns of the girls . \n principal component analysis was performed to identify diet patterns using orthogonal rotation method ( varimax ) . \n food subgroups with factor loading > 0.3 , eigenvalues and percentage of variance explained by each of the major dietary patterns identified in adolescent girls is given in table 1 . \n the factor loading indicated the degree to which the girls diet conformed to one of the dietary patterns identified . \n five patterns with eigenvalues greater than one were identified , which explained about 55.1% of the variance ( table 1 ) . \n the patterns were characterised by typical combination of major cereal with food subgroups , namely ( 1 ) rice meal , ( 2 ) snack type meal , ( 3 ) wheat meal , ( 4 ) pearl millet meal and ( 5 ) sorghum meal ( 61 ) . \n food subgroups , eigenvalues and percentage of variance explained by major dietary patterns identified adolescent girls \n extraction method : principle component analysis . \n the results indicated that consumption of healthy foods mainly whole grains , sprouts and vegetables were high in wheat , pearl millet or sorghum - based patterns than the rice meal and the snacks type meal ( p<0.05 ) . in general , girls with the rice meal and the snacks type meal had low micronutrient intakes and low intake of bio - available zinc and iron than girls from other diet patterns ( p<0.05 ) \n however , all diet patterns were deficient in micronutrients including zinc when compared with the rdi ( 24 , 66 ) ; mainly due to low intakes of healthy foods by the girls . \n in paper ii ( 61 ) , dietary food intakes on three random days by 24-hour recall were analysed for investigating prevailing diet patterns in the girls . \n it was observed that the girls were consuming rice - legumes meals , wheat - legumes / vegetables , mixed meals or bakery items . in all , the consumption of 86 different food items was reported by the girls during the 3 days diet recall . of these , \n 19 foods were different cereals preparations comprising rice , wheat or millets , ; 16 were legume preparations ; seven different bakery products ; five leafy vegetables ; 14 other vegetables ; 13 fried foods ; six fruits ; and six milk and milk products . \n these foods were categorised into 12 food groups based on their major ingredients , such as rice , whole wheat , pearl millet , sorghum , bakery products , fried foods , sprouts , un - sprouted legumes , leafy vegetables , other vegetables , milk and milk products and fruits . \n for example , plain rice , rice flakes and puffed rice were categorised under the rice food group , or foods such as unleavened pancakes ( chapatti , paratha , roti ) were categorised under the wheat group . \n food intake data from 12 food subgroups were used to identify diet patterns of the girls . \n principal component analysis was performed to identify diet patterns using orthogonal rotation method ( varimax ) . \n food subgroups with factor loading > 0.3 , eigenvalues and percentage of variance explained by each of the major dietary patterns identified in adolescent girls is given in table 1 . \n the factor loading indicated the degree to which the girls diet conformed to one of the dietary patterns identified . \n five patterns with eigenvalues greater than one were identified , which explained about 55.1% of the variance ( table 1 ) . \n the patterns were characterised by typical combination of major cereal with food subgroups , namely ( 1 ) rice meal , ( 2 ) snack type meal , ( 3 ) wheat meal , ( 4 ) pearl millet meal and ( 5 ) sorghum meal ( 61 ) . \n food subgroups , eigenvalues and percentage of variance explained by major dietary patterns identified adolescent girls \n extraction method : principle component analysis . \n the results indicated that consumption of healthy foods mainly whole grains , sprouts and vegetables were high in wheat , pearl millet or sorghum - based patterns than the rice meal and the snacks type meal ( p<0.05 ) . in general , girls with the rice meal and the snacks type meal had low micronutrient intakes and low intake of bio - available zinc and iron than girls from other diet patterns ( p<0.05 ) \n however , all diet patterns were deficient in micronutrients including zinc when compared with the rdi ( 24 , 66 ) ; mainly due to low intakes of healthy foods by the girls . \n recipes were devised considering the dietary habits of the girls and representing each of the five diet patterns . \n recipes were formulated ( 1 ) using foods that have high zinc contents such as pearl millet , chick peas , soybean , rajma , green gram , amaranthus seeds and onion stalks ( 54 ) . amongst the zinc - rich foods , \n selection was made on the basis of higher bio - availability ( 32 ) and local availability ; ( 2 ) zinc density of the recipes was increased by using small amounts of sesame , amaranthus and pumpkin seeds ; and ( 3 ) using methods like sprouting / fermentation , which increase the bio - availability of recipes . \n dialysability of the recipes was determined by simulating gastrointestinal conditions and atomic absorption spectrometry ( model 3110 , perkin elmer , norwalk , ct , usa ) . \n contents of -carotene and vitamin c were measured by spectrophotometry ( beckman coulter , inc . \n energy , protein , calcium and iron contents were computed using the indian national database of nutrient composition of raw foods ( 54 ) and adjusting for observed moisture contents of cooked recipes . \n average energy and protein content per 100 g of cooked weight of the recipes was 205 kcal and 2.5 mg , respectively . \n average content of zinc was 1.5 mg/100 g of cooked weight , which was three times more than the observed average daily intake ( 0.47 mg/ 100 g cooked weight ) of the girls . \n average zinc dialysability of the recipes was 18.3% , which was observed to be higher than 11% dialysability of the diets consumed by the girls . \n the zinc - rich snacks containing meat developed for kenyan schoolchildren provided 2.89 mg/225 g of zinc ( 37 ) , which was similar to the zinc content of proposed study ( 3.3 mg/225 g ) . \n thus , consumption of these new recipes as a supplement to the existing diet has potential to improve zinc intake of the vegetarian girls . \n contents of iron , calcium , -carotene and vitamin c were 6.2 g , 105 mg , 716 g and 4.4 mg , respectively . \n wallis test indicated that the mean content of micronutrients such as iron , -carotene , vitamin c of new recipes were significantly higher than the observed intakes of the girls ( p<0.01 ) . \n therefore , modification in the existing diet using these recipes can increase micronutrient intakes of the girls . \n for assessing dietary inadequacies of zinc and other micronutrients , especially in vegetarian populations , a simple tool such as micronutrient quality index is required to identify at - risk individuals . \n it is important to consider the content as well as bio - availability of micronutrients for evaluation of dietary adequacy . \n we have developed adolescent micronutrient quality index ( amqi ) to classify an individual with nutritional deficiencies ( paper iii ) ( 62 ) using the indian dietary guidelines ( 24 ) and the recent us dietary guidelines for choice of healthy foods and habits ( 23 ) . \n food intake data collected through 24-hour recall method for 3 days were utilised to develop the amqi . \n information about frequency of consuming sprouts , fermented foods and habit of taking tea with meals was utilised to judge bio - available intakes . \n efficacy of the amqi was assessed by studying its associations with nutrient intakes , micronutrient adequacy ratio , body mass index and plasma biomarkers of -carotene , vitamin c and zinc . \n the amqi is divided into 13 components , where each component represents a specific grouping of foods . \n seven components measured the degree of compliance , with recommendations for the major food groups such as cereals and millets , legumes , milk and milk products , vegetables , fruits , sugar and visible fats / oils . \n six components relate to healthy eating and micronutrient bio - availability such as adherence to at least 50% consumption of whole grains and micronutrient - dense legumes ( i.e. chick pea , moth beans , lentil ) , food variety ( 23 , 26 , 70 , 71 ) , use of practices enhancing bio - availability and component to evaluate excess fried food intake ( 71 ) . \n each component was scored from zero indicating lack of adherence to its maximum score for full adherence , with intermediate scores calculated to indicate the degree of adherence with dietary recommendations . \n the mean amqi score was 41.59.4 , and 86.8% girls had the amqi score lower than 50 , indicating inadequate dietary nutrient intakes by the girls . \n the majority of the girls showed adherence to three of the healthy choice components , i.e. at least 50% grains as whole grains , low frequency of consuming fried foods and greater food variety . \n adherence by the girls to the consumption of micronutrient dense pulses , sprouts , salad and fermented foods and not consuming tea with meals was poor . \n association of socio - demographic variables with amqi was evaluated using the data on family size , mother 's and father 's education and occupation . in our data , mother 's education and occupation were significantly associated with amqi . a logistic regression analysis of the amqi with socio - demographic factors revealed that age , mother 's education and occupation were significantly and positively associated with the amqi ( r \n = 0.07 , p<0.01 ) . partial correlations of the micronutrient intakes with the amqi scores after adjusting for energy intake and socio - demographic factors were at the range of 0.40.5 and were statistically significant ( p<0.01 ) , which demonstrated the concurrent validity of the new index . \n higher amqi scores were associated with higher concentrations of plasma vitamin c ( r=0.26 ) , -carotene ( r=0.34 ) and zinc ( r=0.12 ) after controlling for socio - demographic factors ( p<0.05 ) . \n thus , the amqi provides an updated measure to evaluate micronutrient quality of diets of lacto - vegetarian indian adolescent girls . \n our index is the first of its kind to consider bio - availability aspects of diet in the evaluation of diet quality . \n we anticipate that such concept of emphasising adequate contents and bio - availability of micronutrients while constructing the diet quality index can be widely applicable to different lacto - vegetarian population groups , although some of the components of the index may require modification with respect to nutrient requirements of different age sex groups and food habits . \n dietary intervention strategies have been identified as the principal approach to tackle nutritional problems in the population . \n we have developed diet supplements in the form of zinc - rich recipes to improve intake of zinc and other micronutrients . \n an intervention trial was conducted to determine the efficacy of proposed recipes in improving zinc and other micronutrient status ( paper iv ) ( 63 ) and functional indices of zinc ( paper v ) ( 64 ) . \n effect of the diet supplementation was viewed in light of supplementing ayurvedic zinc ( jasad bhasma ) tablet . \n diet and jasad supplementation both showed a significant increase in plasma zinc ( 9.9 and 61.3% , respectively ) ( p<0.01 ) ( 63 ) . \n further , the diet supplement showed significant increase in blood status of -carotene and vitamin c as compared to control group ( p<0.01 ) . \n thus , devising such recipes would prove a better sustainable strategy for promoting micronutrient status of adolescents . \n our results demonstrated the beneficial effects of zinc supplementation on cognitive scores of the girls by reducing reaction time ( 613% ) and improving in memory ( 25% ) and rpm scores ( 15% ) than the control group ( 64 ) . \n median recognition threshold for salt taste reduced significantly from 5 to 2.5 mmol / l after both diet and zinc supplementation ( p<0.01 ) ; however , it remained same in the control group . \n this suggests a positive effect of supplementation on cognitive performance and taste acuity of the girls . \n as observed in our study , decrease in reaction time has been reported by pennland et al . \n furthermore , our study demonstrated that zinc supplementation improved memory and non - verbal intelligence in adolescent girls as well as established positive effect of zinc supplementation on taste perception . \n thus , zinc supplementation through diet or ayurvedic jasad tablet not only improves zinc status of the girls but also was a useful strategy for improving cognitive performance and taste acuity function in adolescent girls . \n the present research provided first - hand estimates of micronutrient deficiencies in a cohort of urban indian adolescent girls . \n our data demonstrated that the diets of the girls were deficient in zinc and other micronutrients . \n blood biomarkers of zinc and vitamin a were below the normal range in majority of the girls . \n dietary zinc deficiency and low blood zinc status lead to poor cognition and taste perception amongst adolescent girls . \n therefore , there is a concurrent requirement of a simple tool to identify dietary micronutrient deficiencies and a diet intervention strategy to improve zinc and other micronutrient status of the girls . \n the new diet quality index i.e. amqi has successfully assessed micronutrient deficiency risk among study population and thus provided an updated measure to assess micronutrient quality of diets of lacto - vegetarian adolescent girls . \n an intervention trial on a group of 180 girls has demonstrated effectiveness of the proposed recipes in improving zinc status . \n large - scale studies are needed to confirm its potential as a diet diversification strategy for vegetarian population . \n this study is the only one so far to demonstrate a positive effect of zinc supplementation in improving cognitive performance and taste acuity of adolescent girls . \n effect of zinc supplementation on other aspects of health such as bone development , infections and obesity may be studied in adolescents . \n thus , the findings of the research demonstrate the necessity of adopting healthy micronutrient - rich diets for positive health building in adolescents . \n further , from a global perspective , the methodologies and approaches used to assess dietary inadequacies in the form of amqi and diet diversification strategies could be useful to explore and alleviate problem of micronutrient deficiencies in population . \n this study was funded as a part of the project by zensar foundation , india .", "role": "user" }, { "content": "backgroundzinc is important in adolescence because of its role in growth and sexual maturation . \n adolescents from developing countries such as india may be at high risk of zinc deficiency because of unwholesome food habits and poor bioavailability of zinc from plant - based diets.objective(1 ) to study zinc status and its association with profile of other micronutrients , ( 2 ) to construct a simple tool in the form of adolescent micronutrient quality index ( amqi ) to assess quality of diets of the girls and ( 3 ) to examine the effect of zinc supplement on health of adolescent girls.methodsgirls ( 1016 years ) from two secondary schools of pune , maharashtra state , in western india were enrolled in a cross - sectional study ( n = 630 ) . \n data were collected on dietary intake , cognitive performance , taste acuity , haemoglobin , erythrocyte zinc and plasma levels of zinc , vitamin c , -carotene and retinol . \n amqi was developed using age sex - specific indian dietary guidelines and healthy foods and habits described in the recent us dietary guidelines . \n zinc - rich recipes were developed considering habitual diets of the girls and vegetarian sources of zinc . \n an intervention trial ( n = 180 ) was conducted to assess the effect of zinc - rich dietary supplements and ayurvedic zinc ( jasad ) supplementation.resultsprevalence of micronutrient deficiencies was high in these girls . \n poor cognitive performance was seen in half of the girls , and salt taste perception was affected in 45% . \n amqi was correlated with nutrient intakes and blood micronutrient levels ( p < 0.01 ) , indicating the potential of amqi to measure micronutrient quality of diets of adolescent girls . results of the intervention trial indicated that supplementation of zinc - rich recipes vis - a - vis ayurvedic jasad zinc has the potential to improve plasma zinc status , cognitive performance and taste acuity in adolescent girls.conclusionsreview of the studies on indian adolescent girls demonstrates the necessity of adopting zinc and micronutrient - rich diets for positive health building in adolescents .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a total of 38 randomly drawn elementary schools from two different counties participated in the fvmm project , and nine schools within one of the counties were randomly selected as intervention schools and participated in the norwegian school fruit program for free during the school year 2001/2002 ( 11 ) . in the present study , \n the free subscription program started in october 2001 , and lasted throughout the school year ( i.e. until june 2002 ) . \n questionnaire surveys were conducted in september 2001 ( baseline ) , may 2002 , may 2003 , may 2005 , and september 2009 . sample size and number of clusters \n were determined according to an expected increase in fv consumption of 45% in the intervention group . with this , the study aimed to include 40 schools with 2 classes per school , in total 1,600 pupils at baseline and 1,300 in the follow - up - study . \n the allocation , randomization , and enrollment of clusters were done by the project group . \n small schools with fewer than 10 pupils per grade level were excluded from the sampling frame ( 17 ) . \n the fvmm cohort includes 1,950 pupils ( 6th and 7th graders at baseline ) : 984 boys and 966 girls , 585 in the free fruit group and 1,365 in the control group . \n a total of 320 pupils ( 16% ) participated at the follow - up survey in september 2009 , and constitute the study sample for the present study , of which 282 also participated in the 2005 survey . \n , 296 of the study sample had a parent / guardian who completed a parent questionnaire . \n the average parental age was 40.5 years , and 86% of the parents were mothers / female guardians . \n baseline characteristics from 2001 to 2002 of all particpants , those lost to follow - up , and those remaining in the triala \n participants are children from schools in the norwegian counties hedmark and telemark . \n ( a ) : baseline characteristics differences between those in the free fruit and control group in the full cohort . \n ( b ) : baseline characteristics differences between those lost to follow - up ( attrition ) and the present study sample ( persons having data in both 2001/2002 and 2009 ) . \n ( c ) : baseline characteristics differences between the free fruit and control in the present study sample . \n ( d ) : baseline characteristics differences between the free fruit and control in the loss to follow - up'group . \n free fruit pupils are those who particpated in the norwegian school fruit programme for free during 2001/2002 . \n a survey questionnaire was completed by the pupils in the classroom in the presence of a trained project worker ( surveys conducted within 20012005 ) . \n body mass index ( bmi ) was calculated based on these measures of height and weight . \n age and sex - specific cut off points ( 18 ) were used to categorize adolescents in the 2005 survey , while a bmi of 25 or above was used in 2009 as the criteria for being categorized as overweight ( including obese ) . \n self - reported perceived weight status were assessed by the following question at all surveys ; are you on a ( slimming ) diet , with the following response alternatives : no , my weight is ok , no , but i should be on a ( slimming ) diet , and yes. the two last alternatives were seen to indicate that the responders perceive themselves as too heavy / overweight . \n a new variable was calculated by combining these two to : ( 1=i am too heavy , 0=my weight is ok ) . \n the pupils reported their own sex and parents recorded their level of education at baseline ( lower : no college or university education / higher : having attended college or university ) . \n fv intake was based on two different measures ; 24-h recall ( portions / day ) and a food frequency questions ( ffq , times / week ) . \n consumption of unhealthy snacks ( ffq , times / week ) was calculated as previously described ( 11 ) . \n this study was conducted according to the guidelines laid down in the declaration of helsinki . written informed consent \n research clearance was obtained from the norwegian social science data services . describing the sample , \n differences between the intervention and the control group , and between the study sample and those participating in the baseline survey but not in the 2009 survey ( attrition ) were analyzed using t - test for continuous variables and chi - square statistics for the categorical variables ( table 1 ) . as we did not have baseline data for weight status , we assume there is no baseline difference between the groups , and the effects of the intervention on weight status were considered if there were differences in overweight prevalence in the intervention and control group at follow - up . \n model 1 included intervention condition only ( free fruit vs. control ) . model 2 included sex and age ( class level ) + model 1 . \n a total of 38 randomly drawn elementary schools from two different counties participated in the fvmm project , and nine schools within one of the counties were randomly selected as intervention schools and participated in the norwegian school fruit program for free during the school year 2001/2002 ( 11 ) . in the present study , \n the free subscription program started in october 2001 , and lasted throughout the school year ( i.e. until june 2002 ) . \n questionnaire surveys were conducted in september 2001 ( baseline ) , may 2002 , may 2003 , may 2005 , and september 2009 . sample size and number of clusters \n were determined according to an expected increase in fv consumption of 45% in the intervention group . with this , the study aimed to include 40 schools with 2 classes per school , in total 1,600 pupils at baseline and 1,300 in the follow - up - study . \n the allocation , randomization , and enrollment of clusters were done by the project group . \n small schools with fewer than 10 pupils per grade level were excluded from the sampling frame ( 17 ) . \n the fvmm cohort includes 1,950 pupils ( 6th and 7th graders at baseline ) : 984 boys and 966 girls , 585 in the free fruit group and 1,365 in the control group . \n a total of 320 pupils ( 16% ) participated at the follow - up survey in september 2009 , and constitute the study sample for the present study , of which 282 also participated in the 2005 survey . \n , 296 of the study sample had a parent / guardian who completed a parent questionnaire . \n the average parental age was 40.5 years , and 86% of the parents were mothers / female guardians . \n baseline characteristics from 2001 to 2002 of all particpants , those lost to follow - up , and those remaining in the triala \n participants are children from schools in the norwegian counties hedmark and telemark . \n ( a ) : baseline characteristics differences between those in the free fruit and control group in the full cohort . \n ( b ) : baseline characteristics differences between those lost to follow - up ( attrition ) and the present study sample ( persons having data in both 2001/2002 and 2009 ) . \n ( c ) : baseline characteristics differences between the free fruit and control in the present study sample . \n ( d ) : baseline characteristics differences between the free fruit and control in the loss to follow - up'group . \n free fruit pupils are those who particpated in the norwegian school fruit programme for free during 2001/2002 . \n a survey questionnaire was completed by the pupils in the classroom in the presence of a trained project worker ( surveys conducted within 20012005 ) . \n body mass index ( bmi ) was calculated based on these measures of height and weight . \n age and sex - specific cut off points ( 18 ) were used to categorize adolescents in the 2005 survey , while a bmi of 25 or above was used in 2009 as the criteria for being categorized as overweight ( including obese ) . \n self - reported perceived weight status were assessed by the following question at all surveys ; are you on a ( slimming ) diet , with the following response alternatives : no , my weight is ok , no , but i should be on a ( slimming ) diet , and yes. \n the two last alternatives were seen to indicate that the responders perceive themselves as too heavy / overweight . \n a new variable was calculated by combining these two to : ( 1=i am too heavy , 0=my weight is ok ) . \n the pupils reported their own sex and parents recorded their level of education at baseline ( lower : no college or university education / higher : having attended college or university ) . \n fv intake was based on two different measures ; 24-h recall ( portions / day ) and a food frequency questions ( ffq , times / week ) . \n consumption of unhealthy snacks ( ffq , times / week ) was calculated as previously described ( 11 ) . \n this study was conducted according to the guidelines laid down in the declaration of helsinki . \n written informed consent was obtained from parents and children prior to participation in the study . \n describing the sample , differences between the intervention and the control group , and between the study sample and those participating in the baseline survey but not in the 2009 survey ( attrition ) were analyzed using t - test for continuous variables and chi - square statistics for the categorical variables ( table 1 ) . as we did not have baseline data for weight status , we assume there is no baseline difference between the groups , and the effects of the intervention on weight status were considered if there were differences in overweight prevalence in the intervention and control group at follow - up . \n model 1 included intervention condition only ( free fruit vs. control ) . model 2 included sex and age ( class level ) + model 1 . \n at baseline , there were differences in fv intake ( portions / day ) , frequency of unhealthy snack consumption , and parental educational level between the intervention and the control groups ( table 1 , column a ) . due to the low participation rate in 2009 ( 16% ) , comparisons between those participating and those lost to follow - up are also presented in table 1 . \n first , the present study sample was compared to those participating at baseline ( 2001 ) , but not in the 2009 survey ( table 1 , column b ) . \n the present study sample ( n=320 ) was overrepresented by girls , pupils of parents with higher education , and participants from the intervention group , and the study sample reported a significant lower consumption of unhealthy snacks at baseline than did the drop - outs ( table 1 , column b ) . \n however , when analyzing the present study sample stratified according to the intervention and control group ( table 1 , column c ) , there were no significant differences in the reported baseline characteristics . in the lost to follow - up group , \n the differences are similar to those reported in the full cohort ( table 1 , column d ) . in 2005 \n ( i.e. 3 years after the end of the free fruit intervention ) , there was no significant difference between the free fruit and control groups regarding weight status , bmi , perceived weight status , or fruit and vegetable intake ( table 2 ) . in 2009 , a significant difference in the prevalence of overweight was observed as a smaller proportion of the participants in the free fruit group reported to be overweight than among the participants in the control group ( 15% vs. 25% overweight , p=0.04 ) . \n no significant difference were seen for bmi , perceived weight status , or fv intake . \n mean bmi and overweight prevalence in 2005 and 2009 , fruit and vegetable intake , and perceived weight status at all time points participants are children from schools in the norwegian counties , hedmark and telemark . \n overweight is defined in line with age and sex - specific cut off points according to cole et al . ( 18 ) . perceived weight status . in the crude logistic analysis ( table 3 , model 1 ) , \n the or for being overweight in 2009 was 0.52 ( 95% ci=0.280.97 ) for those receiving free fruit in the school year of 20012002 compared to controls . further adjustment for sex , grade level , and parental education level only slightly changed the or estimate , but the association between free fruit and weight status was no longer statistically significant ( table 3 , models 23 ) . \n odds ratio ( or ) of being overweight in 2009 for the free fruit group compared to the control group participants are children from schools in the norwegian counties , hedmark and telemark . \n include sex and age ( class level)+model i. model iii include parental education level+model ii . \n furthermore , it indicates that it takes time from intervention implementation to effects are seen on weight status recognizing the importance of long - term follow - up intervention studies for obesity prevention . \n no significant effect was observed 3 years after the end of the intervention , but 1 year of free school fruit at age 1012 resulted in a 40% lower prevalence of overweight , compared to controls , 7 years later . \n this effect might have been due to the long - term effect seen for reported fv intake , and/or the reduced consumption of unhealthy snacks ( 1416 ) . \n few intervention studies do follow the participants for several years as done in the present study ( 6 ) , and few studies have reported effects in fv intake after the end of the intervention period ( 19 ) . to our knowledge , there are no comparable studies reporting the effects of 7 years of sustained elevated fv intake on weight status . this extended follow - up period of an intervention proven to be effective in changing eating habits , represents the main strength of the present study . \n no baseline measure of weight and height were included , and the subsequent measures were self - reported . \n baseline data on perecived weight status were included , however , and there were no baseline difference between the proportions of intervention and control group particpants perceiving themselves to be too heavy . \n there are no reasons to believe that there is a differentiated underreporting of weight between the intervention and the control groups , as weight was no issue in the intervention . \n loss to follow - up can lead to bias in randomized trials , especially if the characteristics of people lost to follow - up differ between the randomized groups ( 20 ) . in the present study , the group lost to follow - up differed between the randomized groups in the same way the groups differed in the full cohort . \n furthermore , there were no differences in baseline characteristics between the intervention group and the control group in the presented study sample . according to dumville et al . \n , the attrition is only important if the differeing characteristics is correlated with the trial 's outcome measures ( 20 ) . in the present study , the directions of the loss do not support that this would effect the results . among those lost to follow - up \n , a higher proportion of parents with high education were lost in the intervention than in the control group ( table 1 , column c ) , and among those lost , the intake of unhealthy snacks was lower in the intervention group compared to the control group ( table 1 , column c ) , both findings indicating that the prevalence of overweight probably would have decreased in the free fruit ( intervention ) group had those lost to follow - up been included . \n in addition , this is no perfect randomized study , and limitations regarding the study design and generalizability have been reported earlier ( 15 ) . \n previous results show that free school fruit seem to increase intake of fruit with all its health benefits , reduce intake of unhealthy snacks , especially in lower ses families ( 10 ) , and in addition prevent future excessive weight gain . \n the sum of this suggests that free school fruit should be considered an important public health initiative . \n the present study indicates that free school fruit might contribute to prevention of future excessive weight gain in norwegian children . \n nc drafted the introduction and discussion , eb drafted the methods and results , and kik revised it critically . \n kik has since 2006 been employed by the norwegian directorate of health which in part is responsible for implementing the national school fruit programs . \n this work was supported by the norwegian research council ( both 2001 and 2008 data ) . \n the norwegian research council had no role in the design , analysis , or writing of this article .", "role": "user" }, { "content": "backgroundseveral school fruit programs are initiated with the aim to improve diet and thereby contribute to reduce the prevalence of overweight . to date , no published studies have demonstrated that school fruit schemes do prevent overweight.objectivethe aim of the present study was to assess if increased consumption of fruits and vegetables , due to free school fruit , have an impact on future weight status.designan intervention study including 10- to 12-year - old children from nine schools in two norwegian counties ( hedmark and telemark ) participating in the norwegian school fruit program for free during the school year 2001/2002 and children from 29 control schools . \n follow - up studies were performed in 2005 and 2009 . \n the cohort includes 1950 pupils ( 984 boys , 966 girls ) at baseline , 1,602 participants in 2005 and 320 participants in the 2009 survey , of which 282 also had participated in 2005.resultsin 2005 , there was no significant difference between the free fruit group and the control group regarding weight status , body mass index , or perceived weight status . in 2009 , a significant difference in prevalence of overweight was observed ( 15% vs. 25% , p=0.04 ) . in the crude logistic analysis , \n the or for being overweight was 0.52 ( 95% ci : 0.280.97 ) for the intervention group compared to controls . when adjusting for school , sex , grade level and parental education , the association was no longer statistically significant.conclusionsthese results indicate that free school fruit might contribute to prevent future excessive weight gain . \n however , the study results are limited by low participation rate .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: trisomy 21 ( also referred to as down syndrome ) is the most frequent chromosomal abnormality at birth . \n it affects approximately one in every 800 newborns 1 . in france , prenatal diagnosis is always suggested when indicated by ultrasound findings and maternal serum marker assays . \n about 92% of cases of down syndrome are due to the presence of an extra , free chromosome 21 in all cells , whereas 23% are due to mosaicism and 56% are due to unbalanced heterologous or homologous acrocentric rearrangements ( of which rob(14;21 ) and rob(21;21 ) are the most common ) . around 70% of rob(14;21 ) rearrangements are de novo , and this value is over 95% for rob(21;21 ) 2,3 . \n prenatal diagnosis of recurrent down syndrome due to unbalanced , de novo homologous acrocentric rearrangement is rare . here \n , we report on an exceptionally rare case : a recurrent rea(21;21 ) down syndrome that was probably caused by maternal germ - line cell mosaicism of the rearrangement . a 27-year - old woman \n ( gravida 2 para 1 ) requested a prenatal diagnosis after the detection of increased nuchal translucency in the fetus . \n their first pregnancy had been uneventful and the infant ( a girl ) was healthy . \n chorionic villus sampling at 13 weeks of gestation ( w.g . ) revealed an abnormal karyotype , with a rearrangement between two chromosomes 21 ( compatible with a rob(21;21 ) event ) on the 16 metaphases analyzed . \n karyotyping enabled us to diagnose down syndrome in a female fetus ( 46,xx,+21,rob(21;21)(q10;q10 ) ) . following a request by the couple \n given that ( 1 ) the parents ' first child was healthy , ( 2 ) the parental karyotypes ( in blood lymphocytes ) were normal , and ( 3 ) the vast majority of rob(21;21 ) are de novo , the subsequent genetic counseling was reassuring with regard to future pregnancies . \n the patient requested a prenatal diagnosis because of increased nuchal translucency and distended jugular lymphatic sacs . \n chorionic villus sampling at 13 w.g . revealed rob(21;21 ) down syndrome , with a 46,xy,+21,rob(21;21)(q10;q10 ) karyotype on the 15 metaphases analyzed . \n the pregnancy was subsequently terminated . in order to determine the parental origin of this apparently recurrent rob(21;21 ) , we performed a microsatellite marker analysis ( focusing on two shorts tandem repeats : the d21s11 and penta d loci on chromosome 21 ) in the fetus and parents . \n this showed that the rearrangement involving chromosomes 21 was an isochromosome 21 of maternal origin , rather than a rob(21;21 ) ( fig.1 ) . with a view to detecting potential low - grade mosaicism in peripheral blood cells from the mother , \n we performed fish analysis ( focusing on dscr1 locus on 21q22 ) of 1000 interphase nuclei ; all were normal . \n representative electrophoretograms ( using the microsatellite markers d21s11 and penta d ) for the couple and the aborted male and female fetuses , suggesting an i(21q ) of maternal origin in the first ( female ) fetus and the second ( male ) fetus . considering the area under the curve , the electrophoretograms with the d21s11 marker revealed ( 1 ) a maternal duplication of allele 28 and a paternal allele 33.2 in the female fetus , and ( 2 ) a maternal duplication of allele 28 and a paternal allele 29 in the male fetus . \n the area under curve for the penta d marker shows ( 1 ) a maternal duplication of allele 11 and a paternal allele 12 in the female fetus , and ( 2 ) the presence of three alleles in the male fetus ( a paternal allele 13 , a maternal allele 11 and an allele 12 whose origin can not be proven but which is very probably maternal , in view of the results for the d21s11 marker ) . \n the results of these microsatellite marker analyses suggest that the i(21q ) is of maternal origin in both fetuses . \n the karyotypes of the two aborted fetuses were thus determined to be 46,xx , i(21)(q10 ) and 46,xy , i(21)(q10 ) , respectively . \n what mechanism led to the maternally confined mosaicism ? and what genetic counseling should be given to the couple 's healthy daughter ? \n as mentioned in the introduction , about 95% of rob(21;21 ) translocations arise de novo 4 . \n an isochromosome 21 ( i(21q ) ) is derived from replication of a single chromosome 21 , whereas a homologous rob(21;21 ) involves translocation between two different homologous chromosomes 21 . \n conventional cytogenetic analysis is unable to distinguish between rob(21;21 ) and i(21q ) , and so the use of molecular assays of microsatellite markers is required . in the literature , \n most of the initial reports of rob(21;21 ) down syndrome feature an i(21q ) 5 . \n found that 17 of 19 cases were i(21q ) , with roughly equivalent maternal ( n = 10 ) and paternal ( n = 9 ) inheritance . \n when additionally considering four previous studies , 32 of 36 cases were found to be i(21q ) 57 . \n again , the frequencies of maternally inheritance ( n = 17 ) and paternal inheritance ( 15 ) were equivalent . \n kovaleva and shaffer 8 later analyzed published cases of rea(21;21 ) down syndrome and found that the prevalence of mosaicism among the parents was unusually high . \n however , the recurrence rate for de novo rea(21;21 ) ( rob(21;21 ) or i(21q ) ) down syndrome is reportedly low . \n 9 studied 112 families in which the child 's down syndrome was caused by a de novo t(gq;gq ) event . \n this event was a 21q21q translocation in 77 families , and none of the couples had a second pregnancy affected by down syndrome . \n however , steinberg et al . identified three couples ( one mother and two fathers ) with low - grade mosaicism for rea(21;21 ) \n translocation down syndrome in blood samples and an additional couple in which the mother carried a pericentric inversion of chromosome 21 . \n given that four of the 112 couples ( 3.6% ) had an abnormal karyotype , the researchers estimated the risk recurrence to be between 2% and 3.6% . \n caution should be exercised when counseling that the recurrence risk of this event is remote . a few reports on couples experiencing recurrent de novo rea(21;21 ) down syndrome have demonstrated that mosaicism for rea(21;21 ) in the skin or ovaries of one parent was combined with normal or low - level mosaicism in blood lymphocytes 9 ( table1 ) . \n reports of apparent de novo der(21;21 ) , parental mosaicism and the presence or absence of recurrence with regard to our present case ( with a healthy child born 2 years before the first i(21q ) event , the recurrence of a maternally inherited i(21q ) , and normal peripheral lymphocyte karyotypes in both parents ) , what advice should be given ? \n since the occurrence of another fetus with the same karyotype can not be ruled out , preimplantation genetic screening may provide this couple with the certitude that a baby will be free of down syndrome . \n even though we did not study the woman 's ovarian tissue , the features of the present case suggest the existence of germ - line cell mosaicism with at least three different oocyte populations : those containing a chromosome 21 ( giving rise to normal offspring ) , those containing an i(21q ) ( responsible for recurrent i(21q ) down syndrome ) , and those lacking a chromosome 21 ( responsible for the four miscarriages due to monosomy 21 ) . \n however , the couple 's healthy daughter may have resulted from the rescue of an initial i(21q ) down syndrome zygote ( and thus will require careful genetic counseling ) or the rescue of a monosomy 21 . \n one possible explanation for the occurrence of the maternal i(21q ) is the reduplication of one of the chromosomes 21 , forming a second trisomic cell line with an isochromosome ( 46,xx , i(21q),+21 ) . \n subsequent rescue of the trisomy would have generated a third , balanced cell line with the isochromosome ( 45,xx , i(21q ) ) . in view of the present case and \n the literature data , the vast majority of apparently de novo cases of rea(21;21 ) feature an i(21q ) with maternal or paternal inheritance . \n recurrence of rea(21;21 ) down syndrome does not therefore appear to be such a rare event , with at least 14 recurrences in 105 reported 9 and documented cases ( table1 ) , that is to say an incidence of 13.3% . \n we consider that ( 1 ) the previously reported recurrence rate of 2% is a marked underestimation and ( 2 ) that clinical practice and genetic counseling should be revised accordingly . \n when parental mosaicism is evidenced by high - quality cytogenetic analyses , one can even question whether the first - reported cases of rea(21;21 ) in parents with an apparently normal karyotype were truly de novo . in line with kovaleva and shaffer 's report 8 \n , we recommend performing a dna microsatellite marker analysis as soon as rea(21;21 ) down syndrome is detected ; this should enable one to distinguish between a true rob(21;21 ) and an i(21q ) . \n when an i(21q ) is detected , extensive cytogenetic analysis of at least 500 cells ( from a variety of tissues , if possible ) might enable the detection of low - grade parental mosaicism and thus the provision of appropriate genetic counseling for an inherited rearrangement . \n ", "role": "user" }, { "content": "key clinical messagewe report a rare case of recurrent trisomy 21 caused by an isochromosome 21q and what is very likely to be maternal germ - line cell mosaicism . over 90% of cases of rob(21;21 ) reported in the literature \n are due to an isochromosome 21q , with a risk of recurrence of more than 10% .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: replacement of missing maxillary anterior tooth with residual ridge defect is challenging , considering the high esthetic demand . \n esthetic outcome of fixed prosthetic denture depends on three dimensional emergence profile of the pontic design , tooth shape , and shade . \n emergence profile of the pontic depends on residual alveolar ridge volume , width , and length . \n a detailed treatment planning is required for achievement of a predictable esthetic outcome for anterior ridge defects . \n a localized residual alveolar ridge defect is characterized by deficiency of volume of bone and mucosal tissue . \n seibert classified the localized alveolar ridge defects into class i , class ii and class iii based on horizontal , vertical ridge deficiency . \n allen et al . classified the ridge defects as mild : depth <3 mm , moderate : ranging from 3 mm to 6 mm and severe : > 6 mm , considering the relation of depth of the deformity to the adjacent alveolar bone level . \n hard tissue augmentation procedures include , autologous block grafts , bone grafts and substitutes and guided bone regeneration . \n the soft tissue ridge augmentation procedures include , onlay free mucosal , inter positional connective tissue grafts , pouch graft , roll pedicle grafts and modified roll pedicle grafts . \n roll pedicle graft technique proposed by abrams comprises de - epithelization of a palatal pedicle flap and exposure of palatal bone . \n this pedicle is rolled under the buccal mucosa to increase the buccolingual dimension of the edentulous ridge for later fabrication of a fixed prosthesis . \n modified roll technique using a trap - door approach was proposed to cover the palatal bone , in which the epithelium over the palatal connective tissue is raised and preserved to cover the palatal bone . \n gasparini proposed l shaped incision design on palate to harvest double fold connective tissue pedicle graft to increase the buccopalatal dimensions of the ridge defect . \n platelet - rich fibrin ( prf ) is a second generation platelet concentrate used in conjunction with bone grafts , which offers several advantages including promoting wound healing , bone growth and density , graft stabilization , wound sealing , hemostasis and improving the handling properties of graft materials . \n the present case reports demonstrate a novel technique using modified rolled palatal pedicle connective tissue graft with demineralized freeze - dried bone allograft ( dfdba ) plus prf combination to correct the localized maxillary anterior alveolar ridge defects . \n three systemically healthy patients reported to the department of periodontology with the chief complaint of missing tooth in maxillary anterior region . \n intraoral examination revealed a severe alveolar ridge deformity in relation to missing maxillary left central incisor region [ figures 1a e ] and [ table 1 ] . \n the treatment options including autologous block grafting followed by implant placement and ridge augmentation followed by fixed partial denture were explained to the patient . \n all the patients opted for the second procedure , and informed consent was obtained from each patient . \n ( a , b ) preoperative facial and occlusal view showing localized class iii ridge deformity in maxillary left central incisor region of case 1 . \n ( c ) preoperative occlusal view showing localized class iii ridge deformity in maxillary left central incisor region of case 2 . \n ( d ) preoperative occlusal view showing localized class iii ridge deformity in maxillary left central incisor region of case 3 . \n ( e ) line diagram showing localized alveolar ridge defect preoperative and postoperative dimensions of ridge defects after administration of local anesthesia ( 2% lignocaine with 1:80,000 epinephrine ) , partial thickness horizontal incision was made on the palatal aspect of ridge at mesial line angle of right central incisor to mesial line angle of lateral incisor . from the horizontal incision line , \n an oblique incision was placed from mesial line angle of left lateral incisor to 2 premolar [ figure 2a and b ] . \n care was taken to maintain at least 3 mm distance from the gingival margin of teeth to the oblique incision . \n the partial thickness flap was reflected from oblique incision line to expose the underlying connective tissue [ figure 3a and b ] . \n the palatal connective tissue pedicle graft was then outlined by giving full thickness incision along the oblique incision line , and another parallel incision was given from the mesial line angle of central incisor . \n care was taken to avoid damage to the nasopalatine , and greater palatine nerves and vessels . \n the length of the palatal connective tissue pedicle graft was approximately 2 times more than the apico coronal length of the ridge defect [ figure 4a and b ] . \n ( a ) operative view showing incision lines for harvesting palatal connective tissue pedicle graft . \n ( b ) line diagram showing incision lines for harvesting palatal connective tissue pedicle graft ( a ) operative view showing palatal connective tissue after partial thickness flap reflection . \n ( b ) line diagram showing palatal connective tissue after partial thickness flap reflection ( a ) operative view showing long palatal connective tissue pedicle graft . \n ( b ) line diagram showing long palatal connective tissue pedicle graft the palatal pedicle graft was reflected coronally up to the crest of the ridge defect . from the crest of the ridge defect \n a partial thickness incision was made extending beyond the line angles of adjacent incisors and mucogingival junction , leaving the periosteum on the bone [ figure 4a and b ] . \n the pedicle graft was rolled from the apical end and secured with 50 , prolene horizontal loop suture to the labial flap [ figure 5a ] . \n ( b ) placement of demineralized freeze - dried bone allografts plus platelet - rich fibrin into ridge concavity . \n ( c ) line diagram showing placement of bone graft into ridge concavity later periosteum from crest of the defect was reflected up to vestibular fornix for the placement of dfdba ( tata memorial , > 500 to < 1040 m ) bone graft material mixed with prf . \n prf was prepared just preceding to surgery ; intravenous blood from the antecubital vein was collected in a 10-ml sterile tube without anticoagulant and instantly centrifuged at 3,000 revolutions per minute for 10 min . \n prf was easily separated from red corpuscles base using a sterile tweezers and scissors and then transferred onto a sterile dappen dish . \n prf was mixed with dfdba and then placed onto the ridge defect [ figures 5b and 5c ] . \n prior to placement , bleeding points were induced on the bone to enhance the blood supply . \n later labial flap and palatal flap were approximated with external horizontal mattress suture ; independent direct sutures were placed along the oblique incision on the palate from mesial line angle of lateral incisor to 2 premolar region using 50 prolene suture [ figures 6a c ] . \n temporary ovate pontic maryland bridge was made to create an emergence profile on the ridge , and periodontal pack was placed on the palatal aspect [ figure 7 ] . \n ( b ) operative view showing placement of external horizontal mattress suture on the labial aspect . \n ( c ) line diagram showing placement of suture on the incision line postoperative view showing temporary ovate pontic maryland bridge the patient was prescribed 500 mg amoxicillin every 8 h for 5 days and 800 mg ibuprofen every 6 h as needed . \n the patient was advised to rinse using 0.12% chlorhexidine gluconate mouthwash twice daily for 3 weeks . written and verbal postoperative instructions were given to the patient . \n healing of the augmented ridge and palatal donor sites was uneventful with no postoperative complications . \n 2 months postoperative evaluation showed a considerable amount of ridge augmentation with soft tissue emergence profile [ figure 8a d ] and [ table 1 ] . \n ( a , b ) 2 months postoperative view showing increased ridge dimension of case 1 . \n healing of the augmented ridge and palatal donor sites was uneventful with no postoperative complications . \n the sutures were removed after 2 weeks . 2 months postoperative evaluation showed a considerable amount of ridge augmentation with soft tissue emergence profile [ figure 8a d ] and [ table 1 ] . \n ( a , b ) 2 months postoperative view showing increased ridge dimension of case 1 . \n the present technique was proposed for the correction of severe maxillary anterior alveolar ridge defect by utilizing modified rolled palatal connective tissue pedicle graft and dfdba with prf . \n abrams 's roll technique employed for the correction of mild ridge defects leaves exposed palatal bone . \n modified roll technique , which was proposed by scharf and tarnow , covers the palatal bone , but the tissue obtained in these techniques is sometimes minimal and not suitable for correction of moderate to severe ridge defects . \n gasparini proposed a double fold connective tissue technique , with l shaped incision given at right angle to the gingival margin of the adjacent tooth on the palate . \n the palatal pedicle graft achieved in this technique was more than the defect depth and double folded to the buccal flap . \n the present technique , instead of l shaped incision an oblique incision was given from the line angle of adjacent lateral incisor up to second premolar . \n the oblique incision facilitates harvesting of maximum possible length of pedicle graft ; the length of the pedicle should be > 2 fold to the defect depth . \n the palatal pedicle connective tissue graft reduces the risk of graft necrosis due to its intact blood supply . \n the present technique used prf and dfdba combination , which was earlier used for periodontal regeneration , extraction socket and ridge preservation . \n prf contains growth factors and accelerated tissue healing due to effective neovascularization , enhanced wound closing with swift tissue remodeling and bone formation . \n the present technique resulted in predictable ridge augmentation , which can be probably attributed to the soft and hard tissue augmentation with a connective tissue pedicle and dfdba plus prf combination . \n the present technique can be considered for the treatment of moderate to severe maxillary anterior alveolar ridge defects .", "role": "user" }, { "content": "replacement of missing maxillary anterior tooth with localized residual alveolar ridge defect is challenging , considering the high esthetic demand . \n various soft and hard tissue procedures were proposed to correct alveolar ridge deformities . \n novel techniques have evolved in treating these ridge defects to improve function and esthetics . in the present case reports , \n a novel technique using long palatal connective tissue rolled pedicle graft with demineralized freeze - dried bone allografts ( dfdbas ) plus platelet - rich fibrin ( prf ) combination was proposed to correct the class iii localized anterior maxillary anterior alveolar ridge defect . \n the present technique resulted in predictable ridge augmentation , which can be attributed to the soft and hard tissue augmentation with a connective tissue pedicle and dfdba plus prf combination . \n this technique suggests a variation in roll technique with dfdba plus prf and appears to promise in gaining predictable volume in the residual ridge defect and can be considered for the treatment of moderate to severe maxillary anterior ridge defects .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: for japanese people the preferred place of death has usually been home [ 1 , 2 ] . \n miyata et al . suggested that end - of - life care and home death was not a very practical option in japan because the quality of home care was not satisfactory until recently . \n previous studies have also observed that patients prefer end - of - life and death to happen at home ; however this preference is not often recorded as an actual place of death [ 59 ] . \n steinhauser et al . have indicated that many people prefer to die at home , but , primarily , there are other important factors which need to be addressed before consideration of home death including pain and symptom management , preparation for death , achieving a sense of completion , decisions about treatment preferences , and being treated as a whole person . \n emphasized that policy makers should encourage health services to focus on ways of meeting individual preferred places of death . \n previous studies have found that certain features of the home care system are associated with place of death [ 1013 ] . \n for instance , home visit by general practitioners ( gps ) is a factor that contributes to high incidence of home death . \n reported that the number of home visits per week by home care nurses influenced the incidence of home death . \n grande et al . reported that the commonly mentioned factors in care evaluations by gps and district nurses were their accessibility , enlistment of support from other agencies , and their ability to ensure the availability of equipment and supplies . \n mentioned that a key factor for the success of home care is the availability of a gp and nurses , as well as an access to hospital bed as and when required , and emphasized that these factors need to be satisfied before considering home death . \n some studies have reported that home death is also influenced by the geographical locations of patient 's residence , because the home care system differs in the metropolitan and the rural areas [ 1416 ] . \n gomes and higginson state that patients in rural areas are more likely to die at home because they have difficulties in accessing health care . \n suggested that metropolitan patients were less likely to die at home because of poor social support and a lower availability of home care beds . in the 23 wards of the tokyo metropolitan region , \n a population density of 14,153 people per square kilometer was recorded for the year 2010 ( figure 1 ) , and the home care supporting clinics ( hcscs ) in the 23 wards of tokyo are easily accessible . \n however , the types of home care systems that enable home death have not been studied specifically in a metropolitan setting . \n considering the proportion of aged people population in japan , there is an urgent need for providing the provisions of medical and end - of - life care that are available in hospitals to homes . \n japanese long - term care insurance was introduced in 2000 to promote the socialization of care for frail elderly . \n palliative care from the early phase of treatment is one of its basic concepts , which address home - based palliative care that enables cancer patients to spend their end - of - life period and to die at home , considering that as few as 6.7% cases of home deaths have been recorded for cancer patients in 2007 . \n while palliative care units have been covered by the national medical insurance since 1990 , home - based palliative care has only been covered recently in 2002 . with this background , \n hcscs are expected to play a central role in the provision of end - of - life care at home by providing home care services 24 hours a day and by cooperating with hospitals , home - visit nursing stations , and care managers and ensuring emergency hospital admission . \n it amounted to 11,539 as of september 2010 ; in particular , those in the 23 wards of the tokyo metropolitan region account for approximately 10% of all hcscs in japan . however , the activities conducted at hcscs are not altogether clear because statistical data regarding the activities of hcscs and the actual operating system have not been disclosed to the public . \n thus , the contribution of home care system practiced by hcscs in influencing the choice of the place of death is still unclear . therefore , the purpose of this study was to determine the influence of the home care system practiced by hcscs in the tokyo metropolitan region on home death and to identify features of single and multiple physician practices that influence home death . \n the objects of this study were 998 clinics in the 23 wards of tokyo , japan that were certified as hcscs by the japanese ministry of health , labor , and welfare as of march 1 , 2009 . \n a self - administered questionnaire was mailed in collaboration with the japan network of home care supporting clinics during july 2009 to august 2009 . \n this survey protocol was approved by the ethics committee of the department of medicine , osaka university . \n we , in the questionnaire , queried the clinic 's characteristics , collaboration with other agencies ( hospital , clinic , home visit nursing station , and care manager ) , the number of patients , and home care self - assessments . \n representative individuals of the clinics self - rated their activities on behalf of the facility on a scale of 15 ( strongly disagree to strongly agree ) . \n each hcsc was classified into two types by the number of physicians engaged in the practice : ( 1 ) single physician practice ( single ) and ( 2 ) multiple physician practice ( multiple ) . \n student 's t - test , fisher 's exact test , and mann - whitney 's u - test were used to compare the differences according to the number of physicians . to examine the relationship between the characteristics of hcscs and the proportion of home deaths , we further classified hcscs into two groups by the proportion of home deaths : ( 1 ) less than 10% ( < 10% ) and ( 2 ) equal to and more than 10% ( 10% ) . in this analysis \n , we excluded the clinics with the following features : ( 1 ) those where the number of total patients was less than 10 persons per year ; ( 2 ) those where the number of total patients or patients who died at home was unclear . \n we then compared the differences according to the proportion of home deaths using student 's t - test , fisher 's exact test , and mann - whitney 's u - test . \n next , we performed stepwise multiple linear regression analysis using items that were significant in student 's t - test , fisher 's exact test , and mann - whitney 's u - test as dependent variables . \n out of the 998 clinics in the 23 wards , only 994 clinics could be contacted . \n we received 183 responses ( response rate : 18.4% ) and 166 were finally analyzed ; 17 responses were excluded because they were incompletely answered ( effective response rate : 16.6% ) . \n the multiple physician practices employed significantly more health workers ( including nurse , social worker , and others ) and had sufficient medical care equipments such as ventilators and ivh . \n in addition , they operated significantly more often in parallel with other institutions including hospitals , specific facilities , home visit nursing stations , and home help services and also collaborated significantly more often with hospitals , clinics , home visit nursing stations , and care managers . \n table 2 represents the number of patients . among 15,027 patients referred to 166 hcscs in 2008 , 1083 died at home ( home death rate : 12.3% ) \n thirty - nine clinics , 86.4% of which were single physician practices , had no patients with home death case . \n the total number of patients , the number of patients with home death , and the number of patients living alone were significantly higher for multiple physician practices . \n there were no significant differences in the total numbers of patients per physician and patients who died at home per physician between the two groups . \n the patients who were living alone and died at home were significantly more frequently provided home care by multiple physician practices . \n tables 3 and 4 show the relationship between the characteristics of hcscs and the proportion of home deaths . \n single physician practices with 10% of home deaths significantly collaborated with other clinics and rated themselves high on the factor that the patients could be admitted to hospitals when symptoms were aggravated . \n multiple physician practices with 10% of home deaths significantly collaborated with hospitals and rated themselves high on these factors : that the patients could be admitted to hospitals in case of emergency , that service use was available when required without delay , that the physician provided sufficient explanations to families regarding the present patient 's condition and the details of their medical treatment , and that the physician or nurse taught the family members coping skills for medical procedures and nursing care skills . \n table 5 shows the relationship between the characteristics of hcscs and the proportion of home deaths . \n factors enabling an increase in the proportion of home deaths were as follows : collaboration with clinics ( : 0.33 ) in case of the single physician practices ; collaboration with hospitals ( : 0.37 ) and the physician or nurse teaching the family members coping skills in case of medical procedures and nursing skills to take care of the patient ( : 0.33 ) in the multiple physician practice . \n we conducted the present study to evaluate the influence of home care systems on the incidence of home death . \n first , our results suggest that teaching the family members coping skills in case of medical procedures and nursing skills to take care of the patient may be the factors influencing an increased preference for home death . \n previous studies indicated that the choice of the place of death is strongly influenced by the psychological condition of the caregiver [ 24 , 25 ] . \n recent studies demonstrated that interventions to improve the coping skills of caregivers were effective for promoting their psychological well - being of the caregiver [ 2628 ] . considering that the family members ' concerns about the patient 's condition can be eased by assisting them in providing personal care to the patient \n , it appears that improvement in the coping skills of the family members leads to increased preferences of spending end - of - life period and dying at home by the patient . \n second , we found that collaboration with hospitals was associated with a greater probability of home death preferences in multiple physician practices . \n hospitals have been requested by the japanese medical care law to collaborate with clinics for providing continual patient care . \n the findings suggest that , for continual patient care , it is important to establish a cooperative structure between hospitals and clinics . \n in addition , in the single physician practices also , collaboration with other clinics was an important factor influencing home deaths . \n for single physician practice hcscs , the provision of home care services 24 hours a day was a challenging task , especially during out - of - hours [ 31 , 32 ] . \n thus , some of these practices have initiated a new approach to improve the function of hcscs [ 33 , 34 ] . \n for example , some groups of hcscs constructed a network among themselves and conducted out - of - hours home care services on a rotation basis . under these circumstances , \n the provision of the option of end - of - life care and home death to the patient would become possible . \n third , our findings indicated that the multiple physician practices enabled continuous home care and dying at home for various patients . \n they had several advantages as follows : ( 1 ) larger number of physicians and health workers , ( 2 ) sufficient medical care equipments , and ( 3 ) more collaboration with other agencies . \n such types of hcscs are fewer in sparsely populated rural areas owing to the difficulty in efficient management of such institutions compared with clinics in the 23 wards of the tokyo metropolitan region . . \n previous studies have reported that successful home care depends on their availability and accessibility ; our results showed that the multiple physician practice hcscs in the 23 wards of tokyo are located close to residents of the patients and have various resources for home care . in agreement with previous studies , \n hence , there is an urgent need to improve the home care systems in the 23 wards of tokyo because of the increase in the proportion of aged people population in japan . \n our study identified valuable factors that influence rate of home death in the 23 wards of tokyo . \n the objects of our study were registered clinics such as the hcscs but we were not able to identify functional clinics among them because any clinic which meets the requirement set under the japanese ministry of health , labor , and welfare can acquire a certification of a hcsc . \n therefore , we suspect that a considerable number of nonfunctioning hcscs did not respond to our survey . however , it is actually unclear how the hcscs are operated under the system because statistical data regarding the activities of hcscs have not been disclosed to the public in japan . therefore , we believe that our findings provide a basis to examine the home care system of hcscs that enable spending end - of - life period and home death . \n second , we classified the hcscs into two types on the basis of the number of physicians and compared differences between these two groups ; however , there are other criteria which were not considered such as the type of clinic and type of management practiced . in future , the association of home death with the type of clinic should be studied . in conclusion \n , our findings indicated that home care services in the metropolitan region are unlikely to be achieved without cooperation of service providers and without improvement of family coping skills .", "role": "user" }, { "content": "to examine factors influencing home death , an anonymous survey was mailed to 998 home care supporting clinics ( hcscs ) in the 23 wards of tokyo , japan . \n we classified the hcscs into two types ( single physician practice and multiple physician practice ) and identified factors of each type of practice that predict home death . \n the factors associated with a greater probability of dying at home were as follows : in the multiple physician practices , collaboration with hospitals and teaching coping skills to the family members and , in the single physician practices , collaboration with clinics . \n our findings suggest that home end - of - life care services are unlikely to be achieved without cooperation among service providers and without improvement of the family members ' coping skills .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the combination treatment for skeletal malocclusions in adult individuals has been used not only to achieve a functional and stable occlusion but also to establish normal skeletal relationships with esthetically pleasing soft tissue profile . \n orthognathic surgery and orthodontic therapy are compliment to each other in these types of cases to achieve the desired results . \n a 20 year - old male patient with a complaint of un - even bite presented with a class iii skeletal relationship with prognathic mandible , increased lower facial height , concave profile class iii incisor and molar relationship and anterior open bite [ figures 19 ] . \n intra oral pre - treatment orthopantomogram pre - treatment cephalogram post - treatment extra oral post - treatment iintra oral post - treatment ortho pantomogram post - treatment cephalogram pre- and post - treatment superimposition burstone 's cephalometric analysis \n prognathic mandibleincreased lower facial heightclass iii incisor and molar relationshipanterior open biteconcave profile and compromised esthetics \n increased lower facial height class iii incisor and molar relationship concave profile and compromised esthetics \n pre - treatment prophylaxis , restorationscombination therapysurgical plan : le- forte i osteotomy superior and forward placement of maxilla and bilateral l sagittal split osteotomy for mandibular setbacknon extraction orthodontictherapy with 0.022 roth pre - adjusted edgewise appliancelong term retention plan \n pre - treatment prophylaxis , restorations surgical plan : le- forte i osteotomy superior and forward placement of maxilla and bilateral l sagittal split osteotomy for mandibular setback non extraction orthodontictherapy with 0.022 roth pre - adjusted edgewise appliance long term retention plan le- forte i osteotomy with superior impaction of maxilla allows the auto rotation of mandible , which would reduce the lower facial height , and the forward placement of maxilla , which would help to improve the soft tissue balance . \n it would also help to correct the class iii skeletal relationship along with the bilateral sagittal split osteotomy with mandibular setback . \n the pre - surgical orthodontics was planned to increase the reverse overjet to facilitate the proper positioning of the jaws during the surgery . \n after initial restorative and prophylactic measures , pre - surgical orthodontics was begun with 0.022 0.028 roth pre - adjusted edgewise prescription appliance . \n initially , 0.016 niti wires were used to align the arches , and later shifted to heavier 0.019 0.025 ss arch wires sequentially . \n mild class ii elastics were used to correct the incisor position and to increase the reverse overjet to 6 mm . \n face bow transfer and articulation of models on a semi - adjustable articulator was done and two surgical wafers ( for maxillary positioning and for final mandibular setback ) were fabricated as per the mock surgery carried out on models . \n le- forte i surgical procedure was carried out as decided and the maxilla was repositioned 3 mm anteriorly and 3 mm superiorly . \n bilateral sagittal split osteotomy was performed and the mandible was set back by 7 mm . \n post -surgical orthodontics was initiated after a period of 4 weeks and with the arch wires sequentially changed from 0.017 0.025 niti to 0.021 0.025 ss wires . finishing and settling of occlusion \n upper and lower hawley 's type of retainers was given with instructions to wear full time . \n prognathic mandibleincreased lower facial heightclass iii incisor and molar relationshipanterior open biteconcave profile and compromised esthetics \n increased lower facial height class iii incisor and molar relationship concave profile and compromised esthetics \n pre - treatment prophylaxis , restorationscombination therapysurgical plan : le- forte i osteotomy superior and forward placement of maxilla and bilateral l sagittal split osteotomy for mandibular setbacknon extraction orthodontictherapy with 0.022 roth pre - adjusted edgewise appliancelong term retention plan \n pre - treatment prophylaxis , restorations surgical plan : le- forte i osteotomy superior and forward placement of maxilla and bilateral l sagittal split osteotomy for mandibular setback non extraction orthodontictherapy with 0.022 roth pre - adjusted edgewise appliance long term retention plan \n le- forte i osteotomy with superior impaction of maxilla allows the auto rotation of mandible , which would reduce the lower facial height , and the forward placement of maxilla , which would help to improve the soft tissue balance . it would also help to correct the class iii skeletal relationship along with the bilateral sagittal split osteotomy with mandibular setback . \n the pre - surgical orthodontics was planned to increase the reverse overjet to facilitate the proper positioning of the jaws during the surgery . \n after initial restorative and prophylactic measures , pre - surgical orthodontics was begun with 0.022 0.028 roth pre - adjusted edgewise prescription appliance . \n initially , 0.016 niti wires were used to align the arches , and later shifted to heavier 0.019 0.025 ss arch wires sequentially . \n mild class ii elastics were used to correct the incisor position and to increase the reverse overjet to 6 mm . \n face bow transfer and articulation of models on a semi - adjustable articulator was done and two surgical wafers ( for maxillary positioning and for final mandibular setback ) were fabricated as per the mock surgery carried out on models . \n le- forte i surgical procedure was carried out as decided and the maxilla was repositioned 3 mm anteriorly and 3 mm superiorly . \n bilateral sagittal split osteotomy was performed and the mandible was set back by 7 mm . \n post -surgical orthodontics was initiated after a period of 4 weeks and with the arch wires sequentially changed from 0.017 0.025 niti to 0.021 0.025 ss wires . finishing and settling of occlusion \n upper and lower hawley 's type of retainers was given with instructions to wear full time . \n a profound improvement in facial esthetics was achieved , along with the near - normal dental , skeletal and soft tissue relationships . \n skeletal class iii anomalies are one of the most complicated problems in both childhood and adulthood of all dentofacial abnormalities . \n many studies have demonstrated that transverse dental compensation is correlated with skeletal asymmetry.[69 ] inclinations of the occlusal plane observed in the posteroanterior cephalograms are important characteristics to determine the extension of facial asymmetry . \n class iii skeletal problems are treated with a combination of orthodontic and orthopedic mechanics in growing individuals whereas , correction of the class iii malocclusion usually requires complex surgical procedures during adulthood for attainment of an optimal aesthetic and functional result in class iii patients . \n the orthodontics surgical combination therapy has been success full in this case of skeletal class iii malocclusion . \n it is also evident that the self - confidence level of the individual was raised considerably following the total change in the perception .", "role": "user" }, { "content": "the correction of skeletal class iii malocclusion with severe mandibular prognathism in an adult individual requires surgical and othodontic combination therapy . the inter disciplinary approach is the treatment of choice in most of the skeletal malocclusions . a case report of an adult individual with class iii malocclusion , having mandibular excess in sagittal and vertical plane and treated with orthodontics , , bilateral sagittal split osteotomy and le \n forte i osteotomy for the correction of skeletal , dental and soft tissue discrepancies is herewith presented . the surgical \n orthodontic combination therapy has resulted in near normal skeletal , dental and soft tissue relationship , with marked improvement in the facial esthetics in turn , has helped the patient to improve the self - confidence level .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: advanced copd severely restricts work opportunities and impairs the ability to perform household chores , social activities , and family activities.1 inhaled long - acting bronchodilators and inhaled corticosteroids are widely prescribed for patients with copd . \n these drugs reduce exacerbation risk but have only a modest effect on symptoms and overall respiratory health status . in the majority of patients , these classes of drugs fail to confer improvements in the st george s respiratory questionnaire ( sgrq ) that are considered clinically significant.2,3 chronic bronchitis , traditionally defined as chronic cough and phlegm for at least 3 months a year for at least two consecutive years , is common among patients with copd , especially in current smokers.4,5 when adjustments are made for age , sex , and severity of airflow obstruction , patients with chronic bronchitis experience more exacerbations , have worse respiratory health status , and have higher mortality than do patients without chronic bronchitis , highlighting the need for therapies that might improve symptoms and other clinical outcomes in this subset of patients with copd.5 n - acetylcysteine ( nac ) possesses well - described antioxidant , anti - inflammatory , and mucolytic properties , making it attractive as a potential copd therapy.6 oral nac is thought to enhance the synthesis of glutathione ( gsh ) , a tripeptide with critical systemic antioxidant and anti - inflammatory effects . increased levels of gsh in the lung might improve clinical outcomes by suppressing oxidant - induced inflammation and mucus production and by reducing the viscosity of mucus via the cleavage of mucin disulfide bonds.7 oral nac is widely prescribed in many countries and has been evaluated in numerous placebo - controlled , randomized clinical trials . \n oral nac , usually given in split doses of 3001,200 mg daily , may have a modest effect in preventing copd exacerbations and may also improve symptoms of cough and sputum , though results have not been entirely consistent.811 nac has a good safety profile and has been administered in oral doses of 6,0008,000 mg daily for several months to hiv - infected patients without evident ill effects.12 we hypothesized that nac doses substantially higher than those usually used in patients with copd might improve the clinical outcomes while remaining both tolerable and safe . \n we also reasoned that patients with both copd and chronic bronchitis might be most likely to benefit . \n we conducted a randomized , double - blinded , placebo- controlled trial comparing high - dose nac , 1,800 mg twice daily , versus placebo for 8 weeks in copd patients with chronic cough and sputum production . \n principal eligibility criteria were : 1 ) ratio of postbronchodilator forced expiratory volume in 1 second ( fev1 ) to forced vital capacity of < 0.70 along with an fev1 < 65% of predicted , 2 ) age > 40 years and 85 years , 3 ) current or past history of cigarette smoking of at least ten pack - years , 4 ) no copd exacerbation in the last 4 weeks , and 5 ) presence of chronic bronchitis . \n we defined chronic bronchitis as a positive response to questions 1 and 2 of the sgrq , meaning that cough was present \n several days per week or almost every day and sputum production was present several days per week or \n almost every day.13 this definition correlates well with the more traditional definition of chronic bronchitis but identifies more patients with this phenotype.14 principal exclusion criteria were : 1 ) primary clinical diagnosis of asthma , 2 ) uncompensated heart failure , 3 ) cirrhosis with ascites and edema , 4 ) estimated glomerular filtration rate of < 30 ml / min/1.73 m , 5 ) use of long - acting nitrates , and 6 ) inability to provide informed consent . \n patients with a propensity to develop edema from heart failure or liver disease were excluded because each tablet of the study drug contained 200 mg of sodium for a daily total of 800 mg . \n patients taking long - acting nitrates were excluded because nac may potentiate drugs of this class.15 the trial was conducted with a common protocol at three sites in the minneapolis \n st paul metropolitan area : the minneapolis va health care system , the healthpartners research foundation , and the university of minnesota medical center . \n the institutional review boards at each participating site approved the study ( minneapolis va health care system , the healthpartners research foundation , and the university of minnesota medical center ) , and all patients gave written informed consent . \n the trial was registered with clinicaltrials.gov ( nct01599884 ) . at each site , patients were randomized 1:1 to active drug or placebo in permuted blocks of size two . \n research pharmacists at each site were the only study personnel with access to the randomization list , and they assigned the treatment accordingly . \n the nac was synthesized and formulated according to good manufacturing practice standards by bioadvantex pharma , inc . \n ( mississauga , on , canada ) , which donated the study drug and matching placebo . \n effervescent tablets containing 900 mg of nac were packaged in airtight packets made of aluminum foil to prevent oxidation . \n placebo tablets were indistinguishable from active drug in terms of appearance , effervescence , taste , and odor . \n patients were instructed to take two tablets dissolved in water or fruit juice twice daily . \n patients were allowed to continue all of their usual medications , except for guaifenesin and other over - the - counter antitussives . \n the primary outcome was change in the total score of the sgrq , a well - validated measure of health status in patients with chronic lung disease.13 the sgrq is scored on a scale of 0100 with 100 representing the worst respiratory health status . \n this instrument was self - administered at baseline and again at the end of the 8-week study . \n as secondary clinical outcomes , we evaluated changes in the three domains of the sgrq , the chronic bronchitis symptoms assessment scale ( cbsas ) , and the short form-36 health survey ( sf-36).16,17 we assessed lung function with postbronchodilator spirometry , systemic inflammation with serum c - reactive protein levels , and systemic oxidative stress with plasma 8-isoprostane levels.18 we further assessed oxidative stress and biochemical efficacy of nac , by measuring changes in thiol redox couples , gsh / gsh disulfide ( gssg ) and cysteine / cystine ( cys / cyss ) in plasma . \n trained laboratory technicians separated and processed plasma from collected blood , closely following the methodology described by jones and liang.19 samples were immediately frozen and then shipped to the clinical pediatric center biomarkers core laboratory at emory university for the measurement of the thiol redox couples . \n plasma samples were also processed for the measurement of 8-isoprostane , as described previously.20 measurements of plasma thiol redox couples and 8-isoprostane were performed only in the subset of patients who were randomized at the minneapolis va health care system . \n patients were questioned during a mid - study telephone call at week 4 and at the final study visit at week 8 regarding all adverse events , including possible drug reactions and health care utilization . \n reports of serious adverse events were promptly filed with the institutional review board per institutional policies . as an added safety measure , common laboratory tests , including a complete blood count , \n electrolytes , creatinine , alanine aminotransferase , and prothrombin time , were obtained at baseline and at the 8-week visit . \n the trial was designed to detect a between - group difference of 4 u in the mean change of the total score for the sgrq from baseline to 8 weeks . \n the 4-u change is widely accepted as the minimal clinically important difference for the sgrq.21 for our sample size calculation , we assumed a sd of 7.5 u for the change in sgrq measurements , based on a prior trial of similar patients with copd and similar duration conducted at the minneapolis va health care system.22 based on these assumptions , 55 patients in each arm would provide 80% power for detecting a four - point difference between groups with a two - tailed alpha error of 0.05 . to account for the potential dropout of patients , we had planned for a total sample size of 130 patients , 65 patients in each arm . \n baseline comparisons of treatment groups applied two sided student s t - test to continuous measures and chi - square tests to categorical measures , while wilcoxon signed - rank sum tests were used for highly skewed continuous measures and fisher s exact test was used for categorical measures with low expected cell counts . \n the primary analysis of the changes in the total sgrq score from baseline to the 8-week visit compared the two treatment arms , including only those patients who had completed the study , using an initial t - test and an additional planned analysis regressing the change in sgrq total score on the study arm , baseline total score , and age , sex , and % predicted fev1 . \n changes in outcomes were compared using a simple t - test and an analysis regressing the change in outcome on the intervention arm , respective baseline measure , age , sex , and baseline percentage predicted fev1 . \n residual diagnostics for the sgrq , cbsas , sf-36 , and lung spirometric outcomes indicated no problems with the analyses mentioned earlier , and diagnostic results for the measures of systemic oxidative stress and inflammation indicated some lack of normality and skewness . \n additional analyses of the logarithmic transformation of these measures yielded better diagnostic measures of fit for some of the outcomes , but the results were comparable to those from the initial analyses . due to a potential safety issue , we terminated the trial after 51 patients had been randomized . \n this decision was largely based on the study of sayin et al23 that was published after we had started the study . \n they showed that vitamin e and nac given orally stimulated tumor growth and proliferation in mouse models of b - raf- and k - ras - induced lung cancer by reducing oxidative stress and dna cell damage and by suppressing activation of p53 , a key tumor suppressor protein . \n they were able to replicate these findings in cell lines from both human and mouse lung tumors , suggesting that these findings may have relevance to human lung cancer . \n we terminated the trial because of concerns about administering very large doses of nac to patients with severe copd who were at a very high risk for developing lung cancer . \n the study team was unblinded to the efficacy outcomes only after the decision had been made to terminate the trial . \n we conducted a randomized , double - blinded , placebo- controlled trial comparing high - dose nac , 1,800 mg twice daily , versus placebo for 8 weeks in copd patients with chronic cough and sputum production . \n principal eligibility criteria were : 1 ) ratio of postbronchodilator forced expiratory volume in 1 second ( fev1 ) to forced vital capacity of < 0.70 along with an fev1 < 65% of predicted , 2 ) age > 40 years and 85 years , 3 ) current or past history of cigarette smoking of at least ten pack - years , 4 ) no copd exacerbation in the last 4 weeks , and 5 ) presence of chronic bronchitis . \n we defined chronic bronchitis as a positive response to questions 1 and 2 of the sgrq , meaning that cough was present \n several days per week or almost every day and sputum production was present several days per week or \n almost every day.13 this definition correlates well with the more traditional definition of chronic bronchitis but identifies more patients with this phenotype.14 principal exclusion criteria were : 1 ) primary clinical diagnosis of asthma , 2 ) uncompensated heart failure , 3 ) cirrhosis with ascites and edema , 4 ) estimated glomerular filtration rate of < 30 ml / min/1.73 m , 5 ) use of long - acting nitrates , and 6 ) inability to provide informed consent . \n patients with a propensity to develop edema from heart failure or liver disease were excluded because each tablet of the study drug contained 200 mg of sodium for a daily total of 800 mg . \n patients taking long - acting nitrates were excluded because nac may potentiate drugs of this class.15 the trial was conducted with a common protocol at three sites in the minneapolis \n st paul metropolitan area : the minneapolis va health care system , the healthpartners research foundation , and the university of minnesota medical center . \n the institutional review boards at each participating site approved the study ( minneapolis va health care system , the healthpartners research foundation , and the university of minnesota medical center ) , and all patients gave written informed consent . \n at each site , patients were randomized 1:1 to active drug or placebo in permuted blocks of size two . \n research pharmacists at each site were the only study personnel with access to the randomization list , and they assigned the treatment accordingly . \n the nac was synthesized and formulated according to good manufacturing practice standards by bioadvantex pharma , inc . \n ( mississauga , on , canada ) , which donated the study drug and matching placebo . \n effervescent tablets containing 900 mg of nac were packaged in airtight packets made of aluminum foil to prevent oxidation . \n placebo tablets were indistinguishable from active drug in terms of appearance , effervescence , taste , and odor . \n patients were instructed to take two tablets dissolved in water or fruit juice twice daily . \n patients were allowed to continue all of their usual medications , except for guaifenesin and other over - the - counter antitussives . \n the primary outcome was change in the total score of the sgrq , a well - validated measure of health status in patients with chronic lung disease.13 the sgrq is scored on a scale of 0100 with 100 representing the worst respiratory health status . \n this instrument was self - administered at baseline and again at the end of the 8-week study . \n as secondary clinical outcomes , we evaluated changes in the three domains of the sgrq , the chronic bronchitis symptoms assessment scale ( cbsas ) , and the short form-36 health survey ( sf-36).16,17 we assessed lung function with postbronchodilator spirometry , systemic inflammation with serum c - reactive protein levels , and systemic oxidative stress with plasma 8-isoprostane levels.18 we further assessed oxidative stress and biochemical efficacy of nac , by measuring changes in thiol redox couples , gsh / gsh disulfide ( gssg ) and cysteine / cystine ( cys / cyss ) in plasma . trained laboratory technicians separated and processed plasma from collected blood , closely following the methodology described by jones and liang.19 samples were immediately frozen and then shipped to the clinical pediatric center biomarkers core laboratory at emory university for the measurement of the thiol redox couples . \n plasma samples were also processed for the measurement of 8-isoprostane , as described previously.20 measurements of plasma thiol redox couples and 8-isoprostane were performed only in the subset of patients who were randomized at the minneapolis va health care system . \n patients were questioned during a mid - study telephone call at week 4 and at the final study visit at week 8 regarding all adverse events , including possible drug reactions and health care utilization . \n reports of serious adverse events were promptly filed with the institutional review board per institutional policies . as an added safety measure , common laboratory tests , including a complete blood count , electrolytes , creatinine , alanine aminotransferase , and prothrombin time , \n the trial was designed to detect a between - group difference of 4 u in the mean change of the total score for the sgrq from baseline to 8 weeks . \n the 4-u change is widely accepted as the minimal clinically important difference for the sgrq.21 for our sample size calculation , we assumed a sd of 7.5 u for the change in sgrq measurements , based on a prior trial of similar patients with copd and similar duration conducted at the minneapolis va health care system.22 based on these assumptions , 55 patients in each arm would provide 80% power for detecting a four - point difference between groups with a two - tailed alpha error of 0.05 . to account for the potential dropout of patients , we had planned for a total sample size of 130 patients , 65 patients in each arm . \n baseline comparisons of treatment groups applied two sided student s t - test to continuous measures and chi - square tests to categorical measures , while wilcoxon signed - rank sum tests were used for highly skewed continuous measures and fisher s exact test was used for categorical measures with low expected cell counts . \n the primary analysis of the changes in the total sgrq score from baseline to the 8-week visit compared the two treatment arms , including only those patients who had completed the study , using an initial t - test and an additional planned analysis regressing the change in sgrq total score on the study arm , baseline total score , and age , sex , and % predicted fev1 . \n changes in outcomes were compared using a simple t - test and an analysis regressing the change in outcome on the intervention arm , respective baseline measure , age , sex , and baseline percentage predicted fev1 . \n residual diagnostics for the sgrq , cbsas , sf-36 , and lung spirometric outcomes indicated no problems with the analyses mentioned earlier , and diagnostic results for the measures of systemic oxidative stress and inflammation indicated some lack of normality and skewness . \n additional analyses of the logarithmic transformation of these measures yielded better diagnostic measures of fit for some of the outcomes , but the results were comparable to those from the initial analyses . \n due to a potential safety issue , we terminated the trial after 51 patients had been randomized . \n this decision was largely based on the study of sayin et al23 that was published after we had started the study . \n they showed that vitamin e and nac given orally stimulated tumor growth and proliferation in mouse models of b - raf- and k - ras - induced lung cancer by reducing oxidative stress and dna cell damage and by suppressing activation of p53 , a key tumor suppressor protein . \n they were able to replicate these findings in cell lines from both human and mouse lung tumors , suggesting that these findings may have relevance to human lung cancer . \n we terminated the trial because of concerns about administering very large doses of nac to patients with severe copd who were at a very high risk for developing lung cancer . \n the study team was unblinded to the efficacy outcomes only after the decision had been made to terminate the trial . \n the first patient was randomized in september 2012 , and the last randomization occurred in february 2014 . \n of the 58 patients who provided informed consent , 51 were randomized , and 45 completed the trial : 22 being assigned to placebo and 23 to nac ( figure 1 ) . \n failure to complete the study was due to the termination of the trial prior to the scheduled final visit in five patients , while one patient was physically unable to make the final visit . \n all patients were caucasian with both treatment arms having an average age of ~70 years , an average fev1 of ~40% of predicted , and a high frequency of prior exacerbations and cardiovascular events ( table 1 ) . as might be anticipated in a trial with a relatively small sample size \n patients in the placebo arm were more likely to be current smokers but less likely to be using home oxygen . \n baseline scores for the symptom domain of the sgrq and of the cbsas suggest that the symptoms of chronic bronchitis were somewhat more severe among patients in the placebo arm . based upon the counts of returned study drug , the overall compliance \n was estimated at 94% in the placebo arm and 93% in the nac arm . in the primary outcome , the total sgrq score improved from baseline to the 8-week visit in both treatment arms with differences that were not statistically significant ( adjusted mean difference , 0.1 u ; 95% ci , 7.8 to 8.18 u ; p=0.97 ; table 2 ) . \n similarly , there were no statistically significant treatment - related differences in any of the individual sgrq domains , in the cbsas , or in either the physical or the mental component of the sf-36 . compared to placebo , \n nac had no statistically significant effect on any of the spirometric parameters , except for a marginal improvement in the unadjusted fev1 in patients who received nac ( table 3 ) . \n there was no statistically significant effect on plasma concentrations of any component of the redox pairs , gsh / gssg and cys / cyss ( table 4 ) . \n nac also had no statistically significant effect on reducing the levels of serum c - reactive protein or plasma 8-isoprostane , compared to placebo ( table 4 ) . \n after terminating the study , we assessed the conditional probability of having found statistically significant results had the study continued , using the stochastic curtailment method of of lan and wittes , as discussed by lachin.24,25 we calculated the conditional probability of rejecting the null hypothesis for the primary outcome conditional on the data collected from the 45 patients who completed the sgrq at the beginning and at the end of the 8-week trial . under the original study design assumptions , the conditional probability that data acquired from the planned completion of 110 patients would have detected the differences in the sgrq total score , given the findings to date , was 0.096 . \n using the observed data to estimate the drift parameter central to this calculation , this conditional probability of detecting the differences in the sgrq total score was < 10 . had a mid - study futility analysis been incorporated into the protocol , this result would in itself have terminated the study . \n high - dose nac was generally well tolerated , and most adverse events were thought to be unrelated to the study drug . of the 22 patients in placebo arm , nine reported at least one adverse event with a total of 19 events , three of which were considered serious ( figure 2 ) . of the 23 patients in nac arm , \n 13 reported at least one adverse event with a total of 24 events , three of which were considered serious . \n five patients in the nac arm reported nausea or diarrhea versus only one patient in the placebo arm . \n these symptoms were mild , and the study drug did not need to be terminated for any of these events . \n there were six copd exacerbations reported in the placebo arm with three requiring hospitalization and seven in the nac arm with two requiring hospitalization . \n there were no statistically significant treatment - related differences in blood counts , electrolytes , creatinine , alanine aminotransferase , and prothrombin time , when the baseline values were compared with those at the 8-week visit ( data not shown ) . \n in this randomized controlled trial , we assessed the effects of high - dose oral nac , 1,800 mg twice daily , for 8 weeks in patients with copd and chronic bronchitis . \n this dose of nac is threefold larger than that tested in any other randomized , placebo - controlled copd study of which we are aware . \n though this dose of nac was generally well tolerated over an 8-week period , it did not improve the primary outcome of respiratory health status , as assessed by the sgrq total score . similarly , nac did not improve scores on any of the individual domains of the sgrq , on the cbsas , or on either component of the sf-36 . \n there was also no substantial improvement in spirometry and no improvement in any of the circulating biomarkers of systemic oxidative stress and inflammation . \n there is uncertainty as to how best to assess clinical symptoms associated with chronic bronchitis . \n we chose to use changes in the sgrq total score as the primary outcome , as it is the best - validated assessment of overall respiratory health status in patients with copd , and the clinically meaningful difference of four units has been established . \n the symptom domain of the sgrq contains two questions specific to chronic bronchitis , cough and sputum , and additional questions common to both chronic bronchitis and copd , such as wheezing and dyspnea.13 we did not use the symptom domain as the primary outcome because the clinically meaningful difference has not been established . \n there was concern that any signal present in the symptom domain might be lost when combined with the activity and impact domains , but we found changes in the symptom domain score to be strongly correlated with changes in the total score ( r=0.78 ) . as a secondary outcome , we also administered the cbsas to assess chronic bronchitis severity . \n the cbsas was designed to assess chronic bronchitis in a more specific and comprehensive manner than does the sgrq , but the instrument has not been fully validated , and the clinically meaningful difference has not been established.16 we did find a moderately strong correlation ( r=0.57 ) between changes in the cbsas score and changes in the sgrq total score , providing additional evidence that the use of the sgrq total score as our primary outcome was appropriate . \n low - molecular thiol / disulfide couples , such as gsh / gssg and cys / cyss , have diverse cellular redox signaling functions , some of which occur as responses to a variety of oxidative and inflammatory stresses.26 measurements of gsh / gssg and cys / cyss couples in plasma provide a direct measure of systemic oxidative stress in the extracellular space and an indirect measure of the redox state within the cells.19 it has been demonstrated that plasma gsh / gssg and cys / cyss couples in smokers are in a more highly oxidized state when compared to nonsmokers , thus supporting the suggestion that systemic oxidative stress may play an important role in the pathogenesis of copd and other smoking - related diseases.27,28 by administering a large dose of nac , we anticipated that measurements of plasma thiol couples might reflect a reduction in systemic oxidative stress . however , within the limitations of our sample size , we were unable to show that nac had any such effect for reasons that are not understood . \n when given orally , nac is readily absorbed in the intestine and rapidly deacylated , mostly in the liver , to produce cys.29 it has been previously shown that increased levels of plasma cys can be detected for only 12 hours following a single oral dose.30 the availability of cys is a rate - limiting step in the synthesis of intracellular gsh , but multiple cys metabolic pathways exist , and it is unclear as to what net effect transient increases in plasma cys concentrations might have on sustained intracellular and extracellular gsh levels.31 it has been reported that oral nac , given in daily doses of 1,800 mg for 5 days , increases gsh concentrations in bronchoalveolar lavage fluid by ~50% in patients with fibrotic lung disease.32 however , in another study , the same dosing regimen did not statistically significantly raise gsh levels in plasma or bronchoalveolar lavage fluid from patients with mostly mild to moderately severe copd.30 we also found that a larger than usual dose of oral nac did not cause sustained increases in plasma gsh concentrations in our patients with copd when compared to placebo . \n we did not attempt to assess gsh levels in bronchoalveolar lavage fluid due to the severity of our patients disease . \n oral nac is frequently described as a mucolytic by virtue of its capability to cleave mucin disulfide bonds . in vitro , \n equimolar 50 mm concentrations of nac , cys , and gsh substantially reduce mucus viscosity to about the same extent.7 this effect is highly concentration dependent , and only small effects are evident with a tenfold dilution . \n it has been reported that gsh concentrations in the alveolar epithelial lining fluid of smokers may be in the millimolar range , but that methodology has been questioned , and the true values may be substantially lower.33,34 if oral nac does raise gsh concentrations on alveolar and airway surfaces sufficient to reduce mucus viscosity , it is not apparent whether this imparts clinically important benefits in patients with copd and chronic bronchitis . \n in summary , we were able to show in this randomized , placebo - controlled trial that very large doses of nac , 3,600 mg daily , are well tolerated over an 8-week period in patients with stable copd and chronic bronchitis . \n however , we were unable to show that a high dose of nac improved overall respiratory health status , lung function , or circulating measures of systemic oxidative stress and inflammation . \n these conclusions are tempered by the relatively short period of nac administration and by the small sample size resulting from the early termination of the trial .", "role": "user" }, { "content": "backgroundclinical outcomes are worse in patients with copd and chronic bronchitis . \n n - acetylcysteine ( nac ) is commonly prescribed for such patients but with uncertain clinical benefits . \n we postulated that oral nac , at much larger doses than those ordinarily prescribed , would improve clinical outcomes in a subset of patients with copd and chronic bronchitis.objectivethe aim of this study was to determine whether very high - dose nac would improve respiratory health status in patients with copd and chronic bronchitis.methodspatients with copd and chronic bronchitis were enrolled in a randomized , controlled , double - blinded trial . \n patients received oral nac ( 1,800 mg ) or matching placebo twice daily for 8 weeks in addition to their usual respiratory medications . \n the primary outcome , respiratory health status , was assessed by changes in the st george s respiratory questionnaire . \n the effects of nac on lung function and circulating markers of oxidative stress and inflammation were also evaluated.resultswe terminated the study prematurely because new external information suggested the possibility of a safety issue . \n of the planned 130 patients , 51 were randomized and 45 ( 22 in the placebo arm and 23 in the nac arm ) completed the study . \n there was no statistically significant difference between changes in the st george s respiratory questionnaire total score , comparing nac to placebo ( adjusted mean difference , 0.1 u ; 95% ci , 7.8 to 8.18 u ; p=0.97 ) . \n there were also no significant nac - related improvements in any of the secondary outcomes.conclusionin this 8-week trial , we were unable to show any clinical benefit from a very high dose of nac in patients with copd and chronic bronchitis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cancer remains as a life - threatening disease and a leading cause of death as its control has been difficult . \n although , a range of conventional therapies based on chemotherapy , surgery , and radiotherapy are available , these approaches are in many cases of limited efficacy . moreover , \n current anticancer regimens are frequently associated with significant levels of toxicity and the emergence of drug resistance . \n one major challenge to relieve cancer burden is to develop highly effective drugs with specificity on cancers but little or no side effects on normal mammalian cells . \n many research projects have been focused on developing new chemotherapies either by exploring the anticancer ability of novel compounds or by assessing drugs conventionally used in other clinical diseases . \n natural products have been found to be a relevant source of novel and potent bioactive compounds with minimal side effects in vivo . \n plant derivatives have been known to be effective against a range of diseases with broad antimicrobial activity , and some have also exhibited significant antitumor activity . \n one of the promising compounds is artemisinin , a naturally occurring antimalarial with anticancer properties . \n artemisinin and its derivatives , which are commonly used in malaria therapy , have also potent anticancer activity in the nano- to - micromolar range in sensitive and drug- or radiation - resistant cell lines [ 35 ] . \n importantly , artemisinin is one of the very few drugs that have been widely used as antimalarials but has no significant side effects or clinical resistance , although tolerance has been reported . \n recently , growing amount of research has focused on the mechanisms underlying the action and response to artemisinin - like drugs . in this review \n , we will revisit some of the key issues in the development of artemisinin and its analogs as anticancer agents to better understand the mechanisms of their antitumor effects from the insights of new gained knowledge . by considering the benefits , limitations , and current and future development of artemisinins \n , we can then identify emerging questions and address future research needs in this promising field of cancer drug discovery . \n this endoperoxide compound is extracted from the chinese herb qinghaosu ( artemisia annua or annual wormwood ) which was used for treating fevers for over two millennia . despite its efficacy , \n the prototype drug , artemisinin , has pharmacokinetic limitations . naturally , artemisinin has low solubility in water or oil , poor bioavailability , and a short half - life in vivo ( ~2.5 h ) [ 9 , 10 ] . to overcome some of these problems , three generations of artemisinin - like endoperoxides including semisynthetic derivatives and fully synthetic compounds \n so far , two generations of semisynthetic derivatives of artemisinin such as artesunate , arteeter , artemether , and artemisone have been effectively used as antimalarials with good clinical efficacy and tolerability ( figure 1 ) . \n semisynthetic artemisinins are obtained from dihydroartemisinin ( dha ) , the main active metabolite of artemisinin [ 11 , 12 ] . \n the first generation of semisynthetic artemisinins includes arteeter and artemether , the lipophilic artemisinins , whereas artesunate is the water soluble derivative [ 11 , 12 ] . \n artemisone , a second - generation artemisinin , has shown improved pharmacokinetic properties including longer half - life and lower toxicity . \n so far , artesunate is the derivative that is commonly used in the antimalarial combination therapy . \n fully synthetic artemisinin derivatives have also been designed by preserving the peroxide moiety which confers potent drug activity . \n these compounds are easily synthesized from simple starting materials , thus being currently under intense development [ 1417 ] . \n in the malaria parasite , the endoperoxide moiety of artemisinin has been shown to be pharmacologically important and responsible of the antimalarial activity [ 18 , 19 ] . \n the endoperoxide bond is thought to be activated by reduced heme ( fpfeii ) or ferrous iron ( feii ) , leading to cytotoxic carbon - centered radicals which are highly potent alkylating agents . \n however , the precise mechanism of action and primary target of artemisinin remain under study . in plasmodium \n , it has been postulated that artemisinin may target organelles such as the mitochondrion , endoplasmic reticulum , and the digestive vacuole ( reviewed in ) . \n some postulated molecular targets include heme alkylation , protein alkylation , ca atpase ( serca ) inhibition , membrane damage , and loss of mitochondrial potential ( reviewed in ) . despite the continuous debate on artemisinin activation and specific targets , supporting evidence points that heme or ferrous iron is required for potent activity . \n , artemether has an exquisite action against the tegument ; this activity is also enhanced by iron . \n interestingly , the potent anticancer action of artemisinin can also be attributed to the endoperoxide bond ( red square in figure 2 ) and shares the same parasitical chemical base . \n lack of the endoperoxide moiety does not completely abrogate anticancer activity but significantly reduces cytotoxicity to only fiftieth compared to those compounds with the trioxane ring [ 2628 ] . \n residual anticancer activity may be associated with an alternative peroxide - independent mechanism . in a general consensus , \n iron and heme or heme - bound proteins have been involved in the bioreductive activation of artemisinin [ 2931 ] . in most of the systems , \n preloading of cancer cells with iron or iron - saturated holotransferrin ( diferric transferrin ) triggers artemisinin cytotoxicity [ 3235 ] with an increase in artemisinin activity up to 100-fold in some cell lines . \n moreover , artemisinins tagged to iron - carrying compounds exhibit greater activity compared with that of artemisinin alone [ 3739 ] . \n recently , it was shown that chemical modulation using succinylacetone , a heme synthesis inhibitor , decreases dha cytotoxicity in hl-60 ( human promyelocytic leukemia cells ) . \n this was consistent with previous studies showing that induction of heme oxidase followed by downregulation of the heme synthesis genes may also inhibit cytotoxicity of novel artemisinin dimers in the same cancer line . similarly , \n iron and heme metabolism may have a relevant role in the selective antitumor activity of artemisinin . continued proliferation and growth of malignant cells require higher iron metabolism to achieve processes of cell survival . \n therefore , cancer cells exhibit an increase in transferrin receptors ( tfr ) which are responsible for the iron uptake and regulation of intracellular concentrations . \n levels of expression of tfr in cancer cells may vary depending on the cell line . \n however , they differ substantially from normal cells leading to a high selectivity index of artemisinin and its derivatives . \n reported that leukemia ( ccrf - cem ) and astrocytoma ( u373 ) cells express tfr in 95% and 43% of the cell population , whereas normal monocytes only account for approximately 1% [ 42 , 43 ] . \n it has been hypothesized that iron - activated artemisinin induces damage by release of highly alkylating carbon - centered radicals and radical oxygen species ( ros ) ( figure 2 ) [ 28 , 35 ] . \n radicals may play a role in the cell alterations reported in artemisinin - treated cancer cells such as enhanced apoptosis , arrest of growth , inhibition of angiogenesis , and dna damage ( figure 2 ) . \n several studies have also associated artemisinin toxicity with impaired cytokinesis , enhanced levels of oxidative stress , inhibition of tumor invasion , migration , and metastasis ( reviewed in ) . \n tumor cells have enhanced vulnerability to ros damage as they exhibit lower expression of antioxidant enzymes such as superoxide dismutase , catalase , and gluthatione peroxidase compared to that of normal cells [ 45 , 46 ] . hence , increasing oxidative stress is a common anticancer mechanism of antitumor agents . in addition , the selectivity of artemisinin may be boosted by preferential targeting of cancer biomarkers or overexpressed cancer genes and proteins which are not detectable in normal differentiated tissues . as in plasmodium , \n although artemisinin - induced alterations in some tumor cells are consistent , it is not clear if this toxicity resides in defined molecular targets . \n drug concentrations required to have an effect on cancer cells are often higher than those inducing toxicity in malaria parasites . \n artemisinin , dha , artesunate , and artemether exhibit 48 h ic50s ( fifty percent inhibitory concentration ) up to 15 nm in malaria parasites [ 49 , 50 ] , whereas their anticancer activity is cell - line dependent and ic50s fluctuate between 0.5 and 200 m . \n the exquisite sensitivity of malaria parasites to artemisinin points to the presence of specific parasitic targets . \n by contrast , in cancer cells , the artemisinin effect seems to be rather mediated by more general mechanisms through generation of ros . \n however , it has been suggested that ros - mediated damage may be triggered by an initiating event in the vicinity of artemisinin activation . \n microscopy analyses in artesunate - treated cells have shown early oncosis - like morphological changes at subcellular structures in which ros generation may be triggered . \n microarray analyses found that the action of artemisinin seems to be modulated by the expression of oxidative stress enzymes including catalase , thioredoxin reductase , superoxide dismutase and the glutathione s - transferase family [ 5 , 52 ] . \n artemisinin - sensitive cells have downregulated oxidation enzymes whereas overexpression of these molecules renders cancer cells less sensitive . \n direct evidence in the hl-60 cell line has revealed that early and rapid generation ( 1 h ) of ros has been associated with apoptosis induction and artemisinin - induced damage . \n conversely , the action of artemisinin in several experimental systems has been reverted in presence of the antioxidant agents , n - acetyl cysteine , and 1,2-dihydroxybenzene-3,5-disulfonic acid ( tiron , an iron scavenger ) , which resulted in a delay in cell death [ 40 , 52 , 53 ] . \n a recent study has demonstrated that generation of ros in artesunate - treated hela cells ( 16 h ) occurring before cytotoxicity is being detected ( 48 h ) , suggesting that this may be the starting event in artemisinin - induced damage . the electron transfer chain ( etc ) in the mitochondrion has been proposed to play a role in the generation of ros , however substantial cytotoxicity is still detected in hela cells devoid of etc indicating that other sources of ros may be available in the cells . \n indeed , emerging evidence has postulated that oxidative stress in breast cancer cells is initially generated in the lysosome as consequence of iron - activated artesunate in a process similar to that suggested in malaria parasites . \n thus , activation of the mitochondrial intrinsic apoptotic pathway is a downstream event leading to cell death ( figure 2 ) . in this model \n , artemisinins may be negatively controlling heme synthesis and further increase cytotoxicity . despite the growing evidence of ros - mediated damage in many cell systems [ 31 , 33 , 35 , 54 ] \n particularly , novel artemisinin dimers seem to exert antitumor action with little or no ros generation , however the underlying mechanism of cytotoxicity is still under study . \n it also remains unclear if artemisinins - induced necrosis may be a ros - independent mechanism of cell death . \n the antineoplastic toxicity of artemisinins appears to be also modulated by calcium metabolism [ 40 , 5557 ] , endoplasmic reticulum ( er ) stress [ 33 , 40 ] , and the expression of the translationally controlled tumor protein , tctp , a binding calcium protein which has been also postulated as a parasite target . \n although the expression of the tctp gen , tctp , was initially correlated with cancer cell response to artemisinins , a functional role for tctp in the artemisinin action has yet to be found . as for malaria parasites , \n the role of sarcoendoplasmic ca atpase ( serca ) as artemisinin target in cancer cells has also been explored . \n previous evidence has revealed that treatment with 10 m artemisinin increases calcium concentrations as a result of serca inhibition . \n however , studies on the mechanism of action of two artemisinin dimers have shown that potent ros - mediated induced er - stress after treatment was independent of serca inhibition . \n interestingly , the behavior of a highly active artemisinin dimer and thapsigargin , a well - known serca inhibitor , seems to be similar but mediated by different molecular events . \n nevertheless the er appears to be a relevant site for artemisinin action as in hepg2 cells a fluorescent derivative has been shown to preferentially accumulate in this cell compartment . \n it is also possible that the underlying mechanisms mediating artemisinins cytotoxicity may vary upon specific hallmarks or shifting characteristics in cancer cell lines ( table 1 ) . \n this will be only possible to elucidate if the molecular events involved in countering malignant cell proliferation are investigated in different cell lines under similar conditions . \n significant antitumor activity of artemisinin and licensed semisynthetic artemisinin derivatives has been documented in vitro and in animal models . \n considerable research has been focused on the most active compounds , namely , dha and artesunate . \n one study that tested 55 cell lines from the developmental therapeutics program of the national cancer institute ( nci ) showed that artesunate displays inhibitory activity against leukemia , colon , melanoma , breast , ovarian , prostate , central nervous system ( cns ) , and renal cancer cells . \n dihydroartemisinin has also remarkable antineoplastic activity against pancreatic , leukemic , osteosarcoma , and lung cancer cells . \n moreover , artemisone has shown better activity than artemisinin and considerable synergistic interactions with other anticancer agents . \n artemisinin has been found to act either directly by inducing dna damage ( genotoxicity ) or indirectly by interfering with a range of signaling pathways involved in several hallmarks of malignancy . \n however , direct dna damage is only described in specific systems , while indirect effects are more commonly refereed in the literature . in pancreatic cells ( panc-1 ) \n interestingly , low doses of artesunate were associated with oncosis - like cell death , whereas higher concentrations induce apoptosis . extend and type of damage seem to depend on the phenotype and the origin of cell line , and it may also vary in a time- and dose - dependent manner ( table 1 ) . \n notably , higher sensitivity to artesunate was observed in rapidly growing cell lines when compared with slow growing cancer cells . \n alternatively , dha , artesunate , and artemether are likely to modulate genes and proteins coordinating growth signals , apoptosis , proliferation capacity , angiogenesis and tissue invasion , and metastasis . \n a complex network of interactions through different pathways may enhance the anticancer effect of these endoperoxide drugs leading to cancer control and cell death ( table 2 ) . in normal cells , cyclin - dependent kinases ( cdk ) \n normal growth relies on the ability to translate signals in order to replicate and divide in an effective manner . \n uncontrolled proliferation in cancer cells is the result of mutations inducing amplification of growth signals , deregulation of checkpoints , and loss of sensitivity to growth inhibitors . \n artemisinin and its semisynthetic derivatives are able to effectively induce cell growth arrest in cancer lines either by disrupting the cell cycle kinetics or by interfering with proliferation - interacting pathways . \n dihydroartemisinin and artesunate are very potent growth inhibitors with multiple studies pointing to dha as the most potent anticancer artemisinin - like compound ( dha > artesunate > arteeter > artemether ) [ 5 , 66 ] . \n recently , artemisone has shown impressive antitumor efficacy in 7 cells lines including melanoma and breast cancer cells . \n artemisinin compounds have been shown to exert cytostatic and cytotoxic action on cancer cells [ 63 , 67 ] . \n artemisinin - induced growth arrest has been reported at all cell cycle phases ; however , arrest at g0/g1 to s transition seems to be more commonly affected ( table 2 ) . \n arrest at all cell cycle phases at the same time has been interpreted as a cytostatic effect . \n disruption of the cell cycle at g2/m was observed after dha treatment in osteosacorma , pancreas , leukemia and ovarian cancer cells ( table 2 ) . \n similarly , artesunate interferes with g2 in osteosarcoma , ovarian , and other different cancer lines ( table 2 ) . \n the underlying mechanisms of artemisinins - induced growth arrest include alterations in the expression and activity of regulatory enzymes of the cell cycle , such as cdk2 - 4 and -6 and d type cyclins ( g1-to - s - phase transition ) or cdk1 , and a - type cyclin ( g2/m ) [ 7072 ] . \n the antiproliferative action of artemisinin induces downregulation of cdk transcription , inhibition of cdk promoters or increase of p21 , p27 , and cdk inhibitor ( table 2 ) . \n inhibition of proliferation may be also attributed to downregulation of interacting proteins targeting multiple pathways . \n it has been shown that dha treatment in pancreatic cells ( bxpc3 , aspc-1 ) inhibits viability by decreasing levels of proliferating cell nuclear antigen ( pcna ) and cyclin d with parallel increase in p21 . \n another study in the same system shows that dha counters nf-b factor activation leading to inhibition of its targets in the proliferation ( c - myc , cyclin d ) and apoptotic pathways ( bcl2 , bcl - xl ) . \n downregulation of survivin , a protein modulating apoptosis and g2/m cell cycle progression , was observed after treatment with dha in lung cancer cells ( spc - a1 ) . \n a similar effect was described by qiang et al . in artesunate- treated osteosarcoma cells . in prostate cancer \n , dha induces cell cycle arrest by disrupting the interaction of sp1 ( specificity protein 1 ) and the cdk4 promoter . \n in addition one work has identified artesunate as a topoisomerase ii , an inhibitor which inhibits growth by interaction with multiple pathways . \n overall , artemisinins seem to be interfering with several pathways that are common to different cancer entities . \n apoptosis is a widely studied mechanism in antitumor therapy as its manipulation is an effective strategy for cancer control . \n this cellular process is mediated by a balance between the bcl2 family genes , the proapoptotic bax , and the antiapoptotic bcl2 and their effects on the mitochondria [ 97 , 98 ] . \n an increase in the bax / bcl2 ratio induces the release of cytochrome c followed by sequential activation of caspases and culminating with cell death . \n apoptosis is a common and rapid artemisinin - induced effect observed in many cancer and cell lines . \n treatment with 200 m dha in leukemia cells induced apoptosis after 1 hour of exposure . \n artemisinin sensitivity has been correlated to the level of expression of antiapoptotic ( bcl2 ) and proapoptotic genes ( bax ) in a cancer cell line [ 61 , 97 , 99 ] ( table 1 ) . in general , \n hence , mitochondrial membrane damage is thought to have a pivotal role in the cascade of cell death events . \n many studies have revealed that artemisinin - like compounds induce apoptosis by modulating the bax / bcl2 ratio [ 33 , 44 , 54 , 63 , 75 , 77 , 78 , 86 , 99 ] . \n consistent with these observations , dha and artesunate , in a panel of osteosarcoma cells , caused cytochrome c release , bax overexpression , increase in bax / bcl2 ratio [ 44 , 73 ] , and activation of caspases 3 and 9 . \n dha also activates caspase 8 and decreases the levels of cdc25b , cyclin b1 , and nf-b . in the same system \n , artesunate exposure depletes survivin which has also been involved in the apoptotic dha response in lung cancer cells . \n similar events have been described in hepatoma cancer lines treated with dha , particularly in this system dha and the prototype drug artemisinin seem to have similar potency . \n a microarray analysis has correlated the expression levels of c - myc with enhanced dha - induced apoptosis . \n leukemia ( hl-60 ) and colon cancer cells ( hct116 ) expressing high levels of c - myc are significantly more sensitive to the dha proapoptotic action . \n moreover , knockdown of c - myc in hct116 depleted dha - associated cell death . \n downregulation of c - myc may also correlate with induced g1 arrest in this cell line . \n studies in metastatic melanoma ( a375 , g361 cell line ) and jurkat t lymphoma cells have associated the elevated apoptotic action of dha with upregulation of noxa ( a proapoptotic protein ) , caspase 3 activation , and oxidative stress [ 79 , 80 ] . in lung cells , \n the apoptotic effect of dha occurs with increasing calcium concentration and activation of p38 [ 56 , 57 ] . in some studies alterations on molecules acting on the extrinsic apoptotic pathway \n dha seems to increase the transcription of the cell death receptor 5 ( dr5 ) promoter and induces dr5 in different prostate cancer lines . \n in fact , a combination treatment with trail , a dr5 ligand , strongly enhances dha proapoptotic action by up to 35% on this system . \n artemisinins usually promote apoptosis rather than necrosis in most of the systems , however in some cases both apoptosis and necrosis have been reported . \n induction of apoptosis is a major benefit of artemisinins ' antitumor action as it prevents the collateral effects of inflammation and cell damage caused by necrosis . \n artemisinin - induced necrosis has been associated with low levels of atp and defective apoptotic mechanisms in some cell lines . \n the ability of malignant cells to invade has been associated with high mortality and morbidity in cancer patients . \n the spread of cancer cells to other organs is a process in which malignant cells readily invade through the extracellular matrix , reach and survive in the bloodstream , and finally seed at distant organs . to achieve invasion , \n the cancer cell requires the loss of expression or function of e - cadherin , a calcium - binding transmembrane molecule involved in cell - cell adhesion . a range of genes encoding extracellular matrix processing proteases , motility factors , and adhesion proteins are also acting at different steps in the metastatic process . \n recently , pai-1 and timp-1 known as endogenous protease inhibitors have also been shown to be involved in cancer metastasis . \n an invaluable benefit of artemisinin is its relevant antimigratory activity in highly aggressive and invasive cancer entities [ 56 , 59 , 88 , 91 ] . \n antimetastatic activity of artemisinins has been correlated with modified expression of the matrix metalloproteinases ( mmp ) gene family and their effects on v3 integrins . in hepatoma cells ( hepg2 and smmc 7721 ) , treatment with 12.5 m artemisinin depleted migration linked to a decrease in mmp2 with concomitant increase in timp-2 . \n inhibition of metastasis is achieved as artemisinin increases cell - cell adhesion by enhancing e - cadherin activity and cdc42 activation . \n in addition , it has been found that some cancer cells may have specific proteins cointeracting at different pathways . \n for example , in non - small cell lung cancer and fibrosarcoma , dha treatment induced low levels of mmp2 , mmp7 , or mmp9 driven by ap-1 and nf-b transactivation or inactivation . \n previous studies have shown that mmp2 is regulated by sp-1 transcription factor activity , moreover dha - induced disruption of sp-1 molecular interactions has been postulated as a crucial event for dha regulation effects on different pathways . \n other investigations have found that in mouse lung lewis cancer , lymphoid node metastasis and lymphangiogenesis were retarded by artemisinin - mediated inhibition of vascular endothelial growth factor c ( vgf - c ) . \n as malignant tissues grow , metastases and solid tumors require extra blood supply for thriving and survival . thus , cancer cells induce neovascularisation by regulating proteins and pathways involved in the generation and restructure of new vasculature . \n angiogenesis process leads to enhanced proliferation of endothelial cells through induction of vascular endothelial growth factor ( vegf ) , fibroblast growth factor ( fgf ) , its receptors , and cytokines . \n this event occurs via multiple mechanisms including hypoxia - driven activation of expression of hif-1 and the aryl hydrocarbon receptor nuclear translocator ( arnt ) . \n angiogenesis control is mediated by angiostatin , endostatin , thrombospondin , timps , pai-1 , and others . \n due to their role in tumor survival , the proangiogenic factors and the molecules involved in their regulatory networks are relevant drug targets . \n a microarray - based study revealed that artemisinins , artesunate and other derivatives inhibit neovascularisation by modulating gene expression of angiogenic factors . \n artemisinins responses seem to be mediated by downregulation of growth factors ( vegf , fgf ) [ 82 , 106 ] , hif-1 , new vessel mediator angiogenin ( ang ) , the cysteine - rich angiogenic inducer ( cyr61 ) , some metalloproteinases ( mmp9 , mmp11 , and bmp1 ) , and collagens . in parallel , artemisinins- induced upregulation of angiogenesis inhibitors was observed . \n these findings have been supported by experimental investigation in different systems , unveiling other molecular interactions . \n exposure of human umbilical vein endothelial cells to 50 m dha prevents angiogenesis by depleting the levels of the vegf flt-1 and kdr / flk-1-receptors . \n similar effects were reproduced in lymphatic endothelial cells and lewis lung carcinoma [ 78 , 84 ] . in pancreatic cells ( bxpc-3 ) and balb / c nude mice , \n dha induced inhibition of nf-b dna binding and downregulation of its angiogenic - related targets such as vegf , il-8 , cox2 , and mmp9 . reduced levels of nf-b \n have been previously associated with proliferation and metastasis inhibition [ 33 , 81 , 90 , 94 ] suggesting that nf-b regulation may be a key role in the multimodal action of dha in this system . \n nf-b is a crucial factor regulating multiple processes and it has a key role in the anticancer drug response . \n it is activated by dna damage and it is a mediator of apoptosis resistance in response to drug pressure . \n artesunate has shown its ability to revert cellular transitions allowing re - differentiation of tissues by negative control of wnt - signaling pathway . \n notably , artesunate has been found to be more effective in less differentiated cell lines . \n one major obstacle for a successful anticancer therapy is the development of resistance over time . \n a leading cause of drug resistance is the drug efflux generated by overexpression of membrane protein pumps , which results in ineffective low drug concentrations . \n anticancer activity of artemisinins has shown to be unaffected in otherwise resistant and multiresistant cancer cells . \n one study using the 55 nci cell lines and microarray analysis revealed that genes related with resistance to the established anticancer drugs such as mdr1 ( pgp ) , mrp1 , and bcrp showed no impact on the activity of artemisinins . \n this was substantiated when no effects on the artesunate growth inhibition profile were observed in multidrug resistance hl-60 cell lines overexpressing mrp-1 and bcrp - overexpressing cells , suggesting that antitumor activity of artemisinin is preserved when resistance to other agents is present . \n artemisinins are effective in a broad range of resistant cancer lines including doxorubicin , metrotexate , and hydroxyurea - resistant lines with no cross - resistance . further investigation has shown that artesunate proapoptotic effect is not affected in a doxorubicin - resistant leukemia cell line ; instead artesunate potentiates doxorubicin apoptotic effects . in another study , anticancer potency of artesunate is preserved in chemoresistant and chemosensitive neuroblastoma cell lines and primary neuroblastoma cultures . in this system , sensitivity to artesunate was not affected in vincristin , doxorubicin , cisplastin , topotecan , mephalan , and ectoposide - adapted cells with ic50s ranging from 1.42.7 m similar to that of the parent sensitive cell line . \n only one cell line showed low sensitivity to artesunate which was related to low ros formation and increased expression of gluthatione cysteine ligase ( gcl ) . \n depletion of glutathione mediated by a gcl inhibitor improved artesunate sensitivity in this cell line . \n p - glycoprotein ( pgp ) or p53 attenuation did not affect sensitivity to artesunate . \n dha has shown the lowest ic50 in some cell lines such as cholangiocarcinoma ( cl-6 ) and hepatocarcinoma ( hep g2 ) compared to other anticancer agents ; moreover , upregulation of mdr1 , mrp1 - 2 , or mrp3 shows no effect on potency . \n lack of cross resistance between anticancer agents and artemisinins might be based on different mechanisms of drug action and/or resistance . \n most of the conventional anticancer agents are nucleoside analogs , whereas artemisinins action is thought to be mediated by a ros - dependent mechanism . \n furthermore , in erythromyelogenous leukemia and human small cell lung cancer , artemisinins show no significant inhibition towards pgp or mrp1 , thus in principle overexpression of protein pump may not affect artemisinin 's potency . in another system however , artemisinin ( the prototype drug ) increases doxorubicin resistance by upregulating mdrp through a mechanism that will be discussed later . \n existing anticancer therapies predominantly target cancer proliferation either with chemotherapeutic agents , ionizing radiation or direct toxicity on growth factor signaling pathways . in a combination therapy for cancer \n , the antineoplastic action of artemisinin may contribute to an independent antitumor activity with no additional side effects . \n the benefits of combining artemisinins with other anticancer agents have been investigated showing that multifactorial action of artemisinin in different pathways may improve overall activity ( synergism ) . \n it has been reported that resistant cancer cell lines become sensitive by adding artemisinin to the conventional treatment ( chemosensitization ) . \n interestingly , dha and artesunate have exhibited the strongest chemosensitizing / synergistic effects [ 4 , 110 ] , whereas the prototype drug artemisinin shows only additive and antagonistic interactions ( table 3 ) . \n dha significantly improves the anticancer effect of gemcitabine , an anticancer drug used in pancreatic cancer which develops resistance over time . in vitro and in vivo analysis in pancreatic cells \n demonstrated a dha - induced increase in growth inhibition and apoptosis by 4- and 2-fold , respectively , compared with those obtained with gemcitabine alone . a dual action of dha in potentiating gemcitabine activity and possibly counteracting resistance has been attributed to dha inhibition of gemcitabine- induced nf-b activation and subsequent action on its targets . \n a similar effect has been shown in hepatoma cancer cell lines irrespective of their p53 status . \n dha synergistically enhances tumor growth inhibition by 45% when in combination with gemcitabine , whereas artemisinin , the prototype , only induces additive effects . \n consistent with this observation , a greater antitumor activity was observed when dha was used in a combination with cyclosphosphamide in murine lewis lung carcinoma cell line or in combination with cisplatin in non - small cell lung cancer a549 in mice . in rat c6 glioma cells , \n addition of 1 m dha increased by 177% the cytotoxic effect of temozolomide , a dna - alkylating agent used in the treatment of brain cancer . \n further investigation found that dha promotes apoptotic and necrotic activity of temozolomide through ros generation . \n recently , an enhancement of artesunate anticancer activity has been observed in different combination regimens . \n a striking synergy was achieved in combinations of artesunate and the immunomodulator drug , lenalidomide . however , the benefits of an artemisinin combination therapy need to be carefully dissected . \n therapeutic effects are influenced by the mode of action of the drugs and multiple interactions in particular systems and schedules . \n recently , gravetth et al . showed that gemcitabine has only additive effects when combining gemcitabine and artemisone in colon and breast cancer cells . in cancer colon cells ( ht-29 ) \n , it has been suggested that artemisinin may impair doxorubicin activity possibly by countering the doxorubicin effect on nf-b inhibition . \n the same authors have reported artemisinin - induced resistance in the same system through a different mechanism . \n thus , it has been postulated that artemisinin exposure inhibits serca with subsequent accumulation of calcium . as a result , \n by contrast , pretreatment with a calcium chelator reverted the cells to a sensitive phenotype . \n notably , dha and artesunate have not been evaluated in this system ; it remains to be elucidated whether the most potent chemosensitizers have similar effects on this cell line . \n so far , artesunate or dha in combination with doxorubicin and pirarubicin showed chemosensitizing effect in leukemia and human - small - cell cancer - resistant cell lines , but no further increase of sensitivity was observed in the sensitive parent cell lines . \n overall , this evidence suggests that dha and artesunate have remarkable ability to potentiate antitumor agents and to counter tumor resistance . \n u373 mg , dha treatment inhibits the radiation - induced expression of gst with concomitant ros generation . \n a combination treatment with dha has been shown to be more effective than radiation or dha alone . \n the adjuvant effect of artemisinin in other cancer treatments including hyperbaric oxygen has also been reported . \n a salient feature of artemisinin is that artemisinin resistance in vitro or in the field has yet to be confirmed after 30 years of use as an antimalarial . \n clinically , tolerance has been reported in patients with therapeutic failure . however , in vitro tolerant strains are usually unstable and only develop after several years of continuous drug exposure . \n the multimodal action of artemisinins at different cancer pathways might also predict a delay of induced resistance in malignant cells . indeed , only few cell lines have shown intrinsic low sensitivity or no response to artemisinin or its derivatives . \n for example , artemisinin ( the prototype drug ) seems to be less active in breast cancer cells ( mcf-7 ) and gastric cancer ( mkn ) . \n some studies in breast cancer cells have suggested that artemisinin response may be mediated by estrogen receptors ( er and er ) which are involved in cell proliferation ( reviewed in ) . \n interestingly , it has been documented that in breast cancer cells , disruption of iron metabolism may enhance potency of doxorubicin and cisplatin . \n the low response to artemisinin has been also associated with overexpression of bmi-1 in highly metastatic nasopharyngeal cancer cell lines ( cne-1 , cne-2 ) . \n a recent study found some levels of cross resistance to artesunate and dha in a unique cisplatin chemo - resistant cell line . \n this effect was partially reverted by l - buthionine - s , r - sulfoximine , an inhibitor of the antioxidant glc . however , in vitro resistance has already been developed under experimental conditions . \n microarray and experimental studies using knockouts and transfected cells indicate that upregulation of the tumor suppressor p16 and the antioxidant protein , catalase , may confer resistance to artesunate independent of the p53 status . \n recently , concerns have arisen after baechmeier et al . showed that a 24 h preincubation with 20 m artesunate induces resistance in highly metastatic breast cancer cells . \n pretreated mda - mb-231 metastatic cells were completely refractory to further artesunate treatment , whereas a similar treatment in mda - mb-468 , a non - metastatic cell line , renders less sensitive cells . \n further investigation on the mechanism of artesunate - acquired resistance indicates that upregulated transcription of nf-b , ap-1 , and nmp-1 overcome artesunate apoptotic and antimetastatic action and allows tumor progression . \n it is not clear , however , whether artesunate - induced resistance and loss of sensitivity are preserved after long - term cell subculturing . \n it also remains to elucidate if other semisynthetic endoperoxides may induce a similar effect or whether a combinational therapy may delay or revert the effect on cell lines bearing this phenotype . \n this problem may be overcome by enhancing anticancer activity and thus reducing toxic drug concentrations . \n neurotoxicity has been reported in animal studies in a dose- and time - dependent manner ( 7 days ) [ 118120 ] . \n the toxicity of artemisinin - like compounds has been associated with long - term availability , whereas short - term peak concentrations are not toxic . \n thus , rapid elimination of artemisinin in oral formulations is safer than slow - release or oil - based intramuscular formulations [ 6 , 121 ] . \n remarkably , although artemisinins derivatives have been widely used as antimalarials , their toxicity in humans have been shown to be negligible . in cancer therapy , \n artemisinin may have multiple benefits as it can be used in combination with no additional side effects , but also it enhances potency and reduces doses of more toxic anticancer partners . \n clinical doses used in malaria treatment after administration of 2 mg / kg in patients rise plasma concentrations of 2640 + 1800 g / ml ( approximately 6.9 4.7 mm ) which can be considered up to 3 orders of magnitude higher than those artemisinin concentrations with antitumor activity . \n it becomes relevant to closely monitor the safety of long - term artemisinin - based therapies as severe side effects may be highly unusual but significant . \n so far , artemisinin treatments for as long as 12 months have been reported with no relevant side effects [ 30 , 122 , 123 ] . \n however , an extremely rare case of toxic brainstem encephalopathy was described in a patient after a 2-week herbal / artemisinin combination ( 400 mg ) regimen for breast cancer . \n brainstem neurotoxicity has been reported in animal studies and associated with long - term ( > 28 days ) and high - dose treatments . \n recently , a fatal case of overdosing in a child who was taking antimalarial treatment was reported . \n antitumor activity of artemisinin has also been documented in human trials and individual clinical cases [ 30 , 122 ] . \n artemether and artesunate have been used in cancer therapy with good tolerability and lack of significant side effects . \n artesunate was successfully used in the treatment of laryngeal squamous cell carcinoma and substantially reduced the size of the tumor ( by 70% ) after two months of treatment . furthermore , artesunate increased survival and substantial metastasis reduction when used in combination with standard chemotherapy in patients with malignant skin cancer . \n another report describes a beneficial improvement in a patient with pituitary macroadenoma who was treated with artemether for 12 months . \n artemether has longer half - life and easily crosses the blood - brain barrier which is crucial for brain tumor treatment . \n similarly , a clinical trial in 120 patients with advanced non - small cell lung cancer has shown that artesunate in combination with a chemotherapy regimen of vinorelbine and cisplatin elevated 1-year survival rate by 13% with a significant improvement in disease control and time to progression . \n another trial in uk in colorectal adenocarcinoma to evaluate anticancer action and tolerability of artesunate was completed last year , but the results have not been published . \n imperative need of highly effective compounds with enhanced pharmacological properties has led to the design of novel endoperoxide compounds with selective toxicity toward cancer cells . \n considerable progress has been made in the design of novel compounds with enhanced potency at the nanomolar range , increased selectivity , and low toxicity in vitro . \n independent of stereo- or region - chemistry , strong inhibition was influenced by the functional group attached to the triazole ring . \n substituted compounds with a penthyl benzene group showed the highest antiproliferative activity ranging from 0.07 to 0.39 m 72 h ic50 in 6 cancer lines . \n recently , feng et al . synthesized a series of dihydroartemisinin derivatives via an aza - michael addition reaction with high selectivity index and ic50 in the nanomolar range against hela cells ( 0.37 m ) . in a series of deoxoartemisinins and carboxypropyldeoxoartemisinins , \n different from their antiparasitic activity , it has been found that dimeric and trimeric artemisinin derivatives display much higher antitumor activity than their monomeric counterparts . in the last decade , \n an increase in the number of outputs in artemisinin dimeric compounds with anticancer activity has been observed . \n these compounds have shown ic50 ranging from 0.014 to 6 m [ 130 , 131 ] . \n potent anticancer toxicity has been correlated with the nature of the linker and with lipophilicity or electrophilic substitutions . \n posner et al . developed a series of artemisinin - trioxane derivate dimers from which two phosphate esters displayed nanomolar growth inhibitory values in the nci 60 human cell line screen . \n further investigation in vitro showed that in hl-60 cells , these compounds are more potent than doxorubicin , whereas their strongly anti - parasitic monomeric counterparts showed no anticancer activity . \n as suggested by the authors , two trioxane units in addition to the nature of the linker may be relevant in conferring potent anticancer activity . \n homodimers of artesunic acid have also nanomolar inhibitory values when tested in chemo - resistant and sensitive leukemia cells . \n notably , the artesunic dimer seems to be 6-fold more potent in the multiresistant pgp overexpressing cells ( cem / adr500 ) than in its sensitive counterparts . \n anticancer activity was attributed to apoptosis induction , arrest of cell cycle at g0/g1 , and ros generation . in prostate cancer cells ( lncap , tramp cia , and c2h ) \n , two c10 non - acetal trioxane dimers displayed a 3-fold increase in potency compared to doxorubicin ( 17 - 18 nm versus 45.3 nm resp . ) . the dimers induced arrest at g0/g1 mediated by decreasing cyclin d1 , cyclin e , cdk2 , and an increase in p21 and p27 \n in many studies , there has been an emphasis on the nature and stereochemistry of the dimer linker which may influence anticancer activity . \n however , it has also been shown that the linker by its own is inactive . \n have described that an artemisinin dimer exhibits up to 30-fold more activity than artemisinin in prostate cancer lines . \n this dimer selectively exerted highly antigrowth potential and apoptosis in c4 - 2 ( a cell line derived from lncap ) and lncap cells compared to artemisinin . \n an enhanced anticancer activity seems to be given by the stereoisomery of the linker . in another study , \n c12 non - acetal dimers and one trimer of deoxoartemisinin showed similar potency to that of the conventional anticancer drugs against many cell lines . \n the linker with one amide or one sulfur - centered 2 ethylene groups was essential for potent anticancer activity . \n diastomeric - cholic - acid - derived 1,2,4,5-tetraoxanes were also tested and found to have high anticancer activity against human melanoma ( fem x ) , and cervix cancer ( hela ) cis stereoisomers were twofold more active . \n the authors further suggested that an amide terminus in the linker confers increased anticancer activity . \n interestingly , beckman et al . showed that the stereochemistry of the ether linkage of the dimers , of dihydroartemisinin ( didha ) , and dihydrodeoxyartemisinin ( the respective endoperoxide lacking dimer ) was as important for antitumor activity as the endoperoxide moiety . \n dimers were tested against 60 cells from 9 different cancers showing that although in general the didha was more active than dihydrodeoxyartemisinin toward anticancer growth , asymmetrical dimers of either didha or dihydrodeoxyartemisinin were similarly toxic . \n the mechanism underlying the antiproliferative action of the artemisinin - derived dimers needs further study . \n recently , a series of potent artemisinin - like derivatives of easy synthesis and anticancer activity has been identified . \n these compounds also exhibit relevant antiangiogenic properties as judged by studies in a zebrafish model . \n it is important to recall that some limitations of artemisinins such as short half - life ( between 1 and 5 hours [ 136 , 137 ] ) , limited affordability , and solubility need to be further addressed . \n although semisynthetic compounds have partially overcome these issues , they still rely on the availability of natural precursors . in malaria , some trioxolanes and ozonides with remarkable improved pharmacokinetics are under clinical development . recently \n , it has been found that synthetic trioxolanes with enhanced pharmacokinetic properties may exhibit a similar toxicity than artesunate in schistosomas . \n given that artemisinins may be potentially used as anticancer drugs and possibly in other parasitic and viral infections , the development of novel compounds with enhanced pharmacokinetic properties and targeted anticancer actions is also paramount . \n although novel semisynthetic artemisinins have shown substantial antineoplastic activity , there is still limited information regarding the cytotoxicity of fully synthetic endoperoxides . \n a triol substituted compound has displayed prominent antitumor action in vivo toward melanoma ( lox imvi ) and ovarian ( igrov1 ) cancer in nanomolar concentrations ( lc50 60 nm ) . \n other authors have synthesized compounds with dual action ( antimalarial / anticancer effect ) . these deoxycholic - acid-(dca-)and cholic acid ( ca)derived mixed tetraoxanes are cytotoxic at very low concentrations and particularly potent against melanoma cancer ( lox imvi , lc50 up to 69 nm ) . \n this drug class has shown many biological activities , in particular , strong anticancer growth activity . \n supporting evidence indicates that artemisinin - like compounds may be a therapeutic alternative in highly metastatic and aggressive cancers with no long - term effective therapy [ 44 , 61 ] and commonly developing drug resistance . \n furthermore , antimalarial endoperoxides may act synergistically with other anticancer drugs with no additional side effects . \n the ability of artemisinins to kill cancer cells through multiple and heterogeneous molecular events has been well documented . however , some questions about the molecular base of artemisinin - induced cell death need further study . \n growing research has been focusing on determination of the mechanism of bioactivation and molecular events underlying the artemisinin effects . \n however , how the antitumor activity is exerted following artemisinin activation is still not well understood . \n so far , the precise molecular events involved in how , when , and where ros production is initially triggered in cancer cells remain to be defined . in addition , the relevance of any ros- independent mechanism should be also addressed ; these might not be obvious but possibly important for artemisinin cytotoxicity in some cancer cells . \n some other aspects such as the direct dna damage induced by artemisinin - like compounds and the role of p53 status in genotoxicity need to be further analysed . \n one relevant aim in anticancer therapy is cotargeting multiple pathways minimizing shifting cell hallmarks and side effects . \n whereas it remains important to characterize the anticancer effects of existing and novel artemisinins derivatives , research also needs to be focused on unveiling the mechanisms of cytotoxicity by identifying their relation to a particular cancer biomarkers and molecules . \n artemisinins seems to regulate key players participating in multiple pathways such as nf-b , survivin , noxa , hif-1 , and bmi-1 . \n these molecules and others are to be revealed , which in turn may be involved in drug response , drug interactions , mechanisms of resistance , and collateral effects in normal cells . \n a better understanding of common mechanisms under similar conditions in different cell systems will greatly aid the development of targeted artemisinin derivatives . \n this will improve artemisinins cytotoxicity by lowering ic50 , emerging of resistance , drug associated toxicity , and potentiating drug interactions . \n it is important to connect the molecular interactions and the regulatory effects of artemisinin on the cancer hallmarks and particularly in those tumors with poor prognosis \n . some cancer cell biomarkers may be potentially useful to predict success on an artemisinin - based treatment in specific systems . \n furthermore , novel endoperoxide compounds and combinational therapies can be addressed to target or cotarget markers of carcinoma progression and prevent invasiveness and metastatic properties in highly recurrent and aggressive tumors or advanced stage cancers . \n although the benefits of artemisinins in the clinical setting have been already assessed , specific interactions with established chemotherapy need to be further dissected in different cancer cells and their phenotypes . \n this will be crucial to implement clinical trials and treatment of individual cases . in this \n it is important to note that the prototype drug , artemisinin , seems to modulate responses leading to antagonistic interactions with other anticancer drugs . \n however , whereas it may be useful to have the prototype drug as a control in vitro , its pharmacokinetic properties may differ from the semisynthetic artemisinins . \n therefore , artemisinin antagonistic reactions and resistance must be cautiously validated using different semisynthetic derivatives . \n so far , artemether has been shown to share similar anticancer properties than dha and artesunate . \n the study of how artemisinin drives tumor control may become even more complex as immunological hallmarks are also involved in the generation of tumors . \n immunological hallmarks in cancer cells include the ability to induce chronic inflammatory response , evasion of tumor recognition , and ability to induce tolerance . whether artemisinin may participate in the mechanisms involved in these events has yet to be determined . \n overall , the real potential and benefits of the artemisinin drug class remain yet to be uncovered . the imminent possibility of artemisinins being included in the arsenal of anti cancer drugs has opened the door for challenging research in this area , one that seems to fulfill many expectations .", "role": "user" }, { "content": "improvement of quality of life and survival of cancer patients will be greatly enhanced by the development of highly effective drugs to selectively kill malignant cells . \n artemisinin and its analogs are naturally occurring antimalarials which have shown potent anticancer activity . in primary cancer cultures and cell lines , their antitumor actions were by inhibiting cancer proliferation , metastasis , and angiogenesis . \n in xenograft models , exposure to artemisinins substantially reduces tumor volume and progression . \n however , the rationale for the use of artemisinins in anticancer therapy must be addressed by a greater understanding of the underlying mechanisms involved in their cytotoxic effects . \n the primary targets for artemisinin and the chemical base for its preferential effects on heterologous tumor cells need yet to be elucidated . \n the aim of this paper is to provide an overview of the recent advances and new development of this class of drugs as potential anticancer agents .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 75-year - old male was hospitalized due to severe dyspnea following a four day history of fever , pleuritic chest pain , and productive cough . \n a previous computed tomography ( ct ) scan showed multiple small bullae in both lungs and a large bulla in the left lower lung with several crisscrossed septa in the cavity ( figs . \n , he complained of severe dyspnea ( new york heart association functional class iv ) and could not even complete a pulmonary function test . \n abnormal blood test results were as follows : white blood cell ( wbc ) count 18,100/l and c - reactive protein ( crp ) 29.7 mg / dl . \n arterial blood gas values on room air were a ph of 7.43 ; pco2 , 34.6 mmhg ; and po2 , 59.5 mmhg . \n a chest radiograph showed a fluid - filled giant bulla in the left lung that had increased in size as compared to the previous film ( fig . \n 1b ) . a ct scan of the chest confirmed a 12 cm , thin - walled , fluid - filled bulla in the lower lobe of the left lung ( fig . \n despite intravenous antibiotic treatment ( ceftriaxone 8 g and clindamycin 7.2 g for 4 days , and tazobactam / piperacillin 67.5 g and ciprofloxacin 2 g for five days ) the patient remained febrile , although a sputum culture did not demonstrate any bacterial growth . as the patient was not a suitable candidate for a surgical resection , an 8.5 f pigtail catheter was placed into the cavity under fluoroscopic guidance and attached to an underwater seal drainage unit \n a total of 350 ml of yellow turbid fluid was drained , but cultures from the cavitary fluid showed no growth of any organism . initially , continuous air leakage was observed , suggesting that the cavity had bronchial communication . \n , the blood test showed a wbc of 8,100/l and crp of 7.3 mg / dl . \n arterial blood gas values on room air were ph 7.46 ; pco2 , 34.1 mmhg ; and po2 , 74.5 mmhg . as the bulla shrank , air leakage diminished over time but persisted over a month after the drainage procedure . \n we changed the pigtail to a 24 fr foley catheter that would act as a self - retaining drain that tightly anchored the bulla adjacent to the parietal pleura and chest wall ( figs . \n to prevent sclerosant from spreading to the contralateral lung through a slit of bronchial communication , we instilled a small amount of saline ( less than 5 ml ) prior to the sclerosant instillation . \n seoul , korea ) for sterilization and sclerosis through the foley catheter into the bulla cavity . as the patient continued to show no cough following repeated povidone iodine sclerotherapy \n , we changed the sclerosant to ethanolamine oleate ( 5 ml ) , administered 3 times during a 1 week period . \n the sclerotherapy with ethanolamine oleate appeared to be less effective because intermittent air leakage persisted . \n talc ( 0.5 g mixed with 5 ml saline ) was then 4 times within 4 days , and it produced rapid contraction and fibrosis of the bullous cavity . \n for all the sclerosant procedures , the patient was positioned in a left - down decubitus position and the catheter drainage continued without clamping . after a ct scan confirmed that the bulla had shrunk into a 2 cm , thick - walled , small cavity , we removed the foley catheter and the patient was discharged on the 45th day after the pigtail insertion . \n five months after discharge , the patient showed a round cavity smaller than 1 cm on a follow - up ct scan ( fig . \n patients with a large intrapulmonary emphysematous bulla present a considerable therapeutic problem , particularly if they are elderly or their respiratory reserve is low , due to the risks of surgery . \n intracavitary drainage for cavitary lung diseases was first introduced by monaldi in cases of post - tuberculous cavities . \n this method was first adopted for the treatment of emphysematous bulla by head and avery . \n this procedure was performed in two stages to decrease the risk of pneumothorax ; the first stage produced pleural adhesions using iodine packs and the second stage drained the bulla . \n macarthur and fountain were the first to use a foley catheter in a one - stage endocavitary aspiration with mini - thoracotomy and rib resection , percutaneously . \n shah and goldstraw have reported on using the brompton technique with a foley catheter , but also insufflating the pleural space and the cavity with iodized talc for pleurodesis and fibrosis of the cavity with thoracotomy . however , \n if local adhesion has already formed , percutaneous placement of the catheter and talc sclerosis is possible without thoracotomy . \n because the patient in our case was in very poor condition , we decided to apply the brompton technique . \n initially , we placed a pigtail catheter under fluoroscopic guidance , and the pigtail catheter was then simply exchanged for a foley catheter along the fibrous tract . \n no rib resection or purse - string suture was needed because adhesion between the parietal pleura and bulla was suspected . \n hata et al . have advocated that the paucity of complications is due to the sufficient time between the onset of conservative management which complied of drainage for adhesion and granulation to form . \n three different kinds of sclerosant , povidone iodine , ethanolamine oleate , and talc , were used for sclerosis of the giant bulla through the catheter . \n ethanolamine oleate is a very strong sclerosant but can cause complications such as fever , pain , or a systemic reaction , and can also erode the foley catheter . \n talc can be infused through the foley catheter after mixing with water ( talc slurry ) if talc insufflations are not possible . \n most bullae showing an air - fluid level are merely the result of an inflammatory reaction secondary to peribullous infection . \n a culture of the fluid usually shows no growth of any organism , as occurred in this case . \n truly infected bullae should be managed conservatively , even though conservative treatment is often unsuccessful because of the poor communication between the infected bulla and the bronchial tree . \n dean et al . have shown that percutaneous drainage of the infected bulla should be considered in these high - risk patients . \n percutaneous drainage and suction and talc sclerotherapy through a foley catheter can be a good treatment option for patients with conditions that are too poor to allow for surgical intervention , especially if there is adhesion between the giant bulla and parietal pleura .", "role": "user" }, { "content": "a 75-year - old man who was diagnosed as having a fluid - filled giant bulla was treated with a modified brompton technique due to his poor performance status . \n percutaneous drainage , suction , and talc sclerotherapy through a foley catheter can be good treatment options for patients with conditions that are too poor to allow surgical intervention , especially if there is adhesion between a giant bulla and parietal pleura . \n talc can also be used safely when mixed with normal saline as a sclerosant .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: eight were with posterior choroidal melanomas , one with ciliary body melanoma , three with retinoblastomas and one with vpt . \n all the cases with melanomas underwent chest x - ray , ultrasound of abdomen and clinical examination by an oncologist to rule out metastasis . \n we used the plaque simulator software version 5.3.9 ( bebig gmbh , berlin , germany ) , developed by one of the authors ( ma ) . \n modelling of the eye is done first using axial computerized tomography or magnetic resonance image , from the center of the eye . \n the fundus image is next uploaded on the software to chart the tumor location and also to measure the exact distance from optic disc to fovea . \n the prescription point is the apex of the tumor for all having apical diameter > 5 mm and it is kept at 5 mm for all tumors with apical diameter < 5 mm . \n the average dose rate in our study was 0.62 gy / hr ( range 0.44 - 0.9 gy / hr ) , given over 2 - 8 days depending on the tumor type and size . \n ( a ) longitudinal section of computerized model of the eye ball with the tumor ( posterior melanoma ) as seen in the planning software . \n the various doses of radiation the tumor is exposed to once the plaque is fixed on the sclera and is demonstrated in different colors . \n note 85 gy ( black color ) is just covering the apex of the tumor . \n ( b ) computerized model of transverse section of the same tumor on retinal chart commercially both rimmed and unrimmed plaques are available . \n the coms plaques are circular rimmed plaques available in five sizes , 12 , 14 , 16 , 18 and 20 mm . \n second , as they are circular in shape , they can not be used for tumors near the optic nerve which would require a notched plaque . \n third , the seeds have to be loaded on a siliastic carrier which is then fitted over the plaque [ fig . 2 ] . \n thus when placed over the eye , there is a 1-mm gap between the seeds and the sclera . \n hence higher dose is required to reach the tumor apex which correspondingly increases the scleral dose and also to the structures distal to the apex . \n fifth , as there is lateral overlap of the radiation from the corresponding seeds , the effective dose to sclera is higher . \n all these disadvantages are partly overcome by the unrimmed slotted plaques ( eyephysics , llc , los alamitos , ca ) . \n three of the currently available plaques , models 517 , 917 and 2025 are pictured in fig . \n being unrimmed , they are thin ( 2 mm ) and can easily be passed behind the rectii muscles without resecting them . \n the model 917 also has a notch which can accommodate the optic nerve for tumors close to it . because the i seeds are glued into individually collimating slots carved into the concave surface of the gold plaque , the seeds are closer to the sclera compared to the seeds in the siliastic carrier of a coms plaque . \n most of the laterally directed soft radiation emanating from the seeds in an eye physics plaque is blocked by the gold collimation , eliminating much of the radiation overlap immediately in front of the plaque [ fig . 4 ] . \n ( a ) circular coms plaque seen above along with the corresponding circular siliastic carrier below which is loaded with the i-125 seeds . \n ( b ) siliastic carrier fitted in the coms plaque with the seeds on inside surface ( a - c ) models 517 , 917 and 2025 slotted gold plaques ( eyephysics , llc , los alamitos , california , usa ) along with the corresponding dummy plaques ( wire frames ) . \n note model 917 in the center has a notch for tumors close to optic nerve ( a ) illustration of coms plaque showing a gap between the seeds and the sclera . \n hence higher dose is required to reach the tumor apex which correspondingly increases the scleral dose and also to the structures distal to the apex . \n there is lateral overlap of the radiation from the corresponding seeds ( dark yellow ) . \n ( b ) slotted plaque showing the seeds closer to sclera and minimal overlap of radiation ( dark yellow ) compared to coms plaque , hence lesser dose to sclera reducing this overlap more than compensates for the anticipated inverse - square increase in dose to the sclera adjacent to each seed that results from the seeds being closer to the sclera ( compared to the coms plaque ) . \n it also reduces radiation to the structures adjacent to the plaque edges and distal to the tumor apex . \n barc i ocu - prosta seeds consisting of i source of dimension 4.75 mm ( l ) 0.8 mm ( ) encapsulated in titanium capsules were supplied by radiopharmaceuticals division of bhabha atomic research center , mumbai . \n a novel method of adsorption of radioiodine ( i ) on palladium - coated silver rod was developed . by this method , 3 - 4 mci of i \n these sources were encapsulated using a 50-w , neodymium : yttrium - aluminum - garnet laser welding system . \n the laser - welded sources were subjected to numerous checks such as visual inspection , activity measurement , swipe test , leak test , immersion test , etc . \n ( b ) barc i-125 ocu - prosta seeds once the basic dosimetry is done , seeds were placed into the slots of the plaque and glued to achieve a desired dose rate distribution . \n the typical activity used were 3 - 4 mci per seed so as to achieve treatment dose rates of 0.5 - 1.25 gy / h , with a prescription dose of 40 - 80 gy delivered in 5 - 12 consecutive days . \n prior to surgery , the plaque was sterilized by flash autoclaving for 4 minutes . under peribulbar block localized peritomy \n the tumor margins were identified using transscleral illumination and indirect ophthalmoscopy . a minimum safety margin of 2 mm is maintained . \n then the exact distance of suture placement points from the limbus are marked with marker pen using a calliper . \n the dummy plaque ( cold plaque ) is then secured with temporary knots after passing the sutures through the eye - lets . \n the placement of the dummy plaque is confirmed by indirect ophthalmoscopy and scleral indentation . keeping the episcleral sutures in place , \n the dummy plaque is then replaced with the hot plaque containing the radioactive seeds and then the suture knots are made permanent [ fig . 