Datasets:

tsharish

/

pubmed-summarization-1k

like 0

[ { "content": "You are a medical writer. Summarize the following article: encephalitis is an inflammatory process of the brain parenchyma associated with clinical evidence of brain dysfunction due to infectious , immune - mediated or primary inflammatory causes . of all identifiable infectious agents , \n virus and bacteria account for 90% , with ameba , though rare , also being capable of causing infectious encephalitis . \n free - living amebas are widely distributed in nature , especially in fresh water and soil , but may occasionally invade and live as a parasite in the human tissue . \n several species of acanthamoeba , balamuthia mandrillaris , naegleria fowleri , and sappinia pedata are pathogenic and opportunistic free - living amebas known to cause diseases in humans . since the first case of amebic encephalitis was reported in 1965 , free - living amebas have increasingly been recognized as a pathogen causing central nervous system infections in humans . \n pathogenic free - living amebas cause 2 distinct clinical forms of encephalitis ; primary amebic meningoencephalitis ( pam ) and granulomatous amebic encephalitis ( gae ) . \n pam , caused by n. fowleri , is characterized by a fulminant course of disease with rapid progression to coma and death within a few days . on the other hand , gae , caused by acanthamoeba spp . or b. mandrillaris , usually runs a subacute to chronic course , and eventually progresses to death . \n due to its rarity , difficulty in diagnosis and lack of proven effective treatment , only 10 patients with balamuthia amebic encephalitis ( bae ) were reported to have survived thus far [ 6 - 15 ] . \n the purpose of this report was to demonstrate the clinical presentation , investigation , and treatment outcome of a child with bae , and to review the literature on cases with successful management . \n this report was informed and exempted by the institutional review board , faculty of medicine , chulalongkorn university , thailand . \n a previously healthy 4-year - old thai female patient initially presented with 1-month history of subacute intermittent bi - temporal headache with projectile vomiting , in the absence of fever or diarrhea . \n two weeks later , she developed unstable gait to the right side , and loss of distance approximation . \n there was no history of major illnesses , including sinusitis , pneumonia , chronic skin lesion , or any history of swimming in fresh water . \n she lived in buriram province , the northeastern part of thailand in rural settings , exposed to soil . \n abnormal neurological signs were head tilt to the right , jerky pursuit with nystagmus , hypometric succade , wide - based gait , and dysdiadochokinesia , which indicated right cerebellar hemispheric lesion . \n computer tomography ( ct ) scan of the brain at a local hospital showed an ill - defined 4.4 cm isodensity mass without calcification in the posterior fossa displaying heterogeneous enhancement on post - contrast study and obstructive hydrocephalus . \n magnetic resonance imaging ( mri ) of the brain at king chulalongkorn memorial hospital ( fig . \n 1 ) showed a 3.04.12.5 cm ill - defined infiltrating heterogeneously enhanced mass mainly occupying the right inferior cerebellar hemisphere with perilesional edema , causing right tonsillar herniation and mild obstructive hydrocephalus , highly suspicious for a malignant tumor such as medulloblastoma or high - grade glioma . \n total excision of the mass was performed on day 7 , and intraoperative finding revealed an infiltrative mass at the right cerebellum involving the hemisphere and tonsil with yellowish plaque and small cystic degeneration . \n the specimen was fixed in 10% neutral formalin , routinely processed , and embedded in paraffin wax . \n pathological examination demonstrated severely inflamed cerebellar tissue , with presence of scattered amebic trophozoites ( fig . \n dense lymphocyte infiltrates , aggregates of foamy histiocytes , few vague granulomata , and foci of tissue necrosis were found . \n the pathological diagnosis of amebic meningoencephalitis led to a prompt start of combined therapy of pentamidine ( 4 mg / kg / day ) , sulfasalazine ( 200 mg / kg / day ) , fluconazole ( 12 mg / kg / day ) , clarithromycin ( 14 mg / kg / day ) , and amphotericin b ( 1 mg / kg / day ) . \n on postoperative day 5 , cerebrospinal fluid ( csf ) obtained from lumbar puncture showed lymphocytic pleocytosis ( wbc 225 cell / mm , mononuclear cell 100% , \n rbc 157 cell / mm ) with increased protein of 148 mg / dl and decreased glucose levels of 27 mg / dl ( serum glucose level=126 mg / dl ) . \n no organisms were identified on gram and acid - fast bacillus stain and an indian ink preparation . \n these findings were consistent with amebic meningoencephalitis . in order to identify the specific causative agent , further molecular characterization \n was then performed , using the formalin - fixed brain tissue and fresh csf sample as detailed below . \n the dna was extracted from 1 mg of brain tissue samples and 100 l ( confirm needed ) csf . \n the standard organic method ( phenol - chloroform extraction and alcohol precipitation ) was applied for the dna extraction . \n the resulting pellet was resuspended in a final volume of 30 l of deionized water . \n the gene encoding 18s rrna was amplified by pcr using specific primer sets . the reaction mixture consisted of 10 l of 2.5x mastermix ( eppendorf , hamburg , germany ) , 2 l of template , \n 0.5 m of each forward and reverse primer , and nuclease - free water to a final volume of 25 l . \n the reactions comprised of initial denaturation at 94 for 3 min , followed by 40 cycles of denaturation at 94 for 30 sec , annealing at 55 for 45 sec and extension at 72 for 60 sec , and concluded by a final extension step at 72 for 7 min . \n the pcr products were subjected to 2% agarose gel electrophoresis ( fmc bioproducts rockland , maine , usa ) and upon staining with ethidium bromide , visualized on a uv transilluminator . \n the band of the expected size was excised from the gel and purified using the agarose gel extraction mini kit ( 5prime , hamburg , germany ) according to the manufacturer 's specifications . \n the purified dna was sequenced by first - base laboratories sdnbhd ( selangor darul ehsan , malaysia ) . \n the nucleotide sequences were analyzed by basic local alignment search tool ( blast ) ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) . \n direct sequencing of dna extracted from both brain tissue and csf showed 18s rdna of b. mandrillaris after blast analysis . \n the lasergene 6 package ( dnastar , madison , wisconsin , usa ) was used to assemble the nucleotide sequences . \n the positive sequences were compared with the reference sequences ( af019071 ) available at genbank . \n alignment of the 18s ribosomal dna sequences was performed by using clustal w applying the bioedit program ( version 7.0.4.1 ) . \n phylogenetic trees were constructed for sequence analysis applying the neighbor - joining ( nj ) method of the mega 4.0 program and support tree topologies by boot - strapping applied with 1,000 replicates . according to fig . \n 3 , the phylogenetic tree also showed that this sequence is grouped with b. mandrillaris . \n an initial clinical response was noted for several days following surgical treatment and combined medical treatment . a follow - up ct scan ( fig . \n however , the patient gradually deteriorated and eventually succumbed to multiple organ failure and brain death ( declared on postoperative day 37 ) , approximately 3 months after her first clinical symptoms . \n the dna was extracted from 1 mg of brain tissue samples and 100 l ( confirm needed ) csf . \n the standard organic method ( phenol - chloroform extraction and alcohol precipitation ) was applied for the dna extraction . \n the resulting pellet was resuspended in a final volume of 30 l of deionized water . \n the reaction mixture consisted of 10 l of 2.5x mastermix ( eppendorf , hamburg , germany ) , 2 l of template , 0.5 m of each forward and reverse primer , and nuclease - free water to a final volume of 25 l . \n the reactions comprised of initial denaturation at 94 for 3 min , followed by 40 cycles of denaturation at 94 for 30 sec , annealing at 55 for 45 sec and extension at 72 for 60 sec , and concluded by a final extension step at 72 for 7 min . \n the pcr products were subjected to 2% agarose gel electrophoresis ( fmc bioproducts rockland , maine , usa ) and upon staining with ethidium bromide , visualized on a uv transilluminator . \n the band of the expected size was excised from the gel and purified using the agarose gel extraction mini kit ( 5prime , hamburg , germany ) according to the manufacturer 's specifications . \n the purified dna was sequenced by first - base laboratories sdnbhd ( selangor darul ehsan , malaysia ) . \n the nucleotide sequences were analyzed by basic local alignment search tool ( blast ) ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) . \n direct sequencing of dna extracted from both brain tissue and csf showed 18s rdna of b. mandrillaris after blast analysis . \n the lasergene 6 package ( dnastar , madison , wisconsin , usa ) was used to assemble the nucleotide sequences . \n the positive sequences were compared with the reference sequences ( af019071 ) available at genbank . \n alignment of the 18s ribosomal dna sequences was performed by using clustal w applying the bioedit program ( version 7.0.4.1 ) . \n phylogenetic trees were constructed for sequence analysis applying the neighbor - joining ( nj ) method of the mega 4.0 program and support tree topologies by boot - strapping applied with 1,000 replicates . according to fig . \n 3 , the phylogenetic tree also showed that this sequence is grouped with b. mandrillaris . \n an initial clinical response was noted for several days following surgical treatment and combined medical treatment . a follow - up ct scan ( fig . \n however , the patient gradually deteriorated and eventually succumbed to multiple organ failure and brain death ( declared on postoperative day 37 ) , approximately 3 months after her first clinical symptoms . \n b. mandrillaris , formerly known as leptomyxoid ameba ( leptomyxidae ) , was first identified in the brain of a pregnant mandrill baboon having died of encephalitis in 1986 . in humans , it can cause diseases in both immunocompromised or immunocompetent individuals , especially young children and the elderly . recently \n , it has also been reported in solid organ transplant recipients . to date , approximately 150 cases of bae have been reported worldwide , mostly in the warm regions of the american continent , asia , australia , and europe . \n the first case of bae in thailand and southeast asia has been reported by intalapaporn et al . . \n the case involved a 23-year - old healthy man with prior history of motorcycle accident and upon falling into a swamp 6 months before , he developed a chronic nasal ulcer and had progressive central nervous system ( cns ) deterioration leading to death in spite of receiving full empirical treatment . at autopsy \n , his brain section was sent for fluorescent immunohistochemical analysis to confirm b. mandrillaris infection . however , our case was the first thai child with a premortal diagnosis of bae . \n like other amebas , b. mandrillaris can be isolated from soil samples and fresh water . \n b. mandrillaris can invade through skin wounds or be inhaled through nose or mouth , causing draining ulcers , chronic sinusitis or pneumonia before spreading hematogeneously to the cns . \n the skin lesion is typically a painless plaque or ulcer in the center of the face or extremity ( especially the knee ) . \n correct identification of the skin lesion is of great importance , allowing early diagnosis , weeks or months prior to cns manifestation . nevertheless , most patients , including the present case , presented with neurological involvement from the start , without skin manifestation . \n cns symptoms consist of fever , personality changes , headache , focal seizures , nonspecific cranial nerve dysfunction , or localized motor deficit . \n signs of increased intracranial pressure and alteration of consciousness may develop later as the disease progresses . \n due to the indolent clinical course , bae is difficult to diagnose and mostly recognized postmortem . \n csf usually reveals lymphocyte pleocytosis , with mild to severe elevation of protein levels ( > 1,000 mg / dl ) and normal to low glucose levels which are nonspecific . as b. mandrillaris trophozoites \n are rarely found in the csf , a large number of patients were initially misdiagnosed for other organisms . \n ct scan and mri typically show multifocally enhanced mass - like lesions with ring enhancement , edema , and hydrocephalus mimicking brain abscess , brain metastasis , or intracerebral hematoma . \n a small number of solitary mass lesion was also reported [ 8 - 10,25,26 ] which mimicked a brain tumor with no obvious sign of encephalitis , similar to our case . \n interestingly , a single mass in most cases situated in the anterior cranial fossa . to the best of our knowledge , this was the first case of bae manifesting with a solitary cerebellar mass lesion . \n diagnosis of amebic encephalitis can be confirmed by microscopic identification of characteristic amebic trophozoites in the skin or brain tissue or in csf . \n skin and brain pathology typically show granulomatous inflammation formed by aggregation of foamy macrophages , multinucleated giant cells , and lymphocytes . \n other findings may include presence of neutrophils , eosinophils , and small foci of vasculitis producing large areas of hemorrhage , infarction , and necrosis . \n 3 ) , it is not possible to morphologically distinguish between these 2 amebas . moreover , \n gae caused by acanthamoeba spp . or b. mandrillaris are similar in terms of clinical course , neuroimaging , and pathological findings . therefore , the diagnosis must be confirmed with indirect immunofluorescence ( iif ) techniques , immunohistochemistry ( ihc ) , or pcr . since iif and ihc techniques for these amebas \n are readily available in only few specialized centers such as the centers for disease control and prevention ( cdc ; atlanta , georgia , usa ) , pcr technique , as performed on our patient , may be a more easily accessible tool leading to an earlier diagnosis and treatment of bae before mortality . \n further to our own case , 10 patients who had survived bae were searched for under \" balamuthia \" in medline ( pubmed ) . \n the 10 cases were summarized ( table 1 ) and reviewed in order to demonstrate common factors or antimicrobial agents that may contribute to a better chance of survival . \n the 10 survivors were distributed equally into 3 age groups , 4 children ( < 12 years ) , 3 middle - aged patients ( 13 - 60 years ) , and 3 elderly patients ( > 60 years ) . according to the data collected from all bae cases \n , the proportion of elderly patients who survived appeared to be the highest , approximately 25% survival compared to less than 10% survival in the other groups . \n concerning gender , male individuals were more susceptible to bae , with male : female ratio of 2.5:1 , since they tend to be exposed to outdoor activities more than in females . \n thus , the proportion of female survivors outnumbered that of males , with approximately 15% survival in females and 5% survival in males . \n hence , female gender may play some role in increasing the chances of survival of these patients . \n skin lesions are the first clinical manifestation preceding neurological symptoms in approximately 1/4 of all patients with bae . \n therefore , skin manifestation may allow for early recognition and diagnosis of bae leading to prompt treatment which potentially increase the patient 's chances of survival . in terms of treatment , \n apart from surgical approach , multi - drug regimens based on in vitro data and the clinical experience in successfully treated cases were also administered . \n the novel antimicrobial drug needs to have amebicidal activity , good penetration through the blood - brain barrier with minimal toxicity . \n pentamidine , propamidine isethionates , polymyxin b , gramicidin s , and miltefosine were found to have strong inhibitory effects in vitro against b. mandrillaris . \n unfortunately , some of these amebicidal agents are of limited use because they are not suitable for parenteral use , except for miltefosine in 1 survivor and pentamidine in 4 survivors , including our patient . other antimicrobial agents with little or no in vitro effects included azithromycin , clarithromycin , the azole compounds , trimethoprim , sulfamethoxazole , and amphotericin b . of the 9 survivors with documented specific antimicrobial treatment regimens , almost all have shown similar treatment regimens consisting of azoles ( fluconazole , itraconazole ) in 8 of 9 survivors , macrolides ( clarithromycin , azithromycin ) in 7 of 9 survivors . \n in contrast with in vitro study results , azoles and macrolides may represent good choices as potential antimicrobial agents for treating bae . \n the optimal duration of drug therapy for bae has not yet been ascertained due to the complete absence of any validated biochemical markers of response to treatment , but most survivors had been treated for a few months up to more than 5 years . however , long - term use of multiple drugs might be limited by some undesirable side effects , such as hyperglycemia due to pentamidine or hyponatremia due to thioridazine , resulting in discontinuation of medications . \n currently , patients recently diagnosed with this disease are being treated according to the reported successful regimens ; however , case fatality of this disease is still high . due to the limited number of survivors reported \n , the prognostic factors and effective treatment regimens have so far remained elusive and require more detailed further research . \n although it has become more recognizable among physicians , more case reports and additional research will still be required for more information and a better insight into this disease . a high index of suspicion of clinicians , immunostaining or molecular techniques to promote early diagnosis , multidisciplinary team approach , and prompt initiation of antimicrobial therapy are key factors which might improve survival of the patients .", "role": "user" }, { "content": "balamuthia mandrillaris is one of the 4 amebas in fresh water and soil that cause diseases in humans . \n granulomatous amebic encephalitis ( gae ) , caused by b. mandrillaris , is a rare but life - threatening condition . a 4-year - old , previously healthy , thai girl presented with progressive headache and ataxia for over a month . \n neuroimaging studies showed an infiltrative mass at the right cerebellar hemisphere mimicking a malignant cerebellar tumor . \n the pathological finding after total mass removal revealed severe necrotizing inflammation , with presence of scattered amebic trophozoites . \n cerebrospinal fluid ( csf ) obtained from lumbar puncture showed evidence of non - specific inflammation without identifiable organisms . \n a combination of pentamidine , sulfasalazine , fluconazole , and clarithromycin had been initiated promptly before pcr confirmed the diagnosis of balamuthia amebic encephalitis ( bae ) . \n the patient showed initial improvement after the surgery and combined medical treatment , but gradually deteriorated and died of multiple organ failure within 46 days upon admission despite early diagnosis and treatment . \n in addition to the case , 10 survivors of bae reported in the pubmed database were briefly reviewed in an attempt to identify the possible factors leading to survival of the patients diagnosed with this rare disease .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: both coal tar - salicylic and calcipotriol / betamethasone ointment are topical agents for the treatment of limited chronic plaque psoriasis . \n coal tar - salicylic acid is a conventional and inexpensive agent while calcipotriol / betamethasone is a new and relatively expensive topical modality . \n psoriasis is a common papulosquamous skin disorder affecting 1 - 2% of the world 's population . in the majority of cases , \n several topical modalities have been found effective in limited chronic plaque psoriasis including , topical steroids , coal tar , anthralin , tazarotene and the vitamin d analogue calcipotriol ( calcipotriene ) alone or in combination with betamethasone dipropionate . \n purified coal tar has been found to have high efficacy and good safety profile . in a study by kumar \n 5% crude coal tar ointment was shown to induce 75% reduction in erythema severity index ( esi ) in 59% of patients at 12 weeks . \n calcipotriol / betamethasone dipropionate is a relatively new topical agent and there are numerous studies to document its efficacy in psoriasis . \n it has been shown to produce significantly greater reduction in psoriasis area severity index ( pasi ) of 68.6% at week 4 compared with placebo ( 26.6% ) . \n it has also been found to be superior to formulations containing calcipotriol alone or tacalcitol . to the best of our knowledge \n there is no study comparing the efficacy and safety of conventional coal tar application with calcipotriol / betamethasone dipropionate ointment in limited chronic plaque psoriasis . \n a prospective open label randomized trial was conducted in patients of limited chronic plaque psoriasis ( i.e. involving body surface area < 10% ) , who were off all topical medications in last 15 days and oral medications in last 1 month . \n patients were randomized into two groups using a computer - generated random number table from the website http://www.randomizer.org . \n patients in group a received topical application of 6% coal tar-3% salicylic acid ointment ( salytar - ws shalaks / invida pharmaceuticals pvt . ltd ) every night and group b received calcipotriol / betamethasone dipropionate ointment ( daivobet ointment , win medicare ) every night for 12 weeks . \n the endpoint was 12 weeks of treatment or attainment of pasi score 0 , whichever was earlier . \n patients were withdrawn from the study if there was < 25% reduction in pasi at week 8 , deterioration or serious side - effects warranting withdrawal . \n patients were followed - up at weeks 2 , 4 , 8 and 12 and assessed for disease severity by pasi score , patient 's perception of disease severity ( patient global assessment [ pga ] ) on a scale of 0 - 10 with 10 being baseline disease and 0 being no disease and adverse effects . \n the following definitions were used for assessing treatment outcome \n complete clearance - attainment of pasi score 0 at any point of time during the treatment period.responders-attainment of pasi 50 at the end point of treatment ( complete clearance cases + cases achieving 50 pasi < 100).poor responders - attainment of pasi < 50 at the end point of treatment.deterioration-increase in pasi from baseline any time during 12 weeks of treatment.relapse-appearance of disease in the treatment phase after attaining pasi score 0 and stopping treatment.loss to follow - up : any patient who did not return for the follow - up visits after initiation of treatment . \n complete clearance - attainment of pasi score 0 at any point of time during the treatment period . \n responders - attainment of pasi 50 at the end point of treatment ( complete clearance cases + cases achieving 50 pasi < 100 ) . \n relapse - appearance of disease in the treatment phase after attaining pasi score 0 and stopping treatment . \n loss to follow - up : any patient who did not return for the follow - up visits after initiation of treatment . \n the primary efficacy parameter was a comparison of reduction in pasi from baseline to endpoint of treatment or week 12 . \n secondary efficacy parameters were mean reduction in pasi at each follow - up visit , proportion of patients achieving pasi 75 and pasi 50 at week 12 or end point of treatment whichever , earlier and pga score . \n other treatment outcomes such as complete clearance , responders , poor responders , deterioration and relapse were also compared between the two groups . \n two - sample wilcoxon rank - sum ( mann - whitney ) test was used to assess statistical significance of difference in pasi , pga , mean reduction and mean percentage reduction in pasi at each visit between two groups . \n chi - square test was used to assess statistical significance of achievement of pasi 75 and pasi 50 in two groups . \n two - sample wilcoxon rank - sum ( mann - whitney ) test was used to assess statistical significance of difference in pasi , pga , mean reduction and mean percentage reduction in pasi at each visit between two groups . \n chi - square test was used to assess statistical significance of achievement of pasi 75 and pasi 50 in two groups . \n a total of 62 patients were randomized into two groups : 33 patients in group a ( coal tar - salicylic acid group ) and 29 patients in group b ( calcipotriol / betamethasone dipropionate group ) . of these 13 patients in group a and 8 in group b \n hence 20 cases in group a and 21 in group b completed the study period [ figure 1 ] . \n mean pasi score at baseline in group a ( mean psoriasis area and severity index [ mpasi ] = 5.2 ) was comparable with group b ( mpasi = 4.4 ) . \n enrolment of cases in the study after treatment , mean pasi at week 2 was significantly lower in group b ( 2.7 ) compared with group a ( 4.4 ) and the results were statistically significant ( p = 0.01 ; z = 2.55 ) . \n mean pasi at week 4 was also significantly lower in group b ( 2.3 ) compared with group a ( 3.5 ) ( p = 0.05 ; z = 1.96 ) , but there was no significant difference in mean pasi at week 8 ( mpasi a = 2.9 and mpasi b = 2.6 ; p = 0.39 ; z = 86 ) and week 12 ( mpasi a = 2 and mpasi b = 2.59 ; p=0.17 ; z = 1.36 ) [ figure 2 ] . \n mean percentage reduction in pasi was significantly higher in group b compared with group a at week 2 ( 15.4% in group a vs. 38.6% in group b ) ( p = 0.02 ; z = 2.36 ) , but not at subsequent follow - up visits . \n mean percentage reduction in pasi at week 12 was 61.5% in group a versus 40.7% in group b ( p = 0.18 ; z = 1.34 ) . \n hence at treatment completion , there was no statistically significant difference in pasi score or pasi reduction between the two groups . \n mean psoriasis area severity index score in two treatment groups at each follow - up visit pasi 50 was attained by 8 of 20 cases ( 40% ) patients in group a compared to 9 of 21 ( 42.8% ) patients in group b ( p = 0.36 ; = 1.48 ; d.f . \n pasi 75 was achieved by 2 of 20 ( 10% ) patients in group a compared to 6 out of 21 ( 28.5% ) patients in group b ( p = 0.92 ; = 0.33 ; d.f . \n comparison of treatment outcomes in the two groups the difference in disease outcome at the end of treatment between the two groups was not statistically significant ( p = 0.303 ; = 5.07 ; d.f . \n one case ( 5% ) in coal tar group and 4 ( 19% ) in calcipotriol / betamethasone group had complete clearance of the disease during the treatment phase . of the four cases in group b who achieved complete clearance \n the only case who cleared completely in group a , did not relapse during 12 weeks of the study . \n pga scores were significantly lower in group b compared to group a at week 2 ( 6.75 and 8.24 respectively ) and week 4 ( 5.41 and 7.92 respectively ) ; ( p = 0.003 ; z = 2.95 and p = 0.007 ; z = 2.70 respectively ) . in subsequent follow - up visits , \n pga scores were comparable and not statistically significant in the two groups [ figure 3 ] . \n mean patient global assessment scores in two treatment groups at each follow - up visit no side - effects were observed in the 2 groups . \n unpleasant odor and staining of clothes was not reported by any patient in both groups . \n these include keratolytics , coal tar , corticosteroids , anthralin , topical puva , calcipotriol alone and in combination with topical steroids ( betamethasone dipropionate or mometasone ) and tazarotene . \n the antipsoriatic efficacy of coal tar and calcipotriol / betamethasone has been individually reported in a number of studies . \n coal tar is one of the most commonly used , cheap , safe and effective treatment for psoriasis and its utility , either alone or in combination with phototherapy has been proved in many studies . \n salicylic acid present in commercially available coal tar ointments reduces the thickness and scaling of psoriatic plaques , thereby enhancing the penetration of the active medication . in the study by kumar \n et al . , all patients reported at least 50% reduction and 59.3% had greater than 75% reduction in esi score with 5% crude coal tar . its clinical efficacy was found comparable with 0.1% tazarotene gel . in our study , \n pasi 50 was achieved in 40% cases and pasi 75 in 10% cases after 12 weeks of treatment with coal tar - salicylic acid ointment . \n calcipotriol , a vitamin d analogue , has proven to be highly efficacious in limited chronic plaque psoriasis . \n there are few trials comparing its efficacy with other topical agents such as steroids and coal tar , but have shown conflicting results . \n sharma et al . reported > 50% reduction in esi score at week 4 in 60% of lesions treated with calcipotriol compared to 23.3% of lesions treated with coal tar ( p < 0.01 ) ; however , there was no significant difference observed for the same parameter at week 12 . \n reported greater reduction in disease severity with twice daily calcipotriol application group compared to coal tar - allantoin - hydrocortisone group at week 8 . \n tham et al . found faster reduction in pasi score with calcipotriol twice a day compared to coal tar , 15% w / v cream applied once a day and also found the difference to be significant at all follow - up visits ( weeks 2 , 4 and 6 ) . \n they reported that with calcipotriol , rapid improvement was seen in 1 2 weeks of treatment while significant response was seen with coal tar only after 4 weeks of treatment . \n on comparing liquor carbonis detergens ( lcd ) 15% coal tar solution with calcipotriene 0.005% cream twice daily for 12 weeks , reported significantly greater mean reductions in pasi scores at week 12 with lcd ( 58% vs. 37% ) . \n in addition , significantly higher number of patients in lcd group had absent or minimal psoriasis on the pga scale than the calcipotriene group and improvement was better maintained on 6 weeks follow - up in the same group . \n the two - compound formulation of calcipotriol with betamethasone has been found to be superior to either component used alone in a large trial on 1605 patients , in which end point of absent - to - mild disease was achieved in 48% patients treated with a calcipotriene - betamethasone combination compared to only 16.5% patients treated with calcipotriene alone and 26.3% patients treated with betamethasone alone . \n another study found the efficacy of calcipotriol / betamethasone formulation to be better than calcipotriol alone at 2 and 4 weeks follow - up and showed a greater reduction in mean pasi in the combined formulation group ( 68.6% in once daily , 73.8% in twice daily group ) than in the twice daily calcipotriol alone group ( 58.8% ) and the vehicle group ( 