6 ] . \n the plaque is then removed after an appropriate time as per the dosimetry . during that time \n the patient is kept in an isolated room with the eye covered with a lead shield . immediately after the plaque removal , the eye \n this is to make sure that all the seeds have been removed and none are left behind accidently . \n the seeds are then unloaded by the physicist after soaking it for few minutes in acetone and sent back in a special lead container for proper disposal . \n ( b ) localisation of the dummy plaque being confirmed with indirect ophthalmoscopy and scleral indentation ( not shown ) . \n ( c ) hot plaque with the radioactive i-125 seeds loaded shown just before insertion ( after removing the cold plaque ) . \n ( d ) the hot plaque being inserted with the seeds facing the sclera all steps of the treatment procedure were planned in advance to minimize radiation exposure of personnel . \n the personnel involved in this work were monitored for radiation exposure levels by thermoluminescent dosimetry ( tld ) badge . \n we used the plaque simulator software version 5.3.9 ( bebig gmbh , berlin , germany ) , developed by one of the authors ( ma ) . \n modelling of the eye is done first using axial computerized tomography or magnetic resonance image , from the center of the eye . \n the fundus image is next uploaded on the software to chart the tumor location and also to measure the exact distance from optic disc to fovea . \n the prescription point is the apex of the tumor for all having apical diameter > 5 mm and it is kept at 5 mm for all tumors with apical diameter < 5 mm . \n the average dose rate in our study was 0.62 gy / hr ( range 0.44 - 0.9 gy / hr ) , given over 2 - 8 days depending on the tumor type and size . ( a ) longitudinal section of computerized model of the eye ball with the tumor ( posterior melanoma ) as seen in the planning software . the various doses of radiation the tumor is exposed to once the plaque is fixed on the sclera and is demonstrated in different colors . \n note 85 gy ( black color ) is just covering the apex of the tumor . \n the coms plaques are circular rimmed plaques available in five sizes , 12 , 14 , 16 , 18 and 20 mm . \n second , as they are circular in shape , they can not be used for tumors near the optic nerve which would require a notched plaque . \n third , the seeds have to be loaded on a siliastic carrier which is then fitted over the plaque [ fig . 2 ] . \n thus when placed over the eye , there is a 1-mm gap between the seeds and the sclera . \n hence higher dose is required to reach the tumor apex which correspondingly increases the scleral dose and also to the structures distal to the apex . \n fifth , as there is lateral overlap of the radiation from the corresponding seeds , the effective dose to sclera is higher . \n are partly overcome by the unrimmed slotted plaques ( eyephysics , llc , los alamitos , ca ) . \n three of the currently available plaques , models 517 , 917 and 2025 are pictured in fig . \n being unrimmed , they are thin ( 2 mm ) and can easily be passed behind the rectii muscles without resecting them . \n the model 917 also has a notch which can accommodate the optic nerve for tumors close to it . because the i seeds are glued into individually collimating slots carved into the concave surface of the gold plaque , the seeds are closer to the sclera compared to the seeds in the siliastic carrier of a coms plaque . \n most of the laterally directed soft radiation emanating from the seeds in an eye physics plaque is blocked by the gold collimation , eliminating much of the radiation overlap immediately in front of the plaque [ fig . 4 ] . \n ( a ) circular coms plaque seen above along with the corresponding circular siliastic carrier below which is loaded with the i-125 seeds . \n ( b ) siliastic carrier fitted in the coms plaque with the seeds on inside surface ( a - c ) models 517 , 917 and 2025 slotted gold plaques ( eyephysics , llc , los alamitos , california , usa ) along with the corresponding dummy plaques ( wire frames ) . \n note model 917 in the center has a notch for tumors close to optic nerve ( a ) illustration of coms plaque showing a gap between the seeds and the sclera . \n hence higher dose is required to reach the tumor apex which correspondingly increases the scleral dose and also to the structures distal to the apex . \n there is lateral overlap of the radiation from the corresponding seeds ( dark yellow ) . \n ( b ) slotted plaque showing the seeds closer to sclera and minimal overlap of radiation ( dark yellow ) compared to coms plaque , hence lesser dose to sclera reducing this overlap more than compensates for the anticipated inverse - square increase in dose to the sclera adjacent to each seed that results from the seeds being closer to the sclera ( compared to the coms plaque ) . \n it also reduces radiation to the structures adjacent to the plaque edges and distal to the tumor apex . \n barc i ocu - prosta seeds consisting of i source of dimension 4.75 mm ( l ) 0.8 mm ( ) encapsulated in titanium capsules were supplied by radiopharmaceuticals division of bhabha atomic research center , mumbai . a novel method of adsorption of radioiodine ( i ) on palladium - coated silver rod \n these sources were encapsulated using a 50-w , neodymium : yttrium - aluminum - garnet laser welding system . \n the laser - welded sources were subjected to numerous checks such as visual inspection , activity measurement , swipe test , leak test , immersion test , etc . \n ( a ) illustration showing cross section and the dimensions of barc i-125 ocu - prosta seeds . \n once the basic dosimetry is done , seeds were placed into the slots of the plaque and glued to achieve a desired dose rate distribution . \n the typical activity used were 3 - 4 mci per seed so as to achieve treatment dose rates of 0.5 - 1.25 gy / h , with a prescription dose of 40 - 80 gy delivered in 5 - 12 consecutive days . \n the tumor margins were identified using transscleral illumination and indirect ophthalmoscopy . a minimum safety margin of 2 mm is maintained . \n then the exact distance of suture placement points from the limbus are marked with marker pen using a calliper . \n the dummy plaque ( cold plaque ) is then secured with temporary knots after passing the sutures through the eye - lets . \n the placement of the dummy plaque is confirmed by indirect ophthalmoscopy and scleral indentation . keeping the episcleral sutures in place , \n the dummy plaque is then replaced with the hot plaque containing the radioactive seeds and then the suture knots are made permanent [ fig . 6 ] . \n the plaque is then removed after an appropriate time as per the dosimetry . during that time \n the patient is kept in an isolated room with the eye covered with a lead shield . immediately after the plaque removal , the eye \n this is to make sure that all the seeds have been removed and none are left behind accidently . \n the seeds are then unloaded by the physicist after soaking it for few minutes in acetone and sent back in a special lead container for proper disposal . \n ( b ) localisation of the dummy plaque being confirmed with indirect ophthalmoscopy and scleral indentation ( not shown ) . \n ( c ) hot plaque with the radioactive i-125 seeds loaded shown just before insertion ( after removing the cold plaque ) . \n all steps of the treatment procedure were planned in advance to minimize radiation exposure of personnel . \n the personnel involved in this work were monitored for radiation exposure levels by thermoluminescent dosimetry ( tld ) badge . \n from may 2008 to january 2011 , we operated 13 eyes of 13 patients . the type of tumor with baseline tumor size is given in table 1 . \n baseline characteristics of the tumors of the 13 , nine were with choroidal melanomas . of these , eight were posterior while one case involved the ciliary body region . \n tumors with apical diameter ( ad ) < 1 mm and largest basal diameter ( lbd ) < 5 mm are called as choroidal naevus . \n although the precise coms size criteria were somewhat more complicated and also changed over the course of the study , generally speaking , tumous with ad between 1 and 3 mm and lbd between 5 and 16 mm are classified as small melanomas . with ad between 3 and 10 mm and lbd between 5 and 16 \n mm are classified as medium ( unless it is located within 2 mm from optic disc ) and tumors with ad > 10 mm and lbd > 16 mm are classified as large melanomas . \n the mean ad was 7.6 mm ( range 3.8 - 13.4 mm ) and mean lbd was 12.1 mm ( range 5.2 - 17.3 mm ) . \n the average seed strength was 3.2 mci ( range 2.88 - 3.54 mci ) and the average number of seeds used was 16.1 ( range 9 - 25 ) . \n the average number of days for plaque removal was 6.4 days ( range 4 - 8 days ) and the average dose rate was 0.58 gy / hour ( range 0.44 - 0.89 ) . \n model 2025 was used for five cases while model 917 was used for remaining four . \n transpupillary thermotherapy ( ttt ) was given in the three large melanomas , 2 days before plaque removal as part of the sandwich technique described by kreusel et al . \n in immediate postoperative period case 1 had vitreous hemorrhage with hemorrhagic choroidal detachment and case 3 had bleeding inside the tumor [ fig . 7 ] . \n both these complications were assumed to be due to the sharp tip of the diaphanoscope , which is the instrument used for transillumination [ fig . \n after these two initial complications , we did localization of posterior tumors by indirect ophthalmoscopy and scleral indentation and did not face similar complications . at the mean follow - up of 24 months ( range 10 - 43 months ) \n , the average ad reduced to 4.2 mm and 7.7 mm , respectively [ fig . \n although in both cases tumor had not increased in size , there was optic nerve infiltration in one case and other one was case 3 , which had got injured by the diaphanoscope . \n one case , at 3 years follow - up , was found to have optic atrophy postvitrectomy for nonresolving vitreous hemorrhage . \n of the seven cases , five had visual acuity of > 20/200 before brachytherapy and by last follow - up this was reduced to three [ table 2 ] . \n ( a ) immediate postoperative b - scan image of case one showing large posterior melanoma ( thick white arrow ) along with hemorrhagic choroidal detachment ( thin white arrow ) . \n ( b ) immediate postoperative fundus image of case three showing intratumoral bleed ( thin white arrow ) and track of injury ( thick white arrow ) caused by the bend tip of diaphanoscope during intraoperative transillumination above is the long bent tip of the diapanoscope used for localisation of posterior tumors with transillumination through the sclera . \n below is the short straight tip used for transillumimating anterior tumors through the pupil ( a ) preoperative fundus picture of posterior choroidal melanoma situated in inferior quadrant of right eye ( thick white arrow ) . \n ( b ) preoperative b - scan picture showing mushroom - shaped melanoma ( thick white arrow ) along with surrounding exudative retinal detachment ( thin white arrows ) . \n ( c ) two - year post - brachytherapy fundus picture showing smaller condensed tumor ( thick white arrow ) along with surrounding choroidal degeneration ( thin white arrows ) secondary to radiation . \n ( d ) two - year follow - up b - scan image showing a smaller dome shaped tumor ( thick white arrow ) with resolved retinal detachment shows pre and postoperative visual acuity of choroidal melanoma cases three eyes of three babies had retinoblastoma . \n all were recurrent tumors after completing six cycles of chemotherapy and several sittings of laser . \n the average dose given was 40 gy with the average dose rate of 0.75 gy / hr . the plaque was kept for an average of 2.5 days . \n case one was enucleated at 4.2 month follow - up as it developed peripheral new tumors along with vitreous hemorrhage . \n this tumor kept on recurring even after 13 cycles of chemotherapy and several sittings of laser . with i \n brachytherapy , it regressed within 2 weeks time and the child is doing extremely well at 15 months follow - up . \n it was situated in inferotemporal quadrant beyond the equator with exudative retinal detachment involving inferior half of retina . \n the dose given was 40 gy and the plaque was kept for 3 days . at 21-month follow - up , \n prior to brachytherapy , triple freeze thaw cryotherapy along with intravitreal injection of bevacizumab was tried without success . \n small , medium and large according to the size . tumors with apical diameter ( ad ) < 1 mm and largest basal diameter ( lbd ) < 5 mm are called as choroidal naevus . \n although the precise coms size criteria were somewhat more complicated and also changed over the course of the study , generally speaking , tumous with ad between 1 and 3 mm and lbd between 5 and 16 mm are classified as small melanomas . with ad between 3 and 10 mm and lbd between 5 and 16 mm are classified as medium ( unless it is located within 2 mm from optic disc ) and tumors with ad > 10 mm and lbd > 16 mm are classified as large melanomas . of the nine cases , six were medium sized and three were large melanomas . \n the mean ad was 7.6 mm ( range 3.8 - 13.4 mm ) and mean lbd was 12.1 mm ( range 5.2 - 17.3 mm ) . \n the average seed strength was 3.2 mci ( range 2.88 - 3.54 mci ) and the average number of seeds used was 16.1 ( range 9 - 25 ) . \n the average number of days for plaque removal was 6.4 days ( range 4 - 8 days ) and the average dose rate was 0.58 gy / hour ( range 0.44 - 0.89 ) . \n model 2025 was used for five cases while model 917 was used for remaining four . \n transpupillary thermotherapy ( ttt ) was given in the three large melanomas , 2 days before plaque removal as part of the sandwich technique described by kreusel et al . \n in immediate postoperative period case 1 had vitreous hemorrhage with hemorrhagic choroidal detachment and case 3 had bleeding inside the tumor [ fig . 7 ] . \n both these complications were assumed to be due to the sharp tip of the diaphanoscope , which is the instrument used for transillumination [ fig . \n after these two initial complications , we did localization of posterior tumors by indirect ophthalmoscopy and scleral indentation and did not face similar complications . at the mean follow - up of 24 months ( range 10 - 43 months ) , the average ad reduced to 4.2 mm and 7.7 mm , respectively [ fig . \n although in both cases tumor had not increased in size , there was optic nerve infiltration in one case and other one was case 3 , which had got injured by the diaphanoscope . \n one case , at 3 years follow - up , was found to have optic atrophy postvitrectomy for nonresolving vitreous hemorrhage . \n of the seven cases , five had visual acuity of > 20/200 before brachytherapy and by last follow - up this was reduced to three [ table 2 ] . \n ( a ) immediate postoperative b - scan image of case one showing large posterior melanoma ( thick white arrow ) along with hemorrhagic choroidal detachment ( thin white arrow ) . \n ( b ) immediate postoperative fundus image of case three showing intratumoral bleed ( thin white arrow ) and track of injury ( thick white arrow ) caused by the bend tip of diaphanoscope during intraoperative transillumination above is the long bent tip of the diapanoscope used for localisation of posterior tumors with transillumination through the sclera . \n below is the short straight tip used for transillumimating anterior tumors through the pupil ( a ) preoperative fundus picture of posterior choroidal melanoma situated in inferior quadrant of right eye ( thick white arrow ) . \n ( b ) preoperative b - scan picture showing mushroom - shaped melanoma ( thick white arrow ) along with surrounding exudative retinal detachment ( thin white arrows ) . \n ( c ) two - year post - brachytherapy fundus picture showing smaller condensed tumor ( thick white arrow ) along with surrounding choroidal degeneration ( thin white arrows ) secondary to radiation . \n ( d ) two - year follow - up b - scan image showing a smaller dome shaped tumor ( thick white arrow ) with resolved retinal detachment shows pre and postoperative visual acuity of choroidal melanoma cases \n all were recurrent tumors after completing six cycles of chemotherapy and several sittings of laser . \n the average dose given was 40 gy with the average dose rate of 0.75 gy / hr . the plaque was kept for an average of 2.5 days . \n case one was enucleated at 4.2 month follow - up as it developed peripheral new tumors along with vitreous hemorrhage . \n this tumor kept on recurring even after 13 cycles of chemotherapy and several sittings of laser . with i \n brachytherapy , it regressed within 2 weeks time and the child is doing extremely well at 15 months follow - up . \n it was situated in inferotemporal quadrant beyond the equator with exudative retinal detachment involving inferior half of retina . \n the dose given was 40 gy and the plaque was kept for 3 days . at 21-month follow - up , \n prior to brachytherapy , triple freeze thaw cryotherapy along with intravitreal injection of bevacizumab was tried without success . \n this study gives our experience and learning curve in the management choroidal melanomas , retinoblastomas and vpt with indigenous i brachytherapy . \n risk factors for intraocular melanoma include caucasian race , light skin or eye color , dysplastic nevus syndrome , oculodermal melanocytosis , sun exposure and occupation exposure . \n most patients with ocular melanoma have symptoms such as blurry vision , loss of vision , floaters , visual field loss ( as in our patients ) , growing dark spot on the iris or alteration in the size or shape of the pupil . \n the four radioactive isotopes most widely used in ocular oncology are iodine-125 , palladium-103 , cesium-131 and ruthenium-106 . \n ru plaques emit -particles that travel a relatively short distance in tissue and can not completely irradiate tumors more than 5-mm tall . \n several authors have reported that local tumor control rates and need for enucleation appear to be inferior with ru compared to i , especially when apical tumor height is considered.[1518 ] i for choroidal melanoma was first described by sealy in 1976 . \n the major advantages of this radioisotope were the ability to protect the surrounding ocular structures , including the eyelids and lacrimal system , and the decrease in radiation exposure to the surgical staff . \n the excellent screening characteristics , good tissue penetration , low oxygen enhancement ratio and high relative biological effectiveness make i an ideal source for local radiotherapy . finger et al . \n have reported on the use of pd in the united states to treat choroidal melanomas . \n the seeds are the same size and thus can be used in the same carrier plaque as i. cesium-131 is an x - ray emitter ( 29 kev to 34 kev ) with a half - life ~9.7days that can also be used as i. large scale production process to avail pd and cs for seed brachytherapy application has not been established in india . \n the indian pursuit of developing technology for i brachytherapy sources was driven mainly by three considerations , namely , ( a ) well - established production of i in several gbq quantities , ( b ) need to provide i- brachytherapy sources to meet the domestic needs and ( c ) help to promote the beneficial use of i brachytherapy sources in the country . \n radiation characteristics of radionuclides used in prostate seed implantation for choroidal melanomas , the local treatment failure rate in coms trial was 13% while it was 22.2% in our study . \n this eye received a dose rate of 0.44 gy / hr , which was the lowest dose rate in our study . \n although coms trial recommended a dose rate between 0.43 and 1.05 gy / hr , the american brachytherapy society recommends a dose rate between 0.6 and 1.05 gy / hr , as dose rates of less than 0.6 gy / h show lower tumor control rates . \n thus , this low dose rate could be a factor for poor tumor control in this patient . \n another eye was enucleated as along with radiation retinopathy there was a bulge from the central part of the tumor , at the site of injury by the sharp tip of the diaphanoscope . \n the five year all cause mortality was 19% in enucleation group and 18% for i brachytherapy group , in the coms trial . \n however , in our study the sample size was much smaller and final follow - up shorter compared to coms study . \n of the seven eyes which were analyzed for visual acuity ( va ) , three ( 50% ) had va 20/40 while two ( 28.6% ) had va 20/200 preoperatively . at mean follow - up of 24 months \n only one ( 14.3% ) had va 20/40 while four ( 57.1% ) had va 20/200 . in the coms trial , 70% and 10% of eyes had va 20/40 and 20/200 , respectively . \n three years after brachytherapy , only 31% and 41% of eyes had va 20/40 and 20/200 , respectively . \n moreover in our study three cases were with large tumors that would be expected to fare worse with respect to visual acuity . \n for retinoblastoma , merchant et al . reported a preservation rate of 60% ( 15/25 eyes ) . in our study , of the three eyes of three babies , \n although we had only one case of vpt in our study , it was having an ad of 4 mm with a large exudative detachment which successfully resolved after brachytherapy . \n thus we agree with cohen et al . that i-125 plaque radiotherapy is an effective method of treating larger ( > 2.5-mm thickness ) vpts with extensive exudative retinal detachment . \n barc i ocu - prosta seeds has been reported , it was based on a single case report , that too of a patient with choroidal metastasis whose long - term follow - up is questionable . \n thus our study is the longest series of patients treated with these indigenous seeds and it shows results which are comparable to international standards . in conclusion , episcleral plaques brachytherapy using i seeds is one of the modalities to control intraocular tumor . despite the general axiom that ocular melanomas are radiation resistant \n , highly concentrated radiation therapy can be successful in promoting tumor regression . while there is still a long path to travel to find the ultimate cure for ocular melanoma , the results of this institutional retrospective study represent a significant step forward in the management of intraocular melanomas in india .", "role": "user" }, { "content": "context : to analyze the results of episcleral plaque brachytherapy using indigenous bhabha atomic research centre ( barc ) iodine-125 ocu - prosta seeds for the management of intraocular tumors from a single institute.aim:to report our initial experience and learning curve on the use of barc i-125 ocu - prosta seeds for the management of intraocular tumors such as choroidal melanomas , retinoblastomas and vasoproliferative tumors ( vpt).materials and methods : we retrospectively reviewed 13 eyes of 13 patients who underwent ophthalmic brachytherapy between may 2008 to march 2012 . \n nine cases had choroidal melanomas ; three had retinoblastomas while one case had vpt.results:for choroidal melanomas the average apical diameter before brachytherapy was 7.6 mm and average largest basal diameter was 12.1 mm , respectively , which reduced to 4.2 mm and 7.7 mm after the procedure at an average follow - up of 24 months ( range 10 - 43 months ) . \n retinoblastoma and vpt also showed good regression after brachytherapy.conclusion:plaque radiotherapy using 125i seeds can be performed under peribulbar anesthesia and provides a viable option for the management of intraocular cancer with minimal invasiveness and surgical complications . \n patients in our studies experienced excellent local tumor control . with the availability of indigenous \n barc i-125 ocu - prosta seeds locally , cost effective ophthalmic brachytherapy can be performed in india .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: as spinal surgery techniques and instrumentation devices develop , the demand for minimally invasive spinal fixation ( misf ) grows . \n misf has many advantages , including less blood loss , shorter length of hospital stay , lower rates of infection , and better relief of postoperative pain than traditional open surgery.1 \n 2 \n 3 the percutaneous pedicle screw ( pps ) system is a basic and essential device for posterior misf \n . published research has demonstrated highly accurate pps placement with various imaging support systems , such as computer - assisted navigation.4 \n 5 \n 6 \n 7 \n 8 \n 9 however , such navigation systems are exceedingly expensive , and only well - funded institutions can afford such specialized equipment . \n recent publications have reported the safe and accurate placement of the pps by surgeons with different levels of experience in human cadavers.10 however , the clinical results of patients with degenerative lumbar disease in different institutions and among surgeons are not well known . \n wiesner et al reported an accurate pedicle screw insertion technique using perfect anteroposterior ( ap ) and lateral radiograph image guidance.11 this classic and safe technique has been used widely by spine surgeons . according to a recent report,12 wiesner 's modified method with a guidewire and cannulated screw using dual conventional fluoroscopy units achieved good results for the screw placement without specialized equipment in trauma patients . \n we introduced misf using the modified pps insertion technique with dual fluoroscopy units in 2010 . \n dual imaging views of two planes can simply and easily show the entry point and screw trajectory to the surgeon . \n we hypothesized that even less - experienced surgeons could perform safe surgeries as described in a human cadaveric report,10 if they understood the correspondence between the anatomical landmarks of the spine and the intraoperative imaging views . \n published studies reported only the degree of the pps placement accuracy , but not the comparative clinical results among surgeons . \n in addition , there have been few reports about accuracy enhancement of the pps placement with dual fluoroscopy - based techniques for degenerative lumbar disease . \n the accuracy of the pps placement and the differences in the results between experienced and less - experienced surgeons in spinal surgery for degenerative lumbar spine disease were evaluated . \n this retrospective , comparative study investigated the accuracy of pps placement and the radiation time per pps insertion between two groups of patients who underwent surgery by surgeons with less than 5 years of experience versus surgeons with more than 5 years of experience in spinal surgery . \n an experienced surgeon was defined as a board - certified spine surgeon and a surgeon engaged in spine surgery for over 5 years . \n the study population was selected from consecutive patients who underwent misf with the pps system in fukuoka wajiro hospital and shinkomonji hospital from april 2010 to october 2013 . \n patients with degenerative lumbar disease were included ; cases with pedicle diameter less than 5 mm were excluded . \n the inclusion criterion for surgeons in both groups was based on whether they had practiced the pps method in more than five cases . \n a total of 231 consecutive patients with degenerative lumbar disease were treated by misf with the pps system in the two hospitals . \n the 161 patients satisfying the inclusion criteria were divided into two groups : group a , 74 patients ( 40 male and 34 female patients ; average age 63 years ) who were treated by four surgeons with more than 5 years of experience in lumbar surgery , and group b , 87 patients ( 58 male and 29 female patients ; average age 60 years ) who were treated by four surgeons with up to 5 years of experience . \n the lumbar degenerative diseases included 132 cases of lumbar canal stenosis diagnosed with reference to the international classification and 29 cases with lumbar disk herniation . \n the range of fixation was short segment in 156 cases , 2 segments in 3 cases , and 3 segments in 2 cases . \n the spinal implants used were the pedicle screw and rod systems ( cd horizon sextant , medtronic sofamor danek spine , memphis , tennessee , united states ; and viper , depuy synthes spine , raynham , massachusetts , united states ) . \n the diameters of the screws ranged from 5.2 to 6.5 mm and were chosen to be within the diameter of the pedicle based on preoperative computed tomography ( ct ) . \n abbreviations : asd , adjacent segmental disease ; dsa , destructive spondyloarthropathy ; lcs , lumbar canal stenosis ; ldh , lumbar disc herniation . \n the lateral fluoroscopic radiographic unit was set up at the left side of the jackson table , and the ap unit was set up at the opposite side . \n this setting of the dual fluoroscopy units allowed the surgeon to view biplane images at the same time . \n the c - arm that had the larger diameter was set as the ap view to allow a wider working space for the operation . \n subsequently , the position of the two fluoroscopy units was adjusted for the perfect ap and lateral radiographs of the target vertebra on the monitor . \n the following setting of the fluoroscopy units is the most important preparation for inserting ppss . \n the position of the c - arm should be fine - tuned in the craniocaudal direction to align the anterior end plate of the vertebra with the posterior end plate , and it must be turned around to allow visibility of the pedicle symmetrically toward the vertebral rotation angle on the perfect ap view . on the perfect lateral view , the shaded images of the two pedicles must correspond . after setting the two fluoroscopy units , the entry point and the insertion angle of the screws \n a jamshidi needle was positioned at the base of the transverse process corresponding to the lateral margin of the oval pedicle image in the perfect ap view . \n when the tip of the needle reached the posterior wall of the vertebra in the perfect lateral view , it was checked to be within the medial margin of the pedicle in the ap view.11 a guidewire was inserted through the cannula , and the needle was removed . \n the back muscles were split by a muscle dilator , a cannulated tap was inserted to make a pedicular hole , and then cannulated screws were placed into the pedicle over the guidewire . \n point a is the needle insertion point , and the tip is located on the lateral margin of the pedicle on the perfect anteroposterior view . \n point b shows that the tip of the needle has reached the vertebral body , and it should be within the medial margin of the pedicle on the anteroposterior view . \n pps misplacement was defined as breach of the pedicular wall with a grading scale of 2-mm steps ( grade i : no breach ; grade ii : breach less than 2 mm ; grade iii : breach 2 to 4 mm ; grade iv : breach 4 to 6 mm ; grade v : breach greater than 6 mm ) , as described by gertzbein and robbins.13 the direction of pedicular wall breach in the transverse , sagittal , and coronal planes using 2-mm slice - thickness ct ( aquilion 64 tsx101a and aquilion one tsx301a , toshiba , tokyo , japan ) was assessed by one radiologist and one spinal surgeon , and both were blinded to the patients ' classification . if the ct scan interpretations disagreed , the higher grade was given priority over the lower grade . to evaluate radiation exposure , we measured the total radiation time ( seconds ) required for the pps insertion in the series of operative procedures ranging from the setting of the jamshidi needle to completion of screw insertion . \n values are shown as medians ( range ) for the radiation time and averages standard deviation for the surgical time . \n statistical analyses were performed with the chi - square test for categorical data and the mann - whitney u test and student t test for surgical results to compare the two groups . the differences with p \n there were no significant differences in the characteristics of the patients between the two groups . \n 2 shows the distribution of the vertebral levels in which ppss were placed and the grading of pedicular perforation . \n the distribution of screw misplacement and the grading scale . \n the highest ratio of screw deviation is seen at l2 , and grade iii perforations are seen only at l5 and s1 . of the 658 screws , 637 were placed entirely in the pedicle , and only 21 screws ( 3.2% ) were misplaced from l2 to s1 . \n nineteen screws ( 2.9% ) perforated the cortex of the pedicle in grade ii and 2 ( 0.3% ) in grade iii misplacement . \n the breach rate by lumbar level was 11% at l2 , 1.9% at l3 , 3.6% at l4 , 2.1% at l5 , and 4.5% at s1 ; the highest breach rate was at l2 . \n the breach rates of groups a and b were 3.3% ( 10/306 ) and 3.1% ( 11/352 ) , respectively , with no significant difference ( p = 0.91 ) . in group a , 10 screws were in grade ii misplacement , with no screws in grade iii misplacement . in group \n b , 9 screws were in grade ii misplacement , and 2 screws were in grade iii misplacement ( table 2 ) . \n these misplacements occurred in the fourth and twelfth cases performed by different surgeons in group b. the direction of the pedicular breach was lateral in 12 , medial in 4 , superior in 3 , and inferior wall in 2 . \n malposition screws of grade iii misplacement had medial and inferior positions with respect to each other in group b. no significant differences were seen in the direction of perforation between the two groups ( p = 0.18 , fig . \n the numbers in parentheses in group b represent grade iii misplacements . despite the malposition of screws , all patients in grade ii misplacement had no neurologic symptoms . in grade iii misplacements , one group b patient ( medial wall breach ) had a transient symptom of nerve root irritation . as other surgical complications , \n the median fluoroscopy time for the pps insertion was 25 ( 5 to 92 ) seconds in group a and 51 ( 7 to 124 ) seconds in group b. the radiation exposure was significantly shorter in group a than in group b ( p < 0.01 , table 2 ) . \n the average operative time was 132 49 minutes in group a and 164 46 minutes in group b ( p < 0.01 ) . \n the present study shows that pps placement was highly accurate with the classic technique under dual fluoroscopy - based guidance , even when the surgeon lacked sufficient experience . \n the technique of pps insertion in the lumbar spine was initially introduced by magerl in 1977.14 he described the management of spinal trauma and spondylodiscitis as temporary external fixation . \n wiesner et al reported a safe technique to insert transpedicular noncannulated screws percutaneously with fluoroscopic guidance using a human cadaver model in 1999.11 the authors also reported that the results with this technique were better than those of the well - established magerl technique . \n the first clinical evaluation of the tracts and pps positions with ct scan analysis was followed by the report of an in vivo study by the same authors.15 the accuracy of fluoroscopy with computer - guided technology was assessed using cadavers by foley et al in 2001 , and computer - assisted technology has been adopted since.9 the current percutaneous insertion technique using cannulated screws with a guidewire , first described by holly and foley,16 has become the fundamental technique for misf . \n breach rates of 1.1 to 23% using a percutaneous procedure with two- or three - dimensional navigation systems have been reported.5 \n 6 \n 7 \n 16 the published studies including scoliosis surgery emphasize the advantages of a higher accuracy in screw placement with a navigation - assisted technique than with the conventional fluoroscopy technique.6 \n 8 \n 17 however , the navigation systems are very expensive and require time - consuming preregistration of anatomical landmarks . \n additional ct scans are required when going beyond the imaging area for the target vertebra even with zero - preregistration mobile - type ct navigation.8 \n 18 \n on the other hand , breach rates of 7.2 to 14.8% using the same procedure as ours ( wiesner 's modified technique ) under the assistance of fluoroscopy alone and using a postoperative grading scale of 2-mm steps on ct have been reported.4 \n 7 \n 18 \n 19 heintel et al achieved a highly satisfactory breach rate of 2% for trauma patients using dual fluoroscopy - based technique.12 however , that study did not include screw misplacement with lateral wall perforation in those that were inserted medially . in the present study , \n if they had used the same grading scale of screw misplacement as in the present study , the breach rate should have been higher than the result they reported . in the present study , \n screw placement was better using the dual fluoroscopy - based technique than in reports of the single fluoroscopy - based technique , because the rotating single c - arm could not reflect the three - dimensional trajectory of the needle in real time during the procedure of transpedicular needle insertion into the vertebra . \n taking biplane imaging views simultaneously by dual fluoroscopy units makes it possible to identify the precise entry point and the trajectory of the pps in real time . \n in addition , the use of dual fluoroscopy units has the potential to reduce the incidence of surgical site infection by saving multiple troublesome and unclean steps of c - arm control . \n the cause of the high rate of lateral wall breaches at l2 is likely related to the anatomical features of the lumbar spine . \n the pedicle width of the lumbar vertebrae increases gradually from l1 to l5.20 when the base of the transverse process is located more on the outside than usual due to hypertrophy of a degenerative facet , an increased risk of developing a lateral wall breach is seen because the entry point of the screw is located on the outside.5 additionally , when there is a recess in the lateral pedicular wall , a lateral pedicular breach is unavoidable based on the anatomical features ( fig . \n the computed tomography shows lateral breach of screw due to the hypertrophy of facet and the recess in the lateral pedicular wall . \n screw deviation of less than 2 mm into the canal does not appear to cause adverse postoperative clinical results . \n in fact , the lumbar canal has a 4-mm epidural and subarachnoid space safe zone , and canal encroachment of the screw by less than 4 mm could be tolerated without neurologic symptoms.13 \n wiesner et al reported that a major factor related to the higher misplacement rate of s1 screws with medial wall breach was the presence of the iliac crest in the vicinity.15 ravi et al suggested that the direction of the medial or lateral breaches tended to depend on the location of the screw insertion point.5 briefly , the medial start point due to the vicinity of the ilium resulted in a medial breach . \n additionally , the ap view of the medial margin of the sacral pedicle is often poor compared with that of lumbar vertebrae . \n if the view is clear , a surgeon acquainted with the anatomy could anticipate the medial margin of the pedicle from the upper vertebra to some extent . \n the anatomical characteristics of the sacrum and a poor knowledge of anatomy resulted in the grade iii screw malposition in group b. yang et al reported that the pps insertion technique using the oblique visualization technique under computer - assisted fluoroscopic navigation reduced the fluoroscopy time per screw to an average of 6.6 seconds.6 with fluoroscopy guidance , raley and mobbs reported that of 88 cases , the first five and the last five required an average of 25.8 seconds and 6.6 seconds of fluoroscopy time per screw , respectively.19 the radiation exposure was greatly reduced by the use of computer navigation and the learning curve . a dual fluoroscopy technique similar to ours achieved a good result , with an average fluoroscopy time of 22.7 seconds per pps and a screw breach rate of 3.3%.21 however , the surgeon had been specialized in misf and was probably beyond the learning curve . \n the present study median fluoroscopy time in group a of 25 seconds was similar to a previous report . in group \n b , the radiation exposure was about twice as long as in group a. the fact that the surgeons in group a were masters with knowledge of local anatomy compared with group b contributed to the lack of grade iii breaches and less radiation exposure in group a. whereas the dual fluoroscopy technique contributed to the high accuracy of screw placement on the axial plane and the optimal location of the screw top within the vertebra on lateral imaging,12 it had a disadvantage of requiring more radiation exposure.22 without an expensive imaging support system , the technique of pps insertion using dual fluoroscopy units is fairly accurate . \n however , the higher radiation exposure when using this technique compared with a navigation system is one important limitation . a larger sample size \n would probably have shown a significant difference between the two groups in grade iii breaches . \n the present study showed high accuracy of pps placement by surgeons with a lack of experience , and experienced surgeons had shorter intraoperative radiation time . \n although there was a lack of novelty , there were significant results from the perspective of a first report : the accuracy of the pps placement for degenerative lumbar spine , not cadaveric spines , and the radiation exposure compared between surgeons with more versus less experience . \n an experience - dependent learning curve has the possibility of decreasing the absorbed doses of radiation . and \n less - experienced surgeons should insert the pps under the technical guidance of a senior surgeon in the first 10 or more cases . \n the present technique using dual fluoroscopy units simultaneously resulted in favorable results achieved by the relatively less - experienced surgeons . \n favorable pps placement was achieved using a conventional dual fluoroscopy - guided technique without depending on surgeon experience . \n the classic modified method of pps insertion in the dual fluoroscopy technique has a risk of greater radiation exposure but provides accurate placement in any institution and by any surgeon .", "role": "user" }, { "content": "study design retrospective comparative study . \n objective to evaluate the accuracy of percutaneous pedicle screw ( pps ) placement and intraoperative imaging time using dual fluoroscopy units and their differences between surgeons with more versus less experience . \n methods one hundred sixty - one patients who underwent lumbar fusion surgery were divided into two groups , a ( n = 74 ) and b ( n = 87 ) , based on the performing surgeon 's experience . the accuracy of pps placement and radiation time for pps insertion were compared . \n ppss were inserted with classic technique under the assistance of dual fluoroscopy units placed in two planes . \n the breach definition of pps misplacement was based on postoperative computed tomography ( grade i : no breach ; grade ii : < 2 mm ; grade iii : 2 to < 4 mm ) . \n results of 658 ppss , only 21 screws were misplaced . \n the breach rates of groups a and b were 3.3% ( grade ii : 3.4% , grade iii : 0% ) and 3.1% ( grade ii : 2.6% , grade iii : 0.6% ; p = 0.91 ) . \n one patient in grade iii misplacement had a transient symptom of leg numbness . \n median radiation exposure time during pps insertion was 25 seconds and 51 seconds , respectively ( p < 0.01 ) . \n conclusions without using an expensive imaging support system , the classic technique of pps insertion using dual fluoroscopy units in the lumbar and sacral spine is fairly accurate and provides good clinical outcomes , even among surgeons lacking experience .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: synovial cysts are infrequent findings in the spine ; when they appear , they are mostly located in the lumbar area . \n the pathology arises from the facet joint and may cause pain , radiculopathy or myelopathy , . on the background of the international literature , we report this uncommon case of a cervical synovial cyst associated with congenital fusion , including our therapeutic approach . \n initially , the patient was put in conservative treatment with painkillers and she also received physiotherapy for a short time period . despite these therapies , the patient s pain continued . \n when presenting at our institution the patient complained of left arm pain beginning in the region of the scapula and shoulder , radiating to the forearm and the fingers iv and v. neurological examination revealed a slight motor weakness ( 1/5 ) of left triceps muscle . \n mri - scans showed a cyst at c7t1 level located dorsolaterally on the left side with connection to the left facet joint . \n the remaining cervical discs were highly degenerated , even c7t1 level showing degenerative spondylolisthesis with the respective cyst ( fig . \n after conformation of the correct level , posterior midline incision was performed and the cyst was totally removed following unilateral muscular dissection only on the left side , under the microscope . \n initially , the patient was put in conservative treatment with painkillers and she also received physiotherapy for a short time period . despite these therapies , the patient s pain continued . \n when presenting at our institution the patient complained of left arm pain beginning in the region of the scapula and shoulder , radiating to the forearm and the fingers iv and v. neurological examination revealed a slight motor weakness ( 1/5 ) of left triceps muscle . \n mri - scans showed a cyst at c7t1 level located dorsolaterally on the left side with connection to the left facet joint . \n the remaining cervical discs were highly degenerated , even c7t1 level showing degenerative spondylolisthesis with the respective cyst ( fig . \n after conformation of the correct level , posterior midline incision was performed and the cyst was totally removed following unilateral muscular dissection only on the left side , under the microscope . \n \n in the study presented here , a case of subaxial cervical synovial cyst with congenital fusion is described . \n intraspinal cysts are unusual abnormalities , thus the occurrence of synovial cysts in the cervical region is especially a rarity . \n signs of a symptomatic cervical synovial cyst are mainly neck pain , pain in upper limbs , radiculopathy and myelopathy , , , , all caused by nerve root and/or spinal cord - compression . \n brown - squard syndrome , acute myelopathie and spontaneous haemorraghe have been described in coherence with cervical synovial cysts , . \n the symptoms are similar to all other space - occupying processes , which can make diagnosis difficult . \n triceps brachii is innervated mainly by c6 , c7 and a minor contribution from c8 nerve roots . \n the clinical findings observed in neurologic examination ; pain distribution and slight motor weakness at triceps muscle was due to left c8 nerve root compression . \n the mean age of patients with symptomatic subaxial cervical synovial cysts in numerous studies ranges from 62 to 79 years . \n the youngest patient mentioned in the reviewed literature was 16 years and the oldest 86 years , . \n most commonly , as all types of intraspinal , extradural cysts , subaxial cervical synovial cysts are located at the level c7t1 , , , . \n they appear most infrequently on level c2c3 and c5c6 , . the transitional joint is more affected than the middle levels . at the c7t1 segment \n so , there may be differently pronounced biomechanical forces and a risk for instability in particular , . \n we propose , that the possible mechanism of synovial cyst development in our patient could have been as follows : the partially fused vertebrae of the c3 and c4 levels enhance the load on spine while , reducing the number of functional segments . congenital fusion in spine cause hypermobility and increased loading on adjacent segments and this leads to degeneration of intervertebral discs . \n spondylolisthesis of c7t1 is also a sign of advanced degeneration as seen on our patient . to our knowledge \n , this is the tenth reported cervical synovial cyst in conjunction with congenital fusion , . \n a number of case reports and case series have accurately described the morphology of synovial cyst in the subaxial cervical area . \n connections to other processes like degenerative changes , rheumatoid arthritis , congenital factors and trauma have been drawn . \n coherent theories have been established about their pathogenesis of synovial cysts . however , at the end of the day their aetiology remains unclear , . in respect to clinical diagnostics , \n moreover , mr - study helps to distinguish synovial cyst from other cysts located in spine . \n the synovial cyst differs histologically from the ganglion cyst concerning synovial lining , the containing fluid and existing connection to the facet joint ; synovial cysts are defined as cystic dilatations of the synovium . \n this differential diagnosis can be important for surgical treatment , because of the drift of synovial cysts adhering to the dura . \n furthermore , the incidence of synovial cysts is increasing because of the eased availability of mr- and ct - imaging , . in case of significant / intense symptoms \n further treatment of cervical synovial cysts is usually surgical decompression and extinction of the cyst , , . \n only few reports describe minimalized surgery , like ct guided aspiration or a non - surgical approach , . \n these minimalized procedures can be acceptable for the lumbar region , however , in the cervical region higher safety is demanded due to the risk of spinal cord compression . \n signs of a symptomatic cervical synovial cyst are mainly neck pain , pain in upper limbs , radiculopathy and myelopathy , , , , all caused by nerve root and/or spinal cord - compression . \n brown - squard syndrome , acute myelopathie and spontaneous haemorraghe have been described in coherence with cervical synovial cysts , . \n the symptoms are similar to all other space - occupying processes , which can make diagnosis difficult . \n triceps brachii is innervated mainly by c6 , c7 and a minor contribution from c8 nerve roots . \n the clinical findings observed in neurologic examination ; pain distribution and slight motor weakness at triceps muscle was due to left c8 nerve root compression . \n the mean age of patients with symptomatic subaxial cervical synovial cysts in numerous studies ranges from 62 to 79 years . \n the youngest patient mentioned in the reviewed literature was 16 years and the oldest 86 years , . \n most commonly , as all types of intraspinal , extradural cysts , subaxial cervical synovial cysts are located at the level c7t1 , , , . \n they appear most infrequently on level c2c3 and c5c6 , . the transitional joint is more affected than the middle levels . at the c7t1 segment \n so , there may be differently pronounced biomechanical forces and a risk for instability in particular , . \n we propose , that the possible mechanism of synovial cyst development in our patient could have been as follows : the partially fused vertebrae of the c3 and c4 levels enhance the load on spine while , reducing the number of functional segments . congenital fusion in spine cause hypermobility and increased loading on adjacent segments and this leads to degeneration of intervertebral discs . \n spondylolisthesis of c7t1 is also a sign of advanced degeneration as seen on our patient . \n to our knowledge , this is the tenth reported cervical synovial cyst in conjunction with congenital fusion , . \n a number of case reports and case series have accurately described the morphology of synovial cyst in the subaxial cervical area . \n connections to other processes like degenerative changes , rheumatoid arthritis , congenital factors and trauma have been drawn . \n coherent theories have been established about their pathogenesis of synovial cysts . however , at the end of the day their aetiology remains unclear , . \n in respect to clinical diagnostics , mr - imaging is the best established technique for visualizing synovial cysts , . \n moreover , mr - study helps to distinguish synovial cyst from other cysts located in spine . \n the synovial cyst differs histologically from the ganglion cyst concerning synovial lining , the containing fluid and existing connection to the facet joint ; synovial cysts are defined as cystic dilatations of the synovium . \n this differential diagnosis can be important for surgical treatment , because of the drift of synovial cysts adhering to the dura . \n furthermore , the incidence of synovial cysts is increasing because of the eased availability of mr- and ct - imaging , . in case of significant / intense symptoms \n further treatment of cervical synovial cysts is usually surgical decompression and extinction of the cyst , , . \n only few reports describe minimalized surgery , like ct guided aspiration or a non - surgical approach , . \n these minimalized procedures can be acceptable for the lumbar region , however , in the cervical region higher safety is demanded due to the risk of spinal cord compression . \n written informed consent was obtained from the patient for publication of this case report and accompanying images . \n a copy of the written consent is available for review by the editor - in - chief of this journal on request . \n \n \n \n \n ", "role": "user" }, { "content": "highlightscervical synovial cysts are rare and the symptoms can mislead quickly , for differential diagnostics mr - imaging is important.biomechanical alterations of the spine play a significant role in the development of synovial cyst.surgical treatment should be considered in cervical synovial cysts with neurologic deficit or with cord compression or when the conservative treatment is ineffective .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: subacute granulomatous thyroiditis ( sgt ) , also known as de quervain 's thyroiditis , is a self - limiting , inflammatory disease of the thyroid that is believed to be caused by a systemic viral infection . \n it was first diagnosed in 1825 , and 18 cases were reported as thyroiditis acuta simplex until 1895 . \n it typically occurs in the area of the gland in mid - aged hyperthyroid women complaining of pain , tenderness , fatigue and mild fever . \n it is usually clinically diagnosed without the need for fine - needle aspiration ( fna ) \n . therefore , there are few studies regarding the cytological features of sgt in the literature . \n however , it is important to exclude other diseases of the thyroid because sgt may be confused with them , particularly with malignancies . \n the objective of this study is to define the ultrasonographic ( usg ) and cytopathologic characteristics of sgt and highlight its differential diagnosis from the other lesions of the thyroid . \n a total of 21 cases diagnosed with sgt between 2001 and 2014 were included in our study . \n clinical data , such as the patients ages , clinical findings and clinical preliminary diagnoses and the usg findings , were obtained retrospectively from the pathology reports . \n cytological preparations were re - evaluated in terms of cellularity , multinuclear giant cells ( mngcs ) , granulomatous structures , histiocytes , colloids , follicular epithelial cells , fibrous fragments and inflammatory cells . \n fine - needle aspirations were performed by a cytopathologist ( np ) , who was accompanied by a radiologist ( ky ) , and with ultrasonography guidance , by using a 22-gauge needle , 10 cc syringe and aspirator . on average , \n the procedure was concluded upon the detection of a sufficient number of air - dried preparations stained with the diff - quik dye at the bedside . \n the clinical and cytological characteristics of the 21 cases included into the study have been summarized in table 1 . \n clinical and cytopathological features of subacute granulomatous thyroiditis all , except two cases , were women ( 90% ) and the mean age was 38.19 years ( 1850 years ) . \n seven cases presented with a pain complaint in the area of the thyroid lasting a few weeks , whereas 2 cases had pain and previous upper respiratory tract infection and 1 case had a history of sgt that had occurred 3 months previously . the preliminary clinical diagnosis was sgt in 2 cases , thyroiditis in 6 cases , multinodular goiter ( mng ) in 4 cases , thyroid carcinoma in 4 cases and lymphoma in 1 case . \n the usg findings of the other 20 cases have been summarized in \n table 2 . \n hypoechoic thyroid nodules with irregular margins were observed in 12 cases at usg , whereas heterogeneous , hypoechoic areas ( lava flow ) with indistinct margins were observed in 7 cases [ figures 1a and 2a ] . in 1 case ( \n case 16 ) , one of the bilateral and multiple lesions , which located on the right side , appeared with a hypoechoic area , and the others presented as nodular lesions . in the 13 cases that presented as nodular lesions , \n the nodules were generally unilateral and single , with the largest mean size being 22.19 mm ( range : 740 mm ) , whereas the largest mean size of the hypoechoic - heterogeneous areas was 27.52 mm ( range : 1075 mm ) . \n ultrasonographic findings of subacute granulomatous thyroiditis a subacute granulomatous thyroiditis case sonographically characterized by an ill - defined hypoechoic nodule ( case no . \n the cytologic features of the case included the following : ( b ) multi - nucleated giant cell ( papanicolau stain , 400 ) , ( c ) an epithelioid histiocytic granuloma ( papanicolau stain , 400 ) , ( d ) a group of epithelioid histiocytes adjacent to a giant cell ( papanicolau stain , 400 ) and ( e ) a collection of proliferated follicular cells ( papanicolau stain , 200 ) a subacute granulomatous thyroiditis case with a sonographic image of a poorly defined hypoechoic area . \n the cytologic features of the case included the following : ( b ) multinucleated giant cell ( diff quik , 400 ) , ( c ) an aggregate of epitheliod histiocytes consistent with granuloma ( diff quik , 400 ) , ( d ) a cluster of epithelioid histiocytes ( papanicolau stain 400 ) and ( e ) a group of proliferated follicular cells ( diff quik , 400 ) cytologically , the diffusions were generally normocellular or moderately cellular , and there was no highly dense ( tumoral ) cellularity . \n all cases presented with follicular epithelial cells , although this was rare in some such cases . the cells were generally shaped as honeycomb fragments , with a partially degenerated and proliferated appearance , and it was noted that reactive atypia accompanied 1 case ( case 15 ) . however , no papillary or microfollicular structuring , plasmacytoid appearance or intranuclear inclusion or groove was observed in any sample . \n the mngcs were of variable sizes and forms , contained a cytoplasmic content and were generally large . \n phagocyted colloid and neutrophils appeared in the cytoplasm of some mngcs . in rare cases , there were also some smaller , round , vacuole - cytoplasm mngcs that contained less nucleus . \n though there were epitheloid histiocytes and clusters of epitheloid histiocytes , which were believed to be granulomas , in 10 cases , the epitheloid cells were isolated or formed loose cohesive clusters in 3 cases . \n the granulomas that were assessed appeared similar to those in other granulomatous diseases , specifically , to be derived from bare - foot or carrot - shaped nucleus cells constituting tight syncytial groups of variable sizes [ figures 1 and 2b e ] . \n this colloid generally appeared in thick , small and large masses inside epithelioid histiocytes , some of which occurred in a phagocytosed manner . \n all cases had a dirty background that was composed of cellular debris , blood elements and pink amorphous acellular material , and this was accompanied by neutrophil leukocytes in 2 cases and mixed types of inflammatory cells with dominant lymphocytes in the remaining cases . \n the inflammatory diseases of the thyroid gland are classified into three groups , that is , acute , subacute and chronic . \n de quervain 's thyroiditis , also named giant - cell or granulomatous thyroiditis , is the subacute inflammation of the thyroid and constitutes nearly 36% of all thyroid diseases . \n it is a nonspecific inflammation that generally appears 2 weeks after a viral upper respiratory tract infection and regresses spontaneously within 23 months . \n although its etiology remains unknown , it is believed have a viral origin , similar to the mumps virus , hepatitis b and c viruses , cytomegalovirus enterovirus , and type a and b coxsackie viruses . \n thyroiditis predominantly affects adult females , and the ratio of females to males is 2:16:1 . \n clinically , patients present with localized anterior neck pain associated with glandular tenderness and diffuse pain in the ears and the jaw , which is accompanied by fatigue , weight loss , low - grade fever , elevated erythrocyte sedimentation rate , suppression in the thyroid stimulating hormone level and occasionally dysphagia . \n the thyroid is sensitive at palpation , and there is a mild - moderate growth in the thyroid \n . depending on the stage of the disease , hyperthyroidism , hypothyroidism or euthyroidism may be seen in patients . \n the patients recover spontaneously after weeks or months , and recovery may be supported by symptomatic treatment with nonsteroid anti - inflammatory drugs or , occasionally , cortisone . \n generally , an increase in the size of the thyroid and heterogeneous , diffuse , hypoechoic and confluent areas with negative margins , characteristically defined as lava flow , are observed on usg . \n however , these findings are nonspecific because they may also be observed in lymphocytic thyroiditis , mng and graves diseases , and the clinical findings may assist in the differential diagnosis . \n sgt may also present with nonsensitive solid nodules . unlike the literature findings related to this topic , the number of cases appearing as nodules in our study ( 13 cases ) was relatively higher than the number of cases appearing as hypoechoic areas ( 7 cases ) . additionally , most of our cases were unilateral . \n due to the risk of infiltrative malignancies , such as generalized parenchymal abnormalities , which can be interpreted as diffuse nonneoplastic thyroid disease , including sgt , repeated usg and even fna should be performed to exclude other malignancies in sensitive or nonsensitive hypoechoic and solid nodules . due to the rare \n however , the frequency of cytopathological use has increased with the development of usg approaches . \n fine - needle aspiration is beneficial in the diagnosis of thyroiditis and may provide very accurate results . \n fna plays an important role for accurate diagnosis , particularly when clinicians do not suspect sgt or in atypical cases . \n the fact that among all of our cases , there is no distinct clinical finding that may help us , except for pain in the area of the thyroid in 7 cases , pain and previous upper respiratory tract infection in 2 cases , and the presence of a history of sgt in 1 case as well as the absence of malignancies among clinical differential diagnoses in 5 cases ; this reveals the importance of fna . \n the key cytological characteristics for sgt are as follows : ( i ) a high number of mngcs , ( ii ) epithelioid cells with a tendency for clustering , ( iii ) epithelioid cell granulomas , ( iv ) lymphocytes , macrophages and neutrophils , ( v ) frequently degenerated follicular epithelial cells displaying mild - moderate cellularity , and ( vi ) a dirty background that is composed of cellular debris , naked , degenerated nuclei and thick colloids . \n the absence of one or a few of these does not exclude sgt but instead increases the number of thyroid diseases that are included in the scope of the differential diagnosis . \n the characteristic cytological feature of sgt is the presence of mngcs , which may comprise hundreds of large nuclei and contain colloidal residues in their cytoplasm[figure 3 ] . \n mngcs may be seen inflammatory conditions of the thyroid ( granulomatous diseases , hashimoto 's thyroiditis , graves disease and palpation thyroiditis ) , hyperplastic conditions ( mng displaying degenerative changes ) and neoplastic conditions ( papillary carcinoma , anaplastic carcinoma ) . \n ( a ) multinucleated giant cell secondary to a benign cystic nodule ( our archival case ) ( diff quik , 400 ) . \n ( b ) bizarre giant cells seen in a case papillary thyroid carcinoma ( our archival case ) ( papanicolau stain , 400 ) . ( c ) \n ( d ) multinucleated giant cell with an intracytoplasmic colloid like material ( arrow ) seen in one of our subacute granulomatous thyroiditis cases ( case no . \n 21 ) ( papanicolau stain , 400 ) two morphological types mngcs can be observed in fna samples : those with foamlike cytoplasm and those with dense cytoplasm . \n mngcs with foamlike cytoplasm are round cells with less diagnostic importance and are generally seen in cystic degeneration . \n they are usually composed of multinuclear forms of histiocytes , flat cytoplasmic contours , foamlike , vacuole and hemosiderin cytoplasms [ figure 3a ] . \n further , mngcs with dense cytoplasm have angular cytoplasm and irregular shapes , are larger and contain a higher number of nuclei . \n primarily , the three following conditions should come to mind in diffusions containing mngcs : ( i ) sgt , ( ii ) granulomatous diseases , such as sarcoidosis , tuberculosis and fungal infections , and ( iii ) papillary carcinoma of the thyroid ( pc ) . \n the presence of tumor cellularity and pc nuclear characteristics ( powdery chromatin , nuclear groove and intranuclear inclusions ) , overlapping syncytial tissue fragments , real papillary fragments , if any , and psammoma bodies are characteristics in favor of pc . \n the mngcs that they contain are smaller in number and size compared with sgt and granulomatous diseases . \n these cells are called bizarre giant cells [ figure 3b ] . however , in some pc cases , mngcs of sgt can be seen in addition to the bizarre giant cells [ figure 3c ] . \n dirty background with clinical , well - formed or poor - formed epithelioid granulomas and acute - chronic inflammation is included in the differential diagnosis for sgt . \n the mngcs that are present have a tendency to be more frequent and larger in size and to contain more nuclei . \n the main cells in the granulomatous diseases of the thyroid are epithelioid histiocytes , and the granulomas observed are generally well formed , comprise fewer lymphocytes and acute inflammatory components and do not contain a dirty background . \n however , it should also be highlighted that \n mngcs may not always be seen in sgt aspirates , may sometimes be too few and scattered , or may very rarely be seen in sgt as intensely as they appear in other thyroid diseases . \n granulomas , which appear as epithelioid histiocyte clusters , are another key characteristic for sgt but are rare or may not be seen . \n different rates have been reported with regard to the presence of granulomas in sgt in different studies in literature , and it was suggested that these different rates were due to the association with the stage of the disease or a sampling error . \n epithelioid granulomas were defined in many cases , such as tuberculosis , sarcoidosis and fungal infections , postsurgically in the neck area , auto - palpation habit , hemorrhage in nodular goiter , proximity to histiocytic reaction , hashimoto 's thyroiditis and graves diseases . \n the presence of a high number of mngcs accompanied by acute onset pain , which is also a characteristic clinical symptom for sgt , will be helpful for differential diagnosis . \n garca solano et al . reported the presence of follicular cells with intravacuolar granules and/or plump transformed follicular cells , though this was not a marked characteristic in our cases . \n in contrast , the follicular epithelial cells in our cases were generally degenerated / proliferated , and regenerative atypia findings were observed from an aspirate taken with the suspicion of malignancy . \n however , the patient was diagnosed as sgt due to the absence of cellular and structural malignant characteristics , despite the presence of a high number of mngcs and epithelioid cells accompanied by a dirty background . \n if the patient has the cytological characteristics specified above when he / she comes to the clinic with a clinical diagnosis of sgt , the cytological diagnosis of sgt may not be too difficult . \n however , the following factors may rise to challenges in the diagnosis : ( i ) lack of clinical data , \n ( ii ) failure of the needle to reach the target , ( iii ) absence of the typical cytological characteristics ( i.e. mngcs , granulomas ) as in acute or advanced stage of the disease , and ( iv ) presence of atypical follicular epithelium cells without other diagnostic elements . according to ofner et al . \n although pain and tenderness in the thyroid gland is a very important finding for the diagnosis of sgt , it is not specific and may be seen in suppurative thyroiditis , trauma , radiation , nodular goiter , hemorrhagic and infarct areas , metastatic diseases and rarely , in hashimoto 's thyroiditis . \n generally , the correct diagnosis can be made by combining detailed clinical and physical examination and using serological and cytological characteristics in combination . \n however , clinical follow - up and fna may be very beneficial in such cases . \n subacute granulomatous thyroiditis is a dynamic process , and usg and cytological findings may vary according to the stage of the disease . \n although there is no special radiological finding of thyroiditis , hypoechoic and heterogeneous areas with irregular margins in the thyroid are strongly associated with thyroiditis . however , sgt may also appear as a painful or painless hypoechoic and solid nodule , as occurs in most of our cases . \n they may be confused with malignancies , particularly in such cases , and give rise to difficulties in differential diagnosis . \n the characteristic cytological features in our series in fna were a high number of mngcs with dense cytoplasm , mild - moderate cellularity , degenerated - proliferated follicular epithelial cells and dirty background accompanied with epithelioid granulomas and rare , mixed type inflammatory cells . although the presence of neck pain in the clinical history , the detection of mngcs at fna , their morphological characteristics and their number play a key role in the diagnosis . \n further , utilizing tbc - fungal cultures and assessing the accompanying cell population in the background may help in the differential diagnosis . \n \n all authors of this article declare that we qualify for authorship as defined by icmje . \n each author has participated sufficiently in the work and takes public responsibility for appropriate portions of the content of this article.cv conceived of the study and drafted the manuscript . \n np participated in its design and coordination and helped to scientific revision of the manuscript . \n this study was conducted with the approval from all the institutions associated with this study as applicable . \n sgt = subacute granulomatous thyroiditis fna = fine - needle aspiration usg = ultrasonographic mngcs = multinuclear giant cells mng = multinodular goiter pc = papillary carcinoma \n to ensure the integrity and highest quality of cytojournal publications , the review process of this manuscript was conducted under a double blind model ( authors are blinded for reviewers and vice versa ) through automatic online system .", "role": "user" }, { "content": "background : subacute granulomatous thyroiditis ( sgt ) is an inflammatory disease that presents with different clinical and cytological characteristics . although the diagnosis is generally made clinically , imaging methods and fine - needle aspiration ( fna ) may provide assistance , particularly in atypical cases . \n the objective of this study is to reveal the ultrasonographic ( usg ) and cytological characteristics of sgt.materials and methods : the clinical , usg and cytological findings of 21 cases diagnosed with sgt were reviewed.results:ultrasonographic data was available in 20 cases . a hypoechoic thyroid nodule with irregular margins was detected in 12 of the 20 total cases . of these , \n 9 cases complained about pain in the thyroid lodge and generally had unilateral lesions , heterogeneous and hypoechoic areas with indistinct margins , rather than nodular lesions , which were seen in 7 cases . \n cytologically , the multinuclear giant cells ( mngcs ) found in all cases were accompanied by a dirty background containing varying numbers of granulomatous structures , including isolated epithelioid histiocytes , proliferated / regenerated follicle epithelium cells and inflammatory cells and colloid.conclusion:though hypoechoic and heterogeneous areas with irregular margins are strongly associated with thyroiditis , sgt may also appear as painful or painless hypoechoic , solid nodules and generate challenges in differential diagnosis . although the most remarkable characteristic observed in fna cytology was the presence of multiple mngcs with cytoplasm , a dirty background accompanied by mild - moderate cellularity , degenerated - proliferated follicular epithelium cells , rare epithelioid granulomas and mixed type inflammatory cells are characteristic for sgt . \n the assessment of these radiological and cytological findings in conjunction with clinical findings will assist in the achievement of an accurate diagnosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: as a gastrointestinal ( gi ) disease chronic constipation is very common in the general population with a prevalence of nearly 20% . \n it is also very common in children with a frequency between 3% and 16% . in dealing with this disease , it is important to be sure that it is not secondary to other conditions , like thyroid disease or congenital anomaly of gi tract . \n life style modification can be the first management in chronic functional constipation . then , if no response is achieved , a therapeutic trial with fiber and/or simple laxatives is suggested . in spite of these modalities \n it has been reported that at the end of a 5-year follow - up study , no improvement was seen in 35 - 45% of the patients . in children with chronic constipation \n not responding to laxative treatment the symptom may be due to other causes , one of them being cow 's milk allergy[46 ] . \n association between cow 's milk allergy and chronic constipation has been reported by buisseret in 1978 . in an open but not placebo - controlled study by iacono et al , was shown that 21 of 27 patients with refractory constipation responded to a cow 's milk free diet ( cmfd ) . \n many reports showed the relationship between chronic constipation and cow 's milk allergy , but some were against[6 , 815 ] . loening - \n baucke reported no improvement of the symptom in children with chronic constipation who had a history of cow 's milk allergy and have been on cmfd . \n yimyaem et al reviewed the results of 10 cow 's milk allergy patients studied from 1997 to 2001 and did not find any relation with constipation . in order to clarify these apparently conflicting results we decided to check the effect of cmfd on our patients with chronic constipation . \n in this randomized clinical trial all consecutive patients less than 14 years of age with chronic constipation referred to pediatric gastroentero - logy clinic affiliated with shiraz university of medical sciences between april 2009 and april 2010 were evaluated . \n we used rome iii criteria for definition of functional constipation , i.e. two or more of the following in a child with a developmental age of at least 4 years with insufficient criteria for diagnosis of inflammatory bowel syndrome : two or fewer defecations in the toilet per week.at least 1 episode of fecal incontinence per week.history of retentive posturing or excessive volitional stool retention.history of painful or hard bowel movements.presence of a large fecal mass in the rectum.history of large diameter stools that may obstruct the toilet . \n criteria fulfilled at least once per week for at least 2 months before diagnosis , and one month of at least two of the following in infants up to 4 years of age : two or fewer defecations per week.at least one episode / week of incontinence after the acquisition of toileting skills.history of excessive stool retention.history of painful or hard bowel movements.presence of a large fecal mass in the rectum.history of large diameter stools which may obstruct the toilet \n the exclusion criteria were anatomical causes of constipation ( eg , hirschsprung 's disease , spinal disease ) , constipation due to other disorders ( eg , hypothyroidism , psychomotor retardation ) , prior anal surgery , and use of medications that can cause constipation . \n 140 children were enrolled : 73 boys and 67 girls ( 52.1% and 47.9% , respectively ) , age range , 1 - 13 years ; ( mean , 4.62.7 years ) . \n they all fed cow 's milk , dairy products , or commercial formulas derived from cow 's milk . \n previous treatment with different laxatives such as lactulose , mg(oh)2 , paraffin , and peg for at least three months had been unsuccessful in all patients . \n when the patient was first seen , complete physical examination including rectal examination was done and a detailed chart was compiled containing the results of the physical examination and medical history information such as breast feeding during the first months of life , acceptance of formula at weaning , and especially the presence or absence of rome iii criteria . \n diagnosis of cow 's milk allergy induced constipation was based on increased frequency of defecation or decreased number of signs and symptoms after 4 weeks cmfd and coming back to rome iii criteria after 2 weeks of challenge with cmd in comparison to the control group . \n we define cmfd as a diet free of any dairy products made of cow 's milk . \n flow diagram of patients at the first visit , the parents were asked to record the child 's signs and symptoms , and all medications were discontinued . \n then the patient was assigned to receive peg solution 0.5 gram / kg / day and cmfd or peg solution with the same dose and cmd for the next 4 weeks . \n the order of dietary treatment was randomly assigned by a computer generated method with the individual patient as the unit of randomization and according to this randomization the patients were recommended to receive cmfd or cmd by a pediatric allergist . at the end of the treatment , \n the protocols were evaluated again by pediatric gastroenterologist who was blinded to the type of diet . at baseline and at the end of the first study periods , \n the children were examined by a researcher . during the study period , the parents recorded the number of bowel movements , as well as the appearance of the stools and the child 's difficulty in passing them . to ensure that the children did not receive any other kind of milk or milk - containing foods during the study , the parents were given a list of the most common milk - containing foods to be avoided . during the study period \n , they were asked to record the amount and type of food their child had eaten each day . at the end of the study \n , we analyzed these diaries to evaluate adherence to the diet and the quantity of milk consumed . \n the parents were able to contact us whenever necessary , and telephone contacts helped to ensure adherence to the diet . \n after the first study period , the children who were on the cmfd were given the cmd for another two weeks . \n during the two week challenge period , the parents recorded any clinical symptoms , and the patients were reexamined in the hospital for any adverse reaction , and at the end of the challenge period they were evaluated for presence of constipation again . \n informed consent was obtained from the parents of all the patients involved in the study . \n the pearson chi - square and mcnemar tests were used to compare the rome criteria , and student 's t - test for parametric analysis . \n all p - values were two - tailed , and p - values less than 0.05 were considered to indicate statistical significance . \n two groups were matched for age , sex , duration of illness , frequency of breast feeding at birth and signs and symptoms of constipation at the time of entry to study . \n the base - line characteristics of the 140 patients are shown in tables 1 and 2 . \n eighty - four ( 60% ) children had abdominal pain and only 7 ( 5% ) patients had anal fissures . \n after 4 weeks 56 ( 80% ) patients of the case group responded in comparison to 33 ( 47.1% ) patients in control group ( p=0.0001 ) . \n the comparison of rome criteria in the case group before trial and 4 weeks after cmfd are shown in table 3 . \n the comparison of rome criteria in case group before trial and at the end of trial are shown in table 5 . \n after this period 24 out of 56 ( 42.8% ) responders developed constipation according to rome iii criteria . \n with other words , the frequency of cow 's milk allergy among constipated patients was 80% but the frequency of cow 's milk allergy induced constipation based on our definition ( increased frequency of defecation or decreased number of signs and symptoms after 4 weeks cmfd and coming back to rome iii criteria after 2 weeks of challenge with cmd ) was 34.3% . \n clinical characteristics of children with chronic constipation before trial comparison of rome criteria in children with chronic constipation before trial comparison of rome criteria in children with chronic constipation before trial and 4 weeks after cow 's milk free diet comparison of rome criteria in children with chronic constipation on cow 's milk free diet and cow 's milk diet after 4 weeks comparison of rome criteria in children with chronic constipation on cow 's milk free diet before trial and 2 weeks after cow 's milk diet challenge at beginning of the study there was a trend towards a high frequency of negative skin prick test among the patients with functional constipation , and in only one child with cow 's milk allergy induced constipation it was positive . \n some studies showed that chronic diarrhea is the mostly encountered gi symptom of cow 's milk allergy in children , constipation being another but not too frequent symptom . \n it is not yet confirmed that allergy to cow 's milk could cause refractory chronic constipation . \n several clinical studies have been done in pediatric cow 's milk allergy with inconsistent results . \n recently it is agreed that constipation seems to be the result of hypersensitivity to cow 's milk proteins[412 , 18 ] . in a recent study \n nighty - nine out of 136 ( 72.8% ) constipated children less than 3 years of age had allergy to cow 's milk protein as a cause of constipation and after introduction of the elimination diet clinical improvement was observed in all children . \n the authors concluded that cow 's milk allergy is the most common cause of constipation in the first three years of life . \n syrigou ei et al in greece showed that constipation was improved in 28/32 constipated children with positive atopy patch test ( apt ) after withdrawing the apt - positive foods for an 8-week period . \n we found a relation between the intake of cow 's milk products and constipation in about one third ( 34.3% ) of the patients . in a study in spain 35 of the 69 constipated children ( 51% ) improved during the first cmfd period , 8 of these did not develop constipation when cm was reintroduced , and other 27 children ( 39% ) developed constipation during the cm challenge and improved during the second cmfd phase , which is consistent with our study . \n positive skin prick test response indicates the possible association between the food tested and the patient 's reaction to that specific food . \n although positive skin prick test response only suggests the presence of symptomatic allergy , the negative skin prick test response is an excellent means of excluding ige - mediated food allergy . in this regard irastorza \n i et al did not find an ige - mediated immunologic mechanism in children with chronic constipation , but for approving this , further study is needed . \n the present study showed that excluding cow 's milk products from children 's diet with chronic constipation is associated with improvement of the signs and symptoms in 80% of patients . \n this percent of responding to elimination diet was the same as in other studies[46 , 18 ] . \n in one study , of 27 children with chronic functional constipation who did not respond to 2 months of laxative therapy , 21 ( 77.7% ) were responsive to elimination of cow 's milk and dairy products for a 1 month period , this is comparable with our results . \n we found that cmd has a meaningful effect on making signs and symptoms of constipation , and other factors may have effect on these signs and symptoms like other proteins in other diets , and compliance of patients and their parents during the study . \n it is not completely agreed that 2 weeks of challenge test is enough for coming back of all signs and symptoms of cmd dependent constipation , and if it was longer , further signs and symptoms might recur . \n furthermore , clinical examination of the children in our study showed a low frequency ( 5% ) of severe anal fissures . \n because in some studies[4 , 7 , 11 ] , these lesions reappeared after the reintroduction of cow 's milk and before the onset of constipation , it is hypothesized that these are one of the mechanisms causing constipation . \n but in our study , we found no cause and effect relationship between anal fissure and constipation . \n our pediatric gastroenterology department is a referral center , the pediatricians who referred patients , may have preselected the patients . also , we could not totally rule out psychological factors , which are frequently suggested as the cause of chronic constipation . in most previous studies , like ours \n , all the patients had been previously treated unsuccessfully with laxatives ; so , the high frequency of cow 's milk allergy in constipated children in these studies may have been due in part to their inclusion criteria . \n chronic constipation can be a manifestation of cow 's milk allergy in children . at present , although many questions exist that have no answer , but a therapeutic trial with elimination diet is advisable in all children with constipation unresponsive to correct laxative treatment . \n ", "role": "user" }, { "content": "objectivecow 's milk allergy has different presentations in children and can cause functional bowel symptoms such as chronic constipation . \n the aims of this study were to investigate the role of cow 's milk allergy as a cause of chronic constipation and effect of cow 's milk free diet ( cmfd ) on its treatment in children.methodswe performed a randomized clinical study comparing cmfd with cow 's milk diet ( cmd ) in two groups each consisting of 70 patients ( age range , 1 - 13 years ) with chronic functional constipation ( defined as rome iii criteria ) . \n all subjects had been referred to a pediatric gastroenterology clinic and had previously been treated with laxatives for at least 3 months without success ; also all 140 patients performed skin prick test . \n the case group received cmfd for 4 weeks . \n after that they received cmd for 2 extra weeks . \n the control group received cmd for whole 6 weeks . \n a response was defined as decreased in signs and symptoms that not fulfilled rome iii criteria after 4 weeks of cmfd and came back to rome iii criteria after 2 weeks of cmd challenge.findingsafter 4 weeks 56 ( 80% ) patients of the case group responded in comparison to 33 ( 47.1% ) patients in the control group ( p=0.0001 ) . in the case group after 2 weeks challenge 24 out of 56 ( 42.8% ) responders developed constipation according to rome iii criteria . with other words , \n the frequency of cow 's milk allergy among constipated patients was 80% . \n only one patient had positive skin prick test.conclusionin children , chronic constipation can be a manifestation of cow 's milk allergy . at present , although several aspects must be further investigated , a therapeutic attempt with elimination diet is advisable in all children with constipation unresponsive to correct laxative treatment .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: celiac disease ( cd ) is an immune - mediated systemic disorder elicited by gluten and related prolamins in genetically susceptible individuals and characterised by the presence of a variable combination of gluten - dependent clinical manifestations , cd - specific antibodies , hla - dq2 or hla - dq8 haplotypes , and enteropathy . \n recently , the prevalence of celiac disease across the european countries was shown to be 1.5% based on people who had positive biopsy and ttg results . in the united states , the overall prevalence of celiac disease in children up to 5 years of age is 1 in 104 . \n this disease is quite prevalent in india also with rates of 1 in 96 in north india . \n lifelong adherence to a gluten - free diet ( gfd ) is the cornerstone treatment of celiac disease . \n a gluten - free diet entails strict avoidance of all products containing the proteins from wheat , barley , and rye . \n it is strongly recommended that gluten elimination from diet must be strict and lifelong not only to control symptoms but also to improve quality of life and decrease the risk of complications . \n although a well - planned gluten - free diet may provide adequate nutrition , it may be restrictive . \n strict adherence to gluten - free diet may be more challenging in children and adolescents than in adults . \n compliance to gfd varies from 45% to 81% in children as reported by the north american society of pediatric gastroenterology , hepatology , and nutrition . \n noncompliance is a major problem and the greatest challenge which the physicians face is in predicting the compliance to the gluten - free diet in children . \n noncompliance may occur due to factors like temptation and not liking the taste of gluten - free food and alternative food grains . in adolescents , peer pressure , unclear labelling on ready - to - eat food , and nonavailability of gluten - free food at party , marriages , and so forth \n an increasingly hectic lifestyle of teenagers has contributed to a greater reliance on packaged foods which often contain gluten , and thus making it inconvenient for them to adhere to restrictive diet . since parents are usually responsible for food preparation for children , low level of knowledge about the diet in the parents , nonavailability of gluten - free foods , and unclear labelling lead to noncompliance in children . \n many children experience psychological reactions to being placed on a restrictive diet ( e.g. , feeling deprived , depressed , angry , and anxious ) which have been found to further decrease compliance . \n this study evaluates the impact of celiac disease and the gluten - free diet on the lifestyle and well - being of children with celiac disease and their families , with the aim to identify factors affecting compliance to gfd and predictors of compliance to gfd in children with celiac disease . \n this study is significant and will contribute to the current body of research by providing health care practitioners with information as to what predicts the compliance to gfd , which may be used to better understand education techniques for dietary instruction so that the children living with celiac disease have less of morbidity and achieve their normal growth potential . \n participants will contribute to the understanding of celiac disease and the challenges individuals face with the gluten - free diet . \n this study was conducted in the tertiary care hospital of the department of pediatrics , sms medical college , jaipur , rajasthan , india . during a period of 1 year starting from october 1 , 2011 , till september 30 , 2012 \n , 150 consecutive celiac disease children visiting the gastroenterology super - specialty clinic were studied . \n 134 consecutive children out of these meeting the following inclusion criteria were enrolled in the study : patients aged between 2 years and 15 years , children diagnosed with celiac disease as per revised espghan criteria for diagnosis of celiac disease 1990 , those on gluten - free diet for more than 6 months . patients \n aged between 2 years and 15 years , children diagnosed with celiac disease as per revised espghan criteria for diagnosis of celiac disease 1990 , those on gluten - free diet for more than 6 months . \n exclusion criteria applied were ( 1 ) any child less than 2 years and more than 15 years of age , ( 2 ) those who did not have a documented positive serology and/or biopsy suggestive of celiac disease as per revised espgan criteria 1990 , ( 3 ) those on gluten - free diet for less than 6 months , and ( 4 ) those children whose parents did not consent to be included in the study . \n all children enrolled in the study after signing of the written informed consent form were evaluated for dietary compliance based on a 5-day dietary recall form . a child who had taken even one food article containing gluten in last 5 days \n was considered noncompliant and those who had strictly taken no gluten in their diet in that period were considered compliant . \n diet recall was done by parents for children in preschool age up to 5 years since parents were the only one giving the eatables to these children . \n children , above 5 years of age , going to school and interacting with peers , were actively involved in the dietary recall along with the parents . \n after the dietary assessment , children and their parents were subjected to an interview by the investigator who was blinded for the compliance status of these children . \n interview consisted of a self - administered questionnaire which had questions related to demographic profile , history of illness , parents ' knowledge and understanding of disease , barriers to compliance and effect of celiac disease on feelings of children , eating out , and travel . \n the questionnaire was developed from 4 previously published studies [ 11 , 1416 ] and it was pretested and validated in 20 children in the past in the paediatric gastroenterology unit of kalawati saran children 's hospital , delhi , india . to assess psychosocial problem , standard paediatric symptom checklist containing 35 items \n the pediatric symptom checklist ( psc ) is used to screen psychosocial problems in a child , by using a parent completed screening questionnaire as a part of routine primary care visit . \n it is a screening tool that reflects the parent 's impression of his or her child 's psychosocial functioning [ 17 , 18 ] \n . each psc item is rated asnever0,sometimes1,often2.item scores are summed and the total score is recorded into a dichotomous variable . \n psc score of 28 or higher for children aged 6 years and above , and 24 or higher in children between 2 and 6 yr is taken as emotional and psychosocial impairment . \n if 4 or more items are unanswered , questionnaire was treated as invalid . during the final data analysis , based on the assessment of compliance to gluten free diet \n this collected data was analysed in microsoft excel 07 and primer 5.00 and classified as per aims and objectives . \n inference was drawn using chi - square test and mann - whitney u test to compare the compliant and noncompliant groups . \n p value of < 0.05 was considered significant . binary logistic regression analysis with backward elimination \n was applied using software pasw18 ( trial version ) , to assess predictability of all the variables used in the study . \n dietary compliance was used as dependant variable and various factors studied for association with compliance were used as factors affecting the dependent variable . \n in the study group of 134 children bearing the characteristics as shown in table 1 , 88 children ( 65.67% ) were compliant and 46 ( 34.33% ) were noncompliant . \n compliance was higher in children up to 9 years of age as compared to that in children aged above 9 years . \n females were slightly more compliant than males ; however the difference was not statistically significant ( p = 0.528 ) . \n compliance was significantly associated with higher level of mother 's education ( p = 0.001 ) and type of family , whether nuclear or joint , with children living in nuclear families being more compliant ( p = 0.05 ) . as evident from table 1 , 93.75% of children with graduate and postgraduate mothers were compliant . \n only 78.05% of children with mothers educated up to the 10th class or nongraduate were compliant and only 53.25% of children with mothers educated up to the 8th class were compliant . among children from nuclear families , \n 73.61% were compliant as compared to only 56.45% children from joint families who were compliant to gluten - free diet . \n number of children in compliant and noncompliant group was not significantly different in relation to age at diagnosis of celiac disease ( p = 0.143 ) , sex of the child ( p = 0.528 ) , per capita family income ( p = 0.215 ) , and number of siblings ( p = 0.983 ) . \n father 's education also was shown not to affect compliance significantly ( p = 0.248 ) . despite being an important factor , the symptom with which the child came when he was diagnosed as having celiac disease , whether gastrointestinal or nongastrointestinal , did not correlate with compliance significantly ( p = 0.951 ) in our study . considering that since parents are the ones responsible for feeding the child , their knowledge and general awareness about the disease do significantly relate to compliance . \n as shown in table 2 , parents of children in the compliant group had better understanding of the nature of the disease and were also very evidently more aware about the treatment and better identified the gluten - free food articles . \n there was a statistically significant difference among the parents of compliant and noncompliant children with respect to their knowledge about celiac disease . \n as seen in table 3 , comparing parents ' attitude towards their child 's disease , there was significant difference between compliant and noncompliant groups with p 0.001 . more than half of the parents of the noncompliant children perceived that gfd was a burden on their budget while this number was only 19.32% in the compliant group . \n dietary noncompliance was significantly more in children whose parents felt that preparing a special diet everyday was a ( psychological ) burden on them ( 54.35% in noncompliant group versus 20.45% in compliant group ) and in those who were hesitant to discuss the child 's condition with others and were not interacting with other parents of celiac disease in the gastroenterology clinics or awareness camps held in the hospital . \n as shown in figure 1 and table 4 , child 's attitude towards his restrictive life style is shown to be as much related with dietary compliance as that of parents ' . \n 56.82% of children in compliant group found keeping to gfd easy , while only 19.57% of noncompliant children found it easy to keep to a gluten - free diet . \n 63.64% children in the compliant group shared the responsibility with their parents in maintaining gluten - free diet as compared to only 21.74% children in the noncompliant group who did so . \n as seen in table 4 , a subjective feeling of finding the taste of gfd very good and good was seen in 72.72% of compliant children while it was seen in only 25.92% of noncompliant children . \n it is evident that a child 's positive attitude towards his restrictive diet goes in sync with his adherence to gfd . \n although both groups reported difficulties to maintain compliance at family party / marriage , at school , however this feeling of difficulty to adhere to gfd was significantly less in compliant group as shown in table 4 . \n travelling has come out as an issue in our study where all the children face difficulty to maintain gfd . \n this points towards a scarcity of packaged ready to eat properly labelled gluten - free eatables ' availability in market . \n table 5 shows that the feeling of anger to follow a special diet , feeling of embarrassment to bring gluten - free food to parties , and feeling of being left out of activities at school because of disease are significantly higher in noncompliant children than compliant ones . \n 7.95% of compliant children felt left out of activities at school or friend 's place all or most of the time while this feeling is seen in 47.8% of noncompliant children all or most of the time . \n 19.32% compliant children felt angry all or most of the time on having to follow a special diet . \n our study has shown that how a child feels about his situation is associated with compliance significantly ( p 0.001 ) . comparing the psc scores in both groups , mean \n psc score for compliant group was lower , that is , 8.3 as compared to 14.6 in noncompliant group . \n in both compliant and noncompliant groups , 1 patient had significant psc score indicating screen test positive for social , emotional , and psychological impairment , thus showing that chances of psychosocial impairment exist in both compliant and noncompliant children , being more in noncompliant ones . in figure 2 , the mean \n psc score was seen to be increasing with age in the children suffering from celiac disease ; hence an older child is more at risk of psychosocial impairment . and this increase in psc scores with age is seen both in compliant and noncompliant group emphasizing that all children whether compliant or not are at risk for psychosocial impairment . \n maximum score was seen in children > 9 years of age . a binary multivariable logistic regression analysis with backward elimination \n was conducted to narrow down predictors of dietary compliance using all the factors assessed previously ( whether found to be significantly associated or not ) , namely , age , sex , age at presentation , presenting symptom , that is , gi or non - gi , father 's education , mother 's education , family type , per capita income , number of siblings , parental knowledge , parental attitude , child 's attitude , child 's behaviour and psc score as predictors , and using compliance as dependent variable . \n the wald criterion demonstrated that only age at presentation ( with p value = 0.004 ) , family type ( with p value = 0.0097 ) , child 's attitude ( with p value = 0.0003 ) , and child 's behaviour ( with p value = 0.0195 ) made a significant contribution to prediction . \n other factors associated with compliance to gfd were not significant predictors ( table 6 ) . seeing the odds ratio of the significant predictors , it was demonstrated that the best predictor of compliance is child 's attitude which , if favourable , makes the child 7 times more likely to be compliant . \n children with a positive outlook and feelings about their condition are 4 times more likely to be compliant ; similarly children of nuclear families are 4 times more likely to be compliant . \n odds ratio for age is 0.75 , that is , with each unit increase in age ( one year ) chance of compliance becomes 25% less likely . \n this was in harmony with the rates of compliance as seen in various other studies done in india and outside . \n strict dietary compliance was shown to vary from 45% to 81% in children by hill et al . , 95% in a canadian study on children < 16 years of age by rashid et al . , and 75% by chauhan et al . in a study done on children 217 years of age , in north india in 2010 . \n whereas young children with celiac disease may adhere to a gluten - free diet because of parental influence , the situation remains complex in adolescents . \n the percentage of compliant children dropped from 75.92% in children > 25 years to 41.37% in children above 9 years of age . \n these results are in accordance with ljungman and myrdal , who also reported compliance rates of 93% at 12 years of age decreasing to 76% in 1517 yr age group . various reasons which may be responsible for increasing noncompliance with increasing age include increased social interaction , increasing peer group pressure , increased outdoor activities , and need for experimentation . \n compliance was not significantly associated with the sex of the child in our study , just as in a study by errichiello et al . . \n this low global level of adherence to a gfd in children with celiac disease is troubling given the known morbidity and mortality associated with long - term untreated celiac disease and the lack of any other effective treatment . \n effective counselling about the diet is the single most important factor to ensure the required restriction in diet among these patients . \n our study enumerates factors which are significantly associated with compliance to gfd and understanding the predictors of compliance will help the clinician to target the problem areas and ensure maximum compliance among children . \n mother 's education is found as a significant factor related with the compliance in our study . \n it may be because mother is responsible for buying and preparation of food items . with her knowledge , \n anson et al . ( 1990 ) also found that maternal education is important factor associated with compliance . \n a statistically significant association of compliance was seen with nuclear family which is coherent with results of chauhan jc et al . in 2010 . \n joint family may lead to noncompliance as with many people around the child having all varieties of food , tempts the child and leads him to consume gluten containing food . \n our study also highlights that higher degree of compliance is noted when parents have better knowledge about celiac disease and the gluten containing items , understand importance of gluten - free diet for their child 's overall growth and development , and are able to distinguish gluten containing from gluten - free food so that they handle the menu better . \n anson et al . also showed similar correlation of parental knowledge and dietary compliance . \n there is more evidence that compliance with the gluten - free diet is improved in those who are more knowledgeable about celiac disease and the diet . \n this study also shows that a parents ' positive attitude towards the child 's condition is associated with higher compliance . \n dietary noncompliance is more common when preparing gluten - free food items is considered both a burden on self and financial burden by parents . \n so counselling aiming to increase the knowledge about the disease and awareness of parents regarding cheap and acceptable alternatives to wheat and easy to cook gluten - free food recipes will help ensure compliance to gfd in children . \n child 's positive attitude towards his condition has also come out as a significant factor associated with higher degree of compliance . \n difficulty in maintaining dietary compliance at school and at family party and marriages was higher in dietary noncompliant group compared to the dietary compliant . \n gluten containing food as main dietary item served at above places was a problem for children in both dietary compliant and noncompliant groups . \n these results highlight that the need of widespread availability of gluten - free food and more clear and apparent labelling of gluten - free items are of as much importance as proper counselling and reinforcement during subsequent visits . \n the study results show that dietary restriction has effect on child 's feelings and social activities like eating out and travelling . \n rashid et al . in their study in canada also reported that more than 50% of children felt left out of activities at school and had problems related to compliance . \n anson et al . have reported similar barriers to compliance in relation to child 's feelings . \n these results indicate that negative feelings in some children owing to their dietary restriction are associated with noncompliance in these children . \n this is the area where the counselling of the treating doctor is utmost important so that a child can be made to better accept his situation and the efforts of the parents of the child can be better channelized to achieve this . out of all these various factors studied for association to adherence to gfd , our study narrowed down four factors which can serve most closely as the predictors of compliance . child 's attitude ( best predictor with or = 7 , p value = 0.0003 ) , child 's behaviour ( with or = 4 , p value = 0.0195 ) , family type ( with or = 4 , p value = 0.0097 ) , and age at presentation ( with or = 0.75 , p value = 0.0004 ) made a significant contribution to prediction of compliance . \n one child in both compliant and noncompliant group in our study has screened positive for psychosocial problems and so such problems can be encountered in both compliant and noncompliant children . \n have shown that anxiety is present in celiac disease subjects as a reactive form which decreases with gluten - free diet ; however depressive symptoms still persist in patients on gfd . \n psc scores are seen to increase as the age increases , more so in noncompliant children . \n maximum score was seen in children > 9 years of age which is fairly understandable as this is the age when children interact with people other than their parents and develop a defiant attitude , give in to peer pressure , and develop a need for experimentation . \n the need for psychological support to all patients when they are put on gluten - free diet and continued psychological support through a professional especially to those above 9 years of age is thus emphasised here . \n our study adds to the available data regarding the significant factors that play a role in compliance to gfd . \n however , a few limitations of this study are to be mentioned . first , compliance was not confirmed with concurrent histological and/or serological evaluation . \n however it is not clear if biopsy provides a better assessment of long - term compliance than nutritional evaluation . \n in fact , prior studies showed only a modest correlation of histology with clinical presentation or assessed dietary adherence [ 22 , 23 ] . \n while histological and serological relapse has understandably been used to assess compliance , in some studies a more practical and noninvasive approach has been used where compliance was assessed subjectively on the basis of dietary recall by parents and children in last few days . in a study by mustalahti in 2002 , the patients ' self - concept of long - term adherence to the gluten - free diet was evaluated by using a visual analogue scale . \n patients indicated their level of adherence by marking a scale anchored at 0% and 100% compliant . at the end of the study , \n 2008 in their study defined compliance with gluten - free diet as strict , semistrict , and not on gluten - free diet based on 7-day recall of patient 's intake of amount of gluten assessed subjectively by patient himself or guardian . \n spatola in his study in 2014 has also used a 4-day dietary record to assess compliance wherein those consuming no gluten - containing item in these 4 days were considered compliant . \n therefore we have used a noninvasive method of dietary recall of 5 days to assess compliance . due to lack of reliable tools it is challenging to uncover minor dietary lapses or inadvertent gluten intake . to ensure compliance status of our study group , \n all subjects had been interviewed repeatedly in their follow - up visits in our gastroenterology super - speciality clinic by trained dietician and senior consultants , to uncover hidden transgressions and establish compliance status based on clinical interview besides the 5-day food record . \n however , the results of this study point to a number of areas , both obvious and obscure , that may be productive targets for interventions aimed at improving dietary adherence in individuals and our future studies will aim to establish the validity of these associations . \n this is because most doctors currently suspect and diagnose the disease in children presenting with nongastrointestinal symptoms as well as atypical presenters and in at risk asymptomatic children by active case - finding strategy ( serologic testing for celiac disease in patients with symptoms or conditions closely associated with celiac disease ) . for many years \n , physicians have focused on the diagnosis and molecular and cellular markers of celiac disease , with scarce attention being given to the care and well - being of the patient . \n patients with celiac disease should be monitored regularly for residual or new symptoms , adherence to gluten - free diet , and assessment for complications . \n normal growth and development are achievable on a gluten - free diet and should be goals for monitoring children with celiac disease . as per acg , monitoring of adherence to gluten - free diet should be based on a combination of history and serology . hence for monitoring of compliance to the diet by history , it may be stated that interventions specially aiming at improving the child 's understanding and acceptability of celiac disease to promote a favourable attitude and positive feelings may increase the compliance to gluten - free diet . \n it may be stated that easy availability of palatable , cheap , and socially acceptable gluten - free food and better labelling of food may increase compliance to gluten - free diet . \n it is evident from our results that if the child lives in a joint family , he needs more of follow - up visits and more efforts from physician 's side to ensure compliance as he is more likely to defy the diet . \n also since age at presentation predicts compliance , the responsibility lies on the medical fraternity to identify the typically and atypically presenting children and put the child on gluten - free diet at an age which is less affected by the peers and such that the child inculcates the dietary habits required of him , for life . \n there is a lot of scope for establishment of celiac support groups in india wherein the doctors , ngos , and volunteering individuals can work together to provide the necessary psychological support to the children , where parents are informed of the varied recipe options and upcoming treatments , and a routine assessment can be done from time to time for any psychosocial impairment to all the children , especially those above 9 years of age .", "role": "user" }, { "content": "aim . to identify the predictors of compliance to gluten free diet in children with celiac disease \n . methods . \n 134 children in the study group were assessed for dietary compliance followed by a questionnaire based interview . \n psychosocial parameters were assessed by standard pediatric symptom checklist ( psc ) . \n dietary compliant and noncompliant groups were compared and assessed for factors affecting the dietary compliance . \n predictability of all of these factors was assessed using binary logistic regression analysis with backward elimination to find out the best predictors of compliance . \n results . in the study group , 88 ( 65.67% ) were found to be strictly compliant . \n factors that were found to be significantly associated with compliance were age at presentation , nuclear families , mother 's education , and parents having better knowledge of celiac disease . \n parents ' and child 's attitude towards his having to follow a restrictive diet and child 's feelings were also shown to be significantly associated with compliance . \n binary logistic regression analysis with backward elimination demonstrated that age at presentation , family type , child 's attitude , and child 's behaviour made a significant contribution to prediction . \n conclusions . \n these results will contribute to the current body of research by providing health care practitioners with a framework for better dietary instruction to ensure maximum adherence to gfd .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: acute abdomen is a term used to encompass a spectrum of surgical , medical and gynecological conditions , ranging from trivial to life - threatening conditions , which require hospital admission , investigations , and treatment . \n it also refers to the clinical situation in which an acute change in the condition of the intra - abdominal organs , usually related to inflammation or infection , demands immediate and accurate diagnosis . \n acute abdominal pain is the most common physical complaint accounting for 510% of all emergency department visits as well as the leading cause of hospital admissions in the united states . \n acute abdomen has a sudden onset , can persist for several hours to days and is associated with a wide variety of clinical features which are specific to underlying condition or disease . \n however , despite its frequent occurrence , it is sometimes difficult to manage because no matter how thorough the work - up is , specific diagnosis is not possible in 30% of cases . \n conditions resulting in acute abdomen can cause serious complications or even death , especially if there is a delay in diagnosis and appropriate therapy , hence the necessity for early diagnosis . \n the causes are numerous , from the relatively trivial to immediately life - threatening ones and attempts to reach a diagnosis must sometimes be curtailed in the interest of immediate treatment . \n the commonly observed conditions are appendicitis , intestinal obstruction , and gynecological pathologies , with acute appendicitis being the most commonly occurring abdominal acute condition in emergency departments . of all the imaging procedures available for the evaluation of an acute nontraumatic abdomen , ultrasound scan ( uss ) appears to be the first line modality because it is easily available , cost - effective , portable , easily reproducible , noninvasive , requires minimal patient preparation and has no known side effects . \n the issue of cost and availability become very important in resource - poor setting where patients pay out of pocket for treatment received . \n furthermore , uss offers a real - time dynamic examination , and this characteristic conveys dynamic information about bowel motility and changes in position as well as to depict blood flow . \n this characteristic is very important in the evaluation of some causes of acute abdomen that may impair peristalsis , including small - bowel obstruction , ischemia , enteritis , and inflammatory processes like acute appendicitis . \n several studies have evaluated the diagnostic accuracy of abdominal uss in acute abdomen and have found high sensitivity and specificity . \n a nigerian study with a similar objective showed low diagnostic accuracy of uss in acute appendicitis . \n this may be due to the resolution of the uss facility that was used in the previous study . \n hence , the need to re - evaluate the diagnostic accuracy of uss among nigerian patients becomes very apparent . \n the purpose of this study was to identify by ultrasound ( us ) the spectrum of diseases in adults with nontraumatic acute abdomen at obafemi awolowo university teaching hospitals complex ( oauthc ) , ile - ife ; and to correlate the us findings with the surgical findings with the aim to ascertain the diagnostic accuracy of abdominal us in the setting of acute abdomen . \n this is a prospective cross - sectional study that was carried out at the radiology department of oauthc , ile - ife from june 2010 to may 2011 . \n the study subjects were made up of consecutive 150 patients aged 15 years and above who were referred to the radiology department of oauthc with symptoms and signs of acute abdomen of nontraumatic origin . \n they were sonographically evaluated with mindray ( usa inc ) real - time uss model dc-6 with doppler facilities , probes with frequencies of 3.5 , 5 , and 7.5 mhz with us acoustic gel . \n normal abdominal protocol for scanning the abdomen including fasted state and distended urinary bladder was skipped because of the acute presentation of the cases . however , for equivocal cases modifications like instilling normal saline via urethral catheter was used to distend the urinary bladder which served as an acoustic window for uss and helped to displace the bowel loops from the area of interest especially when scanning for pelvic organs such as the uterus , vagina , adnexae , prostate gland , and rectum . \n patients with right hypochondrial pain underwent a preliminary scan , when they could not comply with the fasting protocol which was later repeated during fasting to confirm the finding . \n in equivocal cases , they were requested to come back for a repeat scan as soon as they were stabilized . \n coupling gel was applied to the exposed abdomen from below the diaphragm to the symphysis pubis . \n most of the uss were performed by the first authors , and the scanning was done supine in both longitudinal and transverse planes . \n the longitudinal scan was done starting from the midline to the lateral margin , taking one side at time , and moving at about 1 cm intervals . \n a transverse scan of the area of interest was also done , moving from midline to the lateral margin also taking one side at time and moving at about 1 cm intervals . \n the inflammatory features identified were : tenderness , reduction or increased in the echo pattern if it is acute or chronic , respectively , increase in organ or tissue size . \n collections were identified by their anechoic and/or mixed density characteristics . vascular assessment with doppler uss \n such were taken thrice , and the average of the three measurements was taken in order to get the value as accurate as possible . the essential information was entered into the computer spreadsheet . \n the us findings were compared with surgical , medical and/or clinical findings where applicable . statistical package for social sciences ( spss ) for windows version 16.0 ( spss inc . ) \n was used to analyze the data using the appropriate descriptive and inferential statistical methods and displayed by means of varied statistical presentations . \n the degree of agreement of the various clinically related procedure tools in terms of a specific diagnosis was determined by the use of kappa statistics , which indicated the degree of agreement beyond chance . \n diagnostic performance markers were sensitivity , specificity , positive predictive value ( ppv ) , negative predictive value , and diagnostic accuracy . written informed consent was obtained from all the study subjects and approval for the study was obtained from the hospital ethical and research committee of the oauthc , ile - ife , osun state . \n this is a prospective cross - sectional study that was carried out at the radiology department of oauthc , ile - ife from june 2010 to may 2011 . \n the study subjects were made up of consecutive 150 patients aged 15 years and above who were referred to the radiology department of oauthc with symptoms and signs of acute abdomen of nontraumatic origin . \n they were sonographically evaluated with mindray ( usa inc ) real - time uss model dc-6 with doppler facilities , probes with frequencies of 3.5 , 5 , and 7.5 mhz with us acoustic gel . \n normal abdominal protocol for scanning the abdomen including fasted state and distended urinary bladder was skipped because of the acute presentation of the cases . however , for equivocal cases modifications like instilling normal saline via urethral catheter was used to distend the urinary bladder which served as an acoustic window for uss and helped to displace the bowel loops from the area of interest especially when scanning for pelvic organs such as the uterus , vagina , adnexae , prostate gland , and rectum . \n patients with right hypochondrial pain underwent a preliminary scan , when they could not comply with the fasting protocol which was later repeated during fasting to confirm the finding . \n in equivocal cases , they were requested to come back for a repeat scan as soon as they were stabilized . \n coupling gel was applied to the exposed abdomen from below the diaphragm to the symphysis pubis . \n most of the uss were performed by the first authors , and the scanning was done supine in both longitudinal and transverse planes . \n the longitudinal scan was done starting from the midline to the lateral margin , taking one side at time , and moving at about 1 cm intervals . \n a transverse scan of the area of interest was also done , moving from midline to the lateral margin also taking one side at time and moving at about 1 cm intervals . \n the inflammatory features identified were : tenderness , reduction or increased in the echo pattern if it is acute or chronic , respectively , increase in organ or tissue size . \n collections were identified by their anechoic and/or mixed density characteristics . vascular assessment with doppler uss \n such were taken thrice , and the average of the three measurements was taken in order to get the value as accurate as possible . \n the us findings were compared with surgical , medical and/or clinical findings where applicable . statistical package for social sciences ( spss ) for windows version 16.0 ( spss inc . ) \n was used to analyze the data using the appropriate descriptive and inferential statistical methods and displayed by means of varied statistical presentations . \n the degree of agreement of the various clinically related procedure tools in terms of a specific diagnosis was determined by the use of kappa statistics , which indicated the degree of agreement beyond chance . \n diagnostic performance markers were sensitivity , specificity , positive predictive value ( ppv ) , negative predictive value , and diagnostic accuracy . \n written informed consent was obtained from all the study subjects and approval for the study was obtained from the hospital ethical and research committee of the oauthc , ile - ife , osun state . \n the ages of the patients ranged from 15 years to 73 years , with a mean age of 32.5 13.8 years . \n the age range of 2029 years had the highest frequency of 51 ( 34.0% ) patients . \n this was followed by 3039 years which had a frequency of 35 ( 23.3% ) patients . \n the lowest frequency was found in ages 70 years and above which had a frequency of 3 ( 2.0% ) patients . \n the females had a frequency of 86 ( 57.3% ) patients while the males had 64 ( 42.7% ) patients [ table 1 ] . \n sex distribution by age the most common clinical indication for us in this study was appendicitis , with a total of 72 ( 48% ) patients . \n renal abscess and hepatitis were the least common cause of acute abdomen necessitating investigations by us . in between these were some other causes of nontraumatic acute abdomen , [ figure 1 ] . \n indications for ultrasound of nontraumatic cases following ultrasonographic evaluation of the patients , acute appendicitis had the highest us diagnosis of nontraumatic acute abdomen with a frequency of 66 ( 44% ) patients . \n the age ranges 2029 years had the highest frequency of acute appendicitis , followed by age range 1019 years , with the least frequency found in ages 70 and above . \n appendicitis was the most common among men ( 41 [ 64.1% ] ) [ table 2a and b ] . \n the ultrasonographic features of appendicitis which were later confirmed at surgery include probe tenderness , increased appendiceal wall thickness , decreased peristalsis , hyperechoic periappendiceal fat , fluid collections [ figure 2 ] , and appendicolith with characteristic target sign on transverse scan [ figure 3 ] . \n their respective frequency was 100% , 83.3% , 83.3% , 66.7% , 16.7% , and 13.9% [ figure 4 ] . \n age distribution by us diagnosis sex distribution by us diagnosis longitudinal sonogram showing periappendiceal fluid collection in a ruptured appendix transverse sonogram of an inflamed appendix with appendicolith showing a characteristic target sign frequency of ultrasound features of surgically diagnosed appendicitis the next common us findings of nontraumatic acute abdomen were an ectopic pregnancy which had a frequency of 34 ( 22% ) patients . \n the highest frequency of ectopic pregnancy was found among the age group 2029 years , followed by the age group 3039 years , the least incidence was found among the age group 1019 years . \n intestinal obstruction was the next common cause of nontraumatic acute abdomen with the highest frequency found among the age groups ( 1019 ) and ( 2029 ) years with the least incidence also noted among the age group 70 years and above . \n patients with no remarkable us findings had a frequency of 8 ( 5.3% ) patients of which 6 ( 75.0% ) were female . \n renal abscess had the least frequency of 1 ( 0.7% ) patient . in all , definitive surgical diagnosis was made in 124 ( 82.7% ) out of the 150 patients . \n outcome at surgery showed that appendicitis had the highest frequency with 72 ( 58.1% ) patients , out of which 12 ( 17.0% ) patients had a ruptured appendix . \n this was followed by ectopic pregnancy which had a frequency of 31 ( 25.0% ) patients and was also noted to most common on the right side ( 68.0% ) . \n the frequencies and percentages of other causes of acute abdomen in this study are shown in table 3a . \n of the 72 patients who had appendectomy , 40 ( 62.5% ) patients were males while 32 ( 37.2% ) patients were females [ table 3b ] . \n age distribution by surgical diagnosis sex distribution by surgical diagnosis the correlation of us findings with surgical findings in this study showed high us diagnostic performance markers in most of the cases of nontraumatic acute abdomen , except in perforated viscus where a moderate sensitivity was noted . \n all the disease entities showed good kappa agreement beyond chance , and they were all statistically significant ( p < 0.001 ) [ table 4 ] . \n correlation of us diagnosis with surgical findings it was also noted that the clinical findings correlate favorably well with us findings in most of the cases of nontraumatic acute abdomen except in perforated viscus where the sensitivity and ppv were low with a value of 33.3% and 40.0% , respectively . \n all the disease entity showed good kappa agreement beyond chance except in perforated viscus where it was noted to be fair . \n acute abdomen in an emergency setup has become one of the most important and routinely encountered emergencies with patients presenting with a variety of symptoms . \n the patterns of disease have been found to vary according to the sociodemographic factors ( sex and age ) , and in this study population the highest incidence of nontraumatic acute abdomen was found in patients within the age range of 2029 years ( 34% ) . \n this was noted to be in concordance with findings of earlier workers , where the highest incidence of acute abdomen was found within the age range of 2130 years ( 27.81% ) . \n however , a contrasting finding was noted in the studies conducted in the western world where the incidence was found to be the highest in the age 4560 years . \n no obvious reason(s ) can be adduced for this discrepancy , though geographical , racial , and dietary differences could probably be responsible . \n there were more females than males in this study , which is in disagreement with the studies done by prasad et al . , and memon et al . , where more males were found probably due to the few cases of gynecological emergencies and exclusion of gynecological emergencies noted , respectively , in their studies . \n this is consistent with findings from other studies carried out by memon et al . and pintado - garrido et al . \n there were more males than females who presented with acute appendicitis which is in concordance with the study done by memon et al . \n acute appendicitis was noted in this study to be common in 2029 years age groups and less common in the elderly age group of 70 years and above which is in agreement with what was noted in the study done by pintado - garrido et al . where it was frequently seen during the second and third decade of life and less frequently among the elderly . \n the sensitivity and specificity of ultrasonography in diagnosing acute appendicitis in this study were 83.3% and 100.0% , respectively . comparing this with a study done by prasad et al . \n , with sensitivity and specificity of 66.6% and 100% , the sensitivity of acute appendicitis was found to be very remarkable . \n however , in a study done by pintado - garrido et al . , the sensitivity and specificity ( 83.7% and 97.4% ) were almost similar to the values noted in this study . \n a contrasting diagnostic accuracy of diagnosing acute appendicitis was observed in the study done by garba and chom their diagnostic accuracy of acute appendicitis by us was 24.4% in contrast with 90.3% in this study . \n this could be attributed to observer error and possibly resolution of the us machine and probe . \n low resolution us machine , inappropriate probes of suitable frequencies , and poor clinical history to guide the operator particularly in cases of self - referral by patients were noted in their study . in this index study , however , most of the procedure were performed by the first author which help to reduce observer error . \n similarly , a high resolution us machine was utilized for the study . all together , these factors may be responsible for high diagnostic accuracy obtained in this study . \n ectopic pregnancies were noted to be commoner on the right side which is similar to the trend all over the world . this right - sided preponderance has been attributed to appendicitis . \n it has been found that chronic inflammatory response from appendicitis can cause adhesions in the right iliac fossa leading to susceptibility to ectopic pregnancy . \n the age range of 2029 years had the highest frequency of 16 ( 31.4% ) patients with ectopic pregnancy , which was in keeping with the findings in the study done by udigwe et al . where their peak age group was 2630 years and in the reproductive age groups . \n in this study , us had high sensitivity ( 100% ) , specificity ( 97.8% ) and was of high diagnostic accuracy in detecting ectopic pregnancy . \n valenzano et al . , gave a discordant findings to the findings of this index study . \n they reported low sensitivity of transabdominal ultrasonography for ectopic pregnancy and subsequently recommended transvaginal ultrasonography when ectopic pregnancy is suspected . \n intestinal obstruction was the third common cause of nontraumatic acute abdomen in this study diagnosed by us . \n of the thirteen patients sonographically diagnosed to have intestinal obstruction , 6 patients were confirmed by surgery while 4 were managed conservatively . \n the remaining 3 patients who had sonographic features of intestinal obstruction were confirmed at surgery to be cases of a ruptured appendix in two and one case of perforated posterior wall of the uterus , respectively . \n the sensitivity and specificity of us in detecting intestinal obstruction is high , 100% and 97.5% , respectively . in recent years \n , intestinal sonography has gained in acceptance for assessment bowel obstruction owing to technologically advanced equipment that improved resolution capability with good cross - sectional imaging of the gut wall and display of the transmural aspects of inflammation . \n in addition , the possibility of assessing intestinal morphology and motility during real - time us observation with no discomfort for the patient makes it a suitable diagnostic procedure in the case of an acute setting such as intestinal obstruction . \n similar to the findings of this study previous report had recorded high diagnostic accuracy for transabdominal ultrasonography in patients with intestinal obstruction . \n sonographic findings of acute cholecystitis in this study were in concordance with several other literature findings . \n however , a comparative study done by bree showed lower values of 93% , 53% and 68% respectively in the above - mentioned diagnostic markers . \n this was adduced to the inability of ultrasonography to differentiate between acute cholecystitis and the incidental finding of gallstones in patients with another cause of right hypochondrial pain . \n the us findings of cases of pelvic inflammatory disease ( pid ) are nonspecific as the appearance can be a differential diagnosis in some acute abdominal conditions like postabortal sepsis . \n other acute abdominal conditions such as ectopic pregnancy and perforated viscus can give similar sonographic findings of pid . \n in this study , pid was diagnosed based on the clinical details , sonographic findings , and subsequent response to management . \n the us findings of renal calculus documented in this study were similar to the previous report . \n us also helps to rule out other possible differentials such as abdominal aortic aneurysm or cholelithiasis which can be clinically mistaken for acute renal colic . in detecting renal calculi \n a comparative study done by malik and zakar showed a lower sensitivity and specificity , 80% and 98% , respectively , though no obvious reason could be adduced for these findings . \n the sonographic appearance of renal abscess seen as a cause of acute abdomen was a well - defined cortical cystic lesion with low level internal echoes although other sonographic features such as poorly defined , complex cystic mass , with internal echogenic fluid may also be present . \n the diagnosis of acute pyelonephritis is usually based on clinical and laboratory findings and imaging is primarily to detect complications \n except for the marked probe tenderness in the renal angle , the sonographic findings were normal . \n intraperitoneal free air in turn lead to scattering of the us waves at the interface of soft tissue and air which is accompanied by reverberation of the waves between the transducer and the air . \n this , typically , results in a high - amplitude linear echo ( increased echogenicity of a peritoneal stripe ) accompanied by posterior artifactual reverberation echoes with characteristic comet - tail appearance . \n maneuvers that can help improve us sensitivity in perforated viscus include positional change and the use of linear - array tranducers . despite the impressive findings recorded in this index study \n histopathology reports , as well as the follow - up data , were not recorded for any the patient . \n similarly , no ideal abdominal preparations were recommended to patient because of the acuteness of the clinical conditions . \n this was seen in some conditions where excessive intraluminal gas caused poor visibility of organs . marked probe tenderness over the diseased organ was a great challenge in compressing the surrounding bowel loops particularly in acute appendicitis . \n it was also noted that in obese patients , the appendix was poorly visualized due to the excessive intra - abdominal fat . \n nevertheless , this study showed the role of us in the management of nontraumatic acute abdomen in adult patients . \n the results found in this study have shown a relatively high sensitivity , specificity , and diagnostic accuracy of us in cases of nontraumatic acute abdomen . \n this study group of patients with nontraumatic acute abdomen requiring prompt diagnosis , ultrasonography is an outstanding imaging modality which has helped the managing physicians and surgeons in arriving at early diagnosis . \n it has also been shown in this study to have high sensitivity , specificity , and diagnostic accuracy . \n we recommend that ultrasonography should be the first investigation of choice for patients with nontraumatic acute abdomen .", "role": "user" }, { "content": "aim and objective : the purpose of this study was to determine the spectrum of disease on abdominal ultrasound ( us ) and the diagnostic efficacy of us in adult patients with nontraumatic acute abdomen at obafemi awolowo university teaching hospitals complex ( oauthc ) , ile-ife.materials and methods : the study population included consecutive 150 adult patients aged 15 years and above presenting with nontraumatic acute abdomen via the adult emergency unit or as inpatients referred to the radiology department of oauthc , ile - ife for abdominal us . \n mindray d.c-6 real - time us scanner with 3.5 , 5.0 , and 7.5 mhz probes and doppler facilities were used to assess the intra - abdominal organs and the findings were compared with the clinical and surgical findings in those cases that were operated.results:the common spectrum of diseases encountered on us in this study included appendicitis ( 66 [ 44% ] ) , ectopic pregnancy ( 34 [ 22% ] ) , intestinal obstruction ( 13 [ 8.7% ] ) while the least finding was renal abscess 1 ( 0.7% ) . \n the correlation of us findings with surgical findings in this study showed sensitivity , specificity , and kappa agreement for appendicitis of 83.3% , 100.0% , and 0.808 ; ectopic pregnancy of 100.0% , 97.8% , and 0.958 ; acute cholecystitis of 100.0% , 100.0% , and 1.0 . however , perforated viscus showed the least sensitivity ( 60.0% ) , specificity ( 99.2% ) , and kappa agreement 0.654 . \n all the disease entities showed good kappa agreement beyond chance , and they were all statistically significant ( p < 0.001).conclusions : this study has shown a relatively high sensitivity , specificity and diagnostic accuracy of us in cases of nontraumatic acute abdomen in a careful hand . \n we , therefore , recommended that these advantages of us should be capitalized upon in settings where other advanced diagnostic modalities are not available .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: between january 2011 and december 2014 , 13 cryptotia deformities in 10 patients were corrected using large z - plasty or trefoil flaps . \n nine patients were treated by large z - plasty and the remaining 4 via formation of trefoil flaps . \n selection of operative technique was based on the surgeon 's preference , with consideration of the extent of accompanying anomalies and the height of the hairline . \n the operation was performed under either general or local anesthesia , depending on patient age . \n cryptotia surgery using a z - plasty or trefoil flap followed the operative techniques of yotsuyanagi et al and adams et al . \n after elevating the flaps and exposing the posterior aspect of the scapha , the fibrous tissue and intrinsic transverse muscle causing contracture of the antihelix are dissected completely . when the antihelical cartilage is deformed , a 1.5 0.5-cm piece of ipsilateral conchal cartilage is harvested and fixed onto the superior portion of the cephaloauricular angle between the posterior aspect of the antihelical cartilage and periosteum of the mastoid bone to enhance projection of the helix ( fig . \n finally , the flaps are transposed and sutured . a 32-year - old man with oblique muscle - type cryptotia of the left ear . a , preoperative image . \n the superior portion of the helix was completely buried under the temporal skin and the inferior crus of the antihelix was acutely bent ( arrow ) . \n c , postoperative image taken 1 year later . the surgical outcomes in terms of creation of an auriculocephalic sulcus and provision of additional skin to cover once - embedded cartilage , and the incidence of complications , including recurrence , were compared according to the surgical technique and the addition of a cartilage wedge graft on the cephaloauricular angle . \n patient age ranged from 5 to 32 years and all were followed for at least 1 year . \n no patient developed any severe complication , including postoperative infection or necrosis of the skin flap ( table 1 ) . \n both large z - plasty and trefoil flap formation effectively provided the additional skin required to cover exposed cartilage and to create an auriculocephalic sulcus . \n one patient treated using a trefoil flap developed a dog - ear anomaly on the superior helix of the corrected ear ; this was corrected successfully by secondary surgery . \n one patient treated with a large z - plasty developed a hypertrophic scar and another patient treated using a trefoil flap grew hair on the transposed posterior auricular skin . to prevent recurrence and to maintain the sharply curved cephaloauricular angle \n , we added a conchal cartilage graft to the cephaloauricular sulcus in 8 of the 13 ears ( table 1 ) . \n none of the patients who received a conchal cartilage wedge graft developed recurrent blunting of the cephaloauricular angle . \n the cryptotia recurred in one of the 4 patients ( 5 ears ) who did not receive a conchal cartilage wedge graft on the cephaloauricular sulcus 6 months after treatment using a trefoil flap ( patient 3 ) . \n secondary surgery featuring a large z - plasty was successful without an added cartilage graft . \n a 32-year - old man presented with oblique muscle - type cryptotia of the left ear . \n the superior portion of the helix was completely buried under the temporal skin and the inferior crus of the antihelix was acutely bent ( fig . \n the patient underwent cryptotia correction via a large z - plasty under local anesthesia . to prevent cryptotia recurrence , \n 1c ) . a 25-year - old man presented with cryptotia of the transverse type . \n the upper portion of the auricle was buried beneath the skin , and the body and the superior crus of the antihelix were compressed together , causing underdevelopment of the helical cartilage ( fig . \n 2a ) . surgical correction using trefoil flap construction was performed as described above , under local anesthesia . \n after skin incision , a lop ear deformity was noted . the lid - like downturn of the helical cartilage was excised and sutured to the upper surface of the underdeveloped helical cartilage , to enhance the helical outline . \n a conchal cartilage graft was splinted to the auriculotemporal sulcus to prevent cryptotia recurrence ( fig . \n at the 6-month follow - up , the results were satisfactory , and an enhanced helical contour was evident ( fig . 2c ) . a 25-year - old man with a transverse muscle - type cryptotia of the left ear . a , preoperative image . the body and the superior crus of the antihelix were compressed together , causing underdevelopment of the helical cartilage . \n 3a ) . surgical correction with construction of trefoil flaps was performed without the addition of a conchal cartilage graft under general anesthesia . \n after 9 months , blunting of the auriculotemporal sulcus was observed in the left auricle and the superior portion of the helix was buried under the scar of the temporal skin ( fig . \n secondary surgery , using a large z - plasty to restore the auriculotemporal sulcus , was performed 1 year postoperatively . at the 9-month follow - up , satisfactory results were evident ; the deepening of the auriculotemporal sulci of both ears was maintained ( fig . \n 3c ) . a 5-year - old boy with bilateral cryptotia . a , preoperative image . \n the cryptotia was of the transverse muscle type in the left ear and of the oblique muscle type in the right ear . \n b , recurrent cryptotia in the left ear 9 months after first surgery featuring construction of a trefoil flap . blunting of \n the auriculotemporal sulcus was evident in the left auricle and the superior portion of the helix was buried under the scar of the temporal skin . \n a 32-year - old man presented with oblique muscle - type cryptotia of the left ear . \n the superior portion of the helix was completely buried under the temporal skin and the inferior crus of the antihelix was acutely bent ( fig . \n the patient underwent cryptotia correction via a large z - plasty under local anesthesia . to prevent cryptotia recurrence , \n the upper portion of the auricle was buried beneath the skin , and the body and the superior crus of the antihelix were compressed together , causing underdevelopment of the helical cartilage ( fig . \n surgical correction using trefoil flap construction was performed as described above , under local anesthesia . \n the lid - like downturn of the helical cartilage was excised and sutured to the upper surface of the underdeveloped helical cartilage , to enhance the helical outline . \n a conchal cartilage graft was splinted to the auriculotemporal sulcus to prevent cryptotia recurrence ( fig . \n at the 6-month follow - up , the results were satisfactory , and an enhanced helical contour was evident ( fig . 2c ) . a 25-year - old man with a transverse muscle - type cryptotia of the left ear . a , preoperative image . the body and the superior crus of the antihelix were compressed together , causing underdevelopment of the helical cartilage . \n 3a ) . surgical correction with construction of trefoil flaps was performed without the addition of a conchal cartilage graft under general anesthesia . \n after 9 months , blunting of the auriculotemporal sulcus was observed in the left auricle and the superior portion of the helix was buried under the scar of the temporal skin ( fig . \n secondary surgery , using a large z - plasty to restore the auriculotemporal sulcus , was performed 1 year postoperatively . at the 9-month follow - up , satisfactory results were evident ; \n the cryptotia was of the transverse muscle type in the left ear and of the oblique muscle type in the right ear . \n b , recurrent cryptotia in the left ear 9 months after first surgery featuring construction of a trefoil flap . blunting of the auriculotemporal sulcus was evident in the left auricle and the superior portion of the helix was buried under the scar of the temporal skin . \n the primary purpose of operations seeking to correct cryptotia is the elimination of a skin deficiency on the posterior auricular surface , using upper and posterior auricular skin . \n it is accepted that local flap construction is better than skin grafting , and many types of such flaps have been described . \n local flaps are cosmetically satisfactory , creating only minimal visible scarring , and are not associated with complications . \n a conspicuous scar , however , can develop when the flap is designed on the scalp or in the preauricular area . \n one advantage of the flap techniques used in this study is that the scar is invisible from both the anterior and lateral viewpoints . \n a large z - plasty can scar the posterior surface of the auricle , but most scarring after creation of trefoil flaps is hidden in the temporal skin . even in the patient who experienced recurrence , it was possible to render the scar invisible from the perspective of the anterior helix and preauricular regions . \n a trefoil flap is usually indicated in patients who do not need cartilage reconstruction because the risk of dehiscence is increased if extensive cartilage reconstruction is required . \n alternatively , wide operative exposure to correct the cartilage deformity is available with a large z - plasty . in the cases reviewed here , either operative technique yielded sufficient skin flap tissue to cover the posterior surface of the upper helical cartilage , and ensured the release of abnormal muscular and fibrous attachments . \n one limitation of the trefoil flap procedure is hair growth in the postauricular sulcus in patients with low hairlines . \n in addition , a dog ear developed in 1 patient was treated using construction of a trefoil flap . \n dog - ear formation , however , can occur with most techniques using local flaps . \n it was easily corrected with minor secondary surgery and the hair on the posterior auricular surface was not of cosmetic concern to the patient . \n early recurrence of cryptotia , attributable to deficient posterior skin coverage , is one of the major postoperative complications after cryptotia surgery . \n it is sometimes difficult to completely cover the posterior surface , especially if severe helical cartilage anomalies are evident . \n although the use of these local flaps was successful for covering the posterior surface of the helical cartilage , the skin tension might be increased during the release , which potentially increases the risk of recurrence . \n some authors have reported good results using isotonic saline injections during operations for 30 minutes and by pulling the ear 1 day before operation to lengthen and dissect the skin of the local flap because tissue expansion requires 2 separate surgical procedures . to prevent recurrence of the deformity \n , we reinforced the structural support for the helical projection with placement of a cartilage graft on the superior portion of the cephaloauricular angle , creating a wedging effect . in our series , \n no cryptotia recurred in any patient in whom a conchal cartilage graft was used as a wedge . \n it seems obvious that the addition of an appropriate surgical technique can prevent the reburial of the cartilage under the skin . \n only 1 patient who did not receive a wedge graft experienced cryptotia recurrence , and this was corrected successfully using a large z - plasty without addition of the cartilage graft , that is , another type of local flap . \n no skin graft was required and the scar visibility was minimal , even after secondary surgery . \n therefore , fixation of the conchal cartilage graft on the cephaloauricular angle can ensure the structural support of the antihelix for the helical projection without blunting of the sulcus . \n because the deformation of the helical cartilage is a secondary abnormality often associated with cryptotia , it should be corrected concomitantly with cryptotia surgery if the deformity of the upper auricular portion is obvious . to correct an antihelical cartilage deformation , some authors advocate placement of a cartilage graft on the posterior or superior aspect of the antihelix . \n hypoplastic helical cartilage deformities with accompanying lob ears were evident in 5 of 13 ears in this study . \n concomitant use of the cartilage wedge graft and strut graft on the antihelix , as described in previous studies , can be helpful in the correction of the associated cartilage anomalies . simultaneous construction of the auriculotemporal sulcus and correction of the cartilage deformity are recommended to prevent recurrence . \n postoperatively , some bolster external fixations along the anterior scapha and posterior antihelix for 1 or 2 weeks can be applied to form an adhesion between the flap and cartilage . \n the recurrence in our cases developed after 9 months ; therefore , periodic follow - up to 1 year postoperatively is recommended . \n only 13 cases were described using multiple techniques ; this study included patients treated with 2 different approaches for coverage , and some with and without cartilage grafts . \n our surgical outcome , however , could be considered effective because only 1 case of recurrent disease required a second surgery , which was successful . \n the success rates of the various surgical techniques for the correction of cryptotia should be investigated in further studies . \n a cartilage wedge graft onto the superior portion of the cephaloauricular angle to enhance projection of the helix is useful at preventing the recurrence of cryptotia . in addition , the combination of the graft with a local flap using a large z - plasty or trefoil flap formation efficiently corrects cryptotia , and is associated with minimal visible scarring and few complications , including recurrence .", "role": "user" }, { "content": "abstractcryptotia attributable to deficient posterior skin coverage frequently recurs . because local flaps cover only the posterior aspects of the defective upper auricular cartilage and lack functional support to resist collapse of the helix , especially if severe helical cartilage anomalies are present , additional support is required to prevent the postoperative recurrence of this anomaly . the authors present cases of cryptotia treated using local flaps including a z - plasty or formation of a trefoil flap with an additional cartilage wedge graft on the cephaloauricular sulcus to enhance projection of the helix . \n the combination of a graft with a local flap using a large z - plasty or trefoil flap efficiently corrects the cryptotia , and is associated with minimal visible scarring and few complications , including recurrence .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: systemic lupus erythematosus ( sle ) is the prototype of systemic autoimmune disorders , affecting virtually any organ system of mainly young women of child - bearing age , at an incidence ranging from 2 to 5 cases per 100,000 persons . \n it is characterized by remarkable heterogeneity in regard to the spectrum and severity of clinical and laboratory manifestations , with disease activity fluctuating considerably during the course of the disease . \n while genetic susceptibility along with environmental interactions contributes significantly to the immune dysregulation that characterizes sle , the exact etiopathogenesis remains elusive . in the late 1970s , \n increased serum levels of interferon ( ifn ) were shown for the first time to be significantly associated with sle and to correlate with disease activity . \n later reports showing that chronic treatment with recombinant ifn in patients affected with malignancies induces autoimmune manifestations coupled by subsequent studies documenting heightened serum levels of type i ifn and type i ifn - inducible genes in patients with sle reinforced the hypothesis that type i ifn has a major role in the pathogenesis of sle . \n although the exact triggers of type i ifn activation in sle are unknown , exogenous viral agents or endogenous nucleic acids seem to be potential candidates through sensing of pattern recognition membrane and cytosolic receptors of specialized ifn-producing cells such as plasmacytoid dendritic cells ( pdcs ) , while genetic contributors in generation of type i ifn in sle have been also implicated . \n of note , recent data have shown that mature neutrophils from lupus patients undergo apoptosis upon exposure to sle - derived anti - ribonucleoprotein antibodies releasing neutrophil extracellular traps ( nets ) that contain dna and neutrophil - derived proteins . \n the sle nets efficiently activate the pdcs to produce type i ifns , thus , acting as an endogenous stimulus for the type i ifn pathway [ 6 , 7 ] . in the current paper , \n our aim is to summarize the latest findings previously shown to support the association of type i ifn pathway with specific clinical manifestations of sle particularly those characterized by renal , skin , neurological involvement , as well as concomitant atherosclerosis providing insights on the potential use of type i ifn as a biomarker and/or therapeutic target in these patients . to the best of our knowledge , \n no data to date support the association of type i ifn activation with other lupus - related manifestations such as serositis or arthritis . \n lupus nephritis and the progression to end - stage renal disease represent one of the major causes of morbidity and mortality in sle patients . \n almost half of the patients with sle present with clinical lupus nephritis , and up to 90% of patients have some degree of histological renal damage . \n different interacting pathogenetic mechanisms such as immune complex deposition , renal infiltration by t cells , macrophages , and dendritic cells , activation of toll - like receptors ( tlrs ) , and a variety of cytokines as well as end - organ responses to immune injury contribute to the pathogenesis of lupus nephritis . despite data deriving both from murine lupus models and patients with sle supporting a pathogenetic role for type ii ifn ( ifn ) , \n there is ever increasing evidence indicating type i ifns as one of the major players in the pathogenesis of lupus nephritis . in 1979 , hooks et al . \n noticed for the first time a significant association of type i ifn serum levels with active lupus . \n two years later , rich reported that typical lupus inclusions ( detected in the glomerular endothelium in almost all lupus patients and in the peripheral blood lymphocytes of more than two - thirds ) were induced by type i ifn in the raji cells , a human b - lymphoblastoid cell line of burkitts lymphoma origin . \n since then , several studies in patients with sle have demonstrated a significant association between both type i ifn serum levels and ifn - induced gene expression in peripheral blood mononuclear cells ( pbmcs)the so - called interferon signature[2 , 814 ] with disease activity and other disease - related features including lupus nephritis ( table 1 ) . \n it should be noted that the largest so far study performed by weckerle et al . , which included 1089 patients from 3 different ancestral backgrounds , showed a strong association between certain autoantibodies and high ifn activity but failed to detect significant association with clinical features of the disease . \n in addition to the aforementioned studies associating type i ifn and clinical and serological features of sle , cdna microarray analysis of gene expression in glomeruli , isolated by laser - capture microscopy from kidney biopsies of lupus patients with focal / diffuse proliferative glomerulonephritis , revealed increased expression of type i ifn - inducible genes , thus , implying a possible pathogenetic role for type i ifn in these patients . \n glomerular expression of tlr-9 , an endosomal sensor of cpg dna leading to type i ifn production , was reported in patients with lupus nephritis but not in healthy controls and was associated with anti - dsdna and higher activity index of lupus nephritis . \n moreover , recent genetic association studies have identified many lupus - associated genetic variants in genes encoding transcription factors and various molecular components involved in the type i ifn pathway [ 1937 ] . \n studies investigating a possible association between genotype and phenotype in lupus patients have brought to light conflicting results regarding the association with lupus nephritis . a case - control study by taylor et al . in a large cohort of north \n american patients of european descent showed a significant association between the single nucleotide polymorphism ( snp ) rs7574865 of the stat4 gene and lupus nephritis , anti - dsdna and early disease onset . \n accordingly , snps of the stat4 gene was associated with lupus nephritis and anti - dsdna in a cohort of 695 swedish patients . \n similar results , although not statistically significant probably due to small sample size , were reported in a japanese study for the snp rs7574865 of stat4 gene . in contrast , the same snp of stat4 was not associated with any specific clinical manifestation of lupus in a northern han chinese case - control study . \n this may be attributed to differences in immune pathways influenced by this polymorphism among different populations . \n an alternative explanation could derive from the fact that rs7574865 with nearby snps can form different haplotype blocks each one conferring a distinct risk for sle and for specific sle manifestations . \n therefore , the diverse effect of this risk snp in sle subphenotypes could be explained by the presence of distinct risk haplotypes among different ethnic groups . in the same study , \n 2 more snps , rs4963128 and rs2246614 of the interferon - regulatory factor 7 ( irf7 ) gene , were tested for association with sle . \n in contrast to what was observed in a european women cohort , no association with increased susceptibility for sle in northern han chinese was reported . however \n , these 2 snps were associated with different subphenotypes of sle . in particular , the rs4963128 was associated with the production of anti - ssa / b antibodies and lupus nephritis . \n the authors suggest that particular variants of the irf7/kiaa1542 region may induce the generation of certain autoantibodies . \n a recent small study of 190 chinese patients with lupus nephritis reported a significant association of the rs2004640 polymorphism of the interferon - regulatory factor 5 ( irf5 ) gene with lupus nephritis but showed no association with any specific histological or clinical manifestation of lupus kidney disease . \n however , a swedish study , consisting of 272 sle patients , investigating several snps related to irf5 ( including the rs2004640 polymorphism tested in the aforementioned chinese study ) , as well as risk snps of stat4 and tnf receptor - associated factor-1 complement component-5 ( traf1-c5 ) demonstrated no association with lupus nephritis . \n however , it should be noted that this was a study primarily investigating a possible overlap in genetic susceptibility between iga nephropathy and lupus nephritis . \n moreover , the small sample size of this study does not offer sufficiently powered results to contradict the positive association between risk alleles in stat4 gene and lupus nephritis demonstrated in other studies . taken together , the data provided by genetic studies further support the association of the type i ifn pathway with sle susceptibility and possibly with lupus nephritis at least in some ethnic groups ( table 2 ) . \n this association between type i ifn and lupus nephritis in humans , which per se does not define a direct cause - effect relationship , has been put to test in many experimental murine lupus models in order to clarify the pathogenetic role of type i ifn in lupus renal disease . \n studies in autoimmune prone mice that were treated with polyinosinic : polycytidylic acid ( poly i : c ) , a synthetic double - stranded rna ligand for tlr-3 that strongly induces type i ifn response , showed higher titers of anti - dsdna antibodies , increased immune complex deposition , accumulation of activated lymphocytes and macrophages , and increased metalloproteinase activity that led to accelerated lupus nephritis and death [ 4345 ] . \n similar results supporting the pathogenetic effect of type i ifn in lupus glomerulonephritis were obtained from murine models injected with adenovirus expressing ifn that leads to sustained release of that cytokine [ 4549 ] . \n moreover , recent studies in healthy ( not lupus - prone ) mice treated with 2,6,10,14-tetramethylpentadecane ( pristane ) , an inducer of type i ifn through tlr-7 signaling , resulted in lupus - like nephritis , possibly through recruitment of inflammatory cells by type i ifn - inducible chemokines . \n interestingly , different strains of mice under the effect of pristane develop histological lesions of diverse severity probably due to yet unknown genetic factors . \n these data demonstrate that increased levels of type i ifn are able to induce lupus nephritis both in lupus - prone and healthy mice . \n additional evidence supporting the pivotal role of type i ifn in lupus glomerulonephritis derives from studies in new zealand black ( nzb ) , new zealand , mixed 2328 as well as pristane - treated mice deficient of the receptor of type i ifn ( ifnar ) . \n the defective signaling through ifnar in ifnar mice conferred protection from kidney disease and was associated with a decrease in the titers of lupus - specific autoantibodies and disease severity . in these models , a decrease in the proliferation and activation of dendritic cells as well as b and t cells was documented [ 5153 ] . \n however , one study conducted in congenic mrl / lpr mice , a lupus - prone model that develops severe crescentic glomerulonephritis , reported that ifnar deficiency caused a significant deterioration of renal disease . \n in contrast , deficiency of the type ii ifn ( ifn ) receptor had beneficial effects on kidney disease , thus , suggesting a protective role for type i ifn pathway at least in this mouse model . \n the role of tlrs and especially of tlr-7 , responsive to ssrna , and tlr-9 , responsive to hypomethylated cpg - rich dna , in type i ifn production in lupus is well established . \n studies in mice that overexpress tlr-7 ( y - linked autoimmune accelerating locus mice yaa mice ) or that were treated with pristane demonstrate the importance of type i ifn and tlr-7 signaling in accelerating and aggravating kidney injury [ 5557 ] . \n using the pristane - induced mouse model of sle showed that upregulation of tlr-7 receptors in b cells and effective activation through tlr-7 and tlr-9 of b cells to produce lupus - specific autoantibodies require an intact type i ifn signaling pathway , thus , suggesting that type i ifn is upstream of tlr signaling in the activation of autoreactive b cells in sle . moreover , activation of tlr-9 signaling pathway through cpg - rich dna was shown to induce severe lupus nephritis in lupus - prone mice . \n additional confirmation was obtained from a study that tested a dual inhibitor of tlr-7 and tlr-9 ( known to inhibit ifn production by pdcs ) in lupus - prone mice . a significant improvement of proteinuria , glomerulonephritis , and survival as well as a reduction of serum levels of nucleic acid - specific autoantibodies was observed . \n further evidence emphasizing the central role of type i ifn in lupus nephritis came from studies investigating the cellular source of type i ifn in lupus nephritis . \n pdcs are well known to be the main type i ifn - producing cells and potentially responsible for the systemic increase of type i ifn levels . \n tucci et al . showed that peripheral pdcs were decreased in sle patients and that this was associated with lupus nephritis . \n moreover , this study demonstrated the presence of pdcs in the glomeruli of patients with severe lupus nephritis . \n interestingly , other studies suggest that immature monocytes recruited in the kidneys [ 62 , 63 ] as well as resident renal cells represent the main source of type i ifn in the kidney , thus , promoting end - organ disease in murine lupus nephritis models . \n finally a recent study by ichii et al . showed that overexpression of the ifn - activated gene 202 ( ifi202 ) positively correlated with the progression of lupus nephritis in the b6.mrlc1 ( 82100 ) mice . \n ifi202 is an ifn - stimulated gene localized on the murine chromosome 1 , and its overexpression in the kidneys and in the immune organs was confirmed in many lupus - prone mouse models such as bxsb , nzb / wf1 and mrl / lpr . \n this further supports the role of this ifn - stimulated gene in the pathogenesis of lupus nephritis and lupus susceptibility in general . \n taken together , these data highlight the importance of the ifn system in lupus nephritis creating exciting new prospectives both at diagnostic and clinical levels . \n interferon - induced chemokines , like macrophage chemoattractant protein 1 ( mcp-1 ) and others , seem to be highly sensitive biomarkers in the assessment of current disease activity and in the early detection of lupus nephritis flare [ 66 , 67 ] . \n moreover , inhibition of mcp-1 in a murine model of lupus nephritis showed significant amelioration of disease symptoms suggesting a new therapeutic approach to lupus kidney disease . \n zagury et al . successfully used an ifn immunogen ( termed ifn kinoid ) in mice with nephritis that transiently induces anti - ifn antibodies resulting in net improvement of lupus nephritis . \n on the other hand , mrl - fas mice treated with ifn showed a significant amelioration of lupus nephritis in these mice suggesting that ifn exerts a local ( rather than systemic ) anti - inflammatory effect . additionally , phase i human clinical trials using anti - ifn monoclonal antibody in patients with mild to moderate sle showed promising results including suppression of type i ifn - inducible genes overexpression in whole blood and skin lesions , profound effects on signaling pathways such as baff , tnf , il-1 and consistent trends toward improvement in disease activity , reduced number of flares , and decreased requirement for new or increased immunosuppressive treatments . \n preliminary data regarding the safety profile especially viral infections and major adverse events support further clinical development [ 7173 ] . however , more data regarding the efficacy and safety of this treatment are awaited . \n cutaneous lupus erythematosus ( cle ) is one of the most common autoimmune - associated skin diseases worldwide . in most cases \n , the disease is localized and limited to the skin area , without multisystemic involvement characteristic of sle . \n while approximately 10%40% of cle depending on the clinical subset of cle may transit to systemic disease , skin lesions in the setting of sle can occur in up to 70% of patients during the disease course [ 74 , 75 ] . while the pathogenesis of the cle remains still unclear , a number of contributors among them \n lupus - like skin lesions have been previously reported at the site of injection of recombinant ifn and ifn in patients with malignancy and multiple sclerosis respectively , while patients with generalized cle features often experience flu - like symptoms [ 76 , 77 ] . in patients with lupus , upregulation of the ifn - inducible antiviral protein myxovirus \n , a finding which has been later confirmed in discoid ( dle ) , subacute cutaneous ( scle ) , as well as other lupus - associated rashes [ 74 , 79 , 80 ] . of interest , \n mxa expression was mainly seen in the epidermis and the upper dermis in dle and scle , while , in rarer cases of lupus tumidus and lupus profundus , mxa was mainly detected in perivascular and subcutaneous areas , respectively , reflecting the distribution of the inflammatory infiltrate in different subsets of cle . \n intracellular ifn itself has been detected at mrna and protein level in all lesional and more than half of not involved skin specimens from 11 lupus patients compared to only one out of 11 healthy controls . \n the overexpression of ifn - related genes in nonpathological skin might be the result of genetically determined ifn pathway activation in these patients . despite the enhanced expression of the ifn-inducible irf7 gene in cle lesions reported by meller et al . \n ifn mrna expression has been reported not significantly different in cle skin compared to normal skin . \n subsequent studies detected the accumulation of pdcs the classical ifn producing cells in lesional skin from patients with dle , sle , and lupus tumidus , providing an explanation for the previously reported reduced pdc numbers in lupus patients [ 79 , 8285 ] . \n two pdc subsets have been identified according to their distribution pattern in cle skin biopsies : a dermal pdcs subset ( d - pdc ) surrounding dermal vessels associated with th1 responses and a second subset at the dermoepidermal junction zone ( j - pdc ) in association with cytotoxic t lymphocytes and subsequent local epithelial damage . in the same study , a positive association was found between the pdc numbers and the density of the infiltrate , suggesting that ifn production could regulate the degree of inflammation in the affected skin areas . \n of note , a higher density infiltrate has been shown in dle compared to sle patients . as a result of \n the locally produced ifn , recruitment of lymphocytes in the cle lesion occurs through the production of ifn- and -inducible chemokines cxcl9 , cxcl10 , cxcl1 , which share a common lymphocytic cxcr3 receptor . compared to ifn \n , ifn has been shown to induce earlier production of these chemokines by keratinocytes , dermal endothelial cells , and dermal fibroblasts , ensuring a first wave of cxcr3 + lymphocytic migration at the site of the cle lesion . \n these findings provide an explanation for the peripherally decreased number of cxcr3+lymphocytes in these patients . \n serum type i ifn activity or expression of ifn - inducible genes in pmbcs from lupus patients was found to be associated with the presence of lupus - associated rashes in some but not all studies so far performed . of interest , \n a positive trend between a history of photosensitivity and type i ifn - induced gene expression has been reported by kirou et al . \n [ 913 ] . while the initial trigger for pdc activation in cle remains elusive , observations of cutaneous lupus flares after sun exposure coupled with experimental evidence suggests uv irradiation as a central player in initiation of the lupus - associated skin injury . \n uv irradiation has been shown to exaggerate the already enhanced apoptosis of keratinocytes in cle leading to generation of rna and dna fragments with subsequent secondary necrosis , production of a variety of ifn-induced chemokines which in turn lead to lymphocytic recruitment and subsequent local inflammatory tissue injury [ 82 , 87 ] . \n in accord with the proposed mechanism , inhibitors of tlr7 and tlr9 signaling in a lupus - prone murine model of interface dermatitis attenuated the skin lesions . \n moreover , a recently identified ifn- and -induced protein the gtpase human guanylate binding protein-1 ( gbp-1)is expressed by keratinocytes and endothelial cells in primary and ultraviolet- ( uv- ) induced skin lesions from patients with various subtypes of cle compared to nonlesional skin . \n it has also been recently demonstrated that the ifn-inducible ifi16 protein normally localized in the nucleus translocates in the cytoplasm of affected skin cells from lupus patients and in uv irradiated keratinocytes leading to generation of antibodies against the ifn-inducible ifi16 recently detected in sera of lupus patients . \n neuropsychiatric systemic lupus erythematosus ( npsle)among the most severe manifestations of sle includes a variety of manifestations involving central , peripheral , and autonomic nervous system as well as psychiatric disorders after other underlying causes have been carefully excluded . \n the prevalence of neuropsychiatric manifestations in the setting of sle varies at a range approximately between 15% and 75% , depending of the ascertainment method used . \n several mechanisms have been so far implicated in the etiopathogenesis of npsle , including antibody - mediated vascular and parenchymal brain injury , concomitant atherosclerotic disease , or the effect of various inflammatory cytokines , including among others interleukin 1 ( il1 ) , tumor necrosis factor ( tnf ) , ifn , and ifn. these cytokines have been shown to induce peripheral depletion of tryptophan previously implicated in the pathogenesis of depression through stimulation of the enzyme indoleamine 2,3-dioxygenase . \n ifn has been also shown to induce the ifn-inducible protein 10 ( ip-10 ) and interleukin-6 ( il6 ) previously implicated in pathogenesis of cns abnormalities . \n induction of sle - like syndromes and neuropsychiatric manifestations have been reported after therapeutic use of ifn approximately in one - third of patients mainly with hepatitis c or certain malignancies giving potential insights of type i ifn implication in lupus - related clinical syndromes [ 9496 ] . while depression seems to be among the most common ifn-related neuropsychiatric side effects and a main contraindication for ifn administration , psychotic features , confusion , bipolar disorders , and seizures can also occur . \n ifn production by astrocytes in transgenic mouse models revealed structural and functional abnormalities ranging from seizures and severe behavioral disorders with high mortality to more subtle learning disabilities depending on high or low intrathecal levels of ifn , respectively . \n notably , calcium and phosphorus deposition in the brain in this experimental model resembled the mineral deposition observed in basal ganglia from patients with the aicardi - goutieres syndrome , an early - onset encephalopathy with elevated csf ifn levels . \n the aicardi - goutieres syndrome is an autosomal recessive disease related to mutations in 5 genes , including among others the 3-repair dna exonuclease 1 ( trex1 ) , recently associated with lupus . the first evidence of type i ifn implication in npsle pathogenesis comes from an early small study in the 1980s , in which elevated csf levels of ifn were detected in 2 out of 15 patients with sle and cns involvement but not in 20 non - npsle individuals . \n both of these patients suffered from psychosis and were characterized by the presence of csf oligoclonal igg . in accord with the above findings , \n elevated ifn levels have been subsequently detected in csfs of five out of 6 lupus patients with psychosis but with no other np manifestations . in the brain autopsy of one of the study participants who died from generalized seizures , the presence of ifn in neurons and \n measured by immunoassay were detected in approximately one - fifth of csfs of both 28 npsle and 14 non - npsle patients , suggesting a limited diagnostic role for ifn in clinical grounds . while no significant differences have been observed in serum levels of interferogenic activity \n measured by bioassay between sle patients with and without neuropsychiatric involvement , csf interferogenic activity has been found to be elevated in npsle patients compared to controls with other autoimmune disorders and cns features . of note , \n remarkably lower levels of interferogenic activity have been observed in sera compared to csfs of npsle patients . \n this was partially attributed to an inhibitory effect of serum igg , providing a potential explanation for the success of intravenous immunoglobulin ( ivig ) treatment in some cases of npsle and other neurological diseases [ 103 , 104 ] . in a recent study , involving 59 npsle patients , it was observed an association between acute flares of np manifestations and elevated ifn activity in the csf . \n the csf interferogenic activity seems to result from pdc stimulation by csf - containing immunocomplexes formed by autoantibodies and antigens released by neurocytotoxic abs or other injured brain cells . \n while pdcs have not been studied in the npsle patients brain cells , elevated number of pdc cells has been isolated from the csf of other neuroinflammatory diseases . in regard \n to peripherally detected type i ifn activity in nsple , in a cohort of 48 sle patients reported by feng et al . , significantly higher ifn - inducible gene expression in peripheral mononuclear cells has been demonstrated in 9 patients , who ever suffered from psychosis or seizures , compared to those without those manifestations . \n such an association was not , however , observed in a larger cohort of 77 sle patients by kirou et al . \n moreover , in a recent cross - sectional study including 58 sle patients , no correlation between depression scores and type i ifn - induced gene expression in pbmc has been detected . taken together , these data imply a potential involvement of type i ifn system in pathogenesis of lupus - related cns features . \n prospective studies with larger number of patients and careful collection of clinical , serological , and imaging data are required to further understand its contribution in pathogenesis of nsple . \n extensive epidemiological studies in sle patients demonstrate a bimodal distribution in mortality rates with the earlier peak attributed to infections and complications from kidney disease and/or neuropsychiatric lupus and a later peak mainly linked to atherosclerotic cardiovascular ( cv ) events . \n a population - based case - control analysis , using general practice database data , found a relative cv disease risk of 2 for women with sle [ 108 , 109 ] . \n strikingly , a fifty - fold increased risk of myocardial infarction was reported among premenopausal women with sle . \n while several traditional risk factors for atherosclerosis are more prevalent among sle patients , they can not fully explain their increased cv burden . \n additionally , the effect on cv risk of sle is more pronounced comparing to the impact of other inflammatory diseases like rheumatoid arthritis . \n these observations support the hypothesis that accelerated atherosclerosis and premature cv disease are significantly enhanced by factors inherent to the pathogenesis of sle . among these , increasing evidence designates type i ifn as a major player in promoting both the pathogenesis of sle and atherosclerosis ( figure 1 ) . \n it is widely believed that atherosclerosis results from chronic endothelial injury paired with a defective vascular repair mechanism leading to invasion of inflammatory cells , lipid deposition , vascular smooth muscle proliferation , and neointima formation . \n several studies suggest that circulating myeloid - derived endothelial progenitor cells ( epcs ) and myelomonocytic circulating angiogenic cells ( cacs ) are the key players in the vascular repair mechanism [ 112 , 113 ] . \n interestingly , reduced number and/or functional abnormalities of epcs / cacs have been documented in patients with sle [ 114118 ] . moreover , heightened type i ifn levels were associated with epcs depletion and endothelial dysfunction in sle patients possibly through ifn-mediated apoptosis of epcs / cacs and induction of differentiation of myeloid cells to nonangiogenic phenotypes . neutralizing the type i ifn pathway redressed the abnormal epc / cac phenotype [ 119 , 120 ] . in accord with the human studies , in a lupus - prone murine model , elevated levels of type \n i ifn led to reduced number and epcs dysfunction . moreover , the presence of ifn inhibited epcs from nonlupus - prone mice to differentiate into mature endothelial cells . \n showed that ifn represses the transcription of the proangiogenic factors il1 and and vascular endothelial growth factor a ( vegf ) and upregulates the antiangiogenic il1 receptor antagonist . in vivo confirmation of this antiangiogenic pathway of ifn interfering with il1 pathways \n furthermore , studies investigating the cellular source of type i ifn add supporting evidence to the effects of type i ifn in vascular injury . \n pdcs have been implicated in the pathogenesis of atherosclerosis and in particular in the destabilization of the atherosclerotic plaque which leads to acute vascular events through upregulation of tnf - related apoptosis - inducing ligand ( trail ) on cd4 + t cells which enhance them to kill plaque - resident cells , thus , rendering the plaque vulnerable . \n however , depletion of pdcs does not reverse the abnormal epc / cac phenotype in vitro . \n a recently studied subset of proinflammatory neutrophils , termed low - density granulocytes ( ldg ) , was identified in the blood of sle patients . \n ldgs exert cytotoxic effects on the endothelium and produce sufficient type i ifn to prevent epcs from differentiating into mature endothelial cells . \n depletion of ldgs restores the functional capacity of the epcs / cacs in vitro , therefore , supporting a role of these abnormal cells and of type i ifn in the pathogenesis of vascular damage in sle . \n interestingly a recent study investigating the immunomodulatory effects of statins in sle demonstrated that simvastatin and pitavastatin significantly inhibit type i ifn production both from pdcs isolated from lupus patients and from healthy pdcs treated with sera from sle patients . the inhibitory effect on type i ifn production was shown to be attributable to inactivation of rho kinases ( a family of downstream kinases of the tlr pathway ) that results in inhibition of the p38 mapk and akt as well as prevention of irf7 nuclear translocation . \n these findings imply that statins exert a beneficial effect in the atherosclerotic process not only due to its lipid - lowering properties but also through inhibition of the type i ifn production . \n it also provides a rationale for a potential therapeutic use of statins in ifn - mediated autoimmune diseases such as sle . \n an additional pathway by which type i ifn may be implicated in cv disease is through platelet activation . in a recent study , \n demonstrated that , in patients with lupus , platelets are activated and overexpress type i ifn - regulated proteins comparing to platelets from healthy controls . given that the same platelet phenotype has been observed in patients with a history of vascular disease , they hypothesized that type i ifn - induced platelet activation could be implicated in the development of vascular disease in sle . further supporting evidence for the role of type i ifn in atherosclerosis and especially in the formation of foam cells came from a study by li et al . . \n foam cells derive from infiltrating monocytes in the subintima where they differentiate into macrophages . upon exposure to oxidized - ldl ( ox - ldl ) , macrophages expressing scavenger receptors ( sr ) internalize cholesteryl ester from ox - ldl and \n are transformed into foam cells which represent the primary components of the early atherosclerotic lesion . in this study , \n ifn priming induced upregulation of sr in the macrophages and increased foam - cell formation . furthermore , \n peripheral blood mononuclear cells from patients with sle overexpressed sr which was positively correlated with increased type i ifn activity . finally , a recent swedish study showed that sle patients with the risk allele rs10181656(g ) in the stat4 gene had a significantly increased risk of ischemic cerebrovascular disease ( icvd ) , comparable in magnitude to that of hypertension . \n moreover , this snp was associated with the presence of two or more antiphospholid antibodies ( apls ) . \n this study indicates that a genetic predisposition involving the type i ifn pathway is an important and previously unrecognised risk factor for icvd in sle and that apls may be one underlying mechanism . \n these data indicate that premature atherosclerosis in sle patients can at least partially be attributed to increased activation of the type i ifn system . \n current attempts to block the type i ifn activity in sle patients may provide therapeutic approaches that achieve successful overall disease activity control and reduce the fatal vascular events that afflict these patients . \n over the past years , the role of type i interferon system in generation of distinct lupus - related clinical phenotypes arising from skin , renal , and cns involvement has been increasingly appreciated . moreover \n , growing evidence suggests the implication of type i ifn pathway in the pathogenesis of atherosclerosis , a frequent comorbidity in these patients , often not fully explained by the presence of co - existing traditional cv risk factors . \n careful characterization of clinical features associated with heightened ifn levels would further increase our insight into lupus pathogenesis allowing the potential use of type i interferon as a therapeutic target for lupus patients characterized by specific clinical and/or serological phenotypes .", "role": "user" }, { "content": "growing evidence over the last few years suggests a central role of type i ifn pathway in the pathogenesis of systemic autoimmune disorders . \n data from clinical and genetic studies in patients with systemic lupus erythematosus ( sle ) and lupus - prone mouse models , indicates that the type i interferon system may play a pivotal role in the pathogenesis of several lupus and associated clinical features , such as nephritis , neuropsychiatric and cutaneous lupus , premature atherosclerosis as well as lupus - specific autoantibodies particularly against ribonucleoproteins . in the current paper , \n our aim is to summarize the latest findings supporting the association of type i ifn pathway with specific clinical manifestations in the setting of sle providing insights on the potential use of type i ifn as a therapeutic target .