26.6% ) . \n pubmed search did not yield any literature on studies comparing coal tar with a calcipotriol - betamethasone combination our study showed that though a calcipotriol - betamethasone combination resulted in an initial more rapid reduction in pasi ( weeks 2 and 4 ) , but this difference was not sustained at later follow - up visits . at the end of the treatment phase , greater mean reduction in pasi was achieved with coal tar - salicylic acid combination . \n greater though not significant number of cases achieved complete clearance , pasi 50 and 75 with a calcipotriol - betamethasone combination . \n there was no staining of clothes or irritation with coal tar possibly because a refined commercially available tar formulation was used instead of crude coal tar . \n calcipotriol / betamethasone two compound formulation leads to significantly faster clinical improvement and patient satisfaction than coal tar ointment applied once daily , but this effect is not sustained and the results are comparable after 12 weeks of treatment . \n a limitation of our study was high drop - out rate of cases in both groups . \n hence further studies with larger sample size are required to compare calcipotriol / betamethasone ointment with conventional topical agents . \n there are few comparative studies on topical therapies for management of limited chronic plaque psoriasis and none between the conventional coal tar - salicylic acid and . \n this study compares the efficacy of these two agents in the management of limited chronic plaque psoriasis and finds them to have similar efficacy at the end of the treatment phase , but an initial more rapid decline in pasi score with calcipotriol / betamethasone compared with coal tar .", "role": "user" }, { "content": "background : chronic plaque psoriasis is a common papulosquamous skin disorder , for which a number of topical agents are being used including coal tar , topical steroids and more recently topical calcipotriol / betamethasone dipropionate . there is no study comparing purified coal tar preparation with calcipotriol / betamethasone dipropionate ointment in limited chronic plaque psoriasis.aims and objectives : a prospective randomized open label controlled trial to compare the efficacy and safety of topical application of coal tar - salicylic acid ointment with calcipotriol / betamethasone dipropionate ointment applied once at night for 12 weeks for the treatment of limited chronic plaque psoriasis.materials and methods : a total of 62 patients of limited chronic plaque psoriasis ( body surface area < 10% ) were randomized into two treatment groups : group a received topical application of 6% coal tar with 3% salicylic acid ointment and group b received calcipotriol / betamethasone dipropionate , once at night for 12 weeks . \n results were assessed based on psoriasis area severity index ( pasi ) scores and patient global assessment ( pga ) at each visit.results:mean pasi was significantly lower at week 2 ( p = 0.01 ) and week 4 follow - up ( p = 0.05 ) and the mean reduction in pasi was significantly higher at week 2 ( p = 0.02 ) with calcipotriol / betamethasone than coal tar - salicylic acid , but this difference was not sustained at subsequent follow - up visits . similarly , pga scores at weeks 2 and 4 were significantly lower with calcipotriol / betamethasone dipropionate ointment ( p = 0.003 and p = 0.007 respectively ) . \n there was no significant difference in any parameter during subsequent follow - up visits or at the end of the treatment phase ( 12 weeks).conclusion : topical nightly application of calcipotriol / betamethasone dipropionate ointment leads to an initial , more rapid reduction in disease severity , but the overall outcome parameters are comparable in the two treatment groups .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: all the animal - related procedures were complied with the association for research in vision and opthamology ( arvo ) statement for the use of animals in ophthalmic and vision research . \n thirty - six healthy new - zealand white rabbits weighing 2500 - 3000 g were divided into 6 equal groups . \n the right eyes of rabbits in group 1 to group 5 received 2 10 colony - forming unit ( cfu)/0.1 ml intravitreal injections of p. aeruginosa suspension . \n rabbits in group 2 to group 5 were treated with intravitreal antibiotics ( group 2 = 0.5 mg/0.1 ml cefepime , group 3 = 1 mg/0.1 ml cefepime , group 4 = 2 mg/0.1 ml cefepime , group 5 = 1 mg/0.1 ml ceftazidime ) . \n the antibiotics were injected into the vitreous cavity by using a 30-gauge needle attached to a tuberculin syringe . \n the eyes of rabbits in each group were examined clinically on 1 , 3 , and 6 day of the experiment . \n severity of endophthalmitis was graded clinically by using a scoring system that previously reported by pleyer et al . at 6 day , \n 0.1 ml vitreous humor aspirates were obtained and plated for quantification on blood agar and the results were expressed as cfu / ml . \n statistical analysis was performed with the spss version 15 to determine the differences between the three treatment groups . \n the wilcoxon test , mann - whitney u test , and kruskal - wallis test were used in the statistical analysis as indicated . \n the mean and the standard deviation of clinical scores in 1 , 3 and 6 day after inoculation in groups are presented in table 1 . in 3 day \n , there was no clinical difference between group 1 and group 2 , but in 6 day a marked decline was noted in the clinical inflammatory findings in all treatment groups when compared with group 1 . the mean and the standard deviation of clinical , histopathological and culture ( cfu / ml ) results in groups mean and standard deviation of cfu / ml values in groups are given in table 1 . \n there was no statistically significant differences in mean cfu / ml values between treatment groups ( group 2 to group 5 ) , but the mean cfu / ml values of eyes in these groups and in group 1 were significantly higher when compared with uninfected controls . the mean and the standard deviation of the histopathological scores in groups are presented in table 1 . \n histopathological examination in group 1 and in group 2 denoted severe inflammation in the vitreous cavity and total destruction of the retinal architecture [ figs . \n the view of normal retinal architecture in group 6 ( control group ) ( h and e , 100 ) severe exudation and abscess formation in the vitreous cavity , dense inflammation in retina and total destruction of the retinal architecture and total retinal detachment is seen in one eye in group 1 ( untreated infected group ) ( h and e , 100 ) abscess formation in the vitreous cavity , dense inflammation in retina and diffuse retinal necrosis and retinal detachment is seen in an eye in group 2 ( 0.5 mg / ml cefepime ) ( h and e , 100 ) preservation of retinal architecture , minimal neutrophil infiltration , and minimal exudation in vitreous cavity is seen in one eye in group 3 ( 1 mg / ml cefepime ) ( h and e , 100 ) \n available data suggest that the cefepime may have advantages over ceftazidime owing to a broader spectrum of activity and reduced potential for development of bacterial resistance . compared with ceftazidime , cefepime has enhanced activity in vitro against gram positive bacteria , including meticillin - sensitive staphylococcus aureus and streptococcus pneumoniae . \n cefepime has better activity against gram - negative bacteria that produce extended spectrum -lactamase and has broadened antipseudomonal activity than the ceftazidime . \n jay and shockley delineated the dose - and time - dependent retinal toxicity of cefepime using electroretinography in pigmented rabbit eyes . \n electroretinographic patterns at 1 and 2 weeks indicated a toxic response to 20 mg of cefepime . \n b - waves were normal at 1 and 2 weeks for rabbits receiving doses of 0.5 mg to 10 mg . \n pharmacokinetic analysis after single intra - vitreal injection of 1 mg of cefepime disclosed the following vitreous fluid levels ( g / ml ) : 645 at o h , 431 at 8 h , 235 at 24 h , and 23 at 72 h. peak aqueous humor levels ( 56 g / ml ) were observed at 8 h after injection . \n the evaluation of clinical results in this study demonstrated that in 3 day after inoculation there was no difference between group 1 and group 2 , but in 6 day , a marked decline was noted in the clinical inflammatory findings in all treatment groups when compared with group 1 . \n these findings suggest that 0.5 mg/0.1 ml intravitreal cefepime was not sufficient to clinically control the p. aeruginosa endophthalmitis . \n bacterial culture results showed us there was no statistically significant difference in mean cfus / ml values between the treatment groups , but in group 4 ( 2 mg/0.1 ml cefepime ) the mean cfu / ml value was the least . \n histopathological examination in group 1 and in group 2 denoted severe exudation and abscess formation in the vitreous cavity , dense inflammation in the retina and total destruction of the retinal architecture and partial or total retinal detachment . \n these results imply that 0.5 mg/0.1 ml cefepime was not satisfactory for preserving of normal retinal architecture . in summary \n , intravitreal cefepime may be an alternative drug in the treatment of p. aeruginosa endophthalmitis . \n clinical and the histopathological results in our study indicate that 0.5 mg / ml cefepime is not satisfactory in the treatment of p. aeruginosa endophthalmitis . \n intra - vitreal 1 mg/0.1 ml cefepime is as effective as intra - vitreal 1 mg/0.1 ml ceftazidime . \n although increasing the intra - vitreal cefepime dose beyond 1 mg/0.1 ml provides additional benefits , this is not statistically significant . \n hypothetically , taking into consideration the broad spectrum and lower resistance rates of cefepime , it may be an alternative drug in the treatment of endophthalmitis caused by other bacteria . \n further , in vivo and in vitro studies need to be carried out to more accurately assess this subject .", "role": "user" }, { "content": "in this study , we evaluated the efficiency of cefepime in the treatment of experimental pseudomonas aeruginosa endophthalmitis . \n we compared the findings with the standard dose of ceftazidime ( 1 mg/0.1 ml ) . \n thirty - six new - zealand white rabbits were divided into 6 equal groups and were treated with different methods ( group 1 = sham , group 2 = 0.5 mg/0.1 ml cefepime , group 3 = 1 mg/0.1 ml cefepime , group 4 = 2 mg/0.1 ml cefepime , group 5 = 1 mg/0.1 ml ceftazidime , group 6 = control ) . \n the eyes of rabbits in each group were examined clinically on 1st , 3rd , and 6th day of the experiment . at 6th day , 0.1 ml vitreous humor aspirates were obtained and plated for quantification on the blood agar and the results were expressed as colony - forming unit / ml . \n subsequently , the eyeballs were enucleated and the histopathological evaluation was performed . \n our findings denoted beneficial effects of cefepime in treatment groups ( especially , in groups 3 and 4 ) . \n intravitreal cefepime may be an alternative drug in the treatment of p. aeruginosa endophthalmitis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 56-year - old man was admitted to the hospital because of traumatic brain injury after falling down some stairs . on admission to our emergency department , multiple bruises and laceration of the scalp were noted . on physical examination \n , he scored 13/15 on the glasgow coma scale . a computed tomography ( ct ) scan showed cerebral epidural hematoma with a linear skull fracture at the right temporoparietal region . \n two months later , he presented with lower back pain and right leg pain that had insidiously developed . \n as time passed , the patient 's symptoms had become aggravated and he had difficulty walking despite analgesic medication . \n the patient 's capacity on a straight leg raise was diminished to 50 degrees on the right leg . \n magnetic resonance imaging ( mri ) revealed a large cystic lesion on the lumbar spine ( fig . \n a ct scan showed a minimal fracture on the l4 lamina and adjoined l5 superior facet joint ( fig . \n the cyst was noted around the right l4-l5 facet joint , which ventrally compressed the dural sac and right - traversing l5 root . \n mri revealed a well - defined , large - sized mass with variable intensity on t2-weighted images surrounding the l4 - 5 facet joint . \n the mass was enhanced after injection of gadolinium and revealed effusion in the interfacet joint , which suggested hemorrhage and contusion of the lesion . \n a large - sized , thick - walled capsulated mass was noted from the ruptured ligamentum flavum . \n the mass compressed adjacent muscles posteriorly and compressed the dural sac ventrally , which seemed to be connected to the facet joint capsule . \n the cystic mass was partially excised and cleaved by using a blade , ronger , and kerrison punch near the facet capsule . \n eight months later , the postoperative mri scan showed remarkable regression of the cyst ( fig . \n 2 ) . several terms for these cysts , including synovial cyst , ganglion cyst , and pseudocystic lesion have been used.1,2 a true cyst , a so - called \" synovial cyst , \" has a synovial lining membrane , whereas a \" ganglion cyst \" has no synovial lining membrane . \n here we presented a case of a ganglion cyst without a synovial lining membrane that seemed to be associated with facet joint instability possibly caused by a laminar fracture close to the facet joint . \n ganglion and synovial cysts can be classified by the presence of the synovial lining and communication with the facet joint ; it is difficult to differentiate them clinically . \n differentiation between the two types of cysts is only of histological value , because they share similar clinical and radiological characteristics . \n posttraumatic degeneration of connective tissue and inflammation have been regarded as causes of these cysts.3 one of the causes of the formation of the ganglion cyst in this case seemed to be related to joint instability induced by laminar fracture close to the facet joint .", "role": "user" }, { "content": "the pathogenesis of juxtafacet cysts is closely related to degenerative instability of the lumbar spine and degenerative changes in the ligamentum flavum and the facet joint . a 56-year - old man presented with severe right thigh pain and numbness for 1 month after a laminar fracture of the l4 spine . \n magnetic resonance imaging revealed a heterogenous cystic mass surrounding the facet joint between the fourth and fifth lumbar vertebrae on the right side . \n conservative therapy was unsuccessful and the lesion was removed by surgical decompression alone without fusion . \n the histological examination showed a fragmented , cystic wall - like structure composed of myxoid degenerative tissue without lining epithelium . here \n we present this case of a ganglion cyst that appeared to be associated with facet joint instability .