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: ludwig 's angina was coined after the german physician , wilhelm friedrich von ludwig who first described this condition in 1836 as a rapidly and frequently fatal progressive gangrenous cellulitis and edema of the soft tissues of the neck and floor of the mouth . with progressive swelling of the soft tissues and elevation and posterior displacement of the tongue , the most life - threatening complication of ludwig 's angina is airway obstruction . \n as a result of antibiotic therapy , along with improved imaging modalities and surgical techniques , mortality currently averages approximately 8% . in ludwig 's angina , the submandibular space is the primary site of infection . \n this space is subdivided by the mylohyoid muscle into the sublingual space superiorly and the submaxillary space inferiorly . \n the majority of cases of ludwig 's angina are odontogenic in etiology , primarily resulting from infections of the second and third molars . \n the roots of these teeth penetrate the mylohyoid ridge such that any abscess , or dental infection , has direct access to the submaxillary space . \n infection can also spread contiguously to involve the pharyngomaxillary and retropharyngeal spaces , thereby encircling the airway . \n other causes include peritonsillar or parapharangeal abscesses , mandibular fractures , oral lacerations / piercing or submandibular sialadenitis , and oral malignancy . \n predisposing factors include dental caries , recent dental treatment , systemic illness such as diabetes mellitus , malnutrition , alcoholism , compromised immune system such as aids and organ transplantation.[69 ] without a treatment , it is frequently fatal from the risk of asphyxia with a mortality rate of 50% . \n the aggressive surgical intervention , the antibiotic introduction , and the improvement of dental care have determined a significant reduction of the mortality rate to less than 10% . \n a 25-year - old gentleman reported to the department of oral and maxillofacial surgery with a chief complaint of inability to open the mouth , pain , and swelling in relation to the lower jaw and neck since a day . on physical examination , he had respiratory distress and was toxic in appearance and his vital signs were monitored immediately . his temperature was 101.8f with a pulse rate of 106 beats per minute , blood pressure of 140/90 mmhg , and a respiratory rate of 25 breaths per minute . \n mouth opening was limited to 1.5 cm ( interincisal distance ) and revealed grossly decayed lower right second molar tooth with drainage of pus . \n extra - oral swelling was indurated , nonfluctuant with bilateral involvement of the submandibular and sublingual glands [ figure 1 ] . \n an immediate diagnosis of ludwig 's angina was made , and the patient was posted for surgical decompression under general anesthesia . \n however , elective tracheostomy was planned for airway maintenance with the help of an otolaryngologist . \n elective tracheostomy was done under local anesthesia , airway secured and general anesthesia was provided . \n separate stab incisions was made in relation to the submandibular space bilaterally and submental space . \n a sinus forceps was introduced to open up the tissue spaces and pus was drained . \n the wound was irrigated with normal saline , and a separate tube drain was placed and secured to the skin with silk sutures [ figure 2 ] . \n intravenous administration of cefotaxime 1 g bd , gentamycin 80 mg bd , metrogyl 500 mg , tid were given for 5 days with a tapering dose of decadran 84 mg bd for first two postoperative days . \n postoperative irrigation was done through the drain which was removed after 36 h along with the infected tooth . \n tracheostomy tube care was taken in the postoperative period , and the skin was strapped on the fifth postoperative day after the removal of the tracheostomy tube . \n preoperative appearance with bilateral involvement of the submandibular , sublingual , and the submental spaces showing brawny induration of the swelling postoperative view showing the tube drains and tracheostomy tube in place \n ludwig 's angina and deep neck infections are dangerous because of their normal tendency to cause edema , distortion , and obstruction of airway and may arise as a consequence of airway management mishaps . in the early stages of the disease , patients may be managed with observation and intravenous antibiotics . \n this is complicated by pain , trismus , airway edema , and tongue displacement creating a compromised airway . \n -hemolytic streptococcus associated with anaerobic germs such as peptostreptococcus and pigmented bacteroides have been described as causative agents . \n streptococcus viridans ( 40.9% ) , staphylococcus aureus ( 27.3% ) , and staphylococcus epidermis ( 22.7% ) were isolated from deep neck infections . \n intravenous penicillin g , clindamycin or metronidazole are the antibiotics recommended for use prior to obtaining culture and antibiogram results . \n recent case reports advocated the use of intravenous steroids which potentially avoided the need for airway management . if patients present with swelling , pain , elevation of the tongue , malaise , fever , neck swelling , and dysphagia , the submandibular area can be indurated , sometimes with palpable crepitus . inability to swallow saliva and stridor raise concern because of imminent airway compromise . \n the most feared complication is airway obstruction due to elevation and posterior displacement of the tongue . to reduce the risk of spread of infection \n airway compromise is always synonymous with the term ludwig 's angina , and it is the leading cause of death . \n the stage of the disease and comorbid conditions at the time of presentation , physician experience , available resources , and personnel are all crucial factors in the decision making . \n blind nasotracheal intubation should not be attempted in patients with ludwig 's angina given the potential for bleeding and abscess rupture . \n flexible nasotracheal intubation requires skill and experience , if not feasible , cricothyrotomy and tracheostomy under local anesthesia are occasionally performed in the emergency department in those with advanced stages of the disease . \n elective awake tracheostomy is a safer and more logical method of airway management in patients with a fully developed ludwig 's angina . \n tracheostomy using local anesthesia has been considered the gold standard of airway management in patients with deep neck infections , but it may be difficult or impossible in advanced cases of infection because of the position needed for tracheostomy or because of anatomical distortion of the anterior neck.[1820 ]", "role": "user" }, { "content": "ludwig 's angina is a form of severe diffuse cellulitis that presents an acute onset and spreads rapidly , bilaterally affecting the submandibular , sublingual and submental spaces resulting in a state of emergency . \n early diagnosis and immediate treatment planning could be a life - saving procedure . here \n we report a case of wide spread odontogenic infection extending to the neck with elevation of the floor of the mouth obstructing the airway which resulted in breathlessness and stridor for which the patient was directed to maintain his airway by elective tracheostomy and subsequent drainage of the potentially involved spaces . \n late stages of the disease should be addressed immediately and given special importance towards the maintenance of airway followed by surgical decompression under antibiotic coverage . \n the appropriate use of parenteral antibiotics , airway protection techniques , and formal surgical drainage of the infection remains the standard protocol of treatment in advanced cases of ludwig 's angina .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: knowledge of craniocervical junction ( ccj ) abnormalities and their morphology is essential for clinicoradiological studies . \n the ponticulus , a bony bar arising from the lateral mass of the atlas , when fully developed , transforms the groove of the vertebral artery ( va ) into a canal ( arcuate foramen ) . these dysmorphisms may be clinically silent7 ) \n . however , in asymptomatic individuals , they may become dangerous in the context of trauma6 ) , or provoke slight troubles during specific diagnostic or surgical procedures1339 ) . \n occipitalization of the atlas ( also known as atlanto - occipital assimilation ) is thought to be a manifestation of so - called occipital vertebrae ( i.e. , incomplete segmentation between the atlantal and occipital bones)11 ) . \n occipitalization is the most common anomaly of the ccj , with a prevalence of 0.083.63% of the population21436 ) . \n because of the rare prevalence of occipitalization of the atlas , the anatomical changes associated with this condition have not yet been fully explored . \n congenital defects of the posterior arch of the atlas are uncommon , but their characteristics have been well described . in emergency departments , it is important to distinguish this variant anatomy from fracture and/or dislocation . \n although x - ray imaging or computed tomography ( ct ) findings of congenital defects of the posterior arch of the atlas have been reported , 3-dimensional ( 3d ) ct features of this anomaly have not been described in detail . \n understanding the anatomical basis of ccj anomalies is important when performing ccj region surgeries . in this report \n , we describe the incidence and anatomical features of arcuate foramina , occipitalization of the atlas , and congenital defects of the posterior arch of the atlas . \n we excluded 3d ct of patients from outside the catchment area of the hospital , including foreigners . \n these included patients who presented at our hospital due to cervical problem ( cervical trauma , neck pain , degenerative cervical disease ) between november 2011 and august 2014 . \n an aquilion prime 160-slice ct scanner ( toshiba medical systems corporation , otawara , japan ) was used for 173 patients and an aquilion cxl edition 128-slice ct scanner ( toshiba medical systems corporation , otawara , japan ) was used for 856 patients . in total , \n the age of the patients ranged from two years and two months to 88 years ( 49.0315.55 ) . \n parameters for the 3d ct acquisition were as follows : 140 mm field of view , 120 kvp , 150 ma , 0.5 mm section thickness , and 0.3 mm interval . \n the scan range was from the mid - body of the t2 vertebra to the base of the occiput . \n axial and sagittal images ( window level 60/window width 320 ) with 2 mm or 3 mm section thickness and a bone axial and sagittal images setting ( window level 350/window width 2700 ) with 2 mm or 3 mm section thickness were transferred to a picture archiving and communication system ( pacs ) . \n a series of 12 3d surface rendering reconstruction images around the vertical rotational view at every 20 was generated using software provided with the aquilion prime or aquilion cxl edition scanners . \n arcuate foramina were classified as either partial or complete and left and/or right . we did not include bony protrusion due to noticeable impression for vas as partial type . partial type was considered as partial arcuate foramen which was noted as a distinct bony spicule extending from the superior articular facet overhanging the dorsal arch . \n assimilation of the atlas was classified in accordance with criteria specified by mudaliar et al.23 ) . \n zone 1 fusion involves the anterior arch of the atlas in front of the lateral masses . \n posterior arch defects of the atlas were classified in accordance with the criteria specified by currarino et al.5 ) , who classified aplasia and cleft into five forms : a ) a fissure or small gap because of failure of posterior midline fusion of the two hemiarches , b ) cleft or absence of one or two arms of the posterior arch , c ) bilateral defects with preservation of the most dorsal part of the arch , d ) absence of the posterior arch with a persistent posterior tubercle , and e ) absence of the entire arch , including the tubercle ( fig . \n one hundred and eight vertebrae ( 108/1029 , 10.5% , 78 males , 30 females , age 1681 years , 48.2814.69 years ) showed the presence of a bony exostosis from the posterior margin of the superior articular facet ( fig . \n bilateral arcuate foramina were found in 41 vertebrae , and in the remaining 67 vertebrae the occurrence was unilateral ( right 31 , left 36 ) . \n right - side arcuate foramina were partial on 18 sides and complete on 54 sides . \n left - side arcuate foramina were partial on 24 sides and complete on 53 sides . \n a defect of the atlantal posterior arch was found incidentally in 12 patients ( 1.17% , nine male patients and three female patients , range 1469 years ) ( fig . \n nine of these patients ( 9/1029 , 0.87% ) had a type a posterior arch defect . \n we also identified one type b , one type d , and one type e defect . \n one hundred and eight vertebrae ( 108/1029 , 10.5% , 78 males , 30 females , age 1681 years , 48.2814.69 years ) showed the presence of a bony exostosis from the posterior margin of the superior articular facet ( fig . \n bilateral arcuate foramina were found in 41 vertebrae , and in the remaining 67 vertebrae the occurrence was unilateral ( right 31 , left 36 ) . \n right - side arcuate foramina were partial on 18 sides and complete on 54 sides . \n left - side arcuate foramina were partial on 24 sides and complete on 53 sides . \n \n in our study , a defect of the atlantal posterior arch was found incidentally in 12 patients ( 1.17% , nine male patients and three female patients , range 1469 years ) ( fig . \n nine of these patients ( 9/1029 , 0.87% ) had a type a posterior arch defect . \n we also identified one type b , one type d , and one type e defect . \n the ponticulus posticus ( arcuate foramen ) , or \" little posterior bridge , \" is an ossification of the oblique atlanto - occipital ligament superior to the va groove of the atlas . \n an arcuate foramen has been reported with an incidence of from 1.14% to 37%202224353638 ) . in this study , \n one hundred and eight vertebrae ( 108/1029 , 10.5% ) showed the presence of a bony exostosis from the posterior margin of the superior articular facet . an arcuate foramen is usually regarded as a simple anatomical variant . \n however , compression of the nervous and vascular structures passing through the foramen may result in a combination of symptoms forming a picture of vertebrobasilar insufficiency17 ) . \n this consists of cervical migraine37 ) , neurosensory - type hearing loss16 ) , neck pain , vertigo , shoulder / arm pain and , in some instances , even loss of postural muscle tone and consciousness432 ) . \n penning25 ) considers that there is more to the mechanism than pure arcuate foramen compression , identifying trauma as a trigger factor . \n however , whether such trauma leads to direct va injury and musculoskeletal compromise , which in turn leads to va compression , is unclear37 ) . \n cushing et al.6 ) found an arcuate foramen in 8 of 11 patients with va dissection and occlusion . \n the site of arterial injury was at the level of this bony variation in all cases . \n because more than 50% of head rotation occurs at the atlantoaxial joint , the va is most vulnerable to compression and stretching at this level . \n therefore , additional compression / tethering of this vessel by an arcuate foramen may increase its predisposition to injury . \n during flexion of the neck , the va glides superiorly and anteriorly relative to the posterior arch , and this is more likely to occur on the posterior lateral masses of the atlas than at more caudal sites in the neck19 ) . \n when the va courses above the posterior arch of the atlas , the placement of lateral mass screws is relatively safe10 ) , however , the risk may increase significantly with any anomalous course of the va . \n indeed , the abovementioned arcuate foramen would place the va in the path of any atlas lateral mass screw . \n young et al.39 ) have commented that the arcuate foramen may be mistaken for a widened posterolateral aspect of the posterior arch of the atlas , so that placement of lateral mass screws at c1 can be difficult . when an arcuate foramen is found , screw fixation through the lateral mass of the atlas is not feasible , and other modalities of internal fixation must be pursued13 ) . \n for example , c12 transarticular screw fixation , the c1 dorsal arch as an entry point for c1 screw placement , and skip c1 screw fixation and to extend the level of fixation proximally or distally can be alternative method12 ) . because arcuate foramina are not rare , the need for identification of this anomaly on preoperative radiographs and , particularly , high - resolution ct can not be overemphasized1 ) . \n occipitalization of the atlas ( also known as atlanto - occipital assimilation ) is thought to be a manifestation of so - called occipital vertebrae ( that is , incomplete segmentation between the atlantal and occipital bone)11 ) . \n occipitalization of the atlas is caused by failure of segmentation between the fourth occipital sclerotome ( proatlas ) and the first cervical sclerotome during embryonic development21 ) . \n the incidence of occipitalization of the atlas ranges from 0.08% to 3.63%21427 ) . in this study , \n the synostosis has been classified into four types based on the zones of the atlas fused with the occiput23 ) . \n zone 1 fusion involves the anterior arch of the atlas in front of the lateral masses ( 20% of cases ) . \n zone 3 fusion involves the posterior arch of the atlas behind the lateral masses ( 13% ) . \n 2 ) . occipitocervical synostosis results in a shift of the first mobile segment between the skull and spine to the c12 junction . \n this causes stress and a restricted range of movement , as a result of which there may be overstretch failure of the supporting myoligamentous structure , leading to a gradual loosening of the atlantoaxial joint with progressive atlantoaxial subluxation23 ) . \n compression of the spinal cord or the brain stem because of occipitocervical synostosis can produce signs and symptoms varying from a simple headache to a full blown neurological syndrome31 ) . \n atlantal occipitalization per se requires no treatment ; however , when symptoms of neural compression or spinal instability develop , surgical intervention , such as ccj decompression and/or fusion , may be required26 ) . \n most patients with occipitalization of the atlas probably remain asymptomatic and undetected . for those that develop symptoms , \n the surgeon should also recognize that manipulation of the cervical spine during surgical positioning may place patients with atlantal occipitalization in greater jeopardy of suffering va occlusion1929 ) . according to wang et al.36 ) , \n wang et al.36 ) reported four distinct types of va at the ccj with occipitalization of the atlas . \n type 1 : the va courses medially after leaving the transverse foramen of the axis , enters the spinal canal below the occipitalized c1 posterior arch , and enters the foramen magnum . \n type 2 : the va courses medially after leaving the transverse foramen of the axis , enters the spinal canal below the occipitalized c1 posterior arch , and enters the foramen magnum . \n the course of the va is on the posterior surface of the occipitalized c1 lateral mass , or forms a curve on it . \n type 3 : the va ascends laterally after leaving the transverse foramen of the axis , passes through the transverse foramen of the atlas ( if present ) , enters an osseous foramen created between the fused atlas and occiput , and then reaches the cranium . \n the anomalous pathway has its internal opening at the external edge or anterior part of the occipitalized c1 lateral mass . \n type 4 : the va is absent on one side of the cvj . in our patients , we could not identify the type of either va . \n the atlas normally develops from the three primary ossification centers : one midline anterior center , which forms the anterior arch , and two lateral centers for each lateral mass . \n two centers at the lateral masses extend posteromedially to form the posterior neural arch by year 4 . \n ossification of the anterior neural arch occurs posterolaterally from the midline anterior center to the lateral mass and is complete at 7 years of age8 ) \n . rarely , in only 2% of the population , a fourth center appears , which results in the posterior tubercle of the atlas and unites with the lateral masses of the atlas . \n posterior atlantal arch defects are attributed to the defective or absent development of the cartilaginous preformation of the arch rather than a disturbance of the ossification9 ) . \n this is supported by findings at autopsy or intraoperatively where connective tissue bridges the bony defect27 ) . \n isolated posterior arch clefts are relatively common , and are reported in 1.55% of the population359 ) . in this study , \n developmental anomalies of the posterior arch of the atlas range from simple clefts to absence of the entire arch . in 1994 , currarino et al.5 ) classified aplasia and cleft in five forms : a ) a fissure or small gap because of failure of the posterior midline fusion of the two hemiarches , b ) cleft or absence of one or two arms of the posterior arch , c ) bilateral defects with preservation of the most dorsal part of the arch , d ) absence of the posterior arch with a persistent posterior tubercle , and e ) absence of the entire arch , including the tubercle . \n type a clefts according to currarino 's classification occur in proximately 4% of the population . over 90% of defects \n are type a. currarino et al.5 ) estimated that 0.69% of the general population harbor types b e . \n patients are most commonly asymptomatic , although the defect can cause chronic cervical pain , headache , and lhermitte 's sign28 ) . \n cervical myelopathy is also possible , and has been reported in several cases1528 ) , especially with types c and d of currarino 's classification , which are both associated with the presence of a free - floating posterior osseous fragment . in these cases , the presence of a posterior tubercle may cause impingement on the cord , which may result in myelopathy or possibly cord contusion . \n richardson et al.27 ) suggested that the symptoms were secondary to compression of the cord by the inward mobility of the isolated posterior bony fragment during extension of the cervical spine . \n sharma et al.30 ) were the first to document true movement of the bony tubercle with neck extension . \n torreman et al.33 ) reported that stenosis of the atlas and axis was observed because of slight abnormal movement and hyperostosis of the persistent posterior tubercle and hypertrophy of the posterior ligaments between the atlas and axis . \n moreover , torreman et al.33 ) suggested that this might explain the delayed occurrence of symptoms of this congenital partial agenesis . \n the cumulative effects of minor cervical traumas may cause myelopathy . in our study , all 12 cases with defects of the atlantal posterior arch were found incidentally . \n flexion and extension x - ray films of the cervical spine in one patient with a type d defect revealed no movement of the posterior tubercle of the atlas . in this study , \n one case with defects in both anterior and posterior atlantal arches , anterior arch have incomplete arch defect ( fig . \n we think that this anatomical feature may contribute to asymptomatic presentation in patient with defect of both atlantal arches . \n the ponticulus posticus ( arcuate foramen ) , or \" little posterior bridge , \" is an ossification of the oblique atlanto - occipital ligament superior to the va groove of the atlas . \n an arcuate foramen has been reported with an incidence of from 1.14% to 37%202224353638 ) . in this study , \n one hundred and eight vertebrae ( 108/1029 , 10.5% ) showed the presence of a bony exostosis from the posterior margin of the superior articular facet . an arcuate foramen is usually regarded as a simple anatomical variant . \n however , compression of the nervous and vascular structures passing through the foramen may result in a combination of symptoms forming a picture of vertebrobasilar insufficiency17 ) . \n this consists of cervical migraine37 ) , neurosensory - type hearing loss16 ) , neck pain , vertigo , shoulder / arm pain and , in some instances , even loss of postural muscle tone and consciousness432 ) . \n penning25 ) considers that there is more to the mechanism than pure arcuate foramen compression , identifying trauma as a trigger factor . \n however , whether such trauma leads to direct va injury and musculoskeletal compromise , which in turn leads to va compression , is unclear37 ) . \n cushing et al.6 ) found an arcuate foramen in 8 of 11 patients with va dissection and occlusion . \n the site of arterial injury was at the level of this bony variation in all cases . \n because more than 50% of head rotation occurs at the atlantoaxial joint , the va is most vulnerable to compression and stretching at this level . \n therefore , additional compression / tethering of this vessel by an arcuate foramen may increase its predisposition to injury . \n during flexion of the neck , the va glides superiorly and anteriorly relative to the posterior arch , and this is more likely to occur on the posterior lateral masses of the atlas than at more caudal sites in the neck19 ) . \n when the va courses above the posterior arch of the atlas , the placement of lateral mass screws is relatively safe10 ) , however , the risk may increase significantly with any anomalous course of the va . \n indeed , the abovementioned arcuate foramen would place the va in the path of any atlas lateral mass screw . \n young et al.39 ) have commented that the arcuate foramen may be mistaken for a widened posterolateral aspect of the posterior arch of the atlas , so that placement of lateral mass screws at c1 can be difficult . when an arcuate foramen is found , screw fixation through the lateral mass of the atlas is not feasible , and other modalities of internal fixation must be pursued13 ) . \n for example , c12 transarticular screw fixation , the c1 dorsal arch as an entry point for c1 screw placement , and skip c1 screw fixation and to extend the level of fixation proximally or distally can be alternative method12 ) . \n because arcuate foramina are not rare , the need for identification of this anomaly on preoperative radiographs and , particularly , high - resolution ct can not be overemphasized1 ) . \n occipitalization of the atlas ( also known as atlanto - occipital assimilation ) is thought to be a manifestation of so - called occipital vertebrae ( that is , incomplete segmentation between the atlantal and occipital bone)11 ) . \n occipitalization of the atlas is caused by failure of segmentation between the fourth occipital sclerotome ( proatlas ) and the first cervical sclerotome during embryonic development21 ) . \n the incidence of occipitalization of the atlas ranges from 0.08% to 3.63%21427 ) . in this study , \n the synostosis has been classified into four types based on the zones of the atlas fused with the occiput23 ) . \n zone 1 fusion involves the anterior arch of the atlas in front of the lateral masses ( 20% of cases ) . \n zone 3 fusion involves the posterior arch of the atlas behind the lateral masses ( 13% ) . \n occipitocervical synostosis results in a shift of the first mobile segment between the skull and spine to the c12 junction . \n this causes stress and a restricted range of movement , as a result of which there may be overstretch failure of the supporting myoligamentous structure , leading to a gradual loosening of the atlantoaxial joint with progressive atlantoaxial subluxation23 ) . \n compression of the spinal cord or the brain stem because of occipitocervical synostosis can produce signs and symptoms varying from a simple headache to a full blown neurological syndrome31 ) . \n atlantal occipitalization per se requires no treatment ; however , when symptoms of neural compression or spinal instability develop , surgical intervention , such as ccj decompression and/or fusion , may be required26 ) . \n most patients with occipitalization of the atlas probably remain asymptomatic and undetected . for those that develop symptoms , \n the surgeon should also recognize that manipulation of the cervical spine during surgical positioning may place patients with atlantal occipitalization in greater jeopardy of suffering va occlusion1929 ) . according to wang et al.36 ) , \n wang et al.36 ) reported four distinct types of va at the ccj with occipitalization of the atlas . \n type 1 : the va courses medially after leaving the transverse foramen of the axis , enters the spinal canal below the occipitalized c1 posterior arch , and enters the foramen magnum . \n type 2 : the va courses medially after leaving the transverse foramen of the axis , enters the spinal canal below the occipitalized c1 posterior arch , and enters the foramen magnum . \n the course of the va is on the posterior surface of the occipitalized c1 lateral mass , or forms a curve on it . \n type 3 : the va ascends laterally after leaving the transverse foramen of the axis , passes through the transverse foramen of the atlas ( if present ) , enters an osseous foramen created between the fused atlas and occiput , and then reaches the cranium . \n the anomalous pathway has its internal opening at the external edge or anterior part of the occipitalized c1 lateral mass . \n type 4 : the va is absent on one side of the cvj . in our patients , we could not identify the type of either va . \n the atlas normally develops from the three primary ossification centers : one midline anterior center , which forms the anterior arch , and two lateral centers for each lateral mass . \n two centers at the lateral masses extend posteromedially to form the posterior neural arch by year 4 . \n ossification of the anterior neural arch occurs posterolaterally from the midline anterior center to the lateral mass and is complete at 7 years of age8 ) \n . rarely , in only 2% of the population , a fourth center appears , which results in the posterior tubercle of the atlas and unites with the lateral masses of the atlas . \n posterior atlantal arch defects are attributed to the defective or absent development of the cartilaginous preformation of the arch rather than a disturbance of the ossification9 ) . \n this is supported by findings at autopsy or intraoperatively where connective tissue bridges the bony defect27 ) . \n isolated posterior arch clefts are relatively common , and are reported in 1.55% of the population359 ) . in this study , \n developmental anomalies of the posterior arch of the atlas range from simple clefts to absence of the entire arch . in 1994 , currarino et al.5 ) classified aplasia and cleft in five forms : a ) a fissure or small gap because of failure of the posterior midline fusion of the two hemiarches , b ) cleft or absence of one or two arms of the posterior arch , c ) bilateral defects with preservation of the most dorsal part of the arch , d ) absence of the posterior arch with a persistent posterior tubercle , and e ) absence of the entire arch , including the tubercle . \n type a clefts according to currarino 's classification occur in proximately 4% of the population . \n over 90% of defects are type a. currarino et al.5 ) estimated that 0.69% of the general population harbor types b e . \n patients are most commonly asymptomatic , although the defect can cause chronic cervical pain , headache , and lhermitte 's sign28 ) . \n cervical myelopathy is also possible , and has been reported in several cases1528 ) , especially with types c and d of currarino 's classification , which are both associated with the presence of a free - floating posterior osseous fragment . in these cases , the presence of a posterior tubercle may cause impingement on the cord , which may result in myelopathy or possibly cord contusion . \n richardson et al.27 ) suggested that the symptoms were secondary to compression of the cord by the inward mobility of the isolated posterior bony fragment during extension of the cervical spine . \n sharma et al.30 ) were the first to document true movement of the bony tubercle with neck extension . \n torreman et al.33 ) reported that stenosis of the atlas and axis was observed because of slight abnormal movement and hyperostosis of the persistent posterior tubercle and hypertrophy of the posterior ligaments between the atlas and axis . \n moreover , torreman et al.33 ) suggested that this might explain the delayed occurrence of symptoms of this congenital partial agenesis . \n flexion and extension x - ray films of the cervical spine in one patient with a type d defect revealed no movement of the posterior tubercle of the atlas . in this study , \n one case with defects in both anterior and posterior atlantal arches , anterior arch have incomplete arch defect ( fig . \n we think that this anatomical feature may contribute to asymptomatic presentation in patient with defect of both atlantal arches . \n the presence of this anomaly should be carefully assessed before screw insertion into the lateral mass of the atlas . \n occipitalization of the atlas considerably changes the anatomy of the upper cervical spine and ccj . \n preoperative diagnosis using 3d ct is of paramount importance for detecting these changes and avoiding neurovascular injury during surgery . despite the low incidence of defects of the posterior arch of the atlas \n , we recommend that surgeons keep the possibility of its existence in mind when considering traumatic atlantoaxial subluxation and atlas fracture .", "role": "user" }, { "content": "objectivewe sought to examine anatomic variations of the atlas and the clinical significance of these variations.methodswe retrospectively reviewed 1029 cervical 3-dimensional ( 3d ) ct images . \n cervical 3d ct was performed between november 2011 and august 2014 . \n arcuate foramina were classified as partial or complete and left and/or right . \n occipitalization of the atlas was classified in accordance with criteria specified by mudaliar et al . \n posterior arch defects of the atlas were classified in accordance with criteria specified by currarino et al.resultsone hundred and eight vertebrae ( 108/1029 , 10.5% ) showed an arcuate foramen . \n bilateral arcuate foramina were present in 41 of these vertebrae and the remaining 67 arcuate foramina were unilateral ( right 31 , left 36 ) . \n right - side arcuate foramina were partial on 18 sides and complete on 54 sides . \n left - side arcuate foramina were partial on 24 sides and complete on 53 sides . \n one case of atlas assimilation was found . \n twelve patients ( 12/1029 , 1.17% ) had a defect of the atlantal posterior arch . \n nine of these patients ( 9/1029 , 0.87% ) had a type a posterior arch defect . \n we also identified one type b , one type d , and one type e defect.conclusionpreoperative diagnosis of occipitalization of the atlas and arcuate foramina using 3d ct is of paramount importance in avoiding neurovascular injury during surgery . \n it is important to be aware of posterior arch defects of the atlas because they may be misdiagnosed as a fracture .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: vitamin d status is determined by the 25-hydroxy - d ( calcidiol ) level ; however , the level that denotes deficiency is uncertain and there is no standard recommended replacement dose . \n vitamin d ( 1,25-hydroxy - d or calcitriol ) , but even in severe kidney failure , calcidiol continues to exert significant metabolic ( and therefore potentially toxic ) effects . \n the kidney disease outcomes quality initiative ( k / doqi ) guideline suggests a target calcidiol level of > 75 nmol / l for those with an estimated glomerular filtration rate ( egfr ) of 1560 ml / min but does not comment on the use of prolonged high cholecalciferol doses that may be necessary to achieve this target . \n this report examines the safety and effect of such dosing on parathyroid hormone ( pth ) and calcidiol levels in four patients with heavy proteinuria . \n the cases all presented to nephrology outpatients with heavy proteinuria , vitamin d deficiency and secondary hyperparathyroidism . \n they were prescribed oral cholecalciferol targeting a plasma calcidiol level > 75 nmol / l , as measured by the \n liaison 25 oh vitamin d total test assay . the data sheet for this assay reports an 8% inter - assay coefficient of variation at 21 nmol / l but local results indicated poor precision at < 20 \n results < 20 nmol / l were assumed to be 10 nmol / l for the purposes of analysis . \n the pth assay used was the abbott diagnostics , architect , intact - pth assay . \n the quoted reference range for this assay is 1.67.2 pmol / l with a coefficient of variation of 5.3% . \n quoted egfr were calculated using the four variable modification of diet in renal disease equation . \n the relationship between calcidiol levels , egfr and plasma pth for the cases with preserved renal function is shown in figure 2 . \n case 1 was a 53 years old caucasian man who presented with nephrotic syndrome from igg - lambda amyloidosis and an egfr of 50 ml / min/1.73 m . \n he required a cholecalciferol dose of 7143 u / day to achieve a calcidiol level > 75 nmol / l . \n case 2 was an obese diabetic 53 years old asian woman who presented with poor energy , an egfr of 18 ml / min/1.73 m and heavy proteinuria but a normal serum albumin . \n a renal biopsy had been performed 16 years earlier for proteinuria and had shown glomerulomegaly only . \n she had a past history of metastatic breast cancer in remission on hormonal therapy and minimal trauma fractures to both hips . \n she required a cholecalciferol dose of 14 286 u / day to achieve calcidiol levels > 75 nmol / l , and calcitriol was commenced at day 335 due to persistent elevations in pth ( 51 pmol / l ) . at commencement of calcitriol , \n case 3 was a 64 years old caucasian woman who presented with nephrotic syndrome from igm - kappa amyloidosis and an egfr of > 60 ml / min/1.73 m . \n she required treatment with 10 714 u / day cholecalciferol to achieve calcidiol levels > 75 nmol / l . \n case 4 was a 22 years old obese caucasian woman who presented with nephrotic syndrome from tip lesion variant focal - segmental glomerulosclerosis and an egfr > 60 ml / min/1.73 m . \n her bone density t - scores measured at the spine and hip were + 2.11 and + 2.33 , respectively , at presentation . \n 20 nmol / l and a pth after 4 months therapy with cholecalciferol was mildly elevated at 7.7 pmol / l . \n adherence to prescribed therapy was suboptimal , although she stated that her non - adherence was predominantly with the evening dose of cyclosporine , not cholecalciferol . \n the four patients in this report were vitamin d deficient and were prescribed high doses of cholecalciferol to achieve calcidiol levels > 75 nmol / l . despite maintenance of high doses for > 1 year in all patients and frequent monitoring of serum calcium , toxicity was not observed . \n sunlight can catalyse the production of 10 00020 000 u calcidiol per day such that persons with normal renal function and a high degree of sun exposure achieve calcidiol levels of up to 250 nmol / l without toxicity [ 4 , 5 ] ; however , there is limited safety data for long - term oral supplementation at similar doses . \n it is known that urinary calcidiol losses are large , proportional to the degree of proteinuria in nephrotics and that cholecalciferol absorption ( in animals ) is not affected by proteinuria . accordingly , large oral cholecalciferol doses proportional to the degree of proteinuria should be effective in raising serum calcidiol levels . \n however , animal data also indicates that very high oral doses of cholecalciferol overwhelm liver 25-hydroxylation , resulting in accumulation of slowly metabolized cholecalciferol . \n this could cause delayed vitamin d toxicity due to rising calcidiol levels , not responsive to cessation of cholecalciferol dosing . \n such toxicity was not observed in this case series , with calcidiol levels falling promptly after cholecalciferol doses were reduced . \n case 4 did , however , fail to achieve target calcidiol levels because she ceased therapy before the titration phase was completed . \n there was a strong correlation for individual cases ( spearman rho 0.68 , p = 0.0003 ) between the prescribed cholecalciferol dose and calcidiol levels obtained 3 months after the last dose change , but an inconsistent dose \n response between cases did not appear to be explained by varying levels of proteinuria , serum albumin , egfr , body weight or differences in baseline calcidiol levels ; however , formal statistical analysis was not possible because regression models did not provide a good fit for the data . \n despite relatively stable and well - preserved kidney function in three cases , no association was found between calcidiol levels and plasma pth , as shown in figure 2 . \n calcidiol is highly ( 88% ) protein bound and the free fraction of calcidiol would likely be increased by the fall in vitamin d - binding protein that occurs in heavy proteinuria . \n this would make the free fraction of calcidiol higher than expected , based on the total calcidiol level and therefore alter the relationship between total levels ( as measured by the assay ) and pth , in patients with proteinuria . \n total calcidiol levels may therefore be an inappropriate guide to cholecalciferol therapy in the setting of extreme protein losses . \n however , it is unlikely that a change in protein binding alone is sufficient to account for the lack of a pth response in cases 1 and 3 . in those patients , where total calcidiol levels were very low at baseline , \n free levels would also have been low , regardless of the bound fraction . a substantial rise in total calcidiol from a severely deficient baseline \n would be expected to increase free levels , and thereby improve secondary hyperparathyroidism . however , in this series , substantial increases in total calcidiol levels did not result in significant pth reductions ( figure 2 ) . \n the lack of a calcidiol pth response relationship in this series casts doubt on the benefit of supplementing cholecalciferol based on a low total plasma calcidiol level in proteinuric patients ; however , if given , such supplementation is safe .", "role": "user" }, { "content": "four patients presenting with heavy proteinuria , vitamin d deficiency and secondary hyperparathyroidism were treated with cholecalciferol for 1.53 years . \n doses of 714314286 u / day were necessary to achieve the calcidiol target of > 75 nmol / l . \n the effect of dosing on calcidiol levels was inconsistent and there was no apparent relationship between changing calcidiol levels and intact parathyroid hormone ( pth ) levels . \n toxicity was not observed . \n this series suggests high doses of cholecalciferol over a prolonged period of time are necessary to achieve recommended calcidiol levels ; however , the lack of an impact on pth casts doubt on the suitability of the calcidiol target , in patients with heavy proteinuria .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cochlear implantation outcomes are dependent on several factors that lead to a good prognosis , such as early diagnosis and intervention , systematic rehabilitation , family permeability , and type of communication , as well as other factors related to hearing loss including etiology , period of deafness , and the presence of other associated impairments1 \n 2 \n 3 . \n genetic causes of deafness include waardenburg syndrome ( ws ) , which accounts for 2%5% of patients with congenital hearing loss4 . \n ws is an autosomal dominant disease characterized by hyperplasia of the medial portion of the eyebrows , a broad nasal root , heterochromia iris , white forelock or early graying , and congenital sensorineural hearing loss5 . \n the most relevant clinical symptom in ws is the hearing loss , which can be unilateral or bilateral , and moderate to profound . \n severe to profound deafness is more evident in patients with type i and type ii ws , with an incidence of 35%75% and 55%91% , respectively6 . \n cochlear implantation is indicated for patients with bilateral and severe to profound hearing loss who are unable to benefit from conventional hearing aids . \n few studies have evaluated the audiological outcomes of cochlear implantation in users with syndromes . some have noted limited success depending on the characteristics associated with the syndrome and the age at implantation . \n studies of ws have reported good outcomes for those with no other impairments associated with the syndrome7 \n 8 \n 9 \n 10 . \n the purpose of this study was to characterize and describe hearing outcomes after cochlear implantation in patients with ws to improve preoperative expectations . \n this was a retrospective and observational study of a series of cases and was performed from march 1999 through july 2012 . \n patients who met the following criteria were included in the study : multichannel cochlear implant user . \n the following data were collected : age at diagnosis of deafness ; age at rehabilitation initiation ; age at cochlear implant activation ; duration of cochlear implant use ( in months ) ; number of active electrodes ; intraoperative neural telemetry results ; aided average pure tone threshold in sound field c before and after surgery ; pre- and post - operative speech perception and production test results . \n intraoperative neural telemetry data were recorded by nucleus nrt 3.1 or custom sound ep 2.0 software from cochlear corporation . \n electrical auditory brainstem response ( eabr ) data were recorded by bio - logic v.7.0 and stimulated by digistim from neurelec . \n free field audiometry data were collected using madsen midimate 622 and retrieved from patient records . where no threshold was available ( such as during pre - operative assessment ) , a value of 130 db was used to calculate the average ( greater than the amplifier limit ) ; the calculation was performed according to the biap recommendation11 . \n speech perception and production were evaluated using our standard protocols and were assessed according to age12 . for children up to the age of 4 years 11 months , \n the early perception test ( esp ) was used ( the portuguese form by orlandi and bevilacqua13 ) . for children aged 5 years or older , \n the portuguese form of the glendonald auditory screening procedure ( gasp ) was used14 . in both tests \n two inventories were submitted to the parents , one addressing information on the frequency with which the child showed significant auditory behaviors in their everyday life ( it - mais - infant - toddler meaningful auditory integration scale)16 \n 17 , the other providing information on the frequency with which the child demonstrated behaviors associated with oral language ( muss - meaningful use of speech scale)18 \n 19 . \n the degree of permeability of the family to the therapeutic process was evaluated following the latin american protocol20 , and was classified as shown in table 1 . \n the cognitive style of the children was assessed through observation by the clinician and/or by parent report of behaviors associated with child development . \n during this period , 806 patients received a cochlear implant . of these , 10 ( 1.2% ) \n * m = male ; f = female ; * * n24 = nucleus 24 ; n24re = nucleus 24 freedom . \n i d : identification ; diag : age at diagnosis ; hearing aid : age when began using hearing aids ; rehab . : \n preoperative evaluations performed before cochlear implantation showed that despite the use of conventional hearing aids , none of the patients could perceive speech ( category zero)15 . \n eight of the children received a nucleus 24 ( cochlear corporation ) implant and 1 child and 1 adult received a digisonic sp ( neurelec ) implant . \n case 10 is an adult with pre - lingual hearing loss , oral language communication and good lip reading . \n intraoperative neural responses were present in all of the cases . among the children , the mean age at the time of implantation was 44 months . \n the average duration of use of a cochlear implant was 43 months at the time of the study . \n patients who could effectively use the speech processor had a pure tone average of 31 db in free field conditions , and the muss and mais questionnaires showed clinical improvements in speech perception and production ( table 4 ) . \n ci : cochlear implant ; pta ( pure tone average ) average threshold at 500 hz and 4000 hz ( 11 ) ; abs = absent ; nr = unrealized ; category : category of speech perception ( 15 ) . on the other hand , 4 patients who were unable to use the speech processor effectively had a pure tone average of 67.5 db in free field conditions . \n in addition , their muss and mais questionnaire responses did not show any improvement in speech perception or production . \n case 10 was able to discriminate all of the vowels and 80% of a closed - set sentence after 9 months of using the speech processor . \n all patients were diagnosed with severe to profound congenital hearing loss , which is in accordance with barzotto and folador21 , who showed that the most common form of hearing loss in ws is profound sensorineural . \n the prevalence of patients with ws who received a cochlear implant in this study was 1.2% , which is close to the value generally reported in the literature8 \n 9 \n 10 \n 22 . during the pre - implant evaluation , \n no patient was found to have benefited from conventional hearing aids , which corresponds to category 0 of speech perception and an inability to detect speech sounds . \n all patients had complete insertion of electrodes and showed an intraoperative neural response , which means that the auditory nerve responded to the first electrical stimulation of the cochlear implant . \n guedes et al.1 showed that adult patients who showed intraoperative telemetry responses had better results in speech perception tests , but this relationship was not statistically significant among children . \n assessment of the hearing outcomes of all patients who were able to use the cochlear implant effectively showed that all had audiometric thresholds that enabled perception of speech sounds ( according to the audiogram of portuguese speech sounds)23 . \n the it - mais questionnaire results also showed significant clinical improvements in most cases , reflecting improvements in listening skills , not only for detection , but also for the recognition of some sounds , since most of the patients had a good hearing threshold . \n kubo et al.3 showed that after 6 to 12 months of use of a cochlear implant , children were able to distinguish and recognize sounds . in cases 4 , 5 , and 7 in the present study no clinical improvement was detected by it - mais because the child didt use the cochlear implant effectively , that is , there were care and maintenance problems as well as infrequent use of the implant during the rehabilitation process . \n these skills are dependent on daily experience , systematic rehabilitation , and stimulation by the family according to kobo et al.3 . in our study \n , we found that children with low family permeability did not show any difference in their muss responses after cochlear implantation . \n cases 4 and 5 are brothers and the family was not involved with their therapy or the fitting of their speech processors . in case 7 \n , the family stopped using the speech processor because the child did not seem to improve . \n these findings indicate that cochlear implants provide access to speech sounds , but that the development of auditory and language skills is dependent on systematic rehabilitation and family involvement2 . \n there are a few studies of cochlear implantation in patients with syndromes in the literature , and these show that patients who have no other associated intellectual impairments , who receive their implant early , and who are subject to sufficient stimulation have good outcomes7 \n 8 \n 9 \n 10 \n 24 . in cases 2 and 3 in the present study , significant improvements in speech perception \n were observed and the family was also a meaningful participant in the therapeutic process . in case 1 , however , although an improvement in hearing behavior was observed , the patient 's oral language was below average after implantation . \n the family showed a low level of participation in the patient 's rehabilitation process and there was inconsistent use of the implant owing to poor care of the equipment , which led to numerous maintenance and technical assistance events , and thus undermined the patient 's performance . \n out of the 10 cases described here , 3 ( cases 5 , 6 , and 7 ) presented with late fitting of hearing aids , late auditory rehabilitation , and late implantation , which was reflected in their speech perception tests . \n several studies have shown that children experience greater benefits from cochlear implantation when the implant is fitted when they are younger than age 2 , which is the ideal period for better leveraging the outcomes of the cochlear implant25 \n 26 . \n andrade et al.10 also confirmed that pre - lingually deafened ws children who have prior non - significant or marginal benefit from acoustic amplification but normal inner ear anatomy are potentially good candidates for audio - oral rehabilitation with a cochlear implant . \n postoperative performance outcomes of 7 cases with ws were also assessed and compared to results obtained by children with non - syndromic congenital deafness . \n therefore , early intervention and rehabilitation is essential for children with ws as well the profoundly hearing impaired . \n this will ensure that they are offered better conditions to achieve good outcomes with a cochlear implant . \n parental involvement throughout the rehabilitation process is also important for improving the quality of communication . \n results from case 10 were not satisfactory despite having early intervention and childhood rehabilitation . on the other hand , \n the patient has not used the cochlear implant for very long , and these results may improve over time . \n genetic counseling is important for predicting the risk of transmission as well as for studying the family of the affected individual21 \n 22 , and genetic findings may influence the prognosis and treatment opportunities . \n in our group of patients with ws who received a cochlear implant , hearing thresholds that allow access to speech sounds were achieved . \n however , those who showed good evolution of the perception of auditory and oral language skills were those who received early stimulation , systematic rehabilitation , and who had a family that was actively involved in the process .", "role": "user" }, { "content": "summary \n introduction : the most relevant clinical symptom in waardenburg syndrome is profound bilateral sensorioneural hearing loss . \n aim : to characterize and describe hearing outcomes after cochlear implantation in patients with waardenburg syndrome to improve preoperative expectations . \n method : this was an observational and retrospective study of a series of cases . \n children who were diagnosed with waardenburg syndrome and who received a multichannel cochlear implant between march 1999 and july 2012 were included in the study . \n intraoperative neural response telemetry , hearing evaluation , speech perception , and speech production data before and after surgery were assessed . \n results : during this period , 806 patients received a cochlear implant and 10 of these ( 1.2% ) were diagnosed with waardenburg syndrome . \n eight of the children received a nucleus 24 implant and 1 child and 1 adult received a digisonic sp implant . \n the mean age at implantation was 44 months among the children . \n the average duration of use of a cochlear implant at the time of the study was 43 months . \n intraoperative neural responses were present in all cases . \n patients who could use the speech processor effectively had a pure tone average of 31 db in free - field conditions . \n in addition , the muss and mais questionnaires revealed improvements in speech perception and production . \n four patients did not have a good outcome , which might have been associated with ineffective use of the speech processor . \n conclusion : despite the heterogeneity of the group , patients with waardenburg syndrome who received cochlear implants were found to have hearing thresholds that allowed access to speech sounds . \n however , patients who received early intervention and rehabilitation showed better evolution of auditory perception .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: congenital epulis ( also known as congenital gingival granular cell tumour ) is a rare benign congenital growth of the newborn . \n it was first described in 1871 by neumann , hence the alternative name is newmanns ' tumour . \n it usually presents at birth with an obvious mass arising from the gingival mucosa of the maxilla or mandible . \n the size of the mass varies from a few millimetres to 9 cm in diameter . \n the recommended treatment is surgical excision under local or general anaesthetic , although spontaneous regression has been reported . \n there are no reports of recurrence , even if incomplete margins are excised , malignant change , or future disruption to teeth or gums . \n an otherwise healthy 1-day - old girl was referred to a large teaching hospital in cardiff for diagnosis and treatment of two large masses protruding from her mouth . \n the baby had normal antenatal scans at weeks 12 and 20 , and pregnancy had been unremarkable , other than mother being group b streptococcus positive from a high vaginal swab . \n mother was fit and well gravida 2 para 1 , with no drug history or family history of note . \n baby was born at term plus eight days weighing 3.85 kg , pink and breathing spontaneously ( apgar : 9 - 10 ) . on examination there were two fleshy , pedunculated masses arising from the upper and lower alveolar ridges measuring 4 3 3 cm just to the right of the midline . \n she was booked for excision of these masses under general anaesthesia ( figure 1 ) . \n both masses were removed with an eliptical insion to the peduncles ( figure 2 ) . \n the child was breastfeeding the day after surgery , and discharged home the following day . \n the two masses were fixed and examined histologically ( figures 3 and 4 ) . \n they showed sheets and clusters of cells containing abundant granular eosinophlic cytoplasm and small uninform nuclei , along with some myxoid areas and areas of haemorrhage and ulceration , confirming the diagnosis of congenital epulis . \n it commonly presents in the neonate , although prenatal diagnosis with ultrasound has been reported as early as 26 weeks gestation . \n the lesion usually arises over the incisor - canine region of the maxilla ( maxillary / mandibular ratio 3:1 ) . \n simultaneous involvement of both maxillary and mandibular alveolar ridges occurs in approximately 10% of reported cases . \n the diagnosis is usually made on clinical grounds alone , although difficulties may arise when the size of the lesion is small , or the index of suspicion is low . \n mri is useful for diagnosis , and superior to ultrasound , showing the gingival origin of congenital epulis without local extension . \n epulis is a greek term literally meaning of the gums and is used to describe a wide variety of gum lesions , regardless of their pathological origin . \n histologically , congenial epulis shows remarkable similarity with the more common granular cell tumours ( gcts ) [ 2 , 11 ] . \n there are , however , many distinguishing features , such as occurrence solely in the neonate , typical location , plexiform arrangement of capillaries , and lack of pseudoepitheliomatous hyperplasia . \n gcts are ubiquitous neoplasms occurring in all age groups , very rarely affecting the gingiva , and can occasionally show malignant change . \n immunohistochemical studies have revealed further differences , demonstrating the reactivity of gcts to s-100 protein and laminin , and their absence in congenital epulis . vered et al . \n have also recently expanded the immunophenotypic distinction between the two , showing gcts stain positive for ngfr / p75 and inhibin- , whereas congenital epulis does not . \n cgts are considered to arise from schwann cells , and hence show strong reactivity to s-100 protein . \n various theories of the origin of congenital epulis include myoblastic , neurogenic , odontogenic , fibroblastic , and histocytic . \n it has been suggested that the occurrence of congenital epulis solely in neonates , and more commonly in females , implies a hormonal mechanism of development . \n however , numerous reports have shown no evidence of either oestrogen or progesterone receptors , and as such suggest an alternative histogenesis [ 11 , 14 ] . in a review of 33 lesions , \n conclude that the immunohistochemical profile does not imply any specific cell types for the histogenetic origin of congenital epulis . \n no estimation of incidence of congenital epulis has been made to date , to the best of our knowledge . \n one centre in the usa saw only two cases over the period of 21 years . in university hospital of wales , a tertiary referral centre for otolaryngology and neonatology , this is the only recorded case of congenital epulis since 1980 , a total of 28 years . using incidence of live births ( 157,454 ) within that time period \n , we calculate an incidence of 0.0006% ( upper 95% confidence interval : 0.0035% , the inverse of the cumulative beta distribution ) . \n although most likely an underestimate , this calculation will serve as an approximation of incidence before a more thorough estimation can be undertaken .", "role": "user" }, { "content": "congenital epulis , also known as neumann 's tumour , is a rare congenital growth affecting the gingival mucosa of neonates . \n it is benign condition , seen more frequently in females , with multiple epuli occurring in only 10% of cases . \n the cause and origin of congenital epulis remains unclear . in this article we present a case report of an otherwise healthy female neonate with two congenital epuli arising from the upper and lower gingival margin , which were successfully treated with surgical excision . \n we also present a review of the literature and an estimation of the incidence of congenital epulis based on our institutions figures , of 0.0006% ( upper 95% confidence interval : 0.0035% ) .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: caesarean section in spinal anesthesia has become increasingly popular in recent years and is now a commonly performed surgical procedure . \n regional anesthesia is performed in 80% of anesthetized patients compared to 20% who receive general anesthesia . \n while consciousness allows the patient to enjoy the early intimate contact with the newborn child ( bonding ) , the procedure may be associated with various important problems . \n arterial hypotension and headache , insufficient or abundant anesthesia , and psychologic distress may be some of the adverse effects of regional anesthesia for caesarean section . \n a common problem in caesarean section is intra- and postoperative nausea and vomiting under regional anesthesia [ 68 ] . \n nv can happen during and after the birth and may affect the well - being of mother and family . \n the well - being of patients may be severely compromised ; 72% of patients are afraid of nv and 71% feel significant discomfort . \n critical anesthesiological complications such as airway obstruction , aspiration pneumonitis , and wound dehiscence are rare and mainly related to postoperative nausea and vomiting in general surgical patients . in addition to postoperative pain , \n previous reports and our observations suggest both nausea and vomiting as a frequent phenomenon , with incidences up to 80% . \n necessary therapeutic measures , the use of personnel , and room and material resources represent an enormous economic burden and are being closely monitored by health system administrators . \n due to the complex pathophysiology , the treatment and prophylaxis of nv is difficult . to keep the costs low , alternative treatments like acupressure and acupuncture \n the pharmacological interventions available include a wide range of drug medication , including dopamine and serotonin receptor antagonists , corticosteroids , antihistamines , sedatives , and anticholinergic drugs . \n the major risk factor for nausea and vomiting during or after spinal anesthesia in cesarean section is arterial hypotension due to the blockade of the sympathetic nerve system . \n nv may be influenced by hormonal changes during pregnancy , which alter the sphincter tone of the esophagus and the stomach and the activity of the small bowel and esophagus , as well as adverse effects of uterotonic drugs , intraoperative manipulation of the uterus , and/or psychological distress aggravated by insufficient or excessive anesthesia [ 2224 ] . \n previous studies have addressed the efficiency of different anti - emetics in terms of reduction of ponv risk in cesarean section patients , mostly using only 1 agent . in a recently published study , we were able to find a multimodal prophylactic regimen for breast surgical procedures . \n there are several studies in spinal anesthesia indicating that multimodal prophylaxis is preferable to prevent nv , especially in caesarean section . \n the goal of the present study was to investigate multimodal pharmacological approaches with tropisetron and metoclopramide ( group ii ) and dimenhydrinate and dexamethasone ( group iii ) compared to a mono therapy with tropisetron ( group iv ) versus no prophylaxis ( group i ) to prevent nv intra- and postoperatively in patients undergoing cesarean section under spinal anesthesia . \n for statistical analysis , we created 4 groups : group i : no prophylactic agents ; group ii : tropisetron 2 mg + metoclopramide 20 mg prophylactically ; group iii : dimenhydrinate 31 mg and dexamethasone 4 mg prophylactically ; group iv : tropisetron 2 mg prophylactically . \n the antiemetic efficacy of the 4 different treatments was evaluated in 308 patients undergoing cesarean section . \n we included 308 patients scheduled for cesarean section as a planned or non - urgent procedure . \n not included were procedures using epidural anesthesia , emergency procedures and procedures using general anesthesia , systemically ill patients , parturients affected with gestosis , hellp syndrome , and known allergies to the planned medication . \n also excluded were patients under the age of 18 . after obtaining approval from the institutional review board ( \n evangelian deaconry hospital freiburg , germany ) and written informed patient consent , patients were randomly assigned to 1 of the 4 groups . \n all patients were given premedication with midazolame 3.75 mg orally 1 hour before transfer to the operating theatre . \n spinal anesthesia ( spa ) was induced in left lateral position between l3/l4 with 0.5% hyperbaric bupivacaine . \n body height 150 cm resulted in 1.8 ml bupivacaine 0.5% ; every 5 cm additional body height resulted in an additional 0.2 ml bupivacaine dosage . \n no opioids were used . after successful puncture , patients were brought in prone position , a foley catheter was applied and the operating table was brought into a 20 left lateral position to circumvent vena cava compression syndrome . when the anesthetic effect reached the th 4/5 segment , patients were kept in an anti - trendelenburg position to stop further ascent . \n systolic blood pressure was kept at a minimum of 100 mmhg with 2 ml doses of cafedrin - theodrenalin diluted 1:10 . \n after full development of the child , the anti - emetic prophylaxis was applied according to randomization . \n further medication was oxytocin ( 3 units bolus , and 10 units in 500 cc 0.9% nacl ) , antibiotic prophylaxis ( 1.5 g uracid or 2 g cefazolin in case of allergy to penicillin ) . \n events of nausea and/or vomiting were recorded in a special questionnaire 2 and 24 h postoperatively . \n data recorded consisted of : date of operation , age , asa , duration of anesthesia and operative procedure , medication taken at home , intraoperative medication , level of spa , nv risk factors , type of nv prophylaxis given , intraoperative complications , intraoperative nv according to the numeric rating scale ( nrs ) with 0 representing no nv and 10 the worst possible nv event , intraoperative fluid management , postoperative opioids , onset and degree of nv in minutes after the end of the operation and medication given , other postoperative complications , and overall patient satisfaction . \n the primary outcome in this study was the incidence of nausea , emesis , or both during the operation and in the early ( 02 h ) or late ( 224 h ) postoperative period . \n trained investigators recorded the number of episodes and the time of occurrence . in all intervals \n , patients scored the nv experience on a scale comparable to the numeric rating scale ( nrs ) , where 0 represented no nv and 10 the worst possible nv event . \n patients were randomly assigned preoperatively to 1 of 4 groups with sealed opaque envelopes that were opened by the anesthetist before induction of anesthesia . \n randomization resulted in 76 patients in group i ( no prophylaxis given ) , 82 patients in group ii ( prophylactic agents tropisetron and metoclopramide ) , 79 patients in group iii ( prophylactic agents dimenhydrinate and dexamethasone ) , and 71 patients in group iv ( prophylactic agent tropisetron ) . \n anti - emetic therapy of patients exhibiting ponv in the early and late postoperative period ( 02 h and 224 h ) was left to the discretion of the physician responsible for the ward , where all agents except the ones already used for anti - emetic prophylaxis could be taken into account . to assess the individual risk of the patients and the risk reduction through the anti - emetic prophylaxis \n the variables considered ( eg , duration of the operation , events of hypotension ) were used to build a statistical model with sas / stat ( sas institute inc . , cary , nc ) . \n the remaining factors significantly affected the observed endpoint , which was the incidence of nausea and vomiting . \n the degree of association of the considered factors and the endpoint were determined using odds ratios . \n to assess the individual risk of the patients and the risk reduction through the anti - emetic prophylaxis , a multivariate statistical analysis was performed . \n the variables considered ( eg , duration of the operation , events of hypotension ) were used to build a statistical model with sas / stat ( sas institute inc . , cary , nc ) . \n the remaining factors significantly affected the observed endpoint , which was the incidence of nausea and vomiting . \n the degree of association of the considered factors and the endpoint were determined using odds ratios . \n there were 308 patients who underwent randomization to 1 of the 4 groups : 76 patients in group i ( no prophylaxis given ) , 82 patients in group ii ( prophylactic agents tropisetron and metoclopramide ) , 79 patients in group iii ( prophylactic agents dimenhydrinate and dexamethasone ) , and 71 patients in group iv ( prophylactic agent tropisetron ) . \n outcome data were complete for all 308 patients : 100% of the patients were female , 90.3% were non - smokers , 23.4% had a history of nausea and vomiting or motion sickness , and 56.8% received postoperative opioids . \n groups were investigated regarding nausea and vomiting intraoperatively and postoperatively in the early ( 02 h ) and late ( 224 h ) postoperative period . \n the incidences of nausea and vomiting were summarized because the incidence of vomiting was rare and statistically non - significant . \n overall 165 ( 53.6% ) patients out of 308 experienced intra- or postoperative nausea and vomiting ( table 2 ) . \n group ii had the lowest incidence of intraoperative nv ( 26.8% ) and groups iii and iv showed no significant differences . \n the relative incidence of ionv was 46.8% ( group 3 ) and 46.5% ( group 4 ) . \n group i had the highest rate of patients experiencing ionv ( 64.5% ) ( tables 2 and 3 ) . compared to group i ( no medication ) , all prophylactic medication ( groups ii , iii , and iv ) led to a significantly lower rate of ionv . \n the effect of medication of group iii and group iv are roughly similar ( an odds ratio of 1 means equality ) ( table 4 ) . the difference between group ii and iii and group ii and iv was also significant . \n the odds ratios ( or ) of 0.42 and 0.42 emphasize the significantly lower incidence of ionv in group ii compared to group iii and group iv . in detail \n the most effective prophylactic medication against intraoperative nausea was a combination of tropisetron and metoclopramide ( 25.6% ) ( group ii ) . \n intraoperative vomiting was also highest in group i ( 15.8% ) and was significantly lower in group ii ( 3.7% ) , group iii ( 8.9% ) , and group iv ( 1.4% ) . \n in the early postoperative period ( 02 h ) the incidence of nausea was highest in the non - treated group i ( 9.2% ) , and was lowered by prophylaxis in group ii ( 6.1% ) , group iii ( 5.1% ) , and group iv ( 4.2% ) . \n there were no differences in the incidence of nausea in the late postoperative period ( 224 h ) between groups ( 1% in groups i iii , and 3% in group iv ) . \n postoperative vomiting was rare : 3% in group i and none of the patients in the treatment groups experienced vomiting postoperatively . \n the major influence from a statistical point of view seems to have been the type of medication given . \n there are no statistical differences between the effect of medication of groups iii and iv . \n the other risk factors additionally investigated did not show any significant differences . there was no risk factor that influenced all groups . \n the median of symptom strength among the symptomatic patients was 5.5 and the mean number of episodes was 1.5 . \n the most effective prophylactic medication against intraoperative nausea was a combination of tropisetron and metoclopramide ( 25.6% ) ( group ii ) . \n intraoperative vomiting was also highest in group i ( 15.8% ) and was significantly lower in group ii ( 3.7% ) , group iii ( 8.9% ) , and group iv ( 1.4% ) . \n in the early postoperative period ( 02 h ) the incidence of nausea was highest in the non - treated group i ( 9.2% ) , and was lowered by prophylaxis in group ii ( 6.1% ) , group iii ( 5.1% ) , and group iv ( 4.2% ) . \n there were no differences in the incidence of nausea in the late postoperative period ( 224 h ) between groups ( 1% in groups i iii , and 3% in group iv ) . \n postoperative vomiting was rare : 3% in group i and none of the patients in the treatment groups experienced vomiting postoperatively . \n the major influence from a statistical point of view seems to have been the type of medication given . \n there are no statistical differences between the effect of medication of groups iii and iv . \n the median of symptom strength among the symptomatic patients was 5.5 and the mean number of episodes was 1.5 . \n the aim of this study was to find a highly efficient anti - emetic regimen and anesthetic procedure to reduce the incidence of intra- and postoperative nausea and vomiting in 308 female patients exposed to cesarean section surgery under spinal anaesthesia . \n the study was conducted on the background that an optimal perioperative patient comfort is of outstanding interest and nv with an average incidence of 30% is rated as one of the most undesirable events in the context of surgery and anesthesia [ 2628 ] . \n therefore , every attempt should be made , especially in the context of birth , to avoid this complication , which is not only an unpleasant adverse effect , but also may cause severe complications such as wound dehiscence , dehydration , aspiration , or pneumothorax . \n we compared combinations ( tropisetron / metoclopramide and dimenhydrinate / dexamethasone ) and a single - drug regimen ( tropisetron ) of known and effective drugs against no prophylaxis to find the best prophylactic treatment for intraoperative and postoperative nausea and vomiting . \n all anti - emetic agents used in this study have been previously extensively investigated and their efficacy in terms of nv reduction has been proven [ 2935 ] . in our patients , \n intraoperative nausea and vomiting was the main problem ( 60% in the untreated group ) . \n postoperative events of nausea and vomiting were low ( 9% ) even in the untreated group . \n this finding agrees with results of other investigations , which showed the main onsets of discomfort during the procedure , with incidences of up to 80% . \n causes for the high incidence of nv may be intraoperative hypotension , reduced cardiac output due to vena cava compression , uterotonic drugs such as oxytocin and particularly methergine , exteriorization and manipulation of the uterus , intestines , and peritoneum , as well as psychological distress , although underlying pathomechanisms are not fully understood in all details . \n 20% of pregnant women have emesis gravidarum and 10% have hyperemesis gravidarum , perhaps due to high levels of hcg , obesitas , reduced gastroesophageal tone , and psychological changes . \n it belongs to the group of 5-ht3- or serotonin antagonists acting in the chemoreceptive trigger zone . \n efficacy of serotonin antagonists in prevention and therapy of ponv has been extensively proven in numerous investigations . \n primarily developed for the treatment of chemotherapy - induced nausea and vomiting , they now play an important role in modern anesthesia . \n they are considered as relatively safe single - dose adverse effects are mostly limited to headache , tachycardia , and sedation . according to the investigations of apfel and others , serotonin antagonists \n are primarily used as second- or third - line drugs in preventing or treating ponv . \n the relative expensiveness of these drugs may limit general use , considering increasing economic constraints in most health care systems . \n . showed that dexamethasone is as effective as other established anti - emetic drugs in ponv prophylaxis and therapy . \n this was confirmed by the multi - center trial of apfel et al , which demonstrated that the anti - emetic effects of dexamethasone , droperidol , and ondansetron are comparable . \n dexamethasone is also well established in the context of chemotherapy induced nausea and vomiting ; low doses provide a sufficient anti - emetic effect . \n dimenhydrinate was another anti - emetic agent used in this study and belongs to the group of antihistamines acting on histamine receptors in the chemoreceptor trigger zone . \n it is , for example , very successfully used for the treatment of motion sickness . \n its efficacy has also been proven in the context of ponv prophylaxis and therapy , although with fewer studies . \n its use in anesthesia so far appears to be less frequent , although it is safe and reasonably priced . \n drugs of these group may be problematic due to the profile of adverse effects , which include not only sedation , but also parkinson symptoms ( tremor , rigor , akinesis ) and severe arrhythmias ( torsade de pointes ) , which is why droperidol , one of the oldest and best established anti - emetics and also used in the context of ponv , was withdrawn from the german market , but subsequently relaunched . \n several investigations have shown the efficacy of metoclopramide in terms of ponv prophylaxis and therapy when it is used in high doses or in combination with other antiemetic drugs like corticoids . \n numerous investigations have shown that both metoclopramide and tropisetron may reduce intra- and postoperative nausea and vomiting in parturients with spinal anesthesia , dexamethasone reduces intraoperative nausea and vomiting , and antihistamines reduce postoperative nausea and vomiting , although data for the latter group of substances are comparatively sparse . \n previous studies in other surgical procedures , such as the multicenter trial of apfel et al . in 2004 , have also shown that anti - emetics in combination add their individual contribution to nv reduction and , therefore , are preferable , particularly in high - risk patients . \n apfel et al . demonstrated that in a combination of anti - emetics , each drug has an additional proportional effect , which means that a double or triple combination is twice or three times as effective as a single drug . \n comparison of ondansetron , dexamethasone , and droperidol , for example , shows a step - wise nv risk reduction of 30% by each individual drug , which , however , was assessed in the context of general anesthesia . in this study , we chose 2 anti - emetic combinations ( tropisetron / metoclopramide and dimenhydrinate / dexamethasone ) and a single - drug regimen consisting of tropisetron in comparison to no prophylaxis . with the combination dimenhydrinate / dexamethasone , we had an excellent anti - emetic experience in a previous investigation with patients undergoing elective breast surgery under general anesthesia . on the other hand , \n preliminary investigations have shown that tropisetron and/or metoclopramide have a good anti - emetic effect in parturient patients with spinal anesthesia . \n previous experiences have also shown that these drugs were in part randomly used and , therefore , not in a controlled , firmly - established prophylaxis . in our study , double prophylaxis with metoclopramide / tropisetron was most effective regimen and reduced nausea to 25.6% intraoperatively and to 6.1% 12 h and 1% 224 h postoperatively . \n in contrast , dimenhydrinate / dexamethasone prophylaxis significantly decreased the incidence of nausea intraoperatively to 44.2% and 12 hrs postoperatively to 5.06% and to 1% 224 h postoperatively , and was just as effective as the single prophylaxis with tropisetron ( 45.07% intraoperatively , 4.23% 02 h postoperatively , 3% 224 h , and 1.41% intraoperatively ) . in the postoperative period \n vomiting , in contrast to nausea , is rare intra- and postoperatively , and was lowered by approximately the same extent in the untreated group as in the treated groups . \n one aspect to be considered is the surgical procedure itself , which is associated with an exteriorization of the uterus and often manipulation of the peritoneum and bowel , thus irritating receptors ( e.g. , 5-ht3 and 5-ht4 type ) and the vagal nerve system , thus causing nausea and vomiting . \n in contrast to dexamethasone and dimenhydrinate , both tropisetron and metoclopramide have a direct and pronounced effect on the bowel and the upper gastrointestinal system , respectively . \n tropisetron interacts with 5-ht3 and 5-ht4 receptors in the bowel , thus influencing motility and preventing serotonin - mediated nausea and vomiting ( e.g. , induced by surgical manipulation of the bowel and intestines ) . \n metoclopramide increases forward motility of the upper gastrointestinal system , thus preventing reflux and regurgitation , but also interacts with 5 ht3 and 5 ht4 receptors as tropisetron and may additionally reduce nausea and vomiting by this mechanism . \n both agents interact via receptors at the chemoreceptor trigger zone , thus accentuating their anti - emetic effect . unfortunately , in most cases anti - \n emetic medication is given as a treatment , so the patients and their family are exposed to the unpleasant experience of intraoperative nv or ponv . \n our results suggest that prophylaxis as applied in this study can certainly reduce the onset of intraoperative nv and ponv and the associated discomfort . \n both the mono- and combination therapy with well - known and safe drugs are efficient ways of doing this . in terms of costs and adverse effect profile \n , the anti - emetic combination of tropisetron and metoclopramide appears to be superior and preferable . except for sedation \n current costs for metoclopramide / tropisetron prophylaxis are in a range of 0.150.8 euros in our hospital , compared to for example , 0.25/1.2 euros for dexamethasone / dimenhydrinate . \n although a triple anti - emetic prophylaxis may have further decreased nv and ponv incidence in this study , we did not test this due to increasing risk of significant adverse effects and is advised only in extremely high - risk patients . \n it belongs to the group of 5-ht3- or serotonin antagonists acting in the chemoreceptive trigger zone . \n efficacy of serotonin antagonists in prevention and therapy of ponv has been extensively proven in numerous investigations . \n primarily developed for the treatment of chemotherapy - induced nausea and vomiting , they now play an important role in modern anesthesia . \n they are considered as relatively safe single - dose adverse effects are mostly limited to headache , tachycardia , and sedation . according to the investigations of apfel and others , serotonin antagonists \n are primarily used as second- or third - line drugs in preventing or treating ponv . \n the relative expensiveness of these drugs may limit general use , considering increasing economic constraints in most health care systems . \n showed that dexamethasone is as effective as other established anti - emetic drugs in ponv prophylaxis and therapy . \n this was confirmed by the multi - center trial of apfel et al , which demonstrated that the anti - emetic effects of dexamethasone , droperidol , and ondansetron are comparable . \n dexamethasone is also well established in the context of chemotherapy induced nausea and vomiting ; low doses provide a sufficient anti - emetic effect . \n dimenhydrinate was another anti - emetic agent used in this study and belongs to the group of antihistamines acting on histamine receptors in the chemoreceptor trigger zone . \n it is , for example , very successfully used for the treatment of motion sickness . \n its efficacy has also been proven in the context of ponv prophylaxis and therapy , although with fewer studies . \n its use in anesthesia so far appears to be less frequent , although it is safe and reasonably priced . \n drugs of these group may be problematic due to the profile of adverse effects , which include not only sedation , but also parkinson symptoms ( tremor , rigor , akinesis ) and severe arrhythmias ( torsade de pointes ) , which is why droperidol , one of the oldest and best established anti - emetics and also used in the context of ponv , was withdrawn from the german market , but subsequently relaunched . \n several investigations have shown the efficacy of metoclopramide in terms of ponv prophylaxis and therapy when it is used in high doses or in combination with other antiemetic drugs like corticoids . \n numerous investigations have shown that both metoclopramide and tropisetron may reduce intra- and postoperative nausea and vomiting in parturients with spinal anesthesia , dexamethasone reduces intraoperative nausea and vomiting , and antihistamines reduce postoperative nausea and vomiting , although data for the latter group of substances are comparatively sparse . \n previous studies in other surgical procedures , such as the multicenter trial of apfel et al . in 2004 , have also shown that anti - emetics in combination add their individual contribution to nv reduction and , therefore , are preferable , particularly in high - risk patients . \n apfel et al . demonstrated that in a combination of anti - emetics , each drug has an additional proportional effect , which means that a double or triple combination is twice or three times as effective as a single drug . \n comparison of ondansetron , dexamethasone , and droperidol , for example , shows a step - wise nv risk reduction of 30% by each individual drug , which , however , was assessed in the context of general anesthesia . in this study , we chose 2 anti - emetic combinations ( tropisetron / metoclopramide and dimenhydrinate / dexamethasone ) and a single - drug regimen consisting of tropisetron in comparison to no prophylaxis . with the combination dimenhydrinate / dexamethasone , we had an excellent anti - emetic experience in a previous investigation with patients undergoing elective breast surgery under general anesthesia . on the other hand , preliminary investigations have shown that tropisetron and/or metoclopramide have a good anti - emetic effect in parturient patients with spinal anesthesia . \n previous experiences have also shown that these drugs were in part randomly used and , therefore , not in a controlled , firmly - established prophylaxis . in our study , \n double prophylaxis with metoclopramide / tropisetron was most effective regimen and reduced nausea to 25.6% intraoperatively and to 6.1% 12 h and 1% 224 h postoperatively . \n in contrast , dimenhydrinate / dexamethasone prophylaxis significantly decreased the incidence of nausea intraoperatively to 44.2% and 12 hrs postoperatively to 5.06% and to 1% 224 h postoperatively , and was just as effective as the single prophylaxis with tropisetron ( 45.07% intraoperatively , 4.23% 02 h postoperatively , 3% 224 h , and 1.41% intraoperatively ) . in the postoperative period \n vomiting , in contrast to nausea , is rare intra- and postoperatively , and was lowered by approximately the same extent in the untreated group as in the treated groups . \n one aspect to be considered is the surgical procedure itself , which is associated with an exteriorization of the uterus and often manipulation of the peritoneum and bowel , thus irritating receptors ( e.g. , 5-ht3 and 5-ht4 type ) and the vagal nerve system , thus causing nausea and vomiting . \n in contrast to dexamethasone and dimenhydrinate , both tropisetron and metoclopramide have a direct and pronounced effect on the bowel and the upper gastrointestinal system , respectively . \n tropisetron interacts with 5-ht3 and 5-ht4 receptors in the bowel , thus influencing motility and preventing serotonin - mediated nausea and vomiting ( e.g. , induced by surgical manipulation of the bowel and intestines ) . \n metoclopramide increases forward motility of the upper gastrointestinal system , thus preventing reflux and regurgitation , but also interacts with 5 ht3 and 5 ht4 receptors as tropisetron and may additionally reduce nausea and vomiting by this mechanism . \n both agents interact via receptors at the chemoreceptor trigger zone , thus accentuating their anti - emetic effect . \n unfortunately , in most cases anti - emetic medication is given as a treatment , so the patients and their family are exposed to the unpleasant experience of intraoperative nv or ponv . \n our results suggest that prophylaxis as applied in this study can certainly reduce the onset of intraoperative nv and ponv and the associated discomfort . \n both the mono- and combination therapy with well - known and safe drugs are efficient ways of doing this . in terms of costs and adverse effect profile \n , the anti - emetic combination of tropisetron and metoclopramide appears to be superior and preferable . except for sedation \n current costs for metoclopramide / tropisetron prophylaxis are in a range of 0.150.8 euros in our hospital , compared to for example , 0.25/1.2 euros for dexamethasone / dimenhydrinate . \n although a triple anti - emetic prophylaxis may have further decreased nv and ponv incidence in this study , we did not test this due to increasing risk of significant adverse effects and is advised only in extremely high - risk patients . \n our investigation in 308 patients experiencing cesarean section under spinal anaesthesia shows that intra- and postoperative nausea and vomiting can be significantly reduced by an anti - emetic prophylaxis combination of tropisetron 2 mg and metoclopramide 20 mg . \n therefore , this safe and reasonably priced combination should be preferred for use in preventing intraoperative nv and ponv in cesarean section patients under spinal anaesthesia .", "role": "user" }, { "content": "backgroundthis paper describes a randomized prospective study conducted in 308 patients undergoing caesarean section in spinal anaesthesia at a single hospital between 2010 and 2012 to find a suitable anti - emetic strategy for these patients.material/methodsspinal anesthesia was performed in left prone position , at l3/l4 with hyperbaric 0.5% bupivacaine according to a cc / cm body height ratio . \n there were no opioids given peri - operatively . \n the patients received either no prophylaxis ( group i ) or tropisetron and metoclopramide ( group ii ) or dimenhydrinate and dexamethasone ( group iii ) , or tropisetron as a single medication ( group iv ) . \n the primary outcome was nausea and/or vomiting ( nv ) in the intraoperative , early ( 02 h ) or late ( 224 h ) postoperative period.multivariate statistical analysis was conducted with a regression analysis and a backward elimination of factors without significant correlation.resultsall prophylactic agents significantly reduced nv incidence intraoperatively . relative risk reduction for nv by prophylaxis was most effective ( 59.5% ) in group ii ( tropisetron and metoclopramide ) . in group iii ( dimenhydrinate and dexamethasone ) \n , nv risk was reduced by 29.9% and by 28.7% in group iv ( tropisetron mono - therapy ) . \n the incidence of nv in the early ( 02 h ) and the late ( 224 h ) postoperative period was low all over ( 7.8% ) , but the relative risk reduction of nv in the early postoperative period was 54.1% ( group iv ) , 45.1% ( group iii ) , and 34.8% ( group ii ) , respectively . in the late postoperative period , there was no significant difference between the 4 groups.conclusionswe recommend a prophylactic medication with tropisetron 2 mg and metoclopramide 20 mg for patients during caesarean section . \n these agents are safe , reasonably priced , and highly efficient in preventing nausea and vomiting .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: inflammatory bowel disease ( ibd ) , which includes crohn 's disease ( cd ) and ulcerative colitis ( uc ) , is a relapsing and remitting disorder characterized by chronic inflammation of the gastrointestinal ( gi ) tract . \n the etiology of ibd remains unclear ; however , both cd and uc are associated with enhanced leukocyte trafficking to the inflamed intestine [ 1 , 2 ] . \n previous studies indicated that effector t cells including cd4-positive t helper ( th ) cells and cd8-positivecytotoxic t ( tc ) cells play pivotal roles in the pathogenesis of mucosal lesions and chronic intestinal inflammation [ 35 ] . \n blockage of lymphocyte migration to mucosal sites has therefore become a potential therapeutic strategy for ibd . \n lymphocytes migrate to specific tissues via a multistep process which is strictly regulated by adhesion molecules and chemokine receptors . \n adhesion molecules present on the vascular endothelium and lymphocytes participate in the tethering , rolling , and adhesion of lymphocytes . \n p - selectin and e - selectin appearing on activated endothelial cells interact with p - selectin glycoprotein ligand- ( psgl- ) 1 expressed by lymphocytes , which promotes the initial tethering and subsequent rolling of lymphocytes over vessel walls . \n lymphocytes expressing 47 integrins roll on mucosal addressin cell adhesion molecule- ( madcam- ) 1 , which is required for homing of lymphocytes to intestinal sites . \n lymphocyte arrest mediated by integrins , such as lymphocyte function - associated antigen- ( lfa- ) 1 ( also known as cd11a / cd18 and l2 integrins ) which interacts with their endothelial - cell ligands intercellular adhesion molecule- ( icam- ) 1 , precedes extravasation into the underlying tissue . \n chemokines are small peptides which bind to chemokine receptors expressed on leukocytes and function as chemoattractants . \n they regulate lymphocyte homing to secondary lymphoid organs and transmigration into tissues by forming a chemokine concentration gradient which attracts lymphocytes to move towards an increasing concentration . \n dysregulation of chemokines and chemokine receptors was implicated in various autoimmune diseases , including ibd [ 11 , 12 ] . \n recent studies indicated that c - c chemokine receptor type 9 ( ccr9 ) and 47 integrins are required for the localization of lymphocytes to the gi mucosa . \n agents developed for disrupting actions of ccr9 and 47 integrins showed promising results in ibd clinical trials . \n glutamine ( gln ) is an immunomodulatory nutrient which is widely used in clinical practice . \n previous studies showed that gln treatment has beneficial effects in different experimental models of colitis . \n gln attenuates the expression of proinflammatory mediators and improves outcomes which may be due to upregulation of heat shock proteins ( hsps ) . \n recent work in our laboratory demonstrated that pretreatment with gln suppresses cytokine expression of th cells and ameliorates the severity of acute dextran sulfate sodium- \n . however , whether the beneficial effects of gln are mediated by modulating lymphocyte trafficking in colitis is still unclear . \n therefore , we investigated the influence of dietary gln supplementation on t cell adhesion molecules and ccr9 expression in mice with dss - induced acute colitis . \n conventional mice were maintained in a temperature- and humidity - controlled room and were fed a standard chow diet ad libitum before the study . \n care of laboratory animals was in full compliance with the guide for the care and use of laboratory animals ( national research council , 1996 ) , and protocols were approved by the institutional animal care and use committee of taipei medical university . \n after 1 week of acclimation , 40 mice were randomly assigned to a control group or a gln group in this study , with 20 mice in each group . \n mice in the control group were fed a common semipurified diet , while the gln group received a diet in which part of the casein was replaced with gln . \n this amount of gln was proven to have an immunomodulatory effect in rodents [ 1820 ] . \n after 5 d of being fed the diets , mice in the control and gln groups were further divided into 2 respective subgroups . \n one subgroup was given distilled water , while the other subgroup received 1.5% ( wt / vol ) dss ( mw 40 kda ; mp biomedicals , solon , oh , usa ) in the drinking water for 5 d to induce colitis . \n there were 4 groups in this study : control diet with distilled water ( c group ) , gln diet with distilled water ( g group ) , control diet with dss water ( dc group ) , and gln diet with dss water ( dg group ) . \n body weights ( bws ) were recorded daily , and all mice had free access to food and water throughout the study . at the end of the experiment , mice were anesthetized and sacrificed by cardiac puncture . \n mesenteric lymph nodes ( mlns ) were removed and processed for further analysis by flow cytometry . \n the colon was cut close to the ileocecal valve , and its length and weight were measured . \n a five - color flow cytometric analysis was performed to determine the distribution of peripheral blood leukocytes . \n antibodies against mouse leukocyte surface antigens were added to 100 l aliquots of whole blood . \n the antibodies used to detect different subsets of leukocytes were as follows : percp - conjugated anti - cd45 ( biolegend , san diego , ca , usa ) for leukocytes , pe - conjugated anti - f4/80 ( ebioscience , san diego , ca , usa ) for monocytes / macrophages , fitc - conjugated anti - ly6 g ( bd biosciences , san jose , ca , usa ) for neutrophils , apc - conjugated anti - cd3 ( ebioscience ) for t cells , and pacific blue - conjugated anti - cd19 ( biolegend ) for b cells . \n after a 30 min incubation at 4c in the dark , red blood cells were lysed , and cells were suspended in staining buffer and then analyzed with a facs canto ii flow cytometer ( bd biosciences ) . \n cd45-positive cells were gated , and results are presented as a percentage of specific cd - marker - expressing cells in blood leukocytes . \n cell suspensions from mlns were obtained by passing the tissues through a nylon cell strainer with a 40 m pore size ( bd biosciences ) in rpmi1640 medium ( biological industries , kibbutz beit haemek , israel ) . \n after centrifugation at 300 g for 10 min , pelleted mln cells were suspended in 1 ml of staining buffer . \n one hundred microliters of cell suspension was incubated with apc - conjugated anti - cd3 ( ebioscience ) and pacific blue - conjugated anti - cd19 ( biolegend ) for 30 min at 4c in the dark . \n stained cells were washed and resuspended in staining buffer to measure the lymphocyte population by flow cytometry . \n percentages of t and b lymphocytes were determined by cd3- and cd19-expressing cells in mln cells . \n whole blood and mlns were used to analyze adhesion molecule- and chemokine receptor - expressing t cells . \n whole blood and mln cells obtained as described above were split into 2 vials with 100 l in each aliquot , and these were incubated with pacific blue - conjugated anti - cd4 ( bd biosciences ) or pacific blue - conjugated anti - cd8 antibodies ( biolegend ) . to investigate expressions of adhesion molecules and chemokine receptors , pe - conjugated anti - psgl-1 antibodies ( bd biosciences ) , apc - conjugated anti-47 integrin , fitc - conjugated anti - cd11a , and percp - cy5.5-conjugated anti - ccr9 ( biolegend ) were added . \n fluorescence data were recorded , and results are presented as percentages of adhesion molecule- and chemokine receptor - expressing cd4 and cd8 lymphocytes . \n total rna was isolated from colon tissue using the trizol reagent ( invitrogen , carlsbad , ca ) . \n rna ( 1 g ) was reverse - transcribed with a complementary ( c)dna synthesis kit ( fermentas , glen burnie , md , usa ) according to standard protocols . for real - time pcr , \n 5 l of 1/10 diluted cdna was amplified in a 25 l pcr volume containing 12.5 l of 2x sybr green master mix reagent ( applied biosystems , foster city , ca , usa ) . \n the reaction was performed with abi 7300 real - time pcr system ( applied biosystems ) according to the thermocycling protocol recommended by the pcr system . \n primer sequences were as follows : mouse icam-1 ( 5-agcacctccccacctacttt-3 and 5-agcttgcacgacccttctaa-3 ) , mouse p - selectin ( 5-tccaggaagctctgacgtacttg-3 and 5-gcagcgttagtgaagactccgtat-3 ) , mouse e - selectin ( 5-tgaactgaagggatcaagaagact-3 and 5-gccgagggacatcatcacat-3 ) , and mouse 18s rrna ( 5-cgcggttctattttgttggt3 and 5-agtcggcatcgtttatggtc-3 ) . \n all samples were analyzed in triplicate , and fold change for each target gene was calculated by the equation 2ct ( ct indicates the difference in threshold cycles between the test gene and 18s rrna , and ct indicates the difference of ct between the experimental and c groups ) . \n double - staining combinations cd3-cd4 and cd3-cd8 were performed on 5 m paraffin - embedded colon sections . \n after antigen retrieval , sections were incubated with an antibody against cd3 ( santa cruz biotechnology , santa cruz , ca , usa ) overnight at 4c and amplified with a rabbit anti - goat immunoglobulin g ( igg ) secondary antibody conjugated with fitc ( santa cruz biotechnology ) . \n for colocalization , sections were then costained overnight at 4c with secondary antibodies against cd4 ( abcam , cambridge , uk ) or cd8 ( novus biologicals , littleton , co , usa ) and amplified with the respective appropriate secondary antibodies : goat anti - mouse igg or goat anti - rabbit igg conjugated with rhodamine ( santa cruz biotechnology ) . \n digital images at 400x magnification per section were acquired using appropriate filters of a zeiss axiophot fluorescence microscope ( carl zeiss microimaging llc , thornwood , ny , usa ) fitted with a nikon d1x digital camera ( tokyo , japan ) . \n these images were then overlaid with dapi - staining images to determine the infiltration of t lymphocyte subpopulations in the colon mucosa . \n all data are expressed as the mean standard error of the mean ( sem ) . \n differences among groups were analyzed by an analysis of variance ( anova ) with tukey 's test . \n a two - way anova with bonferroni correction was used to analyze differences in bw changes \n there was no significant difference in bws during the study between the c and g groups . at 4 d ( d 9 ) and 5 d ( d 10 ) after dss administration \n , weight loss was observed in the dc group compared to the c group , whereas mice with gln supplementation maintained their bws during the dss exposure period . at the end of the study , \n bws were significantly higher in the dg group than the dc group ( figure 3(a ) ) . \n the weight / length ratio of the colon , an indicator of colonic edema , was significantly higher in the colitis groups than the c group ( figure 3(b ) ) . \n there was no significant difference in blood or mln leukocyte subpopulations between the c and g groups . \n compared to the c group , the dss colitis groups had a higher percentage of blood neutrophils and lower t - cell population in mlns . \n also , subsets of effector t cells in the blood and mlns did not change . \n gln supplementation had no influence on blood leukocyte or mln lymphocyte populations in normal or colitic mice ( table 2 ) . \n percentages of adhesion molecules and ccr9 expressed by blood and mln th cells did not differ between the c and g groups . \n dss administration resulted in higher psgl-1 , cd11a ( lfa-1 l subunit ) , and ccr9 expressions by th cells in both blood and mlns , whereas no difference in 47 integrin expression was detected among the control and dss groups . \n mice in the dg group had lower percentages of psgl-1- , cd11a- , and ccr9-expressing th cells in blood ( figures 4(a)4(d ) ) and mlns ( figures 5(a)5(d ) ) . \n the expression level of ccr9 on 47-positive th cells was also suppressed in the dg group ( figures 4(e ) and 5(e ) ) . \n no differences in adhesion molecules and ccr9 expressed by blood and mln tc cells were observed between the c and g groups . \n the dss colitis groups had higher percentages of psgl-1- , cd11a- , and ccr9-expressing blood and mln tc cells , whereas expression levels of 47 integrins did not differ among the 4 groups . \n compared to the dc group , the dg group had lower expression of cd11a by blood ( figures 6(a)6(d ) ) and mln tc cells ( figures 7(a)7(d ) ) . \n there was no difference in expression levels of ccr9 on 47-positive tc cells between the 2 dss colitis groups ( figures 6(e ) and 7(e ) ) . \n there was no difference in mrna levels of icam-1 , p - selectin , and e - selectin between the c and g groups in colon tissues . \n dss - induced colitis greatly upregulated the adhesion molecule genes expressed by activated endothelial cells . \n compared to the dc group , the expression levels of icam-1 , p - selectin , and e - selectin mrna were suppressed in the dg group ( figure 8) . \n cd3 and cd4 double - positive cells are considered th cells , whereas tc cells coexpress cd3 and cd8 . as shown in figure 9 , \n the immunoreactive intensity of th cells was higher in the dc group than the dg group . \n however , intensities of tc cell populations did not differ between the dc and dg groups ( figure 10 ) . \n dss is a heparin - like polysaccharide which results in acute chemical toxicity that disrupts the intestinal epithelial cell barrier . \n dss - induced colitis is characterized by extensive crypt and epithelial cell damage with ulceration , tissue edema , and infiltration of immune cells predominantly in the distal colon that mimics the histological features of uc . \n recent studies indicated that dss - induced morphological and biochemical damage also extends to the small intestines . \n a single cycle of dss exposure to the c57bl/6 strain was found to develop acute colitis which later proceeds to chronic inflammation , and t cell migration to the colon plays an important role in the progression to chronicity . \n regarding the high sensitivity to dss , c57bl/6 mice were used in this study to analyze the consequences of dss exposure on adhesion molecules and chemokine receptors involved in t cell trafficking to the intestines . \n previous studies indicated that increased local secretion of proinflammatory cytokines by the inflamed colon leads to upregulated expressions of vascular adhesion molecules , resulting in a sustained influx of inflammatory cells . \n although inflammation predominantly occurs in the gi tract , ibd patients are likely to develop extraintestinal manifestations that may be attributed to aberrant activation and homing of t cells . \n a recent study indicated that circulating cd4 and cd8 t cells are activated in both cd and uc patients , and these cells were correlated with leakage of microbial products from the impaired intestinal barrier . \n also , the severity of dss - induced colitis was correlated with the immune response of mlns . \n our results indicated that expressions of adhesion molecules and ccr9 on th cells and tc cells significantly increased in both blood and mlns after dss exposure . \n these findings suggest that both local and systemic t cells are activated . the role of th cells in the pathogenesis of ibd has been widely studied . \n dysregulation of th cells can lead to immune cell infiltration into the intestinal mucosa and cause persistent inflammation [ 3 , 6 ] . \n a previous study showed that antigen - specific tc cells caused relapsing colitis in normal mice due to the cytolytic function against the intestinal epithelium . \n reported a gene expression profile of circulating cd8 t cells that predicted a more aggressive disease course for ibd patients . \n nave t cells constantly recirculate between the blood and secondary lymphoid organs . once activated in secondary lymphoid organs , \n they become effector t cells that express adhesion molecules and chemokine receptors which control their extravasation into nonlymphoid tissue sites . \n t cell trafficking to the gut and gut - associated lymphoid tissues ( galts ) requires 47 integrins . \n the ligand madcam-1 is constitutively expressed by the mucosal endothelium in the small intestine and colon . \n ccr9 is thought to participate in the specific localization of t cells to the small intestines because the sole ligand for ccr9 , c - c chemokine ligand 25 ( ccl25 ) , is strongly expressed by the small intestinal epithelium \n . however , wurbel et al . revealed that ccl25 expression increased during the recovery phase after acute dss administration , suggesting a regulatory role of ccr9/ccl25 interactions during colonic inflammation . in this study \n , percentages of psgl-1- , lfa-1- , and ccr9-expressing t cells were upregulated in acute dss colitis , whereas expression levels of 47 integrins in colitic mice did not differ from those of normal mice . \n it is possible that t cell trafficking into the gut during acute dss exposure is less dependent on 47 integrins . in support of our findings , \n wang et al . reported that localization of t cells to the intestines was relatively unaffected by 47 blockade during acute dss - induced colitis . \n gln supplementation attenuates gut injury by a complex mechanism , which involves protecting the epithelial barrier function , reducing oxidative stress , and modulating inflammatory responses . \n the local and systemic immunomodulatory effects of gln have been discussed in various experimental colitis models via different administration routes . \n studies using rodents with trinitrobenzene sulfonic acid - induced colitis indicated that gln given by the rectal route inhibits nuclear factor ( nf)-b- and stat - mediated inflammation in colon tissues and further prevents colon fibrosis through downregulating gene pathways that contribute to the accumulation of matrix proteins . \n we recently demonstrated that intraperitoneal pretreatment with alanyl - gln , a gln - containing dipeptide widely used in parenteral nutrition , suppresses cytokine expression in blood th cells , reduces nf-b - mediated inflammatory responses in the colon , and upregulates expressions of genes which promote recovery of the colonic mucosa [ 17 , 38 ] . \n because most exogenous gln is absorbed in the proximal small intestine , it might not reach the inflamed colon at a sufficient concentration to modulate inflammatory responses . however , the enteral route of gln administration still showed protective effects against dss - induced damage . \n oral gln supplementation reduced the feces water content , enhanced expression of hsps in the colonic mucosa , and ameliorated colon injury caused by dss exposure [ 16 , 39 , 40 ] . \n a previous study indicated that oral gln attenuated leukocyte adhesion and emigration in a rodent model of indomethacin - induced ileitis . in this study \n , we demonstrated that oral gln administration suppressed adhesion molecules and ccr9 expressed by t cells and downregulated the mrna levels of adhesion molecules expressed by endothelium in colon tissues . \n the histological findings also support the results that gln administration suppressed the infiltration of th cells into the colon mucosa . \n gln consumption is an important component of t cell activation [ 42 , 43 ] . \n different susceptibilities of th and tc cells to gln supplementation may be explained by a higher cell population of th cells , which competes as a gln source with tc cells . \n further studies are needed to investigate the molecular mechanisms involved in gene expressions of adhesion molecules and ccr9 regulated by gln . in conclusion , this study showed for the first time that pretreatment with oral gln reduced adhesion molecule- and ccr9-expressing t cells induced by dss exposure . \n the inhibitory abilities against adhesion molecule and ccr9 expressions were more obvious in th cells than tc cells . also , gln supplementation reduced gene expressions of endothelial adhesion molecules in colons , prevented bw loss , and attenuated colon edema in colitic mice . \n our results imply that dietary gln prevented th cell trafficking into colon tissues and provide a new mechanism of gln supplementation that has beneficial effects on ameliorating the severity of acute dss - induced colitis .", "role": "user" }, { "content": "background . migration of t cells into the colon plays a major role in the pathogenesis in inflammatory bowel disease . \n this study investigated the effects of glutamine ( gln ) supplementation on chemokine receptors and adhesion molecules expressed by t cells in mice with dextran sulfate sodium- ( dss- ) induced colitis . \n methods . \n c57bl/6 mice were fed either a standard diet or a gln diet replacing 25% of the total nitrogen . after being fed the diets for 5 days , half of the mice from both groups were given 1.5% dss in drinking water to induce colitis . \n mice were killed after 5 days of dss exposure . \n results . \n dss colitis resulted in higher expression levels of p - selectin glycoprotein ligand- ( psgl- ) 1 , leukocyte function - associated antigen- ( lfa- ) 1 , and c - c chemokine receptor type 9 ( ccr9 ) by t helper ( th ) and cytotoxic t ( tc ) cells , and mrna levels of endothelial adhesion molecules in colons were upregulated . \n gln supplementation decreased expressions of psgl-1 , lfa-1 , and ccr9 by th cells . \n colonic gene expressions of endothelial adhesion molecules were also lower in gln - colitis mice . \n histological finding showed that colon infiltrating th cells were less in the dss group with gln administration . conclusions . \n gln supplementation may ameliorate the inflammation of colitis possibly via suppression of t cell migration .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: who has declared leishmaniasis as one of most serious parasitic diseases and a public health problem in many countries worldwide ( 1 , 2 ) . \n it is responsible for high morbidity and mortality in developing countries and the number of human cases have increased during the past decade ( 3 , 4 ) . on the other hand , dogs are the principle reservoirs for l. infantum , the causative agent of visceral leishmaniasis ( vl ) in most countries , and play an important role in the transmission to human being ( 3 , 5 , 6 ) . over 50 years , pentavalent antimonials have remained the mainstay compounds used for treating both human visceral leishmaniasis ( hvl ) and cvl in most parts of the world ( 7 , 8) . \n although there are many agents for treatment of infected dogs such as amphotericin b , antimonials , aminosidine and allopurinol , definitive curative treatment is not exist . \n the treatment options currently available are limited and the susceptibility of leishmania parasites decrease progressively ( 9 ) . in human , \n pentamidine is mainly used for hvl treatment but its efficacy is questionable in comparison with other agents ( 10 , 11 ) . \n the first oral agent used for the treatment of hvl and zoonotic visceral leishmaniasis ( zvl ) is miltefosine ( 8 , 11 , 12 ) . \n paromomycin and sitamaquine were effective and well tolerated for leishmaniasis treatment ( 8 , 11 , 13 , 14 ) . \n many researchers hint to some new synthetic components such as btb06237 , derivatives of thiadiazole and new series of quinoline tripartite hybrids from chloroquine & ethambutol ( 8 , 15 - 17 ) . \n many in - vitro & in - vivo studies and experimental / clinical trials have confirmed the immune - chemotherapy cohort s advantages ( 4 , 18 - 24 ) . \n virtually no treatment will completely eliminate parasites from the infected animal , and even if temporary clinical improvement is achieved a relapse is to be expected weeks to years after drug withdrawal ( 9 ) . \n the biological activity of herbal crude extracts comes from alkaloids , flavonoids , phenylpropanoids , steroids and terpenoids in aloeaceae family , annonaceae family , apocynaceae family & etc ( 8 , 25 ) . in the literature , there are many works by researchers and research institutes around the world to discover natural compounds with anti - leishmania activities ( 8 , 11 , 25 , 26 ) . in this regard , imod is a herbal mixture of rosa canina , urtica dioica , and tanacetum vulgare in addition to selenium . \n imod has been patented in europe for its potential in decreasing oxidative stress , reduction of tumor necrosis factor activity , improving t helper lymphocytes in hiv positive patients , effectiveness in experimental models of immunoinflammatory - based diseases and reduction of patient s mortality rate in intensive care unit ( icu ) without any mutagenic and genotoxic effects ( 27 ) . \n imod has been well tolerated without any adverse effects in human & animals ( 28 - 38 ) . \n although in recent years many research programs have been focused on anti - leishmania agents but most of these regimens had limitations such as toxicity , cost , long - term therapy , availability , adverse effects and developing parasite resistance ( 8 , 9 , 39 ) . \n therefore , identifying a safe and effective alternative treatment for cvl is the main goal of this preliminary trial . \n twenty healthy mongrel dogs ( males and females ) aging from 1 to 4 years were selected for this trial . \n dogs were kept in individual cages in small animal hospital , faculty of veterinary medicine , university of tehran . \n after one month adapting period , all dogs were examined , vaccinated against common diseases ( dh2ppil and rabvac-1 , fort dodge animal health , usa ) and treated with the anthelmintic drugs . \n all dogs were serologically tested to be free of anti - leishmania antibody by direct agglutination test ( dat ) ( 4 ) . \n inoculation protocol \n amastigotes in compare with promastigotes seem to be more effective in inducing experimental infection and producing significant clinical symptoms at shorter period ( 37 ) . \n so , we used a naturally infected poly - symptomatic dog from a well - known endemic area , meshkin - shahr district , in northwest of iran ( 20 ) . \n donor dog was diagnosed by clinical examination and rk39 dipstick ( diamed - it leish , belgium ) ( 40 ) . \n definitive diagnosis achieved by serological screening ( dat ) followed by bone marrow puncture and parasitological confirmation . \n isolated parasite was identified as l. infantum by pcr - rflp technique using primers derived its1 gene and haeiii restricted enzyme ( figure 1 ) ( 41 ) . \n lane 1 : leishmania major ; lanes 2 - 4 : l. tropica ; lane 5 : negative control ; lanes 6 and 7 : l. infantum ; m : molecular weight marker the spleen of donor dog was removed by surgical laparoscopy procedure in aseptic condition and in the same manner of other authors ( 6 , 20 ) ; then the spleen chopped to small pieces , macerated in normal saline solution in a grinder and diluted to provide desired amastigote count ; 3 - 5 ml ( based on body weight of dogs ) of the spleen homogenate containing at least 10 amastigotes / ml was injected intravenously to 16/20 dogs . \n dogs were randomly divided into five groups with four animals each and were treated using the following protocols : ( a ) group i : negative control as an environment control and did not receive any injection ; ( b ) group ii : received glucantime ( sanofi aventis pharmaceutical co. , france ) 100 mg / kg / day , for 30 days consecutively ( 42 ) ; ( c ) group iii : received glucantime in the same dosage as group ii plus infusion of imod ( rose pharmed biotechnology co. , tehran , iran ) , 2 mg / kg with 100 ml dw 5% over 1 hour , every other day for one month ( based on manufacturer recommendation ) ; ( d ) group iv : received infusion of imod in the same dosage as group iii ; and ( e ) group v : positive control which received sterile normal saline ( table 1 ) . the base line characteristics in different groups of dogs ( data represented as meanse ) . \n animals were monitored regularly by clinical examination , hematological and serological tests on days 30 , 60 , 90 and 120 after the inoculation . for confirmation of parasite establishment and subsequent leishmania infection , \n the mentioned samples underwent giemsa staining followed by light microscope observation for parasite detection . \n the animals were clinically examined each day for monitoring any complications during the treatment period . \n clinical signs associated with cvl were evaluated and monitored at monthly intervals up to 90 days after the end of treatment . \n a complete blood cell count and biochemistry profile ( liver , kidney and electrolytes ) were done for all dogs . \n dat was done and anti - leishmania antibody titers were considered positive at 1:320 ( 4 ) . for evaluating the spleen size , ultrasonography was performed before and after treatment periods . at the end of the experiment , \n all the animals were anesthetized and bone marrow and spleen biopsies were obtained for parasitological evaluation ( 43 - 45 ) . using an i.v . \n liver and spleen samples of all dogs were taken for histopathological evaluation . in brief , imod ( rose pharmed biotechnology co. , tehran , iran ) is the herbal mixture of rosa canina , urtica dioica , tanacetum vulgare and selenium exposed to a pulsed electromagnetic field and dispensed into sterile ampoules for research use . \n each ampoule contains 125 mg of active ingredients in 4 ml solvent ( 27 ) . \n the trial was reviewed and approved by the ethical committee of university of tehran and conducted according to the principles of laboratory animal care . \n statistical analysis \n all data were analyzed with t - test in pre - inoculation and pre - treatment periods within each group . \n repeated measure one - way anova and tukey multiple comparison post - hoc tests were performed between groups in different times . \n the influence of different treatment protocols on clinical signs was evaluated using descriptive analysis such as mcnemar and fisher s exact tests . \n all the analyses were performed by spss ver.16 ( chicago , il , usa ) . \n clinical manifestations \n in this experimental study , the most common clinical post - inoculation manifestations were weight loss ( 16/16 ) , lymphadenopathy ( 15/16 ) , pneumonia ( 13/16 ) and lethargy ( 8/16 ) . \n skin lesions ( 1/16 ) and hemorrhagic rhinitis ( 1/16 ) were detected as lowest clinical signs . \n in contrast to the group ii , lymphadenopathy resolved 30 days after treatment in groups iii & iv . \n pneumonia was deteriorated in groups ii & iv and resolved in group iii ( immune - chemotherapy ) 30 days after treatment . in animals treated by immune - chemotherapy , \n lethargy disappeared gradually after 30 days whereas this finding was not detected in groups ii & iv . \n one of the lowest clinical sign frequencies ( 3/16 ) was nasal mucopurulent discharge which showed no significant difference between pre- and post - treatment periods . despite medical intervention , skin lesions and asymmetric alopecia ( 2/16 ) \n based on statistical analysis lymphadenopathy , pneumonia and lethargy showed no significant differences ( p=0.08 ) . \n 60 days post - treatment , weight loss had shown significant difference ( p=0.02 ) in group iii ( figure 2 ) . \n mean body weight changes before and following interventions in different groups of dogs . in post - inoculation period \n , the significant hematological changes in all groups were increasing red blood cell distribution width ( rdw ) , decreasing packed cell volume ( pcv ) , neutropenia , monocytosis and lymphocytosis . \n 30 days after treatment , hematologic changes showed significant difference ( p=0.02 ) between group iv and group v. these differences were not significant 60 days after treatment in mentioned groups ( iv&v ) which may be due to deterioration of clinical signs . in groups ii & iii , hematological profiles showed no significant differences during the treatment periods . \n all the hematological parameters were reduced in control positive animals until the end of study . based on biochemistry profile analyses , significant elevation of blood glucose and triglyceride \n blood urea nitrogen ( bun ) , albumin , mg and clalso showed significant reduction in infected dogs . in all treated groups , total protein , albumin , bun and liver enzymes ( alt & ast ) did not show any significant differences between inoculation and treatment periods . \n in imod ( iv ) group , cholesterol , hdl & ldl showed significant differences ( p=0.01 , 0.02 , 0.02 respectively ) 30 days after treatment but these findings did not remain until the end of study . \n 30 days after treatment , serum calcium level showed statistically significant difference ( p=0.009 ) between group i & group ii . \n 60 days following the treatment , changes in phosphorus level were not significant but after this time , significant reduction trend ( p=0.02 ) was detected in imod group . at the end of the study ( 90 days after treatment ) \n , there was significant difference between groups ii and v in serum cl level . comparing with control positive group , a significant reduction ( p=0.02 ) in serum na level \n differences for the other serum electrolytes such as fe , mg and k were not noticeable during treatment periods . based on serological results , all dogs had positive titers ( 1:320 ) 60 days following inoculation . in this experiment 60 days after treatment , a number of dogs in groups ii ( chemotherapy ) , iii ( immune - chemotherapy ) and iv ( immunotherapy ) showed reduction of anti - leishmania antibody titers ( 4/4 , 3/4 and 2/4 dogs , respectively ) . \n in all treated groups , decreasing of dat titers were significant 60 days after treatment , however none of them became seronegtive ( < 1:320 ) ( figure 3 ) . \n ( 2=1:160 , 3=1:320 , 4=1:640 , 6=1:2560 , 8=1:10240 , 9=1:2048 ) . in this study , \n to evaluate the effects of various treatments on possible splenomegaly and reducing parasitic load in pre-/post- treatment periods , the spleen sizes of all dogs were measured by ultrasound device ( vivid7 , general electric , usa ) . \n 30 days after treatment , a significant differences ( p=0.046 ) in spleen sizes were detected between groups iii & v. the differences of spleen size between group iv and group v were significant ( p=0.02 ) 60 days after treatment , as well . to confirm definitive infection of dogs , 120 days post - inoculation , parasitological evaluation of bone marrow punctures \n , amastigotes were detected in 12/16 bone marrow aspirations by light microscopy and remaining samples were confirmed by parasite culture . \n the spleen biopsies remained positive in treated animals at the end of experiment , except one dog ( 1/4 ) in group ii and one ( 1/4 ) in group iii , which became negative for leishman bodies . \n formalin - fixed spleen & liver samples were processed through paraffin embedding , sectioned at 4 m with a rotary microtome , placed on a glass slide , stained with hematoxylin & eosin and evaluated microscopically . in this experiment , \n histopathological findings for liver samples were as follows : mixed cell inflammation , peritubular and bile duct fibrosis which were not significantly different among control ( i & v ) and treated ( ii , iii & iv ) groups . in group ii , except in one dog ( 1/4 ) with local hemorrhage , marginal zone hyperplasia was detected in spleen tissue sections ( 3/4 ) . \n marginal zone & follicular hyperplasia were observed in all dogs treated by immune - chemotherapy ( 4/4 ) . in groups \n i , iv and v marginal zone hyperplasia were evaluated in spleen sections as well ( table 2 ) . \n frequencies of histopathological changes of liver and spleen in treated and control dogs at the end of study . \n : number of positive / number of negative ; mzh : marginal zone hyperplasia ; fh : follicular hyperplasia ; lh : local hemorrhage ; mci : mixed cell inflammation ; pf : peri - tubular fibrosis ; bdf : bile duct fibrosis . \n canine visceral leishmaniasis ( cvl ) caused by leishmania infantum is the main reservoir for human infection which is a zoonosis potentially fatal to humans and dogs ( 47 ) . \n induction of parasite resistance , lack of parasitological clearance , expense and toxic effects caused limitations of conventional therapies progressively ( 9 ) . \n the host s immune system plays a fundamental role in the establishment of infection and in therapeutic response . \n so , further effective and safe alternative anti - leishmania or potential immunomodulator agents in addition to conventional therapeutic regimens seem necessary . \n this is the first trial evaluating a novel herbal medicine , imod , for treating experimental cl . \n ( 44 ) , spleen of dog and hamster is suitable organ for experimental inoculation because of higher parasite burden due to the low level of ifn-. so , in this experiment , we inoculated the suspension of live parasites derived from the spleen of donor dog to our dogs through i.v . injection . in this way , \n the natural process is accelerated and induces a stronger immunity response and more obvious clinical symptoms in dogs . for designing experimental studies , time and cost saving are the advantages of using the mentioned protocol ( 6 , 20 ) . \n over 50 years , the use of chemotherapy , based on pentavalent antimonials , has made them as the first step for treating vl in both human and dogs . \n however , due to recently development of drug resistances associated with various leishmanial species ( 5 ) , the need for new agents is more emphasized . \n pentavalent antimonials inhibit two essential enzymes ( phosphofructokinase and dehydrogenase pyruvate ) for parasite survival ( 21 , 48 , 49 ) but in dogs has been mostly unsuccessful . \n although major clinical signs of disease disappear after treatment , this might not indicate the complete absence of parasites in spleen or bone marrow ( 30 ) . \n combination of anti - leishmania agents with vaccines and/or immunomodulator drugs might enhance drug efficacy , stimulate patient immunity and reduce the potential adverse effects of conventional treatment ( 7 , 8 , 11 , 19 - 21 ) . \n the complex nature of cl and its clinical manifestations make its management difficult . all the infected dogs in this experiment were categorized in stage ii and iii , based on staging of canine vl by leish - vet group ( 47 ) . \n the most prominent clinical signs in this trial as also found in naturally infected dogs were lymphadenopathy and weight loss which could be seen along with other clinical signs or clinicopathological abnormalities ( 20 , 21 , 42 , 47 ) . results of glucantime therapy ( group ii ) showed that some clinical signs such as pneumonia were disappeared 60 days after treatment period ; the other manifestations such as lymphadenopathy , lethargy and skin lesions reappeared 30 days after treatment . \n in group ii , reduction of anti - leishmania antibody titers were detected 60 days after treatment , however none of dogs in this group became seronegative ( < 1:320 ) at the end of study . in group iii ( glucantime plus imod ) , \n although remission of clinical signs were seen 30 days after treatment followed by normal hematobiochemistry profiles and reduction of anti - leishmania antibodies after 60 days but negative serological results were not detected by the end of study . \n these findings are also reported by other authors regarding different immune - chemotherapy protocols for cl ( 6 , 8 , 20 - 22 , 24 , 46 ) . resistance to leishmaniasis \n is well known due to cell mediated immunity and the balance of the th1 ( il-2 , ifn- & tnf)/th2 ( il-10 & il-4 ) responses ( 20 , 21 , 24 , 42 ) . \n lack of cell reactivity particularly when specific antibody titers are high is confirmed in patients with acute vl . \n so , a treatment that provides clinical recovery and reduces anti - body titers , at least partially , is highly desirable ( 21 ) . at the end of monitoring period ( day 90 ) , \n one dog from groups ii and one in group iii were clinically treated as confirmed by the conversion of parasitological parameter and according to the clinical classification of leish - vet group ( 47 ) ; this finding was further confirmed by pcr negative results . \n the clinical recovery in groups ii & iii could be related to the use of the glucantime and the immune - chemotherapy protocol and higher cellular reactivity to leishmanial antigens . \n unlike group ii , dogs from group iii ( immune - chemotherapy ) showed clinical signs improvement in a shorter time ( approximately 30 days ) with no relapse . in group iv , imod administration as an immunomodulator drug was not associated with clinical adverse effects and the evaluation of hematological and biochemical ( renal and hepatic function and electrolytes ) tests showed no remarkable changes . \n shortly after imod therapy , decreasing in the spleen sizes were detected ( p=0.02 ) ; this finding may be associated with parasite load reduction . \n however based on parasitological and pcr evaluation , the imod had no effect for parasite elimination in this experiment . in agreement with khorram khorshid et al . \n ( 31 ) , histopathological evaluation for liver and spleen samples showed no significant differences with control groups ( table 2 ) . \n based on some studies , the herbs and selenium in this complex have strong anti - oxidative stress potential and immunomodulator mettalo - enzyme , respectively ( 29 , 50 - 51 ) . as reported by other authors ( 35 ) , an important point that deserves further research was the observation that no adverse effects occurred in the animals with imod therapy . \n on the other hand , animals in group iii ( immune - chemotherapy ) showed better clinical conditions and significant decreasing in spleen size ( p=0.046 ) comparing with group ii ( chemotherapy ) . although , the number of animals in each group was not large enough to ensure a statistical analysis due to many problems associated with experimental studies , this was a considerable result . \n these results suggest that imod can be an important adjuvant for anti - cl therapeutic protocol that causes resolving in clinical staging . \n therefore , the institution of an immune - chemotherapeutic protocol constituted of imod with glucantime may help to open new windows for treatment of leishmaniasis , consequently decreasing the clinical manifestation . \n this is a very interesting possibility that needs further investigation for both leishmaniasis and the other immune mediated diseases . in conclusion , \n these experimental data suggest that administration of imod in combination with conventional treatment reduce the developing of clinical signs in shorter period and improved the quality of patients life . but the relatively low number of animals in each studied groups , short follow - up period and the possible presence of other differences such as individual characteristics make these data insufficient to draw any conclusion regarding the curative effect of imod in this disease . for confirmation of these data , more clinical and/or experimental studies and extending follow - up period after treatment with using real - time pcr ( 43 , 46 , 47 ) are recommended .", "role": "user" }, { "content": "toxicity and drug resistance against pentavalent antimonials , medications of choice in treatment of leishmaniasis for more than 5 decades , have become important subjects globally.this study was a randomized , open labeled trial that was designed to determine efficacy and safety of imod as a novel herbal immunomodulator drug for treatment of canine visceral leishmaniasis ( cvl).twenty healthy mongrel dogs were infected with iranian strain of l. infantum amastigotes and randomly divided to 5 groups with four animals for each included on : i : negative control ( non - infected ) ii : glucantime iii : glucantime plus imod ( immune - chemotherapy ) iv : imod and v : positive control ( non - treated ) . \n physical examination , hematological , biochemical , serological , parasitological , pathological and imaging evaluations were performed pre-/post- interventions every month for 3 months.comparing with control groups ( i&v ) , immune - chemotherapy group ( glucantime plus imod ) showed significantly higher efficacy in resolving the clinical signs and hematobiochemistry factors . based on our results , using imod in combination with meglumine antimoniate ( glucantime ) has significantly improved cvl than the latter drug alone . \n so , it seems this new herbal medicine is useful as adjuvant therapy for canine visceral leishmaniasis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: mixed lineage kinase like poly - adp ribose polymerase 1 receptor interacting protein kinase 3 tumor necrosis factor \n regulated cell death represents an important biological response with major roles during development and in tissue homeostasis . \n apoptosis , the prototypic and best - known cell suicide program , is often considered a silent form of cell death due to its lack of inflammation and efficient clearance mechanisms . \n this well - defined mode of destruction is orchestrated by a signaling cascade led by caspases , and is characterized by the integrity of the cell membrane until engulfment by phagocytes , ensuring minimal cytoplasmic release during the cell death process . similarly ordered forms of cell death , albeit with opposite proinflammatory consequences , are now being recognized in numerous pathophysiologic settings . \n morphologically similar to accidental necrosis , most of these forms of cell death share the capacity to release , often as a direct consequence of loss of membrane integrity , intracellular molecules endowed with the capacity to alert the immune system and therefore to initiate an inflammatory response . \n the signaling cascades regulating these types of necrotic cell death are exceedingly diverse , often ascribed to a particular and well - defined stimulus or cell type , and their identification and descriptions have been abundantly discussed in the literature . \n cell demise as a result of metabolic stress deserves particular attention , based notably on its pathologic consequences when proceeding uncontrolled . \n in particular , death secondary to dna strand breaks has been ascribed to the excessive activity of poly - adp ribose polymerase 1 ( parp1 ) , an enzyme that catalyzes the transfer of successive units of nicotinamide adenine dinucleotide ( nad)-derived adp - ribose to several nuclear proteins , including parp1 itself . \n this post - translational modification has been shown to facilitate dna repair and protect against moderate genotoxic stress . \n high levels of dna damage can , however , lead to a severe depletion of intracellular nad pools , a key step that , depending on cell type and metabolic status , can lead to further loss of atp , reduced mitochondrial function , and release of cell death - inducing factors . despite some diversity in the signaling pathways at work , loss of intracellular nad \n appears to represent a key step in a growing number of modes of cell death ( termed parthanatos , oncosis , or regulated necrosis , depending on cell origin , intracellular mediators , and stimuli ) . \n remarkably , a sharp reduction in the intracellular content of an important cell metabolite does not merely cause cell death by sabotage \n ( i.e. , the inability to sustain basic cellular functions ) , but rather sets in motion a series of signaling cascades leading to the execution of a well - controlled , regulated cell death response . \n these observations have led to the concept of nad as a survival factor , \" endowing cells with the capacity to resist environmental stress in response to oxidative damage ( such as increased endogenous reactive oxygen species production ) or upon exposure to natural ( i.e. , ultraviolet irradiation ) or pharmacologic alkylating agents . \n this conclusion has been further strengthened by the discovery that exogenous and endogenous nad can also oppose other forms of cell death , including apoptosis . with these notions in mind , \n we have undertaken a series of experiments to further assess the putative survival properties of nad during necroptosis , a recently uncovered mode of cell death that is of particular interest for human pathology . \n necroptosis displays all the hallmarks of regulated cell death characterized by a well - described , caspase - independent , signaling cascade , with a prominent role for the receptor interacting protein kinase 3 ( ripk3 ) and its substrate mixed lineage kinase like ( mlkl ) in mediating a form of regulated cell necrosis . of note , \n a member of the caspase family ( caspase 8) has been identified as a negative regulator of necroptosis , indicating a possible antagonism between apoptosis and this form of regulated cell death . \n accordingly , in several experimental settings pharmacologic inhibition of caspase activity shifts the predominant mode of cell death from a non - inflammatory apoptotic mode to necroptosis . \n this observation has led many authors to propose that necroptosis may represent a back - up cell death mechanism to counteract the antiapoptotic , prosurvival strategy devised by many pathogens , as suggested by several in vivo studies . \n alternatively , necroptosis may represent a preferred response that enables dying cells to alert the immune system . using a well - described in vitro cell line able to undergo both apoptosis and necroptosis in response to extracellular agonists \n antibodies to fas ( also known as cd95 or tnfrsf6 ) and tumor necrosis factor ( tnf ) , respectively we have recently demonstrated that although intracellular nad protects cells from apoptosis and parp1-dependent necrosis , it is required for and promotes the necroptotic response ( fig . 1 ) . \n thus , and in marked contrast to the widely held view , intracellular nad does not act as a \n universal cell survival factor , but rather acts as a key metabolite regulating the choice of cell demise . \n intracellular nad appears to modulate necroptosis by acting on members of the sirtuin family , a group of nad - dependent deacylases with previously described roles in many biological responses including apoptosis . \n poly - adp ribose ( par ) polymerase 1 ( parp1)-activating agents lead to a reduction in intracellular nad content and accumulation of par polymers ; both events contribute to necrotic cell death . \n nad can be replenished via multiple biosynthetic pathways using nicotinic acid ( na ) , nicotinamide riboside ( nr ) , and nicotinamide ( nam ) as starting precursors . in most cells , the conversion of nam into nicotinamide mononucleotide ( nmn ) catalyzed by nicotinamide phosphoribosyltransferase ( nampt ) \n represents a major nad biosynthetic step that can be specifically targeted by nampt inhibitors such as fk866 or chs828 . \n nampt inhibition often causes an effective reduction in intracellular nad concentration , sensitizing cells to most forms of regulated cell death with the notable exception of necroptosis . \n poly - adp ribose ( par ) polymerase 1 ( parp1)-activating agents lead to a reduction in intracellular nad content and accumulation of par polymers ; both events contribute to necrotic cell death . \n nad can be replenished via multiple biosynthetic pathways using nicotinic acid ( na ) , nicotinamide riboside ( nr ) , and nicotinamide ( nam ) as starting precursors . in most cells , \n the conversion of nam into nicotinamide mononucleotide ( nmn ) catalyzed by nicotinamide phosphoribosyltransferase ( nampt ) represents a major nad biosynthetic step that can be specifically targeted by nampt inhibitors such as fk866 or chs828 . \n nampt inhibition often causes an effective reduction in intracellular nad concentration , sensitizing cells to most forms of regulated cell death with the notable exception of necroptosis . \n indeed , the recently developed concept of immunogenic cell death posits that cells dying in a \n non - silent fashion possess the capacity to inform the immune system of the level of threat caused by cell damage . shifting the tumor cell death program from a silent ( mainly apoptotic ) process to a proinflammatory form \n therefore represents a promising avenue for improving conventional chemotherapy . in this context , the contrasting effects of intracellular nad ( promoting cell survival in response to genotoxic damage but favoring ripk3-dependent cell death ) suggest caution in devising chemotherapeutic approaches targeting nad metabolism . \n pharmacologic agents inhibiting nad biosynthesis have indeed been shown to synergize with alkylating agents in reducing tumor cell viability . \n in contrast , pharmacologic and nutritional compounds able to increase nad biosynthesis may best support antitumor therapies relying on ripk3-dependent cell demise . \n further studies are therefore warranted to better understand the intricate regulatory pathways linking nad to cell survival and death . \n \n \n we wish to acknowledge the support of the belgian program in interuniversity poles of attraction initiated by science policy programming , belgium and the research concerted action of the \" fdration wallonie - bruxelles \" for financial support .", "role": "user" }, { "content": "abstractthe mechanisms regulating the choice of cell demise remain largely unknown . \n nad+ , a key metabolite with well - known roles in cell metabolism , has been shown to counteract apoptosis while promoting necroptosis , a form of proinflammatory cell death . \n this observation identifies nad+ availability as an important parameter with contrasting roles in the regulation of distinct regulated cell death programs .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: pycnodysostosis was first described in 1962 by maroteaux and lamy . it is a rare autosomal - recessive disorder \n the name derives from the greek words pycnos ( dense ) , dys ( defective ) , and ostosis ( bone ) . \n the disorder is also known as tou - louse - lautrec syndrome , named after the french artist who suffered from pycnodysostosis.1 the principal characteristics of this disorder are short stature , cranial dysplasia , clavicular dysplasia , total / partial dysplasia of the terminal phalanges , obtused mandibular gonial angle , and generally increased bone density.2 intraoral features include persistence of deciduous teeth with premature or delayed eruption of the permanent teeth , which can cause crowding . \n in addition , very poor oral hygiene , periodontal disease , tooth misalignment , enamel hypoplasia , and a grooved palate have been observed.3,4 dental abnormalities such as hypoplasia of the enamel , obliterated pulp chambers , and hypercementosis are some of the most striking features of this anomaly.5 in this case report , we aim to present the case of a girl with pycnodysostosis and show the clinical , radiographic , and diagnostic features , as well as the cephalometric characteristics of this anomaly , to help clinicians and professionals to diagnose it in younger individuals . \n an 18-year - old girl was referred for orthodontic treatment to the department of orthodontics , faculty of dentistry , atatrk university , erzurum , turkey . in terms of general health , \n the patient had glass - bone disease . in the clinical examination , the forehead was prominent with some bossing , the nose was beaked ( figure 1 ) , and the eyes had blue sclera . \n the weight and standing height of the patient were 28 kg and 126 cm , respectively . \n although the structure of the nails was normal , the length was short ( figure 2 ) . \n additionally , dental crowding , hypoplastic teeth , bilateral open bite , and cross - bite were observed ( figure 3 ) . \n radiographical examination revealed increased density and dysplasia of the terminal phalanges of the fingers ( figure 4 ) . the maxillary left lateral incisor , second molar , and all third molars were congenitally absent , and the right maxillary lateral incisor was peg shaped . \n in addition , both the maxilla and mandible were hypoplastic ( figures 3 , 5 , and 6 ) . \n the lambdoid suture was open , and the mandibular angle was obtuse with prognathism ( figures 1 and 5 ) . \n cephalometric measurements of the patient with pycnodysostosis were analyzed and compared with gazilerli norms.6 the most common observations from the cephalometric analysis were retropositioned maxilla ( sna 68.0 ) and mandible ( snb 71.5 ) with a class iii skeletal pattern ( anb 3.5 ) of malocclusion . \n however , from a clinical perspective , the soft tissue profile did not reflect the class iii skeletal pattern . \n in addition , an obtused mandibular gonial angle ( ar - go - me 163.0 ) , hyperdivergent mandibular growth ( sn - gogn 54.0 ) , reduced anterior and posterior facial height ( n - me 106.0 mm , s - go 60.0 mm ) , a maxillary transverse deficiency , and a proclined mandibular incisor were present , but the maxillary incisor inclination was normal ( table 1 ) . \n the periodontal examination of the patient consisted of recordings of visible plaque , oral hygiene , gingival bleeding , probing depth , and clinical attachment level . \n changes in gingival color and contour , edema , and very poor oral hygiene were present . because of these findings \n , the patient s periodontal disease was diagnosed as plaque - induced gingivitis and was treated ( figure 3 ) . \n pycnodysostosis is an autosomal - recessive disorder in which osteoclast dysfunction causes osteosclerosis.7 the incidence of this anomaly is estimated to be 1.7 per 1 million births.3 it is believed that the first case description of pycnodysostosis was in 1923 by montanari ; however , maroteaux and lamy defined the characteristic features of pycnodysostosis in 1962.3 general features include short stature ( less than 150 cm ) , generalized diffuse osteosclerosis with a tendency for fracture after minimal trauma , and hypoplastic clavicles.3,4 cranial and maxillofacial features include prominent eyes with blue sclerae , relative proptosis , beaked nose , frontoparietal bossing , open fontanelles and cranial sutures , hypoplastic paranasal sinuses , and an obtuse mandibular gonial angle , often with relative prognathism.3,4,8 these findings were in agreement with the present case report . \n norholt et al9 stated that these patients often present a class iii dentition owing to the maxillary hypoplasia . \n intraoral features include persistence of deciduous teeth with premature or delayed eruption of the permanent teeth , which can cause crowding . \n in addition , tooth misalignment , enamel hypoplasia , and a grooved palate have been observed.3,4 dental abnormalities such as hypoplasia of the enamel , obliterated pulp chambers , and hypercementosis are some of the most striking features in this anomaly . \n additionally , dental crowding associated with extensive caries and periodontitis is frequently observed.5 dental crowding impedes correct oral hygiene for the patients with pycnodysostosis . in the present study , although persistence of deciduous teeth was not observed , the congenital absence of many permanent teeth and peg - shaped lateral incisors were observed . \n many studies in literature have reported on clinical and radiological findings,1013 cephalometric measurements,4,14,15 and diagnostic features1618 associated with this syndrome . \n however , only the present study has incorporated all of these factors and included cephalometric measurements of the patient compared with turkish cephalometric norms . in the present cephalometric findings \n , a hypoplastic maxilla and mandible were observed , evidenced by sna , snb , and go - me measurements , respectively . \n it is believed that the maxilla would be more involved in the development of the significantly undesirable sagittal skeletal pattern of these subjects . \n these findings associated with decreased sna and anb angles may strongly influence the class iii pattern of malocclusion . \n a highly retropositioned maxilla may be a possible explanation for this observed and previously described numeric factor,4,15 which was identified as a negative anb angle in the present case . \n interestingly , the soft tissue profile was able to mask the intensity of the radiographically observed skeletal class iii malocclusion . \n in addition , this case showed a vertical growth with increased sn - gome and fh - mp angles , with an important influence from a deficient posterior facial height ( s - go ) . \n the n - me measurements , representing the total anterior facial height , were also significantly reduced . \n some features of pycnodysostosis are similar to the more common disorders of osteopetrosis and cleidocranial dysostosis.7 therefore , pycnodysostosis must be distinguished from osteopetrosis and cleidocranial dysostosis . \n emami - ahari et al17 and yeo18 reported the comprehensive diagnostic features of these anomalies . \n the malignant forms are recessive , in which there is severe aplastic anemia caused by the obliteration of the medullary canals and early death.19 cleidocranial dysostosis is an inherited autosomal dominant disorder and is characterized by a usually normal stature and normal texture of bones except for an increased density of the base of the skull in some cases.20 pycnodysostosis is an autosomal recessive anomaly and affected individuals have characteristic facies , beaked nose , blue sclera , short stature , aplasia of the digits , generalized increase in the density of bones even though not sufficient to obliterate medullary canals or cranial passages , abnormal dentition , and bone healing at a normal rate with normal blood findings.17 in pycnodysostosis and cleidocranial dysostosis , exposed fontanelles and cranial sutures are observed at an advanced age,21 although in the present case the glass - bone disease was also observed - a bone abnormality rarely seen in pycnodysostosis . \n there is no specific treatment for this anomaly and the current treatment is only supportive . \n recommendations or information about the effective and reliable orthodontic treatment of children or young adults with pycnodysostosis is not available in the literature.15 orthodontic and orthopedic movements are dependent on osteoclastic activity , bone resorption , and remodeling capacities.15 although some authors propose early treatment using orthodontic methods , others argue that the lack of bone remodeling would impede satisfactory results ; hence , planned extractions would be more suitable.10 tooth extraction in patients with pycnodysostosis is carried out during surgery as atraumatically as possible to reduce the risk of fracture , especially in the mandible.5 however , post - extraction osteomyelitis may develop because of the increased bone density.22 treatment of osteomyelitis in individuals with pycnodysostosis is difficult and may lead to large resections.3,9 norholt et al9 have defended the orthognathic correction by using a distraction osteogenesis technique \n . however , the most important orthopedic problem for orthognathic correction is the high infection rates and the recurrent pathological fracture of bones owing to the limited quality and vascularity of the sclerotic bone.3 \n patients with pycnodysostosis and glass - bone disease characterized by osteoclast dysfunction , fragile bone , craniofacial defects , severe malocclusion , and dental anomalies should be carefully examined and risk factors should be determined while planning treatment . \n the risks should be explained to patients and surgeons , and the treatment of these patients should be decided taking into consideration all the factors . \n frequent visits to the dentist would be suitable for these patients to emphasize the importance of extraordinary oral hygiene to prevent dental decay and periodontal disease .", "role": "user" }, { "content": "pycnodysostosis is a rare genetic disorder and was first described in 1962 by maroteaux and lamy . \n the incidence of this anomaly is estimated to be 1.7 per 1 million births . \n the principal characteristics of this disorder are short stature , prominent eyes with blue sclera , beaked nose , cranial dysplasia , exposed fontanelles and cranial sutures , clavicular dysplasia , total / partial dysplasia of the terminal phalanges , obtused mandibular gonial angle , and generally increased bone density . \n some features of pycnodysostosis are similar to osteopetrosis and cleidocranial dysostosis . \n therefore , it must be distinguished from osteopetrosis and cleidocranial dysostosis in order to diagnose it in individuals of a younger age.the aims of this case report were to show the clinical , radiographic , and diagnostic features , as well as the cephalometric characteristics of pycnodysostosis in comparison with turkish cephalometric norms .