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: renal cancer accounts for 3%4% of new cancer cases in adults.13 data from the nordic cancer registry nordcan show that renal cancer in denmark in the years 20092013 comprised 2.5% of all new male and 1.4% of all new female cancer cases.3 survival after renal cancer has been lower in denmark compared to the other nordic countries for decades.3,4 the multidisciplinary danish renal cancer group ( darenca ) was established in 2006 following a national plan to improve survival of cancer for all danish patients.5 darenca is a group of academic experts representing urology , oncology , pathology , radiology , nuclear medicine , and epidemiology dealing with cancer originating from the renal parenchyma . \n the aim of darenca is to improve the renal cancer survival in denmark , and the group is responsible for developing national guidelines for diagnosis and treatment of renal cancer . \n the nationwide database of the darenca ( darencadata ) was established in 2010 as one of the other tasks of the group . \n the main purpose of the database is to improve the clinical quality of renal cancer treatment in denmark by monitoring selected processes and outcome after renal cancer treatment and secondarily to provide an important data source for observational research . \n darencadata includes all patients with a first - time diagnosis of renal cancer in denmark since august 1 , 2010 . \n the patients are identified by the first - time registration of a diagnosis of renal cancer in the danish national pathology registry to secure verification by histology or cytology.6 through the danish national patient registry , the database additionally identifies all surgical treatment procedures performed on patients with renal cancer.7 \n the variables in the database are obtained from two main sources : through data linkage from central national registries and through data registered online in a web - based form by the treating clinicians . \n this online registration form is part of a common platform for the five urooncological databases in denmark.8 information on sex , age , and vital status is retrieved from the danish national civil registry.9 data on specific surgical and oncological treatment as well as comorbidity are retrieved from the national patient registry.7 these data are part of the routine registration done in connection with procedures performed during hospitalization and outpatient treatment at hospitals . \n the surgical procedures are registered as radical or partial nephrectomies or ablative procedures ( cryotherapy and radio frequency ablation ) , and whether the procedures are performed laparoscopically or open . \n variables describing the surgical quality include information on the length of hospital stay , 30-day postoperative mortality , and 30-day postoperative morbidity . \n systematized nomenclature of medicine codes for the histological subtype of cancer , fuhrman grade , leibovich score , pt - stage , and type of specimen are drawn from the danish national pathology registry.6 additional data from the web - based form include : civil registration number as patient identifier , date of diagnosis , main debut symptoms ( incidentally found tumor , hematuria , nonspecific symptoms ) , and results of blood tests performed at the time of diagnosis ( hemoglobin , c - reactive protein , ionized calcium , lactate dehydrogenase , serum sodium , neutrophils ) . \n the database is not collecting data on lifestyle factors . in case of locoregional or metastatic recurrent disease \n eight quality indicators with recommended standards based on experience and available literature have been selected for monitoring the clinical quality of renal cancer treatment in denmark . \n these indicators collected once a year include description of the treatment of renal cancer ( process indicators ) as well as description of outcome ( result indicators ) . \n as most data come from preexisting registries and only a few data are registered manually in the web - based forms , it should be possible to achieve a high completeness of data , obviously depending on the quality of these data . \n all urological , surgical , oncological , and other departments diagnosing and treating patients with renal cancer register online in the web - based form at the time of diagnosis . \n this form was filled in for 89.0% of all new renal cancer cases during the last study period august 1 , 2014july 31 , 2015 , with a variation between departments treating more than ten patients between 37.5% and 98.6% . \n this registration has improved over the years : 65.4% in 20102011 , 69.3% in 20112012 , 82.3% in 20122013 , and 84.4% in 20132014 . \n four of these had a high and stable registration rate during all 5 years with a mean between 88.0% and 95.9% . \n five improved their registration substantially , one from 14.5% to 87.7% and another from 52.9% to 95.0% . \n only one department showed a decrease in registration from 76.2% to 37.5%.10 as darencadata is a newly established database with only 5 years of data collection to date , results and data from the initial years should be interpreted with caution . during the recent years \n , the algorithms for identification of patients with incident renal cancer in the pathology registry have been optimized . as a result , \n the algorithms have been redefined , and data from five larger hospitals diagnosing and treating patients with renal cancer have undergone a detailed validation of data concerning the surgical procedures and pathological data . \n this validation revealed that the main reason for incomplete data was incorrect or incomplete registration of some of the clinical and pathological data . \n further validation studies will ensure an even higher completeness and validity of all data in darencadata in the future . \n during the period august 1 , 2010july 31 , 2015 , 3,977 patients with renal cancer have been enrolled in the database.11 over this period , incidence has increased in total number of new cases and number of new cases per 100,000 citizens ( table 1).12 the eight quality indicators as well as results from 2010 to 2015 are summarized in table 2.10,11 there has been a tendency toward use of more minimal invasive procedures with lesser surgical traumas . \n the proportion of radical nephrectomies performed laparoscopically has increased from 60.0% in 20102011 to 66.4% in 20142015.11 the proportion of nephron - preserving procedures ( partial nephrectomy and ablation ) increased from 22.9% in 20102011 to 43.5% in 20142015 , and the proportion of patients with t1a ( 4 cm ) cancers who underwent a radical nephrectomy decreased from 46.7% in 20102011 to 17.4% in 20142015.11 the proportion of patients who were hospitalized for 3 days or less after an endoscopic or ablative procedure increased from 68.1% to 80.1% during the last 5 years , while the postoperative morbidity and mortality was stable during the last 5 years.11 tumor size at diagnosis tends to be smaller and less advanced in the most recent years . \n the number of radical and partial nephrectomies with pt1a tumors increased from 17.6% in 20112012 to 29.8% in 20142015 , while the number of patients with pt34 tumors decreased from 45.0% in 20112012 to 29.8% in 20142015.11 information on the specific histological subtype , which is an important prognostic factor and used for determining later treatment of metastatic disease , was recorded for 53% of the newly diagnosed patients in 20102011 , 74.5% in 20112012 , 87.5% in 20122013 , 83.8% in 20132014 , and 85.9% in 20142015.11 the 1-year observed survival after the diagnosis of renal cancer increased from 81.3% for patients diagnosed in 20102011 to 84.1% in patients diagnosed in 20142015.11 \n the 3-year observed survival was 68.2% for patients diagnosed in 20102011 , and 69.9% for patients diagnosed in 20112012.11 \n all patients enrolled in the database are followed until death or emigration with collection of data comprising surgical and medical oncological treatment as well as data on the date and type of recurrence . \n data suggested to be included during follow - up in the future are , among others , the development of a new primary renal cancer in the residual and/or contralateral kidney and development of renal insufficiency after renal surgery . \n no research projects have evolved until now , but in the coming years , the database will be provide the basis for and conduct several observational studies of danish patients with renal cancer . \n darencadata is funded by the danish regions by the danish clinical registries as one of more than 60 national clinical quality databases in denmark.13 epidemiological , statistical , and technical support is provided by two regional registry support centers in denmark ( the registry support center of epidemiology and biostatistics [ north ] and the registry support center of clinical quality and health informatics [ west ] ) . \n the database is headed by a steering group representing the specialties in darenca supplied by biostatistics and quality improvement . an annual report is published each year covering the period from august 1 of the first year to july 31 of the next year.11 the publication follows a national audit by the steering group of national- , regional- , and institutional - based results . \n after publication , the regions and departments perform a local audit of the results for their own organization . \n data from the first 5 years of the database suggest an improvement of survival , a tendency toward smaller and less advanced tumors at the time of diagnosis , and an increased use of less invasive surgery . \n it is important to note that the database is relatively young , and the data from the first years should be interpreted with caution . \n nevertheless , the completeness of the online registration has improved substantially during these first 5 years .", "role": "user" }, { "content": "aim of the databasethe main purpose of the database of the danish renal cancer group ( darencadata ) is to improve the quality of renal cancer treatment in denmark and secondarily to conduct observational research.study populationdarencadata includes all danish patients with a first - time diagnosis of renal cancer in the danish national pathology registry since august 1 , 2010.main variablesdarencadata holds data on demographic characteristics , treatments , and pathology collected through linkage to central registries and online registration of a few clinical key variables . \n eight quality indicators have been selected for monitoring treatment quality and outcome after renal cancer.descriptive datathe incidence of renal cancer in denmark has increased from 12.7 per 100,000 population - years in 20102011 to 15.9 per 100,000 population - years in 20142015 . \n a total of 3,977 danish patients with renal cancer have been enrolled in the database in the period august 1 , 2010july 31 , 2015 . \n the completeness of data registration has increased substantially since the first years of the database . \n a tendency toward smaller and less advanced tumors , less invasive surgery , and a shorter hospital stay was observed , while the postoperative morbidity and mortality remained stable . \n concurrently , the 1-year survival has improved and was 84.1% in 20142015.conclusiondarencadata provides valuable information on quality of and outcome after renal cancer treatment . \n efforts to improve collection and registration of data are ongoing .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: participants of either sex and any race were recruited from the cornea service at mayo clinic ( rochester , mn , usa ) . \n exclusion criteria were ocular pathology except fecd ( in the fecd group only ) or cataract , any previous ocular surgery , current contact lens wear , administration of systemic or topical medications known to affect the cornea , or systemic diseases that could affect the cornea including diabetes . \n this study was reviewed and approved by the institutional review board at mayo clinic ; the research followed the tenets of the declaration of helsinki . \n informed consent was obtained from the subjects after explanation of the nature and possible consequences of the study . \n enrollment visits were scheduled on an afternoon when corneas were assumed to be at steady - state . \n fuchs ' endothelial corneal dystrophy was graded clinically by a trained observer ( kw , khb , or svp ) based on the area and confluence of guttae , and the presence of edema by using slit - lamp biomicroscopy . \n corneas with 1 to 12 or 12 or more nonconfluent central guttae ( grades 1 and 2 ) were considered to have mild fecd ; corneas with confluent guttae of 1- to 2-mm and 2- to 5-mm diameter ( grades 3 and 4 ) were considered to have moderate fecd ; and corneas with more than 5-mm diameter of confluent guttae or any visible edema ( grades 5 and 6 ) were considered to have advanced fecd . the epithelium was intact and without bullae in all participants . \n effective endothelial cell density ( ecde ) was determined by using confocal microscopy ( confoscan 4 ; nidek technologies , freemont , ca , usa ) with a widefield ( 20 ) noncontact objective . \n images of the endothelium were analyzed by a standardized image - processing method that determined the area of guttae and local endothelial cell density . \n central corneal thickness was determined from tomographic images acquired by using a rotating scheimpflug camera ( pentacam hr ; oculus , lynnwood , wa , usa ) as described previously . \n central corneal haze ( backscatter ) in the anterior 120 m and posterior 60 m of the cornea was also determined from scheimpflug images . \n all corneal backscatter measurements were standardized by adjusting corneal image brightness to that of a fixed scatter source to account for any fluctuations in the intensity of the light source and sensitivity of the detection system over time . \n all scheimpflug images were checked for data acquisition errors ( pentacam software version 1.20r29 ) . \n axial resolution of our instrument is 11.8 m per pixel ( range , 11.512.4 m per pixel ) ; because of the software 's surface - fitting algorithm , axial resolution should be better than the resolution of one pixel . \n others have reported the precision of central corneal thickness to be within 3 to 7 m ( schwiegerling j , et al . \n follow - up visits for measurement of corneal hydration control started at approximately 8:00 am and scheimpflug images were repeated before any intervention . \n a low - oxygen transmissible hydrogel contact lens ( polymacon ; oxygen permeability , 7.9 10 cm / s ml o2/ml mm hg ; westcon contacts , duluth , ga , usa ) with thickness of 500 m and diameter of 12 mm was placed on one eye and the eyelid was taped closed . \n the contact lens base curve was 8.0 mm or 8.2 mm depending on the patient 's corneal curvature and clinical assessment of contact lens fit and centration . \n after 2 hours , the contact lens was removed and scheimpflug images were immediately acquired . \n scheimpflug photography was then repeated every 15 minutes for the next hour and every 30 minutes through 5 hours or until corneal thickness returned to corneal thickness within 5% of the thinner of the measurements at presumed steady - state or immediately before contact lens application ( ctss ) . \n participants were asked not to close their eyes for prolonged periods after contact lens removal . \n all measurements were taken in the same air - conditioned and humidity - controlled environment . \n regression models were used to calculate mean differences in steady - state characteristics between fecd groups adjusted for age and multiple comparisons by the bonferroni method ( table ) . \n steady - state characteristics of fecd and normal corneas recovery of corneal thickness was expected to follow an exponential curve : \n where ct(t ) was corneal thickness at time t after removing the contact lens , ct(0 ) was corneal thickness immediately after removing the contact lens , and k was a constant . \n percent recovery per hour was determined as follows : \n time to 95% thickness recovery ( t95% ) was \n\n for a global test of association between prph and swelling with severity of fecd in regression models , we used a likelihood ratio test and a test for trend across fecd groups ( grade 06 ) . \n regression models were used to assess associations between prph and ctss , swelling ( difference between central corneal thickness immediately after contact lens removal and the thinner of the two measurements at steady - state or immediately before contact lens application ) , anterior and posterior steady - state backscatter , and ecde with respective 95% confidence intervals ( 95% ci ) . \n correlations were assessed with spearman ( , ordinal ) or pearson ( r , continuous ) correlation coefficients . \n differences were considered statistically significant if p < 0.05 ( two - sided tests ) . \n stepwise selection for regression models ( removal if p 0.15 , eligible for addition if p < 0.1 ) was used to identify predictors of prph among predefined factors , including ctss , swelling , anterior and posterior backscatter ( all continuous ) , and ecde ( binary , > 1000 cells / mm vs < 1000 cells / mm ) ; predicted prph values were calculated for significant factors . \n careful data and regression diagnostic were conducted to identify possible outliers , leverage , and influence . \n all statistics were calculated by using stata version 13.1 ( statacorp , college station , tx , usa ) . \n participants of either sex and any race were recruited from the cornea service at mayo clinic ( rochester , mn , usa ) . \n exclusion criteria were ocular pathology except fecd ( in the fecd group only ) or cataract , any previous ocular surgery , current contact lens wear , administration of systemic or topical medications known to affect the cornea , or systemic diseases that could affect the cornea including diabetes . \n this study was reviewed and approved by the institutional review board at mayo clinic ; the research followed the tenets of the declaration of helsinki . \n informed consent was obtained from the subjects after explanation of the nature and possible consequences of the study . \n enrollment visits were scheduled on an afternoon when corneas were assumed to be at steady - state . \n fuchs ' endothelial corneal dystrophy was graded clinically by a trained observer ( kw , khb , or svp ) based on the area and confluence of guttae , and the presence of edema by using slit - lamp biomicroscopy . \n corneas with 1 to 12 or 12 or more nonconfluent central guttae ( grades 1 and 2 ) were considered to have mild fecd ; corneas with confluent guttae of 1- to 2-mm and 2- to 5-mm diameter ( grades 3 and 4 ) were considered to have moderate fecd ; and corneas with more than 5-mm diameter of confluent guttae or any visible edema ( grades 5 and 6 ) were considered to have advanced fecd . the epithelium was intact and without bullae in all participants . \n effective endothelial cell density ( ecde ) was determined by using confocal microscopy ( confoscan 4 ; nidek technologies , freemont , ca , usa ) with a widefield ( 20 ) noncontact objective . \n images of the endothelium were analyzed by a standardized image - processing method that determined the area of guttae and local endothelial cell density . \n central corneal thickness was determined from tomographic images acquired by using a rotating scheimpflug camera ( pentacam hr ; oculus , lynnwood , wa , usa ) as described previously . \n central corneal haze ( backscatter ) in the anterior 120 m and posterior 60 m of the cornea was also determined from scheimpflug images . \n all corneal backscatter measurements were standardized by adjusting corneal image brightness to that of a fixed scatter source to account for any fluctuations in the intensity of the light source and sensitivity of the detection system over time . \n all scheimpflug images were checked for data acquisition errors ( pentacam software version 1.20r29 ) . \n axial resolution of our instrument is 11.8 m per pixel ( range , 11.512.4 m per pixel ) ; because of the software 's surface - fitting algorithm , axial resolution should be better than the resolution of one pixel . \n others have reported the precision of central corneal thickness to be within 3 to 7 m ( schwiegerling j , et al . \n follow - up visits for measurement of corneal hydration control started at approximately 8:00 am and scheimpflug images were repeated before any intervention . \n a low - oxygen transmissible hydrogel contact lens ( polymacon ; oxygen permeability , 7.9 10 cm / s ml o2/ml mm hg ; westcon contacts , duluth , ga , usa ) with thickness of 500 m and diameter of 12 mm was placed on one eye and the eyelid was taped closed . \n the contact lens base curve was 8.0 mm or 8.2 mm depending on the patient 's corneal curvature and clinical assessment of contact lens fit and centration . \n after 2 hours , the contact lens was removed and scheimpflug images were immediately acquired . \n scheimpflug photography was then repeated every 15 minutes for the next hour and every 30 minutes through 5 hours or until corneal thickness returned to corneal thickness within 5% of the thinner of the measurements at presumed steady - state or immediately before contact lens application ( ctss ) . \n participants were asked not to close their eyes for prolonged periods after contact lens removal . \n all measurements were taken in the same air - conditioned and humidity - controlled environment . \n regression models were used to calculate mean differences in steady - state characteristics between fecd groups adjusted for age and multiple comparisons by the bonferroni method ( table ) . \n steady - state characteristics of fecd and normal corneas recovery of corneal thickness was expected to follow an exponential curve : \n where ct(t ) was corneal thickness at time t after removing the contact lens , ct(0 ) was corneal thickness immediately after removing the contact lens , and k was a constant . \n percent recovery per hour was determined as follows : \n time to 95% thickness recovery ( t95% ) was \n\n for a global test of association between prph and swelling with severity of fecd in regression models , we used a likelihood ratio test and a test for trend across fecd groups ( grade 06 ) . \n regression models were used to assess associations between prph and ctss , swelling ( difference between central corneal thickness immediately after contact lens removal and the thinner of the two measurements at steady - state or immediately before contact lens application ) , anterior and posterior steady - state backscatter , and ecde with respective 95% confidence intervals ( 95% ci ) . \n correlations were assessed with spearman ( , ordinal ) or pearson ( r , continuous ) correlation coefficients . \n differences were considered statistically significant if p < 0.05 ( two - sided tests ) . \n if p 0.15 , eligible for addition if p < 0.1 ) was used to identify predictors of prph among predefined factors , including ctss , swelling , anterior and posterior backscatter ( all continuous ) , and ecde ( binary , > 1000 cells / mm vs < 1000 cells / mm ) ; predicted prph values were calculated for significant factors . \n careful data and regression diagnostic were conducted to identify possible outliers , leverage , and influence . \n all statistics were calculated by using stata version 13.1 ( statacorp , college station , tx , usa ) . \n twenty - three corneas of 23 caucasian participants with fecd and 8 corneas of 8 caucasian participants with normal eyes were examined ( table ) . \n age was 67 12 years ( mean sd ) in the fecd group and 63 9 years ( p = 0.4 ) in the control group . mean corneal swelling for the combined groups was 53 m ( 95% ci 4857 ) or 9.5% ( 95% ci 8.710.3 ) compared with ctss ; swelling for each group is detailed in the table . \n swelling did not differ between fecd and normal corneas ( p = 0.3 ) . after solving equation ( 1 ) for k , predicted corneal thickness was highly correlated with measured thickness at the same points in time ( r = 0.99 , p < 0.001 ) , and those values were not different ( mean difference , 0.8 m ; 95% ci 1.70.1 ) . \n percent recovery per hour was 49%/h ( 95% ci 4157 ) in normal corneas compared with 45%/h ( 95% ci 3753 ; p = 0.5 vs. normal ; minimum detectable difference , 13%/h ; = 0.05 , = 0.20 ) in mild , 37%/h ( 95% ci 2649 ; p = 0.1 vs. normal ; minimum detectable difference , 16%/h ; = 0.05 , = 0.20 ) , in moderate , and 37%/h ( 95% ci 2943 ; p = 0.028 vs. normal ) in advanced fecd ( fig . \n time to 95% thickness recovery was 4.7 hours ( 95% ci 2.27.1 ) in normal corneas compared with 5.5 hours ( 95% ci 3.18.0 ; p = 0.6 vs. normal ) in mild , 6.9 hours ( 95% ci 3.510.3 ; p = 0.3 vs. normal ) in moderate , and 7.8 hours ( 95% ci 5.79.9 ; p = 0.053 vs. normal ) in advanced fecd . \n percent recovery per hour of corneal thickness across a range of severity of fecd and normal corneas . \n percent recovery per hour of central corneal thickness was measured by scheimpflug imaging after purposefully swelling the cornea ( fecd , n = 23 ; normal , n = 8) . \n percent recovery per hour was decreased in advanced fecd by 12%/h ( 95%ci 123 , p = 0.028 ) compared with normal . \n percent recovery per hour was inversely associated with fecd severity ( nonparametric p trend = 0.023 ; = 0.42 ; fig . 1 ) and with ecde ( r = 0.37 , p = 0.039 ) . \n corneas with ecde < 1000 cells / mm had a lower prph ( 36%/h ; 95% ci 3042 ) than corneas with ecde > 1000 cells / mm ( 46%/h ; 95% ci 4152 ; p = 0.011 ; fig . \n percent recovery per hour was associated with ctss ( r = 0.37 ; p = 0.043 ) . \n low prph was also associated with higher amounts of induced corneal swelling ( r = 0.54 , p = 0.002 ) , and with high central anterior and posterior steady - state backscatter ( r = 0.53 , p = 0.002 and r = 0.49 , p = 0.005 , respectively ) . \n associations were determined between prph of central corneal thickness after induced corneal swelling and morphologic parameters at steady - state in fecd and normal corneas . \n ( a ) corneas with ecde < 1000 cells / mm had a lower prph ( 36%/h ; 95% ci 3042 ; closed circles ) than corneas with ecde > 1000 cells / mm ( 46%/h ; 95% ci 4152 ; p = 0.011 ; open circles ) . \n ( b ) high anterior corneal backscatter was associated with worse corneal hydration control in normal ( open circles ) and fecd ( closed circles ) corneas ( r = 0.53 , p = 0.002 ) . \n only anterior backscatter ( p = 0.012 ) and corneal swelling ( p = 0.009 ) were independently associated with prph ; r for the multivariable model was 0.44 . \n predicted prph values for the identified range of anterior steady - state backscatter are provided in figure 3 based on corneal swelling of 50 m . \n predicted corneal hydration control by steady - state anterior backscatter . predicted corneal hydration control expressed as prph of central thickness shown as a function of steady - state anterior backscatter assuming induced swelling of 50 m \n , a patient with a steady - state anterior backscatter of 1300 su would be expected to have a prph of 46%/h ( 95% ci 4251 ) , whereas a patient with 1600 su would be expected to have a prph of 38%/h ( 95% ci 3342 ) . \n twenty - three corneas of 23 caucasian participants with fecd and 8 corneas of 8 caucasian participants with normal eyes were examined ( table ) . \n age was 67 12 years ( mean sd ) in the fecd group and 63 9 years ( p = 0.4 ) in the control group . \n mean corneal swelling for the combined groups was 53 m ( 95% ci 4857 ) or 9.5% ( 95% ci 8.710.3 ) compared with ctss ; swelling for each group is detailed in the table . \n swelling did not differ between fecd and normal corneas ( p = 0.3 ) . after solving equation ( 1 ) for k , predicted corneal thickness was highly correlated with measured thickness at the same points in time ( r = 0.99 , p < 0.001 ) , and those values were not different ( mean difference , 0.8 m ; 95% ci 1.70.1 ) . \n percent recovery per hour was 49%/h ( 95% ci 4157 ) in normal corneas compared with 45%/h ( 95% ci 3753 ; p = 0.5 vs. normal ; minimum detectable difference , 13%/h ; = 0.05 , = 0.20 ) in mild , 37%/h ( 95% ci 2649 ; p = 0.1 vs. normal ; minimum detectable difference , 16%/h ; = 0.05 , = 0.20 ) , in moderate , and 37%/h ( 95% ci 2943 ; p = 0.028 vs. normal ) in advanced fecd ( fig . \n time to 95% thickness recovery was 4.7 hours ( 95% ci 2.27.1 ) in normal corneas compared with 5.5 hours ( 95% ci 3.18.0 ; p = 0.6 vs. normal ) in mild , 6.9 hours ( 95% ci 3.510.3 ; \n p = 0.3 vs. normal ) in moderate , and 7.8 hours ( 95% ci 5.79.9 ; p = 0.053 vs. normal ) in advanced fecd . \n percent recovery per hour of corneal thickness across a range of severity of fecd and normal corneas . \n percent recovery per hour of central corneal thickness was measured by scheimpflug imaging after purposefully swelling the cornea ( fecd , n = 23 ; normal , n = 8) . \n percent recovery per hour was inversely associated with fecd severity ( nonparametric p trend = 0.023 ; = 0.42 ; fig . 1 ) and with ecde ( r = 0.37 , p = 0.039 ) . \n corneas with ecde < 1000 cells / mm had a lower prph ( 36%/h ; 95% ci 3042 ) than corneas with ecde > 1000 cells / mm ( 46%/h ; 95% ci 4152 ; p = 0.011 ; fig . \n percent recovery per hour was associated with ctss ( r = 0.37 ; p = 0.043 ) . \n low prph was also associated with higher amounts of induced corneal swelling ( r = 0.54 , p = 0.002 ) , and with high central anterior and posterior steady - state backscatter ( r = 0.53 , p = 0.002 and r = 0.49 , p = 0.005 , respectively ) . \n associations were determined between prph of central corneal thickness after induced corneal swelling and morphologic parameters at steady - state in fecd and normal corneas . \n ( a ) corneas with ecde < 1000 cells / mm had a lower prph ( 36%/h ; 95% ci 3042 ; closed circles ) than corneas with ecde > 1000 cells / mm ( 46%/h ; 95% ci 4152 ; p = 0.011 ; open circles ) . \n ( b ) high anterior corneal backscatter was associated with worse corneal hydration control in normal ( open circles ) and fecd ( closed circles ) corneas ( r = 0.53 , p = 0.002 ) . \n lines represent the linear regression . in a multivariable analysis , only anterior backscatter ( p = 0.012 ) and corneal swelling ( p = 0.009 ) were independently associated with prph ; r for the multivariable model was 0.44 . predicted prph values for the identified range of anterior steady - state backscatter are provided in figure 3 based on corneal swelling of 50 m . predicted corneal hydration control by steady - state anterior backscatter . \n predicted corneal hydration control expressed as prph of central thickness shown as a function of steady - state anterior backscatter assuming induced swelling of 50 m ; gray area represents the respective 95% ci . for example \n , a patient with a steady - state anterior backscatter of 1300 su would be expected to have a prph of 46%/h ( 95% ci 4251 ) , whereas a patient with 1600 su would be expected to have a prph of 38%/h ( 95% ci 3342 ) . \n corneal hydration control and thickness recovery after stress - induced corneal edema are reduced in advanced fecd compared with normal corneas . \n anterior corneal backscatter , which is known to be increased early in the course of fecd , is associated with overall endothelial function and should be further investigated for its ability to estimate endothelial function in clinical practice . \n ideal control of corneal hydration requires a balance between passive barrier leakage into the cornea and active pump of solute back to the aqueous humor . \n alterations in corneal hydration can result from pump or barrier dysfunction and are known to adversely affect stromal transparency . in this study , we found that corneal hydration control was impaired in clinically advanced fecd compared with normal and was associated with a delay in recovery of steady - state corneal thickness in fecd ; we were unable to detect a significant difference in mild or moderate disease , although