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: peripheral arterial disease ( pad ) commonly results from progressive narrowing of arteries in the lower extremities due to atherosclerosis . \n it has become evident that pad is an important predictor of substantial coronary and cerebral vascular risk [ 2 , 3 ] . \n the most common symptomatic manifestation of mild to moderate atherosclerotic pad is intermittent claudication , observed in ~5% of individuals older than 60 years [ 5 , 6 ] . \n several studies , using the ankle - brachial index , have revealed that the presence of pad , even when being asymptomatic and in patients with no history of other cardiovascular diseases , is a marker of greatly increased cardiovascular morbidity and mortality [ 7 , 8 ] . \n oxidative stress , through the extra generation of reactive oxygen species ( ros ) , is also involved in the development and progression of pad . \n moreover , risk factors associated with pad , similar to those for coronary heart disease , include high blood concentrations of total cholesterol and ldl - cholesterol . \n inhibitors of 3-hydroxy-3-methylglutaryl coenzyme a ( hmg - coa ) reductase , called statins , are well - known lipid - lowering drugs . \n statins not only reduce lipid levels , but they also have important pleiotropic effects , improving endothelial function , reducing oxidative stress , affecting the lipid metabolism enzyme activities , and so forth [ 1214 ] . \n three main reasons have been suggested for initiating statin therapy for patients with pad of the lower limbs : ( 1 ) prevention of coronary heart disease ; ( 2 ) treatment of lower extremity peripheral arterial disease ; and ( 3 ) perioperative treatment of patients with peripheral arterial disease . \n although several trials have shown that treatment with statins is associated with a reduction in coronary heart disease events , such as stroke [ 18 , 19 ] and mortality [ 2023 ] , most of these trials did not specifically address the treatment of patients with pad . \n the aim of the present study , therefore , was to evaluate lipid peroxidation parameters and total antioxidant capacity in the serum of patients with pad before surgery as well as 35 days and 710 days after surgery . \n we also compared these parameters with those in a group of patients receiving simvastatin therapy . \n the study group consisted of pad patients , treated either surgically ( group i , n = 35 males , aged 61 8 years ) or pharmacologically ( group ii , n = 18 males , aged 62 7 years ) in the department of general and vascular surgery at the poznan university of medical sciences . patients included in group i were admitted for surgical treatment ( implantation of an aortobifemoral bypass graft ) . \n they were diagnosed by measurement of the ankle brachial index ( abi ) and arteriography of the lower limbs , and were clinically stable without any accompanying diseases . \n the patients treated surgically had shown critical ischemia ( abi less than 0.90 , rest pain , ulcer or necrosis of the lower limbs , and ankle pressure 50 mmhg ) . \n blood samples were collected without anticoagulant , in the fasting state , before surgery as well as 35 days and 710 days after surgical treatment . \n group ii had been receiving statin therapy , with 20 mg of simvastatin daily , for at least 3 months . \n the study protocol was approved by the ethics committee of poznan university of medical sciences , and the subjects were fully informed and gave their written consent . \n all the reagents were of analytical grade of purity ( sigma - aldrich , st . \n spectrophotometric measurements were carried out on sp-8001 uv / visible spectrophotometer ( metertech inc . , taiwan ) . \n the subjects ' lipid profile ( total cholesterol , hdl cholesterol , ldl cholesterol , and triglycerides ) , glucose , uric acid , apolipoproteins ( apo a - i , apo b ) and fibrinogen concentrations in serum were measured by standard laboratory procedures , using the roche cobas 6000 analyzer system , dade behring bn ii system , and the sysmex ca-500 series system . the total antioxidant potential ( capacity ) of serum \n was determined by ferric reducing antioxidant power ( frap ) assay according to the benzie and strain method , based on the reduction of ferric ion fe(iii ) to ferrous ion fe(ii ) at a low ph . \n this method measures the change in absorbance at 593 nm owing to the formation of a blue - colored fe(ii)-tripyridyltriazine complex from the colorless oxidized fe(iii ) form , by the action of electron - donating antioxidants . \n lipid peroxidation was measured by estimation of both lipid hydroperoxides ( loohs ) and malondialdehyde ( mda ) concentrations by the sodergren method and ohkawa et al . \n the concentration of thiol ( -sh ) groups was determined according to the hu method . \n ceruloplasmin , in the presence of o - dianisidine hydrochloride in an acidic solution ( ph 5.0 ) , forms a stable yellow - brownish product . \n absorbance was measured at 540 nm and ceruloplasmin activity was expressed in u / l ( mol of oxidized substrate in 1 ml of serum in 1 min ) . \n the paired student 's t - test ( to compare the values before and after surgery ) , the two - tailed unpaired t - test ( to compare group i and group ii ) , and the f - test were used for statistical analysis of the data . the mean changes ( ) in lipid peroxidation parameters and antioxidant capacity , that is , 35 days ( 1 ) and 710 days ( 2 ) after surgery , in relation to the values obtained before surgery , were calculated . \n pearson 's correlation coefficients r1 and r2 were computed for the results found before surgery and the changes observed during treatment ( 1 , 2 ) . \n as shown in table 1 , generally , the clinical parameters of the two groups of patients included in this study did not differ significantly . \n however , the concentrations of total cholesterol and ldl cholesterol were found to be significantly higher in group i before surgery than those in group ii on simvastatin therapy . \n group i patients before surgery had enhanced oxidative stress , as demonstrated by elevated serum levels of mda , in comparison to those treated pharmacologically . \n we did not observe any significant decrease in looh and mda concentrations in group i patients after surgery ( figures 1 and 2 ) . the total antioxidant capacity ( expressed as frap ) and -sh group concentrations in the serum of patients on statin therapy and in those before surgery were similar ( figures 3 and 4 ) . \n however , a decrease was observed in frap level 35 days after surgery , and 710 days after surgery , it was significantly lower in comparison to the values before surgery and on simvastatin therapy . \n moreover , thiol group concentrations 35 days postoperatively were lower than those before surgery and 710 days after surgery and were lower than those in patients treated with simvastatin ( figure 4 ) . a significant difference in the oxidase activity of ceruloplasmin between group ii and group i before surgery was observed . \n its oxidase activity in serum was higher in group ii and 710 days after surgery in group i , in comparison to the values before and 35 days after surgery ( figure 5 ) . \n in addition , all the studied parameters ( looh , mda , frap , -sh groups , and ceruloplasmin ) in group i patients before surgery were significantly correlated with mean changes at 35 days ( 1 ) and/or 710 days ( 2 ) after surgery ( table 2 ) . \n oxidized ldl is a biochemical marker of oxidative damage and has atherogenic effects , including the stimulation of foam cell formation and activation of the inflammatory process in the vascular wall . \n the findings of the present study are broadly consistent with the hypothesis that lipid peroxidation may be one mechanism through which several risk factors may promote pad . \n , we observed an increased mda level in the patients before surgery , which suggests that they were in a state of high oxidative stress . at neutral ph , mda exists as a low reactive enolate anion , but it is still toxic and may damage many biologically important molecules . \n determination of the lipid peroxidation product mda in pad is important because , as was shown earlier , mda damages collagen by forming transverse intramolecular bonds that cause rigidity of blood vessels . \n in addition , modification of native ldl by mda causes the accumulation of cholesteryl esters within the cell in which the atherosclerotic reaction takes place . \n several trials have shown that statin therapy relieves symptoms and improves function in patients with lower extremity pad [ 32 , 33 ] . \n mda concentrations in the serum of the patients treated with simvastatin were lower than those in group i patients before surgery . since pad patients are usually undertreated with regard to the use of lipid - lowering agents , compared to patients with coronary heart disease , our results provide strong support for the efficacy of statin therapy in pad . \n human cells and tissues contain many antioxidant enzyme systems and nonenzymatic antioxidants , which protect against the action of toxic free radicals . \n the frap assay used here is a useful indicator of the body 's antioxidant status , which determines the level of non - enzymatic antioxidants , such as uric acid , ascorbic acid , -tocopherol , and some protein - containing -sh groups . \n an increase in frap level in the patients before surgical treatment is consistent with similar results obtained by gawron et al . in a group of patients with coronary heart disease and by lantos et al . in patients with hypertension . \n an increased antioxidant capacity of serum seems to be response to an increase in the concentration of lipid peroxidation products . \n the reduction in frap level observed in our group i patients 35 and 710 days after surgery can be partly explained by a decrease in their serum antioxidant status and an increase in serum oxidant levels following surgery , as indicated by the negative correlations found ( table 2 ) . in their study , girona et al . \n they showed that simvastatin therapy increases the resistance of both ldl and hdl to oxidation . \n in addition , simvastatin inhibits the ability of activated macrophages to oxidize ldl in vitro in a dose - dependent manner . \n a similar effect has been shown for other statins , such as atorvastatin , which reduces ldl levels and hdl oxidation and protects paraoxonase an enzyme bound to hdl . with regard to frap in our study , simvastatin therapy ( 20 mg daily ) did not influence the total antioxidant potential \n . however , shin et al . found a significant increase in antioxidant ability in their group of hypercholesterolemic patients treated with 40 mg simvastatin daily . \n they suggested the possibility of a dose - dependent effect of simvastatin on plasma antioxidant status . \n this could be the reason why we did not detect any effect of simvastatin on frap in our study . \n glutathione and other proteins , such as albumin , are an important part of serum antioxidant activity against free radicals . \n the thiol groups react with peroxide radicals in the first stage of the oxidation reaction and also act in the lag phase , which is an accepted marker of serum oxidizability . in our group of patients with pad , \n the decrease in thiol group concentrations , observed 35 days after surgery , followed by an increase 710 days after surgery , may be explained by oxidative stress intensification in reperfusion and by the actions of -sh groups , leading to their reduction . \n furthermore , a decrease in both lag phase and albumin level has also been reported in the serum of patients with aneurysmal or arterial occlusive disease . \n some studies have confirmed that ceruloplasmin is an independent risk factor for cardiovascular disease [ 43 , 44 ] . \n authors of that study suggest that increased ceruloplasmin activity is related to the acute phase response to inflammation and necrosis in atherosclerosis obliterans and results from increased ros production , mostly of superoxide radicals . \n therefore , the preferential oxidative destruction of thiol groups can explain the greater susceptibility of ceruloplasmin to oxidative stress . \n recent data show that statins may reduce oxidative stress by decreasing the generation of ros , thereby synergizing with the biological effects of antioxidants . \n the results of our study show that ceruloplasmin activity was influenced by both simvastatin therapy and surgical treatment , but only 710 days postoperatively . in our opinion , simvastatin may be implicated in antioxidant properties of ceruloplasmin , as reflected by the increase in its activity in men on simvastatin therapy . \n several in vitro studies have indicated that ceruloplasmin is a potent catalyst of ldl oxidation and that has been attributed to the presence of a reduced copper atom on its surface . \n ros dissociate copper from ceruloplasmin and therefore can markedly alter its structure and function , which could explain the initial lack of differences in its activity 35 days after surgery . in view of the escalating prevalence of pad in our aging population , \n further studies are needed to clarify precisely not only the mechanisms involved but the relative importance of the lipid - related and nonlipid - related effects of statins as well . \n results of this study show diverse oxidative state responses to surgical treatment and confirm the beneficial effects of statin therapy in pad .", "role": "user" }, { "content": "the various risk factors for peripheral arterial disease ( pad ) are almost identical to those for atherosclerosis and include abnormal levels of lipids or lipoproteins . lipid peroxidation parameters and total antioxidant capacity in the serum of male patients with pad before surgery as well as \n 35 days and 710 days after surgery were measured . \n we also compared these parameters with those in a group of patients receiving simvastatin therapy . \n concentrations of lipid hydroperoxides ( loohs ) and malondialdehyde , the total antioxidant capacity ( assessed by ferric reducing antioxidant power assay ) , concentration of thiol ( -sh ) groups , and ceruloplasmin activity were determined spectrophotometrically in pad patients treated surgically ( group i ) or pharmacologically ( group ii ) . \n the patients before surgical treatment had significantly higher concentrations of malondialdehyde but lower ceruloplasmin activity than those observed in group ii , treated with simvastatin . \n no significant differences before surgery in ferric reducing antioxidant power or thiol concentrations were found between the two groups . \n however , in group i , both ferric reducing antioxidant power and thiol group concentrations decreased 35 days postoperatively , and ceruloplasmin activity increased 710 days after surgical treatment . \n the presented results demonstrate diverse oxidative stress responses to surgical treatment and confirm the beneficial effects of statin therapy in pad .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the sample consisted of cbct scans of 10 patients with a mean age of 18 years ( range : 1420 years ) who visited the orthodontic department of sree balaji dental college and hospital , bharath university , india . \n cbct equipment used in this study is kodak 9500 ( kodak dental systems , practiceworks practiceworks systems , llc , 2009 , new york . \n the settings were 90 kvp ; 10 ma ; field of view 18 cm 21 cm ; exposure time 15 s with a spatial resolution of 10 line pairs / cm and an isotropic 0.2-mm voxel size was used . \n the exclusion criteria included patients with missing or grossly decayed teeth ; dental restorations that altered tooth size , shape ; prosthetic crowns or gingival defects ; facial asymmetry with unilateral or bilateral crossbite pathological diseases . \n carestream 3d imaging software ( care stream 3d imaging software , carestream dental llc , 2014 , rochester , new york , usa ) was used to measure bone thickness . \n the palatal width ( pw ) was measured as the largest palatal distance between the maxillary first molars at the cemento - enamel junction , and the palatal height ( ph ) was measured as the distance from the bony cortex of the hard palate at the midline of the palate perpendicular to the line measuring the width . \n the ratio between the ph / pw is the pi and is expressed in percentage . \n the palatal bone thickness is measured at 0 , 2 , 4 , and 6-mm lateral to the midpalatal suture on the coronal plane and from 0 to 24 mm at 4-mm intervals posterior to the level of the posterior margin of the incisive foramen on the sagittal plane . \n the thickness of the palatal bone was measured perpendicular to the horizontal plane at each designated point [ figure 1 ] . \n sagittal view of reference lines for measuring palatal bone thickness the measured bone thickness values was averaged for the subjects , maintaining their groupings with these three designated mediolateral areas : the midline area at the midpalatal suture , the medial area at the reference lines 2- and 4-mm lateral to the midpalatal suture , and the lateral area at the line 6-mm lateral to the midpalatal suture . \n likewise , there were three anteroposterior areas : the anterior area at lines 4 and 8 mm ; the middle area at lines 12 and 16 mm ; and the posterior area at 20 and 24 mm posterior to the incisive foramen . \n between - subjects factors were pi , and within - subjects variables were the three mediolateral areas and the three anteroposterior areas . \n the pi was classified as deep when the pi was > 44% and shallow when it was below 44% \n the measured bone thickness values was averaged for the subjects , maintaining their groupings with these three designated mediolateral areas : the midline area at the midpalatal suture , the medial area at the reference lines 2- and 4-mm lateral to the midpalatal suture , and the lateral area at the line 6-mm lateral to the midpalatal suture . \n likewise , there were three anteroposterior areas : the anterior area at lines 4 and 8 mm ; the middle area at lines 12 and 16 mm ; and the posterior area at 20 and 24 mm posterior to the incisive foramen . one - way analysis of variance was used to test for differences in bonethickness . \n between - subjects factors were pi , and within - subjects variables were the three mediolateral areas and the three anteroposterior areas . \n the pi was classified as deep when the pi was > 44% and shallow when it was below 44% \n comparison with one - way anova of palatal bone thickness among subjects with shallow and deep pi ( in millimeters ) bone thickness is significantly different among the three anteroposterior areas of the palate . \n it is concluded that bone thickness at anterior position is higher compared to middle and posterior positions in shallow palate p < 0.001 [ figure 2 ] . \n the bone thickness at anterior position is higher compared to the other two positions [ figure 3 ] . \n palatal bone thickness in anteroposterior and mediolateral areas in shallow palate palatal bone thickness in anteroposterior and mediolateral areas in deep palate anteroposteriorly , in the shallow palate , the mean bone thickness in the lateral region is found to be high in the anterior region , average at midline , and decreases in the posterior region . \n bone thickness in the middle region is high in anterior parts and remains more or less at the same level both in middle and posterior region . \n the thickness measured at midline is high at anterior , decreases in the middle region and slightly increases in the posterior region of the palate . in deep palate , the mean bone thickness of in all areas lateral , middle \n , midline areas is found to be high in anterior , average at midline and decreases in the posterior regions . \n the total lateral area demonstrated significantly less bone thickness than did the medial and midline area and the anterior values are high compared to middle and posterior areas [ figure 4 ] . \n thus , there is a significant interaction between the anteroposterior and mediolateral areas ( p < 0.001 ) , and among the anteroposterior and mediolateral areas and the two groups [ table 2 ] . \n palatal bone thickness in total sample showing interaction between anteroposterior and mediolateral areas correlation of palatal bone thickness with different pi \n cone - beam computed tomography produces three - dimensional anatomical images , from which slices can be displayed from any angle in any part of the imaged region and archived digitally . \n it also allows secondary reconstructions , such as sagittal , coronal , and para - axial cuts , and three - dimensional reconstructions of different craniofacial structures that are not magnified nor distorted in size or shape . \n placement of temporary skeletal anchorage devices in the paramedian palatal area has been recommended because of its thin keratinized soft tissue and sufficient cortical bone . \n it provides sufficient bone thickness for high safety and stability of temporary skeletal anchorage devices in all the cases . according to the classification of misch , the maxilla is mostly composed of porous bone corresponding to d3 or d4 , whereas the midpalatal area has dense cortical bone corresponding to d1 or d2 . \n bernhart et al . reported that the most suitable area in adults for implant placement in the palate was located 6 9 mm posterior to the incisive foramen and 3 6 mm para - median to the suture . \n hence , the bone quantity of several placement site was evaluated to verify whether adequate bone thickness is available for placementof temporary skeletal anchorage device in palate . \n the results of this study indicated that the area of highest bone thickness in the paramedian area extended 4-mm posteriorly to the incisive foramen[figure 5 ] . \n comparison of palatal bone thickness according to the mediolateral and anteroposterior areas in the shallow and deep palate groups poggio et al . suggested that 1-mm of bone should be around temporary skeletal anchorage devices for safe placement . \n the significant interaction between the mediolateral and anteroposterior positions indicated that the anterior region was thicker than the middle and posterior ones in both the groups . \n . this might be due to the difference in the amounts of remodeling growth between the posterior and anterior parts . \n king et al . demonstrated sufficient vertical bone depth at 4-mm distal and 3-mm lateral to the incisive foramen to install a 3-mm - long implant in adolescents . \n 6 ] kang et al . reported that bone thickness decreased laterally and posteriorly in the paramedian area in adults . \n ryu et al . also stated that bone thickness was higher in the anterior region than in the middle and posterior regions and also significant differences were found among the midline , medial , and lateral areas of the palate in adolescent and adult patients . \n he stated that bone density tended to decrease from anterior to posterior areas and from the middle to lateral areas of the palate . \n this was in accordance with the study conducted by han et al . where cortical bone density in the adult group , ranged between 1059 and 573 hu , approximately corresponding to the d2 ( 850 1250 hu ) and the upper range of the d3 ( 350 850 hu ) categories inclassification of bone tissue by misch . \n this was explained in part by the fact that the palatal midline gap , formed during the prenatal period , becomes reduced by deposition of bone , and by the age 21 , fibrous tissue with collagen fibers run parallel to the surface . \n thus , further studies of palatal bone thickness measured by pi method according to gender , age and racial differences is needed , to provide important information for clinicians . \n our findings regarding palatal bone thickness of adults in different pi can be summarized as follows : ( 1 ) bone thicknesses in anterior areas were high compared to the middle and posterior areas . \n ( 2 ) bone thickness in midline areas is higher compared to the middle and lateral areas . \n thus , these findings might be helpful for clinicians to enhance the successful use of temporary anchorage devices in the palate in a permanent dentition .", "role": "user" }, { "content": "introduction : the purpose of this study was to compare the bone thickness of the palatal areas in different palatal index ( pi ) groupsmaterials and methods : cone - beam computed tomography scans of 10 subjects were selected with ameanage group of 18 years . \n the measurements of palatal bone thickness were made at 36 sites using carestream 3d imaging software . \n the piwas measured using korkhaus ratio ( palatal height / palatal width ) . \n one - way analysis of variance was used to analyze intergroup differences , as well as the pi difference.results:bone thickness was higher in the anterior region than in the middle and posterior regions p < 0.001 . \n furthermore , significant differences were found among the midline , medial , and lateralareas of the palate.conclusions:these findings might be helpful for clinicians to enhance the successful useof temporary anchorage devices in the palate .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: we describe the use \n of targeted lc ms / ms and different software \n tools to determine the phosphorylation sites in the streptomyces coelicolor cytoskeletal element \n diviva . \n apical growth in the filamentous bacteria streptomyces is directed by a polarisome - like \n complex involving the essential coiled - coil protein diviva . \n this bacterial polarization machinery is regulated by a ser / thr \n protein kinase , afsk , which localizes to hyphal tips and phosphorylates \n diviva , thereby modulating growth polarity and hyphal branching . \n afsk - mediated \n phosphorylation of diviva is induced by antibiotics that arrest cell \n wall synthesis , such as bacitracin \n . it \n will be vital to unambiguously identify the amino acid residues that \n are phosphorylated by afsk to mechanistically dissect the role of \n phosphorylation of the cell polarity determinant diviva . \n previous \n maldi - tof analysis of diviva immunoprecipitated from s. coelicolor following bacitracin treatment showed that \n a large 7.2 kda tryptic peptide ( tpataslppspapsmapaga \n sapsyggnqsmgggpgqsgp syggqqqmspamtqpmapvr \n pqgpspmgqapspmr ) that contains most of the \n c - terminal region of diviva ( see figure 4 ) \n was multiply phosphorylated . \n the identification \n of the phosphorylation sites is necessary so that they can be mutagenised \n to unphosphorylatable ( ala ) or phosphomimetic ( asp ) residues to analyze \n the effect of phosphorylation on diviva activity further . to this \n end \n , two additional tryptic cleavage sites were introduced into the \n 7.2 kda fragment by mutagenesis . \n the confident determination \n of the site of phosphorylation can \n be challenging and depends mainly on the generation of site - determining \n fragments carrying the phosphate group . \n it becomes even more complicated if the phosphate group can be localized \n at different sites within the sequence ( isomers ) . in the initial analysis \n of the resulting peptides potential phosphopeptide isomers \n ms / ms \n acquisitions if they elute closely or together because the mass spectrometer \n is usually set up to implement a dynamic exclusion window to avoid \n repetitive fragmentation of peptides . \n this means , however , that data \n for closely eluting isomers may not even be collected . \n furthermore , \n search tools may not give a clear result when a mixed spectrum of \n coeluting isomers needs to be interpreted , or indeed the user may \n even ignore less probable results in error , choosing to believe only \n a top hit and ignoring lesser scoring results . to improve the analysis , \n ms / ms without dynamic exclusion to collect \n spectra continuously over the whole lc peak of the parent ions . \n a \n software tool was then developed to generate plots of site - determining \n fragment ions from those spectra . \n the retention time of the specific ions \n coincided with the retention times of the phosphopeptides . \n ms / ms analysis \n of phosphopeptide isomers to localize the different phosphorylation \n sites . \n upon digestion \n with trypsin or other common enzymes , the diviva protein could not \n be cleaved into suitable peptides . \n experiments were therefore performed \n with limited digests using proteinase k , but the results were not \n reproducible and still did not cover the complete sequence . \n therefore , \n two artificial cleavage sites for trypsin were introduced into the \n 7.2 kda peptide region . \n two glutamine residues ( q343 and q360 , see \n figure 4 ) were chosen for mutagenesis to arginine \n residues . \n these two residues lie in a low - complexity region that is \n predicted to be disordered , according to the disopred2 disorder prediction \n server , suggesting that these changes would have minimal structural \n effects . in brief , diviva was amplified with primers \n kf478 ( ctggttaacccatatggactacaaggacgacgatgacaagatgccgttgacccccgaggac ) \n and kf86 ( ggtcgacggcgagacggtca ) , \n which introduced an n - terminal flag - tag and cloned in puc19 . \n site - directed \n mutagenesis was performed to introduce the two additional tryptic \n cleavage sites using primers ah13 ( ggtcgatgggcggcggcccgggc)/ah14 \n ( ggttgccgccgtaggacggagc ) \n and ah15 ( ggcagatgtcgcccgcgatgacc)/ah16 \n ( gctggccgccgtaggacggacc ) . \n the flag - diviva ( q343r q360r ) allele was subsequently \n subcloned into pij10550 , which is a derivative of the vector pij6902 in which the apr resistance \n gene has been exchanged for the viomycin resistance gene vio ( hempel , unpublished ) . \n the flag - diviva ( q343r q360r ) \n allele is placed directly downstream of a thiostrepton - inducible promoter tipap . \n the modified diviva protein was expressed in s. coelicolor and immunoprecipitated \n after the cultures were exposed to bacitracin to induce high - level \n diviva phosphorylation . \n protein samples were digested \n with tpck immobilized magnetic trypsin \n ( clontec , saint - germain - en - laye , france ) for 60 or 90 min . \n the digestions \n were stopped by removing the magnetic beads and addition of tfa to \n a final concentration of 0.5% . \n ms / ms \n on an ltq - orbitrap mass spectrometer ( thermo fisher , hemel hempstead , \n u.k . ) \n uplc - system \n using a 25 cm long column ( beh c18 , 1.7 m , 75 m \n 250 mm , waters ) . for detection and analysis of phosphopeptides , multistage \n activation was used with neutral loss m / z of 48.99 and 32.66 ( for 2 + and 3 + charged ions ) . \n ms / ms \n was performed using an inclusion list for just the m / z values of the phosphopeptides of interest using \n the most abundant charge state ( 2 + or 3 + ) observed in the previous \n experiments . \n data acquisition was performed without chromatographic \n peak detection and without dynamic exclusion . in this way \n , multiple \n ms2 spectra were acquired across any eluting peaks of the correct \n mass . \n a detailed description of the ms procedures can be found in \n the supporting information methods . \n raw files were processed with maxquant \n version 1.3.0.5 ( http://maxquant.org ) to generate recalibrated peaklist - files that were used \n for a database search using an in - house mascot 2.4 server ( matrix \n science limited , london , u.k . ) . \n mascot - mgf files were generated from \n maxquant apl - files using a perl script written in - house ( available \n on request ) . \n mascot searches were performed \n on the streptomyces coelicolor protein sequences \n downloaded from uniprot ( www.uniprot.org , 8093 sequences , \n 04042013 ) to which the mutated diviva sequence had been added , or \n for simplifying searches on a small database containing the target \n sequences ( wild - type and mutated diviva ) in a background of 100 random e. coli sequences using 5 ppm precursor tolerance , 0.5 da \n fragment tolerance , and oxidation ( m ) as well as phosphorylation ( sty ) \n as variable modifications . \n mascot search results were imported into \n scaffold 3.6.3 including an x!tandem search for evaluation and further \n into scaffoldptm ( version 2.0 , proteomesoftware.com , portland , \n or ) for analysis of phosphorylation sites using the ascore algorithm \n implemented in scaffoldptm . \n a perl script was developed searching \n for scans in the ms2 peak \n list file ( maxquant / apl and mascot distiller / mgf peak list formats \n are supported ) in which the mass of the fragment ion of interest is \n present , allowing for a user - defined tolerance window . \n it retrieves \n the corresponding intensity that can then be plotted against the scan \n number . \n the mass spectrometry proteomics \n data ( including the perl script for plotting of fragments ) have been \n deposited with the proteomexchange consortium ( http://proteomecentral.proteomexchange.org ) via the pride partner repository with \n the data set identifier pxd000095 and doi 10.6019/pxd000095 ( pride \n accessions 2961929621 ) . \n initially , two \n runs were performed with different tryptic digests \n of a diviva protein preparation using a data - dependent ( top 5 ) mode \n of acquisition including dynamic exclusion and chromatographic peak \n detection . \n the data were processed and merged in one mascot search . \n when searched on the complete s. coelicolor uniprot \n database , the diviva protein was identified with high significance \n as a top match with the highest score and the highest empai among \n 37 s. coelicolor proteins . \n ( for details , see the data sets available section . ) at an fdr of 0.85% , \n 37 peptides ( including modified peptides ) were assigned to diviva , \n resulting in a sequence coverage of 48% and a mascot protein score \n of 9121 . \n all three tryptic peptides generated as a result of the introduced \n tryptic cleavage sites were detected with high confidence . \n all further \n searches were performed on a small custom database containing the \n target sequences ( wild - type and mutated diviva ) in a background of \n 100 random e. coli sequences . on the basis of this , \n this initial experiment identified three peptides ( numbered 1 to 3 \n according to their occurrence in the protein sequence , see figure 4 ) carrying potentially phosphorylated residues ( supporting information table 1 ) . \n peptide 1 ( qletqaddslappr ) \n is not derived from the 7.2 kda fragment but lies immediately n - terminal \n to it in the primary amino acid sequence of diviva . \n peptide 2 ( tpataslppspapsmapagasapsyggnr ) \n and peptide 3 ( smgggpgqsgpsyggqr ) were \n derived from the parental 7.2 kda fragment and were generated as a \n consequence of the two introduced tryptic cleavage sites . \n all three \n peptides were also detected in their unphosphorylated form ( see later ) . \n the mascot search results for peptide 1 showed that both residues \n t304 or s309 can be phosphorylated . \n localization probabilities of \n 99% ( based on mascot delta score ) were observed for the eight \n spectra detected . \n three of them indicated phosphorylation of t304 , \n and four spectra pointed to s309 with scan numbers indicating separate \n elution of those two isomers . \n three ms2 spectra were obtained \n for peptide 2 , all with probabilities \n below 50% ( including some rank 2 to 4 matches ) . \n spectra with the highest \n probabilities ( 48% ) pointed to s338 or y339 as phosphorylated \n residues . for peptide 3 , \n a total of seven matching spectra were \n obtained \n in mascot , and for two of those spectra mascot gave probabilities \n around 99% , indicating unambiguous localization for phosphorylation \n at s344 . \n all other spectra gave probabilities in the range of 4080% \n ( including some rank 2 to 4 matches ) pointing to all potential sites . \n this is a typical situation in the analysis of post - translational \n modifications requiring special targeted analysis combined with user \n inspection of details of spectra . to accomplish this detailed analysis , \n ms / ms ( as described for phosphopeptides \n previously ) to acquire as many ms2 spectra \n of each peptide as possible and have developed a script allowing for \n the detection and plotting of characteristic fragment ions present \n in all acquired spectra ( in silico srm ) . to confirm and improve the \n initial results described above and to determine if multiple phosphopeptide \n isomers were present ( especially for peptides 2 and 3 ) , we performed \n targeted lc \n ms / ms using an inclusion list for just the m / z values of the phosphopeptides of interest \n using the most abundant charge state ( 2 + or 3 + ) observed in the previous \n experiments . \n data acquisition was performed without chromatographic \n peak detection and without dynamic exclusion . in this way \n , multiple \n ms2 spectra were acquired across any eluting peaks of the correct \n mass . \n data from two independent runs of different tryptic digests \n were processed as described above , and the merged mascot search results \n were imported into scaffold 3.6.3 ( including an x!tandem search ) and \n further into scaffoldptm 2.0 ( proteome software ) for evaluation of \n the phosphorylation sites using the ascore probabilistic algorithm and scoring technique incorporated into \n scaffoldptm ( supporting information , tables \n peptide 1 to peptide 3 ) . starting from the initial results ( see \n previous ) , we were mainly interested in the targeted analysis of peptide \n 3 ( smgggpgqsgpsyggqr ) with an m / z = 830.3333 for [ m+2h ] of \n the monophosphorylated version . from this peptide , 89 spectra with \n localization probabilities 95% \n , the phosphorylation site was assigned \n by ascore to s355 , and for 40 spectra the site was assigned to s344 . \n on the basis of the scan numbers the two groups seemed to elute at \n slightly different but overlapping retention times . \n however , because \n of the large number of spectra and the lack of intensity values , this \n was not straightforward to analyze , leaving the software results still \n difficult to interpret . at this stage , \n one option would have \n been to optimize the lc - gradient \n for better separation of possible isomers . \n however , this would need \n to be done specifically for each peptide / isomer , and it is therefore \n not a practical option , especially with a high - throughput nanouplc \n system , limited sample amounts , and complex samples containing many \n phosphopeptides of interest . \n therefore , we developed a tool \n to analyze the elution of specific \n fragment ions of the peptide isomers . \n spectra were inspected visually \n and compared with the theoretical fragment ion series to find specific \n site - determining fragment ions for the two potential phosphorylation \n sites . \n for the potential s355 isomer , the y8-ion was unique , and for \n the s344 isomer , the y9-ion was unique , and their intensities were \n plotted against retention time ( figure 1 ) using \n a perl script written in house . \n the script searches for scans in the \n ms2 peak list file in which the mass of the fragment ion of interest \n is present and retrieves the corresponding intensity , allowing for \n plotting the elution of those fragments over retention time / scan number . \n because the analysis was performed in the ion trap ( it ) of the ltq \n orbitrap , a tolerance window of 0.5 da was used . \n the correct assignment \n of the site - determining ions could clearly be further improved using \n instruments , allowing for fast high - accuracy mass measurements and \n smaller tolerance windows . \n ( a ) xic of m / z = 830.3327 corresponding \n to monophosphorylated doubly charged peptide 3 ( smgggpgqsgpsyggqr ) \n generated in qual browser / xcalibur 2.1 software ( thermo ) and exported \n for scan - based plotting . \n ( b ) scan - based plot of the elution of the \n y8-ion ( m / z = 901.36 ) of the s355 \n isomer ( red ) and the y9-ion ( m / z = 908.42 ) of the s344 isomer ( blue ) generated with the in - house \n developed tool ( mass tolerance 0.5 da ) . \n the elution of the two fragment \n ions coincides exactly with the two peaks of the parent phosphopeptide \n ( a ) . extracting these two ions clearly \n deconvolutes the spectra to a \n main peak and an overlapping shoulder matching the xic of the parent \n ion . \n it shows that the s355 isomer is present under the main peak \n and the s344 isomer elutes under the shoulder of that peak ( figure 1 ) . \n the maxima of the peaks are separated by 30 \n s. the phosphorylation of s355 is strongly supported by the phosphosite \n prediction tool netphos 2.0 ( http://www.cbs.dtu.dk/services/netphos/ ) ; a probability of 0.961 is predicted for s355 in the wild - type \n diviva sequence . \n residue s344 is immediately adjacent to the residue \n modified to generate the tryptic cleavage site . \n netphos predicts 0.238 \n for phosphorylation of qs344 ( wild - type ) and 0.577 for the modified \n sequence motif rs344 . \n another prediction tool , kinasephos2 ( http://kinasephos2.mbc.nctu.edu.tw/index.html ) , predicting probabilities for specific kinases finds increased \n phosphorylation probability of rs344 for only one specific kinase \n ( aurora related kinase ) , while six other kinases remain virtually \n unchanged and two are reduced ( data not shown ) . \n it is formally possible \n that the phosphorylation observed on residue s344 might arise as an \n artifact of the adjacent q343r substitution . \n however , a triply phosphorylated \n species of the naturally occurring 7.2 kda peptide was observed in \n previous maldi - tof analysis , supporting \n the phosphorylation of s344 in addition to the other two residues \n ( s355 , s338 ) reported in this paper . \n ( a summary of the localization \n of peptides and phosphorylation sites is given in figure 4 . ) for peptide 2 ( tpataslppspapsmapagasapsyggnr , m / z = 921.0932 for [ m+3h ] of \n monophosphorylated version ) , 70 spectra were acquired in total ( data \n not shown ) . \n eleven of those spectra \n had probabilities 95% ( including one spectrum with 100% probability ) , \n assigning the phosphorylation site to s338 . \n in addition , there were \n eight spectra with ascore scores > 0 and probabilities in the range \n of 7592% pointing to y339 ( supporting \n information tables ) . \n no special separation in retention time \n ( scan numbers ) seemed to occur for the two potential sites . for more detailed analysis , the elution profiles of two y - ions , \n y5 and y7 , specific for phosphorylation of s338 , \n the y6-ion specific for \n s338 phosphorylation was not present , but the y5-ion excludes phosphorylation \n of y339 , and if y5 is present , then the y7-ion is specific for s338 \n phosphorylation and excludes all other potential residues of the peptide . \n further , all of \n the site - determining ions selected were y - ions , avoiding the potential \n dangers of sequence scrambling associated with the cyclization of \n b - ions . \n as shown in figure 2a , the monophosphorylated , \n triply charged peptide eluted under a single broad peak . \n the y7-ion \n occurred in 64 of 70 acquired spectra and eluted exactly under the \n xic peak of the peptide ( figure 2b ) . \n the y-5 \n ion occurred in 29 of the 70 spectra , and eluted in the same range \n as the xic peak and the y5-ion ( figure 2c ) . \n this is also supported by the phosphosite prediction tool netphos \n 2.0 , which predicts a higher probability for s338 ( 0.979 ) than for \n y339 ( 0.838 ) . \n ( a ) xic ( generated as in figure 1a ) of m / z = 921.0932 corresponding \n to the monophosphorylated , \n triply charged version of peptide 2 ( tpataslppspapsmapagasapsyggnr ) . \n ( b , c ) plot of the elution of the y7-ion ( m / z = 830.32 ) occurring in 64 out of 70 spectra ( b ) and the \n y5-ion ( m / z = 566.27 ) occurring \n in 29 out of 70 spectra ( c ) generated as in figure 1b . \n the scan numbers of the detected y - ions are in the same \n range in both plots and coincide with the scan numbers of the xic \n in panel a. for peptide 1 , qletqaddslappr \n ( m / z = 810.8669 for [ m+2h ] of \n monophosphorylated version ) , 27 ms2 spectra with 100% localization \n probability were obtained after scaffoldptm analysis , confirming the \n initial mascot results . for 24 spectra \n the phosphorylation site was \n assigned to s309 , while in the 3 remaining spectra the site was assigned \n to t304 . \n an xic showed the occurrence of two peaks of the expected m / z separated by 3 min of retention time \n ( figure 3 ) . after assigning \n the identified scans to the retention time it became clear that the \n s309 isomer eluted earlier than the t304 isomer . \n the phosphorylation \n probabilities predicted by netphos were 0.93 for s309 and 0.256 for \n t304 \n . xic of m / z = 810.8669 corresponding \n to the monophosphorylated , doubly charged version of peptide 3 ( qletqaddslappr ) \n generated in qual browser / xcalibur 2.1 software ( thermo ) showing the \n elution of two phosphopeptide isomers separated by 3 min . \n numbers \n on top of peaks indicate scan numbers allowing for the assignment \n of qletqaddpslappr to the first peak and qleptqaddslappr \n to the second peak . \n protein sequence of diviva : \n the 7.2 kda peptide \n is highlighted in yellow ; the phosphorylated tryptic peptide located \n n - terminal to it ( peptide 1 ) is highlighted in blue . \n the arginine residues introduced by mutagenesis \n ( originally glutamine residues q343 and q360 ) are labeled in green . \n the separation of the two isomers \n of peptide 1 is much more distinct \n ( 3 min ) compared with the isomers of peptide 3 ( 30 s ) . \n similar behavior \n of different phosphopeptide isomers , including overlapping elution , \n has been previously described . in our study \n the unphosphorylated \n versions of phospho - peptides 1 to 3 have also been detected . \n table 1 shows a comparison of abundance and \n retention time of the unphosphorylated and phosphorylated isomer versions \n of the peptides . \n the values were extracted from the maxquant output \n ( allpeptides.txt ) , and the results indicate that high levels of phosphorylation \n occurred after bacitracin induction , confirming previous observations \n based on pro - q diamond staining . \n the rate \n was in the range of 3848% for peptides 2 and 3 , while only \n 0.6% was observed for peptide 1 . \n phosphorylation predominantly \n causes a clear reduction of elution time , although a slight increase \n can also occur . as shown in table 1 , all but one of the five observed phosphopeptide \n isomers had an enhanced retention time with differences in the range \n of + 0.6 to + 3 min . \n intensities were calculated as the sum \n and retention times as the average from two independent runs including \n both 2 + and 3 + charged peptides . \n peak of the psmgggpgqsgpsyggqr \n isomer of \n peptide 3 was not detected in maxquant ; instead the values were estimated \n from the xic generated in xcalibur ( see figure 1 ) . \n diviva \n is a cytoskeletal protein that plays a key role in directing \n polar growth and branching in the filamentous bacteria streptomyces . \n the activity of this polarity \n protein is controlled by the ser / thr kinase afsk , which extensively \n phosphorylates diviva on its c - terminus . here \n we define the phosphorylation sites in diviva . because of poor \n fragmentation and closely eluting phosphopeptide isomers the exact \n localization of phosphorylation sites can be challenging , and results \n from automated software tools are often ambiguous . to overcome this \n problem \n we first collected a large number of ms2 spectra for the peptides \n of interest by using an inclusion list and repeated ms fragmentation . \n we then developed and applied a script to extract and plot the retention \n time of site - determining fragment ions . \n plots of different ions were \n aligned with the xic of the parent ion , demonstrating the differential \n elution of phosphopeptide isomers . \n this method retrieves data from \n the mass spectrometry acquisition and visualizes information otherwise \n difficult to recognize . \n it is limited only by the acquired data and \n clearly increases the confidence in otherwise ambiguous results . using \n this method , \n our results demonstrate that diviva is phosphorylated \n in vivo on 5 out of 16 potential phosphorylation sites in the c - terminal \n part of the protein ( t304 , s309 , s338 , s344 , and s355 ) . defining these \n sites \n means that in the future they can be mutagenised to unphosphorylatable \n ( ala ) or phosphomimetic ( asp ) residues to permit a detailed analysis \n of the effects of phosphorylation on diviva function .", "role": "user" }, { "content": "the \n filamentous bacterium streptomyces coelicolor modulates \n polar growth and branching by phosphorylating the cytoskeletal \n protein diviva . \n previous maldi - tof analysis of diviva showed that \n a large 7.2 kda tryptic peptide was multiply phosphorylated . to aid \n localization of the phosphorylation sites \n , we introduced additional \n tryptic cleavage sites into diviva , and the resulting phosphopeptides \n were analyzed by lc \n ms / ms . \n phosphopeptide isomers could be \n separated chromatographically , but because of overlapping elution \n and spectrum quality , site assignment by standard software tools was \n ambiguous . because fragment ions carrying the phosphate group are \n essential for confident localization , large numbers of spectra were \n collected using targeted lc \n ms / ms , and a special script was \n developed for plotting the elution of site - determining fragments from \n those spectra under the xic of the parent ions . where multiple phosphopeptide \n isomers were present , the elution of the site - determining y - ions perfectly \n coincided with the elution of the corresponding phosphopeptide isomer . \n this method represents a useful tool for user inspection of spectra \n derived from phosphopeptide isomers and significantly increases confidence \n when defining phosphorylation sites . in this way \n , we show that diviva \n is phosphorylated in vivo on five sites in the c - terminal part of \n the protein ( t304 , s309 , s338 , s344 , and s355 ) . \n the data have been \n deposited to the proteomexchange consortium with identifier pxd000095 .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in this issue of critical care , aliberti and colleagues examine the question of whether acidemia predicts outcome in patients admitted with acute cardiogenic pulmonary edema ( acpe ) and treated with continuous positive airway pressure ( cpap ) . \n the authors performed a retrospective observational study in a large cohort of patients admitted to the emergency department with acpe and treated with cpap . \n the authors compared treatment failure , defined as a switch to bi - level or invasive ventilation or in - hospital mortality , in two matched groups of patients with and without acidemia on admission . \n the main conclusion was that neither admission acidemia nor type was an adverse prognostic marker . \n acute heart failure syndromes ( ahfss ) are the most common reason for hospital admission in patients older than 65 years , over 50% of whom present with acpe , and up to 10% of patients with acpe will not survive their admission . a number of prognostic factors have been identified : age , systolic blood pressure ( sbp ) , brain natriuretic peptide or troponin rise , hyponatremia , renal dysfunction , previous ischemic heart disease , ejection fraction , and function at discharge . \n however , most of these variables have been used across the whole spectrum of ahfss and relate to longer - term outcome . \n focusing on acpe only , the 3cpo trialists identified patients at immediate risk of death and in need of intervention on presentation ; a simple score based on age , sbp , and the ability to obey commands predicted early mortality . in acute exacerbations of chronic obstructive pulmonary disease , acidosis is a strong predictor of adverse outcome . \n acidosis in hypercapnic respiratory failure is a direct reflection of organ dysfunction , in particular the failure of the lungs to ventilate the alveoli adequately . \n in contrast , in acpe , acidosis is only an indirect consequence of cardiac dysfunction caused by a combination of factors , including edema - impaired gas exchange and tissue hypoperfusion . \n more direct indicators of cardiac function , such as cardiac power output ( cpo ) , which is derived from the product of cardiac output and mean arterial blood pressure , have been shown to be powerful prognostic indicators in patients with ahfs , chronic heart failure ( chf ) , or cardiogenic shock [ 8 - 10 ] . \n clinical risk scores , a product of statistical modeling , are a popular tool to identify prognostic markers . however , most do not pass the acid test of clinical utility , and this is evidence that a change in risk score correlates with changes in patient outcome . \n differentiating the pathophysiological processes under - pinning the different ahfss to provide appropriate and rational treatment is an alternative approach to risk - stratify patients with acpe . \n cotter and colleagues suggested four major clinical ahfss : ( a ) pulmonary edema , ( b ) cardiogenic shock , ( c ) hypertensive ( htn ) crisis , and ( d ) exacerbated systolic chf . by plotting cpo as a marker of cardiac contractility against systemic vascular resistance ( svr ) \n , the authors demonstrated that 95% of patients could be categorized accurately into one of these syndromes . \n understanding the pathophysio - logical mechanisms is key to management ; for example , patients with cardiogenic shock and those with pulmonary edema demonstrate a similar presentation with pulmonary congestion , clammy extremities , low cardiac output , and high wedge pressure . \n however , the patho - physiologies are very different and the treatments are almost opposite . \n the former is characterized by low cpo and low svr that requires inotropic support and occasionally peripheral vasoconstrictors , and the latter is characterized by extreme neurohormonal activation with higher values of cpo and very high svr , necessitating aggressive peripheral vasodilation . \n according to this model , exacerbated systolic chf , htn crisis , and acpe may be viewed as a continuum of progressive neuro - hormonal activation leading to an increase in svr with progressive recruitment of cardiac power reserve . \n the objective of treatment is then to optimize the svr and thus the cardiac performance can be moved toward more optimal loading conditions to effect greater power output . \n the need for invasive hemodynamic monitoring is a limitation , but the advent of non - invasive tools could improve diagnosis , risk stratification , and management of patients with ahfs . \n the etiology of heart failure and the cardiac rhythm influence the acute cardiac response to cpap . in patients with dilated cardiomyopathy , \n cpaps lead to a reduction in cardiac volumes , whereas in ischemic cardiomyopathy , there were small increases . similarly , \n atrial fibrillation resulted in a fall in cardiac index but there was a small rise in sinus rhythm . \n cpap , with its unique combination of respiratory and hemodynamic effects , will remain a cornerstone of the symptomatic treatment of acpe . \n future management should look beyond clinical risk scores to an understanding of etiology and pathophysiology in each patient to provide optimal treatment for this deadly condition . \n acpe : acute cardiogenic pulmonary edema ; ahfs : acute heart failure syndrome ; chf : chronic heart failure ; cpap : continuous positive airway pressure ; cpo : cardiac power output ; htn : hypertensive ; sbp : systolic blood pressure ; svr : systemic vascular resistance . \n ", "role": "user" }, { "content": "several prognostic markers have been identified for patients admitted with acute cardiogenic pulmonary edema . \n most of the markers are based on clinical risk scores . unlike hypercapnic respiratory failure \n , acidosis is not an adverse predictor in these patients . \n hemodynamic variables that assess pathophysiological mechanisms may be more helpful to guide appropriate management .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: replacement of the fragments of the compound sah was done using the lead optimization module of discovery studio 3.5 . \n structure - based drug design and often ligand scaffold hopping is performed in the absence of a protein structure . \n scaffold sah was divided into three substructure parts as group-1 ( 2-amino-4-mercaptobutanoic acid ) , group-2 ( 9h - purine ) , and group-3 ( tetrahydrofuran-3,4-diol ) shown in figure 1 . \n crystal structure of methyltransferase with its inhibitors s - adenosyl - l - homocysteine in dark yellow color docking is drug designing program on the basis of receptor and ligand . \n it is applied to predict the structure and binding free energy of receptor and ligand complex . \n based on the extent of flexibility docking can be classified into four classes : both the receptor and ligand are flexible , receptor is flexible and ligand is rigid , ligand is flexible and receptor is rigid , and both the receptor and ligand are rigid . \n libdock module of discovery studio 3.5 was used for docking of the analogs of sah and target protein . \n the binding site was created by selecting sah using discovery studio 3.5 having binding site dimensions x ( 15.12 ) , y ( 13.23 ) , and z directions ( 17.28 ) for docking . \n the conformations of compounds were generated with maximum 225 numbers of conformations to be generated , and conformations of separate isomers were also created within the threshold of 20.0 kcal / mol relative energy . \n the charmm force field was applied to minimize the compounds with 1000 steps of steepest descent ( sd ) algorithm . \n the having a root mean square deviation ( rmsd ) < 1.0 were considered as duplicates as the higher specified rmsd value will reduce the number of ligand poses returned and an rms gradient 0.001 . \n libdock is a high - throughput algorithm developed by diller and merz , which consist of the polar and apolar features as hotspots . \n the molecules which passed the applied filters were docked with the crystal structure of mtase ( pdb i d - 2p41 ) in complex with guanine - n7 and adenosine-2o methylation ( 7-megpppg2ome ) and sah . \n charmm force field was applied for docking and scoring , and other docking parameters were kept default . \n ligand - receptor minimization in situ during dockingwas performed on the complexes to remove any ligand van der waals clashes prior scoring and calculating binding energy . \n the 5000 steps of sd with free movement of atoms within the binding site sphere were used during the minimization . \n the binding energy of protein - ligand complexes was calculated from the free energies of the complex , and free energies of individual protein and the ligand using charmm force field and implicit salvation method . \n ligands were prepared for use in docking and other applications by using discovery studio 3.5 , particularly for those which require a three - dimensional ( 3d ) coordinates and biological ionization and tautomerization states . when studying receptor - ligand interactions and other areas , it is important to correctly prepare the ligands . \n different protonation states , isomers and tautomers typically have different 3d geometries and binding characteristics . \n admet properties of the drug should be optimum at least to get drug absorbed and distributed to the site of action . \n the ratio of lipophilicity and water solubility should be according to the lipinski rule of five . as a highly soluble drug \n can not cross the membranes and a highly lipophilic drug gets the problem to get dissolved . \n hence , adme and toxicity prediction of compounds was done using admet and toxicity prediction modules of discovery studio 3.5 . \n adme descriptors allow eliminating the compounds with unfavorable admet characteristics early on to avoid expensive reformulation cost later and , for structural refinements that are designed to improve adme properties , prior to resource expenditure on synthesis . \n analogs were also subjected for analysis of topkat_fda_male / female mouse_noncarcinogenicity versus carcinogenicity probability where carcinogen versus noncarcinogen , probability below 0.3 indicates a noncarcinogen , and probability above 0.7 signifies a carcinogen . \n cytochrome p450 2d6 ( cyp2d6 ) plays an essential role in the metabolism of a wide range of xenobiotics in the liver and its inhibition by a drug constitutes a majority cases of drug - drug interaction . \n topkat module of discovery studio 3.5 validates toxicity estimation through quantitative structural toxicity relationship and similarity searching of the model 's database . on the basis of query compound structure \n , predictive models perform an accurate and valid estimation of the query structure because the model is accurately predictive in that region of space . \n replacement of the fragments of the compound sah was done using the lead optimization module of discovery studio 3.5 . \n structure - based drug design and often ligand scaffold hopping is performed in the absence of a protein structure . \n scaffold sah was divided into three substructure parts as group-1 ( 2-amino-4-mercaptobutanoic acid ) , group-2 ( 9h - purine ) , and group-3 ( tetrahydrofuran-3,4-diol ) shown in figure 1 . \n crystal structure of methyltransferase with its inhibitors s - adenosyl - l - homocysteine in dark yellow color \n it is applied to predict the structure and binding free energy of receptor and ligand complex . \n based on the extent of flexibility docking can be classified into four classes : both the receptor and ligand are flexible , receptor is flexible and ligand is rigid , ligand is flexible and receptor is rigid , and both the receptor and ligand are rigid . \n libdock module of discovery studio 3.5 was used for docking of the analogs of sah and target protein . \n the binding site was created by selecting sah using discovery studio 3.5 having binding site dimensions x ( 15.12 ) , y ( 13.23 ) , and z directions ( 17.28 ) for docking . \n the conformations of compounds were generated with maximum 225 numbers of conformations to be generated , and conformations of separate isomers were also created within the threshold of 20.0 kcal / mol relative energy . \n the charmm force field was applied to minimize the compounds with 1000 steps of steepest descent ( sd ) algorithm . \n the having a root mean square deviation ( rmsd ) < 1.0 were considered as duplicates as the higher specified rmsd value will reduce the number of ligand poses returned and an rms gradient 0.001 . \n libdock is a high - throughput algorithm developed by diller and merz , which consist of the polar and apolar features as hotspots . \n the molecules which passed the applied filters were docked with the crystal structure of mtase ( pdb i d - 2p41 ) in complex with guanine - n7 and adenosine-2o methylation ( 7-megpppg2ome ) and sah . \n charmm force field was applied for docking and scoring , and other docking parameters were kept default . \n ligand - receptor minimization in situ during dockingwas performed on the complexes to remove any ligand van der waals clashes prior scoring and calculating binding energy . \n the 5000 steps of sd with free movement of atoms within the binding site sphere were used during the minimization . \n the binding energy of protein - ligand complexes was calculated from the free energies of the complex , and free energies of individual protein and the ligand using charmm force field and implicit salvation method . \n ligands were prepared for use in docking and other applications by using discovery studio 3.5 , particularly for those which require a three - dimensional ( 3d ) coordinates and biological ionization and tautomerization states . when studying receptor - ligand interactions and other areas , it is important to correctly prepare the ligands . \n different protonation states , isomers and tautomers typically have different 3d geometries and binding characteristics . \n admet properties of the drug should be optimum at least to get drug absorbed and distributed to the site of action . \n the ratio of lipophilicity and water solubility should be according to the lipinski rule of five . as a highly soluble drug \n can not cross the membranes and a highly lipophilic drug gets the problem to get dissolved . \n hence , adme and toxicity prediction of compounds was done using admet and toxicity prediction modules of discovery studio 3.5 . \n adme descriptors allow eliminating the compounds with unfavorable admet characteristics early on to avoid expensive reformulation cost later and , for structural refinements that are designed to improve adme properties , prior to resource expenditure on synthesis . \n analogs were also subjected for analysis of topkat_fda_male / female mouse_noncarcinogenicity versus carcinogenicity probability where carcinogen versus noncarcinogen , probability below 0.3 indicates a noncarcinogen , and probability above 0.7 signifies a carcinogen . \n cytochrome p450 2d6 ( cyp2d6 ) plays an essential role in the metabolism of a wide range of xenobiotics in the liver and its inhibition by a drug constitutes a majority cases of drug - drug interaction . \n topkat module of discovery studio 3.5 validates toxicity estimation through quantitative structural toxicity relationship and similarity searching of the model 's database . on the basis of query compound structure , \n predictive models perform an accurate and valid estimation of the query structure because the model is accurately predictive in that region of space . \n pdb structure of mtase protein ( pdbid -2p41.a ) was retrieved from protein drug bank ( http://www.rcsb.org/pdb/home/home.do ) . \n mtase contains 7-megpppg2ome and sah where sah is shown in the binding pocket in dark yellow color in figure 1 . \n the bioisosteric replacement of group-1 ( 2-amino-4-mercaptobutanoic acid ) , group-2 ( 9h - purine ) , and group-3 ( tetrahydrofuran-3,4-diol ) [ figure 2 ] generated 93 , 89 , and 132 new bioisosteric analogs of sah , respectively . \n structure of s - adenosyl - l - homocysteine showing groups modified all the designed analogs of sah were subjected for in - silico adme analysis using discover studio 3.5 . \n only 41 analogs could pass the admet filter ( lipinski rule of five ) and toxicity filters ( carcinogenicity , mutagenicity , cyp2d6 prediction , and toxicity ) . \n a drug should have to get dissolved , i.e. , the drug should be soluble because solubility plays a significant role in drug action . \n hence , solubility range should between the 8.0 ( extremely low solubility ) and 0.0 ( optimal solubility ) . \n levels defined for solubility signified that the compounds with solubility levels 3 and 4 have good and optimal solubility , respectively , therefore these analogs have solubility as per ro5 as tabulated in table 1 . \n inhibitor analogs with good admet properties absorption of the drug should also be good so that a large amount of drug can reach at the site of action . \n absorption of a compound depends mainly on alogp and polar surface area ( psa ) of that compound . \n alogp98 denoted lipophilicity ( alogp ) value of the compound where the value of it should be between the 2.0 and 5.0 for good intestinal absorption of a drug . \n drug to permeate cells and to be absorbed orally it should have psa not more than 140 a. likewise , absorption level 0 and 1 defined that the compounds had good and moderate absorption level , respectively , according to ro5 as given in table 1 . \n all the 41 analogs were subjected for toxicity ( mutagenicity and carcinogenicity ) analysis using discovery studio 3.5 . \n the mutagenic or carcinogenic analogs of sah were eliminated where only 26 compounds were found nonmutagenic and noncarcinogenic [ table 2 ] . \n carcinogen versus noncarcinogen , probability below 0.3 indicates that only 26 analogs were found a noncarcinogen , in male , as well as in female , according to the data made available by the fda . \n the negative effect of selected compounds on cyp2d6 was analyzed and found that none of selected 26 compounds may inhibit the cyp2d6 . \n hence , there may be no chances of drug - drug interaction as shown in table 2 . \n the bioisosteric analogs of group-2 ( 9h - purine ) substructure only showed better druglikeness profiles . \n inhibitor analogs of sah which could pass toxicity screening before docking all the selected druglike 26 analogs of sah and target protein , mtase were prepared using discover studio 3.2 . \n the binding site was defined by selecting the lead compound sah in light red color circle around the sah compound as shown in figure 1 . \n prepared compounds were docked with target protein using libdock module of discover studio 3.2 and hundreds of pose conformations were generated for each compound . \n lead compound sah found to have libdock score 124.5 and binding energy ( 142.4 kcl / mol ) which formed hydrogen bonds with two residues lys.181 and ser.150 as shown in figure 3 . \n the methyl donor substrate sam had libdock score 125.3 and binding energy ( 145.3 kcl / mol ) and formed a hydrogen bond with two residues gly.148 and arg.84 different than the sah within the same binding pocket as shown in figure 3 . \n interaction of ( a ) s - adenosyl - l - homocysteine ( libdock score - 124.5 ) and ( b ) s - adenosyl - l - methionine ( libdock score - 125.3 ) with the methyltransferase target protein . \n s - adenosyl - l - methionine and s - adenosyl - l - homocysteine in yellow color , interacting amino acids in element color , and hydrogen bonds in green color are shown hence , analogs with more libdock score than sah and sam toward target protein ( more than 126 ) and good binding energy was selected as better compound analogs . only 17 analogs [ table 3 ] were found to have better interaction affinity ( libdock score ) than endogenous ligands sah and sam and lower binding energy and were also interacted with the amino acid residues participated in interacting with sah and sam given in table 4 . \n structures of final 17 designed bioisosteric analogs of sah ligand interaction score and interacting residues of better scoring analogs of sah the compound analog 1 with ( 137.8 ) highest libdock score formed h - bond with amino acids residues lys.181 and arg.57 shown in figure 4 . \n the compound analog 15 scored ( 135.9 ) formed the hydrogen bond with ser.150 residue as shown in figure 5 and analog 17 scored ( 136.1 ) also found to interact with the amino acid residues lys.181 and arg.84 as shown in figure 6 . \n these most scoring three compound analogs ( analog 1 , analog 15 , and analog 17 ) and all other selected analogs scored better dock score at lower binding energy and formed the hydrogen bonds with the residues interacting with sah within the same binding pocket . \n computational analysis suggested that the designed compounds interacted in a similar manner of sah within the binding pocket of sah . \n the compounds attained similar binding orientation occupying the common amino acids within the binding site figure 7 . \n interaction of analog 1 most scoring analogs of s - adenosyl - l - homocysteine interacting residues information within the binding pocket of target protein ( element color - ligand ; dotted blue color line - hydrogen bond ) interaction of analog 15 most scoring analogs of s - adenosyl - l - homocysteine within the binding pocket of target protein and interacting amino acid residues ( element color - ligand ; dotted blue color line - hydrogen bond ) analog 17 of most scoring analogs of s - adenosyl - l - homocysteine with interacting residues within the binding pocket of target protein ( element color - ligand ; dotted blue color line - hydrogen bond ) superimposition of all 17 s - adenosyl - l - homocysteine ( yellow color ) designed analogs ( green color ) within the binding site ( pale red color ) of target protein out of analogs designed by bioisosteric replacement of three substructures of sah , group-2 ( 9h - purine ) substructure bioisosteric analogs of sah only showed better interaction affinity than lead sah toward dengue mtase , as well as druglikeness . \n the bioisosteric replacement of group-1 ( 2-amino-4-mercaptobutanoic acid ) , group-2 ( 9h - purine ) , and group-3 ( tetrahydrofuran-3,4-diol ) [ figure 2 ] generated 93 , 89 , and 132 new bioisosteric analogs of sah , respectively . \n all the designed analogs of sah were subjected for in - silico adme analysis using discover studio 3.5 . \n only 41 analogs could pass the admet filter ( lipinski rule of five ) and toxicity filters ( carcinogenicity , mutagenicity , cyp2d6 prediction , and toxicity ) . \n a drug should have to get dissolved , i.e. , the drug should be soluble because solubility plays a significant role in drug action . \n hence , solubility range should between the 8.0 ( extremely low solubility ) and 0.0 ( optimal solubility ) . \n levels defined for solubility signified that the compounds with solubility levels 3 and 4 have good and optimal solubility , respectively , therefore these analogs have solubility as per ro5 as tabulated in table 1 . \n inhibitor analogs with good admet properties absorption of the drug should also be good so that a large amount of drug can reach at the site of action . \n absorption of a compound depends mainly on alogp and polar surface area ( psa ) of that compound . \n alogp98 denoted lipophilicity ( alogp ) value of the compound where the value of it should be between the 2.0 and 5.0 for good intestinal absorption of a drug . \n drug to permeate cells and to be absorbed orally it should have psa not more than 140 a. likewise , absorption level 0 and 1 defined that the compounds had good and moderate absorption level , respectively , according to ro5 as given in table 1 . \n all the 41 analogs were subjected for toxicity ( mutagenicity and carcinogenicity ) analysis using discovery studio 3.5 . \n the mutagenic or carcinogenic analogs of sah were eliminated where only 26 compounds were found nonmutagenic and noncarcinogenic [ table 2 ] . \n carcinogen versus noncarcinogen , probability below 0.3 indicates that only 26 analogs were found a noncarcinogen , in male , as well as in female , according to the data made available by the fda . \n the negative effect of selected compounds on cyp2d6 was analyzed and found that none of selected 26 compounds may inhibit the cyp2d6 . \n hence , there may be no chances of drug - drug interaction as shown in table 2 . \n the bioisosteric analogs of group-2 ( 9h - purine ) substructure only showed better druglikeness profiles . \n before docking all the selected druglike 26 analogs of sah and target protein , mtase were prepared using discover studio 3.2 . \n the binding site was defined by selecting the lead compound sah in light red color circle around the sah compound as shown in figure 1 . \n prepared compounds were docked with target protein using libdock module of discover studio 3.2 and hundreds of pose conformations were generated for each compound . \n lead compound sah found to have libdock score 124.5 and binding energy ( 142.4 kcl / mol ) which formed hydrogen bonds with two residues lys.181 and ser.150 as shown in figure 3 . \n the methyl donor substrate sam had libdock score 125.3 and binding energy ( 145.3 kcl / mol ) and formed a hydrogen bond with two residues gly.148 and arg.84 different than the sah within the same binding pocket as shown in figure 3 . \n interaction of ( a ) s - adenosyl - l - homocysteine ( libdock score - 124.5 ) and ( b ) s - adenosyl - l - methionine ( libdock score - 125.3 ) with the methyltransferase target protein . \n s - adenosyl - l - methionine and s - adenosyl - l - homocysteine in yellow color , interacting amino acids in element color , and hydrogen bonds in green color are shown hence , analogs with more libdock score than sah and sam toward target protein ( more than 126 ) and good binding energy was selected as better compound analogs . only 17 analogs [ table 3 ] were found to have better interaction affinity ( libdock score ) than endogenous ligands sah and sam and lower binding energy and were also interacted with the amino acid residues participated in interacting with sah and sam given in table 4 . \n structures of final 17 designed bioisosteric analogs of sah ligand interaction score and interacting residues of better scoring analogs of sah the compound analog 1 with ( 137.8 ) highest libdock score formed h - bond with amino acids residues lys.181 and arg.57 shown in figure 4 . \n the compound analog 15 scored ( 135.9 ) formed the hydrogen bond with ser.150 residue as shown in figure 5 and analog 17 scored ( 136.1 ) also found to interact with the amino acid residues lys.181 and arg.84 as shown in figure 6 . \n these most scoring three compound analogs ( analog 1 , analog 15 , and analog 17 ) and all other selected analogs scored better dock score at lower binding energy and formed the hydrogen bonds with the residues interacting with sah within the same binding pocket . \n computational analysis suggested that the designed compounds interacted in a similar manner of sah within the binding pocket of sah . \n the compounds attained similar binding orientation occupying the common amino acids within the binding site figure 7 . \n interaction of analog 1 most scoring analogs of s - adenosyl - l - homocysteine interacting residues information within the binding pocket of target protein ( element color - ligand ; dotted blue color line - hydrogen bond ) interaction of analog 15 most scoring analogs of s - adenosyl - l - homocysteine within the binding pocket of target protein and interacting amino acid residues ( element color - ligand ; dotted blue color line - hydrogen bond ) analog 17 of most scoring analogs of s - adenosyl - l - homocysteine with interacting residues within the binding pocket of target protein ( element color - ligand ; dotted blue color line - hydrogen bond ) superimposition of all 17 s - adenosyl - l - homocysteine ( yellow color ) designed analogs ( green color ) within the binding site ( pale red color ) of target protein out of analogs designed by bioisosteric replacement of three substructures of sah , group-2 ( 9h - purine ) substructure bioisosteric analogs of sah only showed better interaction affinity than lead sah toward dengue mtase , as well as druglikeness . \n the drug discovery for dengue fever is the serious concern around the world in recent decades because there is no permanent good drug against dengue . \n mtase plays a crucial role in methylation and catalyzing the capping of viral rna , which is an important step for viral replication . out of the modified analogs of sah \n , 17 analogs were found to have a better affinity for mtase protein and admet property . \n seventeen compounds found nonmutagenic , as well as noncarcinogenic and had a good druglike profile . \n the dock score of all selected 17 inhibitor analogs of mtase found better than sah and even sam also . \n three analogs ( analog 1 , analog 15 , and analog 17 ) were found best scoring among all . \n compounds interacted in the pattern of sah and sam - forming hydrogen bond with lys.181 , ser.150 , and arg.84 amino acid residues found to interact with sam and sah . so the computational study suggested that the designed analogs may act as inhibitors of mtase protein and may lead to the better drug against dengue virus . \n \n ", "role": "user" }, { "content": "aim : aim of this work was to design and identify some s - adenosyl - l - homocysteine ( sah ) analogs as inhibitors of s - adenosyl - l - methionine - dependent methyltransferase ( mtase ) protein using computational approaches.introduction:according to the current scenario the dengue has been a global burden . \n the people are being killed by dengue virus in an abundant number . despite of lot of research being going on dengue worldwide , there is no single drug which can kill its virus . \n this creates an urge for new drug target identification and designing . \n mtase has been reported as an effective target against dengue virus as it catalyzes an essential step in methylation and capping of viral rna for viral replication.materials and methods : the crystal structure of mtase in complex with sah was used for designing new analogs of sah . \n sah analogs designed were analyzed on the basis of docking , admet , and toxicity analysis done using discovery studio 3.5.results:seventeen analogs found noncarcinogenic , nonmutagenic , as well as good admet properties and good drug - like profile.conclusion:these sah analogs , inhibitors of mtase may act as drugs against dengue virus . \n further synthesis and biological testing against dengue virus is under observation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: broadly , there are five areas which are available for a bams graduate to build a career successfully viz . clinical practice , academic ( teaching ) , management & administration , drug manufacturing and research . \n research is a process of searching the knowledge by systematic investigation and to establish novel facts by scientific methods . \n medical research has lot of importance as it is much needed for the addition of knowledge and thereby to improve health care \n . it can be achieved by various methods of research ranging from drug trials to community surveys and from trends in the past years to unusual cases in the hospital . \n even though variety of approaches are available , the scenario of medical research in india is not encouraging . \n there are reports available mentioning facts & figures about the modern medical undergraduate students level research and also discussing the potential reasons behind this apathy , . \n considering the global scenario , the medical council of india is focusing more on the improvement of medical research and emphasizing the same even at undergraduate level . in case of ayurveda , although the research culture is slowly gaining pace , the undergraduate students are not educated or motivated in this direction . \n the present study reports the attitude of interns in an ayurveda teaching hospital about research as a career . \n we carried out a cross sectional study among the interns of the kleu 's bmk ayurved mahavidyalaya , belgaum , wherein the interns ( n = 40 ) were asked to prioritize their career options from research , teaching and clinical practice . \n lastly , the interested candidates were asked to enroll their names for the ongoing research projects in the college . \n this whole exercise was done at the end of a lecture , which was arranged as a part of routine activities for the interns as an institutional norm . \n out of 40 interns , 36 preferred clinical practice as first career priority , whereas 4 selected teaching as option . \n research was chosen as second priority by 18 and third priority by 22 interns . when asked about the rationale behind this priority \n , they unanimously opined that ayurveda is a clinical science and they have opted for a medical degree , hence clinical practice obviously becomes their first preference . \n they also feel that treating the patients and thereby helping mankind is a noble job and they would be happier to take up this job . \n further , they have experienced that the physician who treats the patients receives high regards in the society and that is why their preference is towards clinical practice . \n interestingly , although they could justify their first preference towards clinical practice reasonably well ; they could not provide any justification for their preference towards research . \n rather , they expressed their inability to comment anything about research . regarding enrollment to the research projects \n the present study was carried out to know the attitudes of the interns towards research as career option in an ayurvedic teaching hospital . \n this may be because they are not exposed to the research methodology and importance of research during their undergraduate studies . \n further , the current curriculum does neither include terms like evidence base , data generation nor the introduction to findings of major nationwide research projects such as csir - nmitli , a science initiative in ayurveda . \n the central council for indian medicine ( ccim ) has introduced research as a subject in final year ayurvedic ( bams ) students , which is welcoming step . \n although this will impart theoretical knowledge , it would prove more impactful if coupled with practical training . \n the students during their undergraduate studies rarely get an opportunity to visit a research institute or get hands - on - training in certain techniques . the same thing is reflected in the career options prioritized by the interns participated in our study . \n we therefore suggest that an elective module exclusively in research can be introduced during the internship tenure , wherein the interested students can be posted at a research institute for a period of two months or so . for the students of modern medicine ( mbbs ) , various schemes and programmes are available such as icmr short term studentship ( sts ) , kvpy ( kishore vaigyanik protsahan yojana ) , conferences for medical students and so on . \n mbbs students are eligible to get srf through which they can work on a research project for three years and can extend the work by registering to phd . \n it is offered by indian council of medical research ( icmr ) , council of scientific and industrial research ( csir ) and university grants commission ( ugc ) . \n we further feel that if the students are exposed to the research methodology in their undergraduate days , they will be in a better position to conduct full - fledged research studies during their postgraduate tenure . \n this will certainly help to improve the standards of md / ms dissertations and phd theses . \n vaidya - scientist fellowship programme to train the candidates in the shastras , science and medicine along with exposure to appropriate research methodology is an ambitious programme , which not only needs to be continued but also to be strengthened by increasing intake capacity . \n our study thus highlights the ignorance ( and therefore apathy ) of interns towards research as career option . \n however , it must be noted here that the study has not been conducted in structured way . \n this makes the results less generalizable and it would be desirable to carry out such study in different colleges across the country involving a larger sample size . to sum up , the career preferences given by interns in our study indicates conventional approach towards medical education . \n there is need to change their attitudes through appropriate training and by introducing different programmes to foster the research culture . \n \n ", "role": "user" }, { "content": "although today 's ayurvedic graduates have many career options to select from , they are not given any exposure to these options during their study . \n this results in apathy towards selection of any career apart from clinical practice . \n the present study carried out amongst interns of one ayurvedic college highlights this fact and underlines the importance of introducing \n research as a subject in the curriculum .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the treatment of complicated crown - root fractures in many cases is compromised by tooth fractures that are well below the gingival margin or bone . after root canal obturation , \n proper isolation for a dry operation field is critical for successful restoration of traumatized teeth . in this respect , \n a wide range of treatment options have been advocated for traumatic permanent teeth include ; orthodontic extrusion1 osteotomy / osteoplasty2 intentional replantation3 re - attachment of fragments4 re - attachment of a tooth fragment should be preferable to restoring fractured teeth . \n there are several advantages in this treatment such as obtaining esthetic in a single appointment , being more conservative procedure , obtaining healthy periodontal attachment and it maintains the original tooth contours and translucence as the patient s own.5,6 the present case report describes the re - attachment of an original tooth fragment using a glass fiber post . \n a 32-year - old male patient was referred to the endodontic clinic of the faculty of dentistry , s. demirel university , with the complaint of a fractured right maxillary incisor tooth because of a trauma . \n the patient related pain during breathing and bleeding through the line of fracture ( figure 1 ) . \n the clinical and radiographic examinations showed an oblique crown - root fracture in the maxillary right central incisor involved the enamel \n root canal pulp extirpation and canal preparation was performed using the standard step - back method . \n the prepared teeth were dried with paper - points ( dentsply maillefer , tulsa , ok ) and filled with laterally condensed gutta - percha ( diadent group international inc . , chongju , korea ) and sealapex ( kerr , manufacturing co. , romulus , mi ) root canal sealer . \n after sealer set , the gutta - percha was partially removed from the root canal using heated instrument , leaving 5 mm of the filling material at the apex to maintain a good sealing . \n a post hole within root and coronal fragment was prepared using a drill recommended by manufacturer ( carbotech , ganges , france ) . a glass fiber post ( snowpost , carbotech , ganges , france ) was cemented within root canal with dual adhesive cement ( variolink ii , ivoclar vivadent , schaan , liechtenstein ) . \n after taking his consent , full thickness buccolingual mucoperiostal flap was raised with an intrasulcular incision ( figure 3 ) . \n after all debris on the fractured root surface was scaled , washed away with sterile serum physiologic and dried . \n a primer ( kuraray co. ltd , osaka , japan ) was applied onto the fractured surfaces of the tooth fragments for 20 second . \n clearfil se ( kuraray co. ltd , osaka , japan ) bonding agent was applied to the primed surfaces of the fragments and light cured for 10 second . \n the fragments were reattached with a composite resin ( clearfil ap - x , kuraray co. ltd , osaka , japan ) . \n the excess resin was removed with an excavator and the crown was light cured for 40 seconds from both buccal and palatal aspects . \n final polishing of the crown - root interface was made with ultrafine diamond burs and polishing disks . \n one week later , the sutures were removed and clinical examination was revealed proper healing ( figure 5 ) . \n one month later , the clinical and radiographic examinations revealed a stable reattachment of the crown fragment ( figure 6 ) . \n after 12 months , clinical and radiographic examinations showed a stable reattachment of the fragments , good aesthetics and periodontal health ( figures 7 and 8) . \n the present case report described that tooth fragment reattachment is an alternative to composite resin build - up for restoring esthetics and function of oblique fractured teeth . up to date \n , a lot of different approaches were proposed for treatment of fractured teeth depending on location of the fracture.7 one of the options for managing coronal tooth fractures is the reattachment of the dental fragment.4 re - attachment of fragments offers a good esthetic , less time - consuming and cost - effective restorative option . \n contemporary resin adhesives and resin post systems that allow strong durable bonds to dentin enhance this option.8,9 in this case , a glass fiber post was used to retain the coronal segment and reduce the stress on the luting material . \n the post interlocks the two separate fragments and minimizes the stress on the remaining tooth structure.7,10 the re - attachment of a tooth fragment is a viable technique that restores function and esthetics with a very conservative approach , but for each trauma case should be attempted to restore on an individual basis .", "role": "user" }, { "content": "this case report presents a 32 year old male with an oblique fractured maxillary right central incisor . the procedure used to repair the fracture included flap surgery with an intrasulcular incision and endodontic treatment . \n the root canal was filled with a root canal sealer and gutta - percha . \n after root canal obturation , fragments were luted with composite resin using a glass fibers post . \n after 12 months , clinical and radiographic examinations showed a stable reattachment of the fragments , good aesthetics and periodontal health . \n ( eur j dent 2008;2:138141 )", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: isolated ureteropelvic junction obstruction ( upjo ) and vesico - ureteric junction obstruction ( vujo ) are two common causes of hydronephrosis in children . \n they can be diagnosed easily when are isolated but when together can be difficult to diagnose . \n the presence of these two anomalies in the ipsilateral ureter is rare and is very difficult to diagnose . \n the established protocol for investigation of upjo is ultrasonography ( usg ) of the kidney , ureter and bladder region and diuretic renogram . \n the role of intravenous urography ( ivu ) , micturating cystourethrogram ( mcu ) and retrograde pyelography is still debatable . \n the chance of missing associated pathology ranges from 54.55% to 78.57% in different series and whenever the associated pathology is missed it can complicate the postoperative period . here \n , we discuss the problems we faced when we encountered these two anomalies in the same ureter and the way in which we managed them . \n the total number of patients with both obstructions at the upj and vuj in the same ureter in our study is 5 . \n these patients were managed in our institute between 1 january 2004 to 31 december 2011.the patients were evaluated according to their demographic profile , side of affected ureter , clinical presentation and with diagnostic studies ( usg , diethyl triaminepentaacetic acid ( dtpa ) scan , ivu , mcu and surgical intervention ( anderson hynes dismembered pyeloplasty ) , with the outcome . \n all the patients with unilateral hydronephrosis due to suspected upjo were included in the study . \n in the present study the male : female ratio was 4:1 . the mean age of the patients was 7 years ( range 5 to 10 years ) . the left side was affected in three patients and in two the right side was affected [ table 1 ] . \n unfortunately , in none of the patients we were able to diagnose the ipsilateral distal ureteral obstruction in spite of doing all the above - mentioned investigations . dilated distal ureter was not seen in any of the patients in preoperative usg and even in ivu with 24 hours delayed film . \n all these patients underwent an anderson - hynes pyeloplasty after routine investigations ( usg , dtpa scan and ivu ) . in four patients , \n pyeloplasty was done via dorsal lumbotomy approach and in one patient the flank approach was used . \n a summary of the clinical data , preoperative diagnosis , intraoperative findings and management in patients double j stent was used to protect the anastomosis and also to look for any distal obstruction . in all these five patients , we suspected a distal obstruction as we were unable to negotiate an appropriate size dj stent into the bladder . \n so , a nephrostomy was done in order to delineate the anatomy of the urinary tract as ivu was showing non - functioning kidney . \n images from the ureter in nephrostogram done on the seventh postoperative day showed obstruction at the distal end of the ureter causing dilatation of the ureter with narrowing at the vesicoureteric junction . \n ureteric dilatation persisted on the repeat nephrostogram done after 3 weeks in four of the five patients . \n so , ureteric reimplantation was done in all the four cases with complete vujo . in one patient ( female child ) \n which showed reduced dilatation of the distal ureter on repeat nephrostogram was followed up and the obstruction resolved without any intervention . at present , all the patients are on follow up ( mean duration of follow up is 24 months ) and are doing well . \n the follow - up plan in our institute is as follows : 1 visit at 2 weeks , 2 visit after 1 month , 3 visit after 6 weeks for dj stent removal , 4 visit after 3 months , then at 6 monthly interval for 1 year and then yearly for at least 3 years . \n the coexistence of upjo and uvjo is so rare that even after getting all the routine investigations done in a case of hydronephrosis or a congenital megaureter it can be missed . \n this is the reason why a significant number of these cases were diagnosed intraoperatively or postoperatively in the few series dealing with this rare entity published in the literature . in the series by mcgrath et al . \n it presents as a unique challenge to any clinician because if diagnosed during or after the surgery the parents have to be counseled accordingly which at times is really difficult . \n the incidence of double obstruction ( obstruction at both upjo and uvjo ) varies in different series from 3% to 25% . in our series , \n preoperative diagnosis was done in only 21.43% patients in the study by mcgrath et al . in 35.71% patients in the study by cay et al . in 45.45% in the study by pesce et al . but none of the patients in our study were diagnosed preoperatively . \n the reason for missing the dilated ureter in usg , radionuclide scans and ivu may be due to the severe obstruction at one end of the ureter causing the other obstruction to be totally overlooked or it can be missed if we do not keep the possibility of a second obstruction in mind as mentioned in the literature . \n the inability to visualize the dilated distal ureter in ivu in a case of upjo may be due to a very negligible amount of contrast passing through the intermittently obstructing upj . \n this can lead to missing the second obstruction present in the distal ureter as it is not found to be dilated as seen in our series . as per mcgrath et al . whenever ivu in a case of hydronephrosis due to upjo is unable to delineate the distal ureter we should go for a retrograde pyelography ( rpg ) or usg to rule out the presence of a distal ureteral obstruction . though usg was done in all our cases it failed to suggest any ureteral dilatation . \n as rpg is not routinely done in our cases of upjo we missed to make any preoperative diagnosis of double obstruction of ureter . \n usg and mcu before pyeloplasty in case 1 preoperative usg & ivu of case 2 postoperative nephrostogram showing distal obstruction at left vesicoureteric junction in case 1 postoperative nephrostogram showing dilated distal ureter on the left side suggesting left vesicoureteric junction obstruction also there are chances of human error which are there with any investigation leading to a missed diagnosis . \n thus , whenever in doubt about a double obstruction of ureter we should go for a rpg if the ureters can be catheterized or for a computerized tomographic urography ( ct urography ) if the ureters ca n't be catheterized . \n when we encounter both the obstructions together , upjo should be corrected first as the second obstruction can get resolved spontaneously as was also seen in one of our patients . \n we routinely put in a nephrostomy tube after pyeloplasty whenever the passage of appropriate size dj stent into the bladder is not possible . \n postoperative nephrostogram helps in confirming the distal obstruction and is also of help in following up patients where the distal obstruction is spontaneously resolved . \n children with double obstruction of the ipsilateral ureter present as a diagnostic dilemma . because of the rarity of this condition it can escape the eye of even an astute clinician . \n early diagnosis can be made if this condition is kept in mind while treating any hydronephrosis due to upjo or uvjo . \n as far as our small series is concerned retrograde pyelogram may not be recommended as an essential preoperative investigation but may be a desirable investigation .", "role": "user" }, { "content": "introduction : isolated obstruction of the ureteropelvic junction and the vesico - ureteric junction are the two most common causes of hydronephrosis in a pediatric population.[1 ] they do not pose diagnostic difficulties when are present alone but when together can be difficult to diagnose . here , we discuss the problems we faced when we encountered these two anomalies in the same ureter and the way in which we managed them.aim:to assess the difficulties in diagnosis of pediatric patients who present with both ureteropelvic junction obstruction ( upjo ) and vesico - ureteric junction obstruction ( vujo ) in the ipsilateral ureter and their management protocol.materials and methods : this is a retrospective study . \n the study period is from 1 january 2004 to 31 december 2011 . out of 254 children who were diagnosed to have hydronephrosis due to upjo in our institute , 5 patients ( in the age range of 5 to 10 years ) had both upjo and vujo in the ipsilateral ureter . \n the problems we faced in diagnosing the two conditions are mentioned with a literature review.results:operative intervention was used in four out of five patients ; none of the patients had an accurate diagnosis before surgery . \n all patients were suspected of having double obstruction during pyeloplasty when appropriate size double j stent could not be negotiated through the vesicoureteric junction into the bladder . \n postoperative nephrostogram confirmed the diagnosis in all patients.conclusion:children with double obstruction of the ipsilateral ureter present as a diagnostic dilemma . because of the rarity of this condition it can escape the eye of even an astute clinician . \n early diagnosis can be made if this condition is kept in mind while treating any hydronephrosis due to upjo or uvjo .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the study included 225 boys aged 716 years , recruited from two centers of a football academy in the area of tunis ( latitude , 35n ) . \n children with liver , renal , or bone disease ; intestinal malabsorption ; or cancer ; and those taking vitamin d supplements , anticonvulsant drugs , or systemic corticosteroids were not included . \n the study was carried out from january to march 2014 , a period during which temperatures varied between 10c and 22c and the humidity ranged from 70 to 75% . besides 2 h per week of outdoor physical activity as part of the school program , each child attends three weekly outdoor sessions in the football academy . \n the training sessions are scheduled from 5 pm to 6 pm on friday and saturday , and from 9 am to 10 am on sunday . \n skin color of each participant was determined by two investigators ( ib and mf ) , together with one parent of the child , and classified as fair , corresponding to fitzpatrick skin types 1 and 2 , or dark , corresponding to fitzpatrick skin types 3 and 4 ( 19 ) . written parental permission was obtained for each participant . \n weight , height , and sitting height were measured with the subjects barefooted and lightly clothed . \n body mass index ( bmi ) was calculated as weight per height squared ( kg m ) . \n participants were divided according to the world health organization ( who ) child growth standards for bmi in three groups ; normal - weight group ( bmi85th percentile ) , overweight group ( 85th percentile < bmi < 97th percentile ) , and obese group ( bmi>97th percentile ) ( 20 ) . \n triceps and subscapular skinfolds thickness was measured with harpenden 's skinfold calipers ( baty international , west sussex , england ) . \n biologic maturity was assessed by incorporating anthropometric variables ( weight , standing height , and sitting height ) and was calculated using the equation of mirwald ( 22 ) ; maturity offset=9.236+(0.0002708*leg length*sitting height)+(0.001663*age*leg length)+(0.007216*age*sitting height)+(0.02292*weight by height ratio ) . \n this assessment is a non - invasive and practical approved method of predicting age in years from the peak height velocity ( phv ) as a measure of maturity offset . for the purpose of data analysis \n , children were divided into three groups : pre - phv ( 3 to 1 year from phv ) , around phv ( 1 to + 1 year from phv ) , and post - phv ( + 1 to + 3 years from phv ) . \n the daily vitamin d intake in children 's diet was assessed using a 3-day food record ( including 2 weekdays and 1 day over the weekend ) , combined with a food frequency questionnaire ( ffq ) that the parents mostly completed . a 35-items ffq to quantify the consumption of nutrients naturally rich in vitamin d , such as fatty fish , meat , eggs , milk , and other dairy products . \n the ffq was modified to estimate vitamin d intake and consumption frequency across nine categories ( never , 1 time / month , 12 times / week , 23 times / week , 34 times / week , 1 time / day , 2 times / day , 3 times / day , and 4 times / day ) . \n ease of administration of this ffq was enhanced by the use of a food photograph album of tunisian food products that emphasized portion sizes . \n four food groups were selected as follows : fish ( 50 g / serving ) , eggs ( 50 g / serving ) , red meat ( 50 g / serving ) , and milk ( 200 ml / serving ) . \n consumption frequencies of milk and egg were standardized into servings per day and into servings per week for fish and red meat . \n the data about the mean daily intake of nutrients were processed using the professional nutri pro 7 program ( nutri pro 7 software , cerden , brussels , belgium ) . \n blood was centrifuged at 2000g for 20 min and the plasma was frozen at 40c until analysis ( within 3 months ) . plasma glucose , calcium , phosphorus , and c - reactive protein ( crp ) were assessed on architect c8000 analyzer ( abbott laboratories , abbott park , il ) , using the respective reagents kits . \n plasma 25-hydroxyvitamin d ( 25-ohd ) and insulin concentrations were measured by chemiluminescence immunoassay methods using the liaison analyzer ( diasorin inc . , \n vitamin d status was evaluated according to the standards of the institute of medicine ( iom ) . \n vitamin d deficiency , insufficiency , and sufficiency were defined as plasma 25-ohd concentrations below 12 g / l , 12 to 20 g / l , and over 20 g / l , respectively ( 24 ) . \n insulin sensitivity / resistance was assessed using two indexes ; the homeostasis model assessment of insulin resistance ( homa - ir ) and the quantitative insulin sensitivity check index ( quicki ) , according to the following equations ( 25 , 26 ) : homa - ir=[(fasting insulin in u / ml ) ( fasting glucose in mg / dl)/405 ] ; quicki=1/[log(fasting insulin in u / ml)+log(fasting glucose in mg / dl ) ] . \n data were analyzed using spss for windows ( version 18.0 ; spss inc . , chicago , il ) . \n values are expressed as mean ( sd ) or median ( inter quartile range , iqr ) for continuous variables and as a percent for categorical variables . comparisons between groups were performed using analysis of variance or the mann \n whitney test for continuous variables and pearson chi - square test or fisher 's exact test for categorical variables as appropriate . \n unadjusted and multi - adjusted odd - ratios with 95% confidence intervals were calculated as an estimate of the risk of vitamin d deficiency / insufficiency for several potential risk factors . \n a binary logistic regression model was used to identify predictors for vitamin d deficiency , while adjusting for possible confounding factors . \n adjustment was performed on maturation status ( pre - phv / around and post - phv ) ; body mass ( normal - weight / overweight and obese ) ; skin color ( fair / dark ) ; and dichotomous variables for fat mass ( < 20%/20% ) , homa - ir ( < 1.5/1.5 ) ; and the daily intake of vitamin d ( < 8.5/8.5 g ) , milk ( < 500/500 ml ) , red meat ( < 100/100 g ) , fish ( < 100/100 g ) , and eggs ( < 50/50 g ) , defined as the respective continuous variables split at the median . \n the study included 225 boys aged 716 years , recruited from two centers of a football academy in the area of tunis ( latitude , 35n ) . \n children with liver , renal , or bone disease ; intestinal malabsorption ; or cancer ; and those taking vitamin d supplements , anticonvulsant drugs , or systemic corticosteroids were not included . \n the study was carried out from january to march 2014 , a period during which temperatures varied between 10c and 22c and the humidity ranged from 70 to 75% . besides 2 h per week of outdoor physical activity as part of the school program , each child attends three weekly outdoor sessions in the football academy . \n the training sessions are scheduled from 5 pm to 6 pm on friday and saturday , and from 9 am to 10 am on sunday . \n skin color of each participant was determined by two investigators ( ib and mf ) , together with one parent of the child , and classified as fair , corresponding to fitzpatrick skin types 1 and 2 , or dark , corresponding to fitzpatrick skin types 3 and 4 ( 19 ) . written parental permission was obtained for each participant . \n weight , height , and sitting height were measured with the subjects barefooted and lightly clothed . \n body mass index ( bmi ) was calculated as weight per height squared ( kg m ) . \n participants were divided according to the world health organization ( who ) child growth standards for bmi in three groups ; normal - weight group ( bmi85th percentile ) , overweight group ( 85th percentile < bmi < 97th percentile ) , and obese group ( bmi>97th percentile ) ( 20 ) . \n triceps and subscapular skinfolds thickness was measured with harpenden 's skinfold calipers ( baty international , west sussex , england ) . \n biologic maturity was assessed by incorporating anthropometric variables ( weight , standing height , and sitting height ) and was calculated using the equation of mirwald ( 22 ) ; maturity offset=9.236+(0.0002708*leg length*sitting height)+(0.001663*age*leg length)+(0.007216*age*sitting height)+(0.02292*weight by height ratio ) . \n this assessment is a non - invasive and practical approved method of predicting age in years from the peak height velocity ( phv ) as a measure of maturity offset . for the purpose of data analysis , children were divided into three groups : pre - phv ( 3 to 1 year from phv ) , around phv ( 1 to + 1 year from phv ) , and post - phv ( + 1 to + 3 years from phv ) . \n weight , height , and sitting height were measured with the subjects barefooted and lightly clothed . \n body mass index ( bmi ) was calculated as weight per height squared ( kg m ) . \n participants were divided according to the world health organization ( who ) child growth standards for bmi in three groups ; normal - weight group ( bmi85th percentile ) , overweight group ( 85th percentile < bmi < 97th percentile ) , and obese group ( bmi>97th percentile ) ( 20 ) . \n triceps and subscapular skinfolds thickness was measured with harpenden 's skinfold calipers ( baty international , west sussex , england ) . \n biologic maturity was assessed by incorporating anthropometric variables ( weight , standing height , and sitting height ) and was calculated using the equation of mirwald ( 22 ) ; maturity offset=9.236+(0.0002708*leg length*sitting height)+(0.001663*age*leg length)+(0.007216*age*sitting height)+(0.02292*weight by height ratio ) . \n this assessment is a non - invasive and practical approved method of predicting age in years from the peak height velocity ( phv ) as a measure of maturity offset . for the purpose of data analysis , children were divided into three groups : pre - phv ( 3 to 1 year from phv ) , around phv ( 1 to + 1 year from phv ) , and post - phv ( + 1 to + 3 years from phv ) . \n the daily vitamin d intake in children 's diet was assessed using a 3-day food record ( including 2 weekdays and 1 day over the weekend ) , combined with a food frequency questionnaire ( ffq ) that the parents mostly completed . a 35-items ffq to quantify the consumption of nutrients naturally rich in vitamin d , such as fatty fish , meat , eggs , milk , and other dairy products . \n the ffq was modified to estimate vitamin d intake and consumption frequency across nine categories ( never , 1 time / month , 12 times / week , 23 times / week , 34 times / week , 1 time / day , 2 times / day , 3 times / day , and 4 times / day ) . \n ease of administration of this ffq was enhanced by the use of a food photograph album of tunisian food products that emphasized portion sizes . \n four food groups were selected as follows : fish ( 50 g / serving ) , eggs ( 50 g / serving ) , red meat ( 50 g / serving ) , and milk ( 200 ml / serving ) . \n consumption frequencies of milk and egg were standardized into servings per day and into servings per week for fish and red meat . \n the data about the mean daily intake of nutrients were processed using the professional nutri pro 7 program ( nutri pro 7 software , cerden , brussels , belgium ) . \n blood was centrifuged at 2000g for 20 min and the plasma was frozen at 40c until analysis ( within 3 months ) . \n plasma glucose , calcium , phosphorus , and c - reactive protein ( crp ) were assessed on architect c8000 analyzer ( abbott laboratories , abbott park , il ) , using the respective reagents kits . \n plasma 25-hydroxyvitamin d ( 25-ohd ) and insulin concentrations were measured by chemiluminescence immunoassay methods using the liaison analyzer ( diasorin inc . , \n vitamin d status was evaluated according to the standards of the institute of medicine ( iom ) . \n vitamin d deficiency , insufficiency , and sufficiency were defined as plasma 25-ohd concentrations below 12 g / l , 12 to 20 g / l , and over 20 g / l , respectively ( 24 ) . \n insulin sensitivity / resistance was assessed using two indexes ; the homeostasis model assessment of insulin resistance ( homa - ir ) and the quantitative insulin sensitivity check index ( quicki ) , according to the following equations ( 25 , 26 ) : homa - ir=[(fasting insulin in u / ml ) ( fasting glucose in mg / dl)/405 ] ; quicki=1/[log(fasting insulin in u / ml)+log(fasting glucose in mg / dl ) ] . \n data were analyzed using spss for windows ( version 18.0 ; spss inc . , chicago , il ) . \n values are expressed as mean ( sd ) or median ( inter quartile range , iqr ) for continuous variables and as a percent for categorical variables . \n whitney test for continuous variables and pearson chi - square test or fisher 's exact test for categorical variables as appropriate . \n unadjusted and multi - adjusted odd - ratios with 95% confidence intervals were calculated as an estimate of the risk of vitamin d deficiency / insufficiency for several potential risk factors . \n a binary logistic regression model was used to identify predictors for vitamin d deficiency , while adjusting for possible confounding factors . \n adjustment was performed on maturation status ( pre - phv / around and post - phv ) ; body mass ( normal - weight / overweight and obese ) ; skin color ( fair / dark ) ; and dichotomous variables for fat mass ( < 20%/20% ) , homa - ir ( < 1.5/1.5 ) ; and the daily intake of vitamin d ( < 8.5/8.5 g ) , milk ( < 500/500 ml ) , red meat ( < 100/100 g ) , fish ( < 100/100 g ) , and eggs ( < 50/50 g ) , defined as the respective continuous variables split at the median . \n serum crp and insulin concentrations and homa - ir and total energy intake were significantly higher and quicki lower in obese and overweight children compared to normal - weight children . \n plasma 25-ohd concentrations ranged between 3.80 and 31 g / l , and did not differ according to body mass ( fig . \n vitamin d inadequacy was noted in about 85% of the children , with 40.9% having deficiency and 44% having insufficiency . \n plasma 25-ohd was positively correlated with dietary intake of proteins ( r=0.407 , p<0.001 ) , milk ( r=0.542 , p<0.001 ) , red meat ( r=0.282 , p<0.001 ) , fish ( r=0.502 , p<0.001 ) , and eggs ( r=0.512 , p<0.001 ) ( fig . \n 2 ) . however , no significant correlation was observed with phv , bmi , fat mass , homa - ir , or quicki . \n compared with vitamin - d - sufficient children , those with vitamin d deficiency or insufficiency showed lower intakes of proteins , milk , red meat , fish , and eggs ( fig . \n vitamin d deficiency and insufficiency were associated with lower dietary intakes of vitamin d , proteins , milk , red meat , fish , and eggs . however , \n no association was observed with phv , bmi , fat mass , homa - ir , or skin color ( table 2 ) . \n . correlations of plasma 25-hydroxyvitamin d with daily intake of red meat , fish , eggs , and milk in tunisian active children ( n=174 ) \n . daily intake of proteins , red meat , fish , eggs , and milk according to the vitamin d status in tunisian active children ( n=174 ) . \n clinical , nutritional , and biochemical characteristics of children according to body mass ( n=225 ) values are expressed as meansd or median ( inter quartile range ) ; homa - ir , homeostasis model assessment of insulin resistance ; quicki , quantitative insulin sensitivity check index . \n plasma 25-hydroxyvitamin d and multi - adjusted odd - ratios for vitamin d deficiency / insufficiency in children according to confounding variables phv , pick of high velocity ; or , odd - ratio ; 95% ci , 95% confidence interval ; 25-ohd , 25-hydroxyvitamin d adjusted for maturation status , bmi , skin color , fat mass , homa - ir , and intake of vitamin d , milk , red meat , fish , and eggs \n this study showed that vitamin d inadequacy is common among active tunisian children and is associated with a low intake of vitamin d food sources , but not with maturity status , adiposity , or insulin resistance . \n the high prevalence of vitamin d inadequacy in tunisian children is consistent with similar findings in other parts of the world ( 410 ) . \n this finding is somewhat surprising since these are active children who live in a sunny environment and engage in a reasonable level of outdoor activities . \n our study had been conducted during the winter when plasma 25-ohd levels are usually at their nadir ( 3 ) . because of cool environmental temperatures , children were wearing clothes that covered the trunk and limbs , minimizing the skin area exposed to the sun 's rays and preventing vitamin d synthesis . \n also , the training sessions were held in the early mornings or late afternoons when the sun 's rays are least efficient for vitamin d synthesis ( 7 , 27 ) . \n although dark skin color is a risk factor for hypovitaminosis d , obviously , that distinction is of little importance when most of the skin areas are covered with the clothing . \n however , the most important factor behind the observed vitamin d inadequacy in most children is probably the inadequate intake of dietary vitamin d sources . \n our data demonstrate that active children living in sunny environments may still have vitamin d inadequacy , which underlines the importance of monitoring plasma 25-ohd concentrations in children . \n in all the children participating in the present study , the daily oral vitamin d intake was well below the us institute of medicine recommended daily allowance ( rda ) of 15 mcg ( 24 ) . \n there is no dietary recommendation for vitamin d for children and adolescents in tunisia , as it is assumed that sun exposure will ensure an adequate vitamin d status . \n our finding of low plasma 25-ohd levels in 85% of the participants highlights the need for evidence - based dietary recommendations for tunisian children . \n our study also showed a clear relationship between vitamin d deficiency / insufficiency and low intake of vitamin d food sources ( i.e. fish , meat , milk , and eggs ) . \n ( 10 ) showing a positive correlation of serum 25-ohd with the consumption of vitamin d food sources in korean adolescents . in sunny areas , although sun exposure is the major source of vitamin d in the body , vitamin d inadequacy may occur . \n this suggests that concomitant appropriate dietary intake is required . the assumption that , in sunny environment , sun exposure alone may provide adequate plasma 25-ohd levels is often false . \n when sun exposure is limited as a consequence of low - sunshine seasons , pollution , dark skin , or clothing , the dietary intake of vitamin d may be the more significant contributor to vitamin d status . in these conditions , \n the present study showed no association between plasma 25-ohd and adiposity as assessed either by bmi percentile or fat mass . \n some previous studies reported an inverse relationship between plasma 25-ohd and adiposity ( 7 , 9 , 11 , 28 ) , while others found no association ( 8 , 13 , 14 , 29 ) . in a sample of quebec youth , bmi \n was negatively associated with 25-ohd levels in girls but not in boys ( 30 ) . \n hypothetic mechanisms of low plasma 25-ohd levels in obesity include sequestration of vitamin d in the fat depot , impaired mobilization from the fat depot , and reduced skin and dilution throughout the body . \n other important factors in the obese include limited sun exposure due to few outdoor activities and reduced exposed skin area because of clothing ( 31 , 32 ) . \n this may explain the lack of an association between vitamin d and adiposity in our series . \n indeed , the overweight or obese and normal - weight children included in this study spend as much time outdoors and wear similar clothes , and thus receive the same dose of sunshine . \n the relationship between adiposity and the low vitamin d status described in some studies may be related to short exposure to the sun , rather than an excess of body fat per se . in line with the lack of an association with adiposity , our study showed no association between plasma 25-ohd and insulin resistance , a condition usually associated with obesity . \n in fact , the relationship between vitamin d and insulin resistance is still a subject of debate ( 1720 , 33 ) . \n our study has focused on a broad sample of children and adolescents , and its findings arose from multivariate analyses adjusting on several potential confounders for vitamin d status . \n the study has controlled for the time spent outdoors and thus on the amount of sun exposure , which is an important predictor of vitamin d status . \n although sun exposure was not measured with precision , all participants have comparable outdoor activities and equivalent sun exposure . \n this group of children is probably typical of urban and suburban children from the mediterranean region . \n the trans - sectional design prevents the evaluation of vitamin d status year - round , rendering the findings only suitable for the winter season . \n however , based on parents occupation , most participants have average to high socioeconomic status . \n nutritional assessment was achieved in only 77% of participants and vitamin d intake was estimated using a non - tunisian food database . because the vitamin d content of foods is not given in the food composition database for tunisia , the presumed concentrations of vitamin d were obtained from european food composition tables , which make estimations less precise . to overcome this issue , we considered the consumption of vitamin d food sources in tunisian diet . the development and validation of a vitamin d database for tunisian food is necessary to allow future estimations of vitamin d intake . \n our study did not look for health problems that may be related to vitamin d deficiency , an aspect that is beyond the scope of the study . \n further studies should address the health consequences of hypovitaminosis d in exposed populations . in conclusion , \n vitamin d intake is also low in most children , due to little consumption of vitamin d food sources . finally , circulating 25-ohd concentrations \n are related to vitamin d food sources intake , suggesting that dietary intake is a key contributor in vitamin d status when sun exposure is limited . \n given the key role of vitamin d in growth and health in general , every measure should be undertaken to achieve sufficient vitamin d status in these children . \n these measures include education in order to ensure adequate and safe sun exposure and appropriate consumption of vitamin d - rich / fortified foods . \n further research is needed to establish an optimal combination of sun exposure and food intake / supplementation ensuring year - round sufficient circulating 25-ohd in children and adolescents living in a sunny climate . \n the study was supported by funds of research unit 05/ur08 - 08 and research laboratory lr99es11 , ministry of higher education and scientific research of tunisia .", "role": "user" }, { "content": "backgroundvitamin d inadequacy is widespread in children and adolescents worldwide . \n the present study was undertaken to assess the vitamin d status in active children living in a sunny climate and to identify the main determinants of the serum concentration of 25-hydroxyvitamin d ( 25-ohd).methodsthis cross - sectional study included 225 children aged 715 years practicing sports in a football academy . \n anthropometric measures were performed to calculate body mass index ( bmi ) , fat mass , and maturity status . \n a nutritional enquiry was performed including 3-day food records and food frequency questionnaire . \n plasma 25-ohd and insulin were assessed by immunoenzymatic methods ensuring categorization of vitamin d status and calculation of insulin sensitivity / resistance indexes . \n a logistic regression model was applied to identify predictors for vitamin d inadequacy.resultsvitamin d deficiency ( 25-ohd<12 \n g / l ) was observed in 40.9% of children and insufficiency ( 12<25-ohd<20 \n g / l ) was observed in 44% of children . in a multivariate analysis , \n vitamin d deficiency and insufficiency were associated with a lower dietary intake of vitamin d , proteins , milk , red meat , fish , and eggs . \n however , no significant relationship was observed with maturation status , adiposity , or insulin resistance.conclusionstunisian children and adolescents are exposed to a high risk of vitamin d inadequacy despite living in a sunny climate . \n circulating 25-ohd concentrations are related to the intake of vitamin d food sources but not to maturation status or body composition . \n ensuring sufficient and safe sun exposure and adequate vitamin d intake may prevent vitamin d inadequacy in children from sunny environments .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: although laparoscopy has had only limited established applications in trauma surgery , improved equipment and advanced surgical skills have created greater opportunities for surgeons to apply minimally invasive techniques to the management of the injured patient . \n an acutely injured spleen that causes hemodynamic instability does not lend itself to minimally invasive techniques and requires an open laparotomy to control hemorrhage . \n angio - graphic embolization has increased the success rate of nonoperative management in patients at risk for continued or delayed splenic bleeding . \n but , certain patients are at risk for continued bleeding or delayed hemorrhage even following splenic embolization and may require splenectomy . \n this case report suggests that an spleen injured from blunt trauma can safely be removed laparoscopically following embolization , and laparoscopy represents an alternative to open laparotomy for patients at risk for continued or delayed hemorrhage . \n a ct scan obtained on a hemodynamically stable 15-year - old female following an all - terrain vehicle crash demonstrated a grade v splenic laceration with a moderate hemoperitoneum . \n angiography was performed the following day because of a decrease in hemoglobin from 10.5 g / dl to 8.5 g / dl . only the lower pole of the spleen enhanced with angiography . \n vessels supplying the majority of the spleen were truncated and were thought to represent thrombosis or possibly arterial spasm . \n a decision was made to embolize the central splenic artery with a coil because of the potential risk of continued bleeding . over the succeeding 24 hours , \n the patient 's vital signs were stable except for a significant tachycardia of 120 bpm to 140 bpm . \n the decision was made to perform splenectomy using minimally invasive techniques because of these signs of continued bleeding . \n the patient was given 2 units of packed rbcs before surgery to increase her hemoglobin to a level of 10.5 g / dl . \n after laparoscopic splenectomy , the patient 's abdominal pain was much improved and her hemoglobin remained stable . \n this positioning facilitates gravity in retracting intraabdominal organs and increases the working space in the left upper quadrant . \n the table was tilted to the left to begin the procedure with the patient in a supine position . \n after insufflation with a transumbilical veress needle , 5 ports were used to perform the operation . \n the first port was sited in the umbilicus to accommodate a 10-mm , 30-degree laparoscope . \n five - mm ports were placed in the subxyphoid and left subcostal anterior axillary line positions for retraction and irrigation purposes . \n finally , two 10-mm ports were inserted on each side of the umbilical port for the right and left hands of the operating surgeon . \n after all ports were inserted , the table was tilted to the right to place the patient into a three - quarter right lateral decubitus position . \n the patient was then brought into a reverse trendelenburg position to suspend the spleen for optimal laparoscopic visualization . \n blood clot and coagulum on and within the spleen were left in place . to avoid additional bleeding , \n the gastrosplenic ligament with short gastric vessels was then divided with a harmonic scalpel , and the splenic hilum ( splenorenal ligament with hilar vessels ) was secured and divided with several applications of a 35-mm linear stapling device with vascular cartridge . \n following division of the hilar structures , the remaining ligamentous attachments , which suspend the spleen ( splenophrenic ligament ) , were divided . \n the spleen was placed in a nonpermeable plastic bag and morcellated to facilitate its removal from the abdominal cavity . \n this positioning facilitates gravity in retracting intraabdominal organs and increases the working space in the left upper quadrant . \n the table was tilted to the left to begin the procedure with the patient in a supine position . \n after insufflation with a transumbilical veress needle , 5 ports were used to perform the operation . \n the first port was sited in the umbilicus to accommodate a 10-mm , 30-degree laparoscope . \n five - mm ports were placed in the subxyphoid and left subcostal anterior axillary line positions for retraction and irrigation purposes . \n finally , two 10-mm ports were inserted on each side of the umbilical port for the right and left hands of the operating surgeon . \n after all ports were inserted , the table was tilted to the right to place the patient into a three - quarter right lateral decubitus position . \n the patient was then brought into a reverse trendelenburg position to suspend the spleen for optimal laparoscopic visualization . \n blood clot and coagulum on and within the spleen were left in place . to avoid additional bleeding , \n the gastrosplenic ligament with short gastric vessels was then divided with a harmonic scalpel , and the splenic hilum ( splenorenal ligament with hilar vessels ) was secured and divided with several applications of a 35-mm linear stapling device with vascular cartridge . \n following division of the hilar structures , the remaining ligamentous attachments , which suspend the spleen ( splenophrenic ligament ) , were divided . \n the spleen was placed in a nonpermeable plastic bag and morcellated to facilitate its removal from the abdominal cavity . \n the approach to management of splenic injury due to blunt trauma has undergone major changes over the past 25 years . \n hemodynamically unstable patients bleeding from splenic injury must be taken immediately to the operating room for urgent laparotomy and splenectomy or splenorrhaphy . \n patients whose vital signs are stable should be evaluated for nonoperative management by undergoing a ct scan with iv contrast . \n preservation of splenic tissue has become a major objective in the management of splenic trauma to avoid over whelming postsplenectomy infection ( opsi ) . \n partial splenectomy or splenorrhaphy can be successfully accomplished in certain types of injuries , but the exact amount of splenic tissue necessary to maintain immune competence is not known . \n it is possible in many cases to closely monitor and observe patients with splenic injury whose vital signs remain stable . \n nonoperative management not only preserves splenic tissue and function but also avoids the morbidity attendant with major operative intervention . \n improved ct imaging capability has made it possible to identify certain findings that are associated with a greater risk for continued or delayed splenic hemorrhage . \n the presence of these markers increases the likelihood that a patient will fail observation and require surgery . \n ct findings that are associated with risk for splenic hemorrhage include grade iii through v injuries as defined by the american association for the surgery of trauma ( aast ) grading scale for splenic injuries . \n other findings on ct scan associated with an increased risk of continued bleeding include contrast blush , vascular truncation , aneurysm , or arteriovenous fistula formation . the presence of moderate to large hemoperitoneum ( defined as blood around the liver as well as spleen , peri - colic gutters , and pelvis ) is also associated with nonoperative failure . \n angiography has been demonstrated to be a useful diagnostic adjunct to further define vascular aberrations associated with splenic bleeding and failed nonoperative management . \n embolization has been reported to be effective in controlling splenic bleeding in 50% to 75% of high - risk patients . \n consequently , embolization increases the likelihood for success of nonoperative management to greater than 80% for all grades of splenic injury . even though embolization significantly decreases the need for splenectomy , 5% to 20% of patients \n smith reported that nonoperative failure following embolization was associated with a high grade of injury ( iii at 40% , iv at 38% , and v at 40% ) , moderate to large associated hemoperitoneum ( 36% ) , and extravasation at the time of angiography ( 59% ) . \n when extravasation was associated with a moderate to large hemoperitoneum , the failure rate was 71% . \n in our experience , 4 of 22 embolized spleens ( 18% ) continued to bleed , requiring a splenorrhaphy in 1 patient and splenectomy in 3 . \n surgery following embolization has traditionally been performed through open laparotomy as was done in 3 of 4 of our cases . \n the current case presentation represents our first laparoscopic removal of a bleeding spleen injured from blunt trauma . \n a few isolated case reports have been published of athletes with stable grade iii injuries undergoing \n the largest experience of laparoscopic treatment of blunt splenic injuries was reported by huscher et al . \n of the 11 laparoscopic explorations for splenic injury , only 7 patients had all or part of the spleen removed . \n the remaining 4 patients had cautery or topical coagulants applied to the injured spleen ; no splenic tissue was actually removed . \n we identified 2 case reports in which embolization was performed before splenectomy for blunt trauma . \n a partial splenectomy was performed for an infracted upper pole following embolization for bleeding from a grade iv injury . \n the other embolized patient was 1 of 4 laparoscopic splenectomies reported by nasr et al . \n similar to our case report , the patient continued to bleed following embolization and underwent successful laparoscopic splenectomy . \n importantly , concerns for nonoperative management of spleens that demonstrate signs of continued bleeding or for those at risk of re - bleeding are appearing in the trauma literature . \n these concerns may be particularly relevant in the physically active patient who is susceptible to reinjury of a damaged spleen . \n the risk of serious morbidity or death from hemorrhage from injured spleens may become greater than that for opsi . \n embolization is a less - invasive alternative to laparotomy and is effective in stopping or retarding splenic bleeding in most cases . \n hagiwara et al recently reported successful control of hemorrhage from injured spleens with embolization in patients who demonstrated episodes of hypotension during the initial resuscitation , but responded to fluids . indeed in cases of high - grade injury or angiographic extravasation associated with moderate to large hemoperitoneum , embolization may serve as a bridge to stabilize patients and allow preparation for surgical intervention . \n our experience suggests that in those patients who continue to bleed following embolization or are at risk for delayed bleed or re - injury , laparoscopic splenectomy may represent a viable alternative to open laparotomy for removal of the injured spleen . the practice of preoperative embolization as an aid to reduce intraoperative bleeding during elective laparoscopic removal of large spleens has been reported to be successful for hematologic / oncologic disease \n this case , along with limited reports in the literature , suggests that minimally invasive surgical techniques to remove a spleen for blunt traumatic injury can be performed safely in the hemodynamically stable patient who continues to bleed following embolization . \n in addition , patients who are at risk for spontaneous rebleed or bleed from reinjury may benefit from preoperative embolization as a bridge to operative therapy , and laparoscopy may be a safe , less invasive option for splenectomy .", "role": "user" }, { "content": "background : grade iii through v splenic injuries as defined by the american association for the surgery of trauma ( aast ) grading scale are associated with hemorrhage and nonoperative failure . \n embolization has been reported to reduce splenic bleeding in 50% to 75% of patients with a high - grade injury . \n however , splenectomy following embolization may be necessary in patients who continue to bleed or develop splenic infarction with abscess formation.methods:we present the case of a 15-year - old female who demonstrated a grade v splenic laceration with moderate hemoperitoneum following an all terrain vehicle crash . \n central splenic artery embolization was performed . because of signs of continued bleeding , laparoscopic splenectomy was performed.results:the patient had a satisfactory postoperative result and returned to normal activity in 2 weeks.conclusion:our experience suggests that in cases of high - grade splenic injury or angiographic extravasation associated with moderate to large hemoperitoneum , embolization may serve as a bridge to operative therapy and make laparoscopy a safe , less - invasive option for splenectomy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the incidence of apophyseal fractures of the hip and pelvis is most common in the adolescent population involved in sporting activities . \n the same study has shown that about 75% of the patients were male with an average age of 14.5 years . \n anterior - inferior iliac spine ( aiis ) ( 29% ) was the most common site of fracture with anterior superior iliac spine , ischial tuberosity , lesser trochanter and iliac crest being other sites of apophyseal injury . \n another study has shown ischial tuberosity ( 54% ) being the most common site of apophyseal injury of the pelvis followed by aiis ( 22% ) . \n the incidence of apophyseal injuries has increased due to increased participation of youth in sports as well as an increased incidence of apophysitis which is considered a precursor to avulsion fractures.1 , 3 we report a case of 14 year old boy with a fracture of aiis who presented with signs and symptoms of hip impingement . \n a 14 year old boy presented to our clinic with pain in the left hip for 3 months . \n in addition , he had difficulty in putting his sock and shoe on the left foot . \n x - rays of the pelvis revealed a malunited fracture of anterior inferior iliac spine with excessive callus formation ( fig . 1 ) . \n ct scan of the pelvis revealed a healed fracture of left anterior inferior iliac spine with heterotopic bone formation ( fig . \n 2a , b ) and mri helped to rule out any soft tissue pathology as well as neoplasm ( fig . \n there was no relief from pain at 3 months follow - up and so operative intervention was planned for hip impingement . \n flexion of the hip was confirmed to 120 and internal rotation to 40. x - rays were taken postoperatively to confirm proper excision ( fig . \n patient had full relief of symptoms and returned to full activity 3 months after surgery . \n physical examination has shown no evidence of weakness in his hip and follow - up x - rays did not show any recurrence of heterotopic bone formation ( fig . 5 ) . \n an apophysis is a regular outgrowth around a bone and it origins from a separate center of ossification . \n it fuses with the parent bone later during growth and it usually does not articulate with another bone directly . \n it forms an important site for insertion of a ligament or a tendon.4 , 5 the iliac apophysis appears as a secondary ossification on pelvic x - ray on the anterior and lateral aspects of iliac bone . \n the average age of fusion of iliac apophysis is 14 years in girls and 16 years in boys with a range of 1018 years in girls and 1320 years in boys . \n the fusion of the apophysis occurs early in warm climates due to increased metabolism and it happens later in cold climates.5 , 6 the apophysis provides attachment to the tendons and is an area of weakness prior to its fusion with parent bone . \n the straight head of rectus femoris arises from the aiis and attaches to the patella through a common quadriceps tendon . \n this muscle is an important flexor of the hip and extensor of the knee joint . \n violent force with hip in extension and knee in flexion produces excessive strain on this muscle . \n this results in apophyseal injury in adolescents as it is a weak area while it causes muscle sprain after the fusion of apophysis to the main bone . \n initially , we considered direct injury over aiis to be the cause of avulsion fracture . however , careful history revealed that our patient was hit by a helmet of another player from the outer back side which resulted in forceful contraction of the rectus femoris with the hip in extension and knee in flexion . \n pelvic fractures in children have been classified by torode et al into four categories for the purpose of management . \n they include : type i , nondisplaced fractures ; type ii , displaced to 2 cm ; type iii , displaced more than 2 cm ; type iv , symptomatic nonunion or painful exostosis . \n nonunion and loss of muscle strength are main concerns for type iii and poor muscle strength and loss of motion and impingement are main concerns for type iv avulsion fractures of the pelvis . \n the diagnosis of an avulsion fracture of aiis is made by careful history and physical examination . \n age of the patient is one of the most important diagnostic criteria for this type of fracture . \n the patient usually complains of persistent pain radiating to the thigh and it is difficult to localize the site of pain . \n the avulsed fragment is underneath the iliopsoas and sartorius and so it is difficult to palpate particularly in a young athletic male . \n anteroposterior radiograph of the pelvis plays an important role and careful assessment of radiograph is important \n . it may be difficult to detect a fracture on anteroposterior radiograph if the fragment diameter is less than 2 cm with minimal displacement . \n ct scan can help detect displacement of bony fragment , rule out os acetabuli as well as any heterotopic bone formation while mri can help rule out other soft tissue pathology in absence of visible bony changes on the x - ray . \n sometimes ct scan and mri may fail to rule out neoplasm and in such cases biopsy may be needed . more than 95% of apophyseal injuries of the hip and pelvis in adolescents improve with nonoperative management which includes ice , restriction of activity which includes nonweight bearing and analgesics . \n they have suggested an initial period of nonweight bearing followed by resistive exercise until full muscle strength is achieved . they have advocated a return to full sporting activity after relief of pain which can take about 12 weeks . \n heyworth et al reported that 3% ( 4/120 ) of patients in his operative series with fracture of aiis failed with conservative management and required surgical intervention . \n surgical intervention could be in the form of anatomic reduction and fixation with screws to excision of malunited fragment or heterotopic bone . \n we preferred open method of excision of heterotopic bone to avoid violation of hip capsule . \n a case of heterotopic bone formation after excision of avulsed fragment has been reported in the literature as late as two years after initial surgery requiring repeat surgical excision . \n the last follow - up in our patient was at 2 years after surgery without any evidence of pain or restriction of hip movement . \n we conclude the following : ( 1 ) there is an increased incidence of apophyseal injuries of the hip and pelvis due to involvement of adolescents in contact sports . \n ( 2 ) apophyseal injury of the pelvis and hip should be considered as differential diagnosis while evaluating pelvic pain in adolescents involved in sports . \n ( 3 ) there are increased chances of malunion and heterotopic bone formation in patients with missed diagnosis and failure to start early treatment . \n ( 4 ) ct scan and mri may be needed in late diagnosed cases of malunion or heterotopic bone formation to rule out other possibilities . \n ( 5 ) we would suggest follow - up for at least 2 years postoperatively to check for any heterotopic bone formation .", "role": "user" }, { "content": "apophyseal injuries of the pelvis have increased recently with increased participation of teenagers in contact sports . \n apophyseal fractures of the pelvis should be ruled out from apophysitis , os acetabuli and bony tumors . \n we report a case of fracture of anterior - inferior iliac spine following indirect injury to the hip in a young football player . \n the patient failed to get better with nonoperative management and continued to have pain in the left hip and signs and symptoms of impingement . \n he improved following surgical excision of the heterotopic bone and did not have any evidence of recurrence at 2 years follow - up .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the early detection of visual problems is beneficial in both arresting and preventing disorders such as amblyopia . \n unfortunately , adult test of visual function are unsuitable as they require cognitive , attentional and language skills that children do not typically possess \n therefore , tools and methods for the accurate assessment of visual function using objective approaches in this age - group are desirable . \n the detection of optokinetic nystagmus ( okn ) offers a potential solution to this problem . \n the optokinetic response is an involuntary sawtooth movement of the eye that occurs in response to moving stimuli such as a rotating drum , or drifting bars on a computer screen . \n the response consists of an alternating sequence of slow phases ( sps ) during which the eyes track a feature of the moving stimulus , and quick phases ( qps ) where the eyes move rapidly in the opposite direction to the moving stimulus , ( see fig . \n as the response is reflexive , the presence or absence of okn indicates whether or not a moving stimulus was visible , without the explicit cooperation of the observer . determining the presence / absence of the optokinetic response is a recognized technique for the subjective assessment of visual function that has been used for both adults and young children , . \n however , in children , the additional challenge is to ensure that measurements are as robust and accurate as possible , whilst being non - invasive , quick , and allowing unrestrained head movement . \n computer aided measurement and analysis may facilitate the controlled , accurate and rapid clinical measurement of visual function in this age group . \n figure 1.sample of okn velocity and displacement signal with indicated slow phase ( sp ) and quick phase ( qp ) . sample of okn velocity and displacement signal with indicated slow phase ( sp ) and quick phase ( qp ) . \n camera based eye tracking is a non - invasive computerized approach in which the eye signal is extracted from ( typically ) infrared ( ir ) video . recently , hyon et al . and han et al . \n distance visual acuity was measured objectively by this method yielding good reproducibility and significant correlation between distance visual acuity measured using a standard eye chart and objective visual acuity measured using okn . \n shin et al . continued this work , describing the relationship between okn response and visual acuity in adult humans with ocular disease using the same approach . \n they showed that in subjects with 20/60 or worse visual acuities , objective visual acuity estimated by okn can predict subjective visual acuity . \n unfortunately , current generation eye tracking systems ( such as the setup described by hyon et al . ) generally employ chin rests or head - mounted cameras to account for head movement . \n the requirement for high levels of patient cooperation makes such systems unsuitable for use with young children . \n companies such as tobii ( tobii technology ) and smi ( sensomotoric instruments ) provide remote eye tracking ( heads free ) solutions , but remain at present largely confined to the research setting as they are expensive and expect careful calibration which is difficult to achieve with young children . \n moreover , these systems do not readily compensate for rapid and large head motions that often occur when a child views visual stimuli with an unrestrained head , . \n therefore , subjective assessment of eye movement remains the current standard for okn detection in children . \n a number of related systems for measuring eye movements ( with free head movement ) have also been described . \n eizenman , and model proposed point gaze estimation using purkinje images including methods for calibration with infants ( 6- , 8- , 9- , 15- , and 16 month - old ) . \n zhu and ji used a method to evaluate gaze with a table mounted stereoscopic system without using any user - dependent eyeball parameters . the system compensated head movements and gave an estimation of the gaze direction with respect to a reference head position . to estimate 3d configuration of cameras , lights , screen , head and eyes , \n the stereo vision system was calibrated a priori . however , these methods require a customized setup and are not readily available in the clinical setting . in this study , we report offline methods that were developed to retrospectively analyze videos collected from children as they underwent an assessment in which they viewed drifting stimulus patterns . our aim in doing this was to test whether a low - cost recording setup , using semi - automated approaches could replicate the assessment of an experienced clinical assessor who judged the direction of the quick phase eye movements in the video footage \n . the authors are not aware of similar studies to date , in which attempts have been made to automate the measurement of the optokinetic response in children using consumer grade video equipment in particular . in this work we present simple to implement techniques for detecting the absence / presence of okn , using footage obtained from a consumer grade video recorder . \n the work includes the novel application of known techniques to the issue of okn detection in young children , as well as the implementation of a new feature based stabilization technique which allows for precise head stabilization . \n in particular , we describe methods that extract the motion of the eyes with respect to the head , and processing of that signal in order to estimate the presence or absence of okn . \n two methods for extracting the eye movement signal from video are proposed : ( 1 ) a method based on stabilization of the head and subsequent eye motion analysis ( the stabilization method ) , and ( 2 ) direct subtraction of the head signal from the combined head and eye signal ( the direct subtraction method ) . \n we compare these methods with ( 3 ) visage sdk , a commercial grade head and eye tracking system . \n the performance of the head stabilization process is further assessed by comparison with manual tracking of markers , in the form of stickers that the participants wore on their faces . \n we developed readily usable tools that would facilitate eye tracking ( in the frame of the head ) in rgb video . \n the steps involved are head tracking , head stabilization and pupil center and limbus edge tracking . \n ( b ) stabilized face in which the video is now transformed with the head fixed . \n ( a ) shi - tomasi features detected and tracked on the face region . features in the region of markers are removed . \n ( b ) stabilized face in which the video is now transformed with the head fixed . \n , described a method that tracked general features ( or specific features within a region of interest ) and warped the video frames to remove unwanted movement . \n kinsman et al . reported a technique using head mounted cameras , which compensated head motion , in order to improve eye fixation detection in a wearable device . \n that algorithm was based on maximizing cross correlation between two consecutive frames , and was used to estimate the global motion of the scene resulting from camera movement . \n rothkopf and pelz developed a method that compensated rotational motion of the head by using an omnidirectional camera in a wearable device . \n we implemented an approach to stabilize head movement in which shi - tomasi features were detected in a mask , and then tracked ( using the kanade lucas tomasi ( klt ) point tracking ) to obtain the transformation required to stabilize the video . \n an initial face mask was manually selected within the facial region in a way that excluded eye regions . by doing this we sought to avoid contaminating the head signal with eye movement information . \n shi - tomasi features were detected in the initial frame , within the selected face region only . \n these features were tracked across frames with the kanade lucas tomasi ( klt ) point tracker . during our testing \n we observed that a proportion of features ( around 6% ) were detected in the region of the manually applied markers ( i.e. , the stickers on the participant s faces ) . as we did not intend to use these markers as a tool for facilitating face feature detection , we removed these features from the analysis . \n we found that sufficient features remained for the tracking step of the algorithm to be effective . \n a non - reflective similarity transformation allowing rotation , scaling , and translation was estimated by maximum likelihood estimation sample consensus ( mlesac ) by using the shi - tomasi feature points generated in the current and previous frames . \n this algorithm extends upon the ransac method by maximizing the likelihood of a solution based on the outliers and inliers distribution.\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } \\begin{align}&\\qquad \\quad ~\\left [ { { { \\begin{array}{*{20}l}\\textstyle { { x}'_{i } } \\\\\\textstyle { { y}'_{i } } \\\\\\textstyle 1 \\\\ \\end{array } } } } \\right ] = h_{j } \\left [ { { { \\begin{array}{*{20}l}\\textstyle { x_{i } } \\\\\\textstyle { y_{i } } \\\\\\textstyle 1 \\\\ \\end{array } } } } \\right ] \\\\&~h_{j } = \\left [ { { { \\begin{array}{*{20}l}\\textstyle { s_{j } r_{1j } } & \\quad { -s_{j } r_{2j } } & \\quad { t_{xj } } \\\\\\textstyle { s_{j } r_{2j } } & \\quad { s_{j } r_{1j } } & \\quad { t_{yj } } \\\\\\textstyle 0 & \\quad 0 & \\quad 1 \\\\ \\end{array } } } } \\right ] \\end{align } \n \\end{document } here \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( x_{i } , y_{i})$ \n \\end{document } and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( { x}'_{i } , { y}'_{i})$ \n \\end{document } are feature points in the previous and current frame respectively , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\text{s}_{\\mathrm { j}}$ \n \\end{document } is the scaling factor , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\text{t}_{\\mathrm { xj}}$ \n \\end{document } , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\text{t}_{\\mathrm { yj}}$ \n \\end{document } and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\text{r}_{\\mathrm { 1j}}$ \n \\end{document } , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\text{r}_{\\mathrm { 2j}}$ \n \\end{document } are translation and rotation components between the previous and current frames respectively.\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } \\begin{equation * } h_{total } = h_{j } \\times \\ldots \\times h_{1 } \\end{equation*}\\end{document } using ( 3 ) the total transformation \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\text{h}_{\\mathrm { total}}$ \n \\end{document } between the current frame and the first frame was calculated , thereby allowing registration of the face to its position in the initial frame by way of the inverse transformation ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\textrm { h}^{-1}}_{\\mathrm { total}}$ \n \\end{document } ) . \n firstly , the results were compared to the stabilization achieved by replacing the feature selection and tracking with manual selection ( across frames ) of the four markers placed on the participant s face during video recording ( fig . \n 2(a ) ) . for each frame , four corner points and the center of each marker were selected manually . \n the order in which the features were selected was consistent across frames to maintain correspondence of features from frame to frame . \n secondly , the results of the stabilization method were compared to those obtained from a commercial grade head and eye tracking product ( visage sdk , visage technologies ) . in this case visage sdk detected facial landmarks that were tracked by the sdk . \n ( b ) work flow of direct subtraction method . given the head transformation , we next sought to determine the motion of the eye , with respect to the estimated head motion . \n eye region bounding box was selected manually in the first frame of the stabilized video . \n this bounding box was then applied to crop the eye region across all subsequent ( stabilized ) frames . in this way \n a number of methods have been described for pupil / iris detection and tracking including edge detection and gradient based methods , deformable models based methods \n , and machine learning algorithms . most of these methods are not suitable for use with standard rgb video footage and they are often computationally intensive , particularly those based on deformable models and machine learning algorithms . in this work \n we used a method utilizing simple gabor filters to locate the pupil centroid , which was followed by the starburst algorithm , to locate limbus edge features . \n the pupil was located using multiple oriented ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\theta $ \n \\end{document } ) gabor filters applied to the image.\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } \\begin{align } g(x , y;\\lambda , \\theta , \\phi , \\sigma , \\gamma ) = \\exp ( -\\frac { { x}^{\\prime 2}+{\\gamma ^{2}}{{y}^{\\prime 2}}}{2\\sigma ^{2}})\\cos ( 2\\pi \\frac { { x}\\prime}{\\lambda } + \\phi ) \\notag \\\\ { } \\end{align } \n \\end{document } where \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { x}'=x\\cos \\theta + y\\sin \\theta $ \n \\end{document } , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { y}'=-x\\sin \\theta + y\\cos \\theta $ \n \\end{document}. here \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\lambda $ \n \\end{document } is the number of cycles / pixel ( wavelength ) , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\theta $ \n \\end{document } is the angle of the normal to the sinusoid ( orientation ) , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\phi $ \n \\end{document } is the offset of the sinusoid ( phase ) , and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\gamma $ \n \\end{document } is the spatial aspect ratio . \n after thresholding , standard morphological operations were used to find the centroid of the pupil region ( see fig . \n as mentioned , once this was determined , we used the readily available , starburst algorithm to find limbus edge features . \n this approach tests derivative along radial rays extending away from pupil center until a threshold is exceeded . \n is then replaced with the geometric center of the remaining features and the filtering repeated again . \n 4(e ) ) klt tracked the detected pupil centers and limbus edge features in every frame . \n when a blink occurred , the pupil area decreased to zero ( when the eye lid closed completely ) and then started increasing to full size again . analysis of the resulting pupil area signal was used to identify the entire blink duration , . \n horizontal velocity of the eye \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\text{v}_{\\mathrm { x}}$ \n \\end{document}(t ) in the frame of the face was estimated by finding the velocity of the tracked pupil centers and limbus edge in the stabilized image . fig . \n an interactive tool was developed in matlab ( natick , ma : the math works inc . ) , to initiate and track head and eye movements . \n these points were then tracked ( using klt ) , from which the head and eye velocities could be calculated separately . \n in particular , the eye velocity was the combination of head and eye motion ( eye in space ) because head movement ( head in space ) had not been compensated for .\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } \\begin{equation * } v_{eye } = v_{head - eye } -v_{head } \\end{equation*}\\end{document } pure eye motion ( eye in head ) was calculated from ( 5 ) . \n there was no need for frame transformation in this method , therefore yielding a less computationally expensive method . \n on the other hand , it did not provide a convenient visualization of the eye region as per the stabilization method . \n we processed video frames again with visage sdk , using the sdk s ability to detect facial landmarks ( including pupil centers ) and track movements of the head and eye robustly . \n direct measurement of the eye movement ( eye in head ) was determined by subtracting the head motion ( head in space ) from the eye signal ( eye in space ) , which comprised of mixed head and eye movement . \n 5 shows landmarks identified by visage sdk . \n figure 5.facial landmarks detected by visage sdk . \n facial landmarks detected by visage sdk . in this work we used the eye velocity signal to estimate the presence of okn . after obtaining the velocity signal \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\text{v}_{\\mathrm { x}}$ \n \\end{document}(t ) by three different methods ( stabilization , direct subtraction and visage sdk ) , we used a recently proposed okn detection approach proposed by turuwhenua et al in which quick phases fitting heuristic criteria were averaged , and then result used to identify the presence and direction of okn . \n all peaks within the eye velocity signal were detected and thresholded by an empirical value . \n peaks which were less than a given number of frames apart ( obtained empirically based on stimulus velocity ) were rejected . \n we assumed that an isolated peak was not enough evidence to indicate the presence of okn . \n therefore peaks with no other maxima of the same sign in the trial were rejected . \n the resulting peaks were averaged and scaled using ( 6 ) to calculate an okn consistency value \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\bar { k}$ \n \\end{document}.\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } \\begin{equation * } \\bar { k}=\\left \\ { { { { \\begin{array}{*{20}l}\\displaystyle { \\frac { 1}{n\\sigma _ { v } } \\sum \\limits _ { j=1}^{n } { q(j ) } } \\quad { n>0 } \\\\ \n \\end{equation*}\\end{document } where q(j ) are peak velocities , n is the number of peaks and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\sigma _ { \\mathrm { v}}$ \n \\end{document } is an empirical threshold . all peaks were classified to positive and negative peaks . \n values of \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\bar { k}$ \n \\end{document } of greater than 1 indicated the presence of okn and less than 1 meant no consistent okn was detected . \n the sign of \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\bar { k}$ \n \\end{document } indicated the okn direction . \n it is noted that in turuwhenua et al.s work , the velocity signal was determined using a method based on optical flow of the limbus . in this application \n we applied the algorithm to the velocity signal obtained by our pupil center and limbus edge feature tracking ( using klt ) approach . for validation purposes , \n the quick phase periods of okn were identified by an experienced observer viewing the same videos but masked to the results of the detection algorithm . \n the observer annotated a range of frames in which quick phases appeared to be present ( using quicktime 7.6.6 on a macbook pro ( 15-inch ) ) . \n this observer had three years of experience in viewing and interpreting okn in adults and children . \n from this analysis we sought to determine the method s sensitivity , specificity and predictive values ( positive / negative ) . secondly a clinically trained assessor observed the videos and decided the direction ( right / left ) and presence of okn ( yes / no ) in each trial . \n the assessor was an optometrist with over three years of experience in recording and assessing okn responses in young children and was also masked to the results of the detection algorithm . \n rather than focusing only on the quick phase eye movements ( which was what the experienced observer was instructed to do ) . \n the clinically trained assessor made a holistic judgment of okn presence and direction based on both quick and slow phase eye movements and clinical experience . \n the study was approved by the university of auckland human participants ethics committee ( reference no . \n five children ( two female and three male ) with normal vision ( ages = 21 - 25 months ) participated in this study . the visual stimuli used to elicit okn were a random dot kinematograms ( rdks ) presented on a cathode ray tube monitor ( dell e772p , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 1280\\times 1024 $ \n \\end{document } resolution , 60hz refresh rate ) placed 60 cm from the observer . \n the stimulus was designed to elicit horizontal okn . a program written in matlab using the psychtoolbox on a macbook pro ( 15-inch ) \n the rdk was presented within a circular stimulus aperture with a radius of 8.3 and was made up of 250 white dots ( 138cd/\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\text{m}^{2}$ \n \\end{document } ) presented on a grey background ( 42cd/\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\text{m}^{2}$ \n \\end{document } ) ( dot density = 1.16 dots per degree ) . \n each dot had a diameter of 0.5 , a speed of 8/second ( generated by displacing each dot by 0.13 on every frame ) and a limited lifetime defined as a 5% chance of disappearing on each frame and being redrawn in a random location . \n coherence levels ( the proportion of signal motion to noise motion in the stimuli ) were in the range of 84% to 100% and leftward vs. rightward motion was randomized across trials . \n these stimuli were designed to measure global motion perception in young children , and the parameters were therefore selected to optimize global motion processing , at the expense of an optimal okn response . \n these were useful stimuli for our purposes as they provided a conservative test of the performance of our system . \n video format , with a spatial resolution of \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 1440\\times 1080 $ \n \\end{document } pixels and temporal resolution of 25 frames / sec . \n the children s heads were unrestrained and therefore exhibited a natural range of movements within the cameras field of view . to evaluate accuracy and performance of head tracking method \n ( c ) a random dot kinematogram stimulus ( white dots are signal dots which all moving in same direction , black dots are noise dots which moving in random direction ) . \n ( c ) a random dot kinematogram stimulus ( white dots are signal dots which all moving in same direction , black dots are noise dots which moving in random direction ) . \n the child was asked to follow a single dot with a finger . directly prior to the presentation of an rdk , a flashing fixation point accompanied by a beeping sound \n was presented in the center of the screen to attract the child s attention . each trial \n the characteristics of okn vary depending on whether observers are asked to simply look at the moving visual stimulus or stare at a central point within the display . \n although we were unable to instruct the children whether to look or stare at the screen due to their young age , it is most likely that our procedure generated look okn rather than stare okn . \n table 1 compiles the standard deviations ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\sigma _ { \\mathrm { x}}$ \n \\end{document } , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\sigma _ { \\mathrm { y}}$ \n \\end{document } ) of a tracked feature location ( within the face region ) before and after stabilization , using our proposed method , manual selection of marker stickers on the face and visage sdk . \n the final error was roughly equivalent between the proposed method and the manual selection approach stabilization ( the gold standard ) , but both methods improved upon results obtained by visage sdk . \n an example of head trajectory for one of the subjects before and after stabilization is shown in fig . \n 7.table 1standard deviation of tracked feature location before and after stabilization with three different methods.methodfeature location before stabilization(std in pixels)feature location after stabilization(std in pixels)proposed method(27.4018 , 7.1702)(0.3072 , 0.2766)manual(29.8755 , 6.9806)(0.3670 , 0.3451)visage sdk(28.9918 , 7.6997)(3.0691 , 1.3302 ) \n figure 7.head trajectory before ( red - plus ) and after ( blue - star ) stabilization with proposed method . \n head trajectory before ( red - plus ) and after ( blue - star ) stabilization with proposed method . \n eye velocity signal produced by the stabilization method and the direct subtraction method had a low error and high correlation ( mse = 0:197 0:0474 pixels / frame , correlation = 95:94% 3:25% ) over all children . \n 8 shows the okn velocity and displacement signal before ( with direct subtraction method ) and after stabilization . fig . \n 9 shows the horizontal velocity of the head and pupil measured by the visage sdk in comparison with the stabilization method . \n we found that the visage sdk required a certain duration of video to initialize tracking ( 12 frames on average ) , as it attempted to find the best frame for facial landmark detection . \n figure 8.horizontal velocity and displacement of pupil center by direct subtraction method ( red ) , stabilization method ( blue ) . \n figure 9.horizontal velocity of head and eye measured by stabilization method ( blue ) and by visage sdk ( black ) . \n visage sdk signal does not start from the beginning because it takes time for visage sdk to initialize tracking . \n horizontal velocity and displacement of pupil center by direct subtraction method ( red ) , stabilization method ( blue ) . \n horizontal velocity of head and eye measured by stabilization method ( blue ) and by visage sdk ( black ) . \n visage sdk signal does not start from the beginning because it takes time for visage sdk to initialize tracking . \n our experiment in which an experienced observer identified okn - like movements in video revealed a sensitivity and specificity for our okn peak detection of 89.13% and 98.54% respectively across all children in stabilization method ( true positives = 82 , true negatives = 2094 , false positives = 31 , false negatives = 10 ) . \n the positive predictive value and negative predictive value was 72.57% and 99.52% respectively . by comparing the presence or absence of okn indicated by the value with the trial by trial yes / no responses of the clinically trained observer , we found that the okn detection algorithm agreed with the subjective assessment in 17 of 20 trials . \n the direction of okn indicated by the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\bar { k}$ \n \\end{document } value correlated exactly with that identified by both the experienced observer and the clinically trained assessor . \n okn and okn - like detection results were exactly the same for pupil center and limbus edge tracking methods . \n 10 shows examples of the horizontal velocity and displacement of the pupil with periods of okn . \n red regions indicate periods of okn identified by the experienced observer , whilst the computer detected peaks are shown with black dots . \n figure 10.horizontal velocity and displacement of pupil center ( pixels / sec ) with detected peaks ( black - balls ) and with okn presence regions identified by experienced observer ( red bars ) . \n ( b ) not consistent okn , = 0.5 . horizontal velocity and displacement of pupil center ( pixels / sec ) with detected peaks ( black - balls ) and with okn presence regions identified by experienced observer ( red bars ) . \n we have presented , for the first time , offline tools and methods for the purpose of analyzing okn in children , using readily available algorithms and consumer grade equipment . \n our key additional contributions are : ( 1 ) a method for stabilizing the head based on random facial feature detection ( without using specific facial landmarks such as eye corners , nose tip , lips corners and etc . ) , and ( 2 ) a demonstration of a method able to estimate the presence and direction of the optokinetic reflex from the stabilized video footage of young children with unrestrained heads . \n the head stabilization method was compared against alternate methods based on : ( 2 ) direct subtraction of the head signal from the eye signal ( combined head and eye motion ) , and ( 3 ) a commercially available head tracking and eye gaze estimation system ( visage sdk ) . \n our head stabilization method produced slightly lower error than a gold standard method in which markers placed on the face were manually tracked ( the difference in error between the two was sub - pixel ) . \n both of these methods out - performed the visage sdk which generated errors that would have interfered with the detection of okn . \n the inclusion of stabilization in our processing also facilitated the detection of the pupil center , and subjective assessment of eye movements , as reported by an experienced observer . \n we believe that head stabilization is a valuable tool in the analysis of okn - like movements . \n we found a high correlation ( mse = 0:0990:0574 pixels / frame , correlation = 95:94%3:25% ) between the eye signals obtained using the stabilization method and the direct subtraction method . \n the peaks of the eye velocity signal were matched exactly for both methods and hence there was no difference in okn detection results obtained using either method . \n the stabilization method was as effective as the direct subtraction method for the robust detection of okn . \n our results indicated no meaningful difference between the pupil center and limbus edge approaches ( mse = 0:0512 0:009 pixels / frame , correlation = 96:28% 2:156% ) . \n the okn detection results correlated highly with an experienced observer ( 17 of 20 trials , correlation = 85% ) . \n the direction of okn was easily determined by finding the okn consistency sign and it was identical to the assessment of a clinically trained assessor who viewed the same video footage . \n the three trials for which the okn detection results did not correlate with human observers were characterized by very large head and body movements ( n = 2 trials ) and the presence of a care - giver s hand in the frame which temporarily obscured the face and eyes ( n = 1 trial ) . under these conditions , the okn detection results indicated no okn whereas the human observers reported the presence of okn . \n our proof - of - concept analysis suggests that the techniques described here could form the central component of a vision screening tool . \n specifically , the okn detection algorithms could be combined with the presentation of visual stimuli to measure acuity and contrast sensitivity in young children . \n the stabilization method provides a stable visualization of the eye , which is advantageous to the operator . on the other hand , whilst effective , it is a more computationally expensive way to process eye velocity ( as opposed to direct subtraction method ) . in some instances \n , we found that the head signal could not be measured , leading to baseline shifts in the observed eye displacement signal . here \n , our methods were presented with manual selection of the face region , and an interactive process to initiate the eye velocity estimation . \n our subsequent experimentation with automated face detection methods such as zhu and ramanan face detection algorithm suggests that automated methods will provide further improvements in terms of robustness and usability of the algorithms . in this work \n our main focus was on head stabilization based on fast and simple approaches , and therefore the inclusion of automated face detection methods will be the subject of future work . \n an obvious improvement would be the incorporation of the visage sdk head signals into our methods . with additional work , \n it is likely that our methods could be combined to improve the robustness of the approaches we have developed . \n visage sdk allows real - time processing , that could be used to develop a real - time system . \n recently , free options such as face++ have also been proposed , that in our experience are likely to be effective as well . \n notably , a face tracking option is available for mobile devices with limited frame rate and face size options . \n parallax error was present in our videos , due to the fact that our camera was placed to the side of the head in some cases . according to our results \n , it did not affect detection of okn presence and direction but for precise analysis of okn parameters such as gain and quick phase velocity , parallax free , 3d measurement would be useful . \n as the head rotates , the number of features tended to decrease , thereby resulting in a less effective stabilization . \n we note that yaw and pitch rotations were not well compensated for , due to the nature of these motions . in the future \n , we will investigate how multiple cameras could be used to enable continuous monitoring of the 3d eye position during rotation . \n advanced signal processing methods for analyzing the okn waveform and assessment of the impact of camera frame rate and resolution role on detailed analysis of the eye movement signal will also be the subject of future work . \n a fully automated real - time implementation of the method is a long - term goal . \n we developed tools that improved the visualization of the eye , and facilitated the measurement of okn related eye movements from videos of children . there was no need for special hardware , multiple cameras or infrared lights for this purpose . \n our results in five participants indicated that our simple semi - automated method based on general face region features was sufficient for this purpose . \n the presence and direction of okn was assessed objectively and validated by an experienced observer and a clinically trained assessor viewing the same video footage . \n the results here suggest that consumer grade equipment can be used for the assessment of eye movements in young children which may help in the diagnosis of visual disorders .", "role": "user" }, { "content": "the detection of vision problems in early childhood can prevent neurodevelopmental disorders such as amblyopia . however , accurate clinical assessment of visual function in young children is challenging . \n optokinetic nystagmus ( okn ) is a reflexive sawtooth motion of the eye that occurs in response to drifting stimuli , that may allow for objective measurement of visual function in young children if appropriate child - friendly eye tracking techniques are available . in this paper , we present offline tools to detect the presence and direction of the optokinetic reflex in children using consumer grade video equipment . \n our methods are tested on video footage of children ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ n = 5 $ \n \\end{document } children and 20 trials ) taken as they freely observed visual stimuli that induced horizontal okn . using results from an experienced observer as a baseline \n , we found the sensitivity and specificity of our okn detection method to be 89.13% and 98.54% , respectively , across all trials . \n our okn detection results also compared well ( 85% ) with results obtained from a clinically trained assessor . in conclusion \n , our results suggest that okn presence and direction can be measured objectively in children using consumer grade equipment , and readily implementable algorithms .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: first described in 1984 by inoue , percutaneous balloon mitral valvotomy ( bmv ) has now become a recognized and common therapeutic approach and is used as an alternative to surgical mitral commissurotomy in patients with symptomatic severe mitral stenosis ( ms ) and suitable valve anatomy . \n bmv produces significant changes in mitral valve morphology and improvement in leaflet mobility . with an increase in the use of bmv , \n most patients with ms are female ; and in comparison to the past , ms occurs more frequently in older people . \n interventionists have also gained a great deal of experience , which has brought about a decrease in the incidence of severe mitral regurgitation ( mr ) necessitating surgery . \n bmv has considerably high success rates and low complication rates in short - term and long - term follow - ups . however , there are various reports describing the development of or increase in post - bmv mr , which remains a major procedure - related complication . \n this complication is usually mild and well tolerated but mr degree may increase in 25%83% of cases after bmv . \n the main concern is the development of severe mr following bmv requiring valve replacement in some patients . \n the incidence rate of severe mr after bmv in the literature varies between 1.4% and 7.5% . in a previous study in our institute by aslanabadi and colleagues on 300 patients with moderate to severe ms , the incidence rate of severe mr after bmv was 2% . \n we prospectively studied 105 consecutive patients with rheumatic severe ms who were eligible for bmv using the inoue balloon technique between february 2010 and january 2013 in madani heart center , tabriz , iran . \n the study was approved by the institutional review board , and all the patients gave their informed consent for the procedure . \n the inclusion criteria were symptomatic severe ms with new york heart association ( nyha ) functional class ( fc ) ii or more , mitral valve area ( mva ) 1.5 cm , and mitral valve echocardiographic score 11 , according to the scoring system described by wilkins et al . \n the presence of each of the following factors was considered an exclusion criterion : left atrial ( la ) thrombus ; mr severity higher than moderate ; unfavorable mitral valve morphology ; and need for cardiac surgery because of severe aortic , tricuspid , or coronary disease . \n the results of our previous study showed that a high echocardiographic score is not a contraindication for bmv in rheumatic ms . \n the patients who met the exclusion criteria were referred for surgical treatment . the decision regarding bmv \n was mainly based on echocardiographic assessment , which was employed to measure mva , valvular and subvalvular apparatus calcifications , and mr degree . \n the wilkins score was used to determine the anatomic characteristics of the valve and subvalvular regions . to avoid personal bias in assessing the anatomic scores and the mitral valves , \n these parameters were graded by at least two experienced echocardiologists and , in case of disparity , by a third one to ensure correct classification . \n all the patients underwent bmv using the transvenous trans - septal antegrade technique from the right femoral vein . \n the balloon size was chosen to obtain an effective balloon dilation area/ body surface area of approximately 4cm / m . \n the balloon size was stepwise increased by 0.5 mm consecutive dilations until an mva > 1.5 cm was reached or mr significantly increased . \n right and left heart pressures , including simultaneous la and left ventricular ( lv ) end diastolic pressure ( trans - mitral gradient ) , were measured before and after bmv . \n the bmv procedure was terminated once the gradient was 4 mmhg , there was no diastolic rumble , or in case mr occurred or increased . \n standard transthoracic echocardiography ( tte ) was performed almost one week before and 24 hours after bmv with a ge vivid 7 scanner , equipped with an m3s multi - frequency phased array transducer and tissue doppler imaging facility . \n data were acquired with the subjects at rest , lying in the lateral supine position . \n grey - scale images were obtained using second - harmonic imaging ( 1.7/3.4 mhz ) . \n two - dimensional ( 2d ) electrocardiography ( ecg ) was superimposed on the images , and end - diastole was considered at the peak r - wave of the ecg . left ventricular ejection fraction ( lvef ) was determined using the simpson biplane method by measuring the end - diastolic and end - systolic volumes in 2d images . \n all the measurements , including mva , mitral valve peak gradient ( mvpg ) , mitral valve mean gradient ( mvmg ) , mr severity , la pressure , and pulmonary artery systolic pressure ( paps ) , were obtained in accordance with the american society of echocardiography ( ase ) recommendations . \n transesophageal echocardiography ( tee ) was performed on the same day or on the day before intervention for the exclusion of la thrombi , better evaluation of mitral valve structure , wilkins score , and mr severity ( grades 14 ) , interatrial septal thickening measurement , and reassessment of tte data . \n the mv score was judged according to the wilkins score system , obtained by adding the score of each of these individual morphological features : leaflet mobility ; thickness ; calcification ; and subvalvular thickening . \n a score of 04 was assigned to each component in accordance with the wilkins echocardiographic scoring system . \n adding the individual scores generally resulted in a total echocardiographic score , which varied from 0 to 16 for the mv , with higher values representing increased morphological abnormality . in this study , the final total echocardiographic scores ranged from 5 to 12 . \n after bmv , color doppler echocardiography was used to screen left - to - right atrial shunts . \n lv gram was performed in all the patients before and after bmv to assess mr severity . \n the variables were compared before and after the procedure using the paired samples t - test ( continuous variables ) or the chi - squared test ( categorical variables ) . \n the continuous variables were compared between the patients with and without an increase in mr severity and between the patients with and without a decrease in mr severity using the independent samples t - test . \n multivariate logistic regression analysis was used to define the predictors of an increase in mr severity after bmv . \n complete pre- and post - bmv evaluation was performed in 105 patients ( 84 [ 80% ] females ) at a mean age of 45.81 13.37 ( range = 20 to 76 ) years . \n sixteen ( 15.24% ) patients had atrial fibrillation and 89 ( 84.76% ) had sinus rhythm . \n three ( 2.85% ) patients had a history of previous cerebrovascular accident ( cva ) . \n three ( 2.85% ) female patients aged 22 , 25 , and 31 years were pregnant and underwent bmv at 23 , 21 , and 28 weeks of pregnancy , respectively . \n bmv was successful in all the three patients , and there were no maternal or fetal complications after bmv . \n following bmv , the patients had mainly fc i and fcii , as opposed to a higher fc iii before bmv ( figure 1 ) . \n comparison of nyha functional class pre and post bmv fc , function class ; bmv , balloon mitral valvotomy ; nhya , new york heart association mr severity did not change in 82 ( 78.1% ) patients . \n interestingly , mr severity decreased in 5 ( 4.8% ) and increased in 18 ( 17.1% ) patients . \n the cases of reduction included a one - grade reduction in 4 patients and a 2-grade reduction in one patient . \n the increased cases comprised a one - grade increase in 10 patients , a 2-grade increase in 6 patients , and a 3-grade increase in one patient . \n the reduction cases included one male and 4 female patients with wilkins scores of 5 , 6 , 9 , 9 , and 11 . \n after bmv , small atrial septal defect ( asd ) was reported in 26 ( 25% ) patients by color doppler with a calculated pulmonary - to - systemic flow ratio ( qp / qs ) < 1.2 \n . there were no major complications such as mortality , cva , severe mr necessitating surgery , and tamponade during and after bmv . \n the low incidence rate of mr reduction precluded a comparison between the patients with a decrease in mr and those with no mr change . \n the patients were divided into two groups according to mr degree after bmv : group a with no increase in mr severity and group b with increased mr severity . \n the patients with an increased mr degree after bmv had a significantly higher calcification score and a lower mva before bmv . \n our multivariate logistic regression analysis demonstrated that only the calcification score could predict a rise in mr severity after bmv ( or = 6.38 , 95%ci : 2.09819.433 ; p value = 0.001 ) . \n most cases with increased mr post bmv had commissural mr in the anterior commissure and were more likely to have commissural rupture . \n after bmv , mva significantly increased , whereas paps , la pressure , mvpg and mvmg were significantly reduced . \n comparison of baseline and echocardiographic characteristics in patients with and without increased mr after bmv data are presented as meansd or n ( % ) mr , mitral regurgitation ; bmv , balloon mitral valvotomy ; mv , mitral valve hemodynamic and echocardiographic characteristics before and after bmv data are presented as meansd or n ( % ) bmv , balloon mitral valvotomy ; mr , mitral regurgitation \n bmv , thanks to its considerable efficacy , high success rates , and low complication rates , has become one of the preferred treatments for severe ms since 1984 . \n however , the development of or increase in mr is still a concern after bmv . in this study \n nyha fc also significantly improved following bmv , from class iii to class i and ii in most of the patients . \n bmv yielded excellent immediate hemodynamic and clinical results insofar as mr severity increased only in some patients and , interestingly , decreased in a few . \n there has been a considerable improvement in patients outcome over the past few years . while the reported complication rate during the first 10 years after bmv introduction varied between 8% and 19% , it has been reduced considerably in recent studies with reported rates of only 02% . \n moreover , there has been a significant reduction in severe mr development in need of emergent surgery . \n it has been previously demonstrated that an mva 2 cm can be achieved irrespective of the technique used in most patients . in our study \n , there was a significant improvement in hemodynamic variables , including mva , paps , la pressure , mvpg , and mvmg after bmv . \n it is believed that a higher increase in mva can be achieved only at the expense of more frequent complications . however , in our study , a higher than twofold increase in mva with no complications shows the efficacy of bmv . \n although the incidence of mr has slightly decreased in the past few years , mr development or mr increase is still the major concern after bmv . \n interestingly , in this study we observed mr increase or development in 17.1% , mr decrease in 4.8% , and no mr change in 78.1% of the patients . \n to the best of our knowledge , the increase rate in our study is probably the lowest reported in the literature . \n the majority of the cases with increased mr following bmv had commissural mr from the anterior commissure , most probably due to commissural rupture . \n there are few reports describing a decrease in mr after bmv , with the highest incidence rate being 17 of 20 patients in the palacios and colleagues study . \n we observed a one - grade reduction in 4 patients and a 2-grade reduction in one patient . \n palacios and colleagues described three possible mechanisms responsible for the decrease in mr : 1 ) reversible mitral valve stretching by bmv ; 2 ) fibrosis and healing of the end of the commissures , which may diminish mr due to the excessive splitting of the commissures ; and 3 ) improvement in transient papillary muscle dysfunction caused by balloon trauma at the time of bmv . \n we also believe that in our cases , this decrease could be due to improvement in excessive commissural zone damage and relative structural improvement . \n most studies have evaluated the effect of hemodynamic and echocardiographic variables on the bmv outcome . \n aslanabadi and colleagues evaluated repeated bmv and mitral valve replacement in patients ( even with a wilkins score > 11 ) who had restenosis after primary balloon valvotomy and achieved acceptable results . \n similarly , other studies have shown that a high wilkins mitral score is not a very robust predictor of poor outcomes after bmv . in our study , bmv was successful in all the patients . \n we evaluated the factors that could influence mr severity or mr development . a higher calcification score and a lower mva before bmv predicted a rise in mr , but the total wilkins score could not predict its occurrence . \n in contrast , abascal and colleagues reported that an increase in mr could not be predicted by any features of the valve or the subvalvular apparatus , clinical characteristics of the patient , or technical aspects of the procedure . \n overall , the calcification score is the most important component of the wilkins classification in that it can predict mr development or mr increase because the probability of mr development increases with a rise in the calcification score . indeed , in our previous study , \n in our study , bmv conferred excellent immediate hemodynamic and clinical results inasmuch as mr severity increased only in some patients and , interestingly , decreased in a few . \n what is more , there were no major complications . our results , therefore , give emphasis to the efficacy of bmv in the treatment of patients with severe ms . \n the echocardiographic calcification score was useful for identifying patients likely to have mr development or mr increase following bmv .", "role": "user" }, { "content": "abstractbackground : percutaneous balloon mitral valvotomy ( bmv ) is the gold standard treatment for rheumatic mitral stenosis ( ms ) in that it causes significant changes in mitral valve area ( mva ) and improves leaflet mobility . \n development of or increase in mitral regurgitation ( mr ) is common after bmv . \n this study evaluated mr severity and its changes after bmv in iranian patients.methods:we prospectively evaluated consecutive patients with severe rheumatic ms undergoing bmv using the inoue balloon technique between february 2010 and january 2013 in madani heart center , tabriz , iran . \n new york heart association ( nyha ) functional class and echocardiographic and catheterization data , including mva , mitral valve mean and peak gradient ( mvpg and mvmg ) , left atrial ( la ) pressure , pulmonary artery systolic pressure ( paps ) , and mr severity before and after bmv , were evaluated.results:totally , 105 patients ( 80% female ) at a mean age of 45.81 13.37 years were enrolled . \n nyha class was significantly improved after bmv : 55.2% of the patients were in nyha functional class iii before bmv compared to 36.2% after the procedure ( p value < 0.001 ) . \n mva significantly increased ( mean area = 0.64 0.29 cm2 before bmv vs. 1.90 0.22 cm2 after bmv ; p value < 0.001 ) and paps , la pressure , mvpg , and mvmg significantly decreased . \n mr severity did not change in 82 ( 78.1% ) patients , but it increased in 18 ( 17.1% ) and decreased in 5 ( 4.8% ) patients . \n patients with increased mr had a significantly higher calcification score ( 2.03 0.53 vs.1.50 0.51 ; p value < 0.001 ) and lower mva before bmv ( 0.81 0.23 vs.0.94 0.18 ; p value = 0.010 ) . there were no major complications.conclusion:in our study , bmv had excellent immediate hemodynamic and clinical results inasmuch as mr severity increased only in some patients and , interestingly , decreased in a few . our results , underscore bmv efficacy in severe ms . \n the echocardiographic calcification score was useful for identifying patients likely to have mr development or mr increase after bmv .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: postoperative recovery time and the length of hospitalization have decreased significantly since routine cholecystectomy changed from an open to a laparoscopic procedure . \n early positive results of ambulatory laparoscopic cholecystectomy , by reddicke and olsen in 1990 , fueled its further growth , and it is now well accepted as a safe , cost - effective procedure for symptomatic gallstone disease . \n various studies have documented the safety , feasibility , cost - effectiveness , and patient acceptability of this operation as an out patient procedure . despite these results \n , it has only been practiced sporadically at centers in the uk and is not well established . \n laparoscopic cholecystectomy has been routinely performed at this hospital , and patients have traditionally been admitted and discharged after an overnight stay . with the creation of a dedicated outpatient unit , ambulatory laparoscopic cholecystectomy ( alc ) has been practiced since january 2002 . the objective of this study was to evaluate postoperative morbidity and unplanned admissions , as well as readmissions following ambulatory laparoscopic cholecystectomy . \n from january 2002 to april 2005 ( 40 months ) , 253 patients underwent laparoscopic cholecystectomy in the department of general surgery . \n fifty - five patients had their gall - bladder removed as an inpatient , and 13 patients underwent bile duct exploration . \n alc was offered to 198 of 253 well - motivated patients ( 79% day cases ) . \n the first phase was a retrospective analysis of 112 patients from january 2002 to july 2003 ( 19 months ) . \n all medical records were reviewed to document patient characteristics , perioperative details , unplanned admissions , and readmission rates . \n the second phase was a prospective study involving 86 patients from august 2003 to april 2005 ( 21 months ) . \n all patients with symptomatic gallstone disease , with no evidence of cbd calculi and who met the selection criteria were offered alc . \n patients who had a common bile duct stone were initially offered an endoscopic retrograde cholangiopancreatography and booked for ambulatory laparoscopic cholecystectomy if considered suitable . \n a fully trained surgeon was responsible for confirming the indications and eligibility for outpatient surgery after discussion with the patient . \n only patients belonging to asa grade 1 & 2 were included in the initial study , and a few dedicated patients with asa grade 3 ( 12 in all ) were considered at a later stage of the study . \n another criterion for inclusion was that a responsible adult would be present with the patient for a 24-hour period postoperatively . \n patients who presented as an emergency with acute cholecystitis and underwent cholecystectomy on their initial admission were excluded from the study . \n patients at significant risk of requiring conversion to an open operation , such as those with previous upper abdominal surgery , were also excluded . \n all patients were scheduled for outpatient laparoscopic cholecystectomy in this hospital 's purpose - built outpatient unit . \n patients were admitted to the hospital on the morning of the operation , and every effort was made to accommodate them that morning , with the intention of discharging them in the evening . \n all patients received preoperatively a single dose of broad - spectrum antibiotic and infiltration of local anesthetic to the wound . the anesthetic technique used for these procedures depended on the anesthetist responsible for each surgical session . \n cycli - morphine was the most common opiate used , although pethidine was utilized in a significant number of cases . \n all patients received either diclofenac or parecoxib unless there was a contraindication to nonsteroidal anti - inflammatory drug use . at the conclusion of surgery , \n the patients were discharged before 8 p.m. , with a responsible adult who could look after them for the first 24 hours , along with leaflets explaining the relevant postoperative advice and encouraging the patients to visit their own physician if they felt it were necessary . \n all patients were given a supply of a combination of codeine and paracetamol plus a nonsteroidal antiinflammatory drug for 48 hours . \n patients who did not meet the discharge criteria , and those whose operation was converted to an open procedure , were admitted . \n the study ended 6 weeks after the surgery , with follow - up at the routine surgical clinic . \n of 253 patients , 198 ( 79% day cases ) underwent ambulatory laparoscopic cholecystectomy during the 40-month study period . \n all of the 112 patients in the first phase of the study were either asa grade i or ii . there were 90 women ( 80% ) and 22 men ( 20% ) with a mean age of 45 years ( range , 21 to 78 ) . \n surgery was successfully performed in all the patients without any open conversions . however , 23 patients required unplanned admission for different reasons ( table 1 ) . \n other causes included wound pain , urinary retention , operation in the afternoon , severe shoulder pain , and 2 patients needed admission after the placement of a suction drain . \n twelve ( 50% ) of the 23 patients admitted were more than 55 years of age . \n unplanned admission and readmissions ( january 2002july 2003 ) in total , 4 ( 3.4% ) patients were readmitted after discharge . \n three of these , with wound - related complaints , either hematoma , minor wound infection or wound pain , were treated conservatively . \n one patient , admitted 10 days after discharge with a massive lower gi bleed , was found at laparotomy , to have a cystic artery pseudoaneurysm eroding into the transverse colon . \n of the 86 patients in the second phase of the study , 72 ( 84% ) were women and 14 ( 16% ) were men 16 to 78 years of age ( median , 48 ) . \n twelve well - motivated patients with asa class iii were also considered in this phase of the study in addition to classes ii and i. in 3 patients , the laparoscopic procedure was converted to open cholecystectomy due to difficult dissection , not being able to identify the proper anatomy , or abnormal anatomy . \n an unexpected admission was required for 6 ( 7% ) patients , including 3 who had undergone conversion to an open procedure ( table 2 ) . \n one of the patients had a history of sleep apnea due to obesity ; it was thought it would be prudent to observe him as an inpatient . \n unplanned admission and readmissions ( august 2003april 2005 ) of the 3 patients readmitted after discharge , 2 were treated conservatively for wound - related problems . \n one patient developed a biliary leak from cbd injury and was admitted 7 days after discharge with biliary peritonitis . \n laparotomy revealed a lateral laceration to the common bile duct , which was repaired with t - tube drainage . \n laparoscopic cholecystectomy has undergone a revolution since the advent of its being performed as an outpatient procedure . with continuing pressure on health service resources , \n there has also been a drive to reduce in - hospital stays and to increase the efficiency of procedures . \n the audit commission report of 1990 encouraged the expansion of outpatient procedures , and laparoscopic cholecystectomy fulfills this niche and has been performed in several centers with success . with an increase in outpatient procedures , \n it is necessary to evaluate the conditions in which admission for overnight stays could be kept to a minimum , although realizing that the holy grail of no admissions is , realistically , unobtainable . \n it is important to recognize the difference between studies that have evaluated outpatient cases , which relates to discharge on the same day of the procedure without requiring an inpatient bed , and other studies that include patients admitted overnight but discharged within 24 hours . in our study , we analyzed only those who were discharged on the same day of admission ( before 8 pm ) . whilst discharge the next day ( within 24 hours ) is admirable , and suggests good early mobilization , it still fails to satisfy the audit office criteria of true outpatient procedures . \n unplanned admission after outpatient surgery is an indicator of quality assurance . all discharged patients in our study were reviewed at 6 weeks . \n the unplanned admission rate , whilst initially high at 21% , fell to a much more respectable 7% ( overall 15% ) in comparison with that of other centers , which varied from 3% to 39% . \n the causes of postoperative morbidity were similar in both phases ( table 3 ) except that 3 patients ( 1.5% ) had to have their laparoscopic procedure converted to an open procedure in the second phase , and this did not occur in the first phase . \n results from phases 1 and 2 january 2002april 2005 ( n-198 ) a drop in admission , from 21% to 7% , in the second phase is significant and needs to be analyzed further . \n this was purely at the discretion of the patient ; either they felt they were not fit enough to go home or there was low confidence amongst the nursing staff . \n this was evident in the second phase of the study when only one patient was admitted for observation as he had sleep apnea syndrome . \n patients admitted for pain , nausea , or vomiting were also significantly reduced . whilst there was not a universal anesthetic protocol , each patient received a preoperative opiate , nsaid , and antiemetic . \n we could not correlate the significant number of patients admitted with pain , nausea , and vomiting with any of the anesthetics or antiemetics used . \n patients who were over the age of 55 years did not have a higher incidence of admission than those of a younger age group , contrary to the perception from the first phase of the study . \n only 2 unplanned admission patients were aged above 55 years in the second phase , and both of them were asa grade iii . \n previous reports emphasized the duration of procedure as one of the predictors of unplanned admission . in our study , the total operative time ranged from 16 minutes to 89 minutes ( median , 35 ) . \n the readmission rate of 3.5% compares well with a range of 0% to 8% reported by other authors . \n admission would not have greatly changed the course of these patients , nor would it have prevented these complications from happening . however , biliary leak ( 7 days postop ) would have been picked up earlier if the patient had been admitted . \n this patient and the patient with a pseudoaneurysm of the cystic artery ( 10 days postop ) were read - mitted a week after initial discharge . \n even if they had been operated on as an inpatient , they could have been discharged before the complication became evident . \n there was no clinical evidence of an aortic aneurysm , the possibility of angio - enteric fistula having been considered . \n esophagogastroscopy performed with the patient under anesthesia did not reveal any active upper gastrointestinal bleed . \n the large clotted blood was noted at the gallbladder fossa , and some blood - stained fluid was present in the abdomen . \n the proximal transverse colon was adherent to a large mass of clotted blood in the gallbladder fossa . \n following evacuation of the blood clot , there was brisk bleeding from the cystic artery stump proximal to the clips . \n a hole was identified in the antimesenteric border of the colon where it had been adherent to the organized blood clot . \n there was no true pseudocapsule around the blood clot to indicate clearly the presence of an organized pseudoaneurysm , and the exact cause of the fistulation into the colon was unclear . \n electrosurgical injury to the cystic artery stump was possible during surgery as it was a difficult laparoscopic cholecystectomy . \n it appeared that the clotted blood mass had eroded into the colon and was responsible for the gastrointestinal hemorrhage . \n it is a known fact that most of the early complications after laparoscopic cholecystectomy occur within a week after surgery . \n we felt that early review , either by nurse - lead telephonic review or review in a surgical clinic , would pick up the complications earlier . \n a further change that occurred between these 2 periods was the introduction of a checklist for use by the nursing staff . \n it was observed that , in the first period , the nursing staff were being asked to assess patients fitness for discharge , having received no formal training , and fulfilling a role which , in this hospital , had been reserved for medically qualified staff . during the change , a major investment was made in educating nurses about their new role , and a checklist was drawn up to facilitate the nurses in this decision - making . \n patients were discharged from the out - patient unit if they were tolerating oral fluids or a light diet , or both , with minimal nausea or vomiting , had passed urine , had adequate pain control and were ambulatory . \n a discharge letter was faxed to a referring general practitioner with operative details and recommended postoperative care . \n consequently , this led to a marked reduction in the number of admissions for nausea and simple observations . \n other studies have highlighted the effectiveness of a preoperative visit , and our study again shows that , with stringent preoperative assessment , low numbers of unplanned admissions can be obtained . \n the empowerment of the nurses yielded further rewards as the nurses decided to set up a team to allow follow - up of the patients . \n up to august 2005 , all the patients discharged were cared for by their own physician until their review in the routine general surgical clinic , 6 weeks after the operation . in september 2005 , \n telephone nurse interview care service ( tonics ) was set up to review each case on day 1 and then at 6 weeks following discharge . \n this proved to be an unqualified success , with only one person requesting a formal outpatient appointment , thereby freeing more of these appointments for new referrals or necessary reviews . \n it suggests that these patients do not require aggressive postoperative nursing care , after discharge , and that the availability of general practice or accident and emergency service may suffice instead of the costlier district nurse visit . \n studies have shown that this is the case as long as a coherent and coordinated system of care is in place . \n indeed , it may even be that patients prefer a telephone call to a home visit . \n training has become an important issue as the government strives to ensure that the national health service fulfils its service commitments , often to the detriment of training the next generation of medical staff . \n it is vital that trainees are exposed to all aspects of patient care so as to be fully aware of ambulatory surgery and its place in the surgeon 's armory . \n it would seem wise , though , to limit involvement to more experienced trainees so as to have minimal impact on the service commitment and the admission rate . \n it is also possible that the collection of certain cases in one fixed service may , in fact , be beneficial to the trainee , as it would provide a definite area in which the trainee could focus and develop the practice , especially in the climate of the new deal and european working time directive . \n much has been debated about the financial impetus in the move to further outpatient procedures . \n a cost analysis was undertaken in our trust , which showed that , while the actual operative costs were similar , the real saving came because it was cheaper to carry out the outpatient procedures in their totality compared with elective admissions , and both these mechanisms of laparoscopic cholecystectomy were markedly cheaper than emergency admission . \n the average cost of the elective inpatient laparoscopic cholecystectomy was 1793 compared with 1174 for out - patient cases \n this would be in keeping with other studies that showed that there was a potential reduction in costs of 11% to 25% per patient . \n outpatient laparoscopic cholecystectomy is safe , feasible , and desirable in the majority of patients , with few changes to current practice , and has become established practice at our institution . for the admissions to be kept to a minimum \n , the procedures should be performed by experienced staff , patients should be given pre - emptive anti - emetics , and analgesics , and experienced staff should be given the task of evaluating the discharge criteria . if this were established nationally , it would impact not only patient waiting times but also would result in significant cost savings .", "role": "user" }, { "content": "background : outpatient laparoscopic cholecystectomy is an established practice in the united states , but it is not well established in the united kingdom , and evidence of experience is scarce . the aim of this study was to evaluate the effect of ambulatory laparoscopic cholecystectomy on postoperative morbidity and possible cost savings . \n we tried to elucidate possible predictors of unplanned admission and readmission rates after discharge.methods:this study was conducted in 2 phases . \n the first phase involved 112 patients and was a retrospective analysis from january 2002 to july 2003 ( 19 months ) . \n the second was a prospective study involving 86 patients from august 2003 to april 2005 ( 21 months ) . \n consultants , associate specialists , or higher surgical trainees performed the surgeries in a dedicated outpatient procedure unit . \n the study ended 6 weeks after the operation.results:hospital mortality was zero . \n overall , 29 ( 15% ) patients required unplanned admissions . \n three ( 1.5% ) patients required conversion to open cholecystectomy . \n other causes included simple observations ( 7 ) , wound pain ( 6 ) , nausea and vomiting ( 6 ) , suction drain ( 2 ) , urinary retention ( 2 ) , operation in the afternoon ( 2 ) , and shoulder pain ( 1 ) . of \n the patients discharged , 7 ( 3.5% ) required readmission after the initial discharge . \n five of the 7 readmissions were wound related and treated conservatively . \n two patients underwent laparotomy.conclusion:ambulatory laparoscopic cholecystectomy appears to be safe , feasible , and cost - effective with a low conversion rate . \n the unplanned admission rate can be reduced by better training , criteria for discharge , and improvement in anesthesia . \n this will have implications for surgical training and healthcare resources .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: prostatitis , resulting from both nonbacterial and bacterial causes , affects approximately 214% of men [ 1 , 2 ] . \n nonbacterial prostatitis , which accounts for 9095% of all cases of prostatitis , presents with a diversity of inflammatory symptoms including genitourinary and pelvic pain , urinary obstruction , and ejaculatory dysfunction . a uniformly effective therapy for nonbacterial prostatitis does not exist , and \n the pathogenesis and pathophysiology of this condition are not yet understood . to gain insight into the mechanisms of prostatitis , \n our lab has employed rat models of both bacterial prostatitis and nonbacterial prostatitis [ 46 ] . \n our models of infectious prostatitis have shown that the inflammation is due to virulence factors from escherichia coli and proteus mirabilis [ 7 , 8 ] . \n although the mechanisms for pseudomonas aeruginosa - induced prostatitis involve functional las and rhl quorum sensing systems for complete infection and inflammation to occur , the mechanisms that cause noninfectious prostatitis are essentially unknown . to explore these mechanisms \n , we have developed a murine hapten - induced model of prostatitis , based on our established rat model to analyze nonbacterial prostatitis in the mouse . \n this newly developed murine model , stemming from a rodent hapten - induced model of colitis , enables the use of genetically altered mice to evaluate the etiology of nonbacterial prostatitis . in our search for potential causes of noninfectious prostatitis \n , our attention was drawn to the presence of proteinase - activated receptors ( pars ) in the prostate [ 11 , 12 ] , which is also known to produce par - activating kallikrein - related peptidases belonging to the prostate - specific antigen or psa family . \n furthermore , the pars are upregulated in pathological conditions , such as cancer of the prostate . \n the g - protein - coupled receptor par family comprises four receptors ( pars 14 ) \n . pars are triggered by an unusual serine proteinase mechanism that involves the cleavage - mediated exposure of a masked amino - terminal receptor sequence . \n this revealed sequence then acts as a tethered ligand to stimulate receptor signaling and induce numerous downstream effects . \n in particular , par1 is cleaved by a number of trypsin - fold serine proteinases including , among others , thrombin , plasmin , and cathepsin g [ 1517 ] . \n in addition , synthetic par - selective activating peptides are widely used to stimulate pars . \n these peptides are useful in pharmacological studies because they directly mimic the tethered ligand sequence and bypass proteolytic cleavage altogether [ 15 , 18 ] . \n thus , pars can be activated by synthetic peptides to assess the impact that enzyme - mediated par stimulation might have in a tissue . \n this strategy avoids the complex effects that proteinases themselves might have , such as nontargeted substrate cleavage . \n our studies specifically used the par1-selective activating peptide , tfllr - nh2 ( par1-tf ) , in the context of murine prostatitis . \n pars are known to play a prominent role in a variety of tissues including the gastrointestinal ( gi ) tract and the central nervous system [ 19 , 20 ] . in particular , pars 1 and 2 \n enzymes that regulate par1 in such tissues range from the coagulation proteinases , such as thrombin and factor viia / xa [ 21 , 22 ] , to the kallikrein - related peptidase family ( klks ) . \n the prostate is recognized as an important source of proteinases and klks , for which the most widely recognized klk family member , klk3/prostate - specific antigen ( psa ) , is used as a prognostic indicator of prostate cancer [ 24 , 25 ] . \n prostate - derived klks are thought to promote an inflammatory process not only by cleaving kininogens , prourokinase - plasminogen activator ( proupa ) , and proteins of the extracellular matrix but also by activating pars [ 20 , 23 ] . since pars are expressed in the prostate of a number of species including humans [ 14 , 25 ] and \n since the prostate can produce serine proteinases , we hypothesized that par activation may play a role in nonbacterial prostatitis . to test this hypothesis \n , we developed a new hapten - induced mouse model of prostatitis to evaluate the impact of intraprostatic par1 activation on prostate inflammation . \n this model allowed us to use both wild - type and par1-null mice . to this end \n , prostatitis was induced using ethanol - dnbs in the presence or absence of the par - selective activating peptide , par1-tf , in either wild - type or par1-null ( par1 ) mice . \n our data support an immunomodulatory anti - inflammatory role for par1 that involves an elevation of the anti - inflammatory cytokine il-10 . \n in addition , our work has revealed an unexpected non - par1 target for tfllr - nh2 that diminishes prostatitis via a receptor that warrants further investigation . \n chemicals used in this study included anhydrous ethyl alcohol ( etoh ; commercial alcohols ) and dinitrobenzene sulfonic acid ( dnbs ; mp biomedicals ) . \n par - activating peptides used included the synthetic par1 agonist peptide tfllr - nh2 ( par1-tf ) and its reverse receptor - inactive peptide control rllft - nh2 ( rl ) . \n all peptides were synthesized via solid - phase peptide synthesis by the peptide synthesis facility at the university of calgary . \n the composition and purity of all peptides were established via high performance liquid chromatography ( hplc ) , mass spectral analysis , and amino acid analysis . \n male c57bl/6 mice weighing approximately 21 to 28 g ( 4 to 8 weeks old ) were obtained from the life and environmental sciences animal resource centre at the university of calgary . \n par1-null c57bl/6 mice and their wild - type counterparts were obtained from an in - house breeding colony at the university of calgary , faculty of medicine , from breeding pairs originally provided by johnson & johnson pharmaceutical research and development . \n mice were caged in polysulfone shoebox cages with aspen chip bedding and housed at 20 2c and 40 10% relative humidity , with 12 h of illumination per day . \n mice were randomly divided into groups ( n = 47 ) and anesthetized with 4% halothane . while anaesthetized , mice were transurethrally catheterized with an ethylene oxide sterilized and lubricated pe10 polyethylene feeding tube ( inner diameter 0.28 mm ; outer diameter 0.61 mm ) attached to a 30.5-gauge needle . \n catheters were inserted into the urethra 1.5 cm from the base of the penis . \n all compounds were administered at a maximum volume of 40 l while the catheter was held in place . \n prostatitis was induced using 10 mg / ml of dnbs dissolved in 50% etoh and 50% 0.01 m ph 7.2 sterile phosphate - buffered saline ( pbs ) . \n par peptides were dissolved in 25 mm hepes buffer at ph 7.4 to a concentration of 5 mm and combined 1 : 1 with 50% etoh and 10 mg / ml dnbs . \n mice were administered the following peptides in 40 l solutions : 5 mm ( 100 nmol ) tf or 5 mm ( 100 nmol ) rl . \n the time directly following solution administration was designated as time 0 h and mice were sacrificed by cervical dislocation at intervals of 24 h , 48 h , and 72 h following transurethral catheterization . \n the life and environmental sciences animal care committee in accordance with the canadian council on animal care guidelines granted approval for this study . \n the ventral prostate was aseptically removed from each mouse and visually assigned a score of 03 , based on the severity of prostatitis . \n prostates were scored as follows : grade 0normal appearance ; grade 0.5minor congestion ; grade 1congestion ; grade 2congestion and marked edema ; and grade 3congestion , marked edema , and hyperemia . following macroscopic damage grading and weighing , \n tissue was aseptically divided into three equal pieces : one piece was fixed in 10% neutral - buffered formalin for histological analyses , one piece was stored on ice for immediate myeloperoxidase ( mpo ) assays , and the last piece was frozen and stored at 70c for cytokine enzyme - linked immunosorbent assays ( elisas ) . \n five m sections were obtained and stained with hematoxylin and eosin ( h&e ) according to standard protocols . \n the severity of prostatitis was quantified morphometrically based on three separate categories according to criteria verified by an anatomical pathologist . \n scores of 0 to 3 were assigned to each category and then added together for a final score out of 9 . \n standardized scoring categories were as follows : ( i ) epithelial cell exfoliation and shedding : grade 0normal architecture ; grade 1less than 50% of acini showed epithelial cell exfoliation ; grade 250% of acini showed epithelial cell exfoliation ; and grade 3greater than 50% of acini showed epithelial cell exfoliation ; ( ii ) epithelial cell necrosis : grade 0normal architecture ; grade 1less than 50% epithelial cell necrosis ; grade 250% epithelial cell necrosis ; and grade 3greater than 50% epithelial cell necrosis ; ( iii ) inflammatory cell infiltrate : grade 0normal architecture ; grade 1minor focal infiltrate ; grade 2severe focal and minor diffuse infiltrate ; and grade 3severe diffuse infiltrate . \n slides were imaged on a leica dmr microscope at 20x magnification and photomicrographs were taken using a micropublisher 5.0 rtv digital camera ( qimaging ) and volocity acquisition v 4.4 imaging software ( improvision inc . ) . \n the homogenates were then centrifuged at 13 000 g for 2.5 min and the supernatants were mixed with o - dianisidine ( sigma - aldrich ) in phosphate buffer . \n the solution was assayed at 450 nm and activity was recorded per mg protein . \n tissue examined for cytokine production was homogenized in pbs containing 2 l of protease inhibitor ( sigma - aldrich ) per ml of homogenate . \n supernatants were assayed for il-10 , il-1 , il-6 , tnf- ( ebiosciences ) , and kc / cxcl-1 ( r&d systems ) according to the manufactures ' instructions . \n mouse - specific cdna primers and random hexameric cdna primers were synthesized and gel - purified by the university of calgary dna services . \n whole prostates were harvested from male c57bl/6 mice treated with 0.9% ( w / v ) saline . \n prostate tissue was homogenized in pbs and total rna was extracted and isolated using an rneasy kit ( qiagen ) according to the manufactures ' instructions . \n the concentration of purified rna was determined by measuring the a260 using nanodrop 2000 technology ( thermo scientific ) . \n following rna purification , 5 g of rna was transcribed and amplified at 50c for 50 min using a superscript iii first - strand synthesis system ( invitrogen ) and random hexameric cdna primers . \n once cdna was obtained , 2 l of product was combined with primer pairs designed to amplify mouse par1 . \n primers were as follows : par1 : 5 primer , gcg ggc agc ctt ggg aca at ; 3 primer , atg aag gga gga ggc ggc gt ; -actin : 5 primer , cac ccg cga gca cag ctt ct ; 3 primer , cct cag ggc atc gga acc gc . toptaq dna polymerase ( qiagen ) was used for pcr amplification . \n 35 cycles were run beginning with a 92c denaturing step for 30 sec , followed by a 54c annealing step for 30 sec , and lastly a 72c extension step for 1 min with a final 72c extension step for 1 min . \n pcr products were separated by 2.5% ( w / v ) agarose gel electrophoresis and visualized with sybr safe ( invitrogen ) . \n this study adapted and modified immunohistochemistry methods previously described using rabbit polyclonal anti - par1 antisera [ 28 , 29 ] . \n formalin - fixed , paraffin - embedded sections 5 m in thickness of mouse prostate tissue ( treated with 0.9% saline ) were deparaffinized and hydrated using decreasing concentrations of ethanol . \n sections were boiled in 0.01 m ph 6.0 citrate buffer for 10 min and endogenous peroxidase activity was blocked by incubating sections in 0.3% h2o2 ( sigma - aldrich ) for 20 min . \n , sections were incubated overnight at room temperature with a rabbit polyclonal antibody raised against a synthetic mouse par1 peptide . \n this peptide spans the thrombin cleavage - activation site ( // ) , including the tethered ligand sequence ( underlined ) ( yatpnpr//sfflrnpsedggc : 1/500 ) , and was diluted in pbs with 10% normal goat serum . \n immunolabeling of the primary par1 antibody was detected using a secondary biotinylated goat anti - rabbit antibody followed by avidin - biotin peroxidase complexes ( vector laboratories ) for 1 h at room temperature . \n peroxidase activity was verified using 0.5 mg / ml 3,3-diaminobenzidine tetrachloride ( sigma - aldrich ) in 0.05 m ph 7.6 tris - hcl buffer containing 0.03% h2o2 . \n sections were then counterstained with hematoxylin ( vector laboratories ) for 30 min , dehydrated , and mounted . \n all washes were performed for 15 min with 0.01 m ph 7.2 pbs . \n slides were imaged on a leica dmr microscope at 100x magnification and photomicrographs were taken using a micropublisher 5.0 rtv digital camera ( qimaging ) and volocity acquisition v 4.4 imaging software ( improvision inc . ) . \n group data are presented as means standard error of the mean ( sem ) . \n figures and statistical examination were compiled using graphpad prism v 5.00 software ( graphpad software ) . \n macroscopic and microscopic damage scores were analyzed by a mann - whitney u test or a kruskal - wallis one - way analysis of variance ( anova ) followed by dunn 's multiple comparison test . \n mpo assays and cytokine elisas were analyzed by student t - test or a one - way anova followed by a tukey 's multiple comparison test . \n we first established a hapten - based murine model of acute nonbacterial prostatitis based on our previously published rat model . in keeping with the rat data , \n administration of ethanol - dnbs induced a prominent inflammatory reaction in the mouse prostate that , over a 3-day time period , was maximal at day 2 ( figure 1 ) . at that time point \n , ethanol - dnbs - treated mouse prostates showed all of the hallmarks of inflammation including increased macroscopic and microscopic damage scores , increased prostatic weight gain , and elevated mpo activity ( figures 1(a ) , 1(b ) , 1(c ) , and 1(d ) ) . based on these data , \n a 2-day ethanol - dnbs time course was used to model nonbacterial prostatitis throughout the remainder of this study . \n these ethanol - dnbs - treated prostates also showed significantly elevated il-1 and kc inflammatory cytokine production ( figures 2(b ) and 2(c ) ) . \n histologically , the ethanol - dnbs - treated prostate tissue showed widespread leukocyte infiltration , hemorrhage , extensive destruction of the prostatic acini and epithelium , and epithelial cell necrosis ( figure 6(b ) ) . \n conversely , saline controls showed a healthy and undamaged prostatic architecture ( figure 6(a ) ) . \n a par1 pcr product of the expected size ( 296 bp ) was detected in mouse prostate tissue ( figure 3 ) . \n the par1 pcr product was identical to the one verified by us in mouse colon tissue . \n prostatic par1 was localized prominently throughout the apical acini epithelium and acini lumen as well as throughout the basal acini epithelium and prostatic epithelial cells . \n there was specific staining both at the plasma membrane of cells ( figure 4(a ) : arrows ) and diffuse intracellular reactivity . \n no immunoreactivity was observed using a nonimmune rabbit serum control , and the anti - par1 antiserum did not yield a signal in par1-null mice ( figure 4(b ) ) . in other tissues such as mouse liver , par1 immunoreactivity \n was also detected with our antiserum , as reported previously ( data not shown ) . as outlined above , administration of ethanol - dnbs into the mouse prostate induced pronounced inflammation , as measured by macroscopic and microscopic damage , prostatic weight gain , mpo activity , and cytokine production ( figures 1 and 2 ) . on its own \n , the par1-activating peptide did not affect the indices of prostate inflammation ( data not shown ) . however , when coadministered with ethanol - dnbs , par1-tf markedly reduced the ensuing prostatitis , relative to animals treated with ethanol - dnbs alone . \n these par1-tf - treated prostates showed significantly diminished microscopic damage , weights , and mpo activity , when compared to control prostates treated with the par1-inactive reverse peptide ( ethanol - dnbs - par1-rl ) ( figures 5(b ) , 5(c ) , and 5(d ) ) . \n histological examination of prostate tissue treated with ethanol - dnbs in combination with par1-tf showed very little leukocyte recruitment throughout the prostatic stroma or acini , and the prostatic epithelium was undamaged ( figure 6(c ) ) . \n overall , sections from mice treated with ethanol - dnbs and par1-tf were comparable to noninflamed sections treated with saline . \n in contrast , tissue treated with the reverse - sequence , receptor - inactive par1-derived peptide ( par1-rl ) along with ethanol - dnbs displayed destruction of the prostatic epithelium and acini , as in the inflamed sections treated with ethanol - dnbs alone ( figures 6(b ) and 6(d ) ) . in accordance with the anti - inflammatory effects of par1-tf shown in figure 5 , we found that tfllr - nh2 upregulated production of the anti - inflammatory cytokine , il-10 . \n treatment with ethanol - dnbs alone led to a small increase in prostatic il-10 production versus saline instillation ( figure 7(a ) ) . \n this increase was slightly augmented by the addition of the par1-inactive reverse peptide to the ethanol - dnbs solution ( etoh + dnbs + par1-rl : third histogram from y - axis , figure 7(a ) ) . \n however , the impact of the receptor - active peptide , par1-tf , on il-10 production when administered along with ethanol - dnbs in par1-null mice was not different from the effect of the reverse - sequence receptor - inactive peptide in wild - type mice ( third versus fourth histograms from y - axis , figure 7(a ) ) . strikingly , in the par1 wild - type mice , coadministration of receptor - active par1-tf to ethanol - dnbs - treated wild - type prostates led to a significantly increased il-10 production versus all other treatment groups ( figure 7(a ) , fifth histogram from y - axis ) . \n as already pointed out , this marked elevation due to par1-tf was not observed in par1-null animals and was not observed in wild - type mice treated with ethanol - dnbs along with the reverse - sequence par1-inactive peptide , par1-rl ( figure 7(a ) , third and fourth histograms from y - axis ) . \n significant differences in the levels of il-10 in the serum ( as opposed to the tissue extracts ) were not found between the different treatment groups , suggesting that par1-tf had no effect on systemic il-10 levels ( figure 7(b ) ) . \n the observation of an anti - inflammatory action of the receptor - selective par1-tf agonist , with an absence of an anti - inflammatory action of the reverse - sequence par - inactive peptide par1-rl , strongly pointed pharmacologically to an anti - inflammatory role for par1 . \n we wished to evaluate this putative anti - inflammatory role for par1 further by analyzing the impact of the peptides in par1-null mice . \n the intraprostatic administration of ethanol - dnbs induced an inflammatory reaction in par1-null mice comparable to that observed in the prostates of wild - type mice . \n specifically , in par1-null mice , as in the wild - type animals , ethanol - dnbs significantly increased macroscopic damage scores , prostatic weight gain , and mpo activity , when compared to hepes controls ( figures 8(a ) , 8(c ) , and 8(d ) ) . to our surprise , in the par1-null mice , the coadministration of the par1-activating peptide along with ethanol - dnbs substantially diminished most of the indices of inflammation . \n histological examination of these par1-null mice treated with ethanol - dnbs along with par1-tf revealed very little leukocyte infiltrate , healthy prostatic acinus , stroma , and epithelium ( data not shown ) and markedly attenuated histological tissue damage and mpo activity , similar to the effect of the par1-activating peptide in the wild - type mice ( figure 8(d ) ) . \n however , the coadministration of par1-tf with ethanol - dnbs did not diminish prostatic weights in the par1-null mice ( figure 8(c ) ) . \n thus , in this respect , the par1-active peptide was not active in the par1-null mice . \n these data suggest both par1-dependent and surprisingly par1-independent anti - inflammatory effects of the par1-activating peptide in the murine prostatitis model . \n we found that the murine ethanol - dnbs prostatitis model accurately reflected our previous work with the rat model , with a maximum of inflammatory indices observed at day 2 . \n it is of interest to note that microscopic damage scores decreased dramatically from day 2 to day 3 posttreatment ( figure 1(b ) ) . \n this may indicate that inflammatory resolution was occurring on a microscopic level between day 2 and day 3 posttreatment . nonetheless , day 2 showed maximal microscopic prostate damage and was used throughout the study as the experimental time point . \n in addition to causing an increase in all of the indices of inflammation in the tissue , the ethanol - dnbs - induced prostatitis resulted in an elevation of the tissue proinflammatory cytokines il-6 , il-1 , and kc but not tnf- ( figure 2 ) . \n histologically , it can be suggested that the fixation process may have altered the morphology of the prostatic acini and/or epithelium . \n saline - treated controls , however , were processed in an identical manner and did not show any destruction of the acini or epithelium , arguing against a fixation - induced artifact for the histology specimens . \n our main focus with the use of this murine model was to evaluate a potential role for par1 in murine noninfectious prostatitis . clearly , par1 is present in the mouse prostate , as indicated by our rt - pcr and immunohistochemical data . \n these findings are in keeping with the detection of pars in human normal and cancerous prostatic epithelial cells in vitro [ 25 , 31 ] and in cancerous prostate tissue in vivo . \n we observed that par1 in the mouse prostate was localized to the apical acini epithelium and lumen and expressed to a lesser degree along the basal acini epithelium and epithelial cells . \n thus , par1 is present in the mouse prostate and can in principle readily play a role in murine prostatic function . of note , although par3 and par4 are both expressed in human prostate tissue , data regarding par3 and par4 expression in mouse prostate tissue is limited . \n based on our par1 results , we hypothesize that par3 and par4 are expressed in the mouse prostate . the receptor - selective par1-activating peptide , however , unequivocally does not activate par3 or par4 , as its amino acid sequence is specific for the tethered ligand of par1 . \n it is possible that upregulated thrombin or other enzymes in par1-null mice may activate par3 and par4 , thereby surrogating par1 function . \n further investigation is required to completely elucidate the involvement of par3 and par4 in par1-null mice . in this study , ethanol - dnbs and the par1-activating peptide \n thus , the impact of par1 was on acute injury and our results indicated that the par1-activating peptide dampened the inflammatory response triggered by ethanol - dnbs . \n in particular , the main finding of our work dealing with par1 in our prostatitis model was that the par1-activating peptide , tfllr - nh2 , could cause both a par1-dependent and a par1-independent anti - inflammatory effect . in this regard , the use of both par1-null mice and peptide structure - activity information with a par1-active versus a par1-inactive peptide was essential to identify which effects of the par1-activating peptide were due to par1 itself and which effects were par1 independent . \n our data show that the reverse - sequence par1 peptide , rllft - nh2 , was not able to generate an anti - inflammatory effect in either wild - type or par1-null mice , indicating that some of the effects of the par1-tf peptide ( tfllr - nh2 ) were par1 dependent . \n further , the par1-active peptide , tfllr - nh2 was not able to elevate il-10 or inhibit tissue edema ( reflected by increased prostate weight ) in the par1-null mice . \n thus , at least a portion of the anti - inflammatory action of par1-tf related to il-10 cytokine production and swelling was par1-dependent . because il-10 is a pleiotrophic cytokine with both anti - inflammatory and immunosuppressive properties , \n these data support a direct par1-mediated anti - inflammatory role that has also been described in previous reports . \n for example , par1 agonists have promoted the release of il-10 while inhibiting the production of tnf- and il-6 in mouse microglial cells . \n in addition par1 agonists increase il-10 production in both resting and activated peripheral blood mononuclear cells . \n together , these data support the hypothesis that par1 activation may mediate anti - inflammatory effects in nonbacterial prostatitis . to our surprise \n , however , the receptor - active peptide , tfllr - nh2 , was able to diminish many of the indices of ethanol - dnbs - triggered inflammation in both the par1-null and par1-wild - type mice . \n thus , our work , like other studies , demonstrates the caution with which the par - activating peptides must be used to elucidate the potential impact of par activation in tissues . \n previous studies have indicated that non - par - mediated effects can occur with other par - selective peptide agonists . \n for example , it has been demonstrated that par1 and par2 agonists may cause mast cell mediator release via non - par1 and non - par2 mechanisms . \n further , a relatively potent and selective par2-activating peptide , trans - cinnamoyl - ligrl - nh2 , can have off - target non - par2 effects in some vascular preparations but not others . \n thus , the use of the par1-null mice was a key for us to sort out the par1-dependent versus par1-independent actions of tfllr - nh2 . the data obtained with the par1-null mice revealed a novel anti - inflammatory non - par1 effect of tfllr - nh2 ( but not its reverse - sequence peptide ) in a mouse model of nonbacterial prostatitis . \n the receptor responsible for these par1-independent anti - inflammatory effects of tfllr - nh2 remains to be determined . \n using a newly developed murine model of ethanol / dnbs - mediated prostatitis , we were able to evaluate a potential role for proteinase - activated receptor-1 ( par1 ) in modulating the inflammatory response . employing a par1-activating peptide , tfllr - nh2 , and its receptor - inactive reverse - sequence peptide , rllft - nh2 , along with experiments done in par1-null mice , we established not only that ( 1 ) par1 can play an anti - inflammatory role in noninfectious prostatitis by elevating the anti - inflammatory cytokine il-10 and diminishing swelling but also that ( 2 ) the par1-activating peptide ( but not its reverse - sequence agonist ) can , via a non - par1 mechanism , exhibit substantial anti - inflammatory actions \n . thus , peptidomimetic agonists based on the tfllr - nh2 structure may prove to be of value as therapeutic agents for the treatment of noninfectious prostatitis .", "role": "user" }, { "content": "background . \n nonbacterial prostatitis has no established etiology . \n we hypothesized that proteinase - activated receptor-1 ( par1 ) can play a role in prostatitis . \n we therefore investigated the effects of par1 stimulation in the context of a new model of murine nonbacterial prostatitis . \n methods . using a hapten ( ethanol - dinitrobenzene sulfonic acid- ( dnbs- ) ) induced prostatitis model with both wild - type and par1-null mice , we examined ( 1 ) the location of par1 in the mouse prostate and ( 2 ) the impact of a par1-activating peptide ( tfllr - nh2 : par1-tf ) on ethanol - dnbs - induced inflammation . results . \n ethanol - dnbs - induced inflammation was maximal at 2 days . in the tissue , \n par1 was expressed predominantly along the apical acini of prostatic epithelium . \n although par1-tf on its own did not cause inflammation , its coadministration with ethanol - dnbs reduced all indices of acute prostatitis . \n further , par1-tf administration doubled the prostatic production of interleukin-10 ( il-10 ) compared with ethanol - dnbs treatment alone . \n this enhanced il-10 was not observed in par1-null mice and was not caused by the reverse - sequence receptor - inactive peptide , rllft - nh2 . \n surprisingly , par1-tf , also diminished ethanol - dnbs - induced inflammation in par1-null mice . conclusions . \n par1 is expressed in the mouse prostate and its activation by par1-tf elicits immunomodulatory effects during ethanol - dnbs - induced prostatitis . \n however , par1-tf also diminishes ethanol - dnbs - induced inflammation via a non - par1 mechanism by activating an as - yet unknown receptor .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: detailed protocols , all sequences and their optimization , and full characterization of all synthesized reagents are provided in the supplementary material . briefly : oligonucleotides were coupled to antibodies , unless stated otherwise , in a two - step procedure : ( i ) dtt was used under conditions that reduce interchain disulfide bonds ; ( ii ) 5-end maleimide - functionalized oligonucleotides were coupled to the reduced antibody sulfhydryls , and the products were purified using gel filtration . \n one biotinylated antibody was used in the notcd45ra cascade , with streptavidin used to cross - link it to biotinylated oligonucleotides ; this procedure was performed directly on cells without purification of conjugates ( in this case negative controls with no streptavidin and no antibody were successfully run as well ) . \n reagents were added to cell suspensions , and in all experiments involving pbmc s reagents were removed from solution by centrifugation . in whole blood experiments ( fig . \n 5 ) , reagents were left in blood to mimic the conditions for potential in vivo applications . \n ", "role": "user" }, { "content": "molecular automata are mixtures of molecules that undergo precisely defined structural changes in response to sequential interactions with inputs14 . \n previously studied nucleic acid - based - automata include game - playing molecular devices ( maya automata3,5 ) and finite - state automata for analysis of nucleic acids6 with the latter inspiring circuits for the analysis of rna species inside cells7,8 . here , we describe automata based on strand - displacement9,10 cascades directed by antibodies that can analyze cells by using their surface markers as inputs . \n the final output of a molecular automaton that successfully completes its analysis is the presence of a unique molecular tag on the cell surface of a specific subpopulation of lymphocytes within human blood cells .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: most cases of diarrhea ( 88% ) are attributable to unsafe water and inadequate sanitation and hygiene . according to ngwe and banza - nsungu , diarrheal diseases ( usually linked to faecal contamination of water ) \n cameroon red cross and international federation of red cross and red crescent societies stated that cholera outbreak which occurred in cameroon in 2010 affected about 10,741 people and killed 650 . \n the northern part of cameroon and the littoral region were the most affected localities with 9,406 cases and 600 deaths in the far north region , 511 cases and 24 deaths in the north region , and 457 cases and 12 deaths in the littoral region . \n groundwater from wells , springs , and boreholes is largely consumed due to limited tap water supply in cameroon . \n protection and upgrading of wells were recommended for safe drinking and domestic water sources . usually , groundwater is stored in containers at home for different household uses . because faecal bacteria are distributed widely in point - of - use water sampled from storage vessels among well water consumers in garoua \n consequently , it is important to develop and implement point - of - use water disinfection methods that can be used to improve water quality at the household level . \n filtration with small - pores filters and boiling have been shown to be effective at removing many microbes and suspended solids . \n well water can be physically disinfected by boiling , filtration , or combination of the two techniques . however , unhygienic handling of water during transport or within home can contaminate even previously safe water [ 1 , 4 ] . in case of secondary contamination , within households , pathogenic bacteria introduced into the treated water \n could have different destiny according to disinfection technique used . during the period of storage , contamination by consumers and aftergrowth \n may lead to high levels of faecal bacteria in treated well water , thus posing a risk for consumers . treated or \n not , well water used for drinking purposes could then be a vector of many waterborne diseases . \n . found that storage of untreated groundwater for a long period would increase the health risk to the consumers in the short term if it contains potentially pathogenic bacteria due to their potential growth and activity . \n solutes in water can be used as sources of nutrients for bacterial populations and could therefore markedly enhance bacterial growth . \n the versatile character of bacteria allows them to adapt to numerous apparently hostile conditions as lower temperatures . \n stored water is one of the most important types of water supplies for domestic purposes in cameroon . \n the majority of studies undertaken on water in cameroon has focused on surface and groundwater quality with little work being devoted to point - of - use water quality assessment . \n information about survival / growth capacity of pathogenic bacteria in treated well water stored under local climatic condition is necessary to advice consumers about correct handling of well - treated well water at home . \n this research aimed at evaluating survival and growth of some faecal and pathogenic bacteria in autoclaved and/or filtered well water used for drinking purposes in garoua region . \n our study explored the evolution of the abundances of some faecal bacteria in the well water , treated by autoclaving and/or filtration , during its storage in household conditions . \n it is characterized by a tropical climate with two seasons : a long dry season ( october to april ) and a short rainy season ( may to september ) . \n the monthly average temperature varies from 18c to 42c ; the highest value is often noted during march and the lowest in january . \n two well water points ( w1 , w2 ) were selected based on their highest importance as a drinking water supply , significant difference between their mineralization levels , and the permanent presence of water in these wells during all seasons of the year . \n four water samples ( n = 4 ) were collected bimonthly at each sampling point during dry season ( february - march ) . \n at each site ( w1 , w2 ) , water samples were collected in 500 ml sterile glass bottles , respectively , coded in three replicates and in corresponding 100 ml clean polyethylene bottles . \n the main physicochemical parameters considered were temperature , total dissolved solids ( tds ) , ph , electrical conductivity ( ec ) , and salinity . \n these parameters were chosen in accordance with their general importance on bacterial metabolism and the availability of our laboratory equipments . \n heterotrophic bacteria were enumerated using the spread plate method with plate count agar ( bio - rad , france ) , incubated at 37c for 72 hours . \n membrane filtration was used to enumerate qualitative microbial indicators ( total coliforms , faecal coliforms , escherichia coli , and faecal streptococci ) according to the standard methods . \n the m - endo les ( difco laboratories , detroit , mi , usa ) agar was used for the enumeration of total coliforms , faecal coliforms and e. coli . \n slanetz - bartley and bile esculin azide ( bea ) agars ( biokar diagnostics , beauvais , france ) were used for faecal streptococci counts . \n one of the 3-bottled samples replicates was analyzed for heterotrophic bacteria and qualitative microbial indicators as previously indicated . \n the second was autoclaved at 121c for 15 min to destroy biological and heat sensitive antimicrobial agents . \n the third replicate was filtered and divided into two water samples : one was autoclaved , to destroy biological and heat sensitive antimicrobial agents that might pass through the 0.2 m filters ( millipore corporation , bedford , ma 01730 , usa ) , and the second was not . \n the microbiological quality control of all experimental waters was realized ; none of the bacteria used in this experiment was found . \n three bacterial species were used for their importance to the environment and public health : vibrio cholerae , e. coli , and salmonella sp . \n strains of v. cholerae ( o1 ogawa , el tor ) and e. coli atcc 25922 were obtained from the centre pasteur of cameroon and four strains of salmonella sp . \n were isolated , respectively , from well water , pig , poultry , and human urine in garoua . \n ( 2000 ) procedures . for the preparation of bacterial stocks , a colony forming unit ( cfu ) of each strain from standard agar medium was inoculated into 100 ml of nutrient broth for 24 h at 37c . \n the strain of v. cholerae was grown on alkaline nutrient agar and each of the other strains on standard nonselective plate count agar ( bio - rad ) for later use . \n cells were then harvested by centrifugation at 3000 g for 10 min at ambient temperature and washed twice with sterile nacl solution ( 8.5 \n the washed cells were suspended in autoclaved filtered water from each well ( w1 and w2 ) . from these new solutions , inoculations in three flasks ( filtered - nonautoclaved water , filtered - autoclaved water , and unfiltered - autoclaved water ) were performed for each well . based on our preliminary study , \n flasks were then incubated without shaking , in the dark , at room temperature ( 30 2c ) . \n the containers used by population in garoua allow a time of well water storage up to three days and most households store water for 24 h. for this reason , our study used one day as observation time unit . \n the water storage lasts for three days and analyses were performed after 24 h , 48 h , and 72 h to determine bacterial abundances . \n bacterial abundances were determined immediately after inoculation , at regular intervals ( one day ) up to three days by the spread plate procedure . \n the strain of v. cholerae was grown on tcbs agar ( merck kgaa , darmstadt , germany ) and each of the other strains on standard nonselective plate count agar ( bio - rad ) . \n bacterial abundances are expressed as colony forming unit ( cfu ) per volume of water . \n the number of colony forming units ( cfu ) is multiplied by the dilution factor and expressed in cfu / ml of water . \n the values of bacterial counts ( x ) are transformed using the equation y = log10(x + 1 ) . \n the arithmetic mean of the log - transformed ( base 10 ) values was utilized to summarize bacterial abundance at a given time . \n the results of the physicochemical analysis show that water samples range from acidic to basic with low to high mineralization . \n the well w2 had the highest ph value , a relatively higher salinity , tds , and also the highest electrical conductivity ( table 1 ) . \n the variation of water properties by different types of treatment was characterized by strong variations in ph , conductivity , tds , and salinity . \n although water samples of different microcosms did not have the same physicochemical characteristics as the well they have been taken from , they followed the tendency of the parent points . \n filtration and autoclaving both reduced the conductivity , tds , and salinity levels of the well water samples . \n the concentrations of total coliforms , faecal coliforms , heterotrophic bacteria , and faecal streptococci varied from one well to another , with the highest values recorded at well w2 ( table 2 ) . \n the viable counts of the six test bacteria increased after one day in unfiltered - autoclaved water , but the decrease depended on the organism and the water sample in which they were examined . \n in unfiltered - autoclaved water derived from well w2 , after an initial decrease or latency phase , the viable counts increased and remained almost constant during the experimental period ( figure 1 ) . \n abundances of v. cholerae in unfiltered - autoclaved water ( 4.04 to 5.61 log10cfu / ml in w1 microcosm ; 3.78 to 5.49 log10cfu / ml in w2 microcosm ) were higher than those of other bacteria over the whole incubation period . \n ( poultry strain ) lowered to undetectable levels ( < 1 log10cfu / ml ) after two days of water storage ( figure 1 ) . \n ( pig strain ) population reached 3.07 log10cfu / ml in well w1 microcosm and 3.90 log10cfu / ml in well w2 microcosm while salmonella sp . \n ( human strain ) reached 2.70 log10cfu / ml in well w1 microcosm and 3.88 log10cfu / ml in well w2 microcosm over the same period . \n v. cholera decreased over time but surviving cells persisted for longer period in filtered - nonautoclaved water from well w1 ( 1.91 log10cfu / ml ) and well w2 ( 2.09 log10cfu / ml ) . \n ( poultry strain ) did not follow the same survival pattern in well w2 microcosm as in well w1 microcosm . \n v. cholerae survived with little change in cell density in both autoclaved and filtered well water . while salmonella sp . \n ( human , pig , and water strains ) maintained the same pattern of growth in filtered - autoclaved water from wells w1 and w2 , e. coli progressively decreased its number to undetectable level ( < 1 log10cfu / ml ) after 2 - 3 days . \n ( poultry strain ) and e. coli did not follow the same pattern of growth in filtered - autoclaved water from wells w1 and w2 . after the decrease to undetectable level ( < 1 log10cfu / ml ) at day 2 \n , e. coli grew in filtered - autoclaved water from well w2 and reached 1.61 log10cfu / ml after 3 days . \n of the six bacteria tested , e. coli had the highest decrease in viable counts in any of the microcosms , although the decrease in viable counts was slightly less pronounced in unfiltered - autoclaved water derived from well w2 than in the other test microcosms . \n the physicochemical properties of water samples varied from one well point to another ( table 1 ) . \n these fluctuations were also observed by several authors in the study of groundwater quality in some parts of the city of yaound . \n they are likely linked to differences in human population occupation , spatial heterogeneity of the soil of the region , and the variability of potential retention of microorganisms and chemicals by this soil . comparing the raw and treated well water samples \n , it seems that treatment leads to a decrease in the concentrations of the major elements . \n for instance , salinity and electrical conductivity reached respective minimum levels of 244 ppm and 491 s / cm in treated water . \n this may be related to the retention of suspended solids to filter or the modification of molecules structure . however \n , this decrease in concentration of minerals does not exceed the safe limits for human consumption according to who . \n the results revealed that all investigated raw well water samples contain considerable numbers of heterotrophic bacteria , total coliforms ( tc ) , faecal coliforms ( fc ) , and faecal streptococci ( fs ) ( table 2 ) which are monitored as classical indicators of pollution and exceeding the permissible limit recommended by who . \n several contemporary studies have shown that the presence of fcs and streptococci in groundwater is a frequent phenomenon . \n the presence of coliforms in drinking water has been regarded as an important marker of water safety . \n the bacterial pollution of well water is mostly due to poorly constructed and located latrines , open rubbish dumps , and open drains . \n due to space limitations and lack of a proper drainage network , the traditional latrines system is extensively used in this area , and faecal matter from these latrines into the nearby wells might have contaminated the well water sources . there is a need to educate the public about the quality of their water sources and the importance of clean and healthy surroundings near water sources and to implement measures to prevent the contamination of water sources in the community . \n boiling and/or filtering water is advised until disinfection and retesting to confirm that the contamination has been eliminated . \n treatment of well water by filtration and/or boiling is often presented as an adequate solution to compensate the lack of drinking water in poor communities in developing countries [ 17 , 18 ] . \n however , secondary contamination of the treated water during storage at home could compromise this effort . \n this study assessed the ability of some faecal bacteria ( e. coli , salmonella spp . , and v. cholerae ) of various origins ( human , animal , and well water ) to survive and/or grow in well water treated by filtration and/or autoclaving . during three days of water storage , \n the dynamics of bacterial abundances , in most cases , can be divided into two phases : a phase of relative stability or low decrease in bacterial abundances , followed by a phase of relative growth or bacterial inhibition ( figure 1 ) . \n the first period is similar to a phase of bacterial adaptation to the organic matter available in trace in the water , in conditions offered by the storage . \n the second phase is similar to bacterial latency or accelerated development of cells and is visible on the 2nd or 3rd day , reflecting the depletion of nutrients in the environment or good bacterial adaptation to new environmental conditions . \n overall , the bacterial latency seems to depend on the origin and type of water as well as the bacterial strain . \n the results showed that the unfiltered - autoclaved well water better supports the survival of these organisms . \n indeed , the organic substances dissolved in water in the absence of the native microflora increase the survival and growth of bacteria such as salmonella spp . and e. coli . \n the filtered water , autoclaved or not , is less favourable to the survival / growth of the bacteria tested . in this study \n this would lead to ion binding to the filter and lower the level of mineralization . \n le chevallier et al . reported that the growth of heterotrophic bacteria would be limited in water containing less than 50 mg / l of assimilable organic carbon . \n the filtered - nonautoclaved water is less favourable to bacterial survival / growth than filtered - autoclaved water . \n the filtration through the 0.2 m filter retained the great majority of autochthonous bacteria . autoclaving inactivates most of living organisms in the water treated , reducing the interactions between experimental bacteria inoculated and autochthonous microflora . \n biotic factors are important factors of growth inhibition of salmonella sp . and e. coli . \n these biotic factors are all made of predation by protozoa and other bacteria , phage lysis , and competition with autochthonous bacteria [ 24 , 25 ] . according to mary et al . \n , the potential survival of several species of allochthonous bacteria in filtered - nonautoclaved water is sometimes significantly reduced by the presence of ultramicrocells of autochthonous bacterial microflora , due to nutrient competition which would be exerted by bacteriolytic enzymes of membrane vesicles produced by native microflora . \n although no disinfectant has been added to the treated water , abundances of bacterial pathogens decreased during storage of household water out of reach of any source of secondary contamination ( insects , dust , dirty hands , and soiled containers ) . \n the unfiltered - autoclaved water increases the chances of survival and growth for all bacteria , whereas filtered - nonautoclaved water seems to increase the possibility of negative interactions by competition for nutrients between microorganisms . \n the availability of organic carbon , higher in the unfiltered - autoclaved water , is the key factor of microbial growth control . \n the survival of e. coli in all microcosms was relatively lower than that of all tested salmonella spp . \n several authors have shown that v. cholerae can grow in freshwater in vitro ( concentrations between 2,9 10 and 1,6 10 cells / ml ) . \n in addition , v. cholerae is even able to grow in competition with microbial communities in the water . \n water showed no specific higher growth / survival than clinical strains during storage of water . \n this confirms the role of populations in the contamination of the environment by the test strains . \n the well water provided at source is unsafe for consumption with regard to microbial indicators . \n the absence of these bacteria in autoclaved and/or filtered well water indicates that filtration and boiling can be recommended if properly carried out . \n however , the survival and/or growth of some pathogenic bacteria in autoclaved and/or filtered well water , during storage at home , suggest the importance of water treatment and safe storage at household level . according to our results and taking into account the economical context of the region which is too poor , \n it is recommended that rather than discouraging the use of traditional latrines , users should be made aware of the importance of discarding them from water sources and maintaining them hygienically .", "role": "user" }, { "content": "the ability of strains of faecal bacteria ( vibrio cholerae , escherichia coli atcc 25922 , and four strains of salmonella isolated , resp . , from well water , pig , poultry , and human urine in garoua ) to survive or grow in well water microcosms was compared . \n water samples were obtained from two wells in garoua ( north cameroun ) . \n autoclaving at 121c for 15 min and filtration through 0.2 m filter were used to make microcosms . \n microcosms were constituted of unfiltered - autoclaved , filtered - nonautoclaved , and filtered - autoclaved well waters . \n bacterial strains were inoculated at initial cell concentration of 3 log10cfu / ml . all strains were able to survive / grow in used microcosms , and a maximal concentration of 5.61 log10cfu / ml was observed . \n survival abilities were strain and microcosm dependent . \n the declines were more pronounced in filtered - nonautoclaved water than in the other microcosms . \n e. coli and salmonella sp . \n ( poultry strain ) lowered to undetectable levels ( < 1 log10cfu / ml ) after two days of water storage . \n v. cholera decreased over time , but surviving cells persisted for longer period in filtered - nonautoclaved water from well w1 ( 1.91 log10cfu / ml ) and well w2 ( 2.09 log10cfu / ml ) . \n competition for nutrients and/or thermolabile antimicrobial substances synthesized by \n ultramicrocells or by the autochthonous bacteria retained by the filter might affect the bacterial survival .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: eccrine porocarcinoma ( epc ) , first described by pinkus and mehregan in 1963 , is an uncommon sweat gland carcinoma and the malignant counterpart of eccrine poroma . \n although some large case series of epc have been published [ 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 ] , the biological behavior of this entity has not been fully elucidated . \n accurate diagnosis , optimal treatment , and prognosis of epc are still challenging due to the paucity of data concerning this condition . \n the aim of this study is to report the clinical and pathological features of epc and to contribute to the body of information currently available to dermatologists . \n between 2003 and 2013 , 8 patients were diagnosed with epc at the department of dermatology in the hachioji medical center of tokyo medical university . \n the clinical characteristics of the neoplasm , such as color , shape , and size , were evaluated and recorded by expert dermatologists . \n resected specimens were fixed with 10% buffered formalin , and paraffin - embedded histological sections were stained with hematoxylin - eosin ( he ) . \n in addition to the routine microscopic observation , the following histopathological prognostic factors described by robson et al . were evaluated in each specimen : ( 1 ) lymphovascular invasion ; ( 2 ) depth of invasion measured from the granular layer or ulcerated surface of the neoplasm to the deepest site of invasion ; ( 3 ) number of mitoses per 10 high - power fields ( hpf ) by 40 objective and 10 eye space , and ( 4 ) growth pattern of the neoplastic margin . moreover , immunohistochemical examinations using cam5.2 ( bd biosciences , san jose , calif . , \n usa ) , epithelial membrane antigen ( ema ; dakocytomation , glostrup , denmark ) , and carcinoembryonic antigen ( cea ; dakocytomation ) were performed . \n the preoperative clinical features of the 8 cases , 6 japanese males and 2 japanese females , are shown in table 1 . \n two of the lesions had developed on the head , and 1 each on the back , arm , forearm , buttock , thigh , and lower leg . \n the duration of the lesions ranged from 4 months to 5 years ( mean : 3.5 years ) . \n the mean size of the primary lesion was 39 mm ( range : 1870 mm ) . \n all cases presented reddish nodules displaying an erosive or ulcerated surface , while 5 cases displayed a pedunculated appearance ( fig . \n the results of the initial ct imaging demonstrated multiple metastatic lesions to the mediastinum lymph node , and distant metastases to the brain , liver , and lung in only 1 case with the primary lesion on the left arm . \n the histopathological and immunohistochemical features of the primary lesions are documented in table 2 . in all cases , the malignant neoplastic lesions extended from the epidermis to the dermis ( fig . \n 2a ) , and were composed of large , basaloid and atypical neoplastic cells with hyperchromatic nuclei and some mitotic figures ( fig . \n duct - like structures with eosinophilic cuticular borders were detected in all of the cases ( fig . \n previously described prognostic factors were evaluated as follows : vascular invasion was detected in 1 case deep within the lesion ( fig . \n the depth of invasion ranged from 0.7 to 20.0 mm ( mean : 8.2 mm ) . \n the number of mitoses per 10 hpf varied from 0.6 to 12.3 ( mean : 4.1 ) . \n the growth patterns of the neoplastic margin were classified into 2 groups : an infiltrative growth pattern was seen in 5 cases ( fig . \n 2d ) , while a pushing pattern was seen in 3 cases ( fig . \n immunohistochemical examinations revealed that ema was positive in all 8 cases , and cam5.2 was positive in 5 cases . \n cea , mostly stained in the duct - like structures , was positive in 6 cases . \n the details of the treatment and clinical course from the follow - up observation are summarized in table 1 . \n as adjuvant therapy , local radiation therapy was administered in 2 cases presenting a narrow vertical margin . \n chemotherapy consisting of 6 courses of docetaxel treatment plus 3 courses of docetaxel and cisplatin were administrated to the patient suffering from multiple metastases . \n the duration of the observation ranged from 1 month to 2 years ( mean : 10.9 months ) . during the follow - up period , \n 7 out of the 8 cases , including the patient who received 50 gy of radiation therapy , showed neither local recurrence nor metastasis . among them , the oldest case ( 98 years old ) died of heart failure 3 months after the resection . the case with multiple metastases \n was treated with 21 gy of radiation therapy and chemotherapy as described above , but nevertheless failed to show a clinical response ; the patient experienced local recurrence on the periphery of the skin graft ( fig . \n although the recurrent lesion was surgically resected again , the histopathology demonstrated intradermal proliferation of epc cells ( fig . \n 3b ) , and the patient succumbed to his condition 8 months after the resection . because the prognostic outcomes such as local recurrence , lymph node metastasis , and distant metastasis were seen in only 1 case , a statistical analysis of the patients prognosis and clinical or histopathological variables could not be performed . \n the preoperative clinical features of the 8 cases , 6 japanese males and 2 japanese females , are shown in table 1 . \n two of the lesions had developed on the head , and 1 each on the back , arm , forearm , buttock , thigh , and lower leg . \n the duration of the lesions ranged from 4 months to 5 years ( mean : 3.5 years ) . \n the mean size of the primary lesion was 39 mm ( range : 1870 mm ) . \n all cases presented reddish nodules displaying an erosive or ulcerated surface , while 5 cases displayed a pedunculated appearance ( fig . \n the results of the initial ct imaging demonstrated multiple metastatic lesions to the mediastinum lymph node , and distant metastases to the brain , liver , and lung in only 1 case with the primary lesion on the left arm . \n the histopathological and immunohistochemical features of the primary lesions are documented in table 2 . in all cases , the malignant neoplastic lesions extended from the epidermis to the dermis ( fig . \n 2a ) , and were composed of large , basaloid and atypical neoplastic cells with hyperchromatic nuclei and some mitotic figures ( fig . \n duct - like structures with eosinophilic cuticular borders were detected in all of the cases ( fig . \n previously described prognostic factors were evaluated as follows : vascular invasion was detected in 1 case deep within the lesion ( fig . \n the depth of invasion ranged from 0.7 to 20.0 mm ( mean : 8.2 mm ) . \n the number of mitoses per 10 hpf varied from 0.6 to 12.3 ( mean : 4.1 ) . \n the growth patterns of the neoplastic margin were classified into 2 groups : an infiltrative growth pattern was seen in 5 cases ( fig . \n 2d ) , while a pushing pattern was seen in 3 cases ( fig . \n immunohistochemical examinations revealed that ema was positive in all 8 cases , and cam5.2 was positive in 5 cases . \n cea , mostly stained in the duct - like structures , was positive in 6 cases . \n the details of the treatment and clinical course from the follow - up observation are summarized in table 1 . \n as adjuvant therapy , local radiation therapy was administered in 2 cases presenting a narrow vertical margin . \n chemotherapy consisting of 6 courses of docetaxel treatment plus 3 courses of docetaxel and cisplatin were administrated to the patient suffering from multiple metastases . \n the duration of the observation ranged from 1 month to 2 years ( mean : 10.9 months ) . during the follow - up period , 7 out of the 8 cases , including the patient who received 50 gy of radiation therapy , showed neither local recurrence nor metastasis . among them , the oldest case ( 98 years old ) died of heart failure 3 months after the resection . \n the case with multiple metastases was treated with 21 gy of radiation therapy and chemotherapy as described above , but nevertheless failed to show a clinical response ; the patient experienced local recurrence on the periphery of the skin graft ( fig . \n although the recurrent lesion was surgically resected again , the histopathology demonstrated intradermal proliferation of epc cells ( fig . \n 3b ) , and the patient succumbed to his condition 8 months after the resection . because the prognostic outcomes such as local recurrence , lymph node metastasis , and distant metastasis were seen in only 1 case , a statistical analysis of the patients prognosis and clinical or histopathological variables could not be performed . \n in previous publications , some authors described epc as a biologically aggressive neoplasm with a high rate of recurrence and metastasis . \n ( 69 epc cases ) reported that local recurrence , lymph node metastasis , and distant metastasis were confined to 17 , 20 , and 10% of the cases , respectively , and concluded that aggressive behavior may be the exception . \n similarly , other authors reported indolent biological behavior in epc [ 3 , 5 , 6 , 8 ] . in the present case series , only 1 out of the 8 cases ( 12.5% ) presented a number of unfavorable clinical events including local recurrence , lymph node metastases , distant metastases , and mortality , which appeared to be consistent with the above - mentioned reports . \n robson et al . also suggested the 4 histopathological findings as prognostic factors in epc patients . \n a depth of invasion greater than 7 mm or more than 14 mitoses per 10 hpf were associated with death or lymph node involvement . \n the infiltrative growth pattern was predictive of local recurrence . in the present case series , 1 aggressive case ( case 4 ) displayed 3 of these prognostic factors . \n the remaining cases also displayed the depth of invasion ( cases 3 , 6 , and 7 ) and infiltrating growth pattern ( case 1 , 6 , 7 , and 8) considered to be predictive of recurrence or metastasis , but nevertheless showed neither of these outcomes . \n these inconsistent prognostic results were also reported in a retrospective study by shiohara et al . , who observed that the number of mitoses and depth of invasion were not important prognostic factors . \n however , it should be noted that the present case series treated a small number of cases with a short period of follow - up observation , facts which might be responsible for the inconsistency of the prognostic results . \n in this paper , we reported 8 japanese cases of epc . only 1 case resulted in a local recurrence , lymph node metastases , distant metastases , and death . \n the prognosis of epc may not be as dismal as previously believed ; however , this entity occasionally shows aggressive behavior . in spite of the prognostic factors outlined in previous reports \n , an accurate prediction of the outcomes of epc still poses a challenge for the dermatologist .", "role": "user" }, { "content": "backgroundeccrine porocarcinoma ( epc ) , a slow - growing carcinoma of the sweat gland , is a rare condition documented only in a small number of case series . due to its rarity , \n guidelines and specific recommendations are not widely available . \n accordingly , many dermatologists encounter difficulty in diagnosing and treating epc . \n the aim of this study is to report the clinical and pathological features of epc in order to contribute to the body of information currently available on the subject.patients and methodsfrom 2003 to 2013 , 8 japanese patients were diagnosed with epc at the department of dermatology in the hachioji medical center of tokyo medical university . \n patient data , including clinical manifestations , histopathological findings , immunohistochemical results , treatment method , and clinical course were collected and documented.resultsthe mean age of the patients ( 6 males and 2 females ) was 72.6 years . \n the duration of the lesions ranged from 4 months to 5 years ( mean : 3.5 years ) . \n all of the lesions clinically presented with erosive reddish nodules ( mean size : 39.0 mm ) . \n initial ct imaging revealed that 1 case had multiple distant metastases . \n surgical resection was performed for all primary lesions and follow - up observations were available in all cases ( mean : 10.9 months ) . \n one case with distal metastases underwent both radiation therapy and chemotherapy , but nevertheless succumbed to the disease.conclusionthe epc cases in our department presented a versatile clinical appearance and characteristic histopathological features .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: dry eye symptoms are one of the leading reasons why patients seek eye care in the united states . the prevalence of aqueous - deficient disease is far exceeded by that of evaporative dry eye , the primary cause of which is meibomian gland dysfunction ( mgd ) , with mgd present in 86% of all dry eye patients of known cause [ 2 , 3 ] . \n first - line treatment of mgd usually includes some form of heat therapy , attempting to alleviate terminal duct obstruction by liquefaction of the gland contents . \n a primary challenge is that mgd alters the molecular composition of the meibum increasing the melting point relative to the normal body temperature . \n this increase results in the need for higher temperatures within the gland to liquefy obstructive material . \n previous in vitro and in vivo studies have demonstrated that although the temperatures required to melt the obstructive secretions are reported to range from 32 to 45c , the more severely obstructed glands present in mgd require temperatures > 40c for effective liquefaction . achieving this temperature within the meibomian glands \n one obstacle is that there is an approximate 5c difference in temperature between heat applied on the external eyelid surfaces and that which reaches the inner surface of the lids ( palpebral conjunctiva ) , where the meibomian glands are located . \n this difference is due to both dissipation of heat while passing through the lid tissues and to constant movement of blood through vasculature wicking heat away from the lids . \n therefore , achieving the desired temperature of 40c at the palpebral conjunctiva requires a constant heat of at least 45c be maintained on the outer lid surface , a temperature which may be both uncomfortable and risk causing thermal injury to the eyelid skin . \n a further conundrum is that while adequate heat is required to liquefy obstructions , the cornea is not designed to withstand temperatures much above body temperature . when subjected to heat > 40c , the corneal tissue becomes more malleable , and therefore more vulnerable to molding when exposed to any external pressure . \n further , the nature of the obstructive material , particularly when of longstanding , may require a higher temperature than 40c at the palpebral conjunctiva . \n herein , we describe a case of recalcitrant and symptomatic mgd , where lid warming was deemed necessary but had previously been ineffective , which prompted evaluation and comparison of four different commercially available heat therapies in regard to their effects on the inner surface temperatures of the eyelids . \n a 28-year - old woman , an optometrist , was self - referred for the evaluation of bilateral eye irritation . \n she reported symptoms characteristic of dry eye : stinging , foreign body sensation , and tearing . \n she also reported a decrease in the overall comfort of her contact lenses and decreased contact lens wear time . \n she was particularly concerned by a nightly burning sensation upon removal of her contact lenses . \n her score on the standard patient evaluation of eye dryness ( speed ) questionnaire was 11 points of a possible 28 points . \n she noted that her symptoms first occurred between 1 and 2 years prior to her visit and were increasing in severity . \n she had previously trialed warm compresses at home without success and was fearful that her dry eye symptoms would worsen and that she would lose the ability to continue wearing contact lenses . \n she reported no history of systemic disease and denied any current medications . on initial presentation , her eyes appeared white and quiet . \n fluorescein tear break - up time was 4 s for the right eye and 6 s for the left as measured by the dry eye test method . \n there was no corneal staining and no significant conjunctival staining detected following the instillation of two drops of sodium fluorescein , the second drop instilled 5 min after the first , followed by evaluation 1 min later . \n several meibum plugs , minimally protruding and obstructing the gland orifices , were observed on each lower lid . the total number of meibomian glands yielding liquid secretion , as evaluated with the meibomian gland evaluator ( tearscience , morrisville , nc , usa ) , was 4 for the right lower lid and 10 for the left lower lid . \n prior studies have shown that the application of external heat has limited benefits , and that not all methods are equally efficacious . \n we therefore questioned whether home therapies in general could achieve the temperature elevation necessary to provide benefit to this patient . \n as the patient was herself an optometrist and very interested in an evidence - based treatment plan , we elected to compare two commercial methods of home heat therapy for their ability to elevate the temperature at the meibomian glands under carefully controlled conditions , where the authors were present and personally attentive to all procedures . \n the two home therapies compared were the bruder mask ( bruder healthcare , alpharetta , ga , usa ) and blephasteam ( tha , clermont - ferrand , france ) . \n additionally , we elected to compare two office procedures for mgd , one with an externally applied heat source : miboflo ( mibo medical , dallas , tx , usa ) , and the second with heat applied to the inner surface of the eyelid : lipiflow ( tearscience , morrisville , nc , usa ) . \n the purpose of this testing was to evaluate the efficacy of the heat transfer from the device to the meibomian glands . as the meibomian glands are located adjacent to the inner surface of the eyelid , the temperature of the palpebral conjunctiva served as the primary endpoint in determination of which heat therapy offered the best possibility of successful treatment . \n temperature was measured immediately prior to and immediately after application of each therapy using a non - contact infrared thermometer ( innoo tech , shenzhen , china ) . \n the temperature of the palpebral conjunctiva was measured by manually everting the eyelid and then taking a reading as quickly as possible ( within 23 s ) to minimize heat loss . to facilitate measurements , only the right upper and lower eyelids \n each therapy was assessed at a different visit , with visits separated by a minimum of 4 h , to ensure that temperatures would have returned to basal levels and would not be influenced by prior treatments . \n the devices were tested in order of increasing complexity : bruder mask , blephasteam , miboflo , lipiflow . \n all therapies were performed following each manufacturer 's instructions precisely . at the first visit , \n the mask was heated in a microwave for 20 s and applied to the outer surface of the eyelids for a period of 10 min . \n prior to application , the surface temperature of the mask was variable , ranging from 38 to 48c , with the warmest areas closest to the center of the mask and the coolest at the outer edges . \n the patient 's eyes remained closed throughout the treatment . at the conclusion of the treatment period \n , palpebral conjunctival temperatures had increased from 36.7 to 38.3c and from 36.2 to 37.1c for the lower and upper eyelids , respectively . \n the temperature of the blephasteam itself is not known , but a prior report indicates that the temperature of the outer lid after the application can be as high as 42c . \n two inserts were moistened with saline solution and placed inside the mask prior to commencing the 10-min treatment . \n the patient 's eyes were open within the mask , allowing uninhibited blinking throughout the treatment . at the conclusion of the treatment period , palpebral conjunctival temperatures \n had increased from 37.0 to 39.2c and from 36.5 to 37.6c for the lower and upper eyelids , respectively . \n these results are consistent with previously published findings [ 11 , 12 ] . at the third visit , \n miboflo uses an external paddle that is heated to a temperature of 108f ( 42.2c ) . \n a small amount of ultrasound gel was applied to the instrument 's heated tip prior to gently massaging the outer skin of the upper and lower eyelids for a period of 12 min , as per the recommendation of the manufacturer . \n the patient 's eyes remained closed throughout the treatment period . at the conclusion of the treatment period , the palpebral conjunctival temperature of the lower eyelid was unchanged compared to pre - treatment measurement , remaining stable at 36.8c . \n the palpebral conjunctival temperature of the upper eyelid increased very minimally from 36.3 to 36.5c . upon review of the literature \n , no prior publications could be found describing the effects of miboflo on the temperature of the palpebral conjunctiva , and thus this case appears to be the first providing comparative data relating to the efficacy of heat transfer from the device to the inner surface of the eyelid . at the fourth visit , \n lipiflow is fundamentally different from the other heat therapies in that it combines heat with directional pressure [ 13 , 14 ] . \n the effects of this combined technology were not evaluated in this case , but rather only the efficacy of heat transfer to the palpebral conjunctiva . \n the patient 's eyes remained closed throughout the standard 12-min treatment . at the conclusion of the treatment period , palpebral conjunctival temperatures \n had increased from 37.0 to 42.0c and from 36.9 to 41.1c for the lower and upper eyelids , respectively . \n the average changes in palpebral conjunctival temperatures for each treatment option are represented in figure 1 . \n lipiflow was the only treatment that increased the temperature of the palpebral conjunctiva above 40c . \n since home therapies did not achieve this temperature , and whereas home treatment had not been effective in the past , the patient elected not to use any home therapy , although she was informed that there could be some additional benefit . at the progress evaluation 3 months later , the patient reported improved comfort with and without contact lenses , decreased foreign body sensation , decreased tearing , and a resolution of the burning sensation she had felt upon nightly removal of contact lenses . \n her score on the speed questionnaire at this visit was 4 points of a possible 28 points , an improvement compared to her score of 11 points at her initial evaluation . \n given that the anatomic position of the meibomian glands is adjacent to the palpebral conjunctiva , and therefore closer to the inner eyelid surface than the outer surface , it is reasonable to expect that application of heat to the inner eyelid surface would be more effective in increasing the temperature of the glands . \n thus , it is not surprising that lipiflow was the only therapy which elevated the temperature above the target value of 40c . \n the potential problem of heating the inner eyelid surface without raising the temperature of the cornea is achieved by the lipiflow activators in a unidirectional heating surface that simultaneously insulates the ocular surface [ 13 , 14 ] . \n as illustrated by this case , attempting to heat the inner surface of the eyelids with a heat source applied to the external lid surface has limited efficacy \n . there may be palliative effects seen from any of these forms of external lid surface heating , but these are likely secondary to factors other than liquefaction of the meibum and amelioration of the obstruction within the gland . while there is evidence to support that bruder mask and blephasteam are capable of elevating the temperature of the palpebral conjunctiva \n , there is no evidence that the miboflo is capable of doing so [ 11 , 12 ] . \n there may be some benefit from the use of the bruder mask or blephasteam , as both of these did raise the palpebral conjunctival temperature in this patient , although not to the desired therapeutic level of 40c [ 11 , 12 ] . \n these therapies should be considered as supplemental home therapy , which can be used daily for 1015 min , as supplements to office treatment to remove meibomian gland obstructions . \n an inherent limitation of all case reports is the evaluation of a single individual , but in this instance the patient 's interest and willingness to participate in these temperature comparisons has provided an unusually valuable opportunity . a limitation was that measurements of the palpebral conjunctiva required eversion of the target eyelid , which increases evaporation and thereby decreases temperature . \n ideally , the temperature of both the inner and outer eyelid surfaces would be measured continuously , so as to provide a more comprehensive evaluation of the heat transfer for each therapy . \n the safety and efficacy of lipiflow has also been studied extensively [ 13 , 14 ] . \n this case report validates these studies , but is novel in its same - subject comparison and inclusion and evaluation of miboflo . \n \n ", "role": "user" }, { "content": "the effects on the inner surface temperatures of the upper and lower eyelids of four commercial heat therapies were compared for an individual with recalcitrant meibomian gland dysfunction . \n three therapies ( bruder mask , blephasteam , and miboflo ) involved the application of heat to the external lid surface , and the fourth ( lipiflow ) applied heat to the internal lid surface . \n only lipiflow was effective in elevating the inner surface temperatures to the reported 40c therapeutic threshold for melting obstructed meibum .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: measles is a febrile disease that typically occurs in small children ; the incubation period is 1014 days , after which clinical symptoms such as fever , coughing , and a characteristic rash appears . \n since measles is accompanied by immunosuppression , it has a high frequency of complication with secondary bacterial infections , such as otitis media or pneumonia . \n although developed countries are eradicating measles by promoting effective vaccination , measles remains an important issue , especially in developing countries ( griffin , 2007 ) . \n measles virus ( mv ) , belonging to the genus morbillivirus of the family paramyxoviridae , is an enveloped virus with a non - segmented negative strand rna genome . \n the mv genome has six genes that encode the nucleocapsid ( n ) , phospho ( p ) , matrix ( m ) , fusion ( f ) , hemagglutinin ( h ) , and large ( l ) proteins ( figure 1a ) . \n mv contains two envelope glycoproteins : the h protein , which is responsible for receptor binding and is important for determining cell tropism of mv ; and the f protein , which mediates membrane fusion ( navaratnarajah et al . , 2009 ) . \n the p gene encodes the p protein and the non - structural v and c proteins . \n the v and c proteins are important for antagonizing the host interferon ( ifn ) response ( gerlier and valentin , 2009 ) . \n the p gene encodes the p protein and the non - structural v and c proteins . \n the v protein is translated from an edited rna with a non - templated g residue . \n the c protein is translated from an alternative open reading frame ( purple ) initiated by the second aug . \n pathogenic wild - type mv strains can be isolated by inoculating throat swabs from measles patients in b95a cells . \n signaling lymphocyte activation molecule ( slam , also called cd150 ) , expressed in certain immune system cells including activated b and t lymphocytes , mature dendritic cells , and macrophages , is a receptor for wild - type mv and vaccine and laboratory - adapted strains of mv ( tatsuo et al . , 2000 ) . \n cd46 ( also called membrane cofactor protein ) , expressed in all human and monkey nucleated cells , is a receptor for vaccine and laboratory - adapted strains of mv ( dorig et al . \n recently , nectin-4 [ also called poliovirus - receptor - like-4 ( pvrl4 ) ] has been identified as the epithelial receptor for wild - type mv ( muhlebach et al . , 2011 ; \n several animal models have been used for studying the pathogenesis of mv ( griffin , 2007 ) . \n cotton rats , rats , hamsters , mice , and ferrets can be infected with mv and are commonly used as small animal models for mv pathogenesis . \n after identification of cd46 and slam as mv receptors , numerous transgenic and knock - in mice expressing human cd46 and/or slam were established and intensively used to study different aspects of mv infection ( sellin and horvat , 2009 ) . \n however , non - human primates are the only animals that exhibit acute disease similar to that seen in humans . in this review , we discuss recent findings regarding tropism and pathogenesis of mv ; these findings were obtained by infecting monkeys with recombinant wild - type mv . \n this was reported as early as 1911 , after inoculating monkeys with blood from measles patients ( anderson and goldberger , 1911 ) . in 1921 \n , it was reported that measles could be transmitted from humans to monkeys by placing a filtered throat swab from a measles patient into the tracheae of monkeys ( blake and trask , 1921a ) . \n these authors also performed histological analysis of infected monkeys ( blake and trask , 1921b ) . \n mv was first isolated in 1954 from a specimen obtained from a measles patient ( enders and peebles , 1954 ) . \n enders and peebles ( 1954 ) inoculated human and monkey cell cultures with a throat swab taken from a young boy named david edmonston and isolated mv from these cultures . \n after this , it was discovered that mv isolated from normal human renal cells caused clinical signs similar to those of human measles in monkeys ( peebles et al . , 1957 ) . since then , numerous studies have been carried out by infecting monkeys with mv , measles vaccines , or specimens from measles patients ( griffin , 2007 ) . in such experiments , two species of monkeys , \n cynomolgus monkey ( macaca fascicularis ) and rhesus monkey ( macaca mulatta ) , serve as good animal models . \n new world monkeys are more susceptible to mv than old world monkeys , and infection of marmoset ( saguinus mystax ) with mv results in a fulminant disease ( levy and mirkovic , 1971 ; albrecht et al . , 1980 ) . \n in the past , it was well known that infection of monkeys with materials from measles patients induced clinical signs similar to those of human measles ( nii et al . , 1964 ; yamanouchi et al . , 1970 \n however , curiously enough , infection of monkeys with mv isolated and propagated in cultured cells did not always induce these clinical signs ( enders et al . \n this riddle was solved by the introduction of b95a cells ( a marmoset b - lymphoid cell line ) for isolation and propagation of mv ( kobune et al . , \n ( 1990 , 1996 ) found that mv strains could be efficiently isolated in b95a cells using materials from measles patients . \n more importantly , mv strains isolated from b95a cells retained their original pathogenicity in monkeys . \n these studies indicated that vaccine and laboratory - adapted strains of mv previously isolated from non - lymphoid cells such as vero cells were not true mv ( figure 1b ) . \n a decade later , it was found that the mv receptor slam is highly expressed on b95a cells ( tatsuo et al . , 2000 ) , which accounts for the efficient isolation of pathogenic mv from patient samples . \n similar to mv strains isolated from b95a cells , mv strains isolated and propagated in monkey mononuclear cells , human cord blood cells , human b lymphoblastoid cell lines , and vero cells expressing slam replicated well in monkeys and induced clinical signs of measles ( van binnendijk et al . , 1994 ; mcchesney et al . \n these results suggest that expression of slam on cells used for isolation is important for isolation of pathogenic mv . \n reverse genetics refers to the methods used for recovering infectious viruses from the cdna that encodes the viral genome . by using this method , mutations or extra transcription units \n reverse genetics of mv was first established based on the edmonston vaccine strain ( radecke et al . , 1995 ) . \n however , as previously mentioned , viruses derived from the edmonston vaccine strain do not induce clinical symptoms of measles in monkeys . \n therefore , reverse genetics of pathogenic wild - type mv was needed for the study of mv pathogenesis in monkeys . to this end , we first determined the complete nucleotide sequence of the genome of the pathogenic wild - type ic - b strain ( nc_001498/ab016162 ; takeuchi et al . , 2000 ) , which was isolated in tokyo in 1984 by using b95a cells ( kobune et al . , 1990 ) . \n then , we constructed a complete cdna plasmid of the ic - b strain named p(+)mv323 , and successfully recovered infectious mv ( ic323 strain ) from the p(+)mv323 plasmid ( takeda et al . , 2000 ) . \n importantly , the ic323 strain induced clinical signs such as rash , koplik s spots , and lymphopenia similar to human measles in infected monkeys , indicating that the ic323 strain retains the original pathogenicity of the ic - b strain . \n now , infectious mv strains can be easily recovered from cdna plasmids by using an improved protocol ( takeda et al . , 2005 ) . \n reverse genetics of other wild - type mv strains has been reported for the hl strain isolated in japan ( terao - muro et al . , 2008 ) and the ks strain isolated in sudan ( lemon et al . , 2011 ) . for vaccine strains of mv , reverse genetics for the schwarz / moraten vaccine strain ( combredet et al \n , 2003 ; del valle et al . , 2007 ) and the aik - c vaccine strain ( nakayama et al . , 2001 ) have also been reported . \n reverse genetics for vaccine strains are being used as a platform to generate new multivalent vaccines expressing antigens of other pathogens ( billeter et al . , 2009 ) and oncolytic viruses for cancer therapy ( russell and peng , 2009 ) . \n the p gene of mv encodes two non - structural proteins , namely the c and v proteins . \n however , the function of the c and v proteins in vivo was not well understood . \n the c protein is a small ( 186 amino acid ) , highly positively charged protein . to study the function of the c protein in the context of the natural course of mv pathogenesis \n , we generated an ic323 strain deficient in the expression of the c protein , wtmv(c ) , by using the reverse genetics of wild - type mv ( takeuchi et al . \n notably , the growth of wtmv(c ) in cynomolgus monkeys was dramatically reduced when compared to the ic323 strain . \n a similar growth defect of the ic323 strain deficient in the expression of the c protein , c , in vivo was observed in rhesus monkeys ( devaux et al . , 2008 ) . \n interestingly , c induced more inflammatory cytokines such as tumor necrosis factor alpha ( tnf)- and interleukin ( il)-6 and interferon ( ifn)- and - in infected monkeys . the v protein is translated from an edited mrna of the p gene ( griffin , 2007 ) . \n thus , the amino - terminal domain of the v protein has the same amino acid sequence as the p protein , and the carboxyl - terminal domain of the v protein has a highly conserved amino acid sequence forming a zinc - binding domain , which is important for function as an interferon antagonist ( gerlier and valentin , 2009 ) . an ic323 strain deficient in the expression of the v protein , v , \n was generated by introducing nucleotide mutations in the rna - editing signal in the p gene ( devaux et al . , 2008 ) . \n the growth of v in infected rhesus monkeys was lower than that of the parental ic323 strain . \n v induced more inflammatory cytokines ( tnf- and il-6 ) and ifn- and -. an ic323 strain unable to antagonize stat1 function , stat1-blind virus , was generated by introducing three amino acid substitutions in the shared domain of the p and v proteins ( devaux et al . , 2011 ) . \n the stat1-blind virus induced short - lived viremia and no clinical signs in infected rhesus monkeys . \n this virus induced more inflammatory cytokines ( tnf- and il-6 ) and a th1/th2 balance cytokine ( il-12 ) in infected monkeys . taken together , these findings indicate that the c and v proteins are not non - essential gene products as previously thought , but are stringently required for antagonizing host innate immune and inflammatory responses in vivo . in contrast , in vitro studies indicated that the v protein blocks ifn-/ signal transductions in infected cells , inhibits tlr7-mediated ifn- production in human plasmacytoid dendritic cells , and inhibits ifn induction in infected cells by interacting with mda5 ( gerlier and valentin , 2009 ) . \n furthermore , the c protein appears to inhibit ifn induction in infected cells by regulating viral rna synthesis ( nakatsu et al . , \n thus , it is necessary to elucidate whether the in vivo phenotypes of c- and v - deficient viruses are similar to the in vitro phenotypes . \n recent advances in the study of virus tropism have included the introduction of enhanced green fluorescent protein ( egfp)-expressing viruses . in vivo tropism of morbillivirus \n can be visualized with high sensitivity in living animals as well as tissue samples by using egfp - expressing recombinant canine distemper viruses ( von messling et al . , 2004 ) . \n similarly , mv target tissues or organs can be visualized with high sensitivity by infecting cynomolgus monkeys with an egfp - expressing ic323 strain ( figure 2 ) . \n ( 2007 ) infected rhesus and cynomolgus monkeys with an ic323 strain expressing egfp ( hashimoto et al . , 2002 ) and examined the tropism of wild - type mv in vivo . \n they indicated that the major target cells of wild - type mv were b and t lymphocytes and cd11c - positive , major histocompatibility complex ( mhc ) class - ii - positive dendritic cells . \n this result is consistent with the fact that slam is a receptor for wild - type mv . \n infection of ciliated epithelial cells in the trachea and lungs was also detected , suggesting the presence of another receptor for mv in epithelial cells . \n schematic diagram of reverse genetics of wild - type mv expressing egfp and infection of monkeys . \n a plasmid carrying the full - genome cdna of the ic - b strain and the egfp gene under the control of the t7 promoter is introduced into cho cells expressing human slam ( cho / hslam ) , along with three supporting plasmids expressing n , p , and l proteins , respectively , under the control of the t7 promoter . \n after infection with vaccinia virus expressing the t7 rna polymerase , wild - type mv expressing egfp can be recovered by mixing with b95a cells . \n egfp fluorescence in tissues and organs of infected monkeys can be detected using a fluorescence microscope . \n regarding the early target cells of wild - type mv , classical textbooks describe that the primary targets of mv are the epithelial cells of the respiratory tract . \n however , slam is not expressed in these epithelial cells . to examine the early target cells of wild - type and vaccine strains of mv in the lung , de vries et al . \n ( 2010 ) infected cynomolgus monkeys with egfp - expressing ic323 or vaccine strains of mv via the intratracheal or aerosol route . \n they found that cd11c - positive cells , which include alveolar macrophages and dendritic cells , were the major targets of both viruses . \n interestingly , although viral replication and cellular tropism in the lungs were similar for the two viruses , only wild - type mv caused significant viremia , suggesting a growth defect of the vaccine strain in lymphocyte cells . \n similarly , to examine the early target cells of wild - type mv , lemon et al . \n ( 2011 ) infected cynomolgus monkeys with an egfp - expressing wild - type mv based on the ks strain by aerosol infection and found that the early target cells of wild - type mv in monkeys are macrophages and dendritic cells . \n these studies indicated that alveolar macrophages and dendritic cells but not the epithelial cells of the respiratory tract are the early target cells of wild - type mv . \n nectin-4 is a newly identified epithelial cell receptor ( epr ) for mv . to examine the effect of nectin-4-using activity of mv on disease outcomes in monkeys , an ic323 strain recognizing slam but not nectin-4 was generated by introducing amino acid mutations in the h protein ( leonard et al . , 2008 ) . \n at that time , nectin-4 had not been identified as a mv receptor , and this strain was called epr - blind virus . when rhesus monkeys were infected with epr - blind virus via the conjunctiva and nares , this virus induced viremia and clinical signs in infected monkeys but did not propagate in the lungs . \n this result indicates the importance of nectin-4 for the propagation of mv in the lungs , which is required for the subsequent exit of mv from the host . \n inversely , to examine the impact of the recognition of slam by mv , an ic323 strain recognizing nectin-4 but not slam , slam - blind , was generated ( leonard et al . , 2010 ) . \n when rhesus monkeys were infected with the slam - blind virus , it elicited no clinical symptoms . \n vaccine and laboratory - adapted strains of mv can utilize both cd46 and slam as cellular receptors . \n however , surprisingly , the impact of the cd46-using activity of vaccine and laboratory - adapted strains of mv on their tissue and organ tropism and attenuation is not well understood . \n as cd46 is ubiquitously expressed on all nucleated human and monkey cells , vaccine , and laboratory - adapted strains of mv may infect all tissues and organs of humans and monkeys . \n ( 2010 ) indicated that only cd11c - positive cells were infected with the egfp - expressing vaccine strain via the aerosol route , suggesting that vaccine strains do not use cd46 in vivo . \n however , when the replication of vaccine and laboratory - adapted strains of mv in monkeys is limited , it will be difficult to identify infected cells in tissues . \n furthermore , the infection of vaccine and laboratory - adapted strains of mv may be restricted because of mutations in the p / c / v genes , which are important for antagonizing the host ifn response ( gerlier and valentin , 2009 ) . \n therefore , the tropism shift that solely occurs via the h protein should be evaluated using the wild - type mv expressing egfp , which bears the h protein of a vaccine strain , such as the ic / edh strain we developed previously ( takeuchi et al . , 2002 ) . \n we recently infected cynomolgus monkeys with egfp - expressing wild - type or ic / edh strains and found that slam - expressing lymphocytes were the main targets of both strains , indicating that cd46 does not act as a receptor for vaccine and laboratory - adapted strains of mv in vivo ( figure 3 ; takeuchi et al . , 2012 ) . \n one possible explanation for the limited expansion of the egfp - expressing ic / edh strain in vivo is the activation status of lymphocytes . \n it is known that stimulated lymphocytes are efficiently infected with mv and that stimulated lymphocytes express slam ( tatsuo et al . , 2000 ) . \n the egfp - expressing ic / edh strain that entered into quiescent lymphocytes via the cd46 may not grow well in those cells . \n alternatively , the expression level of cd46 in vivo may be too low to allow mv dissemination by cell cell fusion , as it was reported that high cd46 density is required for mv - induced cell \n cell fusion ( anderson et al . , 2004 ) . for whatever the reason , the growth of the egfp - expressing ic / edh strain was less efficient than that of the egfp - expressing wild - type strain ( takeuchi et al . , 2012 ) , suggesting that the cd46-recognition ability of vaccine and laboratory - adapted mv strains plays a role in the mv attenuation . \n receptor usage of the wild - type and vaccine and laboratory - adapted strains of mv . \n as described in this review , our ic323 strain , recovered from a plasmid carrying the full - genome cdna of the ic - b strain , is now used as a standard wild - type mv strain in mv research . \n furthermore , egfp - expressing ic323 strains are ideal tools for the study of tissue and organ tropism of wild - type mv in vivo . \n although the use of monkeys has several limitations , monkey models still provide the only reliable animal model for the study of the pathogenesis of mv in humans . \n the combination of wild - type and vaccine mv strains generated by reverse genetics and monkey models will provide new insights into the relationship between viral gene functions or individual mutation(s ) and the pathogenesis of mv . \n the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .", "role": "user" }, { "content": "measles virus ( mv ) is an enveloped negative strand rna virus belonging to the family of paramyxoviridae , genus morbillivirus , and causes one of the most contagious diseases in humans . \n experimentally infected non - human primates are used as animal models for studies of the pathogenesis of human measles . \n we established a reverse genetics system based on a highly pathogenic wild - type mv . \n infection of monkeys with recombinant mv strains generated by reverse genetics enabled analysis of the molecular basis of mv pathogenesis . \n the essential in vivo function of accessory genes was indicated by infecting monkeys with recombinant mv strains deficient in the expression of accessory genes . furthermore , recombinant wild - type mv strains expressing enhanced green fluorescent protein enabled visual tracking of mv - infected cells in vitro and in vivo . to date , three different molecules have been identified as receptors for mv . \n signaling lymphocyte activation molecule ( slam , also called cd150 ) , expressed on immune cells , is a major receptor for mv . \n cd46 , ubiquitously expressed in all nucleated cells in humans and monkeys , is a receptor for vaccine and laboratory - adapted strains of mv . \n the newly identified nectin-4 ( also called poliovirus - receptor - like-4 ) is an epithelial cell receptor for mv . \n however , recent findings have indicated that cd46 acts as an mv receptor in vitro but not in vivo . \n the impact of the receptor usage of mv in vivo on the disease outcome is now under investigation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: rheumatoid arthritis ( ra ) is a chronic disease characterized by articular erosions , periarticular bone loss , and chronic inflammation leading to increased risk of osteoporosis . \n systemic bone loss associated with ra is multifactorial : glucocorticoids , decrease of physical activity , and the disease itself , particularly when uncontrolled . bone loss , whether periarticular or systemic , shares , at least partially , similar mechanisms . from the very early stages of ra , bone loss in ra \n joint erosions measured with larsen 's score are correlated with bone mineral density ( bmd ) and vertebral deformities [ 15 ] . \n relevant literature on bone remodelling markers in ra patients and the effect of biologic agents on bone remodelling were identified using pubmed database with bone remodelling markers , biologic agents , and rheumatoid arthritis as key words . \n among mechanisms involved in bone loss , proinflammatory cytokines play a major role in explaining hyper - osteoclastosis . \n the nuclear factor - kappa b ( nfkappab ) signaling pathway regulates the expression of hundreds of genes which are involved in diverse processes like inflammation . \n receptor activator of nfkappab ligand ( rankl ) is a membrane protein secreted by osteoblasts that binds to the rank receptor on osteoclast precursors and provokes maturation of osteoclast cells ( figure 1 ) . \n its natural decoy receptor osteoprotegerin ( opg ) produced by osteoblasts and stromal cells binds to and confines rankl and prevents differentiation of osteoclasts [ 7 , 8 ] . \n various proinflammatory cytokines regulate expression of rankl including tumor necrosis factor ( tnf ) and interleukin-1 ( il-1 ) [ 912 ] . \n rankl values can predict the therapeutic response to anti - tnf therapy in ra patients , which is not the case for opg , whereas opg expression is increased in synovium of anti - tnf treated patients : with both infliximab and etanercept . in contrast \n , rankl is not influenced by the treatment , showing that the ratio rankl / opg is of major importance in regulating bone resorption rather than each of the markers taken alone . \n then , it is not surprising that deleterious effects of rankl on bmd can be prevented by denosumab which is an anti - rankl monoclonal antibody , increasing bmd and reducing bone turnover in ra patients . \n bone formation is also decreased during inflammation as shown in mice . when dkk-1 , a protein that is a member of the dickkopf family , is increased by tnfalpha , \n it exerts its negative regulation on wnt pathway , blocking osteoblast differentiation and inducing expression of sclerostin ( scl ) , leading to the death of osteocytes . \n higher levels of dkk-1 are associated with an increased risk of articular erosions independent of age , baseline radiologic features , c - reactive protein ( crp ) , or disease activity . \n interleukin-6 ( il-6 ) directly induces the production of rankl by synoviocytes in ra patients through the pathway of janus kinase / stat , phosphorylation of stat3 and erk1/2 [ 19 , 20 ] . \n bone matrix is mainly composed of type i collagen and type i collagen telopeptide fragments : i - ctx and ictp can be measured in both serum and urine . \n they are very sensitive and specific markers of bone degradation [ 21 , 22 ] . \n these two telopeptides are released from type i bone collagen by two different enzymatic systems : ( 1 ) ictp , which is derived from matrix metalloprotease activity ( mmp ) and is very effective in bone erosions associated with ra , and ( 2 ) i - ctx , produced by cathepsin k which on the contrary is involved in systemic bone resorption . in ra the ratio of synovial fluid to serum fluid is increased for ictp but not for i - ctx . \n this suggests that ictp is a sensitive marker of periarticular bone resorption linked to mmps activity of various cells like synoviocytes . \n ii - ctx is not a bone remodeling marker but a marker of cartilage degradation , even if the two phenomena are closely related in ra . \n this is illustrated by the cobra study where high levels of i - ctx and ii - ctx measured early in ra predicted an increased risk of further articular damage . \n randomized clinical trials have clearly demonstrated that biological agents are able to prevent partial or even total articular erosions in ra patients . \n this raises the question of their ability to prevent as well the generalized bone loss associated with inflammation encountered in ra patients . \n this preventive effect might be demonstrated by variation of bone remodeling markers or bone mineral density ( bmd ) during the course of treatment . in ra patients , \n bone formation rather than resorption markers better showed the bone response to anti - tnfalpha . \n an open cohort study of 102 ra patients treated during one year with infliximab showed both the variations of bone loss at lumbar spine , hip , and hands and the variation of bone remodeling induced by the anti - tnfalpha . \n when bmd at lumbar spine and hip did not vary , it did incur a significant decrease of 0.8% at the hand ( p = 0.01 ) , giving evidence that metacarpal cortical bone loss is continuing . in ra treated patients with good eular response , variation of bmd was favorable compared to other patients . \n serum ctx and rankl hugely decreased in comparison with baseline values at the same time as the decrease of das score and crp . \n another multicentric and prospective cohort study included 48 women with an average age of 54.2 years ( 2.1 sd ) suffering from severe ra for 10 years ( 11.4 7.8 sd ) who initiated infliximab treatment after the failure of one nonbiologic agent ( dmard ) . \n bmd was not modified during the year of the study but serum i - ctx rapidly and significantly decreased by 30% at the 22nd week before going back to the baseline values . \n inversely , pinp values remained stable with a p1np / ctx ratio in favor of bone formation . \n the ii - ctx , witnessing the cartilage degradation , was not modified in the study group but slightly decreased in patients with values above normal before the biologic agent . in the \n best study , four different therapeutic strategies have been evaluated in 218 early ra patients : ( 1 ) sequential monotherapy , ( 2 ) combined treatment \n step up , ( 3 ) combined treatment with glucocorticoids , and ( 4 ) treatment with infliximab . \n bmd was measured at lumbar spine , hip , and hands ( from 2nd to 4th metacarpal ) after 1 and 2 years . \n after 2 years for all treated groups there was a bone loss at each of these regions . it should be noted though that there was less bone loss in hands for groups treated with either prednisone or infliximab . \n progression of erosions was correlated with the decrease of bmd at both hand and hip regions . \n a search in pubmed database to identify studies analyzing the effects of anti - tnfalpha treatments on bmd and bone remodeling markers in ra patients has been able to identify four studies [ 2932 ] in which bmd was either stabilized or increased at lumbar spine ( up to 2.8% ) or at hip ( up to 13.1% ) . \n variations of bone remodeling markers were heterogeneous but showed a slight decrease of resorption and an increase of bone formation . in vitro \n , il-6 blockade reduces osteoclastic differentiation and bone resorption in monocytes cultures stimulated by rankl or rankl plus tnfalpha . in transgenic mice , formation of osteoclasts is also strongly inhibited by the anti - inflammatory effects of il-6 blockade . \n a pilot study compared 22 healthy nonosteopenic control women with 22 women suffering from active ra treated by perfusions of 8 mg / kg tocilizumab ( tcz ) . at baseline , the opg / rankl ratio was 5 times lower in ra patients than in controls . \n higher levels of dkk-1 , sclerostin , serum betactx , and osteocalcin were seen related to a hyper remodeling status and slowing down of bone formation in ra patients . in serum , \n thanks to tcz , opg / rankl increase was particularly significant in 10 patients who were in remission or in a low activity state in contrast with other 12 patients with still active ra . on the other hand , variations of dkk-1 and sclerostin were similar in both groups . \n thus , inflammation suppression by anti - il-6 rapidly corrects bone homeostasis troubles due to ra . \n they were 416 of 623 patients suffering from moderate suffering from moderate to severe ra who were selected because of an inadequate response to methotrexate . \n methotrexate administration alone was compared to the administration of an association of methotrexate and tcz ( 4 mg to 8 mg / kg every 4 weeks ) . \n tcz reduced in a dose - dependent way the levels of procollagen type ii n - terminal propeptide ( piinp ) , collagen helical peptide ( helix - ii ) , and matrix metalloproteinase-3 ( mmp-3 ) after 4 , 16 , and 24 weeks . among bone formation markers , only serum aminoterminal propeptide of type i collagen ( pinp ) significantly increased in comparison with placebo , when 1-ctx and ictp , markers of bone resorption , decreased . \n tcz increases bone formation by increasing the expression of opg when nonbiological agents have no effect . \n this is shown in a study of bone biopsies from subjects undergoing a prosthesis replacement of the knee . \n finally , tcz also decreases the levels of dickkopf and normalizes the ratio opg / rankl . in radiate study tcz \n decreased c - reactive protein levels and significantly inhibited cathepsin k - mediated bone resorption , as measured by a decrease in ctx - i with a significant decrease in the ctx - i / oc ratio . \n furthermore , the samurai study showed that tocilizumab monotherapy is more effective at one year in reducing radiological progression in patients presenting with risk factors for rapid progression than in low - risk patients according to four independent predictive markers for progressive joint damage ( urinary c - terminal crosslinking telopeptide ( uctx - ii ) , urinary pyridinoline / deoxypyridinoline ( upyd / dpd ) ratio , body mass index ( bmi ) , and joint - space narrowing ( jsn ) score at baseline ) . \n b lymphocyte depletion obtained by using rituximab results in a decrease of resorption bone markers and inhibition of ra induced osteoclastosis ; this effect is obtained by a reduction of the number of osteoclast precursors in synovium and thus increases the ratio opg / rankl in serum and as such could protect bmd . in a prospective study with a follow - up of 315 months after rituximab therapy \n there was no significant change of the bone formation markers ( bap ) and ictp . however , a nonsignificant tendency of decrease of rankl ( with no change of opg ) and a significant decrease of the bone degradation marker deoxypyridinoline crosslinked collagen i were observed . \n ctla4-ig inhibits linking of ctla-4 with the monocyte surface receptor cd80/cd86 and could downregulate differentiation and maturation of osteoclasts acting directly on genes [ 44 , 45 ] . \n ctla-4 dose - dependently inhibits rankl- as well as tumour necrosis factor- ( tnf- ) mediated osteoclastogenesis in vitro without the presence of t cells . \n furthermore , in mice , abatacept protects against bone loss induced by pth giving an explanation to the protective effect of abatacept in ra . \n bone loss in ra is well documented and is a frequent comorbidity needing diagnosis and prevention . \n bone remodeling markers are surrogates to evaluate bone formation , resorption , and further risk of fractures . \n so far , there is no consensus about their role in helping physicians in a clinical point of view . \n in addition to specific antiosteoporotic agents , when needed , biologic agents add their own nonspecific effect to protect ra patients against bone loss and osteoporotic fractures by reducing inflammatory - linked bone loss .", "role": "user" }, { "content": "bone loss in rheumatoid arthritis ( ra ) patients results from chronic inflammation and can lead to osteoporosis and fractures . \n a few bone remodeling markers have been studied in ra witnessing bone formation ( osteocalcin ) , serum aminoterminal propeptide of type i collagen ( pinp ) , serum carboxyterminal propeptide of type i collagen ( ictp ) , bone alkaline phosphatase ( bap ) , osteocalcin ( oc ) , and bone resorption : c - terminal telopeptide of type 1 collagen ( i - ctx ) , n - terminal telopeptide of type 1 collagen ( i - ntx ) , pyridinolines ( dpd and pyd ) , and tartrate - resistant acid phosphatase ( trap ) . \n bone resorption can be seen either in periarticular bone ( demineralization and erosion ) or in the total skeleton ( osteoporosis ) . \n whatever the location , bone resorption results from activation of osteoclasts when the ratio between osteoprotegerin and receptor activator of nuclear factor kappa - b ligand ( opg / rankl ) is decreased under influence of various proinflammatory cytokines . \n bone remodeling markers also allow physicians to evaluate the effect of drugs used in ra like biologic agents , which reduce inflammation and exert a protecting effect on bone . \n we will discuss in this review changes in bone markers remodeling in patients with ra treated with biologics .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in sickle cell disease , a single amino - acid substitution causes sickling of deoxygenated red blood cells ( rbcs ) and the development of microvascular occlusions . \n renal manifestations include hyposthenuria , incomplete renal tubular acidosis , impaired potassium secretion , haematuria and proteinuria . \n this report describes a woman with sickle cell disease who had iga nephropathy and a year later developed rapidly progressing renal failure . \n a 19-year - old female , originally from guinea , had sickle cell disease with numerous vaso - occlusive crises , and she presented with bilateral leg swelling and periorbital puffiness . \n a renal biopsy showed diffuse mesangial proliferative and crescentic glomerulonephritis ( gn ) due to iga nephropathy . \n creatinine fell to 138 mol / l . a year later , it increased to 485 mol / l . \n creatinine was 828 mol / l , ldl 2.3 mmol / l , white blood cell count 4.7 10/l , haemoglobin 104 \n ( a ) glomerulus with segmental capillary loop and arteriolar thrombosis ( long arrow ) , globally sclerosed glomeruli ( short arrows ) and renal interstitial fibrosis , masson trichrome , 200 . \n ( b ) higher power of glomerulus in ( a ) with capillary loop thrombi , pams , 400 . \n ( c ) high power of glomerulus in ( a ) with capillary loop thrombi , fibrinoid injury and mesangiolysis , h & e , 600 . \n ( d ) glomerulus with mesangial cell proliferation and circumferential cellular crescent , pas , 400 . there were up to 18 glomeruli , 9 globally sclerosed , 5 segmentally sclerosed , 3 with thrombotic and fibrinoid injury , and 3 cellular crescents . \n tubular epithelium showed focal cytoplasmic vacuolation , sloughing of cells and prominent hyaline droplet change . \n up to three arterioles showed fibrinoid necrosis , some with associated thrombosis , particularly at glomerular vascular poles . \n there was non - specific staining of glomerular epithelial cell cytoplasmic granules for iga , but no mesangial or capillary wall iga . \n glomerular capillary walls were markedly thickened with subendothelial widening , focal subendothelial fibrin deposition , prominent mesangial cell interposition and reduplication of the glomerular basement membrane ( gbm ) . \n features were of acute microvascular injury with arteriolar fibrinoid necrosis , arteriolar and glomerular thrombotic microangiopathy ( tma ) , and active glomerular crescentic injury , superimposed upon a chronic membranoproliferative - like pattern of glomerular injury , suggestive of chronic tma . \n there were severe chronic irreversible global and focal segmental glomerulosclerosis ( fsgs ) and patchy moderate - to - severe chronic tubulointerstitial damage . \n a 19-year - old female , originally from guinea , had sickle cell disease with numerous vaso - occlusive crises , and she presented with bilateral leg swelling and periorbital puffiness . \n a renal biopsy showed diffuse mesangial proliferative and crescentic glomerulonephritis ( gn ) due to iga nephropathy . \n creatinine fell to 138 mol / l . a year later , it increased to 485 mol / l . \n creatinine was 828 mol / l , ldl 2.3 mmol / l , white blood cell count 4.7 10/l , haemoglobin 104 \n ( a ) glomerulus with segmental capillary loop and arteriolar thrombosis ( long arrow ) , globally sclerosed glomeruli ( short arrows ) and renal interstitial fibrosis , masson trichrome , 200 . \n ( b ) higher power of glomerulus in ( a ) with capillary loop thrombi , pams , 400 . \n ( c ) high power of glomerulus in ( a ) with capillary loop thrombi , fibrinoid injury and mesangiolysis , h & e , 600 . \n ( d ) glomerulus with mesangial cell proliferation and circumferential cellular crescent , pas , 400 . there were up to 18 glomeruli , 9 globally sclerosed , 5 segmentally sclerosed , 3 with thrombotic and fibrinoid injury , and 3 cellular crescents . \n tubular epithelium showed focal cytoplasmic vacuolation , sloughing of cells and prominent hyaline droplet change . \n up to three arterioles showed fibrinoid necrosis , some with associated thrombosis , particularly at glomerular vascular poles . \n there was non - specific staining of glomerular epithelial cell cytoplasmic granules for iga , but no mesangial or capillary wall iga . \n glomerular capillary walls were markedly thickened with subendothelial widening , focal subendothelial fibrin deposition , prominent mesangial cell interposition and reduplication of the glomerular basement membrane ( gbm ) . \n features were of acute microvascular injury with arteriolar fibrinoid necrosis , arteriolar and glomerular thrombotic microangiopathy ( tma ) , and active glomerular crescentic injury , superimposed upon a chronic membranoproliferative - like pattern of glomerular injury , suggestive of chronic tma . \n there were severe chronic irreversible global and focal segmental glomerulosclerosis ( fsgs ) and patchy moderate - to - severe chronic tubulointerstitial damage . \n pathologic findings include papillary necrosis , glomerular hypertrophy and perihilar fsgs , immune complex - mediated membranoproliferative gn ( mpgn ) and an mpgn - like pattern of injury with gbm reduplications but without immune deposits . \n the hypoxic , acidotic and hyperosmolar environment of the inner medulla promotes red cell sickling in the medullary vasa recta , with resultant impairment in blood flow , microthrombi formation , ischaemic microinfarcts and progressive renal medullary injury with papillary necrosis . \n tma encompasses non - inflammatory small vessel vasculopathies associated with endothelial or medial myocyte injury and microvascular platelet thrombosis . \n commonly recognized causes of renal tma include haemolytic uraemic syndrome ( hus ) , thrombotic thrombocytopaenic purpura ( ttp ) , antiphospholipid antibody syndrome , scleroderma , malignant hypertension , disseminated intravascular coagulation , pregnancy- , radiation- and transplant - associated tma . \n iga nephropathy from the first renal biopsy was not corroborated in the second biopsy ; renal tma has been rarely associated with iga nephropathy . \n acute tma is not a commonly recognized complication of sickle cell disease , with renal vascular congestion by sickled erythrocytes not typically associated with fibrin thrombi . \n pathological features in our case suggest an acute tma superimposed upon chronic mpgn - like glomerular changes . the mpgn - like glomerular lesion observed in sickle cell disease \n may be produced by continuous mesangial cell phagocytosis of fragmented red cell masses in glomerular capillaries , with associated remodelling of the gbm and mesangial cell interposition . \n similar ultrastructural changes are observed in rats with intravascular fibrin formation and in human renal biopsies with healing hus . \n the mpgn - like chronic glomerular lesion of sickle cell disease could be regarded as a chronic tma - related lesion . \n a possible link between sickle cell disease and renal tma is the presence of circulating microparticles , derived from budding cell membranes of endothelium or circulating blood cells . \n ttp , characterized by failure to cleave highly pro - thrombotic multimers of von willebrand factor , is associated with elevated levels of platelet and endothelial - derived microparticles . \n microparticles detected in the circulation of patients with sickle cell disease were found to appear during chronic phases and in crises . in the chronic phase , there is haemolysis and the activation of coagulant pathways , resulting in low - grade thrombin generation , depletion of anticoagulants and activation of leucocytes and platelets . \n these pro - coagulant and pro - inflammatory processes are associated with endothelial cell damage and microparticles derived from endothelial cells , platelets and monocytes . during sickle crises , endothelial damage and coagulation activity increases dramatically , accompanied by a rise in circulating microparticles of platelet , endothelial , rbc and monocyte origin . in conclusion , \n a young female with sickle cell disease , treated for biopsy - proven iga nephropathy with the resolution of creatinine , a year later presented with acute renal failure . \n we suggest that circulating microparticles could be a pathophysiological link between sickle cell disease and the development of renal tma . \n this case emphasizes the importance of a further biopsy for acutely declining renal function , even when a definite diagnosis has been made from a previous biopsy .", "role": "user" }, { "content": "a young female with sickle cell disease was treated for biopsy - proven iga nephropathy . \n serum creatinine levels resolved to normal range , but a year later , she presented with oedema , hypertension and acute renal failure . \n a repeat renal biopsy showed acute - on - chronic thrombotic microangiopathy ( tma ) . \n we suggest that circulating microparticles could be a pathophysiological link between sickle cell disease and the development of renal tma . \n this case emphasizes the importance of a further biopsy for acutely declining renal function , even when a definite diagnosis has been made from a previous biopsy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: adrenocortical carcinoma ( acc ) is a rare , aggressive malignancy that features a correspondingly poor prognosis . \n its pathogenesis is poorly understood , especially at the molecular level , as the rarity of the disease renders comprehensive study difficult [ 1 , 2 ] . as a result , \n therapeutic options are currently limited , with medical and radiation therapy complementary to surgery , which is currently the only curative modality . \n the disease accounts for 0.2% of all malignancies and despite multimodal therapies , its prognosis remains poor , with a mean survival of < 30 months . \n an overall incidence of 0.52 per 1 million cases has been reported annually worldwide [ 1 , 2 ] . \n the disease shows a slight female gender preference and a bimodal age distribution , with the first peak in children < 5 years of age and the second peak in the fourth to fifth decade of life . \n a 63-year - old female patient presented left flank pain for 1 year associated with a palpated mass in this topography . in the previous 2 months , she had experienced nausea without vomiting and weight loss ( not measured ) . \n computerized tomography was performed for staging which revealed a large mass of 20.8 16.5 10.6 cm ( 1,902.6 cm ) in size with multiple areas of central necrosis and significant neovascularization in the left adrenal topography without a cleavage plane with pancreas and left kidney and thrombus in the inferior vena cava ( fig . 1 , fig . \n the patient was submitted to surgery with en bloc resection of the mass , body and tail pancreatectomy , splenectomy , left nephrectomy and thrombectomy of the inferior vena cava ( fig . \n histopathology revealed an adrenal carcinoma , a solid pattern , associated with low grade , 20 18 cm in size , and ki67 of approximately 5% . \n we observed capsule infiltration , an extensive necrosis area , clear margins and no lymph node involvement \n pathologic staging iv , american joint committee on cancer ( ajcc ) 2010 , european network for the study of adrenal tumors ( ensat ) stage iii . \n after 8 months of follow - up after surgery , the patient remained without any signs of recurrence on computerized tomography and magnetic resonance scans of the abdomen . \n written informed consent was obtained from the patient for publication of this case report and any accompanying images . \n accs arise from cells of the adrenal cortex , which are specialized steroidogenic cells that produce glucocorticoids , mineralocorticoids , and androgens . \n tumorigenesis may lead to abnormal hormone function , in approximately 6070% of adult patients , and result in excess production of steroid hormones that may clinically manifest as cushing 's syndrome , conn 's syndrome , virilization or feminization . \n however , a proportion of accs may be nonfunctional , and patients may present with nonspecific symptoms such as abdominal pain or fatigue . \n although acc is usually sporadic , it may be associated with familial cancer susceptibility syndromes including the li - fraumeni syndrome , beckwith - wiedemann syndrome , multiple endocrine neoplasia type 1 , and familial adenomatous polyposis . \n these tumors are classified as either nonfunctional or functional depending on whether they produce corticosteroids , androgen , estrogen or mineralocorticoids . \n although early studies reported that up to 50% of these were functional , more recent series have noted hormone secretion in up to 79% of accs . \n open surgery with transperitoneal access is the standard treatment of all patients with localized ( stage i ii ) and local advanced stage ( stage iii ) when complete resection can be achieved . \n laparoscopic adrenalectomy is a safe and effective procedure for pheochromocytoma and for patients with small accs ( < 8 cm ) without preoperative evidence of invasiveness , and adrenal masses that are judged to be only potentially malignant . \n the resection status ( r0 , r1 , r2 ) is a major predictor of prognosis for acc . \n a margin - free complete resection ( r0 resection ) , in fact , provides the only means to achieve long - term survival . in order to obtain such resection \n it is often mandatory to resect adjacent organs such as the wall of the vena cava , liver , spleen , colon , pancreas and/or stomach . \n clinical stages i and ii with tumors have a 5-year survival rate of 84 and 63% , respectively . \n stage iii patients have a 5-year survival rate of 51% and stage iv drops to 15% at 1 year . \n it is important to know that most patients surviving at 5 years are not cured but living with the disease and 85% of patients resected for cure will develop recurrence or distant metastasis . \n other factors negatively influencing the outcome are a size of > 12 cm , high mitotic activity , necrosis , high expression of ki67 and tp53 gene mutation positivity . in 2009 , \n a paper proposed a revision of the ajcc tnm classification , further called the ensat staging system . \n the major finding of their evaluation of the proposed international union against cancer ( uicc ) system is the observation that patients with stage ii disease do not differ considerably in their disease - specific survival from patients with stage iii disease . \n furthermore , patients who have stage iv disease with documented distant metastases have a poorer survival than patients who have uicc stage iv disease without distant metastases , thus clearing the improving prognostic potential . \n studies suggest that adjuvant mitotane can delay and possibly prevent a recurrence of the disease . in 2008 , a panel of international experts unanimously recommended adjuvant mitotane in patients with potential residual disease or a ki67 positivity on pathologic examination of > 10% . \n similarly , the same panel did not consider mitotane mandatory for patients with stage i or ii disease who underwent histologically proven total resection with clean margins ( r0 resection ) and a ki67 index of < 10% . \n the panel was undecided on whether to offer adjuvant therapy to stage iii acc patients following a r0 resection [ 1 , 5 ] . \n acc is a rare disease with poor prognosis . although most recurrences in the adjuvant setting occur at < 6 months postoperatively , this paper reported on a patient submitted to surgical multiorgan resection ( r0 resection ) , pathologic stage iv ( ajcc ) and ensat stage iii associated to adjuvant chemotherapy without signs of recurrence in an ongoing follow - up of 8 months . \n ", "role": "user" }, { "content": "adrenocortical carcinoma is a rare , aggressive malignancy that features a correspondingly poor prognosis \n . the disease accounts for 0.2% of all malignancies and despite multimodal therapies , its prognosis remains poor , with a mean survival of < 30 months . \n this paper reports on a patient submitted to surgical resection and adjuvant chemotherapy for adrenocortical carcinoma with an ongoing follow - up of 8 months after surgery and no signs of recurrence .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the acoustic neuroma is a benign tumor of the eighth cranial nerve , which commonly affects the portion of the vestibular nerve.1 this tumor represents 8% of all intracranial tumors in adults and 80 to 90% of tumors in the cerebellopontine angle.1 \n 2 the incidence of acoustic neuroma is 1:100,000 people per year,3 but with the evolution of imaging that number has increased because asymptomatic lesions are detected . \n its pathogenesis is characterized by a hyperproliferation of schwann cells , often insidious.1 \n 3 \n the vestibular schwannoma can occur in two types : sporadic or associated with neurofibromatosis type 2 . in the first , the tumor is unilateral and represents 95% of cases , whereas , when associated with neurofibromatosis type 2 , the tumor is bilateral and represents the other remaining 5% of cases.4 \n the most common manifestation of acoustic neuroma is a unilateral and gradual loss of hearing , and it may be associated with tinnitus.1 \n 4 \n 5 due to the slow tumor growth , there is enough time for the occurrence of vestibular compensation and adjustment , causing infrequent vertigo symptoms.4 \n for the diagnosis , it is necessary to use imaging methods during the investigation , especially computed tomography and magnetic resonance imaging , both with emphasis on cerebellopontine angle to check the internal auditory canal the main location of emergence of vestibular schwannoma . \n referring to the differential diagnosis of this disease , meningiomas can be cited ; the main differential diagnosis includes meniere disease , metastases , and tumors of other cranial nerves.4 \n the aim of this study is to report an atypical manifestation of vestibular schwannoma . \n the patient , a 46-year - old woman , presented with 2-month history of symptoms of dizziness that lasted several hours . \n she reported associated nausea , sense of fullness , and binaural hearing loss during the attacks . on physical examination , \n audiometry showed sensorineural loss at 8 khz in the right ear , with speech recognition rate of 100% at 50 db and stapedius muscle reflex present but without recruitment . \n the auditory brainstem response ( abr ) showed no signs of retrocochlear disease , and electrocochleography showed signs of endolymphatic hydrops in the left ear . \n six months after symptom onset , the patient 's condition worsened , with the appearance of constant tinnitus in right ear and normal ear , nose , and throat examination . a new audiometry showed moderate to severe sensorineural loss , flat , between 1 and 8 khz , with speech recognition rate of 70% at 45 \n magnetic resonance imaging was suggestive of acoustic neuroma , with dimensions of 5 6 14 mm , in the right internal auditory canal ( fig . \n 1 ) . \n magnetic resonance imaging showing lesion occupying the entire length of the right internal auditory canal ( 5 6 14 mm ) with lateral margin establishing contact with the bottom of the canal and labyrinth without extension . \n the vestibular schwannoma is the most common tumor in the region of the internal auditory canal and is often associated with asymmetrical and sensorineural loss associated with a higher prevalence in females . \n the literature shows that the more frequent hearing change in vestibular schwannoma is a sensorineural loss in high frequencies , associated with absence of acoustic reflex , and a low rate of recognition speech.1 \n 2 \n 3 \n 4 \n 5 however , as can be seen in the case presented , it has been detected in the presence of stapedial recruitment , which would speak in favor of a cochlear etiology . \n moreover , the first consultation revealed a 100% recognition rate of monosyllables , which would also take away the possibility of vestibular schwannoma . \n in abr of vestibular schwannoma , we would find an increased interval between waves i and iii above 2.3 milliseconds , an increased interval between waves i and v above 4.4 milliseconds , an interaural difference of wave v above 0.4 milliseconds , as well as absence of wave i.4 however , abr performed in the patient did not show any suggestive changes . \n the result of the vestibular test case is reported in accordance with the literature , because it showed hyporeflexia on the affected side.4 \n thus , due to inconclusive electrophysiologic examination , we turned to magnetic resonance imaging the gold standard in detecting tumors of the cerebellopontine angle for help diagnosing the patient.2 \n 3 \n 5 \n this report has warned us about the atypical manifestations of vestibular schwannoma , which should always be remembered in research and diagnosis of hearing loss .", "role": "user" }, { "content": "introduction vestibular schwannoma ( also known as acoustic neuroma ) is a benign tumor whose cells are derived from schwann sheaths , which commonly occurs from the vestibular portion of the eighth cranial nerve . \n furthermore , vestibular schwannomas account for 8% of intracranial tumors in adults and 80 to 90% of tumors of the cerebellopontine angle . \n its symptoms are varied , but what stands out most is a unilateral sensorineural hearing loss , with a low index of speech recognition . \n objective describe an atypical manifestation of vestibular schwannoma . \n case report the 46-year - old woman had vertigo and binaural hearing loss and fullness , with ear , nose , and throat examination suggestive of cochlear injury . \n after 6 months , the patient developed worsening of symptoms and onset of right unilateral tinnitus . \n in further exams the signs of cochlear damage remained , except for the vestibular test ( hyporeflexia ) . \n magnetic resonance imaging showed an expansive lesion in the right cerebellopontine angle . \n discussion this report warns about the atypical manifestations of vestibular schwannoma , which must always be remembered in investigating and diagnosing hearing loss .