there were similar trends toward decreased prph . \n percent recovery per hour in normal corneas ( 49%/h , 95% ci 4157 ) was similar to that found in a previous study from our laboratory ( 48%/h ; 95% ci 4353 ) in normal , young non contact - lens wearers . \n another study found lower prph ( 34%/h in normal corneas and 25%/h in fecd ) , and these differences might be due to different experimental conditions and fecd severity . \n nielsen et al . found a similar amount of swelling in advanced fecd and normal corneas ( approximately 44 m or 7% ) ; prph was not determined , but the percentage of swelling was significantly higher in advanced fecd compared with normal . in our study , we defined severity of fecd according to a morphologic grading scale , which can be easily implemented in clinical practice . nevertheless , this grading scale is subjective , which leads to interobserver variation , and does not account for the presence of subclinical corneal edema that can be present even when morphologic changes are not sufficiently advanced . \n we investigated the association between corneal hydration control and various morphologic parameters , including clinical grade and its objective morphological equivalent , ecde , corneal swelling , and corneal backscatter in an effort to provide the clinician with objective measures beyond the patient 's subjective symptoms . \n although all of these parameters were associated with prph in univariable analyses , only anterior corneal backscatter and induced swelling were associated with prph in a multivariable analysis . \n notably , clinical grading and ecde , which are known to be associated , and ctss , did not improve the prediction of prph . \n because the range of normal corneal thickness is large , measurements that fall within this range can not discriminate well between normality and corneal edema , and thus it is not unexpected that corneal thickness did not improve the prediction of prph . \n corneal thickness is still an important parameter in the evaluation of fecd , especially when measurements are thicker than the normal range , or when a change in corneal thickness can be documented . \n determining prph by the method described in this study is time - consuming and not feasible in routine clinical practice . \n therefore , one of the goals of this study was to determine if any objective and easily measured variables could be used as a surrogate for corneal hydration control . \n anterior corneal backscatter was the only variable that was associated with prph and could be measured easily and noninvasively ( fig . \n anterior corneal backscatter in fecd originates from edema and ultrastructural tissue changes in the basal epithelium and anterior stroma . \n early improvement in backscatter after restoring endothelial function has been explained by resolution of corneal edema , suggesting that anterior backscatter is a more sensitive indicator of subtle corneal edema than is clinical examination or pachymetry . \n corneal backscatter is unrelated to corneal thickness in normal ( nonedematous ) corneas ; by combining the steady - state data in this study with previously published data from our laboratory , there was no association between central corneal thickness and standardized anterior backscatter in 23 normal eyes of subjects aged 50 years or older ( r = 0.1 , p = 0.6 ) . \n in contrast , there was a weak association between central thickness and anterior backscatter in fecd ( r = 0.3 , p = 0.004 ; n = 88 ) , in which increased thickness can be attributed to corneal edema . \n although there was overlap between central corneal thickness in fecd ( range , 456666 m ) and normal ( range , 484594 m ) eyes , anterior corneal backscatter greater than 2 sds above the normal mean was present in 8 of 29 mild , 11 of 29 moderate , and 21 of 30 advanced fecd eyes , indicating the potential discriminative value of anterior backscatter . \n although the presence of corneal edema can explain the association between anterior backscatter and prph , the relationship was not highly predictive ( r = 0.44 ) , possibly because a component of backscatter originates from chronic ultrastructural tissue changes and not from edema . because corneal hydration control reflects both barrier and pump function , permeability measures might improve sensitivity and prediction of true pump function . \n the main limitation of this study was our inability to estimate activity of the endothelial pump independent from the endothelial barrier . \n the prph provides an estimate of the net activity of both activities and pump function and can be determined only if the barrier function , based on permeability of the endothelium to a small tracer such as fluorescein , is known . \n unfortunately , determination of endothelial permeability to fluorescein in fecd is challenging and estimates of the barrier function have differed by a factor of 4 between studies , which led to different conclusions regarding fecd . \n these variations may be from unreliable measurement of fluorescein concentration in the stroma because of increased scattered light in these corneas . \n also , estimates of corneal volume from central corneal thickness may be unreliable because of the abnormal thickness profile in fecd , although our thickness measurements based on the entire cornea profile measured by the scheimpflug camera were likely more representative of the cornea than thickness measured at the center by ultrasonic pachymetry . \n for this study , we also assumed that the difference in recovery of induced edema was solely attributed to overall endothelial function and not influenced by evaporation from the anterior corneal surface . \n the epithelium is considerably less permeable than the endothelium , and would likely not influence this measurement significantly . \n also , the epithelium of all participants remained intact during the study and the environmental conditions were controlled , minimizing potential variations in any evaporative component . \n the small sample size of the moderate fecd group may have limited our ability to detect a difference in prph from normal . in summary \n , we found that corneal hydration control became impaired in advanced stages of fecd ( based on morphologic grading ) , and that anterior corneal backscatter could provide an imperfect but notable estimate of endothelial function . \n although morphologic grading is quick and simple in clinical practice , it was more helpful when penetrating keratoplasty was the procedure of choice for fecd because most surgeons waited for clinically detectable edema to be present before offering a transplant . with distinct advantages of endothelial over penetrating keratoplasty , and with knowledge that subclinical edema is present earlier in fecd , the threshold to offer a transplant has decreased . \n however , a simple method of estimating corneal endothelial function in these cases , in which classic biomicroscopy and pachymetric findings are not discriminatory , could help in deciding whether patients will benefit from intervention . \n similarly , a simple estimate of endothelial function could be a prognostic indicator of the outcome of intraocular surgery in the setting of a compromised endothelium . \n further investigation of anterior backscatter as a surrogate for endothelial function is worthwhile to better understand its role in clinical practice .", "role": "user" }, { "content": "purposeto assess corneal hydration control across a range of severity of fuchs ' endothelial corneal dystrophy ( fecd ) by measuring the percent recovery per hour ( prph ) of central corneal thickness after swelling the cornea and to determine its association with corneal morphologic parameters.methodstwenty-three corneas of 23 phakic fecd patients and 8 corneas of 8 healthy control participants devoid of guttae were graded ( modified krachmer scale ) . \n effective endothelial cell density ( ecde ) was determined from the area of guttae and local cell density in confocal microscopy images . \n steady - state corneal thickness ( ctss ) and standardized central corneal backscatter were derived from scheimpflug images . \n corneal swelling was induced by wearing a low - oxygen transmissible contact lens for 2 hours in the morning . \n de - swelling was measured over 5 hours after lens removal or until corneal thickness returned to ctss . \n percent recovery per hour was 100 ( 1 ek ) , where k was determined from ct(t ) = ( dekt ) + ctss , and where d was the initial change from ctss.resultsafter contact lens wear , corneas swelled by 9% ( 95% ci 910 ) . \n percent recovery per hour was 49%/h ( 95% ci 4157 ) in controls and 37%/h in advanced fecd ( 95% ci 2943 , p = 0.028 ) . \n low prph was associated with disease severity , low ecde , and increased anterior and posterior corneal backscatter . \n anterior backscatter was associated with prph in a multivariable model ( r2 = 0.44).conclusionscorneal hydration control is impaired in advanced fecd and is inversely related to anterior corneal backscatter . \n anterior corneal backscatter might serve as an indicator of impaired endothelium in fecd .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: osteoporosis ( op ) is defined as a systemic skeletal disease characterized by bone fragility \n resulting from low bone mass and deterioration of bone microstructure . \n etiologically , \n osteoporosis is divided into three groups : primary type 1 , primary type 2 , and secondary . \n the form of osteoporosis most common in women , following menopause is referred to as primary \n type 1 or postmenopausal osteoporosis . \n senile \n osteoporosis , occurs after the age of 75 years and is observed in both women and men at a \n ratio of 2:1 . \n often a consequence of various chronic inflammatory diseases , secondary osteoporosis \n manifests through bone loss resulting from direct effects of inflammation , poor nutrition , \n reduced lean body mass , immobility and the effects of treatments , especially \n glucocorticoids . \n osteoporosis is a primary comorbidity issue for patients of chronic \n inflammatory diseases , especially rheumatoid arthritis , systemic lupus erythematosus , \n anchylosing spondylitis , and chronic obstructive pulmonary disease1,2,3,4,5,6,7,8,9,10 . following the discovery of the rank / rankl / opg axis \n , primary osteoporosis has been \n considered to be a low grade chronic inflammation , mediated by increased t and b lymphocyte \n activity as a product of aging and estrogen deficiency11,12,13 . \n inflammatory cytokines il-1 and tnf , produced by lymphocytes and \n m - csf , have long been associated with osteoclastic bone loss , with promotion of rankl \n production , through reduction of opg production and up - regulation of the rank receptor on \n osteoclast precursors , thus increasing their sensitivity to prevailing rankl concentrations \n and directly stimulating differentiation of osteoclast precursors14,15,16 . \n il-1 and tnf have long been implicated in osteoclast \n formation in postmenopausal osteoporosis and in ovariectomized animal models17,18,19,20,21,22 . \n ceruloplasmin ( cp ) is an acute phase reactant and antioxidant , characterized by ferroxidase \n activity and increases in inflammation . \n blood serum cp levels are correlated with presence \n of inflammatory diseases such as chronic obstructive pulmonary disease , rheumatoid \n arthritis , systemic lupus erythematosus , behcet s disease , nasal polyps , cystic \n echinococcus , and obesity23,24,25,26 . in light of this information \n , we designed this study to investigate the acute phase \n reactant and inflammatory parameters available in the diagnosis and monitoring of \n osteoporosis . \n therefore , we aimed to evaluate cp and c - reactive protein ( crp ) levels in \n geriatric patients with osteoporosis . \n patients who were over the age of 65 years and were admitted to the harran university \n school of medicine were included in this cross - sectional study . written consent to \n participation was received from each patient , with the hospital s ethics committee granting \n approval in conformation with the principles of the 2nd declaration of helsinki . \n subsequently , 70 geriatric patients meeting the study criteria were divided into two \n groups ; group 1 ( n = 35 ) comprised patients with primary osteoporosis and group 2 ( n = 35 ) \n comprised healthy patients enrolled during routine check - ups , without osteoporosis but \n exhibiting demographic characteristics similar to those of group 1 . \n the exclusion criteria were \n as follows : concurrent diagnosis of endocrine diseases such as thyroid , diabetes mellitus , \n prolactinoma , cushing syndrome , and hyperparathyroidism , thought to cause osteoporosis ; \n diagnosis of chronic inflammatory disease ( according to their medical history and physical \n examination ) ; simultaneous prescription of osteoporosis treatment steroids , diuretics , \n anticoagulants , lh - rh agonist , anticonvulsants , pioglitazone , heparin , or methotrexate ; \n on - going antacid therapy containing aluminum ; presence of kidney , liver , and celiac disease ; \n a history of gastrectomy operation , malabsorption , or total parenteral nutrition ; \n immobility ; current smoking or regular alcohol consumption ; and a history of early \n menopause . body mass index ( bmi ) was calculated for each patient by dividing the body weight by the \n square of the height . \n subject bone density was measured using dexa , with t scores in the \n l2l4 vertebrae and femoral neck under 2.5 considered as osteoporosis . a hologic qdr 4500 a \n dexa ( \n hologic inc 02154-usa ) device was used in bone mineral density ( bmd ) measurements of \n patients . \n l4 vertebrae , femoral neck , and total femur density was expressed as \n g / cm , with the l1l4 average used as the expression of the vertebral bmd . \n serum c - reactive protein , sedimentation rate , and cp levels were analyzed in venous blood \n samples . \n five milliliter blood samples were taken from the forearm venous blood vessels of \n subjects and placed in eppendorf tubes . \n the tubes were centrifuged at 1,500 rpm for 10 \n minutes to obtain serum samples for the measurement of defined parameters . \n all serum samples \n were stored at 80 c , after labeling in a biochemistry laboratory , until the day of the \n analysis . \n the enzymatic activity of cp was measured according to erel s method24 . using this assay , \n the results are expressed as units per gram \n protein ( u / l ) . \n glucose , sodium , potasium , urea , creatinine , aspartate aminotransaminase , \n alanine aminotransferase , albumin , alkaline phosphatase , calcium , phosphorus , magnesium , \n triglycerides , total cholesterol , high density lipoprotein - cholesterol and low density \n lipoprotein cholesterol ( other biochemical parameters such as c - reactive protein , free t3 , \n free t4 , adrenocorticotropic hormon , cortisol , parathyroid hormone , glycated hemoglobin ) \n were analyzed using a roche cobas integra 800 auto analyzer ( roche ) and commercial \n measurement kits . \n spss 18.0 was used in all statistical analyses ( chicago , il , usa ) . \n the one sample \n kolmogorov - smirnov test was used to verify the normality of data distributions . \n results are \n expressed as mean sd . the test was used for categorical variables . \n independent sample t test was used to analyze parametric numerical data , and the \n mann - whitney u test used to analyze non - parametric data . \n pearson correlation coefficients \n were used to determine correlations between serum cp levels and defined parameters measured \n in osteoporotic patients . \n