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the online version of this article ( doi:10.1007/s13555 - 015 - 0073 - 6 ) contains supplementary material , which is available to authorized users . \n mastocytosis comprises a heterogeneous spectrum of diseases characterized by a range of local and systemic symptoms . the current world health organization ( who ) classification , updated in 2008 , differentiates one exclusively cutaneous form from the systemic forms of mastocytosis [ 13 ] . \n cutaneous mastocytosis ( cm ) is a condition classified according to clinical symptoms and identified by an abnormal accumulation of mast cells limited to the skin . clinically , cm is divided into three main variants : maculopapular cm ( or urticaria pigmentosa ) , characterized by disseminated small patches , papules , and plaques ; diffuse cm , affecting large areas of the skin with yellow - red erythroderma - like , diffuse doughy - firm swellings and solitary mastocytoma , partly characterized by blistering and found predominantly in children . \n the much rarer forms are defined as the plaque form , the nodular form , and telangiectasia macularis eruptiva perstans . \n these disorders do not represent independent variants in the who classification and are assigned to maculopapular cm [ 14 ] . \n cm has been diagnosed in patients with disseminated bullous lesions , plaques , nodules , and other clinical presentations such as localized mastocytosis , solitary and multiple mastocytomas , and some other unusual morphologies [ 4 , 5 ] . \n we present a 3-year - long follow - up of a child with skin lesions of various morphologies and sizes , continuous blistering , and frequent flushing during the first 6 months of his life . \n successful treatment was achieved with a short methylprednisolone course and subsequent intermittent h1 receptor antagonist and topical treatments . \n a 6-month - old male infant was referred with different types of skin lesions , persistent blistering , and frequent spontaneous flushing since birth . \n intermittent courses with oral h1 blockers and topical antibiotics and corticosteroids had been administered without improvement . on admission , \n vital signs and chest and abdomen examinations were unremarkable , while hepatosplenomegaly and lymphadenopathy were absent . a variety of skin lesions ( reddish - brown , partially with peau dorange appearance , macules , papules , plaques , and nodules ) , sized 465 mm , were distributed on the neck , trunk , buttocks , and extremities . \n tense bullae , erosions , and crusts were revealed to overlay plaque surfaces ( figs . 1 , 2a ) . \n oral mucosa was not affected . within the first 2 days , we observed several flushing episodes , unprovoked by any triggering factors.fig . \n 1one of the multiple reddish - brown plaques with peau dorange appearancefig . 2 \n a nodular lesion on the neck , b darier s sign one of the multiple reddish - brown plaques with peau dorange appearance \n a nodular lesion on the neck , b darier \n s sign laboratory findings did not disclose hematologic , biochemical , or liver function abnormalities . \n serum tryptase level ( stl ) was 11.8 ng / ml ( reference range < 11.4 ng / ml ) . a biopsy taken from an elevated plaque with vesiculation revealed melanin in the basal / suprabasal layer , subepidermal bulla , dense mast cell infiltration , and some eosinophils in the dermis ( fig . \n toluidine blue and giemsa stainings showed metachromatic granules in the cytoplasm of the infiltrating cells ( fig . \n . the pediatric consultation did not reveal systemic symptoms.fig . 3 \n a subepidermal bulla and dermal infiltration ( h&e ; 200 ) , b cd117-positive mast cell infiltration ( 400)fig . \n 4 \n a toluidine blue ( 200 ) and b giemsa ( 400 ) staining of mast cell dermal infiltration \n a subepidermal bulla and dermal infiltration ( h&e ; 200 ) , b cd117-positive mast cell infiltration ( 400 ) \n a toluidine blue ( 200 ) and b giemsa ( 400 ) staining of mast cell dermal infiltration the patient was initially treated with methylprednisolone 0.6 mg / kg once daily ( o.d . ) intramuscularly ( 3 days ) , oral levocetirizine 1.25 mg o.d , 2% topical fusidic acid , and 0.1% betamethasone valerate cream . \n subsequently , the dose of methylprednisolone was tapered , given orally ( 0.5 mg / kg o.d [ 4 days ] , 0.5 mg / kg every other day [ 2 weeks ] , 0.5 mg / kg twice a week [ 2 weeks ] ) and stopped . \n after 10 days , levocetirizine was replaced with ketotifen 0.05 mg / kg twice daily for eight more weeks and the cream was replaced with 1% hydrocortisone cream for a month . \n parents were counseled on the avoidance of triggering factors for mediator release . at the last follow - up ( 3.5 years of age ) , \n only a few pale - brownish macules were seen with no blistering or isolated flushing episodes . \n all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional and national ) and with the helsinki declaration of 1964 , as revised in 2013 . \n informed consent was obtained from the parent for the child being included in the study and for the publication of the patient photographs . \n the diversity of cm skin manifestations is evident when reviewing the literature . with regard to cutaneous lesions \n , our case seems to belong to the maculopapular and nodular cm , showing a range of lesions of various sizes and morphologies . \n such varied lesions are encountered more often in pediatric than in adult cm where a more uniform presentation of small patches and papules is common [ 15 ] . \n the bullous form of mastocytosis is a rare , morbid condition typically encountered in young children . \n episodic blistering has been reported in maculopapular cm , which usually occurs after stroking or rubbing of the lesional skin and rarely appears spontaneously . \n there are also reports of nodular forms with occasional blistering as well as predominant bullous variants of cm . \n in fact , the long - living bullous manifestations are characteristic of the diffuse cm [ 35 ] . \n it is interesting that in our case , the varied skin lesions , not corresponding to diffuse cm , were associated with an uninterrupted bulla formation for half a year and no improvement with h1 receptor blockers or topical corticosteroids / antibiotics . in our case , \n the flushing episodes were very frequent , spontaneous , and not induced by any precipitating factor ( ambient temperature , food , exercise , stress , medication , etc . ) . \n no other signs of internal organ involvement were revealed except for an stl of 11.8 ng / ml . \n this is not indicative of systemic mastocytosis , where the stl reference value is > 20 ng / ml . this slightly elevated stl might relate to flushing as a single symptom of the mast cell mediator release . \n it is observed more often in patients with systemic involvement , but may also occur in those with purely cutaneous manifestations [ 16 ] . in our case , \n the diagnosis of cm was made based on clinical manifestations , darier s sign , and histopathological and immunohistochemical findings ( anti - c - kit / cd117 with a high specificity and sensitivity for mast cells ) . \n it is widely accepted that growth and differentiation and proliferation of mast cells are controlled by the tyrosine kinase receptor c - kit ( cd117 ) and its ligand stem cell factor . \n it is also controlled by other cytokines such as il-4 , il-6 , il-10 , and il-13 [ 1 , 2 ] . \n recent genetic studies have identified new proteins ( lin28b ) that are of interest in mast cell disease . \n counseling of patients / parents is important to avoid mediator release precipitating factors and treat mast cell mediator release symptoms . \n cm remissions have been reported following treatments with anti - mediator drugs such as h1 and h2 receptor antagonists and cromolyn sodium ( oral and topical ) . \n topical / intralesional corticosteroids , phototherapy , and topical calcineurin inhibitors may be useful [ 810 ] . in our case , \n considering the previous therapy failure , we applied a short course of methylprednisolone , combined with an h1 receptor blocker ( levocetirizine ) and topical mid - potency corticosteroid . \n this was followed by intermittent h1 receptor blocker ( ketotifen ) and topical hydrocortisone courses . \n the 3-year - long follow - up demonstrated that our approach to a refractory , though not severe , clinical form of cm can be to the patient s benefit . of note , \n neither low - dose h2 receptor blockers ( for pediatric use ) nor sodium cromoglycate are available in bulgaria . \n systemic and topical corticosteroids have demonstrated good therapeutic results in some cases of bullous mastocytosis , as reported in the literature [ 11 , 12 ] . \n childhood cm usually has a benign course and most of the cases resolve by puberty [ 2 , 3 ] . with proper treatment and family education on avoiding triggering factors , gradual resolution of both skin lesions and mast cell - mediated symptoms may be observed . despite the lack of systemic involvement \n therefore , follow - up with rigorous evaluation and relevant management is required for each individual case . \n \n r. yankova , t. abadjieva , and v. belovezhdov declare that they have no conflict of interest . \n all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional and national ) and with the helsinki declaration of 1964 , as revised in 2013 . \n informed consent was obtained from the patient s parents for the child being included in the study and for the publication of the patient photographs . \n this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and the source are credited .", "role": "user" }, { "content": "backgroundmastocytosis is a rare disorder with diverse clinical manifestations . in cutaneous mastocytosis \n the mast cell infiltration is limited to the skin , but is often associated with systemic symptoms due to the release of mast cell mediators.case reportwe report a 6-month - old male infant who had skin lesions of various morphologies ( macules , papules , plaques , and nodules ) and sizes , persistent blistering and frequent flushing episodes for half a year . \n vital signs and physical examinations were unremarkable . \n no abnormalities in the laboratory tests were found except for a serum tryptase level ( stl ) of 11.8 ng / ml . the histological and immunohistochemical examinations confirmed the diagnosis of cutaneous mastocytosis . \n the patient was first treated with methylprednisolone , oral levocetirizine , and topical fusidic acid / betamethasone cream . \n subsequently the treatment was tapered and stopped within 9 weeks . \n the child s symptoms improved and were successfully controlled with intermittent courses of ketotifen and topical hydrocortisone over 3 years.conclusionchildhood cutaneous mastocytosis usually has a favorable prognosis , but in some cases the disease can progress with skin manifestations necessitating a more active systemic and topical treatment.electronic supplementary materialthe online version of this article ( doi:10.1007/s13555 - 015 - 0073 - 6 ) contains supplementary material , which is available to authorized users .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: melamine ( mel ) in animal foods and milk products had caused serious accidents , as its metabolism , melamine cyanurate , was easily crystallized in organs and was tending to cause kidney stone and damage [ 13 ] . therefore , establishing a powerful rapid sensitive analytical method for measuring low concentration of mel in kinds of milk products would benefit the routine assay of the related products . several analytical methods , such as gas chromatography - mass spectrometry ( gc - ms ) , high performance liquid chromatography ( hplc ) [ 57 ] gold nanoparticles , colloidal selenium immunoassay , and terahertz time - domain spectroscopy had been reported . \n however , many methods depended on complicated sample treatments . as in gc - ms methods , the sample derivation was strongly demanded as mel contains special label group ; as in hplc methods , liquid - liquid , liquid - solid extraction procedure was needed to cleanse the sample and perform better separation results . in some cases , \n in order to lower the limit of detection ( lod ) or obtain detailed information of the analytes , special detectors , such as mass spectrum ( ms ) , fluorescence detection , surface enhanced raman scattering , electrochemical approach , and online solid - phase extraction , were also used . however , some of these detectors were uncommon or had special demands . \n capillary electrophoresis had advantages on separating complicated samples and had been applied to determine mel [ 1214 ] . \n moreover , ce online stacking methods , which could easily perform enrichment of low - concentration analytes and achieved lower lods , had also been used for assay of mel in real samples [ 1519 ] . \n jin et al . proposed several stacking methods , such as including large - volume sample stacking - sweeping and selective exhaustive injection - sweeping ( sei - s , in either cation or anion mode ) , for determination of melamine and its derivatives in liquid milk . \n lod of mel was around 0.01 ng / ml , however , it 's difficult to achieve better sensitivities for all derivatives in one mode . \n combined cation selective exhaustive injection ( csei ) with sweeping - mekc method . in their study , the lod was 23.4 pg / ml for mel ; however , the recovery of mel was unsatisfied ( ca . \n wu et al . developed a mekc sweeping method for mel , face - centred cube central composite design was used for optimization of conditions , and the lod of mel could reach 5 ng / ml with satisfied recovery within 13 min . in our works , acetonitrile - salt stacking ( ass ) [ 2025 ] was used for detecting mel under cation mode in milk products . \n the factors that influenced both stacking and separation , such as buffer ph , sample acetonitrile concentration , sample salt concentration , injection time , buffer concentration , stacking and separation voltage , were carefully investigated and optimized . \n phosphoric acid , sodium dihydrogen phosphate , disodium hydrogen phosphate , sodium phosphate , sodium chloride , and acetonitrile ( hplc - grade agents ) were purchased from tianjin chemical reagent company ( tianjin , china ) . \n water used throughout was purified by olst m6 ( ao lian co , xian , china ) with a conductivity of 18.2 cm and all the solutions and samples were made daily and filtered through 0.22 m filter . \n experiments were performed on agilent 3d ce capillary electrophoresis system ( agilent , usa ) equipped with a diode array detector ( dad ) and a temperature controller ( 15~60 0.1c ) . \n instrument control and data analysis were carried out by agilent chem station ( rev.a.09.03 , agilent , usa ) on a personal computer . \n for ph measurements , a ph meter ( pb-10 , sartorius , germany ) calibrated with a precision of 0.01 ph unit was employed . \n all the ce experiments were performed on a fused silica capillary ( yongnian photoconductive fibre factory , hebei , china ) . \n the milk samples , obtained from local markets , were deproteinized with acetonitrile at the rate of 6 : 4 ( acetonitrile : milk , v / v ) or as specified . \n then , the treated samples were centrifuged for 15 min at 14,200 rpm to eliminate the precipitates . \n all supernatants were assayed after being added with 100 mmol / l nacl and filtration . \n mmol / l ) were prepared quantitatively with water and stored at 4c until usage . \n all working standard samples contained 8 mmol / l phosphate buffer and required concentration of sodium chloride and 60% acetonitrile ( or as specified ) and ~10 mol / l mel ( final concentration ) . \n all the separations were performed on a fused - silica capillary ( 75 m i.d . \n , effective length of 39 cm , and total length of 50 cm ) at 20c with a constant separation voltage of + 10.0 kv . \n for the first usage , the capillary was activated with 1.0 mol / l naoh for 1 hour . \n the stacking and separation buffer consisted of 80 mmol / l phosphate buffer ( ph 2.8 ) . \n the samples were injected hydrodynamically at + 50 mbar for 40.0 s ( about 20% of the capillary efficient length ) or as specified . before each run , the capillary was rinsed with 0.1 mol / l naoh for 3 min at 1.4 10 mbar . \n as the ass method stacked samples via transient pseudoisotachophoresis way and separated samples via capillary zone electrophoresis mode , several factors that affected stacking , such as sample matrix , voltage , injection time , and separation , such as buffer ph , were carefully studied . in general , mel was positively charged under the selected condition . \n it was stacked based on its difference of migrating velocity between sample zone ( faster ) and outlet buffer zone ( slower ) . \n buffer ph was one of most important factors that would influence separation and stacking . in this section , a ph range of 2.0~5.0 \n was firstly studied , as the pka values of mel were about 5.0 ; it could only be positively charged when buffer ph was lower than 5.0 . \n there was an interferent compound in blank milk sample ( contained no mel , data not shown ) which had similar migration time as mel . regarding this , \n the optimization of ph was mainly based on the resolution ( rs ) between mel and interferent as well as their migration times . \n it indicated that , at the lower ph ( < 2.5 ) , the electroosmotic flow ( eof ) was nearly zero , and mel was strongly and positively charged and migrated to the detecting window by itself ; when the ph became higher , the silanol started to dissociate and , as a result , the eof slightly increased and migration times dropped ; ph 3.5 had the slight longer migration time compared with ph 3.0 , which may be caused by the faster decreasement of effective positive charges of mel compared with the slower increasement of eof . \n in addition , a peak order change was also observed in ph range of 2.0~2.5 , which was similar to our cze separation works ( data not shown ) . \n finally , based on the curve of rs in figure 1 , ph 2.8 , which had the best rs value and relative shorter migration time , was chosen for further usage . \n the influence of buffer concentration , ranged from 20.0 mmol / l to 140.0 \n mmol / l , on stacking was investigated ( figure 2 ) . theoretically , to some extent , \n higher buffer concentration provided larger conductivity difference between buffer and sample zone , which in turn might perform better primary stacking effect . in our works \n mmol / l ) , as the conductance of the buffer was similar to that of the sample zone , the difference of migrating velocity of the mel in buffer and in sample zone was not large enough to initiate stacking . \n when buffer concentration was higher than 40.0 mmol / l , stacking phenomena occurred . \n as the buffer concentration increased , the theoretical plate number ( n ) increased firstly followed by decreasing when the concentration was higher than 80.0 \n mmol / l , which may heat due to the broaden effects of extra joule . \n finally , a concentration of 80.0 mmol / l was selected for further studies . \n the effect of the acetonitrile concentration in sample on stacking was studied and optimized as organic reagent acted as accelerator for speeding up the velocities of analytes . \n it could be seen ( figure 3 ) , as the percent of the acetonitrile was lower than 50% , that the baseline around mel became unsatisfied ( arrow pointed in figure 3 ) for separation and quantification , although the rs value was higher enough between the interferent and mel ( rs > 3.5 ) . when the percentage was larger than 50% , baseline separation and stacking were both achieved . meanwhile , the rs decreased from 3.27 ( 60% ) to 1.53 ( 80% ) as the percentage of acetonitrile increased . \n therefore , a percentage of 60% was considered as the better condition that provided less sample dilution and better rs . \n nacl concentration was also an important factor that affected stacking , as the na acted as leading ions in ass procedure . \n normally , almost all milk products contained na , and the [ na ] varied in larger range ( from 0.18% to 1.5% in mass / volume form or in another form , 3~25 mmol / l ) . in this section \n , same real sample was added with different amount of nacl ( in range of 0~150 mmol / l ) and was tested under same condition . \n the influences of nacl concentration on rs and migration times were shown in figure 2 . \n as the nacl concentration increased , the migration time and rs increased correspondingly ( rs ranged from 1.7 to 3.0 , while migration times ranged from 14.2 min to 20.5 min ) until the concentration of nacl was higher than 100 \n all these indicated that the method had a good tolerance on various concentrations of nacl , which made it more suitable for assaying kinds of milk products . finally , to keep the migration times similar , in the later assays , \n 100 mmol / l nacl was added to the treated real milk samples before measurements . as the injection time \n ( presented as percent of the efficient length ) was closely related to sensitivity of the method , the maximum injection time was carefully selected in this section . \n figure 4 showed that migration times increased ( as a result of decreasing eof ) while the rs values decreased ( mainly caused by the decreasing efficient capillary length ) with increasing injection times ( similar to the results of gao 's work ) . \n based on the rs value between mel and interferent , 20% of the efficient capillary length ( 50 mbar 40.0 s ) was considered as a best injection percent ( rs = 1.75 ) . in this section , stacking voltage was investigated in detail ( figure 4 ) . \n it could be seen that n value appeared as a bell - shaped curve while the voltage increased from 2.5 kv to 25.0 kv . \n experimental data showed that neither under lower nor higher voltage could mel be well stacked . \n a voltage of + 10.0 kv ( ground at outlet ) was finally decided to be the best condition as it was relatively less time - consuming and of highest n value ( 82,000 ) . \n as the status of the inner - wall silanol greatly affected reproducibility of the method , special rinsing step was added before each run . \n it could be seen in figure 5 that an additional 0.1 mmol / l naoh rinsing step was crucial for maintaining reproducibility . without naoh rinsing step ( capillary \n was only flushed with water and running buffer for 1.0 min and 3.0 min respectively , figure 5-(b ) ) , the separation and stacking were ruined compared with the first run ( figure 5-(a ) ) . when the naoh rinsing step was added before the next assay , better separation and stacking regained ( figure 5-(c ) ) . for the selection of the naoh rinsing time \n , our data proved that the 0.1 mmol / l naoh rinsing time should be at least 3.0 min in order to achieve satisfied reproducibility . under the optimized condition \n six replicates of the samples were used to test the inter- and intraday reproducibility of the method both for migration times and peak areas . \n linearity range , using area as the function of the concentration , was obtained by adding different amount ( final concentration of mel ranged from 0.01 mol / l~50 \n mol / l at ten concentration levels ) of mel directly into untreated real milk samples . \n recovery was tested with adding known amount of mel to real samples under two final concentration levels ( 0.5 mol / l and 5.0 mol / l ) . \n separation and stacking results of two bands of milk products ( yili pure milk and wangzai reconstituted milk ) were shown in figure 6 . \n it could be seen that mel was well separated ( from the interferent , in figure 6 ) , stacked , and detected in both tested milk samples using the established method within 20 min . \n for example , the blank yili sample ( without adding mel , figure 6-(a ) ) showed no mel peak even under stacking mode , while a low concentration of 0.5 mol / l mel could be easily detected ( figure 6-(c ) ) under stacking mode , with a ~20 folds enhancement of sensitivity compared with traditional cze mode ( figure 6-(b ) ) ; for the assay of wangzai reconstituted milk ( with adding mel at a final concentration of 8.0 \n an ass method for separation and determination of melamine in milk products was proposed . under the optimum conditions , low concentration of melamine ( 0.03 mol / l ) in milk products \n could be successfully determined , which can cope with the maximum tolerable limits set worldwide for melamine and related compounds . \n the established method also provided simple sample treatment steps , good reproducibility , and a wider linearity which indicated that it is suitable for routine assay of melamine in milk products .", "role": "user" }, { "content": "melamine was measured in real milk products with capillary electrophoresis ( ce ) based on acetonitrile - salt stacking ( ass ) method . \n real milk samples were deproteinized with acetonitrile at a final concentration of 60% ( v / v ) and then injected hydrodynamically at 50 mbar for 40.0 s. the optimized buffer contains 80.0 mmol / l ph 2.8 phosphates . \n melamine could be detected within 20.0 min at + 10 kv with a low limit of detection ( lod ) of 0.03 \n mol / l . \n satisfactory reproducibility ( inter- and intraday rsd% both for migration time and peak area was lower than 5.0% ) and a wide linearity range of 0.05 mol / l ~ 10.0 mol / l were achieved . \n the proposed method was suitable for routine assay of mel in real milk samples that was subjected to a simple treatment step .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: nonalcoholic fatty liver disease ( nafld ) is a pathological condition that encompasses a wide spectrum of liver damage , ranging from simple steatosis to nonalcoholic steatohepatitis ( nash ) , cirrhosis , and hepatocellular carcinoma . \n the pathogenesis of nafld is multifactorial and is characterized by overweight and insulin resistance ( ir ) . \n recently , some studies reveal that bone mineral density ( bmd ) is also influenced by nafld . \n reported a significant association between mean lumbar bmd and nafld in postmenopausal subjects after adjusting for age , body mass index ( bmi ) , alanine aminotransferase ( alt ) , smoking status , and alcohol consumption , and they concluded that postmenopausal women with nafld had an increased risk of osteoporosis . \n pardee et al . reported that obese children with nafld had significantly lower bmd z - scores than obese children without nafld ; among children with nafld , those with nonalcoholic steatohepatitis ( nash ) had a significantly lower bmd z - scores than nafld children without nash . \n however , when this phenomenon is explained by overweight and insulin resistance ( ir ) , there is a paradox . in obese subjects \n , it has been argued that there is a positive relationship between body weight and bone mass especially in adults . \n however , some recent studies reveal that severe ir may negatively affect bmd [ 4 , 5 ] . \n the role of cytokines and other bone - influencing molecules released from the inflammatory liver is still unclear . \n osteocalcin ( oc ) , which is a specific marker of bone formation , has been found to be decreased in liver with nafld [ 6 , 7 ] . besides its role in the calcium and bone metabolism \n nafld patients present with a marked reduction in serum 25(oh ) vitamin d when compared with controls . \n however , although these cytokines are associated with both nafld and bmd , none of them have been confirmed to be involved in the process whereby nafld influences bone metabolism . considering that little is known about chinese patients and that the mechanism underlying the relationship between nafld and bone defect is poorly understood , this cross - sectional study was performed in china to explore the role of overweight , ir , osteocalcin , and vitamin d in the interaction between nafld and bmd \n patients were recruited from the shanghai tenth people 's hospital of tongji university from october 2011 to april 2012 . \n all subjects were screened using a questionnaire on their medical history , symptoms , and findings in physical examination . \n inclusion criteria were as follows : ( 1 ) subjects who were 4070 years old and ( 2 ) males or postmenopausal females with or without nafld . \n ( 1 ) there were other causes of chronic liver disease ( hepatitis b and c , wilson disease , -1-antitrypsin deficiency , autoimmune hepatitis , and cystic fibrosis ) , severe alcohol abuse ( > 10 g of alcohol per day ) , and drug induced fatty liver disease , especially related to amiodarone , estrogens , and vitamin a. ( 2 ) subjects were current or former smokers who quitted smoking less than 6 months ago . \n ( 3 ) there were conditions known to affect bone metabolism , such as kidney , thyroid or parathyroid diseases , hyperprolactinaemia , ovary excision , rheumatoid arthritis , ankylosing spondylitis , malignant tumors , and medication with agents influencing bone metabolism ( such as calcium , vitamin d , and anti - osteoporosis drugs ) . \n a total of 99 males and 125 postmenopausal females were enrolled and divided into 4 groups according to the gender and the presence of nafld : males without nalfd , males with nafld , females without nafld , and females with nafld . \n this study was conducted according to the principles in the declaration of helsinki , and written informed consent was collected before study . \n the whole protocol was approved by the ethics committee of shanghai tenth people 's hospital of tongji university . \n weight was measured with a plethysmography scale , where patients wore minimal clothing , and height was measured with a stadiometer . body mass index ( bmi ) was calculated by dividing the weight by height squared ( kg / m ) . \n nafld was diagnosed based on the ultrasonographic evidence of hepatic steatosis , such as a bright hepatic echo pattern , increased echo attenuation , and loss of intrahepatic architecture . \n liver ultrasonography was conducted with a 4 mhz probe ( eub-6500 , hitachi , tokyo , japan ) and evaluated by an experienced radiologist . \n bmd was measured by dual - energy x - ray absorptiometry ( dexa ) ( hologic ( qdr-4000 ) , usa ) . \n the bmd of lumbar spine ( l ) , right hip ( rh ) , and femoral neck ( fn ) was evaluated , and the means of l , rh , and fn served as the mean bmd ( table 4 ) . \n biochemical markers , including total cholesterol ( tc ) , triglyceride ( tg ) , high density lipoprotein ( hdl ) , low density lipoprotein ( ldl ) , fasting plasma glucose ( fpg ) , fasting insulin level ( fins ) , alt , alkaline phosphatase ( akp ) , aspartate aminotransferase ( ast ) , and serum creatinine ( scr ) were measured with standard biochemical methods . \n bone metabolic markers including type i collagen ( ctx ) , parathyroid hormone ( pth ) , oc , calcitonin ( ct ) , bone alkaline phosphatase ( bap ) , and 25-hydroxyl - vitamin d ( 25(oh)d ) were measured by elisa ( roche ) according to the manufacturer 's instructions . \n insulin sensitivity and ir were evaluated by homeostasis model assessment 2 ( homa2 ) , including homa2%b , homa2%s , and homa2ir , calculated by homa2 v2.2 ( http://www.dtu.ox.ac.uk/homa ) . \n analysis of variance ( anova ) was used to compare the baseline morphometric measurements ( table 1 ) , bmd , and biomarkers in the control group and the nafld group for both genders ( tables 2 and 3 ) . \n analysis of covariance was used to adjust for weight , bmi , wc , lipid profiles , and alt ( table 2 , p value ( a ) ) . \n multiple linear regression analysis was performed to analyze the variables associated with mean bmd and nafld ( table 4 ) . \n statistical product and service solutions version 17.0 ( spss 17.0 ) software was used for statistical analysis . \n at baseline , the age , height , fpg , fins , akp , ast , and scr were comparable between the control group and the nafld group , whereas the weight , bmi , wc , lipid profiles , and alt in subjects of the nafld group were markedly different from those in the control group ( table 1 ) . \n subjects in the nafld group had significantly lower bmd in rh and fn of males and in rh of females . after adjustment for parameters ( weight , bmi , wc , lipid profiles , and alt ) at baseline , \n serum bone metabolic markers including ctx , pth , oc , ct , bap , and 25(oh)d were comparable between the nafld group and the control group in both genders . \n although calcium was significantly different , we did not think this difference was clinically significant . in the nafld group , \n homa2ir was higher in both genders , but homa2%s was lower in females ( table 3 ) . \n three models were used to analyze the correlation between bmd and nafld taking into account all the parameters including age , bmi , waist , homa2ir , and nafld that would affect the bmd . in all the models , nafld played a very important role in the process of the influence on bone . \n in our study , subjects in the nafld group had significantly lower bmd than those in the control group for both genders , and the difference was still present after adjustment for variables . \n however , most clinical trials [ 1 , 9 ] showed a negative association between nafld and lumbar bmd . in the present study \n , there was no significant difference in the lumbar bmd between the nalfd group and the control group , which might be attributed to the differences in the ethic and age . \n since the bmd of femur neck and hip was not detected in previous studies , the bmd of femur neck and hip could not be compared among studies . at baseline , \n subjects in the nafld group were characterized by higher weight , bmi , and wc , which was in accordance with other studies in which overweight or obesity was a predictor for nafld and other serious medical conditions [ 10 , 11 ] . there is a significant relationship between bmi and relative body fat mass . \n consequently , bmi is a widely accepted index of obesity , correcting for gender and ethnicity . \n furthermore , there is a direct association of bmi with hepatic steatosis , nash , and advanced liver fibrosis [ 12 , 13 ] . \n wc is highly correlated with visceral adipose tissue ( vat ) and a marker for abdominal obesity . \n excess vat , or abdominal obesity , is a risk factor of ms as compared to individuals with fat located predominantly in the lower body and subcutaneously . \n overweight , bmi and wc are related to bone mass to a certain extent because any increase in body mass , fat , or lean will expose the skeleton to greater forces during locomotion . \n bone is sensitive to , but not limited to , a variety of mechanical parameters . \n found that the obesity failed to protect against bone mineral loss in postmenopausal women . in our study , correlation analysis showed that there was no significant relation of bmd with weight , bmi , and wc . \n hoy et al . speculated that the bone quality of overweight adolescents adapted to lean mass but not to greater fat mass , because the fat composition ratio was not significantly different between the control group and the nafld group . \n ir was negatively associated with bmd in obese or t2 dm patients [ 17 , 18 ] . even having higher bone density , as in the ir state , diabetic women have lower femoral neck strength relative to load . in ir obese women \n circulating concentrations of inflammatory cytokines are reckoned to be the most important factor in causing and maintaining ir . \n it has been found that ir induced by 12-week high fat diet ( hfd ) could impair the osteoblastic insulin signaling , osteoblast proliferation , and osteoblast survival and result in osteoporosis of the jawbone . \n obesity status - associated ir may induce high circulating intact ( ifgf-23 ) and c - terminal fgf-23 ( ctfgf-23 ) , which is positively associated with pth and negatively associated with vitamin d , resulting in low bone mass . \n elevated alt and nafld are associated with ir , and thus , alt has been proposed as a useful serum marker for early ir , which reflected a balance between oxidative stress and antioxidant response [ 24 , 25 ] . \n failed to find low bmd in nafld patients , but elevated serum alt was found to be associated with lower bmd . in our study , negative association was noted between alt and bmd in nafld group , which was consistent with previously reported studies . \n alt , an indicator of inflammation state in either the liver or system , will affect bone metabolism . \n osteoblasts can secrete oc , but recent work indicates that , besides acting as a specific bone marker for bone formation , oc is also associated with insulin secretion and sensitivity . \n after administration of recombinant oc , insulin secretion increases , blood glucose decreases , and experimental obesity is attenuated . \n consequently , oc has been considered to link bone to energy metabolism , although this was not evident in our study . \n possible explanations for this discrepancy may be that only total serum oc was tested , whereas undercarboxylated osteocalcin ( ucoc ) affects energy metabolism . secondly , the association between oc and steatohepatitis is not confirmed by multivariate analysis . \n thirdly , decreased serum oc in chinese nafld patients as compared to subjects in western countries suggests the potential role of ethnicity . \n vitamin d receptors are present in several cell types and play an important role in both energy metabolism and bone metabolism . \n 25(oh)d is a major circulating form of vitamin d and constitutes the best clinical indicator of vitamin d stores . \n reported that nafld patients had a marked reduction in serum 25(oh)d as compared to controls , and this decrease was closely associated with the histopathological features of nafld . \n however , a report on 102 nafld patients and 54 healthy controls showed no difference in the serum vitamin d , which was consistent with our results . in our study , we did not take the seasonal variation of vitamin d ; since it was a cross - sectional study , we could not balance every impact factor . \n moreover , vitamin d was not the only one of the factors that affect the bone metabolism ; there were still other markers including type i collagen ( ctx ) , parathyroid hormone ( pth ) , oc , calcitonin ( ct ) , and bone alkaline phosphatase ( bap ) . \n future studies are needed to clarify the correlation between vitamin d status and nafld . this retrospective study still had some limitations . \n firstly , being a cross - sectional study , it failed to completely exclude that some correlations were incidental . \n secondly , bmd could be influenced by many factors such as physical activity , calcium / vitamin d intake , and peak bone mass , which were not evaluated in this study . \n thirdly , only total oc , instead of carboxylated and uncarboxylated forms of oc , was measured . \n moreover , we did not perform hepatic biopsy to evaluate the severity of nafld . that was because hepatic biopsy which was considered as the golden standard to diagnose nafld was invasive . \n liver ultrasonography was also considered an effective way to investigate whether the fat existed in the liver . \n further studies are needed to evaluate the effect of nafld on bmd in different extent . \n for example , we could conduct magnetic resonance spectroscopy ( mrs ) on the subjects or a hepatic biopsy on the animal model of nafld . in conclusion \n , bmd is significantly decreased in elderly male and female chinese nafld patients as compared to controls . \n further studies are needed to identify the causative factors , especially the role of ir .", "role": "user" }, { "content": "aim . to investigate bone metabolic characteristics in chinese adults with nonalcoholic fatty liver disease ( nafld ) . methods . \n a total of 224 patients ( 99 males and 125 postmenopausal females ) were recruited and divided into 4 groups : males without nafld , males with nafld , females without nafld , and females with nafld . bone mineral density ( bmd ) was evaluated according to body mass index ( bmi ) , waist circumference ( wc ) , and serum biomarkers . \n cell function was evaluated by homa2%b , homa2%s , and homa2ir . \n results . males in the nafld group had lower bmd of the right hip and the femoral neck ( 0.852 0.117 versus 0.930 0.123 , p = 0.002 ; 0.736 0.119 versus 0.812 0.132 , p = 0.004 ) , and females had lower bmd of the right hip ( 0.725 0.141 versus 0.805 0.145 , p = 0.002 ) even after adjusted for weight , bmi , waist , hdl , and alt . \n there was no significant difference in bone metabolic markers between patients with and without nafld . \n nafld was an important factor that affected the bone ; moreover , the effect attenuated when homa2ir entered into the model ( r2 = 0.160 , = 0.172 , and p = 0.008 ) . conclusions . \n nafld exerts a detrimental effect on bmd in both males and females \n . insulin resistance may play an important role in this pathophysiological process .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: patients were a subset of 292 individuals autopsied by mhbb under a mount sinai institutional review board \n mhbb is a longitudinal study of hiv - associated nervous system complications ; it enrolls hiv - positive and hiv - negative individuals who undergo prospective neuromedical evaluations , and its entry criteria were previously described . \n some individuals come to autopsy without premortem assessment ; in these cases , extensive medical record reviews are performed . \n the 126 brains in this study were from 96 hiv+ and 30 hiv individuals ; 87 were from the longitudinal study and 39 were assessed at autopsy . \n brains were chosen on the basis of having pertinent medical annotation and lack of focal neuropathologies in the deep cerebral white matter . \n clinical information , collected through a combination of patient or caregiver interview , laboratory testing , and/or medical record review , included the following : sex , race / ethnicity , age at death , hiv and hepatitis c virus ( hcv ) status , presence or absence of hypertension , diabetes , obesity , hyperlipidemia , historical herpes infections ( herpes simplex virus , varicella - zoster virus , cytomegalovirus ) , and , for hiv - infected individuals , last cd4 count and plasma viral load prior to death , history of cocaine misuse , and use of cart at the time of death . \n variables obtained from autopsy included presence of cirrhosis ( used instead of clinical diagnosis because of greater accuracy ) and heart weight . \n the mhbb neuropathology protocol has been published previously . in brief , the brain is hemisectioned ; half is formalin - fixed and used to generate 57 paraffin - embedded , hematoxylin and eosin ( h&e)stained , 4-m sections . \n standard h&e sections of deep frontal white matter , encompassing the periventricular watershed , were used for analysis and scanned at 200x with a high - speed , high - resolution olympus vs110 virtual slide scanning system using vs - asw software ( olympus america inc , center valley , pa ) . for each patient , between 15 and 20 arterioles were manually identified and marked for analysis and calculation of the arteriolar sclerotic index ( si ) ; the widest axes of these vessels ranged between 50 and 300 m . \n si was calculated as described , using tools in the vs - asw program . to eliminate variations in wall thickness due to vascular obliquity in the plane of section \n , measurements were done perpendicular to the widest axis of each arteriole , with si = [ 1(inner diameter / external diameter ) ] ( figure ) . \n measurements of the inner diameter ( i d ) and external diameter ( ed ) are taken perpendicular to the widest axis of the arteriole ( lines separated here for visualization ) ; these are used in calculating the si = [ 1(inner diameter / external diameter ) ] . \n statistics were performed using jmp version 9.0 ( sas , cary , nc ) and spss version 19 ( ibm , armonk , ny ) . \n bivariate pearson or spearman correlations were conducted between clinical variables and mean si ; those significant at p 0.1 were considered for inclusion in multivariate ( linear multiple regression ) analyses after assessment for colinearity . \n variables demonstrating colinearity were assessed for independent relationships with mean si by way of partial correlations . \n patients were a subset of 292 individuals autopsied by mhbb under a mount sinai institutional review board \n mhbb is a longitudinal study of hiv - associated nervous system complications ; it enrolls hiv - positive and hiv - negative individuals who undergo prospective neuromedical evaluations , and its entry criteria were previously described . \n some individuals come to autopsy without premortem assessment ; in these cases , extensive medical record reviews are performed . \n the 126 brains in this study were from 96 hiv+ and 30 hiv individuals ; 87 were from the longitudinal study and 39 were assessed at autopsy . \n brains were chosen on the basis of having pertinent medical annotation and lack of focal neuropathologies in the deep cerebral white matter . \n clinical information , collected through a combination of patient or caregiver interview , laboratory testing , and/or medical record review , included the following : sex , race / ethnicity , age at death , hiv and hepatitis c virus ( hcv ) status , presence or absence of hypertension , diabetes , obesity , hyperlipidemia , historical herpes infections ( herpes simplex virus , varicella - zoster virus , cytomegalovirus ) , and , for hiv - infected individuals , last cd4 count and plasma viral load prior to death , history of cocaine misuse , and use of cart at the time of death . \n variables obtained from autopsy included presence of cirrhosis ( used instead of clinical diagnosis because of greater accuracy ) and heart weight . \n the mhbb neuropathology protocol has been published previously . in brief , the brain is hemisectioned ; half is formalin - fixed and used to generate 57 paraffin - embedded , hematoxylin and eosin ( h&e)stained , 4-m sections . \n standard h&e sections of deep frontal white matter , encompassing the periventricular watershed , were used for analysis and scanned at 200x with a high - speed , high - resolution olympus vs110 virtual slide scanning system using vs - asw software ( olympus america inc , center valley , pa ) . for each patient , between 15 and 20 arterioles were manually identified and marked for analysis and calculation of the arteriolar sclerotic index ( si ) ; the widest axes of these vessels ranged between 50 and 300 m . \n si was calculated as described , using tools in the vs - asw program . to eliminate variations in wall thickness due to vascular obliquity in the plane of section \n , measurements were done perpendicular to the widest axis of each arteriole , with si = [ 1(inner diameter / external diameter ) ] ( figure ) . \n measurements of the inner diameter ( i d ) and external diameter ( ed ) are taken perpendicular to the widest axis of the arteriole ( lines separated here for visualization ) ; these are used in calculating the si = [ 1(inner diameter / external diameter ) ] . \n statistics were performed using jmp version 9.0 ( sas , cary , nc ) and spss version 19 ( ibm , armonk , ny ) . bivariate pearson or spearman correlations were conducted between clinical variables and mean si ; those significant at p 0.1 were considered for inclusion in multivariate ( linear multiple regression ) analyses after assessment for colinearity . \n variables demonstrating colinearity were assessed for independent relationships with mean si by way of partial correlations . \n variables whose independent relationships with mean si met significance at p 0.05 were included in multivariate analyses . \n the overall population had a mean age of 50 years , was 66% male , and was 75% racial / ethnic minority , with significant representation of liver disease , hypertension , diabetes , hyperlipidemia , and herpes infections ( table 1 ) . \n hiv - positive and hiv - negative subgroups differed : the hiv - positive subgroup had more african americans and individuals with herpes infections , whereas the hiv - negative subgroup had more diabetes . \n both subgroups had high rates of cirrhosis and hcv . in this cart - era population , \n 98% of hiv - positive patients had antiretroviral ( arv ) exposures , but only 62% were on therapy at death ; reasons for this were multifactorial and included noncompliance as well as regimens being withheld in late stages of other medical disorders . \n cohort characteristics , with hiv - positive and hiv - negative subgroups the mean si for all categories assessed was > 0.4 , in the range of moderate svd ( table 2 ) . \n significant correlations with si were seen for african american race , age , hypertension , hcv , cirrhosis , and cart at death for hiv - positive patients . in the overall population , \n hiv status did not correlate with si , nor did diabetes , hyperlipidemia , gender , or herpes infections . within the hiv population , cocaine misuse , cd4 count , and plasma hiv load \n bivariate correlations between arteriolar sclerotic indices and clinical variables to address colinearity of significant factors , partial correlations were performed . \n eighty - two percent of patients with cirrhosis had hcv ; when hcv status was held constant , the cirrhosis effect on mean si became nonsignificant ( r = 0.08 , p = 0.38 ) . \n however , when cirrhosis was controlled , the hcv effect remained significant ( r = 0.19 , p = 0.04 ) . \n fifty - three percent of those with hypertension were african american ; when hypertension was controlled , significant independent effects of african american race remained ( r = 0.20 , p = 0.03 ) , and when african american race was controlled , significant effects of hypertension remained ( r = 0.21 , p = 0.02 ) . \n mean age of patients with hypertension ( 54.8 1.3 years ) was significantly higher than those who were normotensive ( 46.6 1.0 years , p < 0.01 ) ; when age was held constant , effects of hypertension on si remained ( r = 0.18 , p = 0.05 ) , but when controlling for hypertension , age became nonsignificant ( r = 0.13 , p = 0.15 ) . \n only hypertension was entered into multivariate regression . for the overall population , hcv , african american race , and hypertension \n accounted for 15% of the variance in si in multiple regression ( table 3 ) . \n each factor was independently associated with si , and hcv had the largest effect . for the hiv - positive group , \n the inclusion of terminal cart in the model increased r to 0.21 , with only hcv , hypertension , and cart remaining significant or at trend level ; hcv again had the largest effect . \n multivariate correlation of arteriolar sclerotic indices with clinical variables in both a combined hiv+ and hiv population , as well as in an hiv+ subset finally , by reviewing histories and on - study cart regimens , we estimated lifetime arv - month \n arv - month exposures were calculated by multiplying the number of months a patient was on each arv , summed over the lifetime . for this subsample , \n those on terminal cart had significantly greater arv - month exposures than those not on terminal cart ( on terminal cart : 204 18 exposure months ; off arv at death : 98 24 exposure months , p < 0.01 ) , as well as a longer mean duration of hiv infection ( on terminal cart 13.8 0.7 years ; off cart 10.8 0.9 years , p < 0.01 ) and higher cd4 cell counts ( on terminal cart : 212 30 cells / mm ; off cart : 99 38 cells / mm , p = 0.02 ) . within the group on terminal cart , individuals on protease inhibitor ( \n pi)based regimens ( n = 22 ) had higher si than individuals on non - nucleoside reverse transcriptase inhibitor ( nnrti)based regimens ( n = 15 ) ( si 0.482 0.016 for pi - based regimens ; 0.425 0.019 for nnrti - based regimens , p = 0.03 ) . \n four individuals died on nucleoside reverse transcriptase inhibitors ( nrti ) only , and 8 had other combinations that included other classes of agents . \n the overall population had a mean age of 50 years , was 66% male , and was 75% racial / ethnic minority , with significant representation of liver disease , hypertension , diabetes , hyperlipidemia , and herpes infections ( table 1 ) . \n hiv - positive and hiv - negative subgroups differed : the hiv - positive subgroup had more african americans and individuals with herpes infections , whereas the hiv - negative subgroup had more diabetes . \n both subgroups had high rates of cirrhosis and hcv . in this cart - era population , \n 98% of hiv - positive patients had antiretroviral ( arv ) exposures , but only 62% were on therapy at death ; reasons for this were multifactorial and included noncompliance as well as regimens being withheld in late stages of other medical disorders . \n the mean si for all categories assessed was > 0.4 , in the range of moderate svd ( table 2 ) . \n significant correlations with si were seen for african american race , age , hypertension , hcv , cirrhosis , and cart at death for hiv - positive patients . in the overall population , \n hiv status did not correlate with si , nor did diabetes , hyperlipidemia , gender , or herpes infections . within the hiv population , cocaine misuse , cd4 count , and plasma hiv load \n bivariate correlations between arteriolar sclerotic indices and clinical variables to address colinearity of significant factors , partial correlations were performed . \n eighty - two percent of patients with cirrhosis had hcv ; when hcv status was held constant , the cirrhosis effect on mean si became nonsignificant ( r = 0.08 , p = 0.38 ) . \n however , when cirrhosis was controlled , the hcv effect remained significant ( r = 0.19 , p = 0.04 ) . \n fifty - three percent of those with hypertension were african american ; when hypertension was controlled , significant independent effects of african american race remained ( r = 0.20 , p = 0.03 ) , and when african american race was controlled , significant effects of hypertension remained ( r = 0.21 , p = 0.02 ) . \n mean age of patients with hypertension ( 54.8 1.3 years ) was significantly higher than those who were normotensive ( 46.6 1.0 years , p < 0.01 ) ; when age was held constant , effects of hypertension on si remained ( r = 0.18 , p = 0.05 ) , but when controlling for hypertension , age became nonsignificant ( r = 0.13 , p = 0.15 ) . \n only hypertension was entered into multivariate regression . for the overall population , hcv , african american race , and hypertension \n accounted for 15% of the variance in si in multiple regression ( table 3 ) . \n for the hiv - positive group , the inclusion of terminal cart in the model increased r to 0.21 , with only hcv , hypertension , and cart remaining significant or at trend level ; hcv again had the largest effect . \n multivariate correlation of arteriolar sclerotic indices with clinical variables in both a combined hiv+ and hiv population , as well as in an hiv+ subset finally , by reviewing histories and on - study cart regimens , we estimated lifetime arv - month \n arv - month exposures were calculated by multiplying the number of months a patient was on each arv , summed over the lifetime . \n for this subsample , those on terminal cart had significantly greater arv - month exposures than those not on terminal cart ( on terminal cart : 204 18 exposure months ; off arv at death : 98 24 exposure months , p < 0.01 ) , as well as a longer mean duration of hiv infection ( on terminal cart 13.8 0.7 years ; off cart 10.8 0.9 years , p < 0.01 ) and higher cd4 cell counts ( on terminal cart : 212 30 cells / mm ; off cart : 99 38 cells / mm , p = 0.02 ) . within the group on terminal cart , \n individuals on protease inhibitor ( pi)based regimens ( n = 22 ) had higher si than individuals on non - nucleoside reverse transcriptase inhibitor ( nnrti)based regimens ( n = 15 ) ( si 0.482 0.016 for pi - based regimens ; 0.425 0.019 for nnrti - based regimens , p = 0.03 ) . four individuals died on nucleoside reverse transcriptase inhibitors ( nrti ) only , and 8 had other combinations that included other classes of agents . \n cerebral svd is common in aging and has traditional risk associations with hypertension and diabetes , components of the metabolic syndrome now encountered with greater frequency in hiv populations . \n concomitant with increased prevalence of metabolic abnormalities in hiv , increasing incidence of stroke and cerebral ischemia has been documented . while large artery atherosclerosis and cardiac embolism account for 30% of hiv - associated cerebrovascular events , small vessel occlusion is causative in approximately 20% . \n authors have commented on the diversity of mechanisms underlying stroke in hiv , the prevalence of cryptogenic events , and the possibility that unique hiv - associated factors are important . \n even with stable cart , arterial inflammation is increased in hiv , and a unique hiv - associated vasculopathy has been described . \n alternatively , metabolic risk factors have been linked to cryptogenic stroke and hiv - associated cognitive dysfunction . \n given the possibility of traditional and nontraditional risks for cerebrovascular events and the potential involvement of varying blood vessel calibers , direct neuropathologic study of the cerebral circulation in the context of hiv is necessary to better understand processes related to stroke and dementia . to date \n , hiv - associated cerebral svd has been indirectly measured through funduscopic analysis of retinal arterioles and mri of ischemic white matter changes . while valid techniques , both rely on assumptions that are not rigorously tested : that changes in retinal arterioles will reflect those in brain and that white matter lesions on neuroimaging can be ascribed to svd and not other hiv - associated pathologies . \n perhaps as a consequence of the indirect methodologies , these studies have been somewhat contradictory regarding cerebrovascular risks . \n assessment of cerebral small vessels poses challenges not encountered in the study of large- and medium - caliber arteries , which are amenable to neuroimaging and for which neuropathologic investigations have been published . \n thus , human brain collections present a unique opportunity to assess risk factors for cerebral svd with concrete visualization of endpoints , albeit with the biases that typically accompany autopsy populations . \n individuals succumbing to medical disorders are likely to be enriched for a variety of vascular risk factors that may or may not be representative of individuals with less dire medical conditions . \n the characteristics of our population demonstrate this potential selection bias : there were high rates of liver disease in both our hiv+ and hiv decedents . while a bias , this allowed us to investigate hepatic risks for svd , which has not been previously undertaken . \n there is a growing , controversial literature on whether hepatic disorders are protective or permissive for vascular sclerosis , predicated on the liver 's central role in metabolism , the relationship between fatty liver disease and metabolic syndrome , and inflammatory perturbations of viral hepatitis . \n hcv is of particular interest due to its prevalence , infecting 3% of the worldwide population . in a taiwanese study , \n chronic hcv has been linked to carotid artery atherosclerosis and intima - media thickness in patients with hiv , and positive - strand hcv rna and replication intermediates were detected in carotid artery plaques . \n both hcv and hcv / hiv coinfection were linked to increased cardiovascular risk and incident coronary artery disease . \n hcv was associated with elevations in plasma cell adhesion markers , potential indicators of endothelial dysfunction and precursors to atherosclerosis . \n however , it is important to note that while evidence of hcv - conferred atherogenic risk mounts , some have described the opposite . \n hcv is also implicated in inflammatory svd , as cryoglobulinemia and immune complex deposition may lead to leukocytoclastic vasculitis . \n cns involvement is postulated to occur , but direct demonstration of vasculitic hcv brain pathology is not yet reported . \n brain microvascular endothelial cell lines support hcv replication , and receptors for hcv cell entry are present in human brain blood vessels , but direct evidence of in vivo endothelial infection is lacking . in this study , we examined risk factors for cerebral svd by direct examination of brain tissues . \n chronic hypertension causes arteriolar remodeling and changes cerebral blood flow autoregulation , with increased wall thickness and reductions in lumenal diameter , elevating risk for stroke and cognitive dysfunction . \n our observation that hypertension accounts for age effects on si suggests that blood pressure , and not aging per se , constitutes the primary vascular risk . indeed , a prior autopsy study of putatively normotensive patients with cerebral svd documented evidence of hypertension in two - thirds of the population . \n in contrast , in our cohort , race made independent contributions to svd even when the effects of hypertension were considered . increased prevalence of hypertension in african americans was therefore not a reason for their greater si . \n racial differences in retinal arteriolar caliber have been documented , and smaller lumens / thicker walls in renal arterioles have been demonstrated in african american children compared to white children . \n thus , it is not surprising that african american race conveys risk for increased cerebral arteriolar wall thickness , although the basis of this disparity is unclear . \n we did not find an effect of diabetes , surprising in light of its documented role in microangiopathies . \n while diabetes is thought to be a risk for cerebral svd , some have noted a paucity of direct evidence for this association . \n diabetes has complex vascular impacts and is related to large vessel arteriosclerosis , where decreased compliance in and of itself can be associated with cerebral svd . in one cohort , diabetes constituted a risk for large but not small brain blood vessel thickening , suggesting a dissociation of these pathologies . in our cohort , we postulate that diabetes is not severe enough to result in end - organ microangiopathy ; in our mhbb autopsy study of renal disease , diabetic arteriolar lesions were present in only 3% of kidneys examined . \n we also failed to find an effect of cocaine misuse ; however , we did not ascertain the severity ( quantity and duration ) of the cocaine disorders and thus can not comment on this lack of association . \n the strongest independent risk for cerebral svd in our cohort was hcv , in both overall and hiv - positive populations . \n this is intriguing in light of increasing evidence for hcv - related vascular disorders and a recent publication documenting greater white matter abnormalities in hiv / hcv coinfected vs hiv monoinfected individuals . while it is possible that hcv directly affects cerebral small blood vessels , it is also possible that hcv - related large vessel arteriosclerosis results in arteriolar damage through reduced large vessel compliance and transmission of high pulse pressures during systole . \n it is possible that hcv - induced metabolic disorders predispose to arteriolar damage via dysregulated lipids and glucose and endothelial toxicity . \n it is possible that hcv - related systemic immunologic activation is vasculopathic , as hcv viremia results in elevated inflammatory burden . \n it is possible that hcv incites local inflammation contributing to vasculopathy , as compartmentalized hcv brain replication is documented . \n all these hypotheses merit examination in future studies . finally , of the hiv parameters , \n only cart at death conveyed independent risk for svd , not cd4 cell count prior to death or plasma hiv load . as only 79 of our 96 hiv+ subjects had a lifetime arv exposure history available at the time of autopsy , terminal cart was chosen as a variable for analysis because it could be accurately and reliably ascertained in the entire population . \n there is evidence that antiviral medications have direct endothelial toxicities , and drugs in the nrti class used as common regimen backbones have been implicated in a variety of mitochondrial and oxidative stress endothelial pathways . \n vascular toxic regimen at the time of death would result in enhanced vascular pathology ; it is unclear whether this effect would be reversible upon therapy cessation . \n other elements of contemporary cart regimens may also convey enhanced risk ; there is a variable literature suggesting that pis are of particular concern in the generation of vascular pathologies . of interest , in our sample , individuals dying on pi - based regimens had significantly greater si than those on nnrti - based regimens . \n on the other hand , terminal cart may not have a direct effect on cerebral vasculature and may be a surrogate for some other confounding characteristic . \n one possibility is that the greater lifetime arv exposures of those on terminal cart , in concert with the longer duration of their hiv disease , may have resulted in greater duration of proinflammatory and metabolic perturbations not captured in the syndromic diagnoses used for analyses . \n \n dr . susan morgello participated in study concept and design , analysis and interpretation , manuscript writing and revision , and study supervision . \n jacinta murray participated in study concept and design , acquisition of data , analysis and interpretation , and revision of the manuscript . \n sarah van der elst participated in acquisition of data , analysis and interpretation , and revision of the manuscript . \n desiree byrd participated in study concept and design , analysis and interpretation , and revision of the manuscript . \n \n s. morgello is on the advisory board for temple university comprehensive neuroaids center , on the editorial board for journal of neurovirology , and receives research support from the nih . \n d. byrd receives research support from the nih . go to neurology.org/nn for full disclosures .", "role": "user" }, { "content": "objectives : with the aging of hiv populations , vascular contributions to neuropathogenesis are increasingly important . \n indirect analyses of cerebral small vessel disease have been performed , but there have been no direct studies of human brain to elucidate risk factors for arteriolar sclerosis.methods:mean arteriolar wall thickness ( sclerotic index , si ) was measured in the deep cerebral white matter of 126 brains ( 96 hiv+ , 30 hiv ) . \n correlations with si were performed for age , sex , race , hypertension , hyperlipidemia , diabetes , obesity , cirrhosis , hepatitis c virus ( hcv ) infection , herpes infection , hiv infection , hiv risk , cocaine use , cd4 count , plasma hiv load , and combination antiretroviral therapy ( cart ) at the time of death.results:age , hypertension , race , hcv , and cirrhosis were associated with si ; of the hiv variables , only cart at death was associated with si . to address colinearity , \n partial correlations were run with hcv and cirrhosis , hypertension and race , and hypertension and age . \n with hcv controlled , cirrhosis lost significance ; with hypertension controlled , age lost significance . \n for the entire sample , hcv , african american race , and hypertension accounted for 15% of si variance in multivariate analysis . \n each was independently associated with si , and hcv had the largest effect . for the hiv sample , inclusion of cart in the model increased r2 to 0.205 , with only hcv , hypertension , and cart remaining significant or trend level.conclusions:this tissue - based analysis of cerebral arteriolar disease demonstrates that hcv constitutes an independent risk , in addition to african american race , hypertension , and cart . \n further study is needed to understand what aspects of hcv and cart contribute to cerebrovascular neuropathogenesis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: it is defined as the presence of an akinetic or dyskinetic structure with a wide connection to the left ventricle , which is normal in size and function . \n patients with lva are frequently asymptomatic but congestive heart failure , tachyarrhythmias and systemic embolisation may develop . even sudden death has been observed in lva patients and may be related to rupture of the lva [ 3 , 4 ] . in a group of 108 patients with either lva or diverticulum , who were followed during a median period of 50 months , vts occurred in only ten patients . \n . reported on cardiac mapping prior to ablation in four lva patients with recurrent exercise - induced syncope attributable to sustained fast monomorphic vt . \n the aneurysm was located in the inferolateral part of the left ventricle in all patients . \n mapping during sinus rhythm revealed abnormal signals ( fractionated or late potentials ) on the epicardium but not on the endocardium . in one patient with a stable vt , \n epicardial mapping showed a macrore - entrant vt with a focal pattern of activation at the endocardial surface . \n hence , our case is the first lva patient in whom ( 1 ) endocardial mapping revealed extensive conduction abnormalities ( low voltage , double and fractionated potentials ) , and ( 2 ) successful ablation was accomplished at the endocardial surface . \n our patient had a dilated left ventricle and depressed ejection fractionindicating a more advanced stage of lva compared with the patients in the study by ouyang et al . . \n the underlying mechanism of the vt is most likely a microre - entry circuit at the endocardial surface . \n ventricular tachycardia after cardiac surgery for lvas can be treated by endocardial catheter ablation at the endocardial surface of the left ventricle . \n extensive local conduction abnormalities are recorded within the endocardial surface of the aneurysm which may form the substrate of the ventricular tachycardia .", "role": "user" }, { "content": "we present a patient with a congenital left ventricular aneurysm who visited our outpatient clinic for a routine check - up and , during this visit , lost consciousness due to sustained ventricular tachycardia . in our patient , endocardial mapping revealed extensive conduction abnormalities , and successful ablation was accomplished at the endocardial surface .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: surgical clips are widely used in modern surgery . in addition to vascular and endoscopic clips , surgeons use metal clips liberally for marking purposes . \n to our knowledge , complications caused by placement of surgical marking clips have not been described before . \n this case report illustrates a complication of the placement of a surgical marking clip in the thoracic cavity and subsequent successful treatment . \n a 55-year - old man presented with cold fingers and numbness of the right hand 4 days after undergoing right upper lobectomy for a pt2n1 moderately differentiated adenocarcinoma of the lung . \n physical examination showed a significant temperature difference between the fingers of the right and the left hand . \n radial , ulnar , and brachial artery pulses were absent , and a slight loss of sensation was noted . \n the peak systolic velocity proximal and distal to the stenosis was 142 cm / s and 756 cm / s , respectively . \n subsequently , computed tomography angiography ( cta ) of the upper thorax and right arm was performed . \n this showed subtotal stenosis of the rsa adjacent to a metal clip placed just distally to the origin of the vertebral artery ( fig . 1 ) . \n this surgical clip was placed to mark the upper boundary in the thoracic cavity , where the tumor was adhesive to the parietal pleura , for possible future radiotherapy.fig . \n 1multiplanar reformat reconstruction of a ct image showing subtotal stenosis of the rsa caused by a surgical marking clip multiplanar reformat reconstruction of a ct image showing subtotal stenosis of the rsa caused by a surgical marking clip the patient was immediately admitted to the angiography suite to perform selective angiogram of the rsa through a groin approach ( fig . 2 ) . \n the stenosis was passed using a glidewire ( terumo europe , leuven , belgium ) and a 5f headhunter catheter ( boston scientific , nieuwegein , the netherlands ) . \n subsequently , the glidewire was replaced for an amplatz guidewire ( boston scientific , nieuwegein , the netherlands ) . \n a stiff catheter with a subtle tip was used to pass the curve of the aortic arch . \n the catheter was replaced for a semicompliant 8-mm pta balloon catheter ( optapro ; cordis ) . \n the balloon diameter was chosen after measurement of the normal lumen of the rsa distal to the stenosis on ct . \n the stenosis was dilated to 8.5 mm , determined by an insufflation table , thereby pushing the surgical clip off the artery caudally . \n the balloon was removed and replaced by a 6f monorail catheter ( heart medical europe b.v , best , the netherlands ) , which was placed with its tip at the origin of the rsa . \n selective contrast injections showed an undamaged and patent rsa . a covered stent ( fluency vascular graft , bard benelux n.v . \n , nieuwegein , the netherlands ) was available in case of dissection , but the intervention was successful and uncomplicated , and the catheter and guidewire were subsequently removed . \n the responsible thoracic surgeon was informed . at follow - up in the outpatient ward , \n 2a selective angiogram of the rsa showing a metal clip on the artery just distally to the origin of the vertebral artery . \n b angiogram of the rsa showing passage of a catheter through the stenosis with intraluminal contrast injection to confirm its position distally to the stenosis . \n d angiogram of the rsa showing restoration of blood flow and displacement of the surgical clip a selective angiogram of the rsa showing a metal clip on the artery just distally to the origin of the vertebral artery . \n b angiogram of the rsa showing passage of a catheter through the stenosis with intraluminal contrast injection to confirm its position distally to the stenosis . \n d angiogram of the rsa showing restoration of blood flow and displacement of the surgical clip \n arterial stenosis caused by placement of a surgical clip is an uncommon complication , with only one report in literature ; however , it did not involve a marking clip as in this case report . \n fortunately , surgical marking clips are not applied as tightly as vascular clips , the purpose of which is to occlude blood vessels . \n this might have been the reason for the late onset of symptoms and mild clinical presentation in this case . \n thus , it was assumed that the misplaced clip might be pushed off the rsa from within instead of performing a second thoracotomy to extract the clip . \n of course , the backup plan would be a second thoracotomy to extrude the clip or , in the case of a complication by the endovascular procedure , to save the rsa . \n the only case report on this topic describes a surgically obstructed left internal mammary artery graft by a clip after coronary bypass surgery . \n there are some more reports on vascular stenosis by medical devices , but these describe complications after vascular closing devices , such as the starclose closure device [ 24 ] . in these cases , \n a surgical marking clip , placed in the upper boundary of the surgical resection of the upper pulmonary lobe , caused subtotal stenosis of the rsa . during the surgical procedure , \n the misplacement of the clip was not recognized because it was placed far up in the thoracic cavity . \n thus , the origin of stenosis was thought to be atherosclerotic , and cta was performed first instead of performing angiography directly . \n of course , when thinking of an obstruction caused by corpora aliena , one could even have first performed ct with dual - energy imaging . \n subsequently , a selective angiogram was performed , and the clip was successfully pushed away with use of an angioplasty balloon . after this incident in our institution , \n we have discussed the use of surgical marking clips in oncologic upper thoracic surgery , but for now there are no other means for other marking techniques in our institution . \n arterial stenosis caused by a surgical marking clip may feasibly be treated first with an endovascular procedure , consisting of an angiogram with pta , before performing a second surgery .", "role": "user" }, { "content": "this report describes a rare vascular complication of surgical placement of a marking clip and a possible approach to problem solving . a 55-year - old patient presented with loss of sensation in the fingers and loss of peripheral pulsations in the right arm 4 days after right upper lobectomy for a pt2n1 moderately differentiated adenocarcinoma of the lung . duplex examination and computed tomography \n were performed the same day and showed a subtotal stenosis of the right subclavian artery , which was caused by the surgical placement of a metal clip to mark the surgical boundary . \n selective angiography was subsequently performed . \n percutaneous transluminal angioplasty ( pta ) successfully dilated the stenosis and pushed the clip off . \n flow in the right subclavian artery ( rsa ) was completely restored as were neurology and peripheral pulses . in conclusion , arterial stenosis by a surgical ( marking ) clip \n may be feasibly treated with pta .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: within the industrialized countries , the lifetime breast cancer risk for women is around 9% to 10% , and in some parts of the world it is around 25% , with a tendency to affect younger women . beside individual systemic treatment options , surgery and radiotherapy \n breast surgeons are able to excise only the tumour within clear margins without removing the entire breast , called breast - conserving therapy \n this well accepted and reliable therapy also involves obligatory adjuvant radiotherapy of the affected breast . \n chemotherapy , immunotherapy , and antihormonal therapy are not frequently used as adjuvant therapy . in case of large tumours relative to the size of the breast , or unfavorable anatomical tumour location within the breast \n asymmetry of the breasts , unnatural breast shape with large defect - zones , and chronic pain cause patients to return to the breast surgeon . after radiation therapy , the reconstructive surgeon \n is faced with irritated skin and a much higher percentage of wound healing problems , and implant - based reconstruction is only recommended in selective cases . in contrast , post - radiation reconstruction can frequently only be solved by the use of additional extended autologous surgery . in our plastic surgery unit , which specializes in breast reconstruction , in such cases \n we offer a skin / nipple - sparing mastectomy , followed by primary breast reconstruction based on free autologous tissue transfer , if possible , mostly as a diep flap , in attempting to avoid the need for post - radiation reconstruction . with regard to dcis \n , younger patients , multiple risk factors , the aim of sustained long - term good results , and optional abandonment of otherwise inevitable radiotherapy in case of bct , skin - sparing mastectomy and immediate reconstruction , either with implants or autologous tissue , can serve as initial alternative and successful treatment option to obtain local control and cosmesis . \n our plastic surgery unit belongs to an interdisciplinary breast centre , and specializes in breast reconstruction . \n we have been able to reconstruct more than 1050 breasts by free autologous tissue transfer . among them , we were confronted with patients who underwent bct plus adjuvant radiotherapy in the past \n . referred patients with asymmetry of the breasts and unnatural breast shape and large defect - zones are seen in our outpatient clinic . beside a partial augmentation of the volume , the skin envelope also needed to be replaced . \n after radiotherapy , we try to avoid enlarging the skin envelope with any type of skin expansion . in our opinion \n the only solution of this problem is autologous tissue reconstruction , with the possibility to enlarge the skin envelope by inserting a skin island after skin - sparing or subcutaneous mastectomy . between july 2004 and december 2011 we operated on 64 patients with poor cosmetic results after extended bct and adjuvant radiotherapy ; 41 \n received a skin - sparing or subcutaneous mastectomy followed by a diep flap , and in 23 patients followed by a free ms2-tram flap as reconstruction procedure . in the latter cases , \n the donor site of a diep flap - based breast reconstruction is basically comparable to an abdominoplasty , in which the waste skin and fatty tissue of the external abdomen is used without affecting abdominal wall integrity . \n the blood supply of the elevated tissue complex is ensured by a single or multiple perforator vessels connected to the inferior epigastric artery . normally muscle tissue is not needed . in our cases , \n this surgical technique has been described in detail elsewhere [ 68 ] . in cases of poor cosmetic results after bct in the past , we are confronted with the situation of insufficient skin envelopes associated with remaining breast tissue . in some cases \n an implant was inserted to augment the breast volume . in a first step we always removed the implant , including the capsule and the remaining breast tissue in terms of a nipple- or skin- sparing mastectomy . in cases after bct with asymmetry of breast volume , we performed a skin - sparing or subcutaneous mastectomy , depending on the oncologic situation . with the technique of diep flap - based reconstruction , we were able to augment volume and simultaneously increase the skin envelope by inserting a size - adapted skin island . \n during the past 7 years , between july 2004 and december 2011 , we performed 1068 breast reconstruction procedures with autologous tissue transfer in 940 patients , mostly using the diep flap in 760 reconstructions followed by ms-2-tram flap ( 294 reconstructions ) and free flaps of gluteal area origin ( s-/i - gap : 10 cases ) ( table 1 ) . in our hospital the standard follow - up after free tissue transfer for breast reconstruction includes postoperative appointments in the outpatient centre at 1 , 3 , 6 and 12 months after surgery . \n all included patients presented in our offices within these time frames . in all free flap - based breast reconstruction procedures we had total flap loss in 0.8% ( 9 cases ) . \n a partial flap loss and margin necrosis occurred in 1.3% ( 14 cases ) and 2.5% ( 27 cases ) , respectively . \n hematoma within the breast occurred in 26 cases , and at the abdominal wall in 9 cases . \n none of the 4 patients with a small hernia within the abdominal wall had to undergo an additional surgical intervention in terms of hernioplasty . within the group of patients after bct \n , we performed 41 diep flaps and 23 ms-2 tram flaps after skin - sparing or subcutaneous mastectomy to reconstruct the breast ( figure 1 ) . among this group , \n hematoma within the breast occurred in 4 cases and at the abdominal wall in 1 case . \n none of the patients showed small hernias within the abdominal wall at follow - up . a statistical comparison to the overall group with the group of bct and skin - sparing or subcutaneous mastectomy with immediate reconstruction showed a slightly higher incidence of total flap loss ( 0.8% compared to 1.6% ) and partial flap loss ( 1.3% compared to 3.1% ) , respectively ( table 2 ) . \n except for 1 total flap loss , we achieved good to excellent cosmetic results after the first reconstructive procedure . in the 2 cases with partial flap loss , the tissue transfer also led to a natural breast shape . \n after excising the necrotic tissue , we have been able to reshape the breast in an additional operation . \n a pedicled musculocutaneous latissimus dorsi flap was moved into the defect zone , with a very good cosmetic result . in case of total flap insufficiency \n in this situation , the latissimus dorsi flap is an excellent salvage flap . in the long - term , \n 1 patient had abdominal wall weakness after initial bct , but this did not lead to an additional operation . no hernia was seen up to 1 year postoperatively within this group . with these surgical procedures we could correct the asymmetry after bct with skin - sparing or subcutaneous mastectomy and immediate autologous reconstruction in all cases . \n the introduction of oncoplastic surgery as a volume displacement procedure after breast tumour removal made the strategy of breast - conserving therapy a more powerful tool in the treatment of breast cancer . \n regarding this , a question arises : why do we still perform mastectomies ? there are oncological - based reasons for decision making , including multicentric disease and inflammatory cancer , and most recurrences after bct with previous breast irradiation lead to the indication of mastectomy . \n additionally , the possibilities in recognizing genetic dispositions in case of brca - associated breast cancer give us the chance for prophylactic risk reduction through , for example , nipple - sparing mastectomy . \n our experience suggests additional situations in which to offer nipple-/skin - sparing mastectomy to certain patients . \n regardless of using bct or skin - sparing mastectomy with immediate reconstruction , it should be an oncologically safe procedure , with the best surgical outcome for the patient . \n however , after bct and radiation therapy , our experience in reconstruction with diep flap or ms-2 tram flap after skin - sparing or subcutaneous mastectomy shows a slightly higher complication rate compared to our overall reconstruction procedures \n . this might be due to the complexity of the procedure and the previously performed surgery . \n we have to deal with irradiated skin , scars and remaining breast tissue , and the goal for an optimizing patient satisfaction . \n furthermore , this might be the only remaining surgical choice for the patient . in all patients , who received a microsurgical reconstruction ( n=1068 flaps ) \n , we had a complete flap loss of 0.8% , compared to a flap loss 1.6% in patients after bct and reconstruction . \n this might be a very low complication rate for flap loss , but salvage procedures are needed in the latter group to solve the problem . although mastectomy is an effective procedure , it can have a negative impact on body image , sense of attractiveness , and sexual function . \n bct , which aims to conserve as much of the unaffected breast tissue as possible , is viewed by many surgeons as the option that most patients prefer , particularly among those who are fully informed about all of the available choices . \n however , survey data from a cohort of 125 women undergoing surgical treatment of breast cancer , who were educated on mastectomy and bct , showed that 35% opted for mastectomy even though they understood the benefits of bct . in the us , \n this may be in part due to increased use of magnetic resonance imaging , which commonly identifies additional tumour foci in newly diagnosed patients , leading in some cases to a mastectomy that might not have been undertaken otherwise . \n it could also be driven by fear of disease recurrence or by the poor aesthetic outcomes that are reported by approximately 30% of women after bct . \n further , the increase might be mainly based on the patient s decision for contralateral mastectomy . \n we have to consider that poor cosmetic long - term results after bct mean a prolonged period of suffering . \n hoping for amelioration of the cosmetic result over time , they wait months or years before asking a breast surgeon about correction . if they decide on a surgical procedure , it always means at least 1 additional operation . for those patients who choose it , mastectomy coupled with breast \n reconstructive surgery offers the dual benefits of confidence in tumour eradication and the restoration of femininity , body image , vitality and quality of life . in patients who have undergone breast reconstruction following mastectomy , quality of life scores \n have been found to be equivalent to those of the general population . despite these successes , rates of breast reconstruction \n are low . in a recent audit of 18,216 patients in the uk who underwent mastectomy , less than 30% received breast reconstruction ( 18.6% immediate reconstruction , 9.5% delayed reconstruction ) . \n it is possible that this low rate of reconstructive surgery is driven in part by a failure by some attending physicians to discuss reconstructive options with patients . \n in addition , institutions vary in the procedures they provide , and this may limit the choices available to patients . also , in some instances there may be poor coordination and communication between the various specialties involved in managing breast cancer surgery . \n the aim should be to discuss all options with patients , and to make the full range of surgical procedures available . \n if this were the case , we would anticipate an increase in the number of breast reconstruction procedures . \n in cases of large tumour sizes and/or difficult tumour locations , the initial oncologic breast surgeon should inform the patient of a possibly poor cosmetic result after bct and radiation . \n therefore , a skin - sparing or subcutaneous mastectomy with primary breast reconstruction following a diep flap or ms-2 tram flap should be discussed as a valid alternative . however \n , poor aesthetic outcomes of bct can be corrected in skin - sparing or subcutaneous mastectomy with immediate reconstruction using the diep flap or ms-2 tram flap reconstruction , with low complication rates and high level of satisfaction with the aesthetic outcome .", "role": "user" }, { "content": "summarybackgroundcurrently about 70% of women who suffer from breast cancer undergo breast - conserving therapy ( bct ) without removing the entire breast . \n thus , this surgical approach is the standard therapy for primary breast cancer . if corrections are necessary , the breast surgeon is faced with irritated skin and higher risks of complications in wound healing . \n after radiation , an implant - based reconstruction is only recommended in selected cases . \n correction of a poor bct outcome is often only solved with an additional extended operation using autologous reconstruction.material/methodsin our plastic surgery unit , which focuses on breast reconstruction , we offer a skin - sparing or subcutaneous mastectomy , followed by primary breast reconstruction based on free autologous tissue transfer to correct poor bct outcomes . between july 2004 and may 2011 we performed 1068 deep inferior epigastric artery perforator ( diep ) flaps for breast reconstruction , including 64 skin - sparing or subcutaneous mastectomies , followed by primary diep breast reconstruction procedures after bct procedures.resultsin all free flap - based breast reconstruction procedures \n , we had a total flap loss in 0.8% ( 9 cases ) . within the group of patients after bct \n , we performed 41 diep flaps and 23 ms-2 tram flaps after skin - sparing or subcutaneous mastectomies to reconstruct the breast . among this group we had of a total flap loss in 1.6% ( 1 case).conclusionsin cases of large tumour sizes and/or difficult tumour locations , the initial oncologic breast surgeon should inform the patients of a possibly poor cosmetic result after bct and radiation . in our opinion a skin - sparing mastectomy with primary breast reconstruction should be discussed as a valid alternative .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: two cats were evaluated for progressive exercise intolerance , dyspnea and unilateral infiltrate of the left lung . computed tomography angiography ( cta ) revealed absence of the right pulmonary artery in both cats with systemic arterial collateral vessels perfusing the right segmental pulmonary arteries . in one case , the collateral vessels arose from the esophageal artery , while in the other case they derived off the right costocervical trunk . \n one cat was diagnosed with pulmonary hypertension and was euthanized owing to progressive respiratory distress despite medical management with sildenafil , pimobendan , clopidogrel and furosemide . \n the other cat , without echocardiographic evidence of pulmonary hypertension , was successfully managed with furosemide and enalapril for more than 4 years . \n cta allowed visualization of a rare congenital heart malformation , unilateral absence of the right pulmonary artery , in two cats and accurately characterized the source of collateral blood supply to the affected lung . \n severe pulmonary hypertension may be a negative prognostic factor in cats with this condition as medical therapy in the cat without evidence of pulmonary hypertension resolved clinical signs , while the cat with severe pulmonary hypertension died from the disease . \n a 5-year - old , spayed , female , domestic shorthair cat ( cat 1 ) presented to the ohio state university s veterinary medical center for evaluation of acute disorientation , tachypnea , lethargy and anorexia . \n a grade iii / vi systolic right parasternal heart murmur and focal crackles in the ventral left thorax were noted on auscultation . \n complete blood count , serum chemistry , urinalysis and blood pressure were within reference intervals . \n thoracic radiographs ( figure 1 ) revealed moderate cardiomegaly ( vertebral heart size of 8.8 ) , a severe unstructured interstitial pattern throughout the left lung lobes , leftward shift of the mediastinum with hyperinflation of the right lung lobes and a mild unstructured interstitial pattern within the right caudal lung lobe . \n ( a ) ventrodorsal and ( b ) lateral thoracic radiographs from cat 1 , with unilateral absence of the right pulmonary artery . \n an unstructured interstitial pattern is apparent in the left lung lobes with marked dilation of the left caudal lobar pulmonary artery ( arrow ) and vein . \n on transthoracic echocardiography ( tte ) , trace pericardial effusion was noted with , subjectively , moderate dilation of the right atrium and right ventricle . \n the pulmonary trunk ( pt ) and left pulmonary artery ( lpa ) were severely dilated with a pulmonary valve annulus of 12.4 mm compared with an aortic valve annulus of 8.5 mm , and the right pulmonary artery ( rpa ) was not visualized . \n several tortuous vessels with continuous , turbulent flow on color and spectral doppler imaging were noted at the heart base ( figure 2 ) . \n moderate tricuspid regurgitation with a peak velocity of 4.6 m / s and no evidence of pulmonary valve stenosis predicted a systolic right ventricular systolic pressure of at least 90 mmhg . \n differential diagnoses included pulmonary hypertension ( ph ) secondary to extra - cardiac left - to - right shunt flow , peripheral pulmonary arterial stenosis , pulmonary artery dissection , congenital absence of the rpa , heartworm disease or thromboembolic disease . \n ( a ) a two - dimensional image at the heart base showing the aorta ( ao ) , left atrium ( la ) and pulmonary trunk ( pt ) . \n ( b ) a similar image to that in ( a ) is shown with color doppler imaging demonstrating the turbulent , continuous flow of aberrant vessels around the heart base ( arrows ) . \n thoracic computed tomography angiography ( cta ) images ( figure 3 ) were acquired with an eight - slice ct scanner ( ge lightspeed ultra 8 slice ) using the following parameters : 120 kvp , 49 ma , 1.25 mm slice thickness , spiral pitch of 1.35 and 0.6 s / rotation . \n iodinated contrast medium ( 240 mg iohexol / ml ; omnipaque ) was injected as a single bolus ( 12 ml ; 3 ml / kg iv ) into the right cephalic vein using a power injector and post - contrast images were acquired starting 3 s after injection from cranial to caudal , followed by an additional series from caudal to cranial . \n the right segmental pulmonary arteries were supplied by tortuous blood vessels within the mediastinum , which were interpreted as bronchial arteries . \n there were no obvious filling defects within the pulmonary arteries to suggest pulmonary thrombi or heartworm emboli . \n ( a ) dorsal multi - planar reformat showing the single left pulmonary artery ( arrow ) with absence of a bifurcation at the pulmonary trunk ( # ) . \n contrast is seen in the cranial vena cava ( crvc ) and right atrium ( ra ) as well . \n ( b ) dorsal reformat in a lung window showing diffuse interstitial infiltrates in the mid - to - ventral left lung with reduced lung volume compared with the right . \n ( c ) sagittal multi - planar reformat showing multiple tortuous systemic collateral arterial vessels ( * ) arising from the celiac and esophageal arteries , which course cranially to perfuse the right segmental pulmonary arteries . \n ( d ) a volume - rendered three - dimensional reformatted image from a dorsal perspective demonstrates the lack of a right pulmonary artery with the pulmonary trunk ( pt ) continuing solely as the left pulmonary artery ( lpa ) . note that the left \n right orientation of ( c ) is opposite to that of ( a ) . ao = aorta . \n the cat was diagnosed with congenital absence of the rpa and prescribed clopidogrel ( 18.75 mg po q24h ) , sildenafil ( 6.25 mg po q8h ) and pimobendan ( 1.25 mg po q12h ) . on re - evaluation \n 2 days later after a marked decrease in energy level and mild dyspnea at home , repeat thoracic radiographs demonstrated increased distention of the left caudal lobar pulmonary artery , resolution of the mediastinal shift , an unstructured interstitial pattern throughout all lung lobes most pronounced in the left caudal lung lobe and mild pleural effusion . \n right - sided congestive heart failure was presumed from the pleural effusion and furosemide prescribed ( 10 mg sc q12h ) . \n the cat was euthanized without clinical evaluation 8 days later owing to progressive dyspnea and lethargy at home , despite medical management . \n autopsy revealed severe cardiomegaly with marked right atrial dilation , mild pericardial effusion and diffuse hyperinflation and locally extensive emphysema of the left lung . \n the pt was dilated and continued solely as the lpa with absence of the rpa ( figure 4a ) . \n small - caliber arterial varices derived from the esophageal branch of the celiac artery were found as the primary supply blood to the right segmental pulmonary arteries ( figure 4b ) , rather than hypertrophy of the bronchoesophageal circulation , as initially suspected . \n microscopically , there was severe unilateral subacute interstitial pneumonia in the right lung , consistent with decompensated ph . \n sections of right lung contained multiple thick - walled and tortuous arterioles , reflecting aortic collateral origin and systemic arterial pressures . \n the left lung histopathology revealed severe necrotizing interstitial pneumonia , marked alveolar histiocytosis , type ii pneumocyte hyperplasia , high protein edema and alveolar emphysema . \n microscopically , the myocardium was unremarkable other than rare atrophic myofibers in the right ventricle and moderate , subacute multifocal myofiber degeneration in the right atrium . \n autopsy images from cat 1 showing unilateral absence of the right pulmonary artery in a 5-year - old cat . \n ( a ) the left lung is hyperinflated , while the right lung appears partially collapsed . \n the pulmonary trunk continues solely as the left pulmonary artery ( lpa ) ; no remnant of right pulmonary artery can be seen . \n ( b ) the image shows the origin of the systemic arterial collateral vessels supplying the right lung . \n the aorta ( ao ) gives rise to the celiac artery ( + ) , from which derives the left gastric artery ( arrow ) and many tortuous varices ( * ) tracking along the esophagus ( e ) . \n d = diaphragm . a 3-year - old , castrated , male , domestic shorthair cat ( cat 2 ) presented for cardiac evaluation following a 2 month history of tachypnea . on physical examination , a grade iii / vi systolic murmur was ausculted over the right parasternal border . \n renal values , packed cell volume , total protein and blood pressure were within reference limits . \n the cat was receiving furosemide ( 12.5 mg po , am ; 18.75 mg po , pm ) at the time of initial evaluation . \n prior thoracic radiographs ( figure 5 ) from cat 2 were reviewed , which showed a normal heart size ( vertebral heart size of 7.3 ) , enlarged left caudal lobar pulmonary artery and vein , a mediastinal shift to the right , and slight interstitial opacity throughout the left lung lobes . \n on tte , the pt and lpa were visualized , but two - dimensional and color doppler evidence of a rpa could not be observed . \n pulmonary hypertension could not be documented , as tricuspid regurgitation and pulmonary insufficiency were not apparent , and the right ventricle was read as equivocal concentric hypertrophy with a normal right atrium . \n ( a ) ventrodorsal and ( b ) lateral thoracic radiographs from cat 2 with unilateral absence of the right pulmonary artery . \n enlargement of the left caudal lobar pulmonary artery ( arrow ) and vein is apparent with a mediastinal shift to the right and slight interstitial opacity throughout the left lung lobes . \n a tortuous systemic arterial collateral vessel arose from the right costocervical trunk and extended caudally to anastamose with the right segmental pulmonary arteries . \n the parenchymal changes noted in the left lung on thoracic radiographs had resolved following diuretic therapy administered for 2 weeks prior to ct evaluation . based on echocardiographic and ct findings , the cat was diagnosed with congenital absence of the rpa . \n the cat was prescribed enalapril ( 1.25 mg po q12h ) in addition to the previously prescribed furosemide . at the time of writing \n , 4 years have passed and the cat has remained asymptomatic , without recurrence of pulmonary infiltrates . \n the cat has continued to receive furosemide and enalapril as previously prescribed . on follow - up tte \n performed annually since cta , unchanged mild thickening of the right ventricular free wall and interventricular septum with absence of any appreciable tricuspid or pulmonary insufficiency have been observed . as such , the presence or absence of ph can not be confirmed , though the lack of remodeling suggests no or only mild ph . \n ( a ) dorsal multi - planar reformat showing prominent left caudal lobar pulmonary artery ( arrow ) and vein , with diminutive right caudal lobar pulmonary artery and vein . \n ( b ) a sagittal multi - planar reformat showing the origin and course of the systemic arterial collateral vessel ( arrowheads ) arising from the right costocervical trunk and coursing caudally to perfuse the right segmental pulmonary arteries . \n ( c ) a volume - rendered three - dimensional reformatted image from a dorsal perspective demonstrates the lack of a right pulmonary artery with the pulmonary trunk continuing solely as the left pulmonary artery ( lpa ) . \n rcrpv = right cranial pulmonary vein ; rmidpv = right middle pulmonary vein ; rcapv = right caudal pulmonary vein ; lcapv = left caudal pulmonary vein \n a 5-year - old , spayed , female , domestic shorthair cat ( cat 1 ) presented to the ohio state university s veterinary medical center for evaluation of acute disorientation , tachypnea , lethargy and anorexia . \n a grade iii / vi systolic right parasternal heart murmur and focal crackles in the ventral left thorax were noted on auscultation . \n complete blood count , serum chemistry , urinalysis and blood pressure were within reference intervals . \n thoracic radiographs ( figure 1 ) revealed moderate cardiomegaly ( vertebral heart size of 8.8 ) , a severe unstructured interstitial pattern throughout the left lung lobes , leftward shift of the mediastinum with hyperinflation of the right lung lobes and a mild unstructured interstitial pattern within the right caudal lung lobe . \n ( a ) ventrodorsal and ( b ) lateral thoracic radiographs from cat 1 , with unilateral absence of the right pulmonary artery . \n an unstructured interstitial pattern is apparent in the left lung lobes with marked dilation of the left caudal lobar pulmonary artery ( arrow ) and vein . \n on transthoracic echocardiography ( tte ) , trace pericardial effusion was noted with , subjectively , moderate dilation of the right atrium and right ventricle . \n the pulmonary trunk ( pt ) and left pulmonary artery ( lpa ) were severely dilated with a pulmonary valve annulus of 12.4 mm compared with an aortic valve annulus of 8.5 mm , and the right pulmonary artery ( rpa ) was not visualized . \n several tortuous vessels with continuous , turbulent flow on color and spectral doppler imaging were noted at the heart base ( figure 2 ) . \n moderate tricuspid regurgitation with a peak velocity of 4.6 m / s and no evidence of pulmonary valve stenosis predicted a systolic right ventricular systolic pressure of at least 90 mmhg . \n differential diagnoses included pulmonary hypertension ( ph ) secondary to extra - cardiac left - to - right shunt flow , peripheral pulmonary arterial stenosis , pulmonary artery dissection , congenital absence of the rpa , heartworm disease or thromboembolic disease . \n ( a ) a two - dimensional image at the heart base showing the aorta ( ao ) , left atrium ( la ) and pulmonary trunk ( pt ) . \n ( b ) a similar image to that in ( a ) is shown with color doppler imaging demonstrating the turbulent , continuous flow of aberrant vessels around the heart base ( arrows ) . \n thoracic computed tomography angiography ( cta ) images ( figure 3 ) were acquired with an eight - slice ct scanner ( ge lightspeed ultra 8 slice ) using the following parameters : 120 kvp , 49 ma , 1.25 mm slice thickness , spiral pitch of 1.35 and 0.6 s / rotation . \n iodinated contrast medium ( 240 mg iohexol / ml ; omnipaque ) was injected as a single bolus ( 12 ml ; 3 ml / kg iv ) into the right cephalic vein using a power injector and post - contrast images were acquired starting 3 s after injection from cranial to caudal , followed by an additional series from caudal to cranial . \n the right segmental pulmonary arteries were supplied by tortuous blood vessels within the mediastinum , which were interpreted as bronchial arteries . \n there were no obvious filling defects within the pulmonary arteries to suggest pulmonary thrombi or heartworm emboli . \n ( a ) dorsal multi - planar reformat showing the single left pulmonary artery ( arrow ) with absence of a bifurcation at the pulmonary trunk ( # ) . \n contrast is seen in the cranial vena cava ( crvc ) and right atrium ( ra ) as well . \n ( b ) dorsal reformat in a lung window showing diffuse interstitial infiltrates in the mid - to - ventral left lung with reduced lung volume compared with the right . \n ( c ) sagittal multi - planar reformat showing multiple tortuous systemic collateral arterial vessels ( * ) arising from the celiac and esophageal arteries , which course cranially to perfuse the right segmental pulmonary arteries . \n ( d ) a volume - rendered three - dimensional reformatted image from a dorsal perspective demonstrates the lack of a right pulmonary artery with the pulmonary trunk ( pt ) continuing solely as the left pulmonary artery ( lpa ) . note that the left \n right orientation of ( c ) is opposite to that of ( a ) . ao = aorta . \n the cat was diagnosed with congenital absence of the rpa and prescribed clopidogrel ( 18.75 mg po q24h ) , sildenafil ( 6.25 mg po q8h ) and pimobendan ( 1.25 mg po q12h ) . on re - evaluation \n 2 days later after a marked decrease in energy level and mild dyspnea at home , repeat thoracic radiographs demonstrated increased distention of the left caudal lobar pulmonary artery , resolution of the mediastinal shift , an unstructured interstitial pattern throughout all lung lobes most pronounced in the left caudal lung lobe and mild pleural effusion . \n right - sided congestive heart failure was presumed from the pleural effusion and furosemide prescribed ( 10 mg sc q12h ) . \n the cat was euthanized without clinical evaluation 8 days later owing to progressive dyspnea and lethargy at home , despite medical management . \n autopsy revealed severe cardiomegaly with marked right atrial dilation , mild pericardial effusion and diffuse hyperinflation and locally extensive emphysema of the left lung . \n the pt was dilated and continued solely as the lpa with absence of the rpa ( figure 4a ) . \n small - caliber arterial varices derived from the esophageal branch of the celiac artery were found as the primary supply blood to the right segmental pulmonary arteries ( figure 4b ) , rather than hypertrophy of the bronchoesophageal circulation , as initially suspected . \n microscopically , there was severe unilateral subacute interstitial pneumonia in the right lung , consistent with decompensated ph . \n sections of right lung contained multiple thick - walled and tortuous arterioles , reflecting aortic collateral origin and systemic arterial pressures . \n the left lung histopathology revealed severe necrotizing interstitial pneumonia , marked alveolar histiocytosis , type ii pneumocyte hyperplasia , high protein edema and alveolar emphysema . \n microscopically , the myocardium was unremarkable other than rare atrophic myofibers in the right ventricle and moderate , subacute multifocal myofiber degeneration in the right atrium . \n autopsy images from cat 1 showing unilateral absence of the right pulmonary artery in a 5-year - old cat . \n ( a ) the left lung is hyperinflated , while the right lung appears partially collapsed . \n the pulmonary trunk continues solely as the left pulmonary artery ( lpa ) ; no remnant of right pulmonary artery can be seen . \n ( b ) the image shows the origin of the systemic arterial collateral vessels supplying the right lung . \n the aorta ( ao ) gives rise to the celiac artery ( + ) , from which derives the left gastric artery ( arrow ) and many tortuous varices ( * ) tracking along the esophagus ( e ) . \n a 3-year - old , castrated , male , domestic shorthair cat ( cat 2 ) presented for cardiac evaluation following a 2 month history of tachypnea . on physical examination , a grade iii / vi systolic murmur was ausculted over the right parasternal border . \n renal values , packed cell volume , total protein and blood pressure were within reference limits . \n the cat was receiving furosemide ( 12.5 mg po , am ; 18.75 mg po , pm ) at the time of initial evaluation . \n prior thoracic radiographs ( figure 5 ) from cat 2 were reviewed , which showed a normal heart size ( vertebral heart size of 7.3 ) , enlarged left caudal lobar pulmonary artery and vein , a mediastinal shift to the right , and slight interstitial opacity throughout the left lung lobes . \n on tte , the pt and lpa were visualized , but two - dimensional and color doppler evidence of a rpa could not be observed . \n pulmonary hypertension could not be documented , as tricuspid regurgitation and pulmonary insufficiency were not apparent , and the right ventricle was read as equivocal concentric hypertrophy with a normal right atrium . \n ( a ) ventrodorsal and ( b ) lateral thoracic radiographs from cat 2 with unilateral absence of the right pulmonary artery . enlargement of the left caudal lobar pulmonary artery ( arrow ) and vein is apparent with a mediastinal shift to the right and slight interstitial opacity throughout the left lung lobes . \n a tortuous systemic arterial collateral vessel arose from the right costocervical trunk and extended caudally to anastamose with the right segmental pulmonary arteries . \n the parenchymal changes noted in the left lung on thoracic radiographs had resolved following diuretic therapy administered for 2 weeks prior to ct evaluation . based on echocardiographic and ct findings , the cat was diagnosed with congenital absence of the rpa . \n the cat was prescribed enalapril ( 1.25 mg po q12h ) in addition to the previously prescribed furosemide . at the time of writing \n , 4 years have passed and the cat has remained asymptomatic , without recurrence of pulmonary infiltrates . the cat has continued to receive furosemide and enalapril as previously prescribed . on follow - up tte \n performed annually since cta , unchanged mild thickening of the right ventricular free wall and interventricular septum with absence of any appreciable tricuspid or pulmonary insufficiency have been observed . as such , the presence or absence of ph can not be confirmed , though the lack of remodeling suggests no or only mild ph . \n ( a ) dorsal multi - planar reformat showing prominent left caudal lobar pulmonary artery ( arrow ) and vein , with diminutive right caudal lobar pulmonary artery and vein . \n ( b ) a sagittal multi - planar reformat showing the origin and course of the systemic arterial collateral vessel ( arrowheads ) arising from the right costocervical trunk and coursing caudally to perfuse the right segmental pulmonary arteries . \n ( c ) a volume - rendered three - dimensional reformatted image from a dorsal perspective demonstrates the lack of a right pulmonary artery with the pulmonary trunk continuing solely as the left pulmonary artery ( lpa ) . \n rcrpv = right cranial pulmonary vein ; rmidpv = right middle pulmonary vein ; rcapv = right caudal pulmonary vein ; lcapv = left caudal pulmonary vein \n unilateral absence of a pulmonary artery ( uapa ) is a rare congenital cardiovascular anomaly that was first described in humans in 1868 , and in the veterinary literature in 1986 . in 2011 , a review of the human medical literature revealed 419 cases worldwide . \n there is one documented case of uapa reported in the veterinary literature , in a 2-year - old , siamese cat . \n additionally , this condition has been suggested in two feline cases of pulmonary artery stenosis . \n the images presented here represent veterinary examples of cta for the diagnosis of uapa and highlight additional information gained from this modality , including collateral circulation , presence of segmental pulmonary arteries and lung characteristics . in humans , \n uapa is commonly accompanied by concurrent cardiovascular malformations including tetralogy of fallot , atrial septal defect , coarctation of the aorta , right aortic arch , truncus arteriosus , patent ductus arteriosus and pulmonary atresia . \n left - sided absence is frequently associated with other cardiac malformations , while right - sided absence predominates in isolated cases . \n the absent pulmonary artery in isolated uapa is almost always contralateral to the aortic arch ( eg , absence of the rpa with a left - sided aortic arch ) . during mammalian embryogenesis \n , the distal intrapulmonary pulmonary arteries develop from their respective lung buds and join the proximal portion of the right and left sixth aortic arch , which then develop into the left and right extrapulmonary pulmonary arteries . \n the pt arises from the truncoaortic sac , while the distal right and left sixth aortic arches form the right and left ducti arteriosi . \n the predominant theory for the development of uapa describes anomalous involution of the proximal sixth aortic arch , while the connection between the intrapulmonary pulmonary arteries and the distal sixth aortic arch persists . \n the corresponding pulmonary tissues will become hypoxic and ischemic , prompting growth of anomalous collateral vessels to perfuse the affected lung lobes and predisposing these lungs to infection . presenting complaints in people with uapa are variable with recurrent respiratory tract infections , exercise intolerance and mild dyspnea described most frequently ; hemoptysis occurs less commonly . \n the age at diagnosis in people is variable , with a median of 14 years , ranging from infancy to 58 years . \n infants may present in respiratory distress , with cyanosis , growth delay , severe ph and congestive heart failure . \n adults may be asymptomatic ; the disease incidentally diagnosed once thoracic radiographs are performed for other reasons . \n it has been speculated that the diagnosis can be delayed in humans owing to non - specific presenting signs or because diagnostics are pursued only once respiratory infection or hemoptysis manifest . in humans \n , thoracic radiographs may reveal asymmetric lung lobe size with a deviated mediastinum toward the affected hemithorax and contralateral lung hyperinflation . the affected lung field \n is often reduced in size , hyperlucent , with absent or decreased pulmonary vascular markings , smaller intercostal spaces and an elevated hemidiaphragm . in cat 1 , the mediastinal shift away from the affected lung ( toward the left ) was in contrast to the expected findings of a shift to the right . \n the reason for this is unclear , but may relate to the infiltrate in the left lung lobes of this cat and compensatory hyperinflation of the better aerated right lung lobes . alternatively , intralobar pulmonary sequestration can present with emphysematous changes ; pulmonary sequestration is defined as a portion of lung that does not connect to the tracheobronchial tree and has a systemic arterial supply . as \n this cat did have a systemic arterial supply to the right lung , it is possible that a portion of the right lung represented pulmonary sequestration with emphysematous change ; however , there was no evidence of pulmonary sequestration or right - sided emphysema noted on post - mortem evaluation . \n the mediastinal shift had resolved on the follow - up radiographs , but the paradox of emphysematous and hyperinflated left lung lobes on post mortem stands in contrast to the apparent hypoinflation of the left lung on radiographs . \n an explanation for this discrepancy is challenging , though it is possible that the unilateral emphysema of the left lung resulted in air - trapping and a more prominent size relative to the non - emphysematous right lung at autopsy . \n the term interstitial pneumonia as noted on this cat s lung histopathology reflects inflammation involving the alveolar or interlobular septa and does not imply an infectious etiology . \n the radiographs from cat 2 were consistent with human reports showing a shift toward the affected ( right ) lung . \n a definitive diagnosis in humans can be obtained by performing ct or mri , which can reveal mosaic parenchymal changes , patent segmental pulmonary arteries with variable systemic collateral arterial circulation , and bronchiectasis secondary to recurrent respiratory tract infections . in humans , \n the anomalous systemic collateral vessels primarily arise from not only the bronchial arteries , but have also been documented to develop from the intercostal , subdiaphragmatic , subclavian and coronary arteries . \n transthoracic echocardiography is used to confirm the diagnosis , rule out other cardiac or vascular anomalies , and estimate pulmonary arterial pressure . \n echocardiography may reveal a dilated unilateral pulmonary artery , absence of the contralateral pulmonary artery , ph and right ventricular hypertrophy . \n while angiography remains the historical gold standard for diagnosis in humans , it is reserved for patients undergoing embolization or revascularization surgery . \n the previously reported case of uapa in a cat was similar to the two cases described here ; absence of the rpa was documented by non - selective angiography and autopsy evaluation in a 2-year - old siamese with respiratory distress . in the other two feline reports that relate to this condition , \n flow was not apparent in the lpa during angiography and constriction at the origin of the rpa was additionally noted . while similar to uapa , it is our opinion that these cases represent pulmonary artery stenosis type iia , or juxtaductal constrictions , because of the ostial narrowing at the rpa and post - mortem image showing presence of an occluded lpa from the pt to the left lung \n . the previously reported siamese case also demonstrated unilateral interstitial infiltrate in the left hemithorax , as in the two cases presented here . \n the pulmonary infiltrates are of uncertain etiology ; pulmonary edema related to excess blood flow ( total cardiac output traversing half the normal pulmonary vasculature ) is considered given the response to diuretic therapy . respiratory infection , as occurs in humans with this condition , is considered less likely given resolution without antibiotic therapy . \n angiocardiography has previously characterized the anomaly , though ct appears to be effective for accurate morphologic assessment of the condition , while also allowing improved visualization of the lung parenchyma and systemic collateral vasculature as seen in the two cats described herein . while there has been no consensus on treatment in humans , \n therapies are typically reserved for those experiencing massive hemoptysis , recurrent lower respiratory tract infections and ph . \n treatment options in humans have included partial or total pneumonectomy , selective embolization of collateral vessels , ductal stenting and systemic - to - pulmonary artery grafting . \n pulmonary hypertension in people is treated medically using endothelin receptor antagonists , prostacyclins , phosphodiesterase inhibitors or calcium channel blockers . \n treatment was attempted for the ph in cat 1 , but did not provide sustained palliation . \n cat 2 was diagnosed with right - sided uapa without evidence of ph , though mild ph could not be excluded , and has been successfully managed using oral furosemide and angiotensin - converting enzyme inhibition . \n based on these two cases and the human condition , moderate - to - severe ph may be a negative prognostic factor in cats with uapa . \n right - sided uapa was diagnosed by cta in two cats , allowing accurate characterization of the arterial malformation , as well as determination of the collateral blood supply to the affected lung . \n the condition may be suspected by thoracic radiographs and echocardiography in cats having respiratory signs , unilateral pulmonary infiltrates and dilated lobar pulmonary vessels ; confirmation of the diagnosis is provided by cta .", "role": "user" }, { "content": "case series summarytwo cats were evaluated for progressive exercise intolerance , dyspnea and unilateral infiltrate of the left lung . computed tomography angiography ( cta ) revealed absence of the right pulmonary artery in both cats with systemic arterial collateral vessels perfusing the right segmental pulmonary arteries . in one case \n , the collateral vessels arose from the esophageal artery , while in the other case they derived off the right costocervical trunk . \n one cat was diagnosed with pulmonary hypertension and was euthanized owing to progressive respiratory distress despite medical management with sildenafil , pimobendan , clopidogrel and furosemide . \n the other cat , without echocardiographic evidence of pulmonary hypertension , was successfully managed with furosemide and enalapril for more than 4 years.relevance and novel informationcta allowed visualization of a rare congenital heart malformation , unilateral absence of the right pulmonary artery , in two cats and accurately characterized the source of collateral blood supply to the affected lung . \n severe pulmonary hypertension may be a negative prognostic factor in cats with this condition as medical therapy in the cat without evidence of pulmonary hypertension resolved clinical signs , while the cat with severe pulmonary hypertension died from the disease .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cabbage is one of the most common vegetables used in fresh salads ( 1 ) . \n the physical and chemical characteristics of cabbage are well - known , and important for healthy nutrition . \n cabbage represents an excellent source of vitamin c and a very good source of manganese . \n it is also a good source of polyphenols and anthocyanins , which are important as antioxidant and anti - inflammatory nutrients . \n this antioxidant richness and the presence of glucosinolates in cabbage are partly responsible for its cancer - prevention and cardiovascular disease - protection benefits ( 2 ) . \n consumption of salad vegetables has increased significantly over the past two decades due to their health benefits . however , eating fresh vegetables carries a number of risks , especially if the vegetables are contaminated with pathogenic microorganisms ( 3 ) . among the pathogens most often associated with vegetables and salads \n ( 6 ) , the highest incidence of this pathogenic microorganism occurs in cabbage , green salads , and tomatoes . \n the high prevalence of l. monocytogenes in fresh cabbage ( 95.8% ) and ready - to - eat coleslaw ( 80.1% ) in the accra metropolis indicates that consumers of commercially prepared coleslaws have been extensively exposed to this pathogen ( 7 ) . \n listeria monocytogenes as a psychotropic organism is capable of growth at refrigeration temperatures , which means that low numbers of initially contaminating cells may proliferate and become hazardous if they are present on or transferred to ready - to - eat foods stored in refrigerators ( 8) . \n consequently , the consumption of minimally processed vegetables contaminated with l. monocytogenes may cause listeriosis in humans . \n an outbreak of listeriosis in canada in 1981 was linked to the consumption of coleslaw contaminated with l. monocytogenes ( 9 ) , and one of the largest outbreaks of listeriosis , which occurred in 2011 and included several states in the u.s . \n traditional food preservation techniques based on thermal treatments can provide microbiological stability of food , but they are not appropriate for fresh vegetables . to improve the microbiological stability of minimally processed vegetables in today s market \n , researchers are looking for non - thermal treatments that do not affect the physicochemical properties or nutritional value of these products . \n a very popular way of preserving the quality of minimally processed , fresh - cut vegetables is the use of chitosan films ( 11 - 13 ) . \n the efficacy of chitosan films has been demonstrated for different types of foods , but there is no information on the effects chitosan and the natural compounds of essential oils on cabbage . \n chitosan is a natural biodegradable polymer obtained from chitin , the second most abundant polysaccharide in nature ( 14 ) . \n it has been used extensively in numerous industrial , health , agricultural , and food applications , and is proven to be safe ( 15 - 17 ) . \n the use of chitosan as a food antimicrobial is especially attractive , primarily due to the great resistance of consumers against food that may contain chemical substances . \n the present study was undertaken to evaluate the survival of two strains of l. monocytogenes during storage at 4c on packaged shredded cabbage , in the presence of chitosan - gelatin films with or without essential oils in different concentrations . \n fresh cabbage was purchased from local supermarkets in sabac ( serbia ) and prepared by removal of the outer leaves , then washing and shredding with a shredding machine ( multi moulinette , moulinex ) . \n the shredded vegetables were weighed into sterile containers in amounts of 100 g and inoculated with a prepared bacterial suspension . \n two pathogenic strains of l. monocytogenes , atcc 19112 and atcc 19115-serotype 4b , both epidemiological isolates , were used in this investigation . \n the selected species of bacteria originated from the atcc ( american type culture collection , rockville , md , usa ) . before each experiment , \n stock cultures of bacteria were propagated through two consecutive 24-hour growth cycles in brain heart infusion agar ( bhia , himedia , mumbai , india ) at 37c . \n five well - isolated colonies of each strain were transferred into 10 ml of sterile saline solution ( 0.85% w / v ) to obtain a working culture containing approximately 10 cfu ml-1 . \n next , 1 ml of this suspension was added to each vegetable sample ( 100 g each ) , providing an initial density in the vegetables of approximately 10 - 10 cfu g-1 . \n chitosan of medium molecular weight ( mw 190,000 - 310,000 da , 75% - 85% deacetylation , sigma - aldrich , germany ) was used as a matrix onto which antimicrobial mint and thyme essential oils were incorporated . \n chitosan was dissolved in a 1% ( v / v ) aqueous solution of glacial acetic acid ( merck , germany ) and stirred for 24 hours to ensure total dissolution . \n the final concentrations of chitosan in the film - forming solution were 0.5% ( w / v ) , 1% ( w / v ) , and 2% ( w / v ) . \n a solution of white gelatin 6% ( w / v ) ( centrohem , serbia ) was prepared with 1% ( v / v ) of acetic acid solution using the following procedure : the gelatin was hydrated for 30 minutes at room temperature , then dissolved at 45c ( water bath ) under mechanical stirring until complete dissolution ( approximately 20 minutes ) . \n the prepared solutions of chitosan and gelatin were mixed in a ratio of 1:1 in order to obtain a homogenous mass that would become viscous upon cooling and create a composite film of chitosan - gelatin . as a reference , a gelatin film containing 6% ( w / v ) gelatin was prepared . \n approximately 25 ml of chitosan - gelatin solution was prepared for each petri dish , of which one half was poured into the cover while the other half was poured onto the bottom of the petri dish . after spilling of the solution , \n a composite film was allowed to dry at a room temperature under sterile conditions . until use , \n the same procedure was applied to prepare chitosan - gelatin solutions containing mint or thyme essential oils ( herba doo , serbia ) , which were added to the chitosan - gelatin solution and mixed for 5 minutes in order to obtain a homogenous mass . \n the final concentration of tested essential oil in the coating formulations was 0.2% ( w / v ) . to ensure emulsification of the essential oils , dimethyl sulfoxide 0.2% ( w / v ) ( carlo erba reagents , france ) , \n the films were applied to fresh shredded cabbage samples ( 40 g ) using the following procedure : vegetable samples were inoculated with the bacterial suspension and packed between two layers of the composite chitosan film in petri dishes . \n the prepared samples were sealed in plastic bags and stored at 4c until analysis , which was carried out every 24 hours for 6 days . \n the total number of tested bacteria was evaluated periodically throughout the storage period . treated and \n untreated shredded vegetables ( 10 g samples ) were subjected to microbial analysis during refrigerated storage at 4c at the initial point ( 0 days ) and at 1 , 2 , 3 , 4 , 5 , and 6 days . under sterile conditions , \n 10 g of each sample was homogenized for 10 minutes at 150 rpm , using a laboratory shaker ( j. p. selecta , model 3000974 ) , in 90 ml of sterile saline solution ( 0.85 % nacl w / v ) . \n serial dilutions of each suspension were prepared and plated on petri dishes containing palcam agar ( hi media , mumbai , india ) , which contained acriflavine hydrochloride ( 5 mg l-1 ) , polymyxin b ( 10 mg 1 - 1 ) , and ceftazidime ( 20 mg l-1 ) ( 19 ) . \n microbiological counts were converted to log cfu g-1 and statistical differences were determined using student s t - test ( microsoft excel , 2007 ) after the analysis of variance . \n fresh cabbage was purchased from local supermarkets in sabac ( serbia ) and prepared by removal of the outer leaves , then washing and shredding with a shredding machine ( multi moulinette , moulinex ) . \n the shredded vegetables were weighed into sterile containers in amounts of 100 g and inoculated with a prepared bacterial suspension . \n two pathogenic strains of l. monocytogenes , atcc 19112 and atcc 19115-serotype 4b , both epidemiological isolates , were used in this investigation . the selected species of bacteria originated from the atcc ( american type culture collection , rockville , md , usa ) . \n before each experiment , stock cultures of bacteria were propagated through two consecutive 24-hour growth cycles in brain heart infusion agar ( bhia , himedia , mumbai , india ) at 37c . \n five well - isolated colonies of each strain were transferred into 10 ml of sterile saline solution ( 0.85% w / v ) to obtain a working culture containing approximately 10 cfu ml-1 . \n next , 1 ml of this suspension was added to each vegetable sample ( 100 g each ) , providing an initial density in the vegetables of approximately 10 - 10 cfu g-1 . \n chitosan of medium molecular weight ( mw 190,000 - 310,000 da , 75% - 85% deacetylation , sigma - aldrich , germany ) was used as a matrix onto which antimicrobial mint and thyme essential oils were incorporated . \n chitosan was dissolved in a 1% ( v / v ) aqueous solution of glacial acetic acid ( merck , germany ) and stirred for 24 hours to ensure total dissolution . \n the final concentrations of chitosan in the film - forming solution were 0.5% ( w / v ) , 1% ( w / v ) , and 2% ( w / v ) . \n a solution of white gelatin 6% ( w / v ) ( centrohem , serbia ) was prepared with 1% ( v / v ) of acetic acid solution using the following procedure : the gelatin was hydrated for 30 minutes at room temperature , then dissolved at 45c ( water bath ) under mechanical stirring until complete dissolution ( approximately 20 minutes ) . \n the prepared solutions of chitosan and gelatin were mixed in a ratio of 1:1 in order to obtain a homogenous mass that would become viscous upon cooling and create a composite film of chitosan - gelatin . as a reference , \n approximately 25 ml of chitosan - gelatin solution was prepared for each petri dish , of which one half was poured into the cover while the other half was poured onto the bottom of the petri dish . after spilling of the solution , \n a composite film was allowed to dry at a room temperature under sterile conditions . until use \n the same procedure was applied to prepare chitosan - gelatin solutions containing mint or thyme essential oils ( herba doo , serbia ) , which were added to the chitosan - gelatin solution and mixed for 5 minutes in order to obtain a homogenous mass . \n the final concentration of tested essential oil in the coating formulations was 0.2% ( w / v ) . \n to ensure emulsification of the essential oils , dimethyl sulfoxide 0.2% ( w / v ) ( carlo erba reagents , france ) , was added to each composite film ( 18 ) . \n the films were applied to fresh shredded cabbage samples ( 40 g ) using the following procedure : vegetable samples were inoculated with the bacterial suspension and packed between two layers of the composite chitosan film in petri dishes . \n the prepared samples were sealed in plastic bags and stored at 4c until analysis , which was carried out every 24 hours for 6 days . \n the total number of tested bacteria was evaluated periodically throughout the storage period . treated and \n untreated shredded vegetables ( 10 g samples ) were subjected to microbial analysis during refrigerated storage at 4c at the initial point ( 0 days ) and at 1 , 2 , 3 , 4 , 5 , and 6 days . under sterile conditions , \n 10 g of each sample was homogenized for 10 minutes at 150 rpm , using a laboratory shaker ( j. p. selecta , model 3000974 ) , in 90 ml of sterile saline solution ( 0.85 % nacl w / v ) . \n serial dilutions of each suspension were prepared and plated on petri dishes containing palcam agar ( hi media , mumbai , india ) , which contained acriflavine hydrochloride ( 5 mg l-1 ) , polymyxin b ( 10 mg 1 - 1 ) , and ceftazidime ( 20 mg l-1 ) ( 19 ) . \n microbiological counts were converted to log cfu g-1 and statistical differences were determined using student s t - test ( microsoft excel , 2007 ) after the analysis of variance . \n the antimicrobial effect of 0.5% chitosan films against l. monocytogenes atcc 19115 on shredded cabbage samples was evaluated during 6 days of refrigerated storage at 4c ( figure 1 ) . \n the number of l. monocytogenes atcc 19115 increased from 4.6 log10 cfu g-1 to the 7.5 log10 cfu g-1 in the control sample of untreated cabbage . \n contact of l. monocytogenes atcc 19115 with 0.5% chitosan films in shredded cabbage resulted in rapid inhibition of growth compared to the control . \n complete inhibition of growth in the presence of 0.5% chitosan films was achieved at 120 hours of storage ( figure 1 ) . \n the antimicrobial effect of 0.5% chitosan films against l. monocytogenes atcc 19112 on shredded cabbage is shown in figure 2 . \n significantly increased populations on cabbage did occur with storage at 4c , whereas significant decreases in l. monocytogenes atcc 19112 populations occurred in shredded cabbage stored in the presence of 0.5% chitosan films . \n the relationship between tested strains of bacteria showed positive and statistically significant coefficient correlations , r = 0.97 and r = 0.96 ( p < 0.05 ) in cabbage alone and in cabbage with 0.5% chitosan film , respectively . a large amount of l. monocytogenes atcc 19115 was present in the control shredded cabbage at the beginning of the experiment ( figure 3 ) , and the number significantly increased during storage ( p < 0.05 ) . using a 4.7 log initial inoculation level , treatment with 1% chitosan film for the first 24 hours resulted in a decrease of 1.3 log cfu / g compared to untreated cabbages ( figure 3 ) . \n however , the same treatment achieved complete inactivation of all l. monocytogenes atcc 19115 cells on cabbage after 120 hours . during 6 days of storage at 4c , in the presence of 1% chitosan film , l. monocytogenes atcc 19112 populations inoculated onto shredded cabbage decreased from 4.2 log10 cfu g-1 to undetectable levels after 144 hours ( figure 4 ) . \n it was observed that the addition of thyme and mint essential oils at a concentration of 0.2% increased the antimicrobial activity of 1% chitosan films in both tested bacterial strains . \n the relationship between the strains showed positive and statistically significant correlation coefficients , r = 0.98 and r = 0.94 ( p < 0.05 ) in cabbage alone and in cabbage with 1% chitosan film , respectively . \n cabbage samples treated with 2% chitosan films showed a significant reduction of the l. monocytogenes atcc 19115 population ( p < 0.05 ) . in the presence of 2% chitosan films , microbial reduction of 1.1 log10 cfu g-1 appeared after 48 hours of storage , and there were no detectable bacteria after 6 days of refrigerated storage ( figure 5 ) . \n it should be noted that in this case , application of gelatin with 1% acetic acid can yield a higher reduction in the population of l. monocytogenes atcc 19115 . \n the combined treatment of 2% chitosan films and essential oils showed a significant reduction ( p < 0.05 ) of the tested bacteria , but this activity was still lower than that achieved with acetic acid alone . \n our investigation showed that l. monocytogenes can remain viable on raw shredded cabbage for periods extending beyond their normal expected shelf - life . \n manufacturers usually declare the shelf - life of minimally processed cabbage to be 4 - 5 days , during which time l. monocytogenes in shredded cabbage can multiply to levels dangerous for humans . \n the results obtained in the present study are consistent with the findings of monge and arias - echandi ( 20 ) , who reported cabbage as the most common vegetable showing this organism . \n this could be attributed to high levels of fermentable sugars , such as glucose , which can be readily utilized by l. monocytogenes ( 21 ) . \n contact of l. monocytogenes cells with all tested chitosan films resulted in decreased bacterial populations . \n the mechanism of this antimicrobial activity can be explained in various ways ( 22 , 23 ) . \n some authors have suggested that the interaction between positively - charged chitosan molecules and negatively - charged microbial surfaces results in the disruption of cell membranes , leakage of intracellular constituents , and ultimately , microbial cell death ( 24 ) . additionally , according to a second hypothesis , chitosan oligomers can penetrate into prokaryotic cells and interfere with the transcription of rna and protein synthesis ( 25 ) . \n the inhibition effect of chitosan films can be attributed in part to a lower ph and to acetic acid , which is used in preparing films . \n other authors have reported that the type of acid , molarity , and temperature , as well as ph level , influence the ability of l. monocytogenes to grow ( 26 ) . at the same ph , \n acetic acid was more effective than lactic , citric , malic , and hydrochloric acids . \n acetic acid is the predominant acid in films and undoubtedly had a lethal effect on the two test strains of l. monocytogenes examined in this study . \n our results show that chitosan films possess antimicrobial activity that depends on the concentration of the applied films . in this study , \n the present results indicate that films with higher concentrations of chitosan have more pronounced antimicrobial activity , consistent with previously published data ( 27 ) . \n however , it can be seen that 2% chitosan films exhibit less inhibition of bacterial species than 1% chitosan films . \n this behavior can be explained by the extremely high viscosity of the chitosan solution . according to hirano and nago ( 28 ) , \n due to high viscosity , chitosan slightly diffuses through the gel , and activity is consequently decreased . \n the antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils in this study , which is in agreement with the findings of other authors ( 29 - 31 ) . \n essential oils , due to their antimicrobial activities and safety , have been designated as gras ( generally recognized as safe ) by the u.s . \n comparison of the effect of mint and thyme essential oils against l. monocytogenes in cabbage in the present study showed that the addition of 0.2% thyme essential oil significantly ( p < 0.05 ) affected the antimicrobial activity of films , compared with chitosan films alone . on the basis of our results , \n chitosan - gelatin films have the potential to be used in the food industry as active packaging materials to inhibit foodborne pathogens . \n chitosan and essential oils may have a significant impact on the antimicrobial effect of these films . \n the most prominent activity was shown with 1% chitosan films and 0.2% thyme essential oil .", "role": "user" }, { "content": "backgroundthe highest incidence of listeriosis , due to consumption of ready - to - eat foods and fresh , shredded , minimally processed vegetables , occurs among pregnant women and the elderly . in order to reduce the prevalence of listeriosis among consumers , \n better protective measures are recommended . \n chitosan films , with or without added essential oils , represent a modern , safe method of preserving the quality of such vegetables and significantly reducing the incidence of listeria monocytogenes in these foods.objectivesthe present study was conducted to evaluate the antimicrobial properties of composite chitosan - gelatin films with and without essential oils against two strains of l. monocytogenes , atcc 19115 and atcc 19112 , in fresh shredded cabbage.methodsshredded cabbage was inoculated with l. monocytogenes and packed between two layers of the chitosan composite film , then placed in petri dishes . \n the prepared samples were stored at 4c then analyzed for total viable count on palcam agar while incubated at 37c , every 24 hours for 7 days.resultsaverage l. monocytogenes content ranged from 4.2 - 5.4 log cfu / g , reaching values of 7.2 - 8.6 log cfu / g in samples of untreated cabbage \n . a complete reduction of l. monocytogenes atcc 19115 on cabbage was achieved after 120 hours in the presence of 0.5% chitosan film , whereas reduction of l. monocytogenes atcc 19112 was achieved after 144 hours . in the presence of 1% chitosan film , \n the bacteria withered more quickly and complete reduction of both species of l. monocytogenes was achieved after 96 hours.conclusionsall tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of both strains of l. monocytogenes on cabbage . \n the best effect was achieved with a 1% chitosan concentration . \n the addition of essential oils increased the antimicrobial activity of all tested films .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: quality in healthcare has different dimensions and elements ( 1 - 4 ) , of which patient safety ( ps ) is one of the most important dimensions ( 5 ) . \n ps is a serious global challenge and a very important dimension of healthcare quality ( 6 - 8 ) . according to who , in low and middle income countries ( lmic ) one out of ten patients is harmed while receiving health services ( 9 ) . \n institute of medicine ( iom ) report entitled \" to err is human \" showed that more than 98 thousand patients die in the united states every year as a result of medical errors ( 10 ) . \n for this reason ps has received considerable focus from policy - makers and other stakeholders ( 11 ) . \n patient safety culture ( psc ) is an important factor of ps in healthcare system ( 12 ) . \n the iom offers that the very important challenge to achieve a safer healthcare system is to improve the psc ( 13 ) . \n measurement of psc is a top priority aim to improve quality of ps ( 14 - 20 ) . \n neiva and sorra ( 15 ) defined psc as : the product of individual and group values , attitudes , perceptions , competencies , and patterns of behavior that determine the commitment to , and the style and proficiency of , an organization 's safety management . \n previous studies results show that there is a positive relationship between high psc and safety performance in hospitals ( good ps ) ( 14,21 ) . \n \n globally , several international organizations attempted to promote psc : the world alliance for patient safety ( waps ) , the national patient safety agency ( npsa ) , the agency for healthcare research and quality ( ahrq ) and the australia commission of safety and quality ( acsq ) ( 22 - 24 ) . in this \n regard , several instruments have been developed to measure psc ( 25 - 27 ) . \n the hospital survey on patient safety culture ( hsopsc ) of ahrq is a valid and reliable instrument to measure psc in the hospitals ( 28 - 31 ) . \n this tool is translated to many languages and validated psychometrically ( 32 - 34 ) . \n a review of the literature showed that psc status in iranian hospitals is not satisfactory ( 35 ) . \n thus , the aim of the current study was to clarify psc status in iranian hospitals through a meta - analysis of studies which used hsopsc instrument in iran . \n a meta - analysis study was conducted in 2014 , and the required data were collected searching following keywords : patient safety , patient safety culture , patient safety climate and its combination with hospital ( such as hospital survey on patient safety culture ) , measurement , assessment , survey , and iran , in google scholar , pubmed , scopus , cochrane library , magiran , iranian scientific information ( sid ) and iranmedex . \n manual journal and website searching was also conducted . to increase confidence level of identification of the articles , \n the inclusion criteria for the study were : articles published in persian and english languages , articles that measured psc in hospital , and articles that measured psc using hsopsc instrument . \n exclusion criteria included : articles that measured overall safety culture , articles that measured psc in primary healthcare , articles that not measured all dimension of hsopsc instrument , conference presentations , case reports , and interventional and qualitative studies . \n two reviewers evaluated the articles according to the checklist of strengthening the reporting of observational studies in epidemiology ( strobe ) ( appendix 1 ) . \n \n of 961 retrieved articles , \n endnote x5 software was used for organizing titles and abstracts and also identification of duplication studies ( 36 ) . to calculate the overall psc score , comprehensive meta - analysis ( cma ) software v. 2 and to report the results , forest plot were used . in forest plot , the size of each square shows sample size and lines on each side of the square show confidence interval . \n literature review and retrieval flow diagram \n psc score was calculated based on random model with 95% confidence interval . in random models \n either all or some of the variables are treated as if they are from random causes . \n random model was in contrast to fixed model that demonstrate the observed quantities in regard of explanatory variables which are treated as if the variables are not random . \n this instrument has 3 parts , 12 dimensions , 44 items and 2 single questions ( box . \n 1 ) . all of questions are in the 5-point likert scale ( strongly disagree to strongly agree ) or frequency ( never to always ) ( 37,38 ) . \n a total of 11articles initially were reviewed ( 39 - 49).the characteristics of the reviewed articles are shown in table 1 . the overall numbers of participants were 2972 ( 270 each study ) . \n \n * 1- overall perception of safety , 2- organizational learning / continuous improvement , 3- supervisor / manager expectations & actions promoting \n safety,4- teamwork within hospital units , 5- non - punitive response to error , 6- staffing , 7- hospital management support for patient safety , 8- \n teamwork across hospital units , 9- hospital handoffs & transitions , 10- communication openness , 11- feedback & communication about error , 12- \n adverse event reporting & recording , * * including wide range of health care provider in hospital such as : physicians , nurses , clinical and non - clinical \n staff , pharmacy and laboratory staff , supervisors and hospital managers \n \n the psc score based on the random effect model was determined to be 50.1% ( 95% confidence interval , lower limit= 43.4% , upper limit= 56.9% , i= 99.8 , q - value= 5716.2 , df = 10 , and p \n 2 ) . \n patients safety culture score in the evaluated studies with 95% ci ( based on random model ) \n in this study due to high heterogeneity , sensitive analysis was done by excluding one of the studies ( abdi et al , 2010 ) . finally , after excluding this study , the psc score changed to 52.8% ( 95% confidence interval , lower limit= 48% , upper limit= 57.6% , i=96.8 , q - value= 3456.2 , df = 9 , p \n patients safety culture score in the evaluated studies with 95%ci ( based on random model ) after sensitive analysis ( abdi et al : 2010 ) mean of 12 dimensions of hsopsc in iran \n as shown in fig . 4 , teamwork within hospital units \n dimension has the highest score of psc ( 67.4% ) and non - punitive response to error has the lowest score ( 32.4% ) . \n mean of psc status ( excellent , very good , acceptable , poor , failing ) in hsopsc questionnaire are shown in fig . \n , very good grade has the highest mean ( % 32.3 ) and excellent the lowest ( % 8.3 ) . \n average percentage of respondents giving their psc grade \n mean of reporting number of adverse events in the past 12 months are shown in fig . \n 6 , which shows that approximately % 52.7 of participants did not report any adverse event in the past 12 months . \n average percentage reporting events in the past 12 months \n funnel plot of psc shows that there is no symmetry in gathered data ( fig . \n the hsopsc questionnaire has been used to measure psc in the high income countries ( hics ) , especially , the united states . in present study \n , we systematically reviewed the psc status in iran using studies that administered hsopsc tool . \n overall , the mean response rate for the 12 psc dimensions of the hsopsc questionnaire in iranian hospitals was 50.5% . \n this was lower than many of other previous studies , especially in hics ( 15,16,50 - 54 ) . \n also mean response rate in some studies in lmic was higher compared to that of current study ( 55 - 57 ) . \n furthermore , the ndings of this study demonstrated that \" non - punitive response to error \" dimension has lowest score among 12 dimensions of the hsopsc questionnaire . \n van geest and cummings study showed that absence of a non - punitive response system to errors is an important barrier for identications and reduction of errors in healthcare setting ( 60).non - punitive response system defined as \" the extent to which personnel feel that their mistakes are not held against them and that mistakes are not recorded in their personnel document \" ( 61 ) . \n unreserved system is an effective method for risk reduction in hospitals , which can start with adverse event reporting without punishing , and continue with encourage to report and learning from adverse events . \n the present study revealed that about 41% of participants evaluate their hospitals psc status as excellent /very \n good. el - jardali and colleagues study in lebanese hospitals demonstrated that about 70% of participants evaluated their hospitals psc status as excellent / very good ( 55 ) . \n one study reported a higher excellent / very good for psc than this study ( 62,63 ) . \n \n according to the reviewed articles in this study , \n about 52% of participants did not report any adverse event in the past 12 months . \n contrary to this study , el - jardali and colleagues showed that about 60% of participants did not completed any event in the past 12 months ( 55 ) . \n also , jasti and colleagues showed that 64% of internal medicine house staff in academic teaching hospital did not report an adverse event in the past 12 months ( 62 ) . \n possible reasons for lower rate of reporting adverse events in current study might be the followings : no adverse event occurred in the hospitals during this period ; or , staff did not report adverse events due to punishment system in the hospitals . \n the first reason seems to be impossible due to frequent reports of adverse events or medical errors in the hospitals ( 64 - 66 ) . \n therefore , hospitals managers better off to change current punishment system into participating system for improvement of ps . \n hospital managers should try to remove scold , fear and silence from their system ( 67 ) . \n \n according to published years of reviewed articles in this study ( from 2010 to 2013 ) , it revealed that psc is a very new concept in iranian hospitals and unfortunately this issue has been neglected . in iran , the psc received attention due to ps friendly hospital initiatives since 2010 , which was started in 10 hospitals and recently , ministry of health and medical education ( mohme ) has decided to expand this program to 50 more hospitals ( 68 ) . also from 2009 in iranian healthcare system , \n clinical governance has been introduced as a framework to quality improving of hospitals services ( 69,70 ) . \n these and other similar programs such as hospital accreditation are very useful and important for psc improvement , but , it should be noted that improvement of psc in hospitals and other organizations is highly related to continues quality improvement ( cqi ) culture , organization leadership commitment , creating learning atmosphere in hospitals and a customer - oriented culture in hospitals in long - run . \n the present study has some limitations such as no access to some of databases , and that , included articles were conducted only in hospitals . \n nowadays , measuring psc in healthcare organizations is being increasingly welcome , especially in the hics , and by iranian hospitals . in this \n regard , review of related studies showed that iranian hospitals performance in psc filed is weak . \n hence , improving psc should be prioritized in iranian hospitals . in this regard hospitals staff \n * give information separately for cases and controls in case - control studies and , if applicable , for exposed and unexposed groups in cohort and cross - sectional studies . \n note : an explanation and elaboration article discusses each checklist item and gives methodological background and published examples of transparent reporting . \n the strobe checklist is best used in conjunction with this article ( freely available on the web sites of plos medicine at http://www.plosmedicine.org/ , annals of internal medicine at http://www.annals.org/ , and epidemiology at http://www.epidem.com/ ) .", "role": "user" }, { "content": "background : nowadays , for quality improvement , measuring patient safety culture ( psc ) in \n healthcare organizations is being increasingly used . \n the aim of this study was to clarify psc status \n in iranian hospitals using a meta - analysis method . \n methods : six databases were searched : pubmed , scopus , google scholar , cochrane library , magiran , \n sid and iranmedex using the search terms including patient safety , patient safety culture , patient \n safety climate and combined with hospital ( such as \" hospital survey on patient safety culture \" ) , \n measurement , assessment , survey and iran . \n a total of 11 articles which conducted using hospital \n survey on patient safety culture ( hsopsc ) questionnaire initially were reviewed . to estimate \n overall psc status and perform the meta - analyses , comprehensive meta - analysis ( cma ) software \n v. 2 \n was employed . \n results : the overall psc score based on the random model was 50.1% . \" teamwork within hospital \n units \" dimension received the highest score of psc ( 67.4% ) and \" non - punitive response to error \" \n the lowest score ( 32.4% ) . \n about 41% of participants in reviewed articles evaluate their hospitals \n performance in psc as excellent / very good. approximately % 52.7 of participants did not report \n any adverse event in the past 12 months . \n conclusion : the results of this study show that iranian hospitals performances in psc were poor . \n among the 12 dimensions of hsopsc questionnaire , \n the \" non - punitive response to error \" achieved \n the lowest score and could be a priority for future interventions . in this regard , hospitals staff \n should \n be encouraged to report adverse event without fear of punitive action .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: minimally invasive dentistry is an approach that seeks to maintain the patient 's oral health with preventive measures and to treat possible disturbances of health as early as possible and with as little intervention as possible . \n this requires that caries is detected at an early stage of development and that its status can be monitored frequently . \n however , the current methods for diagnosing caries are able to detect caries only at a relatively advanced stage . \n accordingly , methods for early detection of caries have been researched for the past twenty years . \n many of these methods still require extensive research before they can be used in clinical practice . \n optical caries diagnosis methods are based on the fact that caries cause changes in the tooth 's optical properties at an early stage of development . \n this was a pilot study to investigate whether diffuse reflectance visible / near - infrared spectroscopy ( vis / nir - s ) can be used to detect dental caries lesions . \n reflectance spectroscopy measures the intensity of light at several different wavelengths , that is , its spectra , after the light has reflected from the studied object . \n diffuse reflectance refers to light that has been reflected from the inside of the object , rather than from its surface . in this \n study the intensity was measured at wavelengths in the visible range and at wavelengths in the near - infrared range , covering wavelengths in the range 4201000 nanometers . within this range , \n the intensity was measured at 2305 different wavelengths , so that the difference between consecutive wavelengths was approximately 0.25 nm . \n this study was limited to studying natural caries lesions that could be diagnosed with fiber - optic illumination , on smooth surfaces of extracted tooth . \n a theory of caries diagnosis using near - infrared spectroscopy emerges from the previous studies of detecting caries lesions with near - infrared light [ 27 ] . \n according to this theory , the development of a caries lesion increases the porosity of the affected tissue , which in turn leads to an increased scattering of light in the lesion . \n wavelengths in the near - infrared range are considered better than the wavelengths in the visible range , because the former can penetrate deeper into the tissue and are less affected by stains on the tooth . \n the purpose of this study was to provide additional evidence in support of this theory . \n the dental services of the city of vaasa provided extracted human teeth for the study . the teeth were stored immersed in denatured alcohol in order to disinfect them and to keep them hydrated . before inspection and measurements , \n the teeth were inspected by the first author with fiber - optic illumination , after the technique was introduced to him by the second author , in order to detect healthy areas of enamel and areas of enamel that contained caries lesions . in total 21 teeth were used in the study . \n a total of 109 points of enamel were measured on the teeth , consisting of 69 points which were thought to represent healthy enamel and 40 points which were thought to represent caries lesions . \n each measurement point produced a spectra , a sample for the rest of the analysis . in pattern recognition terminology the diagnosis of a given sample , as either healthy or carious , is called the label of the sample . \n the analysis of the samples tries to create a method which estimates the diagnosis , the label , of the sample based only on the measurements . \n an optical fiber , placed in contact with the sample , conveys light from a light source to the sample . \n another optical fiber is placed in contact with the sample at a small distance from the first fiber . \n some fraction of the light which scatters inside the sample will eventually exit the sample so that it enters the second optical fiber . \n it then gets conveyed to a spectrometer , which measures the spectra of the reflected light . \n photonics describes the key properties with the absorption coefficient and the scattering coefficient of the material . \n the measured spectra is analyzed in order to deduce information about the sample material . \n the measurements were made with a spectrometer hr4000 ( ocean optics inc . , dunedin , fl , usa ) and with a general purpose transmission dip probe model t300-rt - vis / nir ( ocean optics inc . , \n the probe contains two optical fibers , both with a diameter of 300 m , housed in a stainless steel assembly with a diameter of 3.175 mm . \n one of the fibers is connected to a light source and brings light to the sample . \n the light source used in this study was a tungsten halogen lamp hl-2000 ( ocean optics inc . , dunedin , fl , usa ) . \n thus , the study had to be carried out with a probe that was readily available in our laboratory . \n however , it was considered to be suitable for this study when the ferrule enclosing the inner assembly was removed , exposing the stainless steel assembly that houses the fiber optics . \n the period of time for which the spectrometer collects light when it is making one measurement is called the integration time . in this study integration time \n a longer integration time produces better measurement results than a short one , because the intensity of the collected light increases at all wavelengths , yielding a better signal - to - noise ratio ( snr ) . \n therefore , the integration time is typically set as long as possible . however , if the intensity of the collected light at a given wavelength exceeds the measurement range of the spectrometer , the spectrometer saturates . in that case \n the intensity can not be measured , and we know only that it exceeded the maximum measurable value . in order to make the measurement results comparable to results that would have been obtained with the same spectroscope using another light source or another integration time \n this is done by measuring the smallest and the greatest intensity value that a measurement can produce with the given integration time for each wavelength and by scaling all other measurements to that range . \n the lowest possible intensity values are obtained by measuring the so - called dark current , which is caused by thermal noise . \n measuring a white reference sample produces the greatest possible intensity values . in this study , the integration time was set so that the white reference sample ( a white reference tile ws-2 , avantes inc . , \n a spectrometer must also be calibrated for its detector , so that its measurement results are comparable to those obtained by other spectroscopes . \n this is done by measuring the spectra of a sample whose spectra is known . in this study \n the used spectroscope was calibrated for its detector by the manufacturer as part of its construction . \n a spectroscopic measurement result contains many small random errors , which are collectively called ( thermal ) noise . \n when the dark current is subtracted from the spectra , the mean value of the effect caused by the noise is shifted to zero , and thus the effect of noise is observed as errors which have a normal distribution with a zero mean . in order to minimize the effect of noise in the samples , each point was measured one hundred times consecutively , and the resulting spectra were averaged . \n this meant that the probe needed to stay as motionless as possible for two seconds . \n however , a far shorter time period would have probably been sufficient . as a further measure against noise , \n the samples were smoothed by using the savitzky - golay method with a window length of 61 and sixth degree polynomials . \n this method selects the coefficients of a sixth degree polynomial so that the polynomial is the best possible approximation for the measurement result , that is , the spectra , for the 30 wavelengths before a given wavelength and for the 30 wavelengths after it . \n the value of the polynomial at the given wavelength replaces the measured intensity at that wavelength . \n this removes , or smoothens , fast and small changes in the spectra , which are mainly caused by noise . a simple computational algorithm , based on exhaustive search , \n was then used to find a set of rules that could be used for detecting caries lesions . at this point , \n the goal was to classify the samples into two classes : points on healthy enamel ( healthy samples ) and points on caries lesions ( carious samples ) . \n for this , a set of rules was searched for , so that every rule had the following format : if the sample 's normalized intensity at a given wavelength is greater than ( or smaller than ) a given threshold i , the sample is classified as carious ; otherwise , the sample is classified as healthy . \n thus , each rule had three parameters : the wavelength , the intensity threshold i , and whether or not the threshold is an upper or lower limit for the intensity . \n if , and only if , one or more of the rules classified the sample as carious , the sample was classified as carious . if none of the rules considered the sample as carious , it was classified as healthy . \n it was hoped that the algorithm would select a set of rules which resembles the results found in earlier studies on this subject . \n a number of wavelengths were selected from the range of available wavelengths ( 4201000 nm ) as options for parameter in the search , so that the intervals between the wavelengths were equal and the first and the last wavelength were always selected as options . \n the search was done with different numbers of wavelengths . for each of the selected wavelengths , the algorithm sorted the samples ' intensities at that wavelength and considered the midpoint between each two consecutive intensities as a possible threshold i in a rule . \n the algorithm calculated the classification accuracy on the training set for each of the pairs and i described above , using the threshold i first as an upper limit for classifying the sample as carious and then using it as a lower limit , and chose the values of and i and the type of threshold , which gave the best accuracy ( see pseudo - code at pseudocode 4 ) . \n after a rule had been selected this way , the algorithm selected another rule with the same method , so that the new rule gave the best possible accuracy when used together with the previously selected rule(s ) . \n this was continued until the maximum allowed number of rules , here five rules , was reached , or until the classifier was unable to find a new rule which would improve the classification accuracy . \n this algorithm , like every machine learning method , requires a set of samples which is used for searching for the rules and a separate set of samples which is used for evaluating the accuracy that is achieved with the resulting rules . \n the former set of samples is called the training set and the latter set is called the validation set . \n this may cause problems for the machine learning method when the samples are divided into a training set and a validation set , because some types of samples may become overrepresented in the training set , misleading the learning method as it tries to recognize what discerns the two classes from each other . in this study , this risk was alleviated by using a 4-fold cross - validation . in this method , the samples are divided into four groups , and one of them is used as the validation set while the other three groups form the training set . \n each group in turn is used as the validation set , and the results from these four folders are averaged . this way \n each sample is a part of the training set in three folders and a part of the validation set in one folder . \n it is unlikely that the same types of samples would be overrepresented in all four training sets , unless the entire set of available samples has this problem . \n a single training set which has this problem would stand out from the others , and the skewed learning results from it would be corrected by the results from the other training sets . while the small set of samples may still give a skewed representation of the kinds of samples which are being studied , the cross - validation seeks to minimize this problem . in this study \n the averaging was done so , that a median rule set was constructed from the rules which the algorithm selected for the folders , and all of the samples were then classified with the median rule set . \n median of the numbers of rules in the folders determined the number of rules in the median rule set . \n some manual deliberation was used when constructing the rules of the set . for each rule in the final set , a temporary rule set was composed by selecting one rule from each folder 's rule set , so that the rules in the temporary set resembled each other , if that was possible given the available rules . \n the median of the wavelengths used in the rules in the temporary rule set determined the wavelength for the rule in the median rule set . \n the intensity threshold and the type of threshold were selected similarly for the rule in the median rule set . \n each sample was diagnosed as either healthy or carious by the first author , and the selected rules estimated each sample to be either healthy or carious . based on these two properties , \n samples which were diagnosed as healthy and which were estimated to be healthy by the rules are called true negatives ( tns ) . \n similarly , carious samples which were correctly estimated are called true positives ( tps ) . \n a healthy sample which was estimated to be carious is called false positive ( fp ) and a carious sample which was estimated to be healthy is called a false negative ( fn ) . \n these four values can be used to calculate the following five values which describe the accuracy of the selected rules . \n positive predictive value ( ppv ) is the probability that the classifier , that is , the set of rules , is correct when it estimates a sample to be carious . \n negative predictive value ( npv ) is the probability that a healthy estimate is correct . \n accuracy is the fraction of the samples which were correctly estimated , that is , where the rules gave the correct answer . \n positive predictive value ( ppv ) is the probability that the classifier , that is , the set of rules , is correct when it estimates a sample to be carious . \n negative predictive value ( npv ) is the probability that a healthy estimate is correct . \n accuracy is the fraction of the samples which were correctly estimated , that is , where the rules gave the correct answer . \n after the classification rules had been selected and the samples had been classified according to them , there were fifteen samples which the author had diagnosed as carious but which were classified as healthy ( false negatives ) . \n the spectra of these samples were virtually indistinguishable from the spectra of the healthy samples ( see figure 3(a ) ) , at least for the analysis methods used in this study . \n thus , a hypothesis was made that these samples , the false negative cases , had been misdiagnosed by the author and subsequently mislabeled . \n the rules that were selected by the algorithm suggested that a short wavelength , namely , 420 nm , was relatively useful in the diagnosis of caries . \n therefore , another hypothesis was made , according to which a number of samples had been diagnosed by the author as carious while in fact the measured points were only stained and were thus false positive cases of the diagnosis , even if they had been classified correctly by the classifier . \n notation i( ) refers to the normalized intensity of the spectra at wavelength . in other words , the sample was thought to represent a stain if it had a small scattering coefficient at both a long wavelength ( 815 nm , which is in the near - infrared range ) and a short wavelength ( 420 nm ) . \n the samples , or the spectra of the measured points , are presented in figure 2 . \n the number of wavelengths which were selected as options for the rule 's parameter , that is , parameter wavelengthoptioncount , had only a small effect on the accuracy of the resulting median rule set . \n when only the shortest wavelength ( 420 nm ) and the longest wavelength ( 1000 nm ) were available as options , the median rule set had an accuracy of 82% . with three wavelengths to choose from , \n when the number of options was between four and six , the accuracy was 85% . with greater numbers of wavelengths available , the accuracy was 84% . \n this suggested that the rules depicted a phenomenon which was consistently present in all four folders . \n when the number of options for the rules ' wavelengths was 15 , the median rule set indicated that a sample is carious if , and only if , i( 420 ) \n a confusion matrix of the classification accuracy that is achieved with these rules is presented in table 1 , showing that these rules reached an accuracy of 84% . as can be seen in figure 3(a ) and in table 1 , there were fifteen carious samples which were classified as healthy ( false negatives ) , and whose spectra was virtually indistinguishable from the spectra of the healthy samples . \n as explained in section 2.4 , this leads to a hypothesis that these samples had been misdiagnosed and subsequently mislabeled , and that they therefore represented healthy samples and were in fact classified correctly . \n according to the theory on optical caries diagnosis , an elevated intensity in the near - infrared range is the best indication of a dental caries lesion . \n however , the rules selected by the search algorithm indicated that a short wavelength , namely , 420 nm , was relatively useful in the diagnosis of caries . as explained in section 2.4 , \n another hypothesis was thus made , according to which a number of samples had been diagnosed as carious while in fact they were only stained . \n all samples that were identified as stained had been diagnosed and classified as carious , and thus appeared to be true positive cases . \n these suspected misdiagnoses had not lowered the apparent accuracy of the classification , but they may have caused the rule set to erroneously consider stains as caries lesions . \n when the search algorithm was run again , giving 15 options for the parameter , after first relabeling the fifteen false negative cases as healthy samples ( first hypothesis ) and then relabeling the eight suspected stains as healthy samples ( second hypothesis ) , the algorithm selected only one rule in every cross - validation folder . \n all rules set an upper limit for the normalized intensity at a wavelength in the near - infrared range . \n the median of those rules was i( 791 ) 0.3255 , which is consistent with the theory . \n this study suffers from a small number of samples . although the study used 109 measurements , they were taken from only 21 individual teeth \n this fact is significant , because it is probable that samples taken from a single tooth resemble each other more than samples taken from different teeth or from different patients . \n fifteen of those measurements were considered to be misdiagnosed by the first hypothesis , and further eight measurements were considered to be misdiagnosed by the second hypothesis . therefore , further study is needed to increase the reliability of the accuracy estimate of this method . \n the measurement results together with the theory on the topic suggest that many of the measurements which were supposedly made from a caries lesion are in fact made from healthy enamel , which was in some cases stained . when we make these suggested corrections to the labeling of the samples , the samples seem to fit well to the theory and the samples can easily be accurately classified \n . these kinds of diagnostic mistakes , or false positive diagnoses , are a credible explanation , because the diagnoses were made by a novice on the subject . \n however , such corrections also pose a risk that the measurement results are relabeled to make them fit the theory , which would inflate the accuracy of the method . \n the composition of the dental tissues varies from tooth to tooth and between different sites of a given tooth . \n as can be seen in figure 2 , the spectra of the different healthy samples vary quite a bit , especially at the visible wavelengths . \n this suggests that the threshold intensity or intensities for diagnosing a suspected lesion as carious might also vary similarly . in order to compensate for the inter - tooth and intra - tooth variance \n , we might consider measuring the average spectra for a given tooth by measuring several points on the tooth surface , that is , by scanning the surface and by evaluating how much the spectra of the suspected lesion differ from the tooth 's average . \n unfortunately , this approach could potentially make this method less effective for its original purpose . \n the method is being developed for the detection of caries lesions at an early stage of development . \n thus , the dentist does not necessarily notice all of the lesions which are detected by the device . \n if the inspected tooth surface contains several developing caries lesions , the average spectra of the surface could be something in between the healthy enamel and the carious enamel , making the lesions appear too similar to the average surface to be diagnosed as carious . \n the scanning method would also make it rather awkward to inspect several teeth per patient . \n quantitative light - induced fluorescence ( qlf ) and laser - induced fluorescence ( lf ) are two optical methods for the detection of caries lesions . \n they are based on fluorescence , or the phenomenon that when the tooth sample is illuminated with a light source , some of the light is absorbed in the sample , after which the sample emits light at a longer wavelength . for both methods \n study the sample was considered carious if the measured intensity was greater than a fixed threshold , i( 791 ) 0.3255 . \n the proposed explanation is that the increased scattering due to caries causes more light to be reflected to the measuring fiber optic . \n > 520 nm because increased scattering due to caries interferes with the detection of the fluorescence , and lf expects to find increased intensity at the near - infrared range caused by fluorescence from organic molecules in the sample . \n since the samples in this study were stored in denatured alcohol , they were probably relatively free of organic molecules . \n further study is required to determine whether the fluorescence from organic molecules , that is , the phenomenon measured by lf , interferes with the detection method outlined in this study , especially for in vivo measurements . \n if it does interfere , it probably makes the method more eager to label a sample as carious , thus increasing its sensitivity and reducing its specificity . \n this effect may be modified , at least in part , by selecting a new set of rules based on results from in vivo measurements . incidentally , \n in contrast , authors of this study felt that the method outlined in this paper helped them to increase specificity . \n an ability to measure the amount of dental tissue lost to caries could be pursued by inducing caries in vitro to a tooth sample ( see [ 6 , 17 , 18 ] ) so that the amount of mineral dissolved from the tooth could be measured without destroying the sample , and by measuring the spectra of the sample at varying degrees of mineral loss . \n one possible method for this would be to cycle the tooth sample in de- and remineralization solutions and to measure the amount of mineral dissolved to the solutions with a mass spectrometer . \n finding a method to calculate the amount of the mineral loss from the spectra would be a regression problem . \n it seems that spectroscopic measurements can help to reduce false positives at in vitro setting , including those caused by stains . \n however , the work reported in this paper was a pilot study , and further research is required to evaluate the strength of the evidence for the method 's performance at in vitro setting and to extend the measurements to in vivo setting .", "role": "user" }, { "content": "background . \n a caries lesion causes changes in the optical properties of the affected tissue . \n currently a caries lesion can be detected only at a relatively late stage of development . \n caries diagnosis also suffers from high interobserver variance \n . methods . \n this is a pilot study to test the suitability of an optical diffuse reflectance spectroscopy for caries diagnosis . \n reflectance visible / near - infrared spectroscopy ( vis / nirs ) was used to measure caries lesions and healthy enamel on extracted human teeth . \n the results were analysed with a computational algorithm in order to find a rule - based classification method to detect caries lesions . \n results . \n the classification indicated that the measured points of enamel could be assigned to one of three classes : healthy enamel , a caries lesion , and stained healthy enamel . \n the features that enabled this were consistent with theory . conclusions . \n it seems that spectroscopic measurements can help to reduce false positives at in vitro setting . \n however , further research is required to evaluate the strength of the evidence for the method 's performance .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: post - traumatic stress disorder ( ptsd ) is characterized by various altered emotional responses as a result of trauma exposure ( e.g. , combat , assault , and disasters ) . \n patients with ptsd not only experience intense negative emotional reactions when reminded of their trauma but also report exaggerated arousal ( poor sleep , restlessness , hypervigilance ) , anhedonia , social withdrawal , and decreased emotional expressivity , referred to as emotional numbing . characterizing the neural basis of these diverse , distorted emotional responses poses a major challenge to contemporary psychiatric research . \n functional neuroimaging techniques have focused primarily on the study of brain function related to fear perception and response , and have consistently implicated aberrant amygdala reactivity to fear - relevant probes and other abnormalities in a broad aberrant amygdala - linked circuitry involving the medial prefrontal cortex ( mpfc ) , insula , anterior cingulate cortex ( acc ) , and hippocampus ( rauch and shin , 1997 ; pitman et al . , 2001 ; nemeroff et al . , 2006 ; rauch et al . , 2006 ; etkin and wager , 2007 ; liberzon and sripada , 2008 ; shin , 2009 ; shin and liberzon , 2010 ) . \n together these interconnected regions form a disrupted functional network thought to be responsible for impaired regulation of fear responses , enhanced attention to threat - related stimuli , and biased memory for adverse events ( shin , 2009 ) . \n anxiety disorders , such as ptsd , are believed to manifest from dysfunction in a complex integrated functional network , largely , between cortical and limbic regions ( gilboa et al . \n , 2008 ; bluhm et al . , 2009 ; shaw et al . , 2009 ; daniels et al . , 2010 ) . \n some studies have begun to examine these brain circuits and region - to - region interactions , by measuring the extent to which activity in one region is correlated with activity in another during a particular task . \n although these dysfunctional networks have been implicated in mediating several characteristics of ptsd , such as , hyperarousal , abnormal reactivity to emotional stimuli , and avoidance of emotionally distressing memories ( nemeroff et al . , 2006 ; shin and liberzon , 2010 ) , little is known about how these regions may interact dynamically within individual subjects . \n some clues exist from anatomical and functional studies that these brain regions may indeed form a network responsible for emotion processing . \n tracer studies in non - human primates ( amaral and price , 1984 ; saunders et al . , 1988 ; barbas and de olmos , 1990 ; stefanacci et al . , 1996 ; ghashghaei and barbas , 2002 ; ghashghaei et al . , 2007 \n ; freese and amaral , 2009 ) and , more recently , diffusion tensor imaging studies in humans ( croxson et al . , 2005 ; johansen - berg et al . , 2008 ; \n 2009 ) have identified robust bidirectional projections between the amygdala and the mpfc , rostral acc ( racc ) , insula , and hippocampus . \n consistent with known anatomical connections , several studies that have examined functional connectivity of the amygdala have found significant co - activation and/or functionally correlated activation of the amygdala and the mpfc , insula , hippocampus , and racc ( phan et al . , 2002 ; wager et al . \n , 2007a ; kober et al . , 2008 ; etkin et al . , 2009 ; \n it is well established that negatively valenced emotional stimuli activate the amygdala , which mediates subjective and attentional - vigilance aspects of threat processing ( liberzon et al . , 1999 \n liberzon and phan , 2003 ; taylor et al . , 2003 ; wager et al . , 2003 ; \n etkin and wager , 2007 ; kober et al . , 2008 ; liberzon and sripada , 2008 ; etkin , 2009 ; shin and liberzon , 2010 ) . \n similarly , insula activity also increases in response to emotionally aversive stimuli that evoke visceral or somatic sensations ( simmons et al . , 2004 ) . \n increased amygdala and insula activation during fear conditioning have been shown to be reliably associated with one another ( etkin and wager , 2007 ) . \n amygdala activity is decreased in response to suppression of negative affect via reappraisal and during inhibition of conditioned fear responses as a result of increased activation in the mpfc and racc , which exert top - down inhibitory influences on amygdala reactivity to fear and threat ( ochsner et al . , 2002 ; taylor et al . , 2003 ; phelps et al . , 2004 ; etkin et al . , 2006 , 2011 ; urry et al . , 2006 ; \n the magnitude of task - dependent functional coupling between the amygdala and mpfc / racc has been shown to be negatively correlated with intensity of subjective reports of negative affect ( banks et al . , 2007 ) . \n increased functional connectivity between the amygdala and the hippocampus has been attributed to the persistence of memories for emotionally arousing events ( hamann et al . \n , 1999 ; kilpatrick and cahill , 2003 ; phelps , 2004 ; ritchey et al . \n , 2008 ; murty et al . , 2011 ) . specifically , the hippocampus forms episodic representations of the emotional significance and interpretation of events , and influences amygdala activity when emotional stimuli are encountered ( phelps , 2004 ) \n . these lines of convergent evidence suggests that how the amygdala interacts with other regions may mediate the control , or lack thereof , of fear perception and emotional arousal in humans . \n dysfunctions within discrete areas that form an amygdala paralimbic / frontal network have been implicated in mediating several characteristics of ptsd , such as , hyperarousal , abnormal reactivity to emotional stimuli , and avoidance of emotionally distressing memories ( nemeroff et al . , 2006 ; shin and liberzon , 2010 ) . in particular , many studies have shown amygdala hyperactivity in ptsd in response to trauma - related imagery ( shin et al . \n , 1997 , 2004a ) , combat - related sounds or smells ( liberzon et al . , 1999 ; pissiota et al . , 2002 ; vermetten et al . , 2007 ) , trauma - related photographs or words ( hendler et al . , 2003 ; driessen et al . , 2004 ; \n , 2000 ; shin et al . , 2005 ; williams et al . , 2006 ; bryant et al . , 2008 ) . exaggerated amygdala reactivity observed in ptsd has been posited to be a result of insufficient top - down regulation from the mpfc and acc , consequently leading to hyperarousal and deficits in extinction as well as the inability to suppress enhanced fear perception or exaggerated fear responses to trauma - related stimuli ( rauch and shin , 1997 ; rauch et al . \n , 1998 ; pitman et al . , 2001 ; liberzon and phan , 2003 ) ; for example , shin et al . \n ( 2004a , 2005 ) have observed that exaggerated amygdala reactivity is negatively correlated with responses in the dorsal and ventral mpfc across individuals with ptsd . \n however , gilboa et al . ( 2004 ) found little evidence for failure of inhibition of acc over the amygdala in individuals with ptsd related to civilian trauma during symptom provocation and in fact found that amygdala activity significantly influenced acc activity . \n insula hyperactivity has been observed in ptsd patients and given its role in the experience ( e.g. , somatic sensation ) of negative emotions and structural connectivity to amygdala ( augustine , 1996 ; aggleton and saunders , 2000 ; freese and amaral , 2009 ) , the insula may be working in concert with aberrant amygdala responses ( bremner et al . , 2003 , 2005 ; \n , 2007 ; vermetten et al . , 2007 ; lindauer et al . , 2008 ; simmons et al . , 2008 ; werner et al . , 2009 ; whalley et al \n although less commonly implicated , abnormal hippocampal function , and diminished hippocampal volumes in ptsd patients have been associated with deficits in contextual processing , as well as memory impairments , and neuroendocrine dysregulation ( bremner et al . , 1999 , 2003 ; bonne et al . , 2001 ; \n shin et al . , 2004a , b , 2006 ; werner et al . , 2009 ) . \n recently these functional connectivity techniques have been applied to the study of corticolimbic circuitry abnormalities at baseline or at rest ( resting - state functional connectivity ) . \n studies of functional interconnectivity of brain regions derived from resting - state scans provides insight into the relationship of spontaneous brain activity between brain regions without being confounded by task influences on activation and has even been shown to reflect structural connectivity between brain regions ( greicius et al . , 2009 ; \n resting - state functional connectivity of the amygdala has revealed patterns of connectivity consistent with task - based connectivity patterns ( stein et al . \n moreover , resting - state functional connectivity has been a useful tool for identifying abnormalities in the functional organization of brain systems in several anxiety and mood disorders ( greicius , 2008 ) . \n however , little is known about what abnormalities , if any , in amygdala connectivity exist at rest in ptsd . \n therefore the primary aim of the present experiment was to investigate aberrant amygdala functional connectivity patterns in returning operation enduring freedom / operation iraqi freedom ( oef / oif ) veterans with combat - related ptsd ( ptsd group ) and combat - exposed oef / oif veterans without ptsd [ combat - exposed control ( cec ) group ] during resting - state . \n we hypothesized that amygdala connectivity to the acc , mpfc , insula , and hippocampus would differentiate the ptsd group from the cec group . \n if observed , such findings would extend our understanding of the pathophysiology of ptsd by identifying a disturbed network that exists outside of the presence of an overt threat / danger or in the absence of stimulus or task - induced negative emotional processing . \n thirty - four , right - handed , male veterans returning from oef / oif with documented exposure to combat - related trauma participated in this study . based on the dsm - iv ( apa , 1994 ) , \n 17 participants met criteria for current ptsd ( ptsd group ; age : 30.12 7.70 years ; caucasian = 16 ; hispanic or latino = 1 ) and the other 17 participants were combat - exposed matched controls without ptsd ( cec group ; age : 33.71 9.12 ; caucasian = 16 ; asian = 1 ) . \n psychiatric diagnoses were established via the structured clinical interview for dsm - iv ( first et al . , 1996 ) . \n additional standardized clinical instruments including the clinician administered ptsd scale ( caps ; blake et al . , 1995 ) , the ptsd checklist : military ( pcl - m ; blanchard et al . , 1996 ) , the combat exposure scale ( ces ; keane et al . , 1989 ) , the hamilton depression inventory ( ham - d ; williams , 1988 ) , and the beck depression inventory ( bdi - ii ; beck et al . , 1996 ) were administered to quantitatively characterize ptsd symptoms , severity of trauma exposure , and depression . \n relative to the cec group , the ptsd group had significantly higher scores on the caps , pcl - m , and ham - d and bdi - ii . of note \n , the groups did not differ in severity of trauma exposure . some of the ptsd patients had current psychiatric co - morbidity ( n = 2 with current major depressive disorder ; n = 2 with current alcohol abuse ) or had a past co - morbidity more than 6 months ago ( n = 1 had major depressive disorder ; n = 4 had alcohol abuse , one of whom also had past opioid abuse ; n = 1 had alcohol dependence in full sustained remission ) at the time of scanning . \n in addition , some ptsd patients had a history of psychotropic medication usage ( n = 8 had taken an selective serotonin reuptake inhibitor , one of whom had also taken a norepinephrine dopamine reuptake inhibitor ; n = 1 had taken a tri - cyclic antidepressant ; n = 2 had taken a serotonin antagonist - reuptake inhibitor ) , but none of the ptsd patients were currently taking any psychotropic medications at the time of scanning . \n all participants were free of any clinically significant medical or neurologic condition that would affect brain blood flow / metabolism or function and/or task performance . \n none of the subjects had a positive urine toxicology screen at the time of scanning . \n all participants gave written informed consent after explanation of the experimental protocol , as approved by the va ann arbor healthcare system and university of michigan institutional review boards . \n ptsd , post - traumatic stress disorder ; cec , combat - exposed controls ; caps , clinician administered ptsd scale ; pcl - m , ptsd checklist : military ; bdi - ii , beck depression inventory ; ham - d , hamilton depression inventory ; ces , combat exposure scale . \n all participants underwent an 8-min resting - state fmri scan in which they were instructed to fixate on a white crosshair that was centrally projected against a black background and let their mind wander without falling asleep . \n fmri scanning was performed on a 3 t ge signa system ( general electric ; milwaukee , wi , usa ) using a standard radiofrequency coil at the university of michigan functional mri laboratory . \n whole - brain functional images ( i.e. , blood oxygenated level - dependent , bold ) were collected from 43 axial , 3-mm - thick slices using a t2 * -sensitive gradient echo reverse spiral acquisition sequence ( repetition time , 2000 ms ; echo time , 30 ms ; 64 64 matrix ; 220 mm field of view ; flip angle , 90 ) , optimized to minimize susceptibility artifacts ( signal loss ) at the medial temporal lobe ( including the amygdala ; stenger et al . , 2000 ) . \n cardiac and respiratory cycles were recorded with mri vendor supplied pulse - oximeter and respiratory belt for physiological corrections on resting - state data . \n a t1-weighted anatomical image was collected in the same planes as the functional data , but with higher in - plane resolution ( 1 mm , t1-overlay ) to aid in later co - registration . \n a high resolution , t1-weighted volumetric anatomical scan ( t1-spgr ; three - dimensional spoiled gradient echo ) was also acquired for precise anatomical localization and normalization . \n data from 32 participants ( cec = 17 ; ptsd = 15 ) met criteria for high quality and scan stability with minimum motion correction and were subsequently included in fmri analyses ( <3 mm displacement in any one direction ; two ptsd patients were excluded for poor data quality due to excessive head movement ) . \n functional data were processed and analyzed using statistical parametric mapping software ( spm8 ; wellcome trust centre for neuroimaging , london ) using similar methods previously published from our lab ( jelsone - swain et al . , 2010 ) . \n images were corrected for physiological signal fluctuations using a custom code written in matlab ( mathworks , natick , ma , usa ; noll et al . , 1991 ) . \n slice timing and movement correction was done to the time - series data using spm8 . \n each participant s t1-overlay was co - registered to the time - series data and the t1-spgr was then co - registered to the co - registered t1-overlay image . \n the co - registered t1-spgr was then segmented into gray matter , white matter , and cerebrospinal fluid ( csf ) and normalized to montreal neurological institute ( mni ) space using vbm8 toolbox of spm8 and the resulting normalization matrix was applied to the time - series data . \n these normalized time - series data were subsequently re - sampled to 2 mm voxels and smoothed with an 8-mm gaussian kernel to minimize noise and effects due to residual differences in functional and gyral anatomy during inter - subject averaging . \n then the resulting white matter and csf segments were further defined using a custom algorithm previously described ( welsh et al . , 2007 ) . \n each voxel s time - series was detrended to correct for linear drift over time . \n nine nuisance covariates ( time - series predictors for global signal , white matter , csf , and the six movement parameters , including the first derivative , obtained during realignment to account for motion - related effects in bold ) were sequentially regressed from the time - series . \n the resulting time - series were then band - passed filtered between the frequencies of 0.01 and 0.10-hz to limit the analysis to resting - state frequencies of interest . to determine amygdala connectivity during resting - state , seed regions in the left and right amygdala \n were defined by an anatomically based amygdala mask in each hemisphere ( from mask of region of interest analysis software , marina ; tzourio - mazoyer et al . , 2002 ; walter et al . , 2003 ) . \n we then extracted the averaged time course from these seed regions in each participant s data and calculated correlation coefficients between these average time courses and all other voxels of the brain resulting in an r - image for amygdala connectivity . \n the resulting correlation coefficients were then transformed into z - scores using a fisher r - to - z transformation and the resulting z images were analyzed at the second level in a random - effects statistical model . \n two - tailed independent samples t tests were used to identify areas of the brain that exhibited activity that covaried with the amygdala differentially during resting - state between the two groups ( ptsd > cec ; cec > ptsd ) . \n significant activations were identified with a whole - brain voxel - wise threshold of p < 0.005 with a minimum cluster extent of > 387 contiguous voxels ( 3096 mm ) , to correct for multiple comparisons at a corrected p < 0.05 calculated using monte - carlo simulations ( afni 3dclustsim ) . \n previous studies interested in differences in brain connectivity between patients with ptsd and trauma - exposed controls without ptsd have used similar significance thresholding approaches to balance type i and ii error rates ( yin et al . \n , 2011a , b ) . to clarify the signal direction , variance , and specificity of differences in strength of connectivity between the cec and ptsd groups during resting - state , we extracted individual subject s z - score values from activated voxels that fell within an anatomically based mask for each a priori region from the between - group contrast ( ptsd > cec ; tzourio - mazoyer et al . , 2002 ; walter et al . , 2003 ) . \n of note , we did not conduct statistical tests on these measures , as they were defined from significant activations resulting from whole - brain maps of group differences in connectivity . \n thirty - four , right - handed , male veterans returning from oef / oif with documented exposure to combat - related trauma participated in this study . based on the dsm - iv ( apa , 1994 ) , \n 17 participants met criteria for current ptsd ( ptsd group ; age : 30.12 7.70 years ; caucasian = 16 ; hispanic or latino = 1 ) and the other 17 participants were combat - exposed matched controls without ptsd ( cec group ; age : 33.71 9.12 ; caucasian = 16 ; asian = 1 ) . \n psychiatric diagnoses were established via the structured clinical interview for dsm - iv ( first et al . , 1996 ) . \n additional standardized clinical instruments including the clinician administered ptsd scale ( caps ; blake et al . , 1995 ) , the ptsd checklist : military ( pcl - m ; blanchard et al . , 1996 ) , the combat exposure scale ( ces ; keane et al . , 1989 ) , the hamilton depression inventory ( ham - d ; williams , 1988 ) , and the beck depression inventory ( bdi - ii ; beck et al . , 1996 ) were administered to quantitatively characterize ptsd symptoms , severity of trauma exposure , and depression . \n relative to the cec group , the ptsd group had significantly higher scores on the caps , pcl - m , and ham - d and bdi - ii . of note \n , the groups did not differ in severity of trauma exposure . some of the ptsd patients had current psychiatric co - morbidity ( n = 2 with current major depressive disorder ; n = 2 with current alcohol abuse ) or had a past co - morbidity more than 6 months ago ( n = 1 had major depressive disorder ; n = 4 had alcohol abuse , one of whom also had past opioid abuse ; n = 1 had alcohol dependence in full sustained remission ) at the time of scanning . \n in addition , some ptsd patients had a history of psychotropic medication usage ( n = 8 had taken an selective serotonin reuptake inhibitor , one of whom had also taken a norepinephrine dopamine reuptake inhibitor ; n = 1 had taken a tri - cyclic antidepressant ; n = 2 had taken a serotonin antagonist - reuptake inhibitor ) , but none of the ptsd patients were currently taking any psychotropic medications at the time of scanning . \n all participants were free of any clinically significant medical or neurologic condition that would affect brain blood flow / metabolism or function and/or task performance . \n none of the subjects had a positive urine toxicology screen at the time of scanning . \n all participants gave written informed consent after explanation of the experimental protocol , as approved by the va ann arbor healthcare system and university of michigan institutional review boards . \n ptsd , post - traumatic stress disorder ; cec , combat - exposed controls ; caps , clinician administered ptsd scale ; pcl - m , ptsd checklist : military ; bdi - ii , beck depression inventory ; ham - d , hamilton depression inventory ; ces , combat exposure scale . \n all participants underwent an 8-min resting - state fmri scan in which they were instructed to fixate on a white crosshair that was centrally projected against a black background and let their mind wander without falling asleep . \n fmri scanning was performed on a 3 t ge signa system ( general electric ; milwaukee , wi , usa ) using a standard radiofrequency coil at the university of michigan functional mri laboratory . \n whole - brain functional images ( i.e. , blood oxygenated level - dependent , bold ) were collected from 43 axial , 3-mm - thick slices using a t2 * -sensitive gradient echo reverse spiral acquisition sequence ( repetition time , 2000 ms ; echo time , 30 ms ; 64 64 matrix ; 220 mm field of view ; flip angle , 90 ) , optimized to minimize susceptibility artifacts ( signal loss ) at the medial temporal lobe ( including the amygdala ; stenger et al . , 2000 ) . \n cardiac and respiratory cycles were recorded with mri vendor supplied pulse - oximeter and respiratory belt for physiological corrections on resting - state data . \n a t1-weighted anatomical image was collected in the same planes as the functional data , but with higher in - plane resolution ( 1 mm , t1-overlay ) to aid in later co - registration . a high resolution , t1-weighted volumetric anatomical scan ( t1-spgr ; three - dimensional spoiled gradient echo ) was also acquired for precise anatomical localization and normalization . \n data from 32 participants ( cec = 17 ; ptsd = 15 ) met criteria for high quality and scan stability with minimum motion correction and were subsequently included in fmri analyses ( <3 mm displacement in any one direction ; two ptsd patients were excluded for poor data quality due to excessive head movement ) . \n functional data were processed and analyzed using statistical parametric mapping software ( spm8 ; wellcome trust centre for neuroimaging , london ) using similar methods previously published from our lab ( jelsone - swain et al . , 2010 ) . \n images were corrected for physiological signal fluctuations using a custom code written in matlab ( mathworks , natick , ma , usa ; noll et al . , 1991 ) . \n slice timing and movement correction was done to the time - series data using spm8 . \n each participant s t1-overlay was co - registered to the time - series data and the t1-spgr was then co - registered to the co - registered t1-overlay image . \n the co - registered t1-spgr was then segmented into gray matter , white matter , and cerebrospinal fluid ( csf ) and normalized to montreal neurological institute ( mni ) space using vbm8 toolbox of spm8 and the resulting normalization matrix was applied to the time - series data . \n these normalized time - series data were subsequently re - sampled to 2 mm voxels and smoothed with an 8-mm gaussian kernel to minimize noise and effects due to residual differences in functional and gyral anatomy during inter - subject averaging . then the resulting white matter and csf segments \n were further defined using a custom algorithm previously described ( welsh et al . , 2007 ) . \n each voxel s time - series was detrended to correct for linear drift over time . \n nine nuisance covariates ( time - series predictors for global signal , white matter , csf , and the six movement parameters , including the first derivative , obtained during realignment to account for motion - related effects in bold ) were sequentially regressed from the time - series . \n the resulting time - series were then band - passed filtered between the frequencies of 0.01 and 0.10-hz to limit the analysis to resting - state frequencies of interest . to determine amygdala connectivity during resting - state , seed regions in the left and right amygdala \n were defined by an anatomically based amygdala mask in each hemisphere ( from mask of region of interest analysis software , marina ; tzourio - mazoyer et al . \n we then extracted the averaged time course from these seed regions in each participant s data and calculated correlation coefficients between these average time courses and all other voxels of the brain resulting in an r - image for amygdala connectivity . \n the resulting correlation coefficients were then transformed into z - scores using a fisher r - to - z transformation and the resulting z images were analyzed at the second level in a random - effects statistical model . \n two - tailed independent samples t tests were used to identify areas of the brain that exhibited activity that covaried with the amygdala differentially during resting - state between the two groups ( ptsd > cec ; cec > ptsd ) . \n significant activations were identified with a whole - brain voxel - wise threshold of p < 0.005 with a minimum cluster extent of > 387 contiguous voxels ( 3096 mm ) , to correct for multiple comparisons at a corrected p < 0.05 calculated using monte - carlo simulations ( afni 3dclustsim ) . \n previous studies interested in differences in brain connectivity between patients with ptsd and trauma - exposed controls without ptsd have used similar significance thresholding approaches to balance type i and ii error rates ( yin et al . \n to clarify the signal direction , variance , and specificity of differences in strength of connectivity between the cec and ptsd groups during resting - state , we extracted individual subject s z - score values from activated voxels that fell within an anatomically based mask for each a priori region from the between - group contrast ( ptsd > cec ; tzourio - mazoyer et al . \n , 2002 ; walter et al . , 2003 ) . of note , we did not conduct statistical tests on these measures , as they were defined from significant activations resulting from whole - brain maps of group differences in connectivity . \n across the entire brain , we observed a discretely localized difference in amygdala connectivity pattern between groups . from the right amygdala anatomical seed region , we observed that ptsd patients exhibited stronger connectivity with the insula than cec subjects ( mni peak : [ 38 , 18 , 2 ] , z - score = 4.29 , volume = 440 voxels ; figure 1 ) ; this pattern was not detected from the left amygdala seed . \n follow - up roi analyses on the extracted z - scores of the strength of connectivity from the insula revealed that both groups exhibited positive amygdala insula coupling , however , the extent of connectivity between the amygdala and insula was greater in the ptsd group than the cec group ( figure 1 ) . to explore the clinical relevance of the observed amygdala \n insula connectivity abnormalities , we performed correlational analyses between the extracted values of the strength of connectivity and ptsd symptom severity measures ( caps , bdi - ii , pcl - m , and ham - d ) but did not observe any significant correlations ( all ps > 0.05 , corrected for multiple comparisons ) . of note \n , we did not observe group differences in any other a priori areas that we predicted , such as the acc , mpfc , and hippocampus in relation to amygdala connectivity at rest . between - group \n whole - brain voxel - wise statistical t map overlaid on a canonical brain rendering ( left , mni coronal , y - plane = 14 ; right , mni sagittal , x - plane = 38 [ right ] ) showing stronger amygdala connectivity to the insula during rest in the ptsd group ( ptsd < cec ) . connectivity target is displayed at whole - brain voxel - wise p < \n 0.005 , uncorrected ; color bar represents statistical t - scores ; bar graph shows mean extracted z - scores ( sem ) within each group from activated voxels that fell within an anatomically based insula mask , showing stronger connectivity in ptsd patients ( > cec ) . \n ptsd , post - traumatic stress disorder ; cec , combat - exposed control ; l , left . \n this is the first study to our knowledge that examines intrinsic amygdala functional connectivity patterns during rest in returning oef / oif veterans with combat - related ptsd compared to a group of oef / oif veterans with combat exposure , but without ptsd . \n we found stronger amygdala insula resting - state functional connectivity in the ptsd group compared to the cec group . of note , \n this connectivity pattern was from the right amygdala seed and was not shown from the left amygdala . although we did not make an a priori prediction about lateralization of amygdala resting - state connectivity several findings of amygdala hyperactivity in ptsd and correlations between ptsd symptom severity and amygdala activity have been right - sided ( rauch et al . , 1996 , 2000 ; \n pissiota et al . , 2002 ; fredrikson and furmark , 2003 ; driessen et al . , 2004 ; shin et al . , 2004a ) . \n contrary to our original hypothesis we did not observe any significant differences in amygdala connectivity to any other a priori regions ( mpfc , acc , hippocampus ) in the ptsd group compared to the cec group at rest . \n this is a notable negative finding and requires replication ; however , we acknowledge that the absence of differences in amygdala frontal or amygdala hippocampal connectivity between groups could have resulted from : ( 1 ) our stringent , whole - brain correction for multiple comparisons to detect significance coupled with a small sample size may have led to false negatives and/or more subtle connectivity abnormalities ; and/or ( 2 ) the resting - state task may be insensitive to detecting amygdala prefrontal and amygdala hippocampal connectivity abnormalities , which may require engagement by an overt task . both the amygdala and insula \n have been separately implicated in the pathophysiology of anxiety and ptsd ( rauch et al . , 2000 ; \n pissiota et al . , 2002 ; shin et al . , 2004a ; protopopescu et al . , 2005 ; nemeroff et al . \n , 2006 ; hopper et al . , 2007 ; carrion et al . , 2008 ; shin and liberzon , 2010 ) . \n the amygdala plays an important role in the subjective and attentional - vigilance aspects of threat processing , and thus abnormalities in amygdala activity may be associated with hyperarousal and hypervigilance to threat in ptsd ( etkin , 2009 ) . \n moreover , several studies have shown that the amygdala is hyperresponsive to both trauma - related ( rauch et al . , 1996 ; \n shin et al . , 1997 , 2004a ; liberzon et al . , 1999 ; \n , 2002 ; hendler et al . , 2003 ; driessen et al . , 2004 ; \n , 2005 ; vermetten et al . , 2007 ) and unrelated stimuli in ptsd ( rauch et al . , 2000 ; armony et al . , 2005 ; \n ; williams et al . , 2006 ) , amygdala activation is positively correlated with ptsd symptom severity ( rauch et al . , 1996 ; \n shin et al . , 2004a ; armony et al . , 2005 ; protopopescu et al . , \n fredrikson and furmark , 2003 ) , and symptom reduction after treatment is associated with decreased amygdala activation ( felmingham et al . , 2007 ) . \n likewise , ptsd patients display exaggerated insula activation during script - driven imagery ( lanius et al . \n 2008 ) , fear conditioning and extinction ( bremner et al . , 2005 ) , the anticipation of negative images ( simmons et al . , 2006 ) , the retrieval of emotional or neutral stimuli ( bremner et al . , 2003 ; werner et al . \n , 2009 ; whalley et al . , 2009 ) , and aversive smells and painful stimuli ( vermetten et al . , 2007 ) and is also positively correlated with ptsd symptom severity ( osuch et al . , 2001 ; hopper et al . , 2007 ; \n the insula controls evaluative , experiential , and expressive aspects of internal emotional states via visceral and somatic changes ( e.g. , autonomic flight - or - fight responses ) evoked during presentations of aversive stimuli ( phan et al . , 2002 ; anderson et al . , 2003 ; \n critchley et al . , 2004 ; simmons et al . , 2004 ; paulus and stein , 2006 ) and it has been posited that the insula relays interoceptive information to the amygdala to help guide behavioral responses ( augustine , 1996 ; craig , 2002 ; simmons et al . , 2004 ; paulus and stein , 2006 ) . \n in fact , the insula provides some of the strongest cortical connections to the major output division of the amygdala responsible for generating fear responses to symptom - provoking stimuli ( augustine , 1996 ; aggleton and saunders , 2000 ; freese and amaral , 2009 ) and abnormalities in these structures has been suggested to underlie exaggerated fear responses and the persistence of traumatic memories ( shin and liberzon , 2010 ) , as well as anxiety proneness ( paulus and stein , 2006 ; simmons et al . \n furthermore , evidence from a recent study suggests that a functional network between the amygdala and insula mediates anxious anticipation of negative events and anxious individuals display exaggerated activity within this network during anticipation of aversive stimuli ( carlson et al . , 2010 ) . \n individuals with ptsd display excess anticipation of negative events and because of this are preoccupied with studying their environment for possible threats ( i.e. , hypervigilance ) and increased amygdala \n insula functional coupling may be a mechanism supporting hypervigilance in patients with ptsd . besides the present study , others have investigated baseline connectivity patterns in patients with ptsd and observed abnormalities in functional connectivity within the default - mode network when compared to healthy controls ( although sometimes inconsistent ; bluhm et al . , 2009 ; daniels et al . \n our study extends these findings to resting - state amygdala coupling within a corticolimbic network known to be dysfunctional during trauma - related anxiety provocation , emotionally based tasks , and evocative stimuli in ptsd patients . however , our study has some important limitations . \n first , our study only included males and therefore can not be generalized to females . \n second , the resting - state analysis of changes in amygdala insula connectivity do not allow for inferences about directionality or causality , which await task - based path or dynamic causal analyses . \n in addition , we have interpreted our resting - state findings based on previous functional and structural imaging studies , however , research with converging methods ( i.e. , task - dependent and -independent fmri , diffusion tensor imaging ) are much needed to link connectivity at rest with brain structure and function . \n lastly , the cross - sectional nature of our measurement does not allow us to ascertain whether enhanced amygdala \n insula resting - state connectivity was present before the traumatic experience and if so , makes it a potential vulnerability maker for ptsd . \n despite these limitations , our findings demonstrate that alterations in these connectivity patterns in a network involved in emotional processing and regulation may be relevant to a brain model of ptsd that involves baseline abnormalities in amygdala insula functional connectivity that exist even without task induction . \n these findings suggest that the aberrant amygdala and insula activation to fear - evocative probes previously characterized in ptsd may be driven by an underlying enhanced connectivity between amygdala , a region known for perceiving threat and generating fear responses , and the insula , a region known for processing the meaning and prediction of aversive bodily states . \n insula connectivity may reflect an exaggerated , pervasive state of arousal that exists outside the presence of an overt , actual threat / danger . \n extends our understanding of the pathophysiology of ptsd , and the current findings prompt further investigation in this emerging area of neuroimaging research . \n the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .", "role": "user" }, { "content": "post - traumatic stress disorder ( ptsd ) is often characterized by aberrant amygdala activation and functional abnormalities in corticolimbic circuitry , as elucidated by functional neuroimaging . \n these activation studies have primarily relied on tasks designed to induce region - specific , and task - dependent brain responses in limbic ( e.g. , amygdala ) and paralimbic brain areas through the use of aversive evocative probes . \n it remains unknown if these corticolimbic circuit abnormalities exist at baseline or at rest , in the absence of fear / anxiety - related provocation and outside the context of task demands . \n therefore the primary aim of the present experiment was to investigate aberrant amygdala functional connectivity patterns in combat - related ptsd patients during resting - state . \n seventeen operation enduring freedom / operation iraqi freedom ( oef / oif ) veterans with combat - related ptsd ( ptsd group ) and 17 combat - exposed oef / oif veterans without ptsd [ combat - exposed control ( cec ) group ] underwent an 8-min resting - state functional magnetic resonance imaging scan . using an anatomically derived amygdala \n seed region we observed stronger functional coupling between the amygdala and insula in the ptsd group compared to the cec group , but did not find group differences in amygdala prefrontal connectivity . \n these findings suggest that the aberrant amygdala and insula activation to fear - evocative probes previously characterized in ptsd may be driven by an underlying enhanced connectivity between the amygdala , a region known for perceiving threat and generating fear responses , and the insula , a region known for processing the meaning and prediction of aversive bodily states . \n this enhanced amygdala \n insula connectivity may reflect an exaggerated , pervasive state of arousal that exists outside the presence of an overt actual threat / danger . \n studying amygdala functional connectivity at rest \n extends our understanding of the pathophysiology of ptsd .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: haematomas of the superficial abdominal wall occur infrequently in the hospital setting . though uncommon the well - described complications of an abdominal wall haematoma include uncontrolled haemorrhage requiring blood product transfusion and death . \n a number of factors are known to predispose to the development of an abdominal wall haematoma . \n these include older age , female sex and the use of anti - platelet or anti - coagulant agents . \n obesity is an additional factor that may complicate the formation of an abdominal wall haematoma . \n compared with the non - obese , the sub - cutaneous tissue of the obese is considered dysfunctional and has a different vascular structure and extra - cellular matrix composition . the self tamponade effect that limits the extension of an abdominal wall haematoma may be deficient in the obese . here \n we report the case of a 59-year - old obese female who developed an abdominal wall haematoma and haemodynamic instability during admission in our hospital . \n a 59-year - old obese female was admitted to the hospital with fever on the background of poorly controlled type 2 diabetes ( hba1c 9.5% ) . \n the patient 's background included ischaemic heart disease , chronic kidney disease , peripheral vascular disease and a right - side , below - knee amputation . \n on examination , the patient 's weight was 125 kg , height 154 cm and body mass index was 53 . \n two weeks later , the patient remained hospitalized for the management of an infected diabetic foot ulcer and awoke one morning with acute abdominal pain and shortness of breath . the patient was haemodynamically compromised with a pulse rate of 120 and blood pressure 90/60 lying . \n the haemoglobin fell overnight from 126 to 90 g / l and a few hours later there was a further fall to 79 \n platelet count was 242 , international normalized ratio ( inr ) 1.0 , activated partial thromboplastin time ( aptt ) 33 and anti - factor xa level 0.41 in keeping with prophylactic clexane administration . \n a ct scan was performed , which demonstrated a large abdominal wall haematoma ( see fig . 1 ) . \n figure 1:ct abdomen of a 59-year - old obese female with an abdominal wall haematoma . ct abdomen of a 59-year - old obese female with an abdominal wall haematoma . \n there are limited data on the relationship between weight or body mass index ( bmi ) and the development of an abdominal wall haematoma . in the case \n series we reviewed , the weight or bmi of the patient is rarely mentioned . yet , \n where a photographic image is published , the patient 's weight and abdominal girth often appear excessive . \n it has been recognized that women are more prone to haematoma formation owing to the relative lack of abdominal wall muscle mass compared with men . \n the effects of pregnancy are also known to contribute to haematoma formation . despite a paucity of evidence \n , it has been suggested that the obese are at risk of developing complicated abdominal wall haematomas and the presence of increased abdominal fat may predispose to an increased risk of haemorrhage . the adipose tissue of the obese differs from those with a normal bmi and obesity - associated adipose tissue dysfunction is an entity thought to be caused by a combination of inappropriate angiogenesis , localized inflammatory reaction and hypoxia . \n specifically , the vascularity of subcutaneous tissue in the obese is abnormal when compared with controls . \n there is an increase in the number and size of blood vessels in the abdominal wall and there are structural alterations in the small arteries . \n these processes are driven by an increase in local vascular endothelial growth factors and angiopoietins . \n change in the subcutaneous tissue of the obese is not limited to the vasculature and there are differences in the extra - cellular matrix when compared with the non - obese with the structure of both elastin and collagen affected . \n quantification of elastin in one trial showed that adipose tissue from obese individuals had < 6% total elastin content compared with 12% in lean individuals . \n as in the elderly where vascular fragility and changes to the subcutaneous tissue environment limit the external compression of an abdominal wall haematoma , the same may be said of the obese . \n for this reason the tamponade effect that contributes to the cessation of haemorrhage may be attenuated in obese patients . to summarize , although abdominal wall haematomas are not common , they are potentially fatal . \n the literature makes little reference to the weight or body mass index of this group of patients . \n it has been shown that there are changes in the vascularity and the extra - cellular matrix in the subcutaneous tissue of the obese . \n it is thought that the lack of external compression of an abdominal wall haematoma makes bleeding more likely . for this reason , \n the obese appear at greater risk from this relatively uncommon phenomenon and vigilance is required in this group of patients to ensure their haemodynamic stability and safety .", "role": "user" }, { "content": "we report the case of a 59-year - old obese female who developed an abdominal wall haematoma during administration of prophylactic clexane . compared with \n the non - obese , the subcutaneous tissue of the obese is considered dysfunctional and has a different vascular structure and extra - cellular matrix composition . \n while the development of an abdominal wall haematoma is relatively uncommon , when they occur they can have fatal consequences . \n the altered subcutaneous tissue environment in the obese attenuates the normal external compression of an abdominal wall haematoma and as a result the obese are at greater risk of haemorrhage .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the extraction of biomolecules , dna , rna , and protein , is the most crucial method used in molecular biology . \n dna , rna , and protein can be isolated from any biological material such as living or conserved tissues , cells , virus particles , or other samples for analytical or preparative purposes . \n two categories that involved in purifying dna include the isolation of recombinant dna constructs such as plasmids or bacteriophage and the isolation of chromosomal or genomic dna from prokaryotic or eukaryotic organisms . \n generally , successful nucleic acid purification required four important steps : effective disruption of cells or tissue ; denaturation of nucleoprotein complexes ; inactivation of nucleases , for example , rnase for rna extraction and dnase for dna extraction ; away from contamination . \n the target nucleic acid should be free of contaminants including protein , carbohydrate , lipids , or other nucleic acid , for example , dna free of rna or rna free of dna . \n quality and also integrity of the isolated nucleic acid will directly affect the results of all succeeding scientific research . \n on the other hand , rna is an unstable molecule and has a very short half - life once extracted from the cell or tissues . \n there are several types of naturally occurring rna including ribosomal rna ( rrna ) ( 80%90% ) , messenger rna ( mrna ) ( 2.5%5% ) and transfer rna ( trna ) . \n special care and precautions are required for rna isolation as it is susceptible to degradation [ 3 , 6 ] . \n rna is especially unstable due to the ubiquitous presence of rnases which are enzymes present in blood , all tissues , as well as most bacteria and fungi in the environment [ 3 , 5 ] . \n the most common isolation methods can be divided into two classes : utilization of 4 m guanidinium thiocyanate and utilization of phenol and sds . \n purification of protein is one of the most important parts in protein research to understand their function , as they may partly or completely be involved in any dna synthesis activity . \n protein purification is required to determine its unique characteristics , including size , charge , shape , and function . \n protein can be extracted by a few methods such as detergent lysis , shearing force , treatment with low ionic salt ( salting out ) , and rapid changes in pressure , which aimed to weaken and break the membranes surrounding the cell to allow proteins to escape . \n normally , protein extraction is performed at a very low temperature ( 4c ) as proteins are easily denatured once they are released from the cells . \n specific buffer conditions are recommended to be maintained because of the sensitivity of proteins toward environmental ph changes . \n the purity of water will affect the yield of end products as unpurified water contains a lot of microorganisms or proteases that will result in protein degradation . \n protein inhibitor , which may exist in solution or buffers , causes the hydrolyzation of proteins . \n detergent , another significant factor that can not be neglected in purification of protein , consists of a hydrophobic portion of a linear or branched hydrocarbon tail and a hydrophilic \n they solubilize the membrane protein and are amphiphatic molecules which form micelles with the hydrophilic head of proteins . \n reducing agents will be added into solution or buffer for protein extraction and purification to avoid the lost of activity of proteins or enzymes which is caused by oxidization . \n storage of proteins is important as the half - life of protein is commonly dependent on the storage temperature . \n a quick and easy assay method must be known for protein purification so that a known molecular weight , specific affinity , or immunoaffinity of nonenzymatic protein of interest can be detected using appropriate method . \n they are ion exchange chromatography , gel filtration , affinity chromatography and gel electrophoresis . \n the very first dna isolation was done by a swiss physician , friedrich miescher in 1869 . \n he hoped to solve the fundamental principles of life , to determine the chemical composition of cells . \n he tried to isolate cells from lymph nodes for his experiment but the purity of lymphocytes was hard and impossible to be obtained in sufficient quantities . \n therefore , he switched to leucocytes , where he obtained them from the pus on collected surgical bandages . \n initially , miescher focused on the various type of protein that make up the leukocytes and showed that proteins were the main components of the cell 's cytoplasm . during his tests , he noticed that a substance precipitated from the solution when acid was added and dissolved again when alkali was added . \n this was , for the first time he had obtained a crude precipitate of dna . \n to separate dna from the proteins in his cell extracts , miescher developed new protocol to separate the cells ' nuclei from cytoplasm and then isolated dna . \n however , his first protocol failed to yield enough material to continue with further analysis . \n he had to develop a second protocol to obtain larger quantities of purified nuclein , which had been named as nucleic acid later by his student , richard altman . in the eighteenth century \n , proteins were known as a distinct class of biological molecules by antoine fourcroy and others . \n they distinguished this molecule by its ability to coagulate under treatment with heat or acid . \n however , the first description of protein was carried out by gerhardus johannes mulder , a dutch chemist , in 1893 . \n his studies on the composition of animal substances , mainly fibrin , albumin , and gelatin , showed the presence of carbon , hydrogen , oxygen , and nitrogen . \n furthermore , he recognized that sulfur and phosphorus were present sometimes in animal substances that consisted large number of atoms and he established that these substances were macromolecules . \n most of the early studies focused on proteins that could be purified in large quantities . \n most of the proteins are hard to purify in more than milligram quantities even with today 's highly advanced methods . \n a majority of techniques for protein purification were developed in a project led by edwin joseph cohn , a protein scientist , during world war ii . \n he was responsible for purifying blood and worked out the techniques for isolating the serum albumin fraction of blood plasma , which is important in maintaining the osmotic pressure in the blood vessels , which help keep soldier alive . \n after the fated event where miescher managed to obtain dna from cell , many others have followed suit which lead to further advancement in the dna isolation and purification protocol . \n the initial routine laboratory procedures for dna extraction were developed from density gradient centrifugation strategies . \n later procedures made use of the differences in solubility of large chromosomal dna , plasmids , and proteins in alkaline buffer . \n currently , there are many specialized method of extracting out pure dna , rna , or protein . \n most of these protocols have been developed into commercial kits that ease the biomolecules extraction processes . \n ( 1 ) guanidinium thiocyanate - phenol - chloroform extractionsalt is the common impurity in nucleic acid samples . \n it has always been required to be removed from nucleic acid samples before any downstream processes and analysis can be done . therefore , single or multiple separation and/or purification steps are needed to desalt the sample comprising the nucleic acid . \n the general steps of nucleic acid purification include cell lysis , which disrupts the cellular structure to create a lysate , inactivation of cellular nucleases such as dnase and rnase , and separation of desired nucleic acid from cell debris . \n organic solvent phenol - chloroform extraction is one of the examples , which is widely used in isolating nucleic acid . \n although phenol , a flammable , corrosive , and toxic carbolic acid can denature proteins rapidly , it does not completely inhibit rnase activity . \n this problem can be solved by using a mixture of phenol : chloroform : isoamyl alcohol ( 25:24:1 ) . \n proteins , lipids , carbohydrates , and cell debris are removed through extraction of the aqueous phase with the organic mixture of phenol and chloroform [ 12 , 13 ] . \n the hydrophobic layer of the emulsion will then be settled on the bottom and the hydrophilic layer on top by centrifugation . \n the upper phase which contained dna is collected and dna can be precipitated from the supernatant by adding ethanol or isopropanol in 2 : 1 or 1 : 1 ratios and high concentration of salt . \n dna precipitate is collected by centrifugation , and excess salt is rinsed with 70% ethanol and centrifuged to discard the ethanol supernatant . \n the dna pellet is then dissolved with te buffer or sterile distilled water .the use of guanidinium isothiocyanate in rna extraction was first mentioned by ulrich et al . \n therefore , it has been displaced by a single - step technique , which is known as guanidinium thiocyanate - phenol - chloroform extraction , by chomczynski and sacchi ( 1987 ) , whereby the homogenate is extracted with phenol / chloroform at reduced ph . \n the principle of this single - step technique is that rna is separated from dna after extraction with acidic solution consisting guanidinium thiocyanate , sodium acetate , phenol , and chloroform . in the acidic conditions , \n total rna will remain in the upper aqueous phase of the whole mixture , while dna and proteins remain in the interphase or lower organic phase . \n it has always been required to be removed from nucleic acid samples before any downstream processes and analysis can be done . \n therefore , single or multiple separation and/or purification steps are needed to desalt the sample comprising the nucleic acid . \n the general steps of nucleic acid purification include cell lysis , which disrupts the cellular structure to create a lysate , inactivation of cellular nucleases such as dnase and rnase , and separation of desired nucleic acid from cell debris . \n organic solvent phenol - chloroform extraction is one of the examples , which is widely used in isolating nucleic acid . \n although phenol , a flammable , corrosive , and toxic carbolic acid can denature proteins rapidly , it does not completely inhibit rnase activity . \n this problem can be solved by using a mixture of phenol : chloroform : isoamyl alcohol ( 25:24:1 ) . \n proteins , lipids , carbohydrates , and cell debris are removed through extraction of the aqueous phase with the organic mixture of phenol and chloroform [ 12 , 13 ] . \n the hydrophobic layer of the emulsion will then be settled on the bottom and the hydrophilic layer on top by centrifugation . \n the upper phase which contained dna is collected and dna can be precipitated from the supernatant by adding ethanol or isopropanol in 2 : 1 or 1 : 1 ratios and high concentration of salt . \n dna precipitate is collected by centrifugation , and excess salt is rinsed with 70% ethanol and centrifuged to discard the ethanol supernatant . \n the use of guanidinium isothiocyanate in rna extraction was first mentioned by ulrich et al . \n therefore , it has been displaced by a single - step technique , which is known as guanidinium thiocyanate - phenol - chloroform extraction , by chomczynski and sacchi ( 1987 ) , whereby the homogenate is extracted with phenol / chloroform at reduced ph . \n the principle of this single - step technique is that rna is separated from dna after extraction with acidic solution consisting guanidinium thiocyanate , sodium acetate , phenol , and chloroform . in the acidic conditions , \n total rna will remain in the upper aqueous phase of the whole mixture , while dna and proteins remain in the interphase or lower organic phase . \n ( 2 ) alkaline extraction methodalkaline lysis has been used to isolate plasmid dna and e. coli . \n it works well with all strains of e. coli and with bacterial cultures ranging in size from 1 ml to more than 500 ml in the presence of sodium dodecyl sulfate ( sds ) . \n the principle of the method is based on selective alkaline denaturation of high molecular weight chromosomal dna while covalently closed circular dna remains double stranded . \n bacterial proteins , broken cell walls , and denatured chromosomal dna enmeshed into large complexes that are coated with dodecyl sulfate . \n plasmid dna can be recovered from the supernatant after the denatured material has been removed by centrifugation . \n it works well with all strains of e. coli and with bacterial cultures ranging in size from 1 ml to more than 500 ml in the presence of sodium dodecyl sulfate ( sds ) . \n the principle of the method is based on selective alkaline denaturation of high molecular weight chromosomal dna while covalently closed circular dna remains double stranded . \n bacterial proteins , broken cell walls , and denatured chromosomal dna enmeshed into large complexes that are coated with dodecyl sulfate . \n plasmid dna can be recovered from the supernatant after the denatured material has been removed by centrifugation . \n ( 3 ) ctab extraction methodfor plant extraction , the initial step that needs to be done is to grind the sample after freezing it with liquid nitrogen . \n the purpose of doing this step is to break down cell wall material of sample and allow access to nucleic acid while harmful cellular enzymes and chemicals remain inactivated . after grinding the sample \n cetyltrimethylammonium bromide ( ctab ) is a nonionic detergent that can precipitate nucleic acids and acidic polysaccharides from low ionic strength solutions . \n meanwhile , proteins and neutral polysaccharides remain in solution under these conditions . in solutions of high ionic strength \n ctab is therefore useful for purification of nucleic acid from organisms which produce large quantities of polysaccharides such as plants and certain gram - negative bacteria . \n nucleic acid must be precipitated after this from the supernatant and washed thoroughly to remove contaminating salts . \n the purified nucleic acid is then resuspended and stored in te buffer or sterile distilled water . for plant extraction , \n the initial step that needs to be done is to grind the sample after freezing it with liquid nitrogen . \n the purpose of doing this step is to break down cell wall material of sample and allow access to nucleic acid while harmful cellular enzymes and chemicals remain inactivated . after grinding the sample \n cetyltrimethylammonium bromide ( ctab ) is a nonionic detergent that can precipitate nucleic acids and acidic polysaccharides from low ionic strength solutions . \n proteins and neutral polysaccharides remain in solution under these conditions . in solutions of high ionic strength \n ctab is therefore useful for purification of nucleic acid from organisms which produce large quantities of polysaccharides such as plants and certain gram - negative bacteria . \n nucleic acid must be precipitated after this from the supernatant and washed thoroughly to remove contaminating salts . \n the purified nucleic acid is then resuspended and stored in te buffer or sterile distilled water . \n ( 4 ) ethidium bromide ( etbr)-cesium chloride ( cscl ) gradient centrifugationcscl gradient centrifugation is a complicated , expensive , and time - consuming method compared to other purification protocols . \n nucleic acids can be concentrated by centrifugation in an etbr - cscl gradient after alcohol precipitation and resuspension . \n covalently closed circular molecules will accumulate at lower densities in the cscl gradient because they incorporate less etbr per base pair compared to linear molecules . \n cscl gradient centrifugation is a complicated , expensive , and time - consuming method compared to other purification protocols . \n nucleic acids can be concentrated by centrifugation in an etbr - cscl gradient after alcohol precipitation and resuspension . \n covalently closed circular molecules will accumulate at lower densities in the cscl gradient because they incorporate less etbr per base pair compared to linear molecules . \n ( 5 ) purification of poly ( a ) rna by oligp(dt)-cellulose chromatographypoly ( a ) rna is the template for protein translation and most of the eukaryotic mrnas carry tracts of it at their 3 termini [ 4 , 15 ] . \n it makes up 1 to 2% of total rna and can be separated by affinity chromatography on oligo ( dt)-cellulose . poly ( a ) tails form stable rna - dna hybrids with short chains of oligo ( dt ) that attach to various support matrices [ 4 , 15 ] . \n high salt must be added to the chromatography buffer to stabilize the nucleic acid duplexes as only a few dt - a base pairs are formed . \n a low - salt buffer is used after nonpolyadenylated rnas have been washed from the matrix . this buffer helps to destabilize the double - stranded structures and elute the poly ( a ) rnas from the resin . \n there are two methods commonly used in the selection of poly ( a ) rna column chromatography on oligo ( dt ) columns and batch chromatography . \n column chromatography normally used for the purification of large quantities ( > 25 g ) of nonradioactive poly ( a ) rna isolated from mammalian cells . \n batch chromatography is the preferred method when working with small amounts ( < 50 g ) of total mammalian rna . \n it can be used when many rna samples are to be processed , whether radioactive or not . \n batch chromatography is carried out with a fine grade of oligo ( dt ) cellulose at optimal temperatures for binding and elution . \n poly ( a ) rna is the template for protein translation and most of the eukaryotic mrnas carry tracts of it at their 3 termini [ 4 , 15 ] . \n it makes up 1 to 2% of total rna and can be separated by affinity chromatography on oligo ( dt)-cellulose . poly ( a ) tails form stable rna - dna hybrids with short chains of oligo ( dt ) that attach to various support matrices [ 4 , 15 ] . \n high salt must be added to the chromatography buffer to stabilize the nucleic acid duplexes as only a few dt - a base pairs are formed . \n a low - salt buffer is used after nonpolyadenylated rnas have been washed from the matrix . this buffer helps to destabilize the double - stranded structures and elute the poly ( a ) rnas from the resin . \n there are two methods commonly used in the selection of poly ( a ) rna column chromatography on oligo ( dt ) columns and batch chromatography . \n column chromatography normally used for the purification of large quantities ( > 25 g ) of nonradioactive poly ( a ) rna isolated from mammalian cells . \n batch chromatography is the preferred method when working with small amounts ( < 50 g ) of total mammalian rna . \n it can be used when many rna samples are to be processed , whether radioactive or not . \n batch chromatography is carried out with a fine grade of oligo ( dt ) cellulose at optimal temperatures for binding and elution . \n solid - phase nucleic acid purification can be found in most of the commercial extraction kits available in market . \n many of the problems that are associated with liquid - liquid extraction such as incomplete phase separation can be prevented . \n solid phase system will absorb nucleic acid in the extraction process depending on the ph and salt content of the buffer . \n the absorption process is based on the following principles : hydrogen - binding interaction with a hydrophilic matrix under chaotropic conditions , ionic exchange under aqueous conditions by means of an anion exchanger , and affinity and size exclusion mechanisms . \n solid - phase purification is normally performed by using a spin column , operated under centrifugal force . \n silica matrices , glass particles , diatomaceous earth , and anion - exchange carriers are examples that have been utilized in solid - phase extraction method as solid support . \n four key steps involved in solid - phase extraction are cell lysis , nucleic acids adsorption , washing , and elution . \n the initial step in a solid phase extraction process is to condition the column for sample adsorption . \n column conditioning can be done by using a buffer at a particular ph to convert the surface or functional groups on the solid into a particular chemical form . . \n next , the sample which has been degraded by using lysis buffer is applied to the column . \n the desired nucleic acid will absorb to the column with the aid of high ph and salt concentration of the binding solution . \n other compounds , such as protein may have strong specific bond with the column surface as well . \n these contaminants can be removed in the washing step by using washing buffer containing a competitive agent . for the elution step , te buffer or water \n is introduced to release the desired nucleic acid from the column , so that it can be collected in a purified state . \n normally , rapid centrifugation , vacuum filtration , or column separation is required during the washing and elution steps of purification process . \n a mixed - bed solid phase nucleic acid extraction and its use in the isolation of nucleic acid have been disclosed . \n the mixed - bed solid phases of this invention are the mixtures of at least two different solid phases , can be solid or semisolid , porous or non - porous . \n each solid phase can bind to the target nucleic acid under different solution conditions and release the nucleic acid under similar elution conditions . \n ( 1 ) silica matricesthe basis for most of the products related to nucleic acid purification is the unique properties of silica matrices for selective dna binding . \n types of silica materials including glass particles , such as glass powder , silica particles , and glass microfibers prepared by grinding glass fiber filter papers , and including diatomaceous earth . \n hydrated silica matrix , which was prepared by refluxing silicon dioxide in sodium hydroxide or potassium hydroxide at a molar ratio of about 2:1 to 10:1 for at least about 48 hours , had been introduced in dna purification . \n dna binds to the inorganic matrix and is released in heated water .the principle of silica matrices purification is based on the high affinity of the negatively charged dna backbone towards the positively charged silica particles . \n sodium plays a role as a cation bridge that attracts the negatively charged oxygen in the phosphate backbone of nucleic acid . \n sodium cations break the hydrogen bonds between the hydrogen in water and the negatively charged oxygen ions in silica under high salt conditions ( ph 7 ) . \n the purified dna molecules can be eluted under low ionic strength ( ph 7 ) later by using te buffer or distilled water .besides silica matrices , nitrocellulose and polyamide membranes such as nylon matrices are also known to bind with nucleic acids , but with less specificity . \n these materials are often used as solid - phase nucleic acid transfer and hybridization matrices . \n polyamide matrices are more durable than nitrocellulose and are known to bind nucleic acids irreversibly . \n the basis for most of the products related to nucleic acid purification is the unique properties of silica matrices for selective dna binding . \n types of silica materials including glass particles , such as glass powder , silica particles , and glass microfibers prepared by grinding glass fiber filter papers , and including diatomaceous earth . \n hydrated silica matrix , which was prepared by refluxing silicon dioxide in sodium hydroxide or potassium hydroxide at a molar ratio of about 2:1 to 10:1 for at least about 48 hours , had been introduced in dna purification . \n the principle of silica matrices purification is based on the high affinity of the negatively charged dna backbone towards the positively charged silica particles . \n sodium plays a role as a cation bridge that attracts the negatively charged oxygen in the phosphate backbone of nucleic acid . \n sodium cations break the hydrogen bonds between the hydrogen in water and the negatively charged oxygen ions in silica under high salt conditions ( ph 7 ) . \n the purified dna molecules can be eluted under low ionic strength ( ph 7 ) later by using te buffer or distilled water . besides silica matrices , nitrocellulose and polyamide membranes such as nylon matrices \n these materials are often used as solid - phase nucleic acid transfer and hybridization matrices . \n polyamide matrices are more durable than nitrocellulose and are known to bind nucleic acids irreversibly . \n ( 2 ) glass particleglass particles , powder and beads are useful for nucleic acid purification . for example , \n dna isolation from agarose gels involved the use of chaotropic salts to facilitate binding of dna to common silicate glass , flint glass , and borosilicate glass ( glass fiber filter ) . \n the adsorption of nucleic acid onto the glass substrate occurs most likely based on the mechanism and principle that similar to adsorption chromatography . \n this invention has discovered that a mixture of silica gel and glass particles can be used to separate nucleic acid from other substances in the presence of chaotropic salts solution . \n for example , dna isolation from agarose gels involved the use of chaotropic salts to facilitate binding of dna to common silicate glass , flint glass , and borosilicate glass ( glass fiber filter ) . \n the adsorption of nucleic acid onto the glass substrate occurs most likely based on the mechanism and principle that similar to adsorption chromatography . \n this invention has discovered that a mixture of silica gel and glass particles can be used to separate nucleic acid from other substances in the presence of chaotropic salts solution . \n ( 3 ) diatomaceous earthdiatomaceous earth , which is also known as kieselguhr or diatomite , has silica content as high as 94% . \n it has been used for filtration and in chromatography and it is useful for the purification of plasmid and other dna by immobilizing dna onto its particles in the presence of a chaotropic agent . the resulting diatomaceous earth - bound dna is then washed with an alcohol - containing buffer . \n the alcohol containing buffer is then discarded and dna is eluted out in a low salt buffer or in distilled water . \n diatomaceous earth , which is also known as kieselguhr or diatomite , has silica content as high as 94% . \n it has been used for filtration and in chromatography and it is useful for the purification of plasmid and other dna by immobilizing dna onto its particles in the presence of a chaotropic agent . the resulting diatomaceous earth - bound dna is then washed with an alcohol - containing buffer . \n the alcohol containing buffer is then discarded and dna is eluted out in a low salt buffer or in distilled water . \n ( 4 ) magnetic bead based nucleic acid purificationmagnetic separation is a simple and efficient way which is used in purification of nucleic acid nowadays . \n particles having a magnetic charge may be removed by using a permanent magnet in the application of a magnetic field . \n often , magnetic carriers with immobilized affinity ligands or prepared from biopolymer showing affinity to the target nucleic acid are used for the isolation process . \n for example , magnetic particles that are produced from different synthetic polymers , biopolymers , porous glass or magnetic particles based on inorganic magnetic materials such as surface - modified iron oxide . \n materials with a large surface area are preferred to be used in the binding of nucleic acids . \n magnetic particulate materials such as beads are more preferable to be a support in isolation process because of their larger binding capacity . \n the nucleic acid binding process may be assisted by the nucleic acid wrapping around the support . \n a magnet can be applied to the side of the vessel , which contains the sample mixture for aggregating the particles near the wall of the vessel and pouring away the remainder of the sample .particles having magnetic or paramagnetic properties are employed in an invention where they are encapsulated in a polymer such as magnetizable cellulose . in the presence of certainconcentrations of salt and polyalkylene glycol , magnetizable cellulose can bind to nucleic acids . \n small nucleic acid required higher salt concentrations for strong binding to the magnetizable cellulose particles . \n therefore , salt concentration can be selectively manipulated to release nucleic acid bound to magnetizable cellulose on the basis of size . the magnetizable cellulose which bound with nucleic acid will be washed with suitable wash buffer before they are contacted with a suitable elution buffer to separate out the desired nucleic acid with cellulose . \n separation of magnetizable cellulose from supernatant during all the purification steps can be done by applying a magnetic field to draw down or draw them to the side of the vessel . \n the magnetizable cellulose used in this invention has an iron oxide content of up to around 90% by weight of the total mass of the cellulose . \n the magnetic component of cellulose can also be substituted by other magnetic compounds such as ferrous oxide or nickel oxide .an extraction kit based on the principle of magnetic bead based nucleic acid purification is commercially available in the market . \n the special part of this kit is that the reagents provided are intended for use with magnetic tools . \n the kit does not require any organic solvents and eliminates the need for repeated centrifugation , vacuum filtration or column separation . \n the protocol is based on a modified alkaline lysis procedure followed by binding of the nucleic acid to magnetic particles . \n the magnetic tool is used to capture magnetic particles with the bound nucleic acid and contaminants are removed by washing with wash buffer provided . \n the nucleic acid is then eluted from the magnetic particles with the elution buffer .another extraction kit has the same principle as the extraction described above , which used the magnetic - particle technology for nucleic acid purification . \n it combines the speed and efficiency of silica - based dna purification with the convenient handling of magnetic particles . \n a magnetic rod protected by a rod cover is used for the capture of magnetic particles . \n then , the magnetic rod cover is positioned above another vessel and the magnetic particles are released .nucleic acid purification by using zirconia bead is another type of magnetic bead based purification . \n these microspherical paramagnetic beads have a large available binding surface and can be dispersed in solution . \n the total nucleic acid isolation kit , which uses this technology for the nucleic acid purification , makes use of the mechanical disruption of samples with zirconia beads in a guanidinium thiocyanate - based solution that not only releases nucleic acid but also inactivate nuclease in the sample matrix . after the lysis step , dilution of samples \n the mixture of beads and nucleic acid are immobilized on magnets and washed to remove protein and contaminants . \n removal of residual binding solution is done with a second wash solution and finally the nucleic acid is eluted in low - salt buffer .solid - phase reversible immobilization paramagenetic bead - based technology has been utilized for a pcr purification system to deliver quality dna . \n pcr amplicons bind to paramagenetic particles which draw them out of solution , allowing contaminants such as dntps , primers , and salts to be rinsed away .magnetic oligo ( dt ) bead is an alternative to other oligo ( dt ) matrices for the purification of poly(a ) rna from total rna sample . \n the poly(a ) rna can be extracted by introducing magnetic beads coated with oligo ( dt ) . \n the beads will then be drawn to the bottom of a tube removing mrna directly from total rna . \n the magnetic beads which are specially treated minimize the nonspecific binding of other nucleic acids and ensure the purity of mrna . \n magnetic separation is a simple and efficient way which is used in purification of nucleic acid nowadays . \n particles having a magnetic charge may be removed by using a permanent magnet in the application of a magnetic field . \n often , magnetic carriers with immobilized affinity ligands or prepared from biopolymer showing affinity to the target nucleic acid are used for the isolation process . \n for example , magnetic particles that are produced from different synthetic polymers , biopolymers , porous glass or magnetic particles based on inorganic magnetic materials such as surface - modified iron oxide . \n materials with a large surface area are preferred to be used in the binding of nucleic acids . \n magnetic particulate materials such as beads are more preferable to be a support in isolation process because of their larger binding capacity . \n the nucleic acid binding process may be assisted by the nucleic acid wrapping around the support . \n a magnet can be applied to the side of the vessel , which contains the sample mixture for aggregating the particles near the wall of the vessel and pouring away the remainder of the sample . \n particles having magnetic or paramagnetic properties are employed in an invention where they are encapsulated in a polymer such as magnetizable cellulose . in the presence of certainconcentrations of salt and polyalkylene glycol \n small nucleic acid required higher salt concentrations for strong binding to the magnetizable cellulose particles . therefore \n , salt concentration can be selectively manipulated to release nucleic acid bound to magnetizable cellulose on the basis of size . the magnetizable cellulose which bound with nucleic acid will be washed with suitable wash buffer before they are contacted with a suitable elution buffer to separate out the desired nucleic acid with cellulose . \n separation of magnetizable cellulose from supernatant during all the purification steps can be done by applying a magnetic field to draw down or draw them to the side of the vessel . \n the magnetizable cellulose used in this invention has an iron oxide content of up to around 90% by weight of the total mass of the cellulose . \n the magnetic component of cellulose can also be substituted by other magnetic compounds such as ferrous oxide or nickel oxide . \n an extraction kit based on the principle of magnetic bead based nucleic acid purification is commercially available in the market . \n the special part of this kit is that the reagents provided are intended for use with magnetic tools . \n the kit does not require any organic solvents and eliminates the need for repeated centrifugation , vacuum filtration or column separation . \n the protocol is based on a modified alkaline lysis procedure followed by binding of the nucleic acid to magnetic particles . \n the magnetic tool is used to capture magnetic particles with the bound nucleic acid and contaminants are removed by washing with wash buffer provided . \n another extraction kit has the same principle as the extraction described above , which used the magnetic - particle technology for nucleic acid purification . \n it combines the speed and efficiency of silica - based dna purification with the convenient handling of magnetic particles . \n a magnetic rod protected by a rod cover is used for the capture of magnetic particles . \n then , the magnetic rod cover is positioned above another vessel and the magnetic particles are released . \n nucleic acid purification by using zirconia bead is another type of magnetic bead based purification . \n these microspherical paramagnetic beads have a large available binding surface and can be dispersed in solution . \n the total nucleic acid isolation kit , which uses this technology for the nucleic acid purification , makes use of the mechanical disruption of samples with zirconia beads in a guanidinium thiocyanate - based solution that not only releases nucleic acid but also inactivate nuclease in the sample matrix . after the lysis step , dilution of samples \n the mixture of beads and nucleic acid are immobilized on magnets and washed to remove protein and contaminants . \n removal of residual binding solution is done with a second wash solution and finally the nucleic acid is eluted in low - salt buffer . \n solid - phase reversible immobilization paramagenetic bead - based technology has been utilized for a pcr purification system to deliver quality dna . \n pcr amplicons bind to paramagenetic particles which draw them out of solution , allowing contaminants such as dntps , primers , and salts to be rinsed away . \n magnetic oligo ( dt ) bead is an alternative to other oligo ( dt ) matrices for the purification of poly(a ) rna from total rna sample . \n the poly(a ) rna can be extracted by introducing magnetic beads coated with oligo ( dt ) . \n the beads will then be drawn to the bottom of a tube removing mrna directly from total rna . \n the magnetic beads which are specially treated minimize the nonspecific binding of other nucleic acids and ensure the purity of mrna . \n ( 5 ) anion - exchange materialanion exchange resin is one of the popular examples that utilized the anion - exchange principle . \n it is based on the interaction between positively charged diethylaminoethyl cellulose ( deae ) groups on the resin 's surface and negatively charged phosphates of the dna backbone . \n the anion - exchange resin consists of defined silica beads with a large pore size , a hydrophilic surface coating and has a high charge density . \n the resin works over a wide range of ph conditions ( ph 69 ) and/or salt concentration ( 0.11.6 m ) which can optimize the separation of dna from rna and other impurities . \n therefore , salt concentration and ph conditions of the buffers are one of the main factors that determine whether nucleic acid is bound or eluted out from the column . \n impurities such as protein and rna are washed from the resin by using medium - salt buffers , while dna remains bound until eluted with a high - salt buffer .the method of utilizing anion exchange materials to isolate nucleic acid has been disclosed in an invention , where the commercially available strong or weak positively charged anion exchanger materials were used with selected solutions of known ionic strength for adsorption and elution . \n most of the water - soluble components such as protein can be washed through the column by employing a solution with a known ionic strength for the binding of nucleic acids to the anion exchange column materials . the ionic strength for elution \n is generated by using known salt concentration , which mixed with a buffer to control ph strength , ideally corresponding to the lowest ionic strength at which the nucleic acids will completely elute . \n anion exchange resin is one of the popular examples that utilized the anion - exchange principle . \n it is based on the interaction between positively charged diethylaminoethyl cellulose ( deae ) groups on the resin 's surface and negatively charged phosphates of the dna backbone . \n the anion - exchange resin consists of defined silica beads with a large pore size , a hydrophilic surface coating and has a high charge density . \n the resin works over a wide range of ph conditions ( ph 69 ) and/or salt concentration ( 0.11.6 m ) which can optimize the separation of dna from rna and other impurities . \n therefore , salt concentration and ph conditions of the buffers are one of the main factors that determine whether nucleic acid is bound or eluted out from the column . \n impurities such as protein and rna are washed from the resin by using medium - salt buffers , while dna remains bound until eluted with a high - salt buffer . \n the method of utilizing anion exchange materials to isolate nucleic acid has been disclosed in an invention , where the commercially available strong or weak positively charged anion exchanger materials were used with selected solutions of known ionic strength for adsorption and elution . \n most of the water - soluble components such as protein can be washed through the column by employing a solution with a known ionic strength for the binding of nucleic acids to the anion exchange column materials . the ionic strength for elution \n is generated by using known salt concentration , which mixed with a buffer to control ph strength , ideally corresponding to the lowest ionic strength at which the nucleic acids will completely elute . \n the first step in protein purification is cell lysis . in order to purify and analyze protein efficiently \n the plasma membrane of mammalian cells , composed of phospholipids and proteins , is easy to be disrupted . in comparison , \n protein extraction from fungi and bacteria appears more challenging due to their stable cell wall that is stronger than the plasma membrane . \n some specific factors must be taken into account when developing protein extraction protocol for plant . \n for example , the presence of rigid cellulose cell wall must be sheared in order to release the cell contents . \n specific contaminating compounds such as phenolics and a range of proteinases may result in protein degradation or modification . therefore , specific conditions are required for protein extraction and purification from plant . \n mechanical disruption techniques , such as french press or glass beads are used to remove the cell wall , followed by detergent based extraction of total protein . \n ion exchange chromatography separates proteins based on their surface ionic charge using resin that are modified with either positively - charged or negatively - charged chemical groups [ 4 , 7 ] . \n most proteins have an overall negative or positive charge depending on their isoelectric point ( pi ) at a given ph , which makes them possible to interact with an opposite charged chromatographic matrix . \n if the net charge of the protein is positive at a ph below pi value , the protein will bind to a cation exchanger ; at a ph above the pi value the net charge of the protein is negative and the protein will bind to an anion exchanger . \n proteins that interact weakly with the resins , for example a weak positively charged protein passed over resin modified with a negatively charged group , are eluted out in a low - salt buffer . on the other hand , proteins that interact \n proteins with very similar charge characteristics can be separated into different fractions as they are eluted from the column by increasing the concentration of salt in elution buffer . \n ion exchange column is one of the technologies that utilized the principle of ion exchange chromatography . \n the membrane absorbents in columns are stabilized cellulose - based with highly porous structure that provides proteins access to the charged surface easily . \n interactions among molecules and active sites on the membrane happened in convective through - pores . \n therefore , the adsorptive membranes have the potential to maintain high efficiencies when purifying large biomolecules with low diffusion . \n gel filtration chromatography , also called size - exclusion or gel - permeation chromatography , separates proteins according to molecular sizes and shape and the molecules do not bind to the chromatography medium . \n it is a process in which large molecules passes through the column faster than small molecules . \n small molecules can enter all of the tiny holes of the matrix and access more of the column . \n small - sized proteins will pass through those holes and take more time to run out of the column compared with large - sized proteins that can not get into those holes but run out directly of the column through void space in the column [ 4 , 7 ] . \n the target sample is applied on top of the column which contained porous beads , an example of matrix in the column . \n the separation of molecules can be divided into three main types : total exclusion , selective permeation , and total permeation limit . \n total exclusion is the part that large molecules can not enter the pores and elute fast . for selective permeation region , intermediate molecules may enter the pores and may have an average residence time in the particles depending on their size and shape . as for total permeation limit , \n small molecules have the longest residence time once they enter the pores on the column . \n an advantage of gel filtration - based chromatography is that it is suited for biomolecules that may be sensitive to ph changes , concentration of metal ions , and harsh environmental conditions . \n affinity chromatography depends on a specific interaction between the protein and the solid phase to affect separation from contaminants . \n it enables the purification of a protein on the basis of its biological function or individual chemical structure . \n proteins that have a high affinity towards the specific chemical groups such as ligands will covalently attach and bind to the column matrix while other proteins pass through the column . \n electrostatic or hydrophobic interactions , van der waals ' forces and hydrogen bonding are the biological interactions between ligands and the target proteins . \n the bound proteins will be eluted out from the column by a solution containing high concentration of soluble form of the ligand . \n a biospecific ligand that can attach to a chromatography matrix covalently is one of the requirements for successful affinity purification . \n the binding between the ligand and target protein molecules must be reversible to allow the proteins to be removed in an active form . \n after washing away the contaminants , the coupled ligand must retain its specific binding affinity for the target proteins . \n some examples of biological interactions that are usually used in affinity chromatography are listed in table 1 ( see ) . \n chromatographic separation by differential affinity to ligands immobilized on a beaded porous resin is fundamental to protein research . a complete kit that contains pack beaded affinity resin columns based on principle of affinity chromatography has been introduced to the market . \n an affinity resin can be used in batch or microcentrifuge spin column format depending on the scale and type of experiment to be carried out . \n furthermore , it can be packed into some sort of larger gravity - flow column as well . \n . the partially purified protein from the chromatography separations can be further purified with nondenaturing polyacrylamide gel electrophoresis ( page ) , or native gel electrophoresis . \n in page , the proteins are driven by an applied current through a gelated matrix . \n the movement of protein through this gel depends on the charge density ( charge per unit of mass ) of the molecules . \n the size and shape of protein are another two important factors that influence page fractionation . \n the acrylamide pore size plays a role as a molecular sieve to separate different sizes of proteins . \n the larger the protein , the slower it migrates as it becomes more entangled in the gel . \n shape is also one of the factors because compact globular proteins move faster than elongated fibrous proteins of comparable molecular mass . \n page is usually carried out in the presence of the sodium dodecyl sulfate ( sds ) . a protein treated with sds \n will usually eliminate the secondary , tertiary and quarternary structure of protein [ 4 , 7 ] . \n proteins unfold into a similar rod - like shape because of the electrostatic repulsion between the bound sds molecules . \n the number of sds molecules which bind to a protein is approximately proportional to the protein 's molecular mass ( about 1.4 g sds / g protein ) . \n each protein species has an equivalent charge density and is driven through the gel with the same force . \n many proteins still retain their biological activities after running page . however , larger proteins are held up to a greater degree than smaller proteins because the polyacrylamide is highly cross - linked . \n consequently , proteins become separated by sds - page on the basis of their molecular mass . \n sds - page can be used to determine the molecular mass of the mixture of proteins by comparing the positions of the bands to those produced by proteins of known size . \n sds used in electrophoresis resolve mixture of proteins according to the length of individual polypeptide chains . \n a technique called two - dimensional gel electrophoresis was developed by patrick ofarrell in 1975 . \n it is used to fractionate complex mixtures of proteins by using two different techniques isoelectric focusing and sds - page . \n first , proteins are separated according to their isoelectric point in a tubular gel . after this separation , the gel is removed and placed on top of a slab of sds - saturated polyacrylamide . \n the proteins move into the slab gel and separated according to their molecular mass . \n two - dimensional gel electrophoresis is suitable to detect changes in proteins present in a cell under different conditions , at different stages in development or the cell cycle , or in different organisms . \n southwestern blotting is a method that is used to isolate , identify , and characterize dna - binding proteins by their ability in binding to specific oligonucleotide probes [ 44 , 45 ] . \n many of the dna - binding proteins in the cell need to be isolated individually and characterized to define the gene function . \n next , separated proteins are transferred to a nitrocellulose filter , polyvinylidene difluoride ( pvdf ) or cationic nylon membrane . \n the filter will then be incubated with oligonucleotide probes to analyze the adsorbed proteins [ 44 , 45 ] . \n however , this technique is beset with problems such as large amounts of nuclear proteins are required ( typically 50100 mg ) , protein degradation during isolation , facing difficulties in achieving efficient electrophoretic separation and transfer of a wide molecular size range of proteins . \n generally , the extraction or purification techniques or kits available in the market can only allow the extraction of one type of nucleic acid , either dna or rna , or protein from a targeted organism . \n when the cellular material is limiting , it is desirable to extract dna , rna and protein from the same source . \n a variation on the single - step isolation method of chomczynski and sacchi ( 1987 ) , that the guanidinium thyicyanate homogenate is extracted with phenol : chloroform at reduced ph , allows the preparation of dna , rna and protein from tissue or cells . \n this method involves the lysis of cells with guanidine isothiocyanate and phenol in a single - phase solution . a second phase forms after the addition of chloroform where dna and proteins are extracted , leaving rna in the aqueous supernatant . \n the dna and proteins can be isolated from the organic phase by precipitation with ethanol or isopropanol and the rna precipitated from aqueous phase with isopropanol . \n several all - in - one extraction kits have been introduced in the market nowadays . \n for example , a column - based extraction kit that designed to purify genomic dna , total rna and total protein from a single biological sample simultaneously , without the usage of toxic substances such as phenol or chloroform and alcohol precipitation . \n it is compatible with small amounts of a wide range of cultured cells and harvested tissue of animal and human origin . \n the targeted sample does not need to be separated into 3 parts before the purification of dna , rna and protein . \n a solution - based 3-in-1 extraction kit that is available in the market is another example of non - organic solutions kit that can extract and purify dna , rna and protein , from different organisms in any types and sizes . \n its three simple steps protocol , which takes around 15 to 30 minutes , provides a fast and easy way to do the extraction of different biomolecules . \n therefore , higher yield can be expected as fewer steps leads to fewer loss . \n automated extraction system , a large , expensive and complex instrumentation designed for high - throughput sample processing , has helped to simplify the isolation of nucleic acids . \n this system was designed for medium to large laboratories which has grown in presence over recent years . \n automating nucleic acid extraction process is potentially beneficial for a number of reasons including to reduce working time , decrease labor costs , increase worker safety and in the midst provides opportunity in increasing reproducibility and quality of results . besides \n , it is a key solution to increasing the laboratory efficiency in clinical laboratories , purification of high - quality biomolecules such as dna , rna and protein from a variety of starting material will be used in downstream testing applications . \n . the speed , accuracy and reliability of the whole extraction process should be maximal and at the same time minimize the risk of cross - contamination . \n a solution has to be introduced to increase sample preparation efficiency without sacrificing the quality . \n the possibility of cross - contamination should be reduced and the systems are amenable to bar - coded sample tracking . \n an extraction system that is available in the market has met the requirements stated above . \n it offers forensic laboratories fast and reliable sample processing along with high - quality automated dna purification . \n it is a paramagnetic - particle handling system to process sample and provide consistent yield and purity as there is no detectable cross - contamination between samples . \n the whole extraction process takes about 20 minutes from start to the end because only three simple steps are needed : ( 1 ) add liquid samples to reagent cartridge ; ( 2 ) place reagent cartridges into the machine ; ( 3 ) press start button \n another example of automated system that is flexible and efficient for extraction of nucleic acids and proteins has been introduced . \n various starting materials can be processed by using this system , which is designed for small and medium sample throughput . \n the flexibility of this system allows the extraction of nucleic acid from up to twelve samples simultaneously . \n the kits that optimized for this system can extract genomic dna , cellular rna , viral or bacterial nucleic acids . \n biomolecules extraction is the first step that needs to be performed for the following analysis or manipulation process . \n therefore , any automatic system must include not only automatic equipment for each extraction step but also equipment for automating the transfer of liquid between machines . \n automation has aided in increasing the throughput and improving the reliability of the process , but these systems are still designed for use in a laboratory environment only . some of the nucleic acid extraction system that are available in the market are large and require manual pre - processing stages by laboratory staff with technical expertise . therefore , robotic workstations for nucleic acid extraction should fulfill a true walk - away automation , which means a fully automated process . \n a combination of all - in - one biomolecules extraction solution and method with fully automated extraction system can be a prospective invention in the future . \n the purification of dna , rna or protein from various organisms can be performed simultaneously using this type of extraction system with just a single extraction method . \n it is often inconvenient that targeted biomolecules sample from an animal , plant or even a clinical sample must be sent to a laboratory for it to be extracted and analyzed . \n the samples , especially clinical sample such as blood , need to be refrigerated and transferred to the nearest laboratory for extraction and analyzing . \n hence , a portable biomolecules extraction system , which brings several advantages such as reduced labour , reduced waste and increased speed of extracting process , can be a potential development in the future . \n the combination of portable extraction system with dna , rna , or protein analyzer can be build up in the future to help researchers in reducing working time and increasing the work efficiency . \n continued improvement in miniaturization will be the future trend of robotic automation in the laboratory . \n many clinical laboratories are performing workflow analysis and finding that smaller systems with lower throughput are more consistent with clinical laboratory workload . \n besides , this automation system can be implemented at relatively low cost , improving the turnaround times and also reduce the labor costs . \n since the first dna isolation was successfully done by friedrich miescher in 1869 and the initial dna extraction developed from density gradient centrifugation strategies by meselson and stahl in 1958 , many techniques for biomolecules purification has been developed . from guanidinium thiocyanate - phenol - chloroform extraction to the column - technology that is widely used in dna and rna extraction , and chromatography purification method to immunoblotting that used to extract proteins , biomolecules extraction has helped researchers and scientists in manipulating subsequent molecular biology analysis in order to have a better understanding in the biological materials of the earth . the automated nucleic acid extraction system has been developed due to the influence of rapid growth of automation technology nowadays . automating nucleic acid extraction process is potentially beneficial for a number of reasons including to reduce working time , decrease labor costs , increase worker safety and at the same time provides opportunity in increasing reproducibility and quality of results . \n however , improvement of the weaknesses for some of the instruments needs to be conducted all the time . in the mean time , an all - in - one biomolecules extraction system , or the invention of a miniature and portable extraction system can become a prospective development in the future .", "role": "user" }, { "content": "extraction of dna , rna , and protein is the basic method used in molecular biology . \n these biomolecules can be isolated from any biological material for subsequent downstream processes , analytical , or preparative purposes . in the past , \n the process of extraction and purification of nucleic acids used to be complicated , time - consuming , labor - intensive , and limited in terms of overall throughput . currently , there are many specialized methods that can be used to extract pure biomolecules , such as solution - based and column - based protocols . \n manual method has certainly come a long way over time with various commercial offerings which included complete kits containing most of the components needed to isolate nucleic acid , but most of them require repeated centrifugation steps , followed by removal of supernatants depending on the type of specimen and additional mechanical treatment . \n automated systems designed for medium - to - large laboratories have grown in demand over recent years . \n it is an alternative to labor - intensive manual methods . \n the technology should allow a high throughput of samples ; the yield , purity , reproducibility , and scalability of the biomolecules as well as the speed , accuracy , and reliability of the assay should be maximal , while minimizing the risk of cross - contamination .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: since the initial development of inactivated influenza vaccines in the 1940s , vaccine manufacturers have continually sought to improve their products in response to three main drivers : increased safety and comfort of vaccinated individuals , improved manufacturing security and productivity , and greater vaccine efficacy . \n the most notable example of such improvements was the development in the 1970s of subvirion vaccines to replace whole virion inactivated vaccines to reduce vaccine reactogenicity , although these latter vaccines are still commercially available in some countries . \n the vast majority of influenza vaccines , both licensed and in development , are produced from virus propagated in embryonated hens eggs . in recent years , considerable efforts have been made to develop alternative production systems , such as cellculture vaccines , as a complementary source of influenza vaccine to further increase the global production capacity . \n most vaccine manufacturers have cellculture influenza vaccine development programmes and in 2007 , a first cellculturebased seasonal influenza vaccine received european licensure . \n other recent developments include the reformulation of vaccine with novel adjuvants including virosomes , influenza viruslike particles and the production of recombinant influenza vaccines . \n , \n\n the intense political and public interest surrounding avian and pandemic influenza in recent years has stimulated interest in influenza research by governments , nongovernmental organizations , vaccine manufacturers and other researchers . \n the benefits of this renewed interest extend beyond our preparedness for the next influenza pandemic and into seasonal vaccination . \n there is increased awareness of the immediate need to increase seasonal influenza vaccination coverage and to optimize the immunogenicity of current influenza vaccines . \n\n here \n , we review sanofi pasteur s epidemic and pandemic influenza research and development programme with emphasis on two key projects : intradermal influenza vaccine for seasonal vaccination and pandemic influenza vaccine development . \n the elderly are at high risk of serious disease from respiratory infections , particularly influenza , and this population accounts for the majority of the disease burden ( for a review , see ref . \n influenza vaccination is thus recommended for all individuals older than 65 , 60 or even 50 years , depending on the country . \n while many studies attest to the efficacy of influenza vaccination , the exact level of vaccine efficacy in the elderly remains a matter of debate . \n , \n , \n , \n , \n , \n , \n , \n , \n in healthy adults aged < 65 years , one dose of trivalent , inactivated vaccine is considered to be highly immunogenic . \n with increasing age , however , changes in the immune system result in a lower immunogenicity of influenza vaccines compared with that in younger adults . \n consequently , the efficacy of conventional intramuscular influenza vaccines is also lower among the elderly . \n one approach to increase influenza vaccine immunogenicity is the use of a vaccine adjuvant , such as mf59 in the licensed vaccine fluad . \n , \n a second approach is to formulate the vaccine with virosomes that mimic the structure of viral particles with the aim of improving antigen presentation , invivac ) . \n a recent study comparing both of these vaccines , together with a licensed nonadjuvanted , subunit vaccine , found all three vaccines to have similar immunogenicity profiles . \n influenza vaccines change each year , so by definition , vaccination of individuals in atrisk groups is recommended before each influenza season , and thus individuals can be vaccinated every year for many years . \n although such data do not exist at an individual level , current formulations of conventional inactivated splitvirion vaccines are well known and do have a good longterm safety record . \n , \n , \n during its 40 years of existence , approximately 1 billion doses of the vaccine vaxigrip ( sanofi pasteur , lyon , france ) have been distributed . to further improve seasonal influenza vaccines , \n the approach adopted at sanofi pasteur has been to identify alternative methods to increase immunogenicity without using adjuvants or other additives . \n the immunological potential of the intradermal route for immunization has been known for a long time . since the 1930s , studies with a variety of antigens \n have shown that vaccination via the dermis can induce comparable immune responses to intramuscular vaccination , but with a fraction of antigen dose ( for a review , see ref . \n intradermal vaccination against rabies is routinely used in some countries as a way of sparing antigen , and against hepatitis b , the intradermal route has also been shown to induce immune responses in individuals who were previously unresponsive to intramuscular vaccination . \n although the exact mechanism remains unclear , the efficiency of intradermal immunization is thought to be due to the capture and presentation of antigen by dendritic cells , predominantly dermal dendritic cells , which then drain through the extensive lymph network to the lymph nodes , as well as the direct migration to the nodes of freeantigen , resulting in the stimulation of resident lymph node dendritic cells . \n together , these processes result in the activation of lymph node t cells and an efficient initiation of cellular arm immune responses . \n although the potential of intradermal vaccination has been known for some time , it is only recently that advances in vaccine delivery systems have allowed this route to be considered for the largescale production of vaccines such as influenza . despite the successes attributable to the historical intradermal injection methods ( such as the standard mantoux intradermal injection technique that involves inserting a 27 g , 3/8 inch , short bevel needle attached to a plastic , 1ml disposable syringe into the skin at a very slight angle , the bifurcated needle for smallpox vaccination , multipuncture devices for bcg and needlefree jet injectors ) , all have important drawbacks . \n the development of an easytouse , disposable microdelivery system for intradermal vaccination ( soluvia ; becton dickinson , franklin lakes , nj , usa ) led to the reconsideration of the intradermal route for influenza vaccination . \n briefly , it consists of a prefilled , readytouse syringe with an integral , narrow ( 30 gauge ) , shortbevel microneedle that protrudes only 15 mm from the proximal end of a glass syringe . \n it was designed and engineered based on skin anatomical requirements to ensure a consistent and reliable injection of 01 ml of fluid into the papillary and reticular dermis . \n , \n\n sanofi pasteur s intradermal influenza vaccine programme for the elderly is based on the hypothesis that the natural potential of the intradermal route can be exploited to increase immune responses to a vaccine produced using essentially the same process as that used to produce a licensed vaccine ( vaxigrip ) . \n the physical properties of the skin limit the volume of fluid that can be injected into the dermal layer . \n the volume of a typical intradermal vaccination is 01 ml , five times less than most intramuscular vaccinations . \n consequently , the challenges of developing an intradermal influenza vaccine have included not only the identification of the appropriate antigen dosage , but also the production of vaccine containing the appropriate dosage in onefifth of the volume . in a phase 2 study , the immunogenicity and safety of two different intradermal vaccine formulations containing 15 or 21 g of haemagglutinin per strain \n were compared with that of vaxigrip , which contains 15 g of haemagglutinin per strain . \n the study was designed to test whether one or both of the investigational intradermal vaccines induced statistically superior immune responses compared with the control vaccine . \n superiority was demonstrated in terms of the primary endpoint ( geometric mean titres 21 days after vaccination ) for all three strains , and higher responses were observed in all but one of the nine secondary analyses based on immunogenicity criteria defined by the european committee for medicinal products for human use ( chmp ) ( day 21 seroprotection rates , day 21 seroconversion rates and day 021 mean titre increases for each of the three strains ) . \n differences between responses in the two intradermal vaccine groups ( 15 or 21 g haemagglutinin per strain ) were not significant . \n study subjects were aged 6085 with a median age of 70 years . as could be expected , \n this was the case with both intradermal and intramuscular vaccines for each of the three strains and importantly , seroprotection rates remained higher after intradermal vaccination than after intramuscular vaccination in the older age group ( table 1 ) . \n this study led to the continued development of an intradermal influenza vaccine for adults aged 60 years , containing 15 g of haemagglutinin per strain , which is equivalent to the quantity of antigen contained in conventional intramuscular vaccines . \n the results of a subsequent phase 3 trial with this vaccine confirm the superiority observed in the phase 2 trial . \n affect of age class on the difference in postvaccination seroprotection rate after intradermal and intramuscular vaccination in a phase 2 study results are expressed as the absolute difference in seroprotection rate and 95% confidence interval of the difference for each strain after with intradermal vaccine containing 15 g haemagglutinin per strain or intramuscular vaccine containing 15 g haemagglutinin per strain . \n while the greatest challenge surrounding seasonal influenza vaccination for elderly adults is increasing vaccine immunogenicity and thus the level of protection , for younger adults the challenge is to increase the vaccination coverage . \n in five western european countries in 20062007 , coverage rates among adults in their twenties and thirties were around 10% . \n in these countries , coverage rates increase with age to 15% of adults in their forties and 21% of adults in their fifties . \n comparable coverage rates are reported in the usa and in countries in asia , latin america and eastern europe . \n , \n these numbers are considerably lower than the target coverage rates of between 50% and 90% set by national and international health organizations . \n , \n , \n even among healthcare professionals \n a population assumed to be better informed of the risks of influenza for themselves and for their patients influenza vaccination coverage remains low in many cases . \n the morbidity and mortality associated with influenza are lower among adults younger than 60 years than among the elderly . \n complications are less frequent in young adults than in the elderly , but do occur . for example , in a study of over 20 years of us national hospital discharge survey data ( 1980s and 1990s ) , the average annual rate of primary pneumonia and influenza hospitalizations attributable to influenza was 68 per 1 00 000 personyears among persons aged 549 years and 379 among persons aged 5064 years . \n typically , however , influenza infection of a healthy young adult results in uncomplicated illness with 37 days of high fever with other symptoms including cough , headache and myalgia . \n the benefits of influenza vaccination in this age group are therefore often expressed in terms of cost benefits because of prevented work absenteeism . \n studies among the general adult population or among working adults have shown that influenza vaccination can be costeffective , and even cost saving . \n , \n , \n\n in addition to cost benefits , the benefits of vaccinating adults against influenza include reduced family and social disruption , and reduced transmission to others who may be at increased medical risk themselves . indeed , while an individual s decision to get vaccinated is motivated predominantly to protect oneself , \n it is the prevention of transmission to others who are at risk that motivates health authorities to specifically recommend influenza vaccination for healthcare workers and anyone with a household member who is in a high risk group . \n two recent surveys in europe and the usa found that around 1416% of individuals cited a dislike of needles and injections as one of the reasons for not getting vaccinated . \n , \n other barriers included the common misperception that being healthy is sufficient protection against influenza , that the risk of contracting the disease is low ( most frequent responses in these two studies ) , or a lack of recommendation by an individual s family practitioner , or a lack of reimbursement . \n these findings suggest that , together with improved education about influenza disease and vaccination , and reimbursement programmes , alternative vaccination methods that avoid the need for a classic syringe and needle have the potential to contribute to increase vaccination uptake among such populations . \n this is the rationale for the development of an intradermal influenza vaccine for young adults using the same microinjection system as described above . \n in contrast to the vaccine for elderly adults , the intradermal vaccine for young adults was developed with the aim of providing equivalent immunogenicity to current intramuscular vaccines . \n phase 2 trials have demonstrated that a 9 g intradermal dose of haemagglutinin per strain is sufficient to elicit an equivalent ( statistically noninferior ) immune response to vaxigrip ( j. beran et al . , vaccination and travel medicine centre , hradec kralove , unpublished results ) . \n clinical trial results obtained to date reveal no safety issues with either the 9 or the 15g formulation of the intradermal vaccine . \n , \n the rates of solicited systemic reactions and unsolicited adverse events observed in each trial performed to date have been comparable between intradermal and intramuscular groups . \n furthermore , a study conducted over 3 consecutive years , with ( re)randomization to intramuscular or intradermal vaccination each year revealed that the rates of reaction did not increase from year to year in any of the randomized subgroups , suggesting that intradermal vaccination could be safely administered repetitively or in alternation with intramuscular vaccine from year to year ( j. beran et al . \n intradermal vaccination with the microinjection system is inherently safer than vaccination via the intramuscular route , since the 15 mm long microneedle limits the possibility of mechanical damage to nerves or blood vessels . \n also inherent to intradermal vaccination is the higher frequency of minor visible injection site reactions , such as redness , swelling or induration , around the point of intradermal vaccination . \n higher rates of these injection site reactions after intradermal vaccination have been observed in all the clinical trials performed to date , but importantly the incidence of injection site pain has been comparable between groups , and as with intramuscular vaccination , these reactions are shortlived and disappear spontaneously . \n a marketing authorization dossier on both the 9g formulation for adults < 60 years and the 15g formulation for adults 60 years was submitted to the european medicines agency and is currently ( september 2008 ) under review . \n the elderly are at high risk of serious disease from respiratory infections , particularly influenza , and this population accounts for the majority of the disease burden ( for a review , see ref . \n influenza vaccination is thus recommended for all individuals older than 65 , 60 or even 50 years , depending on the country . \n while many studies attest to the efficacy of influenza vaccination , the exact level of vaccine efficacy in the elderly remains a matter of debate . \n , \n , \n , \n , \n , \n , \n , \n , \n in healthy adults aged < 65 years , one dose of trivalent , inactivated vaccine is considered to be highly immunogenic . \n with increasing age , however , changes in the immune system result in a lower immunogenicity of influenza vaccines compared with that in younger adults . \n consequently , the efficacy of conventional intramuscular influenza vaccines is also lower among the elderly . \n one approach to increase influenza vaccine immunogenicity is the use of a vaccine adjuvant , such as mf59 in the licensed vaccine fluad . \n , \n a second approach is to formulate the vaccine with virosomes that mimic the structure of viral particles with the aim of improving antigen presentation , invivac ) . \n a recent study comparing both of these vaccines , together with a licensed nonadjuvanted , subunit vaccine , found all three vaccines to have similar immunogenicity profiles . \n influenza vaccines change each year , so by definition , vaccination of individuals in atrisk groups is recommended before each influenza season , and thus individuals can be vaccinated every year for many years . \n although such data do not exist at an individual level , current formulations of conventional inactivated splitvirion vaccines are well known and do have a good longterm safety record . \n , \n , \n during its 40 years of existence , approximately 1 billion doses of the vaccine vaxigrip ( sanofi pasteur , lyon , france ) have been distributed . to further improve seasonal influenza vaccines , \n the approach adopted at sanofi pasteur has been to identify alternative methods to increase immunogenicity without using adjuvants or other additives . \n the immunological potential of the intradermal route for immunization has been known for a long time . since the 1930s , studies with a variety of antigens \n have shown that vaccination via the dermis can induce comparable immune responses to intramuscular vaccination , but with a fraction of antigen dose ( for a review , see ref . \n intradermal vaccination against rabies is routinely used in some countries as a way of sparing antigen , and against hepatitis b , the intradermal route has also been shown to induce immune responses in individuals who were previously unresponsive to intramuscular vaccination . \n although the exact mechanism remains unclear , the efficiency of intradermal immunization is thought to be due to the capture and presentation of antigen by dendritic cells , predominantly dermal dendritic cells , which then drain through the extensive lymph network to the lymph nodes , as well as the direct migration to the nodes of freeantigen , resulting in the stimulation of resident lymph node dendritic cells . \n together , these processes result in the activation of lymph node t cells and an efficient initiation of cellular arm immune responses . \n although the potential of intradermal vaccination has been known for some time , it is only recently that advances in vaccine delivery systems have allowed this route to be considered for the largescale production of vaccines such as influenza . despite the successes attributable to the historical intradermal injection methods ( such as the standard mantoux intradermal injection technique that involves inserting a 27 g , 3/8 inch , short bevel needle attached to a plastic , 1ml disposable syringe into the skin at a very slight angle , the bifurcated needle for smallpox vaccination , multipuncture devices for bcg and needlefree jet injectors ) , all have important drawbacks . \n the development of an easytouse , disposable microdelivery system for intradermal vaccination ( soluvia ; becton dickinson , franklin lakes , nj , usa ) led to the reconsideration of the intradermal route for influenza vaccination . \n briefly , it consists of a prefilled , readytouse syringe with an integral , narrow ( 30 gauge ) , shortbevel microneedle that protrudes only 15 mm from the proximal end of a glass syringe . \n it was designed and engineered based on skin anatomical requirements to ensure a consistent and reliable injection of 01 ml of fluid into the papillary and reticular dermis . \n , \n\n sanofi pasteur s intradermal influenza vaccine programme for the elderly is based on the hypothesis that the natural potential of the intradermal route can be exploited to increase immune responses to a vaccine produced using essentially the same process as that used to produce a licensed vaccine ( vaxigrip ) . \n the physical properties of the skin limit the volume of fluid that can be injected into the dermal layer . \n the volume of a typical intradermal vaccination is 01 ml , five times less than most intramuscular vaccinations . \n consequently , the challenges of developing an intradermal influenza vaccine have included not only the identification of the appropriate antigen dosage , but also the production of vaccine containing the appropriate dosage in onefifth of the volume . in a phase 2 study , the immunogenicity and safety of two different intradermal vaccine formulations containing 15 or 21 g of haemagglutinin per strain \n were compared with that of vaxigrip , which contains 15 g of haemagglutinin per strain . \n the study was designed to test whether one or both of the investigational intradermal vaccines induced statistically superior immune responses compared with the control vaccine . \n superiority was demonstrated in terms of the primary endpoint ( geometric mean titres 21 days after vaccination ) for all three strains , and higher responses were observed in all but one of the nine secondary analyses based on immunogenicity criteria defined by the european committee for medicinal products for human use ( chmp ) ( day 21 seroprotection rates , day 21 seroconversion rates and day 021 mean titre increases for each of the three strains ) . \n differences between responses in the two intradermal vaccine groups ( 15 or 21 g haemagglutinin per strain ) were not significant . \n study subjects were aged 6085 with a median age of 70 years . as could be expected , \n this was the case with both intradermal and intramuscular vaccines for each of the three strains and importantly , seroprotection rates remained higher after intradermal vaccination than after intramuscular vaccination in the older age group ( table 1 ) . \n this study led to the continued development of an intradermal influenza vaccine for adults aged 60 years , containing 15 g of haemagglutinin per strain , which is equivalent to the quantity of antigen contained in conventional intramuscular vaccines . \n the results of a subsequent phase 3 trial with this vaccine confirm the superiority observed in the phase 2 trial . \n affect of age class on the difference in postvaccination seroprotection rate after intradermal and intramuscular vaccination in a phase 2 study results are expressed as the absolute difference in seroprotection rate and 95% confidence interval of the difference for each strain after with intradermal vaccine containing 15 g haemagglutinin per strain or intramuscular vaccine containing 15 g haemagglutinin per strain . \n while the greatest challenge surrounding seasonal influenza vaccination for elderly adults is increasing vaccine immunogenicity and thus the level of protection , for younger adults the challenge is to increase the vaccination coverage . \n surveys of vaccination uptake repeatedly show that coverage rates among young adults are low . in five western european countries in 20062007 , \n coverage rates among adults in their twenties and thirties were around 10% . \n in these countries , \n coverage rates increase with age to 15% of adults in their forties and 21% of adults in their fifties . \n comparable coverage rates are reported in the usa and in countries in asia , latin america and eastern europe . \n , \n these numbers are considerably lower than the target coverage rates of between 50% and 90% set by national and international health organizations . \n , \n , \n even among healthcare professionals \n a population assumed to be better informed of the risks of influenza for themselves and for their patients influenza vaccination coverage remains low in many cases . \n the morbidity and mortality associated with influenza are lower among adults younger than 60 years than among the elderly . \n complications are less frequent in young adults than in the elderly , but do occur . for example , in a study of over 20 years of us national hospital discharge survey data ( 1980s and 1990s ) , the average annual rate of primary pneumonia and influenza hospitalizations attributable to influenza was 68 per 1 00 000 personyears among persons aged 549 years and 379 among persons aged 5064 years . \n typically , however , influenza infection of a healthy young adult results in uncomplicated illness with 37 days of high fever with other symptoms including cough , headache and myalgia . \n the benefits of influenza vaccination in this age group are therefore often expressed in terms of cost benefits because of prevented work absenteeism . \n studies among the general adult population or among working adults have shown that influenza vaccination can be costeffective , and even cost saving . \n , \n , \n\n in addition to cost benefits , the benefits of vaccinating adults against influenza include reduced family and social disruption , and reduced transmission to others who may be at increased medical risk themselves . indeed , \n while an individual s decision to get vaccinated is motivated predominantly to protect oneself , \n it is the prevention of transmission to others who are at risk that motivates health authorities to specifically recommend influenza vaccination for healthcare workers and anyone with a household member who is in a high risk group . \n two recent surveys in europe and the usa found that around 1416% of individuals cited a dislike of needles and injections as one of the reasons for not getting vaccinated . \n , \n other barriers included the common misperception that being healthy is sufficient protection against influenza , that the risk of contracting the disease is low ( most frequent responses in these two studies ) , or a lack of recommendation by an individual s family practitioner , or a lack of reimbursement . \n these findings suggest that , together with improved education about influenza disease and vaccination , and reimbursement programmes , alternative vaccination methods that avoid the need for a classic syringe and needle have the potential to contribute to increase vaccination uptake among such populations . \n this is the rationale for the development of an intradermal influenza vaccine for young adults using the same microinjection system as described above . \n in contrast to the vaccine for elderly adults , the intradermal vaccine for young adults was developed with the aim of providing equivalent immunogenicity to current intramuscular vaccines . \n phase 2 trials have demonstrated that a 9 g intradermal dose of haemagglutinin per strain is sufficient to elicit an equivalent ( statistically noninferior ) immune response to vaxigrip ( j. beran et al . , vaccination and travel medicine centre , hradec kralove , unpublished results ) . \n clinical trial results obtained to date reveal no safety issues with either the 9 or the 15g formulation of the intradermal vaccine . \n , \n the rates of solicited systemic reactions and unsolicited adverse events observed in each trial performed to date have been comparable between intradermal and intramuscular groups . \n furthermore , a study conducted over 3 consecutive years , with ( re)randomization to intramuscular or intradermal vaccination each year revealed that the rates of reaction did not increase from year to year in any of the randomized subgroups , suggesting that intradermal vaccination could be safely administered repetitively or in alternation with intramuscular vaccine from year to year ( j. beran et al . , vaccination and travel medicine centre , hradec kralove , unpublished results ) . \n intradermal vaccination with the microinjection system is inherently safer than vaccination via the intramuscular route , since the 15 mm long microneedle limits the possibility of mechanical damage to nerves or blood vessels . \n also inherent to intradermal vaccination is the higher frequency of minor visible injection site reactions , such as redness , swelling or induration , around the point of intradermal vaccination . \n higher rates of these injection site reactions after intradermal vaccination have been observed in all the clinical trials performed to date , but importantly the incidence of injection site pain has been comparable between groups , and as with intramuscular vaccination , these reactions are shortlived and disappear spontaneously . a marketing authorization dossier on both the 9g formulation for adults < 60 years and the 15g formulation for adults 60 years \n was submitted to the european medicines agency and is currently ( september 2008 ) under review . \n the challenges of developing a pandemic influenza vaccine candidate differ from those of developing improved vaccines against seasonal influenza in almost every respect . \n although an influenza pandemic is expected , it is not known which strain of virus , or even which subtype , will cause it . \n the challenge is therefore to develop a vaccine against a disease that does not yet exist . \n currently , the most widely accepted scenario is that the next pandemic strain will evolve out of one of the highly pathogenic avian influenza a ( h5n1 ) strains that have been in circulation among both wild bird and poultry populations , and have caused almost 400 human cases over the past 5 years . \n seed strains used to produce most of the current pandemic vaccine candidates are derived by reverse genetics from one of these h5n1 avian strains . \n , \n other possibilities include the emergence of an h7 or h9 strain , or the resurgence of a human h2n2 strain , which caused 1957 pandemic . \n when a pandemic occurs , the priority will be to vaccinate as many people as possible , as quickly as possible . among the many industrial , logistical and political challenges that this implies \n , the identification of a minimum dose of antigen needed to confer an acceptable level of protection against severe disease to optimize the manufacturing capacity is critical . \n sanofi pasteur s strategy for pandemic influenza vaccine development has been to provide a firstgeneration vaccine as quickly as possible for stockpiling , whilst developing secondgeneration vaccines with improved immunogenicity profiles . \n first , using a manufacturing process adapted from seasonal vaccine production ( fluzone sanofi pasteur , swiftwater , pa , usa ) , a nonadjuvanted h5n1 vaccine was produced in the usa under governmental contract and provided to the us national institute of allergy and infectious diseases ( niaid ) for clinical evaluation . \n a dose ranging study , which tested doses of 7590 g of haemagglutinin of this nonadjuvanted vaccine , revealed that a twodose regimen of 90 g of haemagglutinin was needed to elicit a response expected to reduce the risk of getting influenza in 45% of subjects . \n this led to the fda s approval of this vaccine as a first measure to ensure the nation s readiness , pending the development of the next generation of vaccines , \n and confirmed the need for formulations with improved immunogenicity . \n this vaccine has been further evaluated in a second study of the response to a third , booster vaccination 6 months later , which found that titres were higher after the booster injection than after the second injection . \n a second project with an adjuvanted vaccine has therefore been conducted with the dual objective of improving the immune response to the vaccine whilst reducing the dose of antigen needed . \n aluminiumbased adjuvants are readily available , are widely used in licensed vaccines and have documented safety . the first clinical trial with an aluminium hydroxide adjuvant \n this trial was also designed as a dose ranging and formulation finding trial and evaluated three antigen dosages ( 75 , 15 and 30 g of haemagglutinin ) , each with or without adjuvant . \n although the adjuvanted 30 g formulation was the most immunogenic and 67% of subjects seroconverted after two vaccinations , there was no adjuvant effect at either of the two lower dosages . furthermore , the lowest dose ( 75 g ) appeared to perform better without adjuvant than with adjuvant . these findings led us to select the adjuvanted 30 g formulation and 75 g nonadjuvanted formulation for further investigation . \n results from a clinical trial of these two formulations in children in thailand confirm the immunogenicity of the vaccine , with the adjuvant providing a clear immunogenic advantage . \n the mf59 oilinwater emulsion adjuvant used in novartis licensed seasonal influenza vaccine for the elderly , fluad , has been shown to increase immune responses to h5n1 after both homologous vaccination as well as after heterologous vaccination with a nonpathogenic h5n3 virusderived vaccine . \n , \n another proprietary oilinwater emulsionbased adjuvant has been developed by glaxosmithkline biologicals ( gsk ) and has been tested in an h5n1 prototype vaccine formulation . \n these studies have shown that these adjuvanted vaccine formulations are well tolerated and significantly dosesparing compared with nonadjuvanted vaccine , and are able to induce crossneutralizing antibody responses to various h5n1 clades and subclades . \n our third project , undertaken in parallel with the aluminiumbased adjuvanted vaccine project , was the development of vaccine containing an oilinwater emulsion of the same class as those described above . \n this proprietary adjuvant is a squaleneinwater emulsion with a very fine particle size and a narrow particle size distribution . \n the potential of this emulsion in a clade 1 influenza a / vietnam/1194/2004 ( h5n1 ) vaccine has been evaluated in preclinical studies in two species , as well as in a phase 1 clinical study . in a macaque viral challenge model , \n two injections of this emulsionadjuvanted h5n1 vaccine with 30 g of haemagglutinin were found to reduce the incidence and severity of interstitial pneumonia , and protect against infection in the lungs and upper respiratory tract after intratracheal challenge 3 months later with homologous wildtype virus . \n protection against disease and death was seen in a ferret model in which groups of animals received two injections of either 19 , 38 , 75 or 15 g of haemagglutinin with emulsion adjuvant or a saline control and were challenged 2 months later with the parental wildtype virus . \n all vaccinated animals survived challenge , whereas five of the six controls died . vaccinated animals also showed fewer and milder clinical signs of disease ( temperature increase , body weight loss ) , shed less virus in nasal samples 2 and 4 days after challenge , and had fewer and milder lesions in the lungs upon histopathological examination . \n both species mounted robust haemagglutination inhibition responses against the vaccine strain , as well as crossreactive responses against the clade 2 indonesia/5/05 strain . \n strong homologous immunogenicity and crossreactive responses were also seen in the first clinical trial with this vaccine . \n this study in healthy 18 to 40year olds , evaluated vaccine with antigen dosages ranging from 19 to 15 g . \n results showed that after two injections , even the lowest dosage elicited haemagglutination inhibiting antibody titres 32 \n geometric mean titres were in the same range as 30 g with aluminium hydroxide adjuvant and as 90 g without adjuvant , i.e. a potential dose sparing of up to 48fold ( figure 1 ) . \n geometric mean titres of haemagglutination inhibiting antibodies against clade 1 h5n1 influenza strains 2128 days after two vaccinations with nonadjuvanted or adjuvanted vaccine in groups of healthy adults in three clinical trials . adapted from data in ref . \n none of the clinical or preclinical studies performed so far have revealed any clinically significant adverse events or safety signals after vaccination with any of the nonadjuvanted or adjuvanted formulations . \n , \n , \n clinical trials comparing adjuvanted and nonadjuvanted vaccine show that adjuvantation does increase the incidence of minor injection site reactions , such as redness , but that increasing the antigen dosage does not . \n recent advances in vaccine delivery systems have allowed the intradermal route of administration to be reconsidered for annual vaccination against seasonal influenza . \n this strategy avoids the unknowns associated with the repetitive annual administration of vaccine adjuvants and has led to the development of a new vaccine based on a current , wellknown , trivalent , inactivated splitvirion vaccine , with two dosage formulations designed specifically for younger and older adults . in contrast , adjuvanted vaccines will play a pivotal role in protection against the next human pandemic of influenza , helping to prime and immunize as many people as possible against a newly emerging strain of influenza with a finite vaccine production capacity . \n the ability of this new generation of vaccine to induce broadly crossreactive antibodies opens up the possibility of priming with stockpiled vaccine to mitigate the impact of infection during the first few months of the next pandemic , pending the availability of vaccine against the actual pandemic strain .", "role": "user" }, { "content": "abstract challenges facing seasonal and pandemic influenza vaccination include : increasing the immunogenicity of seasonal vaccines for the most vulnerable , increasing vaccination coverage against seasonal influenza , and developing vaccines against pandemic strains that are immunogenic with very low quantities of antigen to maximize the number of people who can be vaccinated with a finite production capacity . \n we review sanofi pasteur s epidemic and pandemic influenza research and development programmes with emphasis on two key projects : intradermal influenza vaccine for seasonal vaccination of both elderly and younger adults , and pandemic influenza vaccine .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: colorectal cancer ( crc ) is a common digestive tumor ; the incidence of crc is just lower than gastric and esophageal cancer . \n crc is becoming a very urgent public health concern , especially in the developed countries . in usa \n , the incidence rate and mortality rate of crc ranked third among all tumors in both men and women . \n body mass index , height , smoking status , and alcohol use have been reported to be associated with crc risk . however , the pathogenesis of crc is still uncertain . \n peroxisome proliferators - activated receptors ( ppar ) , which have ppar , ppar/ and ppar , are members of the nuclear receptor superfamily of ligand - activated transcription factors . \n due to its association with many human cancers such as colon , thyroid , breast , and prostate , ppar has been suggested to be an attractive target for cancer therapy . \n although the ppar nuclear receptor pathway was involved in cancer development , it might appear to have both oncogenic and tumor suppressor functions . \n showed that ligand activation of ppar in colon cancer cells could cause a considerable reduction in linear and clonogenic growth , increase expression of carcinoembryonic antigen , and the reversal of many gene expression events specifically associated with colon cancer . \n however , saez et al . suggested that ppar activation may provide a molecular link between a high - fat diet and increased risk of crc . \n a common polymorphism in the ppar , ccagca , causing a proala substitution at codon 12 ( pro12ala ) , has been reported . \n the pro12ala polymorphism has been suggested to be associated with decreased receptor activity , lower body mass index , and improved insulin sensitivity . \n the proala change might cause a conformational change in the ppar protein , and thus affect its activity . \n several studies have reported the association between ppar pro12ala polymorphism and crc risk [ 822 ] . however , the results were still equivocal . \n recently , a meta - analysis with nine studies found that this polymorphism was not associated with crc risk . \n however , six case - control studies were published and not all studies supported that result . \n therefore , we performed a meta - analysis of all eligible studies to evaluate the association between ppar pro12ala polymorphism and crc risk . \n the following terms were used : colorectal neoplasms or colorectal cancer ) and ( ppar or peroxisome proliferators - activated receptor ) . \n all searched studies were retrieved and only published studies with full - text articles were included . in duplicate samples , \n the inclusion criteria was as follows : ( 1 ) a case - control study or a cohort study ; ( 2 ) the study evaluated the association between ppar pro12ala polymorphism and crc risk ; ( 3 ) the ppar pro12ala genotypes were provided . \n the exclusion criteria were as follows : ( 1 ) animal studies ; ( 2 ) not relevant to crc or ppar ; ( 3 ) reviews or abstracts ; ( 4 ) not offer enough data . \n two authors extracted the following data : first author , year , race , sample size , and genotype distribution . \n statistical analysis was all conducted using stata software 11.0 ( statacorp , college station , texas , usa ) . \n odds ratio ( or ) with a 95% confidence interval ( ci ) was presented for dichotomous data , and significance level was 0.05 . \n dominant model , recessive model , and additive model were used in this meta - analysis . \n q - statistic and i - statistic were used to measure statistical heterogeneity and significance level was 0.10 . \n fixed - effect models was selected when no significant heterogeneity , otherwise we used the random - effects model . \n subgroup analyses were carried out based on race and cancer site . to evaluate the reliability of the results , one - way sensitivity analyses and cumulative meta - analysis were performed . \n the following terms were used : colorectal neoplasms or colorectal cancer ) and ( ppar or peroxisome proliferators - activated receptor ) . \n all searched studies were retrieved and only published studies with full - text articles were included . in duplicate samples , \n the inclusion criteria was as follows : ( 1 ) a case - control study or a cohort study ; ( 2 ) the study evaluated the association between ppar pro12ala polymorphism and crc risk ; ( 3 ) the ppar pro12ala genotypes were provided . \n the exclusion criteria were as follows : ( 1 ) animal studies ; ( 2 ) not relevant to crc or ppar ; ( 3 ) reviews or abstracts ; ( 4 ) not offer enough data . \n two authors extracted the following data : first author , year , race , sample size , and genotype distribution . \n statistical analysis was all conducted using stata software 11.0 ( statacorp , college station , texas , usa ) . \n odds ratio ( or ) with a 95% confidence interval ( ci ) was presented for dichotomous data , and significance level was 0.05 . \n dominant model , recessive model , and additive model were used in this meta - analysis . \n q - statistic and i - statistic were used to measure statistical heterogeneity and significance level was 0.10 . \n fixed - effect models was selected when no significant heterogeneity , otherwise we used the random - effects model . \n subgroup analyses were carried out based on race and cancer site . to evaluate the reliability of the results , one - way sensitivity analyses and cumulative meta - analysis were performed . \n based on the inclusion and exclusion criteria , 15 studies including 13575 cases and 17085 controls were included in our meta - analysis . \n only three studies were performed in asian populations , while other studies were performed in caucasian populations . \n result of this meta - analysis suggest that ppar pro12ala polymorphism was significantly associated with a reduced risk of crc in dominant genetic model ( or=0.90 ; 95% ci 0.830.98 ; p=0.01 ; figure 2 ) . \n no significant association was found between ppar pro12ala polymorphism and crc risk in asians ( or=0.80 ; 95% ci 0.601.09 ; p=0.15 ) . \n however , ppar pro12ala polymorphism was significantly associated with a reduced risk of crc in caucasians ( or=0.91 ; 95% ci 0.830.99 ; p=0.03 ) . \n when stratified analysis was performed by crc site , no positive association was found between ppar pro12ala polymorphism and rectal cancer ( or=0.95 ; 95% ci 0.741.22 ; p=0.71 ) . \n however , a reduced risk of colon cancer was observed ( or=0.85 ; 95% ci 0.760.94 ; p=0.002 ) . \n results of other genetic models are listed in table 2 . to evaluate the reliability of the results \n , we conducted cumulative meta - analysis by pooling the data , and each time one study was added . \n the results showed that the pooled ors tended to be stable ( figure 3 ) . \n we also performed the one - way sensitivity analysis by omitting studies one at a time . \n we found that any single study did not influence the pooled or , suggesting that the results of this meta - analysis were robust ( figure 4 ) . \n moreover , no significant publication bias was found by funnel plot ( figure 5 ) and egger s test ( p=0.12 ) \n based on the inclusion and exclusion criteria , 15 studies including 13575 cases and 17085 controls were included in our meta - analysis . \n only three studies were performed in asian populations , while other studies were performed in caucasian populations . \n result of this meta - analysis suggest that ppar pro12ala polymorphism was significantly associated with a reduced risk of crc in dominant genetic model ( or=0.90 ; 95% ci 0.830.98 ; p=0.01 ; figure 2 ) . \n no significant association was found between ppar pro12ala polymorphism and crc risk in asians ( or=0.80 ; 95% ci 0.601.09 ; p=0.15 ) . \n however , ppar pro12ala polymorphism was significantly associated with a reduced risk of crc in caucasians ( or=0.91 ; 95% ci 0.830.99 ; p=0.03 ) . \n when stratified analysis was performed by crc site , no positive association was found between ppar pro12ala polymorphism and rectal cancer ( or=0.95 ; 95% ci 0.741.22 ; p=0.71 ) . \n however , a reduced risk of colon cancer was observed ( or=0.85 ; 95% ci 0.760.94 ; p=0.002 ) . \n results of other genetic models are listed in table 2 . to evaluate the reliability of the results \n , we conducted cumulative meta - analysis by pooling the data , and each time one study was added . \n the results showed that the pooled ors tended to be stable ( figure 3 ) . \n we also performed the one - way sensitivity analysis by omitting studies one at a time . \n we found that any single study did not influence the pooled or , suggesting that the results of this meta - analysis were robust ( figure 4 ) . \n moreover , no significant publication bias was found by funnel plot ( figure 5 ) and egger s test ( p=0.12 ) \n ppar pro12ala polymorphism has been reported to be associated with breast cancer , gastric cancer , and inflammatory bowel disease [ 2426 ] . \n lu et al . suggested that ppar pro12ala polymorphism was not associated with crc risk . \n however , a previous meta - analysis found that ppar pro12ala polymorphism might be a protective factor for crc . \n thus , we did this update meta - analysis to find the association between ppar pro12ala polymorphism and crc risk . \n we found that ppar pro12ala polymorphism was significant associated with crc risk , suggesting that ppar ala allele carriers had reduced crc risk compared to ppar pro allele carriers . \n furthermore , we found that this effect was only existed in caucasians but not in asians , suggesting a possible influence among different genetic backgrounds and environmental exposures , but these were only studies with asians . \n more studies with asians are needed to further investigate the association between ppar pro12ala polymorphism and crc risk . \n results from this meta - analysis found that ppar pro12ala polymorphism was only associated with colon cancer . \n it has been suggested that ppar activity was higher in the distal colon ; it is possible that the ala / ala+pro / ala genotypes had the greatest effect in the segment of the colon with the least ppar activity . \n tanaka and coworkers indicated that administration of the ppar ligand troglitazone significantly reduces the number of aberrant crypt foci ( acf ) lesions . \n . found that the combination of resveratrol with a ppar agonist could be a promising pharmacological approach for treatment of crc . \n thus , ppar agonists combined with other chemotherapy drugs or other targeted therapies are worth pursuing in the treatment of crc [ 3136 ] . \n first , the number of included studies was moderate . therefore , the results could be influenced by random error . \n second , crc is a multifactorial disease , but the interactions among gene - environment and gene - gene were not considered in this meta - analysis . \n third , other factors such as gender or diet habit may participate in the progression of crc . \n however , we did not conduct subgroup analysis by these factors due to limited data . \n in summary , this study suggested that ppar pro12ala polymorphism was a protective factor of crc .", "role": "user" }, { "content": "backgroundthe association between peroxisome proliferators - activated receptor ( ppar ) pro12ala polymorphism and colorectal cancer ( crc ) risk is still controversial . \n a meta - analysis was performed.material/methodswe conducted a literature search using pubmed , embase , and cochran databases . \n the pooled odds ratio ( or ) with 95% confidence intervals ( cis ) were calculated . \n fixed - effects and random - effects models were used . \n dominant model , recessive model , and additive model were used in this meta-analysis.resultsfifteen studies including 13575 cases and 17085 controls were included in our meta - analysis . \n result of this meta - analysis found that ppar pro12ala polymorphism was significantly associated with a reduced risk of crc ( or=0.90 ; 95% ci 0.830.98 ; p=0.01 ) . \n no significant association was found between ppar pro12ala polymorphism and crc risk in asians ( or=0.80 ; 95% ci 0.601.09 ; p=0.15 ) . \n however , ppar pro12ala polymorphism was significantly associated with a reduced risk of crc in caucasians ( or=0.91 ; 95% ci 0.830.99 ; p=0.03 ) . \n when stratified analysis was performed by crc site , no positive association was found between ppar pro12ala polymorphism and rectal cancer ( or=0.95 ; 95% ci 0.741.22 ; p=0.71 ) . \n however , a reduced risk of colon cancer was observed ( or=0.85 ; 95% ci 0.760.94 ; p=0.002).conclusionsin summary , this study suggests that ppar pro12ala polymorphism was a protective factor of crc .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: approximately 47,000 total hip arthroplasty ( tha ) surgical procedures are done annually in poland.1 this is one of the most frequent and also one of the most burdensome orthopedic procedures in terms of extent and number of complications . \n the main indication for tha is advanced coxarthrosis , which affects both older men and women with similar frequencies , occurs most frequently between ages 60 and 90 years , and is a cause of severe chronic pain . \n those patients often suffer from other advanced comorbid diseases , the most frequent being hypertension , heart failure , diabetes , and chronic obstructive pulmonary disease ; therefore , the surgical procedure and period of rehabilitation present significant burdens for patients . \n an effective perioperative analgesia prevents serious cardiovascular complications , decreases the number of infections , and shortens the hospitalization period . \n it is also a prerequisite for early introduction of effective physiotherapy . in some tha studies , \n the advantages of regional over general anesthesia have been demonstrated.2,3 however , a systematic review published in 2016 demonstrated a lack of sufficient evidence for regional anesthesia advantages , although a shorter hospitalization period was used.4 in the postoperative period , continuous epidural analgesia plays an important role . for patients with contraindications or those who give no consent to this type of analgesia , an intravenous ( iv ) route of analgesic administration \n is the main method of pain treatment , especially during the first 24 h after the surgery . \n extensive orthopedic surgery ( such as knee or hip arthroplasty ) involves extensive tissue damage , especially of bone tissue , which in turn is associated with severe pain ; therefore , opioid administration is required in this patient group . for many years \n , morphine has been the gold standard of treatment for moderate - to - severe pain , although recently , an interest in oxycodone for the treatment of postoperative pain has been observed . \n oxycodone is used more frequently by physicians as it displays a beneficial pharmacological profile and lower percentage of adverse effects ( aes ) in comparison to morphine . \n the studies published to date confirm oxycodone s safety and high analgesic efficacy in pain treatment although most of the studies refer to the oral route of administration.57 oxycodone is a semisynthetic , thebaine opioid derivative , which was synthesized for the first time in 1916 and used in 1917.8 it has been widely used in the treatment of both acute and chronic pain for over 80 years . \n the mechanism of oxycodone s action is based on the activation of peripheral and central and opioid receptors . \n compared with morphine , oxycodone displays a lower affinity to -opioid receptors , but it activates opioid receptors to a significantly larger extent than morphine . \n in addition , its concentration in the brain is approximately six times higher , owing to the active transport through the blood \n brain barrier , which significantly increases its analgesic efficacy.912 moreover , in experimental studies , a beneficial influence of oxycodone as a result of an increased expression of gaba - b receptors in sensory neurons has been found . this increased expression induced hyperalgesia inhibition in a neuropathic pain model induced by the cytostatic drug vincristine.13 forty - five percent of oxycodone binds to serum proteins ( slightly more than morphine at 35% ) , and it is metabolized through cytochrome p-450 liver enzymes to the first - order metabolites , oxymorphone and noroxycodone.14 only oxymorphone displays analgesic effects via agonist effects on -opioid receptors , which are 14 times stronger compared with oxycodone administered parenterally , although oxymorphone concentration is too low for significant clinical effects.1518 oxycodone s plasma elimination half - life ( t1/2 ) is ~4 h , irrespective of the route of administration . \n oxycodone is excreted in the urine , mainly in the form of unbound noroxycodone and oxymorphone conjugated with glucuronic acid . only about 10% of the administered oxycodone \n is excreted unchanged in the urine.1921 the primary aim of the study was to assess the analgesic efficacy , aes , and oxycodone safety administered as a continuous infusion with ketoprofen injected into the iv line to patients after tha . \n the study protocol has been approved by the bioethical committee of the poznan university of medical sciences . \n the study was conducted from march to november 2014 in the jzef stru multiprofile municipal hospital in poznan . \n a total of 14 patients who had undergone a total non - cemented hip arthroplasty from a lateral access were recruited for the study . \n several tests were conducted before the surgery : 1 ) full blood count and 2 ) determination of plasma concentrations of sodium , potassium , creatinine ( for the calculation of the estimated glomerular filtration rate ) , urea , alanine aminotransferase , asparginate aminotransferase , total protein , and albumin \n . the perioperative risk was american society of anesthesiologists ( asa ) ii in five patients and asa iii in nine patients . \n the mean height of patients was 1706 cm , and the mean body mass was 7512 kg . before surgery , all patients received oral midazolam ( dormicum tablets ; roche ) at a dose of 7.5 mg . \n all patients received analgesia consisting of 15 mg heavy bupivacaine ( marcaine spinal 0.5% heavy ; astrazeneca ) via the sub - arachnoid route at the l3/l4 level . \n in addition , sedation was induced during anesthesia by propofol injection ( propofol 1% mct / lct fresenius ) via the iv route at a dose of 13 mg / kg of body weight / h with oxygen therapy and maintenance of respiratory tract patency via the oropharyngeal airway or through a laryngeal mask airway , whenever necessary . \n if no pain was present 3 h after spinal anesthesia , continuous infusion of oxycodone chloride ( oxynorm ampoules ; mundipharma ) via an iv route was started at a dose of 1 mg / h ( n=5 ) or 2 mg / h ( n=9 ) . \n a dose of 1 mg / h was administered to patients with a body mass < 65 kg ( n=5 ) , and a dose of 2 mg / h was given to patients whose body mass was > 65 kg ( n=9 ) . \n all patients in the postoperative unit received an iv ketoprofen ( 100 mg ) injection every 12 h. all patients were prescribed a rescue dose ( in the case of pain intensity over 4 according to a numerical rating scale [ nrs ] ) of 2 mg of oxycodone administered via the iv route in the nurse - controlled analgesia system , which could be repeated every 10 min . \n blood samples were taken for oxycodone concentration assays in blood serum ( a free fraction and protein - bound ) after 30 , 120 , and 240 min after starting the drug infusion . at the moment of blood sampling \n , patients were asked about pain intensity according to nrs ( 010 ) at rest and during movement . \n an nrs 3 at rest and an nrs 4 during movement ( hip flexion ) were considered satisfactory . in the postoperative unit , \n blood pressure , heart rate , blood oxygen saturation , and electrocardiogram were continuously monitored in all patients . \n the number of oxycodone rescue doses was recorded , and patients were also observed for the appearance of drug - related aes such as nausea , vomiting , pruritus , cognitive impairment ( recognizing time , place , and appropriate responses to questions posed ) , and respiratory depression defined as < 8 breaths / min with a decrease in oxygen blood saturation < 90% . \n the primary aim of the study was to assess the analgesic efficacy , aes , and oxycodone safety administered as a continuous infusion with ketoprofen injected into the iv line to patients after tha . \n the study protocol has been approved by the bioethical committee of the poznan university of medical sciences . \n the study was conducted from march to november 2014 in the jzef stru multiprofile municipal hospital in poznan . \n a total of 14 patients who had undergone a total non - cemented hip arthroplasty from a lateral access were recruited for the study . \n several tests were conducted before the surgery : 1 ) full blood count and 2 ) determination of plasma concentrations of sodium , potassium , creatinine ( for the calculation of the estimated glomerular filtration rate ) , urea , alanine aminotransferase , asparginate aminotransferase , total protein , and albumin \n . the perioperative risk was american society of anesthesiologists ( asa ) ii in five patients and asa iii in nine patients . \n the mean height of patients was 1706 cm , and the mean body mass was 7512 kg . before surgery , all patients received oral midazolam ( dormicum tablets ; roche ) at a dose of 7.5 mg . \n all patients received analgesia consisting of 15 mg heavy bupivacaine ( marcaine spinal 0.5% heavy ; astrazeneca ) via the sub - arachnoid route at the l3/l4 level . \n in addition , sedation was induced during anesthesia by propofol injection ( propofol 1% mct / lct fresenius ) via the iv route at a dose of 13 mg / kg of body weight / h with oxygen therapy and maintenance of respiratory tract patency via the oropharyngeal airway or through a laryngeal mask airway , whenever necessary . \n if no pain was present 3 h after spinal anesthesia , continuous infusion of oxycodone chloride ( oxynorm ampoules ; mundipharma ) via an iv route was started at a dose of 1 mg / h ( n=5 ) or 2 mg / h ( n=9 ) . \n a dose of 1 mg / h was administered to patients with a body mass < 65 kg ( n=5 ) , and a dose of 2 mg / h was given to patients whose body mass was > 65 kg ( n=9 ) . \n all patients in the postoperative unit received an iv ketoprofen ( 100 mg ) injection every 12 h. all patients were prescribed a rescue dose ( in the case of pain intensity over 4 according to a numerical rating scale [ nrs ] ) of 2 mg of oxycodone administered via the iv route in the nurse - controlled analgesia system , which could be repeated every 10 min . \n blood samples were taken for oxycodone concentration assays in blood serum ( a free fraction and protein - bound ) after 30 , 120 , and 240 min after starting the drug infusion . at the moment of blood sampling \n , patients were asked about pain intensity according to nrs ( 010 ) at rest and during movement . \n an nrs 3 at rest and an nrs 4 during movement ( hip flexion ) were considered satisfactory . in the postoperative unit , \n blood pressure , heart rate , blood oxygen saturation , and electrocardiogram were continuously monitored in all patients . \n the number of oxycodone rescue doses was recorded , and patients were also observed for the appearance of drug - related aes such as nausea , vomiting , pruritus , cognitive impairment ( recognizing time , place , and appropriate responses to questions posed ) , and respiratory depression defined as < 8 breaths / min with a decrease in oxygen blood saturation < 90% . \n mean values of the laboratory parameters from analyzed patients are demonstrated in table 2 . in all patients , \n no factors influencing metabolism and excretion of the selected drugs were found ( table 2 ) . \n the surgery time was 9015 min , and the length of patients stay in the operation theater was 15015 min . from the group of patients treated with oxycodone infusion at a dose of 1 mg / h , two patients required a single bolus of 2 mg oxycodone ( nrs 5/6 at rest at the time of oxycodone bolus administration ) , and the oxycodone dose in the infusion \n oxycodone concentration was not assayed in these patients , and additional rescue doses of oxycodone were not required . in the rest of the analyzed group of patients , there was no need for rescue doses of oxycodone during the postoperative period , both at rest and during movement . in the analyzed patients , oxycodone aes such as vomiting , pruritus , cognitive impairment , respiratory depression , and blood pressure changes \n mean total and protein - bound oxycodone serum concentrations in three out of five patients receiving oxycodone at a dose of 1 mg / h and mean pain intensity ( nrs ) at rest and during movement ( n=3 ) are shown in table 3 . \n mean total and protein - bound oxycodone concentrations in the blood serum in nine patients treated with oxycodone at a dose of 2 mg / h , and mean pain intensity ( nrs ) at rest and during movement are shown in table 4 . \n in this study , oxycodone , administered in a continuous infusion for postoperative pain treatment in tha patients , was coadministered with ketoprofen injected into the iv line every 12 h. oxycodone was used at 1 and 2 mg / h depending on patient s body weight . in both patient groups , in consecutive observations , pain intensity was mild and \n did not exceed 3 ( according to nrs ) at rest and 4 during movement . in the group of patients treated with oxycodone at 1 mg / h \n an oxycodone dose of 2 mg / h provided all nine treated patients with satisfactory analgesic effects , which is substantiated by the fact that no patient required administration of additional doses of analgesics . \n the mean oxycodone concentration in this patient group did not exceed 43 ng / ml of the total and 26 ng / ml of protein - bound oxycodone , whereas pain intensity did not exceed 3 ( according to nrs ) . \n an oxycodone dose of 1 mg / h provided effective analgesia in three out of five treated patients with mean oxycodone concentration in the three - patient group did not exceed 25 ng / ml of the total and 18 ng / ml of protein - bound oxycodone . in three analyzed patients \n two patients required administration of rescue doses of 2 mg oxycodone ( nrs 5/6 at the moment of the drug administration ) and a dose increase to 2 mg / h . \n oxycodone concentrations in these patients were not measured . in the patient group with body weights < 65 kg , an oxycodone dose of 1 mg / h was effective only in some patients . a dose increase to 2 \n mg / h was used in cases of severe pain intensity associated with extensive surgery and the fact that bone pain usually displays severe intensity associated with mixed receptor and neuropathic components.12 nausea , vomiting , bradycardia , and hypotension are opioid - induced aes . \n oxycodone aes such as vomiting , pruritus , cognitive impairment , respiratory depression , and blood pressure changes were not observed . \n one patient experienced nausea , which disappeared after iv administration of ondansetron at a dose of 4 mg . \n bradycardia was observed in two patients ( heart rate < 45 ) , and it also disappeared after iv atropine administration at a dose of 0.5 mg . in both patient groups in the study period , serum oxycodone steady state was not achieved . \n four hours after starting oxycodone infusion , total and protein - bound drug concentrations were still increasing . to establish the time necessary to achieve a serum drug steady state when administering oxycodone as continuous iv infusion , another study with a longer assay period and more time points should be done . \n analgesia may be associated with serum opioid concentrations . in a study conducted by kokki et al , \n patients undergoing laparoscopic cholecystectomy had oxycodone concentrations equaling 2050 ng / ml.22 in another study performed among patients after cardiac surgery , oxycodone concentrations were in the range of 625 ng / ml.23 these observations demonstrate that oxycodone concentrations may vary significantly depending on the doses used , time of blood sampling , and type of surgery . \n the data obtained in our study indicate that oxycodone concentrations in patients after tha may be in the range of 2442 ng / ml . however , a full pharmacokinetic / pharmacodynamic analysis of oxycodone administered after tha surgery should be done . \n patients undergoing this procedure are most frequently aged > 60 years and apart from arthrosis , suffer from other advanced chronic comorbidities , which require constant drug administration . \n these comorbidities should thus be considered when choosing pre- and postsurgical analgesia methods , which would enable patients rapid return to normal functioning . for many years \n , morphine has been the gold standard opioid for the treatment of moderate - to - severe pain . in 2009 , \n oxycodone was registered in poland , and thus it was possible to also start using oxycodone by the parenteral route , which had been widely used earlier in other countries mainly by the oral route . \n oxycodone is an opioid , which thanks to its unique mode of action ( affinity of and receptors , active transport to central nervous system , and activation of the gaba system ) provides effective analgesia , also due to a short plasma half - life , easy dose titration , and relatively mild aes . \n due to its agonist action on opioid receptors , oxycodone is often successfully used in visceral pain treatment ( such as after extensive abdominal surgery ) , as these receptors have been shown to be present on nerve endings in the peritoneum and dorsal horns of the spinal cord.24 the results of this study demonstrated that oxycodone was also effective in postoperative pain treatment after an extensive orthopedic surgery during the first 24 h. the titration of an effective dose of oxycodone administered by iv infusion allows a switch to the oral route of or oxycodone administration that should be effective and safe for each patient . \n analgesia administered via the iv route in the early postoperative period should provide fast pain relief , stable pharmacokinetics , and convenient dosing . \n tha is one of most extensive orthopedic surgeries , and it is associated with severe postoperative pain ; therefore , apart from central and peripheral blockades , opioids from step 3 of the world health organization analgesia classification are most commonly used . to limit oxycodone doses , a nonsteroidal anti - inflammatory drug was added . in this case , ketoprofen that possesses significant analgesic efficacy as far as bone pain is concerned was used . \n it should be noted that among patients enrolled , no patient had been diagnosed with renal and/or liver diseases or peptic ulcers , which would have been contraindications to ketoprofen administration . \n laboratory parameters were within normal range ; thus , no factors that would have influenced drug metabolism and excretion were found . in this study , \n opioid treatment had been started by the time central blockade analgesia subsided , and the patient had already recovered normal cognitive functions after propofol sedation . \n study limitations include lack of a control group , moderate number of enrolled patients , short period of observation ( 24 h ) , and limited number of serum oxycodone assays ( done only at 4 h ) , which had not allowed drug steady state to be reached \n . however , despite the aforementioned limitations , we were able to demonstrate an effective analgesic effect , good profile of aes , and safety of a combination of oxycodone infusion at a dose of 2 mg / h together with a bolus of 100 mg ketoprofen administered every 12 h for severe pain intensity treatment after tha surgery . \n continuous oxycodone infusion at a dose of 2 mg / h in conjunction with ketoprofen ( 100 mg ) every 12 h , both administered via the iv route , can provide effective analgesia in patients during the first 24 h after tha surgery . \n oxycodone at 1 mg / h administered as an iv infusion is effective in some patients after tha . \n oxycodone iv infusions at doses of 1 and 2 mg / h do not induce drowsiness , vomiting , pruritus , respiratory depression , or blood pressure changes ; however , out of 14 treated patients , bradycardia was observed in two patients and nausea in one \n . intravenous infusion of oxycodone chloride in conjunction with iv ketoprofen provides analgesia that is effective and acceptable to patients during the first 24 h after tha . \n oxycodone administered as a continuous iv infusion is a safe pain management method in patients after tha .", "role": "user" }, { "content": "backgroundtotal hip arthroplasty ( tha ) causes extensive tissue damage and severe pain . \n this study aimed to assess the analgesic efficacy , adverse effects ( aes ) , and safety of continuous intravenous ( iv ) oxycodone infusion with ketoprofen ( injected into the iv line ) in patients after tha , and to assay serum oxycodone levels.patients and methodsfourteen patients , aged 5982 years with american society of anesthesiologists ( asa ) classification i or iii , underwent tha with intrathecal analgesia and sedation induced by iv propofol . after the surgery , oxycodone ( continuous iv infusion ) at a dose of 1 mg / h ( five patients ) or 2 mg / h ( nine patients ) with 100 mg ketoprofen ( injected into the iv line ) was administered to each patient every 12 h. pain was assessed using a numerical rating scale ( nrs : 0 no pain , 10 the most severe pain ) at rest and during movement . \n aes , including hemodynamic unsteadiness , nausea , vomiting , pruritus , cognitive impairment , and respiratory depression , were registered during the first 24 h after surgery.resultsoxycodone ( continuous iv infusion ) at a dose of 2 mg / h with ketoprofen ( 100 mg ) administered every 12 h provided satisfactory analgesia in all nine patients without the need of rescue analgesics within the first 24 h after tha . in three out of five patients , \n oxycodone at 1 mg / h was effective . \n oxycodone did not induce drowsiness , vomiting , pruritus , respiratory depression , or changes in blood pressure . \n bradycardia appeared in two patients , and nausea was observed in one patient.conclusionoxycodone infusion with ketoprofen administered by iv is effective in patients after tha . \n intravenous infusion of oxycodone is a predictable , stable , and safe method of drug administration .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: internet has become a ubiquitous feature at home , school and the work place as the world - wide population of internet users has grown rapidly in the recent years . \n internet user population world - wide has doubled from 1.15 billion to 2.27 billion and has grown from 418 million to 1 billion in the last 5 years in asia . \n rapid expansion and proliferation of the internet has provided better opportunities for communication , information and social interaction . however , \n the excessive undisciplined use by , some individuals has led to the emergence of the concept of internet addiction . \n the proposed diagnostic criteria for internet addiction are obsessive thoughts about internet and the use of the internet more than is intended or despite its negative consequences including withdrawal symptoms and tolerance . \n studies have shown that young internet users and males have a higher risk of addiction . \n this addiction has been linked to intermediate psychosocial variables such as avoidance , ( escapism ) male gender and applications such as online games . \n excessive use and pre - occupation about the internet has been shown to affect day - to - day life activities , time management , marriage , sexual life , productivity at work , education and academic work . \n studies have shown that excessive use of the internet is associated with such psychiatric conditions as anxiety , depression , social phobia , impulsiveness and substance abuse , as well as the induction of seizures , insufficient sleep and social isolation . \n an increasing number of young malaysians are resorting to the internet as the medium of choice for information and entertainment . \n a study by an international marketing firm taylor nelson sofres which observed the habits and behavior of internet users found that the largest number of social network partners belonged to malaysian internet users with the highest average number of 233 digital friends when compared with their peers from other countries . \n another survey by microsoft conducted among 2800 internet users in 11 countries in the asia - pacific region has shown that 71% of malaysian internet users spend more than 1 h / day on cyber social activities and that the largest number of internet friends on facebook belonged to malaysian internet users . studies from various countries have reported on internet addiction , its association with mental health , yet no reports have come from malaysia . \n therefore , an online survey was carried out of regular internet users to assess the frequency of the use of various internet applications and explore the association of compulsive internet use with mental health and socio - demographic factors . \n a cross - sectional online survey was carried out by university tunku abdul rahman ( utar ) . \n the utar opinion poll survey is an initiative undertaken by a committee with representatives from all faculties of the university . \n every month , the committee plans and executes opinion poll surveys on various topics of general interest about the youth in malaysia ( http://poll.utar.edu.my ) . \n the registered utar opinion poll survey participants are young adults from various parts of malaysia , most of whom are young university students with access to the internet . \n sampling method and sample size calculation were not used since this was an exploratory study . \n the survey also provided an option for participants to invite their friends to take part . \n the online survey questionnaire had sections on demographic information such as age , gender , marital status , monthly income , educational status , employment status , questions on availability of internet at the work place and the typical number of hours spent online per day and applications or the purpose for which the internet is used . \n frequency of using various internet applications such as gaming , social network , e - mails etc . , were assessed on a five - point likert scale as never , seldom , sometimes , often and always . \n the survey also contained a 12-item general health questionnaire ( ghq-12 ) and compulsive internet use scale ( cius ) . \n ghq-12 designed by goldberg , has reliability coefficients ranging from 0.78 to 0.95 in various studies with a well - established international validity . \n for example , the options given for each question in ghq-12 and the scores assigned ( as shown in parenthesis ) are better than usual - ( 0 ) , same as usual - ( 1 ) , less than usual - ( 2 ) and much less than usual - ( 3 ) . \n ghq-12 scores are calculated by summing up the scores of all 12 items giving a score range of 0 - 36 . \n a score > 15 suggests evidence of distress and a score > 20 suggests severe problems and psychological distress . ghq-12 and its scoring is available at http://www.workhealth.org/uci%202007/practicum%2008%20ghq%202007.pdf . \n cius is an easily administered , psychometrically sound , valid instrument used to assess the severity of compulsive internet use . \n cius originates from an analysis of criteria for dependence and obsessive - compulsive disorder as found in the dsm - iv , literature on behavioral addictions and from qualitative research on self - declared internet addicts . \n it has a high internal consistency and high correlations with concurrent and criterion variables demonstrating its good validity . \n for example , the options for each question and the scores assigned ( as shown in parenthesis ) are never - ( 0 ) , seldom - ( 1 ) , sometimes - ( 2 ) , often - ( 3 ) and always - ( 4 ) . scores are calculated by summing up the scores of all 14 items giving a score range of 0 - 36 . however , it has no cut - off point to categorize a participant as an internet addict . \n data extracted into microsoft excel was converted into statistical package for social sciences ( spss inc . \n the relationship of cius score with demographic factors and ghq was explored using bivariate statistics . \n correlation coefficients for ghq score and cius score with age , daily hours and years of internet use were calculated . \n mean ghq and cius scores were compared with categories of demographic variables and the statistical significance of the difference in mean scores was tested using independent samples t - test or anova as appropriate . \n the relationship of cius score with ghq , daily hours and years of internet use and socio - demographic variables was tested by linear regression analysis . a p < 0.05 was considered as significant . \n a cross - sectional online survey was carried out by university tunku abdul rahman ( utar ) . \n the utar opinion poll survey is an initiative undertaken by a committee with representatives from all faculties of the university . \n every month , the committee plans and executes opinion poll surveys on various topics of general interest about the youth in malaysia ( http://poll.utar.edu.my ) . \n the registered utar opinion poll survey participants are young adults from various parts of malaysia , most of whom are young university students with access to the internet . \n sampling method and sample size calculation were not used since this was an exploratory study . \n the survey also provided an option for participants to invite their friends to take part . \n the online survey questionnaire had sections on demographic information such as age , gender , marital status , monthly income , educational status , employment status , questions on availability of internet at the work place and the typical number of hours spent online per day and applications or the purpose for which the internet is used . \n frequency of using various internet applications such as gaming , social network , e - mails etc . \n , were assessed on a five - point likert scale as never , seldom , sometimes , often and always . \n the survey also contained a 12-item general health questionnaire ( ghq-12 ) and compulsive internet use scale ( cius ) . \n ghq-12 designed by goldberg , has reliability coefficients ranging from 0.78 to 0.95 in various studies with a well - established international validity . \n for example , the options given for each question in ghq-12 and the scores assigned ( as shown in parenthesis ) are better than usual - ( 0 ) , same as usual - ( 1 ) , less than usual - ( 2 ) and much less than usual - ( 3 ) . \n ghq-12 scores are calculated by summing up the scores of all 12 items giving a score range of 0 - 36 . \n a score > 15 suggests evidence of distress and a score > 20 suggests severe problems and psychological distress . ghq-12 and its scoring is available at http://www.workhealth.org/uci%202007/practicum%2008%20ghq%202007.pdf . \n cius is an easily administered , psychometrically sound , valid instrument used to assess the severity of compulsive internet use . \n cius originates from an analysis of criteria for dependence and obsessive - compulsive disorder as found in the dsm - iv , literature on behavioral addictions and from qualitative research on self - declared internet addicts . \n it has a high internal consistency and high correlations with concurrent and criterion variables demonstrating its good validity . \n for example , the options for each question and the scores assigned ( as shown in parenthesis ) are never - ( 0 ) , seldom - ( 1 ) , sometimes - ( 2 ) , often - ( 3 ) and always - ( 4 ) . \n scores are calculated by summing up the scores of all 14 items giving a score range of 0 - 36 . \n however , it has no cut - off point to categorize a participant as an internet addict . \n data extracted into microsoft excel was converted into statistical package for social sciences ( spss inc . \n the relationship of cius score with demographic factors and ghq was explored using bivariate statistics . \n correlation coefficients for ghq score and cius score with age , daily hours and years of internet use were calculated . \n mean ghq and cius scores were compared with categories of demographic variables and the statistical significance of the difference in mean scores was tested using independent samples t - test or anova as appropriate . \n the relationship of cius score with ghq , daily hours and years of internet use and socio - demographic variables was tested by linear regression analysis . a p < 0.05 was considered as significant . \n of the 330 respondents who completed the online survey , 185 ( 55.2% ) were females and 145 ( 44.8% ) were males with a mean age of 23.17 ( sd = 3.84 ) . \n two hundred and three ( 61.5% ) respondents were full - time students , 247 ( 74.8% ) were single ; 214 ( 64.8% ) had a bachelor 's degree and 204 ( 61.8% ) had monthly income of < 2000 malaysian ringgits ( 1 malaysian ringgit 0.32 us dollar ) [ table 1 ] . \n the average years of internet use was 8.7 ( sd = 3.85 ) and the mean hours of daily internet use was 6.56 ( sd = 3.73 ) [ table 2 ] . \n a majority of participants had an internet connection either at home ( 93.3% ) , or in college or at the work place ( 96.1% ) and 62.7% had an internet connection on their mobile phones ( data not shown ) . \n association of demographic factors with cius score and ghq score bivariate correlation coefficients of cius score and ghq scores with age , durations of internet use and ghq score the overall mean cius score was 19.85 ( sd = 10.57 ) and the mean ghq score was 15.47 ( sd = 6.29 ) . according to the recommended ghq-12 cut - off scores , 55.5% ( 183/330 ) respondents showed evidence of psychological distress and 28.2% ( 93/330 ) had severe distress . \n bivariate correlation between cius score and ghq score was 0.249 ( p < 0.001 ) . \n mean cius scores were compared with categories of socio - demographic variables of gender , education , income , marital status and job status . \n of these , the mean cius scores were significantly high among respondents who had a master 's or a higher degree [ table 1 ] . \n cius score was compared with age , years of internet use and the number of hours the internet is used daily , using bivariate correlations and the correlation coefficients were 0.118 , 0.014 and 0.242 respectively . \n all the correlations were weak , but statistically significant for age ( p = 0.03 ) and hours of internet use daily ( p < 0.001 ) [ table 1 ] . \n a comparison of the mean ghq scores among categories of gender , education , income , marital status and job status exhibited no statistically significant differences . \n a comparison of ghq score with age , years of internet use and daily hours of internet use by bivariate correlations gave correlation coefficients of 0.040 , 0.033 and 0.017 respectively suggesting that there was no correlation and no statistical significance ( p > 0.05 ) [ table 2 ] . \n a majority of the participants responded that they often / always used the internet for social networking ( 85.5% ) and personal e - mails ( 78.5% ) , followed by work - related surfing ( 67.2% ) and general information search ( 63.9% ) . \n the frequency of the use of the youtube and movie websites on the internet and to download ( software , movies , music etc . ) reported as often / always was 54.2% [ table 3 ] . \n frequency of using internet applications by multiple linear regression analysis age ( = 0.111 , p = 0.033 ) and marital status ( = 0.124 , p = 0.018 ) were negatively associated with cius score whereas daily hours of internet use ( = 0.269 , p = 0.001 ) and ghq score ( = 0.259 , p = 0.001 ) were positively associated with cius score after adjusting for the effect of socio - demographic variables [ table 4 ] . \n association of cius score with ghq-12 score , age , sex , marital status and hours of internet use per day \n social networking , personal e - mails and general information search were the most frequently used internet applications . \n mean cius score was not high , but its range was wide and weakly correlated with daily hours of internet use , age and marital status and ghq scores . by ghq case criterion , \n nearly a quarter of the respondents had severe psychological distress , but the proportion with internet addiction could not be reported since unlike the more recent internet addiction tests , cius does not have a cut - off score . \n however , studies using internet addiction test have reported the prevalence of internet addiction of adolescents from taiwan as 31 ( 19.8% ) , china 32 ( 6.44% ) , greece 33 ( 11.6% ) , japan 34 ( 8 - 10% ) and malaysia 35 ( 29% ) . \n the pattern of internet usage in our study was similar to the findings of a survey by accenture ( a multinational management consulting , technology services and outsourcing company ) which has reported that social network sites usage ( sns ) was the preferred method of communication among adolescents in malaysia , which ranks first as the most sns active country ( malaysian communications and multimedia commission ) . \n similar to the results of our study and those from usa and korea , the same study also showed that sns usage had a significant negative effect on psychological well - being . \n other studies about mental health and internet use have reported that mental health problems such as depression , low self - esteem , high level of stress , distorted view of body image , loneliness and prior addictions increased the risk of internet addiction . \n cius scores in the higher range are consistent with the frequency of internet addiction reported in studies from china and korea . \n research has suggested that the ease of access will tend to facilitate the use of internet from home , school / the work place , or mobile networks . \n this convenience has encouraged the use of the internet to the extent of addictive behavior . \n it is reasonable to argue that easy access to the internet may be another possible risk factor for addiction . \n the internet is an essential tool for learning in the modern education system , but a study from taiwan has reported availability of the internet as a possible risk factor for addiction among college students . \n nevertheless , it is not easy to determine the optimal use of internet or put restrictions on the use of various applications . in our study , \n the number of hours of daily internet use was associated with cius score , but years of internet use was not since most ( > 90% ) of our participants had an internet connection at home or place of work / study , increasing the likelihood of their using it for longer hours . \n our findings of positive correlation between cius and ghq scores are in agreement with the emerging concept of association between internet addiction and mental health . as cross - sectional design \n can only identify the views and reported behavior of respondents at a particular point in time . \n further research to observe actual behavior or a prospective study to follow - up the internet users might be helpful . despite online anonymous survey , some responses may have been biased leading to a reporting bias . \n the sample surveyed might have been relatively healthy , accounting for relatively low to moderate correlations found between the cius score and the ghq score . only about 30% of registered participants responded to the survey , but there was no information about those who did not complete the survey ( non - respondents ) for us to assess how non - response may have affected our results . \n future research directed at answering questions on the relationship between problematic or addictive use of the internet and mental health should include a more heterogeneous sample , in terms of age , occupation ( i.e. non - students ) and education . \n as cross - sectional design can only identify the views and reported behavior of respondents at a particular point in time . \n further research to observe actual behavior or a prospective study to follow - up the internet users might be helpful . despite online anonymous survey , some responses may have been biased leading to a reporting bias . \n the sample surveyed might have been relatively healthy , accounting for relatively low to moderate correlations found between the cius score and the ghq score . only about 30% of registered participants responded to the survey , but there was no information about those who did not complete the survey ( non - respondents ) for us to assess how non - response may have affected our results . \n future research directed at answering questions on the relationship between problematic or addictive use of the internet and mental health should include a more heterogeneous sample , in terms of age , occupation ( i.e. non - students ) and education . \n compulsive internet use was weakly correlated with ghq score and hours of internet use daily . \n internet users should be educated about the ill effects of over - use and ways of spending time away from internet .", "role": "user" }, { "content": "background : the last decade has seen the emergence of the internet as the prime communication medium changing the way people live and interact . \n studies from various countries have reported on internet addiction and its association with mental health , but none have come from malaysia.objectives:we aimed at assessing the frequency of the use of various internet applications and exploring the association of compulsive internet use with mental health and socio - demographic factors.materials and methods : a cross - sectional online survey was carried out among participants registered for the monthly opinion poll survey of university tunku abdul rahman , malaysia . \n the questionnaire contained socio - demographic information , the use of various internet applications on a five - point likert scale , compulsive internet use scale ( cius ) and 12 item general health questionnaire ( ghq-12 ) . \n correlations and linear regression analyzes were carried out.results:of the 330 respondents , 182 were females and 148 were males . \n the mean age was 23.17 ( sd = 3.84 ) . \n mean cius score was 19.85 ( sd = 10.57 ) and mean ghq score was 15.47 ( sd = 6.29 ) . \n correlation coefficients of cius score with age , years of use and daily hours of internet use were 0.118 ( p = 0.03 ) , 0.014 ( p = 0.81 ) and 0.242 ( p < 0.001 ) respectively . \n multiple linear regression analysis showed that age ( = 0.111 , p = 0.033 ) and marital status ( = 0.124 , p = 0.018 ) were negatively associated with cius scores whereas daily hours of internet use ( = 0.269 , p = 0.001 ) and ghq score ( = 0.259 , p = 0.001 ) were positively associated with the cius score.conclusions:compulsive internet use was correlated with ghq score . \n more research is needed to confirm our results . \n psychologists may consider assessing internet addiction when evaluating young psychiatric patients .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 43-year - old male with a history of uncontrolled hypertension was admitted to our neuroscience intensive care unit form an outside institution with a diagnosis of a hunt & hess grade 4/fisher grade 3 sah ( fig . \n an evd was placed on admission and a digital subtraction angiography ( dsa ) was performed which demonstrated presence of the right vertebral artery fusiform aneurysm with the posterior inferior cerebellar artery ( pica ) arising from the base of a focal dilatation from the fusiform aneurysm segment ( fig . \n after consideration of all the treatment options , endovascular treatment was elected in view of poor grade sah and patients ' cardiopulmonary status . \n a microcatheter was subsequently placed into the vertebral artery with coiling of the focal dilatation arising off the aneurysm along with deployment of a 3.7518 mm ped completely covering the fusiform vertebral aneurysm for vessel remodeling . \n a raymond class ii occlusion of the focal dilatation arising from the fusiform aneurysm was achieved ( fig . \n the evd was converted to a ventriculo - peritoneal shunt before the patient was discharged home in a good neurological condition . \n he was alert and oriented with no focal def icits at discharge except presence of right sided sixth cranial nerve palsy . \n routine follow up angiography done at 6 months as per our institutional protocol showed coil compaction and enlargement and regrowth of both the focal dilatation and the fusiform aneurysm without migration of the pipeline stent ( fig . \n even though the patient was asymptomatic , considering significant enlargement of the aneurysm with a prior presentation with sah , he was taken back to the neuro - interventional suite with placement of three overlapping ped 's ( 3.5 mm182 and 3.514 mm ) to increase the overall coverage area and further reduce the shear stress which possibly caused the aneurysm to continue growing despite treatment with a single ped on presentation . \n the post procedure course was uneventful and he was discharged home with no new neurological deficits . \n a follow up angiography was performed at 3 months which showed no residual aneurysm ( fig . \n fusiform aneurysms represent a challenging subgroup of intracranial aneurysms which generally presents with ischemic stroke , cranial nerve palsies , brainstem compression , hydrocephalus and intracranial hemorrhage . \n sah is generally uncommon in patients with fusiform aneurysm ; but when present increases the complexity associated with management of these aneurysms . \n given the complex morphology of fusiform aneurysms , both endovascular and surgical treatment options remain limited and technically challenging . \n poor grade sah along with associated co - morbid medical conditions often results in pursuing the endovascular route for treatment of intracranial aneurysms even for cases for which there is potential for increased complications . \n use of stents in ruptured sah is such an indication as they often require administration of dual antiplatelet agents which associated risks of hemorrhagic complications , either spontaneous or associated with interventions such as placement or revision of evds and vps . \n flow diverters induce disruption of flow near the aneurysm neck , inducing thrombosis into the aneurysm sac while preserving physiological flow in the parent vessel and adjacent branches and have been the most recent advancement in endovascular treatment of intracranial aneurysms \n . the term \" flow diversion \" refers to the concept of hemodynamic influence on an aneurysm by reducing both inflow and outflow with flow diverters being stent - like endovascular implants designed to alter the blood flow in an artery in a way that favors the flow along the longitudinal axis of the target vessel and reduces inflow and outflow of an aneurysm covered by the device . \n various flow diverters commercially available includes ce mark device ( silk , balt extrusion , montmorency , france and the pipeline embolization device ( ped , ev3 , irvine , ca , usa ) \n . a tight mesh of small cell sizes and a high longitudinal flexibility of these newer flow diverters offer the possibility to cover an aneurysm orif ice and in carefully selected cases , may successfully be used to reconstruct intracranial vessel dissections . while approved for large or giant necked aneurysms involving the ica from the petrous to the superior hypophyseal segments , a number of studies have shown the effectiveness of stent - assisted coiling in sah with good overall clinical outcome ; albeit at higher rates of complications [ 6 , 7 ] . \n most of these complications have been hemorrhagic secondary to the use of antiplatelet and anticoagulant medications . \n however , once the acute period is over with good aneurysm occlusion , delayed thrombosis of the stent remains the foremost concern along with other device - related complications such as creeping of the stent or migration / shortening of the ped . \n overall , the use of ped has been shown to result in excellent aneurysm occlusion in various series . while immediate angiographic exclusion of the aneurysm at the end of the original procedure is observed only in up to 10 - 20% of patients treated with ped , \n total aneurysm occlusion rates of more than 90% at 1 year have been reported in various studies even in large and giant aneurysms and even fusiform and dissecting type aneurysms through remodeling of the parent vessel over time . \n the use of ped in wide neck aneurysms makes it an ideal choice to be used in conjunction with coil placement as conventional stent porosity would not provide significant protection against coil migration as compared to ped in some cases where smaller coils needs to deployed . while the lack of immediate aneurysm occlusion with flow diverters necessitates obliteration of aneurysm sac using simultaneous coil placement in patients with sah , as the occlusion rates with use of flow diverting stents such as ped increases up to 90% at one year follow up , any residual aneurysm neck after securing of the aneurysm dome should not be concerning as the flow diverter stent should actually lead to complete aneurysm occlusion due to its mechanism of action . the case described in this report \n was treated with this hypothesis in mind . to avoid the possibility of coil migration / herniation without a scaffold , a ped was used to address this and also to treat the fusiform vertebral artery aneurysm . \n the use of conventional low coverage stent assisted coiling was not considered optimal due to the origin of the pica from the fusiform aneurysm segment of the artery . \n placement of flow diverter ped was considered the best option as it would allow coiling of the focal dilatation of the aneurysm and leave the pica patent due to maintenance of the flow secondary to associated pressure gradient . hence once positioned and prior to coil detachment into the focal dilatation from the aneurysm , a 3.75 mm18 mm ped device \n was partially deployed to cover the pica and the fusiform aneurysm while temporarily jailing the microcatheter . \n the coil was then detached , and the remainder of the stent was deployed , preventing migration of the coil mass . \n the combined use of both modalities , the coil and the ped , provided immediate protection from re - hemorrhage , while counting on the long term protection through remodeling of the parent vessel by the ped . \n unfortunately , in our case , the follow up angiogram showed aneurysm regrowth with coil compaction despite well positioned ped which required another procedure . the plausible hypothesis for aneurysm expansion in our case \n may be related to the low coverage of the fusiform segment of the aneurysm which allowed progression of the aneurysm in the diseased fusiform segment due to persistent shear stress in the vessel and led to recurrence of the aneurysm . \n we hypothesize that in such cases it may be important to reduce the shear stress in the vessel wall to allow vessel remodeling ; failure of which may result in persistent growth of the fusiform aneurysm as was seen in the present case . \n unfortunately , the number of ped to be employed and what is constituted as adequate coverage is considered controversial with no consensus . \n technically , a single ped is considered adequate if the target lesion is fully covered and in case of immediate contrast medium stagnation . however , placement of multiple devices may be of value in cases with an unchanged aneurysm perfusion after implantation of ped indicating an insufficient effect of flow diversion and cases of widespread longitudinal vessel dilatation where a telescoping implantation of multiple devices was necessary to cover the entire lesion . \n while the use of multiple peds appears intuitive in cases with fusiform aneurysms to decrease the shear stress on the diseased vessel wall , it may not obviate the chances of incomplete occlusion in these subgroup as seen in the study by jabbour et al . and may unnecessarily increase procedural time , procedural cost , and the risk of thromboembolic complications . on the other hand , a dense packing of the device during the implantation process does raise the degree of coverage resulting in larger flow diversion and a larger protective effect arguing in favor of implantation of more than one flow diverter across the orifice in order to increase the density with an improved flow diversion towards the parent artery . the benefit of increased density needs to be balanced with risk of side branch or parent vessel occlusions due to an in - stent thrombosis and other thromboembolic complications . \n we believe that in the absence of definitive evidence for either and balancing the risk benefits ratio , concept of a staged therapy with initial rather defensive implantation of devices followed by additional flow diverters dependent on the follow - up results appears intuitive . \n while this approach may be useful for patients who does not presents with sah , poor response with aneurysm regrowth in patients with sah may be concerning due to risk of re - rupture as could have happened in our case . in these cases of fusiform aneurysm presenting with sah , it may be prudent to utilize multiple peds to increase the coverage area ; what is considered adequate is debatable and is up to the discretion of the treating neurointerventionlist as even with more than one ped , jabbour et al . reported with poor outcome in patients with fusiform aneurysm . \n hence considering an earlier follow up angiography in patients with fusiform aneurysms treated with ped especially in patients with sah may be of value to detect increase in size of the aneurysm earlier and tailor the number of devices necessary to achieve the desired outcome or pursue alternative treatment modality to prevent aneurysm rupture . \n fischer , et al recently reported complete aneurysm occlusion or decrease in size of the aneurysm in about 96% of patients with fusiform or dissecting aneurysm at a follow up of 1 year . \n interestingly , in the same study ; only 24% of cases showed complete cure and 30% showed partial occlusion at 3 months follow - up angiography . \n there was no aneurysm growth in the study at three or one year follow - up angiogram demonstrating the safety and eff icacy of ped in fusiform and dissecting aneurysms . \n none of the patients in the study had acute sah though , and a number of patients were treated with more than one peds . \n in contrast to this study , siddiqui et al reported less favorable results in a series of 7 large or giant vertebrobasilar fusiform aneurysms treated with flow diverters with significant morbidity and mortality ; the poor outcome being secondary to post - treatment aneurysm ruptures in two and lack of neurological improvement caused by brainstem infarcts in another 2 patients . \n suboptimal outcome with the use of ped in fusiform aneurysms was also echoed in the study by jabbour , et al in which they found fusiform aneurysm shape as a negative predictor for aneurysm obliteration despite a significantly higher number of peds ( 1.8 ) used in this subset of patients .the variable results from different studies highlights the complexity associated with use of ped in vertebrobasilar fusiform aneurysms . \n as the data on the use of ped in vertebrobasilar aneurysms presenting with sah is not robust , clinicians should be careful in extrapolating the excellent outcome following the use of flow diverters in well studied conditions . \n nevertheless , with the increasing use of ped outside more common fda approval indications , apart from demonstrating the efficacy , the clinical relevance of understanding the patterns of failure can not be overemphasized as highlighted in the present case . in conclusion , \n an unusual case of persistent aneurysmal growth following treatment with ped assisted coiling of a fusiform vertebral artery aneurysm is reported . as the use of ped is becoming increasingly common for a number of clinical indications , the mechanism and instances of failure needs to be understood to prevent complications and optimize the use of this newer device . \n we suggest considering an earlier follow up angiography in patients with fusiform aneurysms treated with ped to detect inadequate response to treatment with possible need of subsequent multiple / overlapping ped to increase the chances of successful outcome .", "role": "user" }, { "content": "the complex morphology of vertebrobasilar fusiform aneurysms makes them one of the most challenging lesions treated by neurointerventionists . \n different management strategies in the past included parent vessel occlusion with or without extra - intracranial bypass surgery and endovascular reconstruction by conventional stents . \n use of flow diversion has emerged as a promising alternative option with various studies documenting its efficacy and safety . however , there are various caveats associated with use of flow diversion in patients with fusiform vertibrobasilar aneurysms especially in patients presenting with acute subarachnoid hemorrhage ( sah ) . \n we report a rare case of persistent aneurysmal growth after coiling and placement of the pipeline embolization device ( ped ; ev3 , irvine , california , usa ) for sah from a fusiform vertebral artery aneurysm . as consequences of aneurysm rupture \n can be devastating especially in patients with a prior sah , the clinical relevance of recognizing and understanding such patterns of failure can not be overemphasized as highlighted in the present case .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: nilgai antelope ( boselaphus tragocamelus ) are in the family bovidae and closely related to cattle bos spp . \n they were brought to the united states from india as zoo animals before the mid-1920s and released in south texas around1930 ( leslie and sharma , 2009 ) . by the early 1970s , \n they were distributed in nine texas ( tx ) counties and in northeastern mexico ( presnall , 1958 , sheffield et al . , 1983 , leslie and sharma , 2009 ) . \n however , they have expanded their range in south texas and in some areas there are more nilgai per ha than native ungulates ( mungall and sheffield , 1994 , moczygemba et al . , 2012 ) . \n nilgai have large home ranges with mean year - round ranges for females of 8234 ha ( range = 851 - 31,533 ) and for males of 6626 ha ( range = 733 - 20,864 ) ( foley et al . , in review ) . in comparison , white - tailed deer ( odocoileus virginianus ) , another wildlife host of cattle fever ticks ( cfts ) in southern tx , have much smaller home ranges of approximately 600 ha ( webb et al . , 2008 , hellickson et al . , 2008 ) . \n this behavior has persisted on their introduced range and latrine formation has been observed near offal which are entrails and internal organs disposed of after field dressing harvested nilgai \n . formation of communal latrines may be influenced by the presence of odors such as offal . \n nilgai and white - tailed deer co - exist with cattle in south texas and they are competent hosts for the two cft species rhipicephalus ( boophilus ) microplus and rhipicephalus ( b. ) annulatus , introduced to texas ( perez de leon et al . , 2012 ) . \n cfts transmit an important tick - borne disease , bovine babesiosis caused by babesia ( b. bovis and b. bigemina ) . \n bovine babesiosis was once endemic in the southern united states and caused severe losses to the cattle industry . \n however , the disease and its vectors were eradicated from the united states by 1943 by the u.s . \n department of agriculture - animal and plant health inspection service ( usda - aphis ) , the texas animal health commission and livestock producers , and the cooperation of landowners under the cattle fever tick eradication program . \n presently , the widespread prevalence of cfts in neighboring border states of mexico poses a significant threat to u.s . \n cattle producers . to prevent reintroduction , a quarantine buffer zone between texas and mexico was established ( perez de leon et al . , 2012 , perez de leon et al . , 2014 , giles et al . \n challenges to cft incursion in the permanent quarantine zone along the rio grande river are more frequent ( giles et al . , 2014 ) due to the increased prevalence of cft host species such as nilgai ( cardenas - canales et al . , 2011 ) , white - tailed deer ( kistner and hayes , 1970 ) , stray cattle ( bos spp.),other livestock and from interactions between cft and exotic weeds along the trans - boundary region with mexico which form a pathogenic landscape that facilitates the invasion and survival of cfts ( racelis et al . , 2012 , esteve - gassent et al . , 2014 ) . \n nilgai move widely throughout this environment , are implicated in the spread of cft in south texas , and therefore necessitate the establishment of cft quarantine areas that regulate the movement of cattle and other host animals ( texas animal health commission , 2016 ) . \n methods for control of cfts on white - tailed deer have been developed which use feeders capable of dispensing acaricide treated corn ( pound et al . , 1996 ) . however , there are no known methods to control cfts on nilgai , other than culling , which reduces the density of susceptible hosts ( messenger , 2014 ) . \n the current study investigated the use of potential odor lures to attract nilgai as the first step in designing a treatment program to control cft on nilgai . to increase the probability of trapping success , scent / odor lures are often used as an attractant ( geary , 1984 , mills et al . , 2010 , schlexer , 2008 ) . \n an odor lure is typically a substance that attracts an animal through its sense of smell and is different from bait as it is not intended to be consumed ( schlexer , 2008 ) . \n these lures exploit an animal 's hunger or curiosity , or stimulate social or territorial responses ( wyshinski , 2001 ) . \n lures are typically used to attract target animals into control devices such as traps or pharmaceutical delivery systems . \n odor lures have been used to attract river otters ( lutra canadensis ) , everglades mink ( mustela vison ) to estimate abundance ( humphrey and zinn , 1982 ) , to attract coyotes ( canis latrans ) to traps ( turkowski et al . , 1983 ) , to estimate density of grizzly bears ( ursus arctos horribilis ; romain - bondi et al . , 2004 ) , and for estimation of species distributions ( moruzzi et al . \n , 2002 ) . evaluation of attractiveness and selectivity of potential lures is needed to develop control methods , including acaricide or vaccine delivery systems , for nilgai in the context of vector management of the cft ( martin and fagre , 1988 , mcdaniel et al . , 2000 , \n an efficient way to determine lure selectivity is to combine scent lures with remote trail cameras which are triggered by movement to record animal activity ( moruzzi et al . \n trail cameras offer many advantages for wildlife research including definitive species identification , multiple species detection , and a permanent photo record ( schlexer , 2008 , texas a and agrilife extension , 2009 ) . \n the current study used trail cameras to investigate the effectiveness of potential artificial odor lures in attracting nilgai as compared to offal , which is anecdotally reported to be attractive to nilgai . \n wtd were included in the study because they were commonly encountered in preliminary tests of the lures and are also important wildlife hosts of cft in south texas . \n this study tested the hypothesis that nilgai are attracted equally to offal and synthetic compounds that mimic offal . \n the study was conducted from august to october 2016 on the east foundation 's santa rosa ranch , a 9000 ha ranch located in kenedy county , texas ( 2655n , 9742e ) ( fig . 1 ) . \n the ranch runs a cow - calf operation designed to support wildlife conservation and other public benefits of ranching and private land stewardship . \n nilgai are common and surveys conducted in 2016 reported a population density of 4.5/km ( tc & ao unpublished data ) the ranch is situated in a sub - tropical region which receives an average rainfall of 60 cm of rainfall annually with average daily temperatures ranging from 19 to 27 c . \n the study site is characterized by a dense chaparral honey mesquite ( prosopis glandulosa torr . ) and huisache ( acacia farnesiana ( l. ) willd . ) savannah , and oak woodlands ( quercus virginiana mill.).fig . \n 1the location of the study site ( santa rosa ranch ) near riviera , tx.fig . \n 1 the location of the study site ( santa rosa ranch ) near riviera , tx . four treatment lures were evaluated for their attractiveness to nilgai . \n the study used nilgai offal , a natural odor lure , as a positive control and compared it with three artificial odor lures . \n screwworm lure and volatile fatty acids were chosen because they mimic odors expected to be produced from offal . \n citronella oil was included as a strong organic odor that was unrelated to the smell of offal . \n ten fresh offals consisting of the internal organs and entrails from the thoracic and abdominal cavities of nilgai harvested on the east foundation 's el sauz ranch in willacy co. , texas were collected on june 9 , 2016 . \n the offals were individually packed in large plastic bags and immediately cooled on ice before transportation to the cattle fever tick research laboratory ( cftrl ) , located in edinburg , texas where they were stored at 20 c until further use . during trials , offals were placed into plastic , 20-l lure buckets . in a pilot study , to extend the effectiveness of nilgai offal , caging of offal was tested by placing offal into an iron mesh cage , but attraction was greater when the offal was placed in uncaged buckets where naturally occurring scavengers such as turkey vultures ( cathartes aura ) and coyotes ( canis latrans ) had access . \n feeding and defecation by carnivores was considered to be a natural part of the odor lure and more similar to offal observed by hunters to be attractive to nilgai . \n this lure was developed to mimic rotting flesh to attract the livestock pest , screwworm fly cochliomyia hominivorax ( coquerel ) . \n it was selected for testing because of its strong odor and similarity to the smell of rotting offal . \n the screwworm lure was prepared as per the method of mackley and brown ( 1984 ) with slight modifications . \n briefly , butanol , iso - butanol , and acetic acid ( each 187 ml ) were mixed with butyric acid and pentanoic acid ( 62 ml each ) . \n phenol ( 50 g ) , p - cresol ( 50 g ) , benzoic acid ( 12 g ) and indole ( 12 g ) were added and mixed properly . \n finally , dimethyl disulfide ( 187 ml ) was added and the lure was then aliquoted in 50 ml graduated tubes and stored at room temperature until further use . \n all chemicals for the lure were purchased from sigma - aldrich , usa and formulated at the cftrl , prior to deployment in the field . \n vfa was selected as a treatment because it mimics the smell of entrails , which are part of offal and has a strong odor . \n the vfas in the lure approximated the vfas in the rumen of a bovine heifer and were prepared using methods described by dr . \n the lure mixture contained 100 mm acetic acid , 24 mm propionic acid , 14 mm butyric acid , 1.7 mm valeric acid , 0.2 mm caproic acid , 1.7 mm iso - butyric acid , 1.2 mm 2-methyl - butyric acid and 1.2 mm iso - valeric acid . \n lure was formulated at the cftrl , and stored in an amber glass bottle at room temperature prior to deployment in the field . \n citronella oil was selected because it produces a pungent and long - lasting odor , especially under higher temperatures . \n it does not mimic offal , so this treatment tests the hypothesis that nilgai are generally attracted to strong odors other than offal . \n it is derived from cymbopogon spp . , ( lemongrass ) , which is a native to india throughout the range of nilgai . \n the oil was purchased from sigma - aldrich , usa and stored at the cftrl , prior to deployment in the field . \n four treatments of nilgai offal ( control ) , screw worm lure , vfa , and citronella oil were established on each of ten transects at the east foundation 's santa rosa ranch ( kenedy co. , tx ) . \n random points 1 km apart were established within the study site and used as the beginning of transects oriented ne to sw to be perpendicular to the prevailing se wind to avoid mixing of the odor plumes . \n each transect was marked at four points at 0 , 100 , 200 , and 300 m to deploy the four lures ( fig . \n 2locations of nilgai lure transects ( red bars ) at the santa rosa ranch near riviera , tx . \n ( for interpretation of the references to colour in this figure legend , the reader is referred to the web version of this article.)fig . \n 2 locations of nilgai lure transects ( red bars ) at the santa rosa ranch near riviera , tx . \n ( for interpretation of the references to colour in this figure legend , the reader is referred to the web version of this article . ) at each site in each transect a plastic 20 l bucket was recessed in hole ( 0.5 m deep ) so that the vent openings were level with the soil surface ( at the conclusion of study , buckets were removed for disposal ) ( fig . \n four moultrie a-5 trail cameras ( gen2 ; model : mcg-12688 ) with motion sensors and 12-led near - infrared flash with a 15 m range to get clear pictures even at night were mounted on wooden stakes at approximately 1 m height around the bucket on each site . \n cameras were placed strategically within a 15 m radius of the lure , keeping in view the direction of wind flow and existing animal trails to cover all areas . \n vegetation in front of the cameras was removed to reduce the occurrence of vegetation triggering the camera 's motion detector . \n cameras were set to take three pictures per triggering event to capture the animal 's direction of travel or identify unique individuals . \n 3lure bucket recessed into soil at each treatment location at the santa rosa ranch.fig . \n 3 lure bucket recessed into soil at each treatment location at the santa rosa ranch . \n the partially thawed offal was placed over the bucket and allowed to settle into the bucket . at the artificial lure sites , \n for screwworm lure sites , an additional screw cap vial fitted with a dental wick ( richmond dental & medical , charlotte , nc ) and 50 ml of lure was added to the bucket . \n the vial with dental wick was developed to extend the life of the screwworm lure given its high rate of volatility in warm weather , which was not an issue with the other lures , due to their composition . \n memory cards of all cameras were replaced after two weeks in order to continue data collection . \n the study was carried out in two phases starting aug . 8-sept . 6 and sept . \n . attraction to lures was recorded by visitation to sites determined by examination of digital images . \n the number of visits by animals to each lure was tabulated by species and transect . \n in some cases there were multiple pictures of the same animal during a short period of time . in these cases \n we modeled separately the number of nilgai and wtd visits to each lure assuming a negative binomial distribution with a log link function in the glimmix procedure of sas 9.3 ( sas , 2012 ) . \n a total of 214 target animal visits were captured at all lures of the ten transects consisting of 110 nilgai and 104 wtd . additionally , cattle ( bos taurus x indicus ) were documented visiting some of the transects . other non - target animas including coyotes , raccoons ( procyon lotor ) opossums ( didelphis virginiana ) feral pigs ( sus scrofa ) and turkey vultures ( cathartes aura ) \n among the ten transects deployed for the study , the number of visits of animals varied ( p > 0.05 ) among the various transects over the course of the study . \n number of visits of all animals averaged 21.4 5.48 per transect ( range = 357 ) , whereas nilgai averaged 11.0 4.27 visits / transect ( range 146 ) and wtd averaged 10.4 3.13 visits / transect range ( 030 ) . the offal lure used as a positive control received 102 total visits ( 78 nilgai , 24 wtd ) followed by screwworm lure with 48 visits ( 16 nilgai , 32 wtd ) . \n vfa and citronella oil lures received 32 visits each ( table 1 , fig . \n 71% of nilgai attracted to all lures during the study and was significantly greater ( p < 0.05 ) than the other lures for nilgai ( fig . \n there was no significant difference in visitation of lure sites between the screwworm and vfa ( table 1 ) . \n however we only documented nilgai defecating at the offal and screwworm lure sites ( fig . \n were to the screwworm lure although there was no significant difference between treatments ( fig . \n 4c).fig . 4distribution of animal visits to lure sites at the santa rosa ranch , near riviera , tx.fig . \n 4fig . 5nilgai cow visiting lure site ( a ) and ( b ) nilgai bull defecating at offal lure site at the east foundation 's santa rosa ranch , near riviera , tx.fig . \n 5table 1lure wise visits of animals on all transect at the east foundation 's santa rosa ranch , near riviera , tx.table 1luretotal animal no . \n ( mean se)offal ( control)102 ( 10.2 4.38)78 ( 7.8 3.87)24 ( 2.4 1.18)sw48 ( 4.8 1.76)16 ( 1.6 0.42)32 ( 3.2 1.68)vfa32 ( 3.2 1.25)12 ( 1.2 0.51)20 ( 2.0 1.11)citronella32 ( 3.2 1.20)4 ( 0.4 0.16)28 ( 2.8 1.18)*letters in each column represent a significant difference . \n distribution of animal visits to lure sites at the santa rosa ranch , near riviera , tx . \n nilgai cow visiting lure site ( a ) and ( b ) nilgai bull defecating at offal lure site at the east foundation 's santa rosa ranch , near riviera , tx . \n lure wise visits of animals on all transect at the east foundation 's santa rosa ranch , near riviera , tx . \n after their initial release in the 1930s , the population and distribution of nilgai in south texas have increased despite year - round hunting without regulations . \n nilgai habitat in south texas grasslands is similar to their native range in india . in india , nilgai generally avoid dense forest and prefer level or undulating plains covered with grass and patches of scrubs ( sankar et al . , 2004 ) which is characteristic of the south texas plains . in india , \n there are also several large predators including tigers , ( panthera tigris ) ; lions , ( panthera leo ) ; leopards , ( panthera pardus ) ; wolves , ( canis lupus ) ; and striped hyenas , ( hyaena hyaena ) ; that effect their survival , reproduction and behavior . in texas , \n nilgai distribution is likely to increase over time given the favorable local conditions and relocation of animals for hunting purposes . \n this may further complicate the negative interactions nilgai have with cattle production and overall success of cft eradication . \n further , a recent research study from south texas revealed wide - ranging movements in nilgai with mean year - round home range sizes were similar between sexes but highly variable between females ( 8234 ha , range = 851 - 31,533 ) and males ( 6626 ha , range = 733 - 20,864 ) ( foley et al . \n this underscores associated risks of nilgai moving cfts large distances throughout the temporary cattle fever tick preventative quarantine areas in eastern cameron and willacy counties in texas and to the north ( texas animal health commission , 2016 ) . \n therefore , developing a lure and delivery system for cft control measures on nilgai is critical to the eradication program to prevent spread of this livestock disease vector in south texas and beyond . \n further , data on wtd attraction towards the employed lures were included as they also serve as an alternate host of cft ( kistner and hayes , 1970 ) and are involved in its spread . even though , the offal lure attracted significantly more nilgai in our study , the screwworm lure was the only other lure to induce defecation and possible latrine formation . \n it is possible that higher doses of screw worm lure could improve attraction to a level more similar to offal . \n the screwworm lure in buckets has been informally tested by usda wildlife services and it improved the efficiency of ground harvesting of nilgai ( david trevino , personal communication ) . \n future tests should focus on higher rates of the screwworm lure and use the numbers of nilgai visitations at offal sites as a benchmark for a successful lure . \n use of offal is logistically difficult and may not be feasible for wide spread deployment as a lure for cft control on nilgai . \n other natural lures including extracts of plant compounds from species in the native range of nilgai in india should be investigated . \n nilgai are known to be attracted to the fresh flowers of the mahua tree ( madhuca longifolia ) in india ( ns , personal communication ) . \n although this plant species does not occur in the u.s . , the volatile odor compound , jasmonic acid has been isolated from this plant and should be investigated as a lure . \n other nilgai attractants may be known from traditional observation in india and could be gathered through written and oral surveys . \n these surveys could also reveal compounds or plant materials that could be used as baits . \n these baits could be medicated with acaricides for cft control in a similar way to corn feeders , which have been utilized in the past for cft control on wtd ( pound et al . , 1996 ) . \n future studies should investigate both lures and baits as potential control options for cft on nilgai . \n this study focused on the attraction of nilgai to a central location where they could be potentially be treated for cft control . \n it is possible that an effective acaricide or vaccine delivery system could be used in the vicinity directly existing latrines where the local nilgai population is already gathering . \n more research is needed on nilgai latrine ecology to determine if they could function as a lure site for treatment of cfts . \n it may also be possible to combine lures with latrines to get maximum attraction of nilgai in a local area . \n considering the serious challenges of controlling cfts on nilgai , development of methods to use artificial lures and existing latrines as lures is critically needed towards designing a delivery system for acaricides / vaccines for these animals in their natural habitat . \n a lure and delivery system would eliminate the present hurdle of capturing and restraining of these animals for the administration of these acaricides / vaccines . \n future studies are also needed to improve the attractiveness of artificial lures which mimic offal or specific food items that are known to be attractive to nilgai . ultimately , a strategy to effectively attract and control the cft on nilgai could potentially replace aerial and ground harvesting efforts to safeguard texas and u.s .", "role": "user" }, { "content": "cattle fever ticks ( cft ) , vectors of bovine babesiosis and anaplasmosis , were eradicated from the united states by 1943 , but are frequently reintroduced from neighboring border states of mexico via stray cattle and wildlife hosts including white - tailed deer ( odocoileus virginianus ) ( wtd ) and nilgai antelope ( boselaphus tragocamelus ) . \n nilgai antelope are exotic bovids from india that are hosts of cft , have large home ranges as compared to wtd , thus have the potential to spread cft through the landscape . currently , there are no methods to control cft on nilgai . \n odor lures were evaluated to determine if nilgai could be attracted to a central point for development of control methods . \n four treatments , nilgai offal a natural odor lure was used as the positive control ; and compared to three artificial odors ; screw worm lure , volatile fatty acids , citronella oil . \n studies were conducted on a free - ranging population of nilgai at the east foundation 's santa rosa ranch ( kenedy co. , near riviera , texas , usa ) . \n game cameras were used to document visitation to the lures . \n in the ten randomly placed transects , 110 nilgai and 104 wtd were photographed . \n offal had significantly more visits by nilgai ( 71% of total visits ) than screwworm ( 15% ) , vfa ( 11% ) , and citronella ( 4% ) . for wtd \n , there was no significant difference in visitation at the lure treatments .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: capsule endoscopy ( ce ) is increasingly used for the evaluation of small bowel disease . \n the ease of use and patient tolerance of ce has made it popular among gastroenterologists and patients . \n currently , ce is most commonly used to identify the origin of obscure gastrointestinal bleeding , but its indications are broadening . \n various reports have described impaction or retention of the capsule in the small bowel that required retrieval . despite the low risk of complications , \n capsule retention may reveal the underlying cause of the gastrointestinal disease , but can cause acute intestinal obstruction and perforation requiring surgery . here , we describe a case of retained capsule that was retrieved with single incision laparoscopic surgery ( sils ) . \n a 43-year - old man with no past medical history presented to our hospital for investigation of anemia and a positive fecal occult blood test . \n the small bowel was therefore examined using ce ( pillcam sb2 , given imaging , yokneam , israel ) . \n the patient was unable to pass the capsule more than 2 weeks after ingestion but did not have pain or symptoms of bowel obstruction . \n abdominal x - ray showed the retained capsule in the right side of the abdomen , and an abdominal ct revealed the capsule in the small bowel . to confirm the diagnosis and retrieve the capsule , enteroscopy with a double - balloon enteroscope ( en-450t5/w , fujifilm , tokyo , japan ) \n the double - balloon enteroscopy revealed a circumferential stricture with an ulcer and giant diverticulum in the small intestine 2 m proximal to the ileocecal valve ( fig . \n we performed bougie dilatation for the stricture , but the enteroscope was unable to move past the stricture . \n small bowel contrast imaging using gastrografin at the time of ce revealed two more strictures at the anal side . \n as it was impossible to retrieve the retained capsule using an enteroscope , sils was performed to resect the small bowel containing the ce and stricture after obtaining written informed consent from the patient . \n an ez access ( hakko medical , nagano , japan ) was placed around the umbilical incision . a 12-mm camera port ( xcel trocar , ethicon endo - surgery , inc . \n , cincinnati , ohio , usa ) and two 5-mm trocars ( yelloport , surgical innovations , leeds , uk ) were inserted through the ez access . \n a pneumoperitoneum with a pressure of 10 mm hg was created and a 10-mm rigid 30-degree laparoscope ( karl storz endoscopy , tuttlingen , germany ) was used . \n laparoscopy revealed an edematous bowel with erythema 2 m proximal to the ileocecal valve where the stricture was presumably located , and the tattoo of the small bowel was identified ( fig . \n after the trocars and the lap protector had been removed , the affected small bowel was brought outside the abdomen and resected ( fig . \n a functional end - to - end anastomosis was performed using a gia stapler with a 80 - 3.8 cartridge ( covidien , mansfield , mass . \n the anastomosis , without signs of bleeding , was then pushed back into the abdomen and the incision was closed ( fig . 2c ) . \n the histopathological diagnosis was crohn 's disease with ulcer and stricture of the ileal segment ( fig . \n the patient 's recovery was uneventful and he was discharged home on postoperative day 8 . \n ce has become an important modality in the evaluation of small bowel disease since its introduction by iddan et al . in 1999 . \n the advantages of ce include noninvasiveness , simplicity and safety , but the possibility of ce retention exists . \n capsule retention was defined by the international conference on capsule endoscopy ( icce ) in 2005 as the presence of a capsule in the digestive tract for at least 2 weeks or requiring directed medical , endoscopic or surgical intervention . \n the rate of capsule retention is variable and is influenced by the clinical indication for ce [ 4 , 5 ] . \n the reported rates were 0% in healthy individuals , 1.4% in patients with obscure gastrointestinal bleeding , 513% in those with suspected crohn 's disease and 21% in patients with intestinal obstruction . \n of 22,840 procedures identified in a systematic review of both prospective and retrospective studies by liao et al . \n , 184 capsule retentions occurred , resulting in a pooled retention rate of 1.4% , with 1.2 , 2.6 and 2.1% occurring in cases with obscure gastrointestinal bleeding , crohn 's disease and neoplastic lesions , respectively . \n other causes of retention were nonsteroidal anti - inflammatory drug - induced enteropathy , postoperative stenosis , adhesions , tuberculosis , ischemia and radiation enteritis . our patient was originally investigated for obscure gastrointestinal bleeding and had no symptoms of bowel obstruction . \n no methods exist , including imaging studies , that can predict the occurrence of capsule retention . \n capsule retention indicates the presence of underlying pathology and thus helps in identifying the etiology and site of obstruction . \n the longest duration of retention reported by the icce is 2.5 years , but sequelae associated with long - term capsule retention were not reported . \n some reports advocated surgical intervention that allows removal of both the capsule and the pathology that caused the capsule retention [ 5 , 6 ] . in a systematic review of 184 capsule retentions by liao \n retained capsules were recovered through spontaneous excretion or by pharmaceutical intervention in 15% , endoscopically in 12% and surgically in 58.7% of cases . \n endoscopic retrieval and extraction by push - and - pull enteroscopy using the double - balloon technique have been reported , but subsequent surgical retrieval is often required because of the underlying pathology that caused the stricture or obstruction . \n most cases of surgical retrieval were laparotomies despite the benign nature of the diseases that caused the ce retention . \n however , surgeons should quickly convert the procedure to laparotomy or add ports to avoid complications that arise due to technical difficulties in sils . \n successful outcomes can be expected in patients with retained capsules if the principles of safe laparoscopic surgery , including stringent patient selection , are followed . \n ", "role": "user" }, { "content": "capsule endoscopy ( ce ) is commonly used for examining and diagnosing gastrointestinal disease , especially small bowel disease . \n capsule retention is a well - known and significant complication of ce and requires surgical or endoscopic removal . \n most reports described the retrieval of retained ce via laparotomy . \n we report a case of successful retrieval of the capsule using single incision laparoscopic surgery .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: malaria is the most important parasitic disease and half of the world s population is under the risk of being infected with the diseases ( 1 ) . \n the infection is still the most important mosquito - borne disease in iran and one of the major health problems especially in the south and southeast parts including sistan and baluchistan , hormozgan and kerman provinces ( 2 ) . \n four species of plasmodium are responsible for causing human malaria : p. falciparum , p. vivax , p. malariae , and p. ovale ( 3 ) . \n plasmodium vivax is the most widespread species of plasmodium in humans and causing about 80 million clinical cases annually . \n vivax infections are rarely mortal but it can causes very debilitating illness ( 5 ) . \n its clinical characteristics are not enough for an accurate diagnosis , since they are shared by other occurring infections , such as typhoid , visceral leishmaniasis and tuberculosis ( 6 ) . \n the laboratory diagnosis of p. vivax infections usually depends on the microscopic examination of giemsa - stained thick and thin blood smears , immunochromatographic tests , and serological methods ( 7 - 9 ) . \n these methods provide a cost effective , rapid diagnostic tool which can easily be used in the field ( 10 ) . \n nonetheless , these methods are subject to misdiagnosis particularly in the cases of mixed cases and low level parasitemia ( 7 , 11 - 13 ) . \n polymerase chain reaction ( pcr ) as a dna - based molecular detection method is more sensitive than microscopy , and is now being used widely in the field of malaria diagnosis ( 10 , 14 , 15 ) . the real - time pcr produces fast results with very little contamination risks , a high sensitivity and specificity , and the possibility of quantification , but is relatively expensive and needs more competent employees ( 16 - 18 ) . \n nowadays many studies have shown the important role of asymptomatic carriers of malaria as a major reservoir of parasites and maintenance of high levels of transmission ( 19 , 20 , 21 ) . \n even a few number of carriers are able to infect the anopheles and maintenance of the disease ( 19 ) . in order to better understanding and evaluating the epidemiology of malaria in hormozgan province \n this study was undertaken to detect p. vivax in asymptomatic treated vivax malaria patients to trace latent / sub - patent malaria infection . in the study both microscopic examining of blood films and nested - pcr method are used . \n in this study , the venous blood of all detected cases with p. vivax in bashagard , minab and roodan districts in hormozgan province from 2009 to 2010 was examined . totally , 240 blood specimens from asymptomatic treated individuals during 2009 to 2010 were collected . \n thick and thin blood smears were prepared in field laboratories and the thin film was fixed using methanol . \n all slides were stained with 10% giemsa and examined with oil immersion ( x1000 ) for detecting malaria parasites by a trained microscopist and rechecked by experienced microscopists at the malaria central laboratory of minab district . \n approximately 1000 l of venous blood was collected in edta , stored at -20 c and then transported to the molecular laboratory of parasitology department of tabriz medical college for pcr method ( 10 ) . \n dna was extracted by q1amp dna blood mini kit 50 ( qiagen , city name , germany ) according to the instructions . \n all samples were assessed using plasmodium genus specific ( primary pcr ) and p. vivax / p. \n falciparum species - specific primers for the ssrrna gene by nested pcr method ( 10 ) . \n primers for plasmodium genus : fplu:5'-ctt gtt gtt gcc tta aac ttc-3rplu:5'-taa aaa ttg ttg cag tta cg-3 \n fplu:5'-ctt gtt gtt gcc tta aac ttc-3 rplu:5'-taa aaa ttg ttg cag tta cg-3 primers for p.falciparum ( as p. falciparum positive control ) ( 205bp):ffal:5'-tta acc tgg ttt ggg aaa acc aaa tat att-3rfal:5'-aca caa tga act caa tca tga cta ccc gtc-3 \n ffal:5'-tta acc tgg ttt ggg aaa acc aaa tat att-3 rfal:5'-aca caa tga act caa tca tga cta ccc gtc-3 primers for p.viax ( 120bp):fviv:55'-cgc ttc tag ctt aat cca cat aaa tga tac-3rviv:55'-act tcc aag ccg aag caa aga aag tcc tta-3 \n fviv:55'-cgc ttc tag ctt aat cca cat aaa tga tac-3 rviv:55'-act tcc aag ccg aag caa aga aag tcc tta-3 the thermo cycling condition were initial denaturaation of dna at 94 c for 3min , followed by 30 cycles of 94 c for 60 s , 56 c for 2min , and 68 c for 2.5min . \n these steps were followed by an additional primer extension step of 7min at 72 c . to make it visible and weigh the amplified dna , \n 10 l of pcr product was applied on 1.7% agarose gel under 100v electric field for 45minutes . \n the gel then was immersed in ethidium bromide 0.5 g / ml for 10minutes and after being washed by deionized distilled water , was observed and analyzed by using transilluminator ( 450 nm uv ) . \n positive cases with at least 400 parasites in l blood ( from malaria laboratory of minab district and malaria laboratory in tehran university of medical sciences - school of public health ) were used as positive control , and the samples of non - infected individuals and those with p. falciparum were used as negative control . \n totally 240 individuals with a history of vivax malaria treated a year earlier , were involved in this study , including 194 , 31 and 15 individuals from bashagard , minab and roodan districts , respectively . in microscopic examination of peripheral blood smears , \n but , we detected two plasmodium vivax related bands in the electrophoresis of the nested pcr products ( 120bp ) . \n in recent years , the economy of 4 malaria endemic provinces in iran ( sistan and baluchestan , kerman , bushehr and hormozgan ) has suffered a substantial loss during malaria epidemics , and malaria control activities imposed heavy expenses to the socio - economic developmental programs ( 22 ) . in this situation one of the major challenges \n is detecting of asymptomatic infection which is not detectable by routine tests due to the lack of malaria symptoms and having low levels of parasitaemia . \n so , these patients become gametocyte carriers and have a key role in continuing disease transmission that might combat the malaria elimination program ( 23 - 25 ) . considering the challenge of asymptomatic malaria in the elimination program , \n the aim of this study was to detect p. vivax in asymptomatic treated patients to trace latent / sub - patent malaria infections . in this study \n many studies have recently shown the importance of asymptomatic malaria carriers as the parasite reservoir and the transition of the disease . in a study , conducted in 2009 on 38 individuals with a history of vivax malaria in a year before \n , no infection was detected among studied individuals by microscopic examination of thick and thin blood smears but one of the samples was identified as p. vivax infection by nested - pcr method ( 26 ) . in an investigation on 500 symptomless individuals randomly selected in hormozgan province to evaluate \n the presence of plasmodium infection using elisa method , 1% of the studied population ( 5 of 500 ) was positive and had high igg antibody titer , although no cases of infection with plasmodium were found by parasitological and molecular methods ( 25 ) . among 120 volunteer patients in chabahar , \n iran , that were investigated by microscopic examination and pcr methods , 107 cases were positive for malaria by both methods and 13 out of 120 were negative by microscopy of which 9 cases reported positive using pcr . \n the result also showed 3 cases as having mix infection of p. vivax and p. falciparum by microscopy and 34 mix positive cases by nested pcr method ( 27 ) . \n the present study was performed in hormozgan province which is one of the main malaria endemic regions in iran . to increase the accuracy and reliability of the results , \n microscopic and molecular techniques were simultaneously used to detect plasmodium parasite among studied cases as asymptomatic carrier . \n microscopic technique was used as a gold standard and nested - pcr as a sensitive and specific method for asymptomatic malaria diagnosis which can detect low parasite densities ( 28 ) . \n detection of malaria species and correct treatment can reduce the number of malaria - infected individuals who carry the parasites and may thus reduce the risk of re - introducing of malaria into other parts of the country , outside the province , where an interruption of transmission had been earlier achieved . \n nested pcr detection of malaria can be a helpful complement to microscopic test , as a gold standard method , to obtain the real prevalence of each species and also for the follow - up of the patients after specific treatment . \n , 2008 , carried out a study on 212 symptomatic patients by microscopic examination of blood smears on day 0 , 14 and 28 and nested pcr technique . \n the pcr method has had also remarkable advantages in detection of mix infections of malaria . in iran , afghanistan and pakistan , both nested pcr and microscopic examination applied for detection of mix infection of p. vivax and p. falciparum . \n the result showed 0%-2.5% mix infection by microscopy and 22% , 65% and 23% in iran , afghanistan and pakistan , respectively , using nested pcr ( 30 ) . \n there are many reports on the use of molecular techniques for confirmation of diagnosis , epidemiological studies and drug efficacy assessment of malaria ( 2,31 - 33 ) . \n application of pcr methods for the detection of low density of malaria parasites and mixed infections has been demonstrated repeatedly ( 2 ) . wherever malaria elimination program is implemented \n furthermore , the relapsing cases caused by the activation of hypnozoites in the liver 2 - 3 years after the initial infection eventually could threaten the progress of the program . \n each of these items can establish transmission of the disease and returning malaria outbreaks in population with relatively low level of acquired immunity ( 2 ) . \n we could detect two asymptomatic carriers in individuals with a history of vivax malaria treatment at least one year before participation in the study . \n this finding can have a significant impact on the adoption of best practices and removing of asymptomatic carriers of malaria parasites in elimination program of the country . in a study conducted in afghani immigrants without malaria symptoms and signs in southeastern iran by conventional light microscopy , \n 1.6% of subjects demonstrated p. vivax in their peripheral blood thick smear ( 34 ) . \n asymptomatic carriers could be due to reasons such as drug resistance , latent forms of the parasite or re - infection . \n determination of each of these items requires detailed epidemiological and molecular follow - up of the cases in the time of onset of the disease . \n unfortunately , due to the long time elapsed from the onset of the disease there was not any possibility for us to further follow up the cases . \n but , regardless of the causes , this phenomenon has a decisive role in the success of malaria elimination program in iran and can be a potential risk for development of outbreaks of malaria . molecular detection of malaria can be a helpful complementary test to microscopic examination for correct diagnosis of the disease and for the follow - up of patients after specific treatment ( 2 ) . \n it seems that detection of malaria reservoirs by molecular methods should be included in the list of major priorities of the malaria elimination program in iran . \n following up the malaria cases after treatment by a combination of methods , or new diagnostics such as rdts ( rapid diagnostic tests ) , can be included in the priorities of malaria elimination program in iran .", "role": "user" }, { "content": "backgroundplasmodium vivax is the most widespread species of plasmodium in humans and causing about 80 million clinical cases annually . \n this study was undertaken to detect p. vivax in asymptomatic treated vivax malaria patients to trace latent / sub - patent malaria infection.methodthe venous blood of all detected cases with p. vivax in bashagard , minab and roodan districts in hormozgan province from 2009 to 2010 was examined by microscopic and nested pcr methods for presence of the parasite.resultsin microscopic examination of peripheral blood smears , all samples were negative for the presence of the parasites . \n but , we detected two p. vivax related bands in the electrophoresis of the nested pcr products ( 120 bp).conclusionfollowing up the malaria cases after treatment by a combination of methods , or new diagnostics such as rdts can be included in the priorities of malaria elimination program in iran .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cutaneous collagenous vasculopathy ( ccv ) is a distinct and rare cutaneous microangiopathy affecting the superficial dermal blood vessels . \n these patients present with asymptomatic blanchable pink or red macules , telangiectasia , or petechiae distributed symmetrically on bilateral lower extremities with progressive involvement of the upper extremities and trunk . \n the comorbidities frequently associated in these patients are diabetes mellitus , hyperlipidemia , hypertriglyceridemia , and hypertension . \n this condition remains largely underdiagnosed and is commonly mistaken for pigmented purpuric dermatosis or generalized essential telengiectasias . \n a 50-year - old female presented with asymptomatic rash on the lower extremities since 2 years . \n cutaneous examination revealed erythematous to hyperpigmented nonblanchable , nontender macules and petechial lesions over both the lower extremities [ figure 1 ] . \n there was a history of diabetes mellitus in the patient for which she was currently not on any medications . \n nonblanchable macules and petechiae on lower extremity skin biopsy from the erythematous macule showed vasculopathy involving the small vessels of the superficial plexus . \n the affected vessels showed abundant pink collagenous deposit in the wall and moderately dense lymphocytic infiltrate around them [ figures 2 and 3 ] . \n the collagenous deposits in the vessel walls were periodic acid schiff ( pas ) positive [ figure 4 ] . \n the case was diagnosed as cutaneous collagenous vasculopathy ( ccv ) . dilated superficial vessels with pinkish hyaline deposit in the vessel wall . \n ( hematoxylin and eosin 100 ) dilated superficial vessels with pink hyaline deposit in the vessel wall . \n ( hematoxylin and eosin 400 ) pas positive hyaline deposit in the vessel wall . ( periodic acid schiff 400 ) \n the first case of cutaneous collagenous vasculopathy presenting with asymptomatic telangiectases was described by salama and rosenthal in the year 2000 . \n the occurrence of microangiopathy in diabetes mellitus could possibly contribute to the development of ccv . \n another hypothesis is that ccv may be caused by a genetic defect in collagen synthesis . \n the comorbidities seen in patients with ccv were diabetes mellitus , hypertension , hyperlipidemia , hypothyroidism , and venous insufficiency . \n clinically , the most common presentation was in the form of asymptomatic bilaterally symmetrical progressive telangiectases on lower extremities with gradual progression to upper extremities and rarely the trunk . \n other clinical morphologies described were discrete dark pink blanchable macules , petechiae , red macules , and ecchymosis in one patient . the patient described in this report had erythematous , petechial lesions , and nonblanching macules . \n histologically , ccv is characterized by dilated and thickened superficial dermal vessels with flat endothelial cells and the vessel wall containing hyaline material . \n there is paucity of inflammation and the vessel walls show no sign of damage by inflammatory cells . \n the hyaline material of the thickened walls is highlighted by immunohistochemistry for laminin and type iv collagen but not with elastic stains , which indicates it is a derivative of the basement membrane collagen and is the result of reduplication and splitting of the basement membrane zone surrounding small vessels . \n histopathologically , ccv may be misdiagnosed as telangiectasia ( dilated capillaries without inflammatory infiltrate ) , livedoid vasculopathy ( deposits of fibrin in the dermal vessels without significant inflammatory infiltrate ) or cutaneous small vessel vasculitis ( leukocytoclasia , damage to the vascular endothelium with fibrin deposition ) . \n other conditions showing hyaline material in the vessel walls are lipoid proteinosis ( hyaline material around the eccrine gland with atrophy of the glands ) , porphyrias ( subepidermal blister ) , pseudoporphyrias ( subepidermal blister ) , secondary amyloidosis ( hyaline material in papillary dermis and subcutaneous tissue with congo - red positivity ) , and thrombotic vasculopathy ( occlusion of the lumen by the thrombus and hemorrhage . ) \n luse bodies representing collagen fibers with abnormally long spaces between electron - dense bands . \n however , it is proposed that vascular damage is followed by repair leading to a defect in collagen formation and abnormal disorganized collagen deposition in the cutaneous blood vessel wall . \n the current report emphasizes the need for awareness of this condition and its clinical and histological mimicks . \n \n ", "role": "user" }, { "content": "cutaneous collagenous vasculopathy ( ccv ) is a distinct , rare , and underdiagnosed condition . \n we report a case of ccv in a 50-year - old woman presenting as asymptomatic , erythematous to hyperpigmented nonblanchable macules over both the lower extremities . \n the clinical differential diagnosis of the lesions was pigmented purpuric dermatoses ( schamberg 's purpura ) and cutaneous small vessel vasculitis . \n histology of the lesions revealed dilated superficial dermal vessels with abundant pink hyaline material in the vessel wall , which stained with periodic acid schiff stain . \n the patient was diagnosed as ccv . \n this condition remains largely underdiagnosed and is commonly mistaken for pigmented purpuric dermatosis or generalized essential telangiectasia . \n emphasis on the differentiation of ccv from its clinical and histological mimicks is made .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: nowadays , various musculoskeletal disorders ( msds ) occur among the people of different occupations and populations . among the different occupational groups , nurses experience higher occupational stress , as msds are more prevalent in the staff in hospital environments . due to the nature of their work , nurses are exposed to a higher risk of fatigue and diseases , especially msds . \n although these disorders occur in various parts of the body such as neck , arm , wrist , and waist , low back pain is more prevalent . \n research shows that many nurses permanently or temporarily leave their work on having such disorders . on the other hand \n , it was reported that physical and psychosocial needs can be a reason for a job change among those working in the field of health . \n one of the major problems in prevention of work - related msds is their multifactorial nature including physical , organizational , psychosocial , personal , and cultural factors . \n meanwhile , hospital staff , in addition to the physical needs associated with patients transfer , are often exposed to other related factors including psychological needs , official disputes , pressure of time , lack of social support , conflicting needs , loss of work speed control , etc . \n these factors are usually referred to as psycho - social or psychological factors which lead to staff 's cognitive disorders through their effect on their mental resources . \n epidemiological studies have detected these factors , in combination with physical activities , as the risk factors for neck pain . \n on the other hand , working conditions in health care environments necessitate exposure to a combination of physical and psychological needs . \n cognitive disorders , which result in psychological stress , increase the biomechanical response of musculoskeletal system to physical factors , which may enhance the risk of such msds among nurses . in addition , work overload was detected as an important issue among health care and treatment staff , especially in intensive care units . \n work overload is counted as one of the most important occupational stressors , as reported by nurses . \n it can indirectly affect patients safety due to causing a reduction in job satisfaction and motivation and an increase in staff 's burnout , as well as having negative effects on communication . despite the importance of the issue \n , few studies have been conducted to investigate in depth the psycho - social risk factors associated with the msds in nurses . \n therefore , the association between msds and the existing risk factors among nurses should be studied more deeply . \n this study aimed to investigate and define the relationship between mental workload and msds among the nurses working in alzahra hospital . \n it is hoped that the obtained results can form the required background to evaluate various dimensions of psychological workload among nursing staff and lead to a macro - ergonomic intervention to redesign the nursing work environment to increase the efficiency and efficacy of nurses activities in hospitals . \n they can also help the managers and health care decision makers to reduce staff 's psychological workload , control the psycho - social factors and their outcomes in nursing profession , prevent and reduce prevalence of msds , increase patients safety level and satisfaction from nursing services , and ultimately increase efficiency among the nurses and hospitals . \n this is a descriptive cross - sectional study conducted in alzahra university hospital in isfahan , iran in 2013 . \n this hospital was selected due to its high number of personnel as well as having various wards and treatment activities . \n firstly , 247 subjects were randomly selected through a systematic random sampling from the list of all nurses working in alzahra hospital . \n after selection of the subjects , necessary coordination was made with the hospital manager . before completion of an anonymous questionnaire , subjects gave their consent to participate in the research . \n if any of the selected nurses was excluded due to any reason ( absence , loss of interest to attend the study , etc . ) , she / he was replaced by the next staff in the list . \n all volunteers were examined by a specialist of physical medicine before being selected as a subject and attending the research , and those with vertebral fractures , kyphosis , lordosis , scoliosis , intervertebral disk rapture , and hernia and other diagnosed acute msds were excluded from the study . \n inclusion criteria were work experience of more than 1 year and staff 's permanent , contract , and casual employment status . in the present study \n , both goals of the study ( mental workload and prevalence of msds ) were investigated using the national aeronautics and space administration task load index ( nasa - tlx ) and the cornell musculoskeletal discomfort questionnaire ( cmdq ) . \n nasa - tlx is a tool used to investigate the mental workload and was designed by the human factors engineers in nasa . \n this tool was suggested after 3 years of extensive research on the physical and mental activities in various occupations in over 40 simulation laboratories . \n this index is a multidimensional process with various evaluation degrees , which provides a self - evaluation model to estimate mental workload through use of six scales . \n the tlx model includes three dimensions of imposed demands to an operator during working ( physical , mental , and temporal loads ) and three factors associated with the outcome of the work ( person 's performance , level of effort , and level of frustration ) . \n the process of mental workload evaluation through nasa - tlx involves three stages . at the first stage , weight in each of the six scales is determined to reveal the priority of the six scales of tlx . at this stage , \n all scales are self - evaluated and selected by the staff in a paired form and in 15 different positions , and then , each workload dimension is scored 0 - 1 . at the second stage , to allocate the rating of workload , each of the six scales is rated with the goal of determination of each scale 's effect on the mental wor kload . at this stage , the respondent or participant scores each of these six dimensions from 0 to 100 based on his / her own working condition . at the third and the last stage , after determination of weight and rating in previous stages , \n total workload is calculated in the range 0 - 100 through the following formula : total workload = rating weight/15 . \n the research conducted on nurses showed that nasa - tlx had a high correlation with other methods of mental workload evaluation . in a study conducted for the evaluation of nurses mental workload in the intensive care unit ( icu ) in isfahan , \n this questionnaire is a data collecting tool for musculoskeletal discomfort data , which was designed by professor alen hedge et al . in 1999 \n this questionnaire has been designed in three stages of discomfort frequency , discomfort severity , and the effect on capacity for work in the latest working week . \n it has the map of body and 12 parts , which totally analyzes 20 sections of the body . \n mean discomfort frequency for 12 body parts is calculated as the score of msds [ figure 1 ] . \n this questionnaire is used in the usa and other countries as a valuable tool to investigate the level of musculoskeletal discomfort . \n its validity and reliability were estimated by cronbach alpha = 0.986 . to investigate some of the demographic characteristics of the subjects , age , sex , height , weight , \n wo rk experience , related ward , working shift , and body mass index ( bmi ) were added to this tool . \n the collected data were analyzed by spss 20 . to calculate and define the condition of investigated indexes , descriptive statistical tests and tables were used . to investigate the association between mental workload and musculoskeletal discomfort severity , pearson , spearman , and musculoskeletal linear regression tests were used . \n this is a descriptive cross - sectional study conducted in alzahra university hospital in isfahan , iran in 2013 . \n this hospital was selected due to its high number of personnel as well as having various wards and treatment activities . \n firstly , 247 subjects were randomly selected through a systematic random sampling from the list of all nurses working in alzahra hospital . \n after selection of the subjects , necessary coordination was made with the hospital manager . before completion of an anonymous questionnaire , subjects gave their consent to participate in the research . \n if any of the selected nurses was excluded due to any reason ( absence , loss of interest to attend the study , etc . ) , she / he was replaced by the next staff in the list . \n all volunteers were examined by a specialist of physical medicine before being selected as a subject and attending the research , and those with vertebral fractures , kyphosis , lordosis , scoliosis , intervertebral disk rapture , and hernia and other diagnosed acute msds were excluded from the study . \n inclusion criteria were work experience of more than 1 year and staff 's permanent , contract , and casual employment status . in the present study \n , both goals of the study ( mental workload and prevalence of msds ) were investigated using the national aeronautics and space administration task load index ( nasa - tlx ) and the cornell musculoskeletal discomfort questionnaire ( cmdq ) . \n nasa - tlx is a tool used to investigate the mental workload and was designed by the human factors engineers in nasa . \n this tool was suggested after 3 years of extensive research on the physical and mental activities in various occupations in over 40 simulation laboratories . \n this index is a multidimensional process with various evaluation degrees , which provides a self - evaluation model to estimate mental workload through use of six scales . \n the tlx model includes three dimensions of imposed demands to an operator during working ( physical , mental , and temporal loads ) and three factors associated with the outcome of the work ( person 's performance , level of effort , and level of frustration ) . \n the process of mental workload evaluation through nasa - tlx involves three stages . at the first stage , weight in each of the six scales is determined to reveal the priority of the six scales of tlx . at this stage , \n all scales are self - evaluated and selected by the staff in a paired form and in 15 different positions , and then , each workload dimension is scored 0 - 1 . at the second stage , to allocate the rating of workload , each of the six scales is rated with the goal of determination of each scale 's effect on the mental wor kload . at this stage , the respondent or participant scores each of these six dimensions from 0 to 100 based on his / her own working condition . at the third and the last stage , after determination of weight and rating in previous stages , \n total workload is calculated in the range 0 - 100 through the following formula : total workload = rating weight/15 . \n the research conducted on nurses showed that nasa - tlx had a high correlation with other methods of mental workload evaluation . in a study conducted for the evaluation of nurses mental workload in the intensive care unit ( icu ) in isfahan , \n this questionnaire is a data collecting tool for musculoskeletal discomfort data , which was designed by professor alen hedge et al . in 1999 \n this questionnaire has been designed in three stages of discomfort frequency , discomfort severity , and the effect on capacity for work in the latest working week . \n it has the map of body and 12 parts , which totally analyzes 20 sections of the body . \n mean discomfort frequency for 12 body parts is calculated as the score of msds [ figure 1 ] . \n this questionnaire is used in the usa and other countries as a valuable tool to investigate the level of musculoskeletal discomfort . \n its validity and reliability were estimated by cronbach alpha = 0.986 . to investigate some of the demographic characteristics of the subjects , age , sex , height , weight , \n wo rk experience , related ward , working shift , and body mass index ( bmi ) were added to this tool . \n the collected data were analyzed by spss 20 . to calculate and define the condition of investigated indexes , descriptive statistical tests and tables were used . to investigate the association between mental workload and musculoskeletal discomfort severity , pearson , spearman , and musculoskeletal linear regression tests were used . \n the study was conducted on 247 nurses working in the hospital in the summer of 2013 . the obtained results on the demographic characteristics showed that there were 22 ( 9% ) male and 225 ( 91% ) female subjects of whom 71% were married and 29% were single . \n nurses mean age was 34.8 ( 6.7 ) years , ranging 23 - 67 years . \n nurses mean bmi , weight , and height were 24.24 , 64.5 kg , and 163 cm , respectively [ table 1 ] . \n subjects mean age , weight , height , and bmi as observed in table 2 , the results of mental workload questionnaire showed that the two dimensions of effort and performance had the highest values . \n the dimension of mental demand of work had the highest value and the dimension of frustration had the lowest value [ table 2 ] . \n frequency distribution of musculoskeletal discomfort showed that low back pain ( 76.1% ) was the most frequent complaint ( total discomfort frequency in a part of body ) among the nurses . \n pain in neck and knee was the most frequently ( 68% and 61.9% , respectively ) reported discomfort after low back pain . \n the lowest pain complaints were for back , elbow , arm , and thigh , which were 22.7% , 23.9% , 28.7% , and 31.2% , respectively [ table 3 ] . \n statistical indexes of each workload dimension among nurses ( out of 100 ) frequency distribution of musculoskeletal discomfort among nurses pearson correlation coefficient showed no significant association between the levels of musculoskeletal discomfort among nurses , and workload scale of performance and mental demand ( p > 0.05 ) , but other dimensions of workload , especially the dimension of frustration , had a significant direct association with the level of musculoskeletal discomfort among nurses ( p < 0.05 ) [ table 4 ] . \n as presented in table 4 , there was no significant association between the level of low back pain among nurses and the workload scale of performance and mental demand ( p > 0.05 ) , but it had a significant association with other workload dimensions , especially the dimension of frustration ( p < 0.05 ) . \n there was no significant association between the prevalence of msds and demographic characteristics ( p > 0.05 ) . \n workload score in the dimensions of physical , temporal demand , level of frustration , and level of effort showed an association with msds . \n musculoskeletal linear regression test was adopted to detect the effect of each mental workload dimension score on msds . \n the results showed that each workload dimension including the level of frustration , temporal demand , total mental workload , physical demand , and level of effort had the a significant effect on msds . \n their standardized values were 0.17 , 0.127 , 0.1 , 0.09 , and 0.03 , respectively . \n our obtained results also showed that msds have a high prevalence among nurses and the disorders in waist , neck , and knee are more frequent , which is consistent with the findings of a study conducted in estonia . in the present study , \n low back pain was the most reported complaint ( 76.1% ) by nurses , which is consistent with a study conducted in japan . \n it reported that the highest msds among nurses were low back pain ( 59% ) , shoulder pain ( 46.6% ) , neck pain ( 27.5% ) , knee pain ( 16.4% ) , and pain in upper part of the leg ( 11.8% ) . in a study conducted by choobineh et al . on 346 nurses in iran \n , it was found that low back pain was the most common msd among nurses ( 61.8% ) . \n this shows that nurses are more predisposed to the risk factor of low back pain in their profession . \n the present study showed that mental workload is very high among the hospital nurses ( 77.7% ) . \n it was such that among the six subscales of nasa workload , the scales of effort and performance and mental demands were the highest respectively . \n one of the reasons for this finding could be the role of nurses in their working environment , as nursing errors can result in irreversible miserable outcomes in patients and directly affect patients safety . based on a report by iom , ( institute of medicine ) about 44,000 - 98,000 persons die of medical errors due to mental and physical workload imposed to the staff working in various wards in the usa . on the other hand \n , the association between total mental workload and each of the six scales with msds showed that frustration had the highest association with the prevalence of msds and low back pain among nurses , although it had the lowest value , which is consistent with the study of habibi et al . \n they reported that occupational stress and high workload among nurses resulted in a physiological response in the form of muscular tension , and ultimately , low back pain , which can be due to getting less support from their superior management , other colleagues , and others , as well as increased misbehavior of clients ( patients and their families ) and exposure to critical patients . in a systematic review on previous research entitled are depression , anxiety and poor mental health risk factors for knee pain ? , the obtained results yielded absolute evidences and documents claiming the association between depression and knee pain . \n as msds are one of the major reasons for work absenteeism and sick leave among nurses , these results are of great importance and can be used by hospital managers and nurses . therefore , it seems that more concrete results can be obtained through further and more comprehensive studies conducted by experts of mental workload in nursing profession . \n this study investigated the association between mental workload among hospital nursing staff and the prevalence of msds . \n our obtained results showed a significant association between high mental workload among hospital nurses and the increase in their msds . among the six mental workload scales , frustration had the lowest value but the highest association with msds , especially low back pain . \n this scale of workload should be specifically noticed by hospital managers to modify nurses mental workload to prevent the ascending trend of msds . \n this can be effective on staff 's efficiency and efficacy and , consequently , can lead to an increase in efficiency of health and treatment services in iran .", "role": "user" }, { "content": "background : musculoskeletal disorders ( msds ) are a serious problem among the nursing staff . \n mental workload is the major cause of msds among nursing staff . \n the aim of this study was to investigate the mental workload dimensions and their association with msds among nurses of alzahra hospital , affiliated to isfahan university of medical sciences.materials and methods : this descriptive cross - sectional study was conducted on 247 randomly selected nurses who worked in the alzahra hospital in isfahan , iran in the summer of 2013 . \n the persian version of national aeronautics and space administration task load index ( nasa - tlx ) ( measuring mental load ) specialized questionnaire and cornell musculoskeletal discomfort questionnaire ( cmdq ) was used for data collection . \n data were collected and analyzed by pearson correlation coefficient and spearman correlation coefficient tests in spss 20.results:pearson and spearman correlation tests showed a significant association between the nurses msds and the dimensions of workload frustration , total workload , temporal demand , effort , and physical demand ( r = 0.304 , 0.277 , 0.277 , 0.216 , and 0.211 , respectively ) . however , there was no significant association between the nurses msds and the dimensions of workload performance and mental demand ( p > 0.05).conclusions : the nurses frustration had a direct correlation with msds . \n this shows that stress is an inseparable component in hospital workplace . \n thus , reduction of stress in nursing workplace should be one of the main priorities of hospital managers .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 49-year - old man was admitted to pusan national university hospital with complaints of squeezing chest pain and drowsy mentality . his systolic blood pressure was 70 mmhg , and his heart rate was 120 bpm . \n computed tomography revealed acute type a aortic dissection ( ataad ) that involved the aortic arch and the descending thoracic aorta ( fig . \n 1 ) . an emergency operation was performed . regional cerebral oxygen saturation ( rso2 ) \n was monitored upon arrival at the operation room , and it was maintained during surgery using an invos system ( somanetics , troy , mi , usa ) ( fig . \n the arterial perfusion line was placed on the right subclavian artery that appeared to be visually normal . after initiating cardiopulmonary bypass ( cpb ) , \n after aortic cross clamping , the ascending aorta and the aortic valve were observed through aortotomy . \n an intimal tear was located in the ascending aorta , and the coaptation of the aortic valve was good . \n ascending and hemiarch replacement was planned because the visible arch and the descending aorta were intact . \n the proximal innominate artery was clamped , and perfusion catheters were inserted into the left carotid and left subclavian arteries . \n then , the right rso2 decreased abruptly , and it did not recover as compared to the left one . despite declamping and rechecking the inside of the innominate artery , we found no luminal problem . \n as dynamic carotid artery obstruction was suspected , the operation was continued because such obstructions usually resolve after operation . although the distal aortic anastomosis was completed and an adequate amount of blood flow to the branch of artificial graft was restarted , the right rso2 did not increase . \n another intimal tear on the proximal right common carotid artery , which was obstructing the blood flow , was identified using angiography . \n a 1280 mm smart control nitinol stent system ( cordis co. , bridgewater , nj , usa ) was inserted into the right common carotid artery ( fig . \n the total bypass time , aortic cross clamp time , and selective antegrade cerebral perfusion time were 227 , 191 , and 85 minutes , respectively . \n the patient was extubated on postoperative day 2 and discharged on postoperative day 13 without neurologic deficit . \n despite advances in surgical techniques , the mortality rates of ataad have remained high in patients with brain malperfusion . \n occlusion of the aortic arch vessels , which is propagated from the dissected aorta , commonly leads to neurological deficit . \n the main factor causing malperfusion is the dynamic obstruction of the false lumen or hypotension itself . in most cases , \n this can be relieved by restoring sufficient true luminal blood flow via surgery . in the present case \n the patient was treated via stent placement at the time of the surgery , using a hybrid technique . \n first , whenever the patient 's condition is acceptable , evaluations of the aortic arch vessels are essential for selecting the arterial approach for cardiopulmonary bypass in ataad involving the aortic arch . \n a previous study elucidated when the malperfusion occurs : 1 ) pre - surgery malperfusion , 2 ) malperfusion at the institution of cardiopulmonary bypass , 3 ) malperfusion occurring after aortic cross clamping , and 4 ) malperfusion postdistal aortic anastomotic construction . clamping the innominate artery for sacp may have caused injuries such as intimal tear and dissection , resulting in a reduction of carotid blood flow . \n this speculation is consistent with the fact that rso2 dramatically decreased when sacp was initiated . \n malperfusion , at the beginning of cpb , can be generated not only by retrograde perfusion via the femoral artery but also by antegrade perfusion via the subclavian artery . \n if rso2 drops at the time of cpb initiation , surgeons should promptly change the arterial cannulation site . \n in addition , it is important to initiate monitoring before anesthetic induction to detect problems by observing serial saturation changes . \n near - infrared spectroscopy ( nirs ) provides continuous rso2 monitoring and is a simple noninvasive method for monitoring cerebral perfusion . \n nirs - guided sacp allows a safe approach to aortic arch surgery , and a unilateral progressive discrepancy in rso2 indicates the occurrence of brain malperfusion . \n it is recommended that additional perfusion should be addressed immediately , when major hemispheric discrepancies appear . in our case \n third , if rso2 drops without any apparent anatomic or procedural reason , diagnostic angiography , as a hybrid technique , is strongly recommended . as for the discrepancy in rso2 in our case , even though aortic replacement was completed , we ascertained the luminal integrity of the innominate artery and suspected insufficient brain perfusion due to dissection or re - dissection of the carotid artery . \n angiography is needed to confirm the status of the carotid artery lumen . in our case \n , we found a tear on the right common carotid artery and achieved rso2 recovery through prompt carotid stent placement . \n after an open arterial stenosis , sufficient brain perfusion was restored , and no postoperative neurological symptoms developed . \n there are several published experiences with acute carotid revascularization in ataad cases involving the aortic arch vessels . in these cases , \n carotid stent placement was performed to recanalize the artery or seal an intimal flap , and a high success rate was achieved . in summary , in ataad patients with decreased mentality , preoperative evaluation of the aortic arch vessels , continuous monitoring of rso2 , and the use of a hybrid technique that involves confirmatory angiography for detected problems will reduce neurologic complications from brain malperfusion . \n in addition , if a hybrid operation room is available , surgeons can save additional time in finding and fixing vascular complications .", "role": "user" }, { "content": "a 49-year - old man with drowsy mentality was diagnosed with acute type a aortic dissection ; he underwent an emergency operation . \n when selective antegrade cerebral perfusion was initiated , the right regional cerebral oxygen saturation ( rso2 ) decreased as compared to the left one . \n adequate blood flow was perfused through the branch of the artificial graft , after distal anastomosis , but the right rso2 did not recover . \n angiography revealed another intimal tear on the right common carotid artery . \n a stent was then inserted . \n the right rso2 promptly increased to the same level as that of the left one . \n the patient was discharged without any neurologic complications .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: thirty one cases of pathologically proven gastric cancer occurring from march 2002 to march 2005 were prospectively included in this study . \n the patient records and the pertinent clinical data are shown in table 1 and include tumor size ( greatest diameter ) , pathological tnm ( ptnm ) staging ( uicc 1997 ) and who histological grading ( 11 ) as described : well differentiated = an adenocarcinoma with well - developed glands and often resembling a metaplastic intestinal epithelium ; moderately differentiated = an adenocarcinoma intermediate between the well differentiated and poorly differentiated ; poorly differentiated = an adenocarcinoma composed of highly irregular glands that are recognized with difficulty , or single cells that remain isolated or are arranged in small to large clusters with mucin secretions or acinar structures . \n a ct perfusion was approved by the hospital ethics committee and a patient consent was obtained before imaging . \n all tumors were resected via a surgical procedure at one week after mdct scanning ( ge - lightspeed , ge medical systems , milwaukee , wi ) . following a 1,000 - 1,200 ml oral dose of water , and a 20 mg intravenous injection of scopolamine ( boehringer ingelheim , germany ) \n the patients were instructed to practice a gentle breathing technique while scanning , and were fixed with an abdominal belt . \n the lesion was localized on the non - enhanced ct scan with a 2 cm tumor region of interest defined by an experienced radiologist . \n the dynamic scan was acquired at this level , performed at a static table position during an intravenous bolus of 50 ml in nonionic iodinated contrast enhance medium ( iopromide , ultravist300 ; schering , berlin , germany ) via the antecubital vein at 4 - 5 ml / s . \n the following parameters were used : 10 s for the scan delay from the start of injection ; 5 mm slice thickness ( reconstruction slice thicknesses were 5 mm and 10 mm ) ; 1 s gantry rotation period with a 1 s temporal resolution ; 120 kv , 100 ma and a 60 sec transverse data acquisition period . \n next , the data were transferred to a workstation ( advantage windows 4.0 ; perfusion 3.0 ; ge medical systems ) and analyzed using commercial software . \n the advantages of the analytical method included a deconvolution for perfusion and blood volume , which demonstrated good temporal resolution and high spatial resolution , while high image noise and limited volume coverage appeared to be its disadvantages . \n each region of interest , drawn over the tumor by a radiologist section by section , was as large as possible to reduce noise ( > 50 pixels ) and to almost completely cover the whole lesion , with care to exclude peripheral fat and necrotic area . \n maps of tumor blood flow ( bf ) ( ml/100 g / min ) , blood volume ( bv ) ( ml/100 g ) , mean transit time ( mtt ) ( sec ) , and permeability surface ( ps ) ( ml/100 g / min ) were calculated automatically for all four sections ( with reconstruction slice thickness 5 mm ) available for each patient . \n the same process was repeated in the sections where reconstruction of slice thickness was 10 mm . \n the mvd was estimated by immunohistochemical staining of the surgical specimens with anti - cd34 monoclonal antibody ( dako , copenhagen denmark ) ( 12 ) . \n any single brownstaining endothelial cell or small clusters of brown - staining endothelial cells , with or without a lumen , are clearly separated from its adjacent microvessels , tumor cells , and other connective tissue elements considered as being individual vessels . \n vessels of a caliber larger than the approximately eight red blood cells and vessels with a thick muscular wall were excluded from the final counting . \n after screening the areas with intense neovascularized spots in a low power field ( 40 ) , the microvessels in the area with the highest number of discrete microvessels were counted in a 400x field . \n moreover , three separate areas of intense neovascularization were assessed for each sample and the mean mvd was calculated for each tumor evaluated . \n the bv , bf , mtt , ps , and mvds are expressed as the meanstandard deviation ( sd ) and the data were subjected to a kolmogorov - smirnov normality test . \n all findings were prospectively analyzed and were found to be correlated with the clinicopathological results ( histological grading , presence of lymph node metastasis , serosal involvement , tnm staging , and mvd ) . \n the statistical analyses ( t - test and spearman rank correlation ) were calculated in spss 11.5 ( spss inc . , \n for the two - tailed tests , p - values less than 0.05 were considered statistically significant . \n thirty one cases of pathologically proven gastric cancer occurring from march 2002 to march 2005 were prospectively included in this study . \n the patient records and the pertinent clinical data are shown in table 1 and include tumor size ( greatest diameter ) , pathological tnm ( ptnm ) staging ( uicc 1997 ) and who histological grading ( 11 ) as described : well differentiated = an adenocarcinoma with well - developed glands and often resembling a metaplastic intestinal epithelium ; moderately differentiated = an adenocarcinoma intermediate between the well differentiated and poorly differentiated ; poorly differentiated = an adenocarcinoma composed of highly irregular glands that are recognized with difficulty , or single cells that remain isolated or are arranged in small to large clusters with mucin secretions or acinar structures . \n a ct perfusion was approved by the hospital ethics committee and a patient consent was obtained before imaging . \n all tumors were resected via a surgical procedure at one week after mdct scanning ( ge - lightspeed , ge medical systems , milwaukee , wi ) . \n following a 1,000 - 1,200 ml oral dose of water , and a 20 mg intravenous injection of scopolamine ( boehringer ingelheim , germany ) , a perfusion scan was performed in a 16-section mdct cine period lasting 60sec . \n the patients were instructed to practice a gentle breathing technique while scanning , and were fixed with an abdominal belt . \n the lesion was localized on the non - enhanced ct scan with a 2 cm tumor region of interest defined by an experienced radiologist . \n the dynamic scan was acquired at this level , performed at a static table position during an intravenous bolus of 50 ml in nonionic iodinated contrast enhance medium ( iopromide , ultravist300 ; schering , berlin , germany ) via the antecubital vein at 4 - 5 ml / s . \n the following parameters were used : 10 s for the scan delay from the start of injection ; 5 mm slice thickness ( reconstruction slice thicknesses were 5 mm and 10 mm ) ; 1 s gantry rotation period with a 1 s temporal resolution ; 120 kv , 100 ma and a 60 sec transverse data acquisition period . \n next , the data were transferred to a workstation ( advantage windows 4.0 ; perfusion 3.0 ; ge medical systems ) and analyzed using commercial software . \n the advantages of the analytical method included a deconvolution for perfusion and blood volume , which demonstrated good temporal resolution and high spatial resolution , while high image noise and limited volume coverage appeared to be its disadvantages . \n each region of interest , drawn over the tumor by a radiologist section by section , was as large as possible to reduce noise ( > 50 pixels ) and to almost completely cover the whole lesion , with care to exclude peripheral fat and necrotic area . \n maps of tumor blood flow ( bf ) ( ml/100 g / min ) , blood volume ( bv ) ( ml/100 g ) , mean transit time ( mtt ) ( sec ) , and permeability surface ( ps ) ( ml/100 g / min ) were calculated automatically for all four sections ( with reconstruction slice thickness 5 mm ) available for each patient . \n the same process was repeated in the sections where reconstruction of slice thickness was 10 mm . \n the mvd was estimated by immunohistochemical staining of the surgical specimens with anti - cd34 monoclonal antibody ( dako , copenhagen denmark ) ( 12 ) . \n any single brownstaining endothelial cell or small clusters of brown - staining endothelial cells , with or without a lumen , are clearly separated from its adjacent microvessels , tumor cells , and other connective tissue elements considered as being individual vessels . \n vessels of a caliber larger than the approximately eight red blood cells and vessels with a thick muscular wall were excluded from the final counting . \n after screening the areas with intense neovascularized spots in a low power field ( 40 ) , the microvessels in the area with the highest number of discrete microvessels were counted in a 400x field . moreover , three separate areas of intense neovascularization were assessed for each sample and the mean mvd was calculated for each tumor evaluated . \n the bv , bf , mtt , ps , and mvds are expressed as the meanstandard deviation ( sd ) and the data were subjected to a kolmogorov - smirnov normality test . \n all findings were prospectively analyzed and were found to be correlated with the clinicopathological results ( histological grading , presence of lymph node metastasis , serosal involvement , tnm staging , and mvd ) . \n the statistical analyses ( t - test and spearman rank correlation ) were calculated in spss 11.5 ( spss inc . , \n for the two - tailed tests , p - values less than 0.05 were considered statistically significant . \n the perfusion parameters for gastric cancer in 31 patients ( with reconstruction slice thicknesses of 5 and 10 mm ) were compared , and revealed no significant differences ( p > 0.3 ) . in this study , \n the mean perfusion values and mvd for tumors are as follows : bf ( 48.1416.46 ml/100 g / min ) , bv ( 6.702.95 ml/100 g ) , mtt ( 11.754.02 sec ) , and ps ( 14.175.23 ml/100 g / min ) and mvd ( 41.711.53/400x field ) . \n moreover , the relationship between values and different histological grades , serosal involvement , distant metastasis , or lymphatic metastasis , and ptnm are detailed in tables 2 - 5 . \n a significant difference exists for the ps value between patients with or without lymphatic involvement ( p = 0.038 ) , as well as among different histological grades ( p = 0.04 ) and tnm staging ( p = 0.026 ) . \n however , the bf , bv , mtt , and mvd of gastric cancer revealed no significant relationship with any clinicopathological features ( p > 0.05 ) ( figs . 1 , 2 ) . \n currently , a perfusion ct is calculated by the deconvolution approach , which is based on the theory that immediate enhancement of the tumor is largely due to the presence of the contrast media within the intravascular space and its first - pass to the extravascular space . with the leakage to the extravascular space , \n the enhancement of the tumors are caused by the contrast media in both the intrasvascular and extravascular space ( 10 ) . \n the deconvolution model has the ability to tolerate greater image noise , is therefore rather well suited to abdominal scans , and is the preferred method for the measurement of low levels of perfusion , which are applicable to gastrocarcinoma ( 14 ) . \n the majority of the injected contrast media remains intravascular within 40 s ( it is also affected by cardiac output and central blood volume ) ; however , a much greater proportion later passes into the extravascular space . \n the duration of this process lasts around 2 to 4 min ( 15 - 17 ) . \n a perfusion ct scan was performed prospectively in 10 patients with histologicallyproven colorectal cancer using different acquisition times ( 45 , 60 , and 130 s ) by goh et al . ( 18 ) . \n no significant difference was found for bf , bv , or mtt values between any acquisition times ; however , significant differences in ps were found between 45 sec and 65 or 130 sec . by measuring the attenuation change within the input artery and tumor , an irf ( input response function ) curve can be derived . \n the peak of this curve is regarded as bf , while bv is represented by the area under the curve . as a result , \n different acquisition times do not drastically affect these three values since the shape of the curve is fixed . \n although the radiation dose in a perfusion ct scan is around 700 mgy ( 70% of abdominal ct ) , the extra 2 min dose may be harmful to the patient and efforts should be taken to minimize the dose . \n furthermore , a long acquisition time can lead to respiratory motion in an abdominal scan . \n when taking all of these elements into account , we determined that the 60 sec acquisition time be the most appropriate for our study . \n furthermore , patients who suspend their breathing will often exhale , which will lead to more motion artifacts and the temptation to take a deep breath when experiencing the \" hot flush \" associated with a rapid bolus of contrast medium will interrupt the perfusion scanning . therefore , a quiet respiration was requested during the scan , with patients in the prone position and fixed with a waistline to reduce the extension of respiration ( 14 ) . \n pathological tnm staging , histological grading , serosal involvement , lymphatic metastasis , and mvd have been identified as important predictors of the prognosis resulting from gastric cancer in our study ( 19 - 20 ) . moreover \n , ptnm is the conventional prognostic index as it reflects the depth of invasion as well as lymphatic or distal metastasis ( 3 ) . \n tumor outcome is determined by tumor size , extent , stage , and biological behavior and is largely described according to its histological grade . \n recent studies have acknowledged that the lymphatic metastasis status is critical in the prognosis of gastric cancer . \n the mortality of patients with lymphatic metastasis is 3.92x greater than patients without lymphatic metastasis . \n angiogenesis is a highly complex phenomenon that is essential for the growth of solid tumors , hence permitting rapid tumor growth and increased potential for tumor metastasis . \n furthermore , angiogenesis is a significant predictor of prognosis and hematogenous metastasis in patients with gastric cancer . \n mvd is currently applied as an indicator of tumor angiogenesis , and has further been demonstrated that , in some tumors , up to 15% of tumor blood vessels demonstrate the presence of cancer cells in the lumen ( 21 ) . \n it is proposed that these small , leaky vessels allow tumor cells to reach the circulatory system , thus increasing the probability of metastasis . \n the results of a multiple elements analysis in breast cancer , indicated that mvd plays a more important role in predicting invasion and metastases than other clinical indicators . \n also , several studies have shown a positive statistical correlation between mvd and metastasis in other solid tumors such as in the lung , uterus , cervix , and prostate . \n however , the relationship is controversial in gastric cancer ( 5 , 22 - 24 ) . according to the results of this study \n , there is a significant difference for the ps value between patients with and without lymphatic involvement . \n moreover , there is also a significant difference between different histological grades and tnm stages , while bf , bv , mtt , and mvd revealed no significant correlation with clinicopathological findings for gastric cancer . \n permeability surface represents the transmission rate of contrast media from capillary endothelium to interstitial space , reflects the integrity of endothelial cells and permeability of vessels . \n it is known that tumor capillaries , in general , have wide inter - endothelial junctions , a large number of fenestrate and transendocannels , and discontinuous or absent basement membrane . \n compared to normal vessels , they are more easily penetrated by large particles , including tumor cells . \n this whole process often happens along with an inflammatory reaction that accelerates permeability changes ( 22 , 25 ) . \n previous reports have put too much emphasis on blood flow of the tumor rather than the functional differences compared to normal vesselscapillary permeability , which appears to be of value in grading of cerebral glioma and lung cancer ( 13 , 26 ) . \n we believe ps to be an indicator of prognosis in gastric cancer , warranting further study in larger cohort of patients . there is no significant difference in the bf , bv , mtt and mvd between patients with and without lymphatic involvement , but also with different histological grades and tnm staging \n . the reasons for this may be as follows : first , this may be due to the small size of the study population , which contained many patients with poorly differentiated carcinoma , which perhaps causes some statistical bias . \n second , elevated tissue pressure present at the center of such tumors have caused the lumen and resulted in the underestimation of the mvd ( 3 ) . \n ( 10 ) that angiogenesis stimulates the opening of significant numbers of arteriovenous shunts , rather than producing a new vascular supply ( 10 ) . \n anything above may affect the result of bf , bv and mtt values . moreover , different tumors have different pathological features . regional cerebral blood volume is closely related to the grading of glioma ( 27 ) . \n fourth , tumor vessels are structurally and functionally abnormal , with uneven diameters , increased length and tortuosity , multiple arteriovenous shunts , and loss of physiological regulation of blood flow . \n the distribution of tumor vessels is uneven , with a large amount in the vascular area and a small amount in necrotic region . because mvd is a direct technique has a significant shortcoming as it depends on the availability of postoperative tissue or biopsy materials . \n additionally , a gastric ulcer is associated with cancer , thus complicating accurate calculation ( 28 ) . \n fifth , there is the possibility that mvd acts as an indicator of angiogenesis correlates hematogeneous metastasis . \n first , as the size of the study population was too small , no estimation of the absolute value of ps data could be provided for under a clinical analysis . \n third , the lack of control group in the study is another limitation , the normal gastric wall is more likely to be too thin for us to achieve perfusion ct values . \n fourth , a respiratory artifact is something hard to overcome , especially for a 60 sec free breathing scan . \n it has been reported that mri could aid in optimizing treatments , categorizing lesions , and influencing patient care in brain tumors ( 26 ) , which might be a hint for the futher investigation in gastrointestinal system . \n perfusion ct is a reproducible , objective , and feasible imaging strategy for the evaluation of oncology . \n furthermore , the analysis of perfusion ct in gastric cancer ( especially for the ps value ) , might be a helpful prognostic indicator , or as being useful for predicting the response to clinical treatment .", "role": "user" }, { "content": "objectiveto investigate the relationship between the perfusion ct features and the clinicopathologically determined prognostic factors in advanced gastric cancer cases.materials and methodsa perfusion ct was performed on 31 patients with gastric cancer one week before surgery using a 16-channel multi - detector ct ( mdct ) instrument . \n the data were analyzed with commercially available software to calculate tumor blood flow ( bf ) , blood volume ( bv ) , mean transit time ( mtt ) , and permeability surface ( ps ) . the microvessel density ( mvd ) , was evaluated by immunohistochemical staining of the surgical specimens with anti- cd34 . \n all of the findings were analyzed prospectively and correlated with the clinicopathological findings , which included histological grading , presence of lymph node metastasis , serosal involvement , distant metastasis , tumor , node , metastasis ( tnm ) staging , and mvd . \n the statistical analyses used included the student 's t - test and the spearman rank correlation were performed in spss 11.5.resultsthe mean perfusion values and mvd for tumors were as follows : bf ( 48.1416.46 ml/100 g / min ) , bv ( 6.702.95 ml/100 g ) , mtt ( 11.754.02 s ) , ps ( 14.175.23 ml/100 g / min ) and mvd ( 41.711.53 ) . \n moreover , a significant difference in the ps values was found between patients with or without lymphatic involvement ( p = 0.038 ) , as well as with different histological grades ( p = 0.04 ) and tnm stagings ( p = 0.026 ) . \n however , bf , bv , mtt , and mvd of gastric cancer revealed no significant relationship with the clinicopathological findings described above ( p > 0.05).conclusionthe perfusion ct values of the permeable surface could serve as a useful prognostic indicator in patients with advanced gastric cancer .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: striae of the laser - assisted in situ keratomileusis ( lasik ) flap are described as creases or puckers in the cornea as a consequence of lasik surgery.1 striae are a frequent etiological factor of post - lasik subject dissatisfaction . \n confocal microscopy shows wrinkles in the superficial corneal layers in > 97% of subjects.2 nonetheless , the greater proportion of these subjects is asymptomatic ; the incidence of clinically significant striae necessitating intervention is considerably less , ranging from 0.2% to 1.5%.2 the most frequent categorization of lasik flap striae is according to their size . \n macrostriae are full thickness larger corneal creases that frequently induce symptomatic visual deterioration and usually mandate surgical management . \n other reports classify striae according to treatment ; ie , whether requiring surgery or not.3 flap striae occur as a result of slippage or wrinkling of the flap following lasik surgery . \n this typically results from unbalanced realignment of the edge of the lasik flap with the epithelial ring . \n it is concluded that the discrepancy in the curvature of the unchanged posterior flap and the newly altered stromal bed is the principal etiological factor for this mismatch . \n the modified convexity of the stromal centre can result in flap redundancy which is difficult to get into a perfectly flat position , described as the tenting effect . \n this would clarify the greater incidence of lasik flap striae with higher refractive errors necessitating greater depth of ablation.4 striae are difficult to avoid . \n attempts to decrease the incidence of lasik flap striae are centered about meticulous repositioning of the flap and early examination of the flap to assure proper positioning.5 landmarks located on the flap edge permit precise realignment of the flap . \n slit lamp examination of the flap at 15 to 20 minutes postoperatively is advocated to spot early flap slippage and ensure equal distribution between the epithelial ring periphery and the flap edge.5 regarding folds diagnosed in the early postoperative follow up , the ideal management is to float and irrigate the flap and then stretch it back into position.6 early wrinkles can be managed by flattening with microsponges . \n flattening can be undertaken under the slit lamp or under the operating microscope by gently pressing on the folds.7 striae that fail to be flattened will require more invasive management . \n many postulate the next measure is to scrape the epithelium over the folds , then irrigate the flap with balanced saline and stretch the flap back into position.7 \n this study was conducted on 161 eyes of 87 subjects undergoing lasik refractive surgery for correction of myopic , hyperopic and astigmatic refractive errors using wavelight ex500 ( alcon laboratories ; ft worth , tx , usa ) . \n all subjects provided written informed consent for this procedure and for their data ( and accompanying images if applicable ) to be published in this paper . \n this study was approved by the ethics research committee , faculty of medicine , university of alexandria , alexandria , egypt . \n a novel flap double twist technique was applied to reduce the incidence of post - lasik flap striae . \n a superior hinge was applied in all cases using moria evolution 3 microkeratome ( moria , antony , france ) . \n the flap was floated and stroked in the same way as was done for management of first postoperative day striae , where the method was to float and irrigate the flap into position , followed by applying gentle pressure on the flap with a wet merocel microsponge and moving the flap away from the hinge position . \n the sponge was then manually squeezed to become drier and the flap was continuously stroked in a direction opposite to the hinge . \n next , the flap was carefully twisted obliquely and sequentially in two opposite directions while gentle pressure was applied on the flap in order to completely dehydrate the flap and stromal bed ( figures 1 and 2 ) . \n finally , the flap was repositioned while applying gentle horizontal pressure in two opposite directions ( figure 3 ) . \n the entire procedure was completed in 1 to 2 min , and then the flap was permitted to dry for 10 to 15 s. topical steroid eye drops ( 1% econopred plus , alcon laboratories , inc . , fort worth , tx , usa ) were then instilled , making benefit of the white colored suspension to ensure gutter symmetry ( figure 4 ) . \n antibiotic , nonsteroidal anti - inflammatory , and lubricating drops are applied , and the speculum was carefully removed ( video s1 ) . \n since the laser used was mounted with a slit lamp , the slit beam was passed over the corneal surface to ensure the gutter s symmetry . \n the subject was then escorted to a separate slit lamp , where the gutter symmetrical width was examined again . \n this study was conducted on 161 eyes of 87 subjects ( table 1 ) ; 28 males ( 32.18% ) and 59 females ( 67.82% ) . \n the type of refractive error was simple myopia in 19 eyes ( 11.80% ) , myopic astigmatism in 111 eyes ( 68.94% ) , simple hyperopia in six eyes ( 3.75% ) , hyperopic astigmatism in 16 ( 9.93% ) eyes and mixed astigmatism in nine eyes ( 5.59% ) . \n the spherical refractive error treated ranged from 12 to + 6 d and the astigmatic refractive error treated ranged from 0 to 5.25 d with the minus cylinder axis ranging from 0 to 180. corneal parameters of the studied subjects were obtained preoperatively with a tomey anterior segment analyzer ( tms-5 ) : k1 ranged from 39.75 to 46.06 d with a mean of 43.03 d , k2 ranged from 40.05 to 47.61 d with a mean of 44.21 d , k1 axis ranged from 1 to 180 with a mean of 75 and the pachymetry of the corneal apex ranged from 496.0 to 676.0 m with a mean of 540.0 m . regarding the operative data , the flap thickness ranged from 90 to 130 m with a mean of 110 m , the ablation diameter ranged from 6.0 to 6.5 mm with a mean of 6.5 mm , the ablation depth ranged from 24 to 153 m with a mean of 68 m and the residual stromal thickness ranged from 287 to 447 m with a mean of 361 m ( table 1 ) . at 1 hour , 24 hours and 1 week postoperatively , no striae were encountered in the studied subjects . \n flap striae occur as a result of slippage or wrinkling of the flap following lasik surgery . \n this typically occurs as a result of misalignment of the edge of the lasik flap with the epithelial ring.4 striae are difficult to prevent . efforts to reduce the incidence of lasik flap striae are centered around meticulous repositioning of the flap and early examination of the flap to assure proper positioning.5 precise lasik flap repositioning is hindered by the presence of fluid in the interface between the stromal bed and posterior flap surface , adding to the flap bed mismatch . \n this can be overcome by proper dehydration of this interface , as advocated in this flap double twist technique . \n this novel flap double twist technique shows great success in post - lasik striae prevention , particularly for macrostriae due to flap misplacement and dislodgment . \n the technique is perhaps more relevant to higher ablation of the stromal bed , specifically those with 50 to 100 micron corrections changing the convexity of the stromal bed with respect to posterior flap curvature . \n as most microkeratome flaps are meniscus in profile and they are easier to lift and move , the femtosecond flaps are flimsier in the periphery compared to microkeratome flaps that are thicker in the periphery and thinner centrally . furthermore , the femtosecond flaps have a rougher stromal bed and are harder to move temporally and nasally with a dry sponge than microkeratome flaps . \n although time consuming , this flap double twist technique can prevent one of the most common lasik complications and does not require special instruments or learning .", "role": "user" }, { "content": "a novel flap double twist technique was applied to reduce the incidence of post - laser - assisted in situ keratomileusis ( lasik ) flap striae . the flap is floated and stroked in the same way as is done for management of first postoperative day striae , where the method is to float and irrigate the flap into position , followed by applying gentle pressure on the flap with a wet merocel microsponge and moving the flap away from the hinge position . \n the sponge is then manually squeezed to become drier , and the flap is continuously stroked in a direction opposite to the hinge . \n next , the flap is carefully twisted obliquely and sequentially in two opposite directions while applying gentle pressure on the flap in order to completely dehydrate the flap and stromal bed . \n finally , the flap is repositioned while applying gentle horizontal pressure in two opposite directions . \n this novel flap double twist technique shows great success in post - lasik striae prevention .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: following traumatic spleen rupture or surgery , heterotrophic autotransplantation of the spleen tissue occurs in a process called splenosis . \n it can occur anywhere in the abdominal cavity and can even reach the brain tissue . due to the fact that splenosis is a rare incident , the pathogenesis is not fully understood . yet in order to predict when splenic implants will occur , some assume that the spillage of the damaged splenic pulp into the adjacent cavity leads to the seeding or it may be due to hematogenous spread . \n manipulation of splenosis can lead to many severe complications like obstruction and bleeding that can occur as a result of splenotic tissue overgrowth 1 , 2 . in 1995 , \n higgins and crain 3 reported the first successful laparoscopic procedure for pelvic splenosis and ever since it has been the treatment of choice for splenosis 3 , 4 . in this case , while undergoing a bariatric surgery , we report an incidental finding of splenosis in a morbidly obese patient who underwent splenectomy due to a traumatic injury 10 years ago . \n a 30yearold female , known to have hypertension and diabetes , complained of excessive weight gain , after her 1 year gastric band lost its effectiveness . after further questioning , the patient shared that she had a laparoscopic splenectomy 10 years ago after a trauma . \n nonetheless , a laparoscopic gastric band removal and conversion into sleeve gastrectomy was still planned . during the operation , implanted splenic bodies were incidentally found all over her abdomen such as in the stomach , liver , gallbladder , diaphragm , and at the left upper quadrant , except the lower pelvis , as seen in the images below . beginning the laparoscopic surgery according to plan , unaware of her splenotic condition , \n she had three trochars inserted into her abdomen in preparation for the gastric sleeve . when the camera was first inserted , we directly observed multiple spleens implanted , covering the abdomen and concluded the diagnosis to most likely be splenosis as the patient underwent a splenectomy in the past . after observing splenosis all over the stomach , \n the gastric sleeve procedure became complicated and difficult to fulfill as the splenotic implants were also found on the greater curvature of the stomach ( fig . \n moreover , implanted spleens were found surrounding the gastric band , thus it was an emergency to remove the gastric band before any erosion occurs , injuring the spleen and causing a massive bleed . in a meticulous manner , laparoscopic dissection of the fibrosis around the gastric band was done , avoiding the surrounding splenic nodules ( fig . \n 2 ) . the band was then cut and withdrawn from the stomach and out of the abdominal cavity . then some spleens were dissected and sent for pathological examination to confirm our diagnosis . \n moreover , a very rare event of splenosis was found , silently surrounding and obstructing the gallbladder of the patient ( fig . \n 4 ) ; which should be checked on a regular basis in case of cholecystitis or other gallbladder abnormalities . \n another interesting finding is the seeding on the diaphragm as seen in figs 5 , 6 , 7 . \n postoperatively , the patient was informed about the complication that arose in the procedure that led to aborting the gastric sleeve surgery . \n she was then consulted by a nutritionist in order to guide her through a healthy lifestyle of diet and exercise . \n the patient remained in the hospital for 3 days in order to monitor her stability and assess the risk of any postoperative complications with the splenic implants . \n pathology : received in formalin are two fatty fragments enclosing around seven dark brownish nodular formations . \n multiple splenic nodules , consistent with suggested diagnosis of splenosis , no evidence of other pathologies . \n splenosis is known as heterotopic splenic tissue autotransplantation in a different anatomical location than that of the normal spleen , usually after trauma or surgical avulsion of the spleen or even hematological diseases . \n although these implants acquire the normal function of the spleen , it is a benign acquired disease unlike the congenital accessory spleen , which arises from the dorsal mesogastrium 5 and is found near the splenic hilum . \n however , in splenosis , the splenic tissues have poorly formed capsules , no hilum and vary in shape and size 5 , 6 . \n they even differ by their blood supply ; splenic implants use the surrounding peritoneal vessels , rather than the splenic artery 7 . \n splenosis can occur anywhere in the body , but it is mainly found in the abdomen , usually at port sites of previous surgeries 6 , 7 . statistically , it has been shown to occur in 1617% of patients who undergo elective splenectomy for hematological disease , and in 4476% of patients with a posttraumatic splenectomy due to spillage after traumatic insult 6 , 8 . in our case , although the patient did not report any hematological diseases , the patient underwent a splenectomy due to a trauma , thus increasing the risk of splenic tissue spillage in the most common location , the abdomen . in light of splenosis \n usually being asymptomatic , it is most commonly incidentally discovered , during any abdominal surgery or through an evaluation for another disease . \n it is usually suspected in patients with a history of a splenectomy and symptomatic . in this case , our patient was asymptomatic , nor did she experience any discomfort . \n although the first part of the surgery was completed , gastric band removal , it was solely due to the fear of an erosion or inflammation of the gastric band that can later on cause an easily avoidable complication \n . thus , only the gastric band was removed and the sleeve gastrectomy was aborted due to the splenotic implant locations that made the surgery anatomically difficult and dangerous as there was a high risk of bleeding . on the other hand , symptoms of splenosis can be nonspecific , for example , abdominal pain due to an infarction , enlarging mass , obstruction from the adhesions , gastrointestinal bleeding , hydronephrosis , or pressure by mass effect 9 . \n although our patient was asymptomatic , she did experience an enlarged abdomen which was thought to be a result of her weight gain . \n looking back , this may also be an effect of the splenosis , rather than simply from the retired gastric band . \n the diagnosis of splenosis is normally well established by a radionuclide scintigraphic study of the liver and spleen with technetium99 m sulfur colloid , which can accurately detect splenic tissue as small as 1 cm in diameter 5 . \n scintigraphy with technetium99 m radiolabelled heatdamaged erythrocytes or with indium 111labeled platelets , and ferumoxidesenhanced mri are other valuable tools for diagnosing splenosis 10 , 11 . \n once splenosis is confirmed , no further workup is necessary unless the patient is symptomatic . \n unfortunately , our patient 's case was found incidentally upon laparoscopic surgery , which is rarely used to diagnose . \n usually splenosis is confirmed by radionuclide scintigraphic study , which did not apply in our case . despite not knowing the degree of function of the spilled splenic tissue , \n this may be demonstrated by a peripheral blood smear and noting the presence of damaged , nonfunctional rbcs , like h j bodies , heinz bodies , and pitted red cells , which increase in the asplenic state . \n earlier in medicine , the preferred treatment of choice for identification and removal of ectopic splenotic implants is by surgery . nowadays , \n since one can visualize the retrogastric pouch in laparoscopic surgery , which is not seen through the open approach , laparoscopic surgery is now preferred as it decreases the risk of spillage , using an endobag . \n the seeding of spilled splenic cells under highpressure pneumoperitoneum during a slightly longer procedure is a new and specific problem being faced in laparoscopic splenectomy , minimally invasive surgery such as laparoscopy remains the ideal treatment for patients with symptomatic splenosis12 . \n although , there hasn't been a lot of research concerning laparoscopic surgery in an asymptomatic patient , in our case , the sole purpose of the surgery was for a gastric band removal followed by a gastric sleeve , which was then complicated by the incidental finding of splenosis in the abdomen . \n in conclusion , great technical and meticulous care is required during laparoscopic proceduces , specifically splenectomy , in order to avoid rupturing the splenic capsule , spilling , and splenetic implantations known as splenosis . \n nevertheless , in the case of splenosis , it is not necessarily considered as a potential life threatening and dangerous incident , especially in asymptomatic patients and do not require surgery unless they are symptomatic . \n although known to be a rare incidence with only a few reported cases after laparoscopic splenectony 7 , splenosis cases are expected to increase in the future . \n \n ", "role": "user" }, { "content": "key clinical messagein any patient , the occurrence of postsplenectomy splenosis can complicate the planning of further surgeries . in our case , \n the gastric sleeve procedure was aborted , as it would have put the patient 's life in danger . \n therefore , only the gastric band was removed , eliminating future erosion .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: continuous subcutaneous insulin infusion ( insulin pump ) therapy is an effective method of managing glycemic control in people with diabetes mellitus who require insulin . as such \n , accurate and reliable insulin delivery is a top priority when using an insulin pump.1 as the use of insulin pumps has increased , many different rechargeable and battery - operated systems have been created . \n rechargeable lithium - ion batteries are becoming popular power sources for portable electronic devices , including insulin pumps.2 the electrolytes contained within the battery have excellent conductivity and life - cycle performance . \n however , there are risks associated with the use of lithium - ion batteries , such as leakage and fire hazards . \n furthermore , excessive heat exposure may cause the separator ( a membrane inside the battery ) to shrink or melt , causing a short circuit between the two electrodes.2,3 prolonged exposure to high temperatures , such as those that may occur if a rechargeable battery is repeatedly overcharged or if the pump is exposed to direct sunlight , leads to increased heat production within the battery . \n insulin manufacturers specify that insulin temperatures should not exceed 37c;4,5 temperatures above this cutoff carry the risk of insulin degradation , with the associated consequences of prolonged hyperglycemia.6,7 previous studies have shown that exposure to temperatures higher than 37c may increase the risk of insulin fibrillation , a form of protein misfolding that leads to the development of precipitates in insulin solutions.8 therefore , temperature fluctuations in rechargeable insulin pumps may have significant implications for the stability of the insulin in the pump . \n however , temperature fluctuations in nonrechargeable battery - operated pumps have not yet been examined compared with those using rechargeable batteries . \n changes in insulin temperature may potentially affect insulin action , and thus have the potential to compromise glycemic control and/or safety . \n therefore , the goal of this study was to evaluate temperature fluctuations during the charging period of rechargeable insulin pumps , and compare them with temperature fluctuations in battery - operated insulin pumps , in both ambient temperatures ( eg , usual home / office temperature in the us ) and in a high - temperature environment ( eg , outdoors on a summer day in the us ) . \n the materials and equipment required for this study included an extruded polystyrene rigid - foam insulation board ( 6145.72.5 cm , foamular ; owens corning , toledo , oh , usa ) to prevent stray heat conduction between the experimental pumps . \n the design also included a tis40 infrared ( ir ) camera and two 54 ii b thermometers for measuring air and insulin - pump temperatures ( fluke corporation , everett , wa , usa ) . \n the 54 ii b thermometers , together with chromega alomega thermocouples ( sa1-k-72-sc , gauge 30 [ 0.025 cm ] , length 182.9 cm ; omega engineering inc , stamford , ct , usa ) were used to monitor insulin - pump and ambient temperatures . \n a temperature - controlled environment was simulated in a hotpack environmental - chamber ( 417522 ; sp industries , warminster , pa , usa ) . \n six t : slim pumps ( tandem diabetes care inc , san diego , ca , usa ) were used as insulin pumps with rechargeable batteries . \n six vibe pumps ( animas diabetes care llc , west chester , pa , usa ) were used as insulin pumps with regular batteries . \n high - purity water with food dye ( mccormick , sparks , md , usa ) was used in lieu of insulin to fill cartridges and prime pumps . \n the study set up was constructed and conducted on the extruded polystyrene rigid - foam insulation board in ambient temperature ( figure 1a ) and in a temperature - controlled environmental - chamber ( figure 1b ) . \n two thermometers ( 54 ii b ) were used to measure pump and air temperatures . \n one thermometer was used to measure pump temperatures and required two thermocouples : one attached to the rear of the rechargeable pump located in the center of the set up ( figure 1c ) , and one attached to the rear of the battery - operated pump . \n both thermocouples were attached at the location of the insulin cartridge . a separate thermometer , with one thermocouple , provided reference air - temperature measurements in both settings . for both ambient - air and environmental - chamber temperature measurements , \n the ir camera was set up on a tripod , targeting the rechargeable pump located in the center of the set up , and capturing all 12 pumps in the ir camera frame . during the ambient - temperature study \n , ir pictures were taken every 60 seconds , and insulin - pump temperature and air temperature were logged every 60 seconds over the course of a 3-hour period . \n ir imaging was used to register and demonstrate temperature changes of all 12 pumps , but thermocouple measurements were conducted on only one sample of each type , to quantify the extent of heating . during the elevated - temperature study , the environmental - chamber was heated to 35c , and the equipment was set up as depicted in figure 1b . the chamber s design allows the pulling of a power cable through to the outside , which can then be plugged in without opening the chamber \n . the environmental - chamber door was securely closed , and 2 hours were allowed before the start of the study to let the temperature return to 35c . \n once the proper temperature was reached , the power strip was plugged in , initiating the charging period for the rechargeable pumps . \n ir pictures were taken every 60 seconds , and insulin pump temperature and air temperature were logged every 60 seconds over the course of a 3-hour period . for both experiments , \n rechargeable pumps were either low on battery or drained when charging initiated , while battery - operated pumps were equipped with new batteries . \n the rechargeable pumps were fully charged after approximately 70 minutes , as judged at the end of the temperature climb . \n the materials and equipment required for this study included an extruded polystyrene rigid - foam insulation board ( 6145.72.5 cm , foamular ; owens corning , toledo , oh , usa ) to prevent stray heat conduction between the experimental pumps . \n the design also included a tis40 infrared ( ir ) camera and two 54 ii b thermometers for measuring air and insulin - pump temperatures ( fluke corporation , everett , wa , usa ) . \n the 54 ii b thermometers , together with chromega alomega thermocouples ( sa1-k-72-sc , gauge 30 [ 0.025 cm ] , length 182.9 cm ; omega engineering inc , stamford , ct , usa ) were used to monitor insulin - pump and ambient temperatures . \n a temperature - controlled environment was simulated in a hotpack environmental - chamber ( 417522 ; sp industries , warminster , pa , usa ) . \n six t : slim pumps ( tandem diabetes care inc , san diego , ca , usa ) were used as insulin pumps with rechargeable batteries . \n six vibe pumps ( animas diabetes care llc , west chester , pa , usa ) were used as insulin pumps with regular batteries . \n high - purity water with food dye ( mccormick , sparks , md , usa ) was used in lieu of insulin to fill cartridges and prime pumps . \n the study set up was constructed and conducted on the extruded polystyrene rigid - foam insulation board in ambient temperature ( figure 1a ) and in a temperature - controlled environmental - chamber ( figure 1b ) . \n two thermometers ( 54 ii b ) were used to measure pump and air temperatures . \n one thermometer was used to measure pump temperatures and required two thermocouples : one attached to the rear of the rechargeable pump located in the center of the set up ( figure 1c ) , and one attached to the rear of the battery - operated pump . \n both thermocouples were attached at the location of the insulin cartridge . a separate thermometer , with one thermocouple , provided reference air - temperature measurements in both settings . for both ambient - air and environmental - chamber temperature measurements , \n the ir camera was set up on a tripod , targeting the rechargeable pump located in the center of the set up , and capturing all 12 pumps in the ir camera frame . during the ambient - temperature study \n , ir pictures were taken every 60 seconds , and insulin - pump temperature and air temperature were logged every 60 seconds over the course of a 3-hour period . \n ir imaging was used to register and demonstrate temperature changes of all 12 pumps , but thermocouple measurements were conducted on only one sample of each type , to quantify the extent of heating . during the elevated - temperature study , the environmental - chamber was heated to 35c , and the equipment was set up as depicted in figure 1b . the chamber s design allows the pulling of a power cable through to the outside , which can then be plugged in without opening the chamber \n . the environmental - chamber door was securely closed , and 2 hours were allowed before the start of the study to let the temperature return to 35c . \n once the proper temperature was reached , the power strip was plugged in , initiating the charging period for the rechargeable pumps . \n ir pictures were taken every 60 seconds , and insulin pump temperature and air temperature were logged every 60 seconds over the course of a 3-hour period . for both experiments , \n rechargeable pumps were either low on battery or drained when charging initiated , while battery - operated pumps were equipped with new batteries . \n the rechargeable pumps were fully charged after approximately 70 minutes , as judged at the end of the temperature climb . \n for the rechargeable pumps , the sensor readouts indicated temperature increases in both the ambient- and elevated - temperature settings . \n an increase of 6.4c from the initial temperature was measured in the ambient - temperature setting ( figure 2 ) . \n the sensor readouts also indicated an increase of 4.4c from the initial temperature in the environmental - chamber setting , which was kept at a constant 35c ( figure 3 ) , with a maximum measured temperature of 40.4c . \n the ir camera also revealed an apparent increase from the initial temperature in the environmental - chamber setting ( figure 4 ) . \n the ir camera showed a 2.7c - higher starting temperature compared with the actual chamber temperature . \n no significant temperature differences were found between the battery - operated pumps in either the environmental - chamber ( 35.9c ) or the ambient setting ( 22.6c ) . \n in this study , temperatures measured during a full charging period of the rechargeable lithium - ion battery pump ( 70 minutes ) were shown to increase substantially over time in both the ambient - temperature setting and in the temperature - controlled environmental - chamber . \n the results further showed that the temperatures of the rechargeable insulin pumps often exceeded 37c in an environment with an elevated temperature of 35c during a full charging period . \n in contrast , the battery - operated pumps showed little or no temperature fluctuation in either environment . \n manufacturers of rechargeable insulin pumps suggest charging the battery for no longer than 1015 minutes per day , possibly to avoid overcharging and the associated consequences described here . \n however , manufacturers do not actually prohibit charging longer,9 and thus a full - charge cycle as tested here is not an unlikely scenario . \n insulin - analog manufacturer specifications indicate that their product should not be exposed to temperatures over 37c.4,5 the labeling information containing instructions for diabetes patients using insulin pumps states that the temperature of the insulin in the pump cartridge may exceed ambient temperature when the pump housing , cover , tubing , or sport case is exposed to sunlight or radiant heat.4 during exploratory experiments in which temperature sensors were placed inside the pump cartridge , additional heating beyond what was observed in the current study was noted ( data not shown ; due to the invasive nature of these exploratory experiments , which required manipulation of the insulin pumps , it was decided that these experiments were not representative of appropriate pump use ) . in the study described here , it was shown that during charging , insulin pumps with rechargeable lithium - ion batteries were subjected to temperature increases that may exceed the recommended temperatures for insulin storage and handling , especially in warm environments \n . these temperature variations may result in unexplained glycemic variability in the patient , as higher temperatures may result in compromised insulin quality . \n by measurements , we have shown that lithium - ion rechargeable batteries , such as those currently used to power insulin pumps , showed substantial temperature increases during a full charging period in both ambient conditions and warm environments compared with battery - operated pumps . \n when charging in warm environments , rechargeable pump temperatures may exceed the temperature recommended for insulin storage and handling , potentially affecting the reliability of insulin action . \n when using lithium - ion rechargeable batteries in the design of new pumps , the implications of these temperature increases should be taken into consideration , as well as the effect heating may have on insulin quality , especially in warmer climates , as mentioned earlier , as the effects were largest in the environmental - chamber .", "role": "user" }, { "content": "the role of continuous subcutaneous insulin infusion ( insulin pumps ) has become increasingly important in diabetes management , and many different types of these systems are currently available . \n this exploratory study focused on the reported heating issues that lithium - ion battery - powered pumps may have during charging compared with battery - operated pumps . \n it was found that pump temperature increased by 6.4c during a long charging cycle of a lithiumion battery - operated pump under ambient temperatures . in an environmental - chamber \n kept at 35c , the pump temperature increased by 4.4c , which indicates that the pump temperature was above that of the recommended safety limit for insulin storage of 37c . when designing new pumps , and when using currently available rechargeable pumps in warmer climates , the implications of these temperature increases should be taken into consideration . \n future studies should also further examine insulin quality after charging .", "role": "assistant" } ]