roc - curve analysis was implemented to find \n indicatory cut - off values for serum cp levels in osteoporosis patients . \n patient clinical , anthropometric , and biochemical findings are shown in table 1table 1.general demographics , clinical data , and biochemical parameters of the \n patientsgroup 1 ( n=35)group 2 ( n=35)age ( years)70.0 ( 65.083.0)70.00 ( 65.084.0)gender ( f / m ) 28/721/14bmi ( kg / m)28.1 3.428.2 3.3glucose ( mg / dl)107.6 9.2105.3 13.2urea ( mg / dl)1.1 0.21.2 0.2creatinine ( mg / dl)0.7 ( 0.51.1)0.7 ( 0.41.2)ast ( u / l)19.6 6.421.2 8.0alt ( u / l)18.0 7.020.2 8.2albumin ( g / dl)3.1 0.63.2 0.6ldl ( mg / dl)107.5 36.5105.5 34.7hdl ( mg / dl)45.1 11.245.2 12.0ca ( mg / dl)9.2 0.59.3 0.6p ( mg / dl)3.3 0.63.4 0.6magnesium ( mg / dl)2.0 0.32.0 0.2alp ( u / l)86.0 ( 39.0178.0)81.0 ( 50.0239.0)pth \n ( pg / ml)56.0 ( 13.6172.0)59.00 ( 40.0232.0)hemoglobin ( g / dl)13.0 1.812.6 1.0mpv ( fl)6.8 0.97.0 1.6esr ( mm / h)23.3 13.622.8 11.7crp ( mg / dl)1.0 ( 0.18.7)1.3 ( 0.19.4)ceruloplasmin ( u / l)887.8 89.5728.7 102.8parametric data are expressed as mean sd ; nonparametric data are expressed as \n median ( minimum - maximum)bmi : body mass index ; ast : aspartate transaminase ; alt : alanine transaminase ; ldl : \n low density lipoprotein ; hdl : high density lipoprotein ; ca : calcium ; p : phosphorous ; \n alp : alkaline phosphatase ; pth : parathyroid hormone ; mpv : mean platelet volume , esr : \n erythrocyte sedimentation rate ; crp : c - reactive protein . \n statistically significant differences were not observed between the groups in \n terms of age or gender ( p > 0.05 ) . although the crp level and erythrocyte sedimentation \n rate of group 1 patients were not different from those of group 2 patients ( p > 0.05 ) , \n the serum cp levels of group 1 were found to be significantly higher ( p < 0.001 ) . in \n pearson correlation analysis , serum cp values \n were not associated with any observed \n parameter ( for all ; p > 0.05 ) . \n parametric data are expressed as mean sd ; nonparametric data are expressed as \n median ( minimum - maximum ) bmi : body mass index ; ast : aspartate transaminase ; alt : alanine transaminase ; ldl : \n low density lipoprotein ; hdl : high density lipoprotein ; ca : calcium ; p : phosphorous ; \n alp : alkaline phosphatase ; pth : parathyroid hormone ; mpv : mean platelet volume , esr : \n erythrocyte sedimentation rate ; crp : c - reactive protein . \n p < 0.01 binary logistic regression analysis revealed that cp levels were an independent factor ( b = \n 0.022 , se = 0.005 , wald = 17,816 , p < 0.001 ) . in roc - curve analysis , \n serum cp levels \n above 830.15 u / l were shown to provide 85.7% sensitivity and 85.7% specificity in the \n diagnosis of osteoporosis patients ( area under the curve = 0,897 , 95% confidence interval = \n 0,8250,970 ; p < 0.001 ) . \n this is the first study to investigate serum cp levels in geriatric patients , and has shown \n that cp levels are higher in primary osteoporotic patients than in those without \n osteoporosis . \n further , it has been shown that cp levels above 830.15 u / l can be used for the \n diagnosis of osteoporosis with 85.7% sensitivity and 85.7% specificity . \n cp is known as an acute phase reactant and an antioxidant parameter in inflammatory \n diseases , and has been observed in elevated levels in several chronic inflammatory \n diseases23,24,25,26 , 28,29,30,31 . in a study measuring inflammatory marker protein levels in \n elevated plasma inflammation , cp levels \n were shown to be associated with an increased \n incidence of chronic obstructive pulmonary disease requiring hospitalization23 . in a study on copper levels in subjects \n with rheumatoid arthritis , serum copper and cp levels \n another study in \n trace elements and some extracellular antioxidant proteins levels revealed serum copper and \n cp levels were significantly higher in the serum of patients with systemic lupus \n erythematosus27 . \n additionally , \n osteoporosis is observed concomitantly with a number of chronic inflammatory diseases ; a \n consequence of cytokine action on the bone remodeling system in the favor of bone \n resorption1,2,3,4,5,6,7 . \n for example , osteoporosis \n in patients with copd has been observed in previous studies , with osteoporosis found to be a \n consequence of chronic inflammation4,5,6,7 . \n previous studies investigating osteoporosis \n in patients with rheumatoid arthritis and ankylosing spondylitis have shown that \n osteoporosis was correlated with activation of disease , low bmi , age and increasing disease \n duration1 , 2 . \n alternatively , there have been studies evaluating crp levels and oxidative status in \n primary osteoporotic subjects without chronic inflammation . in some of these studies , \n crp \n levels were found to be higher , implicating that it may be possible to use crp in screening \n tests for osteoporosis32,33,34,35 . in another study , total oxidant status , although not \n correlated with bmd , was found to be higher in geriatric patients with osteoporosis35 . in this study we evaluated inflammatory \n parameters and cp levels in subjects without chronic inflammatory disease . only geriatric \n patients with and without osteoporosis \n were included , with serum cp levels found to be \n higher in geriatric patients with osteoporosis than in healthy subjects . \n however , other \n inflammatory parameters , specifically crp and esr , did not differ between the study groups . \n surprisingly , serum cp levels above 830.15 u / l exhibited 85.7% sensitivity and specificity \n in the diagnosis of osteoporosis . in summary \n , this study demonstrated that serum cp level is elevated in osteoporosis \n independently of other inflammatory parameters , and thus may be considered in use as a \n screening test for osteoporosis . \n limitations of the study included a cross - sectional study \n design and a relatively small sample size .", "role": "user" }, { "content": "[ purpose ] to evaluate serum ceruloplasmin levels in geriatric patients with osteoporosis . \n [ subjects and methods ] seventy geriatric patients over 65 years of age were recruited . \n patients were divided into two groups : group 1 ( op , n=35 ) consisted of patients with \n osteoporosis , and group 2 ( n=35 ) consisted of patients without osteoporosis . \n dual - energy \n x - ray absorptiometry scanning was used in the measurement of bone mineral density in all \n cases . \n inflammatory parameters , including c - reactive protein , sedimentation rate , and \n serum ceruloplasmin levels were analyzed in blood samples . \n [ results ] no statistical \n differences in inflammatory parameters were observed between the two groups , however , \n serum ceruloplasmin levels were significantly higher in group 1 than in group 2 . in \n pearson analysis , \n serum ceruloplasmin levels were not found to be correlated with any \n biochemical parameters . \n receiver operator characteristic curve analysis revealed that \n serum ceruloplasmin levels were predictive of osteoporosis with 85.7% sensitivity and \n 85.7% specificity over the level of 830.15 . \n [ conclusion ] our study demonstrated that \n measurement of serum ceruloplasmin levels may have potential as a screening methodology \n for geriatric patients with osteoporosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: depofoam bupivacaine ( exparel , bupivacaine liposome injectable suspension ) is for single - dose infiltration into the surgical site to produce postsurgical analgesia . among new drug delivery systems , exparel is promising because such formulation leads to a slow release of bupivacaine , therefore , allowing a longer duration of action and a slower uptake into the systemic circulation , avoiding high plasma ( and tissue ) concentrations . \n another depofoam product , depodur ( morphine sulfate extended - release liposome injection ) , can exchange its drug load with lidocaine when coadministered , leading to changes in systemic exposure . \n we therefore explored this potential with exparel in a clinically relevant minipig model mimicking wound infiltration . \n lidocaine with epinephrine is commonly used for wound infiltration prior to surgery [ 3 , 4 ] . in clinical practice \n , the use of a lidocaine - bupivacaine mixture has the theoretical advantage of allowing a smaller dose of each agent than if they were used alone . \n lidocaine is expected to provide faster onset of sensory blockade after local nerve block and may be administered in the same field in surgical patients . \n epinephrine decreases bleeding in the area of injection by constricting blood vessels . as a result \n , the use of epinephrine as a vasoconstrictor agent is expected to maximize any potential local interaction by decreasing local clearance from the injection . \n the combined additive toxicologic effects of lidocaine and bupivacaine on central nervous ( cns ) and cardiovascular ( cv ) systems have been reported [ 611 ] , but there is a paucity of data evaluating the potential for drug interaction , from a pharmacokinetic ( pk ) perspective . \n the objective of the present study was to quantify the degree of drug interaction that may occur when exparel and lido are infiltrated subcutaneously ( sc ) within 5 , 10 , 20 , or 40 minutes of each other at clinically relevant doses and concentrations . \n the skin of pigs has a layer of sc tissue , which is very similar to that of man . \n the skin morphology ( tight adhesiveness of the skin to the underlying structures ) , compared to rat , rabbit , or dog where the skin is loose , and physiology makes the swine a preferred model for extrapolation to humans [ 1214 ] . due to the clinical relevance of the miniature swine model used in this study \n , the present data were expected to provide a relevant prediction of the potential local interaction of exparel when administered with lidocaine in humans . \n the depofoam drug delivery system is a proprietary , injectable technology that provides a sustained release of therapeutic compounds . \n the depofoam system consists of microscopic , polyhedral , lipid - based particles composed of numerous nonconcentric , aqueous chambers containing the drug in solution . \n depofoam bupivacaine ( exparel ; bupivacaine extended - release liposome injection using multivesicular depofoam technology ) , 15 mg / ml ( expressed as anhydrous bupivacaine base ) was provided by pacira pharmaceuticals , inc . \n , san diego , ca , usa . as needed , exparel was diluted with 0.9% sodium chloride injection usp to achieve a target concentration of 7.5 mg / ml . xylocaine - mpf , ( 1% or 2% lidocaine hcl with 1 : 200,000 epinephrine ) was manufactured by astrazeneca , wilmington , de , usa . \n male nave yucatan miniature swine were received from sinclair bioresources auxvasse , mo , usa . the animals were 6 to 17 months of age on arrival , and 2450 kg at the time of dosing . \n the protocol was reviewed and approved by the institutional animal care and use committee ( iacuc ) of sinclair research center for compliance with regulations prior to study initiation . \n this study complies with all applicable sections of the final rules of the animal welfare act regulation ( 9 cfr ) . \n animals were housed in individual , stainless - steel , metabolism cages throughout the study period . \n animals were fed once a day with free access to water . during a 5-day acclimation period , \n sixty ( 60 ) male yucatan swine were randomized into 20 groups ( n = 3/group ) . \n exparel and/or lidocaine solution 1% or 2% ( with epinephrine 1 : 200,000 ) was administered sc at dose levels of either 1 or 2 mg / kg . \n bupivacaine was incorporated into the sustained release material at a percent loading of 1.5% by weight and further diluted with 0.9% sterile sodium chloride to achieve the desired concentration . \n control groups with equivalent dose and volume were used to allow useful comparison with the test formulation . \n all remaining groups received 0.2 ml / kg lidocaine followed by 0.27 ml / kg exparel at a given interval of time later ( 5 , 10 , 20 , or 40 minutes ) . \n since the recommended dose volume is approximately 2 ml / cm , the dose was equally distributed as 6 serial bolus injections along a 5 cm virtual incision line in the scapular region ( figures 1 and 2 ) . \n each injection was made perpendicular to the skin surface ( i.e. , directing the needle approximately 90 degrees ) , and each bolus was injected slowly ( over 5 seconds ) in the exact same spot as trailing injections along the line . the first injection ( start of dosing ) was performed beginning proximal to the line . \n the needle was redirected slightly more distal than the first pass of the needle , and the process was repeated a second time with another aliquot . \n blood samples were collected at predose , 5 , 10 , 15 , 30 minutes , and 1 , 2 , 4 , 6 , 8 , 12 , 24 , 48 , 72 , and 96 hours postdosing . \n plasma concentrations were simultaneously analyzed by abc laboratories , columbia , mo , usa , using a validated lc - ms / ms assay . \n the method is selective for the quantification of bupivacaine and lidocaine in k3edta plasma in the concentrations ranging from 0.25 to 100 ng / ml for each analyte . depending on the time interval , between 5 and 40 minutes of plasma data for lidocaine \n the pk parameters were evaluated by a noncompartmental model using winnonlin , version 5.0 ( pharsight corp . \n the pk parameters included maximum plasma concentration ( cmax ) , time at which the cmax occurred ( tmax ) , and area under the plasma concentration - time data ( auc0t ) . \n the appropriate group mean values and standard deviation ( sd ) were calculated from the individual data . \n the pk results are shown in tables 1 and 2 and figures 3 , 4 , and 5 . \n most differences in plasma parameters were clinically insignificant and were attributed to biological variations in individual responses . \n notably , there was no clinically meaningful difference in the mean systemic plasma exposure to either lidocaine or bupivacaine when exparel was given 20 minutes or longer after lidocaine administration in studies using 4 mg / kg of lidocaine and exparel . while systemic exposure to lidocaine or bupivacaine was not increased when exparel was administered 20 minutes or longer following lidocaine administration , when the interval was less than 20 minutes there were increases in systemic exposure . at the early timepoints ( 5 and 10 minutes ) , \n there was a marked difference in plasma lidocaine and/or bupivacaine ( cmax , auc024 hr ) in animals receiving larger doses of more concentrated formulations . \n when the high dose of lidocaine was followed by the high dose of exparel ( 4 mg / kg each ) by 510 minutes , the systemic exposure to lidocaine was increased over the exposure seen when the high dose of lidocaine was administered alone ( table 1 ) ( cmax 1,070 82.9 versus 18,600 5 , 472 ng / ml and auc024 hr 872 290 versus 1,290 465 hrng / ml ; cmax 1,640% ; auc024 hr 48% ) . \n when the high dose of lidocaine was followed by the high dose of exparel ( 4 mg / kg each ) by 510 minutes , cmax of bupivacaine ( exparel ) was increased 671,000% ( 519 230 versus 865 488 and 5,730 ng / ml ) and auc024 hr was 5095% higher ( 2,240 721 hrng / ml versus 4,370 and 3,370 1 , 980 hrng / ml ) compared to when exparel was administered alone ( table 2 ) . \n drug interactions are significant risk factors , especially , in surgical patients receiving multimodal analgesia . \n the magnitude of these interactions depends on a multitude of factors including dose volume , dose concentration , injection method , and timing / sequence of administration . in the present study \n , we evaluated the degree of drug interaction that may occur when exparel is infiltrated 5 , 10 , 20 , or 40 minutes after an injection of lidocaine at various clinically relevant dose ratios and drug concentrations . \n we used a clinically relevant animal model with in vivo conditions that simulate the sc infiltration in a wound . \n a special injection infiltration procedure was used to facilitate close contact between lidocaine and bupivacaine while minimizing the risk of disruption of lipid vesicles and other disturbances of the injection area . \n this model was considered particularly relevant for this type of investigation due to skin similarities between the minipig and humans [ 1214 ] . \n the doses selected in our studies were based on these recommendations . the recommended guideline in pigs \n is lidocaine given at 14 mg / kg maximum dose mixed with conventional bupivacaine 1 - 2 mg / kg before the incision is made . when lidocaine is used for regional nerve blocks , plasma levels are usually 3,0005,000 ng / ml ; toxicities may be observed at 6,000 ng / ml , but more commonly occur once levels exceed 10,000 ng / ml . therapeutic levels are usually 7001,000 ng / ml while plasma threshold associated with systemic toxicity is 2,000 to 4,000 ng / ml for bupivacaine [ 17 , 18 ] . as the toxicity of bupivacaine is known to be generally associated with its cmax , exparel may be safer than unencapsulated bupivacaine solution at the same dose by allowing for a longer presence of bupivacaine at lower systemic peak levels . \n there was no clinically meaningful difference in the mean systemic plasma exposure to either lidocaine or bupivacaine when exparel was given 20 minutes or longer after lidocaine administration in studies using 4 mg / kg of lidocaine and exparel . \n at the early timepoints ( 5 and 10 minutes ) , there was a marked difference in plasma lidocaine and/or bupivacaine ( cmax , auc024 hr ) in animals receiving larger doses of more concentrated formulations . \n it should be noted that the dosing procedure selected for this study maximizes the potential risk of drug interference . \n the injected concentrated formulations were in close proximity of each other , especially after being infiltrated in the same field and within a short time interval . \n the high - dose ratio ( 4 : 4 ) results highlight the possibility of a clinically relevant pk interference when exparel is infiltrated within a shorter time interval following lidocaine solution . \n the involvement of epinephrine to vasoconstrict most likely allows greater interaction of the concentrated compounds at the injection sites . \n it is not yet clear which precise mechanism(s ) of action are involved in this model . \n the physiological mechanism is based in part upon the higher affinity of lidocaine to the depofoam . \n it is likely that the local interaction is influenced by diluting / mixing effects of the exposed sites in the presence of both formulations . \n it is also possible that , at shorter time intervals , increasing local blood flow accelerates systemic absorption of the injected formulation(s ) since the vascular effects of lidocaine and bupivacaine are dynamic and dependent on concentration and time [ 1922 ] . in summary \n , there was no increase in either drug when the administration of exparel was delayed by 20 or 40 minutes after the injection of the lidocaine solution . \n while exparel should not be admixed with lidocaine , administration of exparel after at least 20 minutes following local administration of lidocaine did not increase the release of either drug . \n based on the preclinical data , we conclude that local administration of exparel after at least 20 minutes following local administration of lidocaine did not increase systemic exposure of either drug .", "role": "user" }, { "content": "we explored the potential for exparel to interact with lidocaine . \n sixty ( 60 ) male yucatan swine were randomized into 20 groups ( n = 3/group ) . \n exparel ( 2 or 4 mg / kg ) and/or lidocaine hcl solution 1% or 2% ( with epinephrine 1 : 200,000 ) were injected subcutaneously along a 5 cm virtual incision line . \n the effects on the pharmacokinetics of bupivacaine and lidocaine were examined when 5 , 10 , 20 , and 40 minutes had passed between administration of lidocaine and exparel . systemic exposure to lidocaine was increased ( auc024 hr by 48% ; cmax by 1,640% ) when lidocaine ( 4 mg / kg ) was followed 5 minutes later by exparel ( 4 mg / kg ) compared to lidocaine administered alone . \n plasma bupivacaine was increased ( auc024 hr by 5095% ; cmax by 671,000% ) when lidocaine ( 4 mg / kg ) was followed 5 or 10 minutes later by exparel ( 4 mg / kg ) compared to exparel alone . while exparel should not be admixed with lidocaine , this study shows that local administration of exparel after at least 20 minutes following local administration of lidocaine did not increase the release of either drug .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: genomics is a powerful tool for understanding the genomic basis of biological processes in individual organisms and their communities . \n the fungal genomics program ( http://jgi.doe.gov/fungi ) of the us department of energy ( doe ) joint genome institute ( jgi ) has partnered with the international scientific community to support genomic exploration of the kingdom fungi and to help address problems related to energy and the environment . \n the exponential growth of data resulting from several large - scale genomics initiatives like the 1000 fungal genomes project requires new approaches for data integration and analysis ( 1 ) . \n we designed mycocosm , an integrated fungal genomics resource , to allow researchers to easily access large amounts of genomics data and analyze them using web - based analytical tools . \n the mycocosm portal enables in - depth multidimensional analysis of individual genomes and efficient comparative genomics of fungi , which may be applied to phylogenetically related fungi , or to those sharing the same lifestyle , ecological niche or phenotypic trait . \n the first jgi fungal portal was created for the white rot fungus phanerochaete chrysosporium in 2004 ( 2 ) . to enable comparative genome analysis within the same analytical framework , in 2008 jgi integrated data from six genomes of dothideomycete plant pathogens ( three sequenced by jgi and three others provided by the dothideomycetes genome consortium ) . \n this served as a prototype for mycocosm , the first official version of which was released in march 2010 in response to a call for a pan - fungal genomic resource from the community of fungal biologists brought together by the burroughs wellcome fund ( alexandria , va ) . by 2011 , \n here we provide an update on the latest developments of mycocosm , which includes flexible tools for the analysis of exponentially growing genomics and other omics data sets , and extends user community participation to the entire genome project cycle , from nomination of species for sequencing through genome annotation and comparative genomics . \n since our last report ( 3 ) , mycocosm has grown to host > 250 publicly available fungal genomes ( figure 1 ) , 80% of which were sequenced by jgi and 20% by other groups added for comparative purposes . \n individual genomes , or biologically relevant groups of them , may be searched using keywords or sequence , investigated using mycocosm analytical tools , and downloaded for custom analyses . \n the genomes sequenced by jgi are shown in blue and those sequenced by others are shown in red . \n the genomes sequenced by jgi are shown in blue and those sequenced by others are shown in red . \n also in the past two years , all mycocosm nodes have been populated with newly sequenced and annotated genomes including the recently activated nodes for glomeromycota , entomophthoromycotina , kickxellomycotina , blastocladiomycota , neocallimastigomycota and others . \n several new branches such as xylonomycetes , zoopagomycotina and cryptomycota have been added for a more complete picture of the fungal tree of life ( figure 2 ) . \n several model fungi have been added to mycocosm , for which genes are linked to the corresponding records in curated databases such as the saccharomyces genome database ( 4 ) , the aspergillus genome database ( 5 ) and others . \n genbank records for jgi - sequenced fungal genomes are linked to mycocosm using jgidb qualifiers ( http://www.ncbi.nlm.nih.gov/genbank/collab/db_xref/ ) . \n each node of the tree is linked to the corresponding group page and portals for individual genomes within the group . \n each node of the tree is linked to the corresponding group page and portals for individual genomes within the group . \n omics data can be explored in depth , in a single - genome context ( figure 3 ) . \n genomes in mycocosm are also grouped for comparative genomics analyses ( figure 4 ) , into two kinds of groups : phylogenetic and ecological . \n phylogenetic groups are represented ( and linked to ) by the nodes of the mycocosm tree , and facilitate comparative analyses of organisms with a shared evolutionary history . \n ecological groups represent a curation effort in which fungi of similar lifestyles ( e.g. endophytes , mycorrhizal symbionts , plant pathgens , etc . ) \n have been assembled into groups that are linked to the chapters of the genomics encyclopedia of fungi ( 6 ) . \n red bars indicate n. crassa genes predicted by the broad institute and uploaded into mycocosm . \n the four tracks with brown bars illustrate snps derived from resequencing of mutant strains of n. crassa ( 7 ) . \n the two pink curves represent transcriptome profiling using rna - seq during n. crassa growth under two different conditions . \n a phylogroup containing seven annotated genomes of fungi from mucoromycotina is shown on the left . \n an ecogroup with seven annotated genomes of phylogenetically diverse endophytes is shown on the right . \n red bars indicate n. crassa genes predicted by the broad institute and uploaded into mycocosm . the four tracks with brown bars illustrate snps derived from resequencing of mutant strains of n. crassa ( 7 ) . \n the two pink curves represent transcriptome profiling using rna - seq during n. crassa growth under two different conditions . \n a phylogroup containing seven annotated genomes of fungi from mucoromycotina is shown on the left . \n an ecogroup with seven annotated genomes of phylogenetically diverse endophytes is shown on the right . to encourage the research community to participate in the further growth of mycocosm \n , users can now nominate diverse fungal species for sequencing ( figure 5 ) in the context of the 1000 fungal genomes project ( http://1000.fungalgenomes.org ) . \n nominated species will be peer reviewed , and , if approved , will be sequenced , annotated and fully integrated into mycocosm s comparative genomics framework . \n figure 5.1000 fungal genomes nomination page . over 500 families of fungi and associated genome projects are displayed . \n green and yellow rows highlight families with no , or only one , sequenced genome , where additional species can be nominated for sequencing via the use of the \n nomination requires user registration and commitment to provide jgi with dna and rna samples for sequencing . \n green and yellow rows highlight families with no , or only one , sequenced genome , where additional species can be nominated for sequencing via the use of the \n nomination requires user registration and commitment to provide jgi with dna and rna samples for sequencing . for genome comparison to produce meaningful results , application of the same set of functional annotation databases to all genomes \n , the existing gene models are fed into the functional annotation part of the pipeline , using the same databases used for annotation of jgi genomes , to ensure consistent references for genome comparisons . \n all fungi sequenced at jgi are annotated using the jgi annotation pipeline , which integrates an array of tools for gene prediction , annotation and analysis ( 8) . using repeat - masked genome assemblies as input , protein - coding gene models are predicted using a combination of gene predictors of three general kinds : ab initio , homology - based and transcriptome - based . \n the ab initio fgenesh ( 9 ) and genemark ( 10 ) are specifically trained for the given genome . \n homology - based fgenesh+ ( 9 ) and genewise ( 11 ) are seeded by blastx ( 12 ) alignments of fungal sequences in ncbi s nonredundant protein database . \n transcriptome - based models are predicted from assembled rna - sequencing data derived from the cultured fungus . for each genomic locus , \n the best representative gene model is selected based on a combination of protein homology and transcriptome support ; these make up a gene catalog. in addition to protein - coding genes , trnas are predicted using trnascan - se ( 13 ) . \n signalp ( 14 ) is used to detect the sequence motifs responsible for protein localization , tmhmm ( 15 ) identifies possible transmembrane domains and interproscan ( 16 ) predicts functional domains from pfam ( 17 ) and other databases . \n protein alignments to the ncbi s nonredundant ( http://www.ncbi.nlm.nih.gov ) , swiss - prot ( 18 ) , kegg ( 19 ) and kog ( 20 ) databases additionally facilitate functional interpretation . \n interpro , kegg and swiss - prot hits are used to map gene ontology ( go ) terms ( 21 ) . \n detailed annotation reports from these methods are provided on every coding gene s protein page . \n additionally , summaries listing numbers of genes by category in the go , kegg and kog classifications are accessible from the portal menu , and can be compared with other selected genomes to explore gene family expansions and contractions across genomes . \n predicted gene models , along with different lines of supporting evidence including transcriptomics and similarity to proteins in other genomes , are displayed on a genome browser ( figure 3 ) . \n the browser , which is based on the ucsc genome browser ( 22 ) , displays genomic features as horizontal tracks , which can be customized to the needs of each user . \n for example , predicted gene models are linked to annotation reports , while genome conservation tracks are linked to vista point ( 23 ) . \n two new types of data , single - nucleotide polymorphisms ( snps ) and gene expression profiles , have been added to the browser , to enable the visualization of resequencing and transcriptomics data , respectively ( figure 3 ) . \n these are important additions to the resources developed , for example , for model fungi such as the ascomycete neurospora crassa ( 7 ) or the basidiomycete schizophyllum commune ( 24 ) . predicted gene models , and their annotations , \n can be improved through the process of manual curation , which is open to all authorized users and coordinated by the principal investigator of each project . \n such collective efforts were critical for the analysis of several fungal genomes ( 2431 ) . additionally , users can upload custom tracks to the browser and share them , either with specified collaborators or globally . this capability to upload data for individual genes or entire genomes , makes mycocosm a powerful and customizable data exchange resource for the community . \n the wealth of genomes in mycocosm creates an opportunity to compare groups of genomes , and the need for efficient tools to enable these comparisons . \n mycocosm therefore includes tools that integrate single genomes into a comparative context , such as the ability to visualize variation in gene counts in different go , kegg and kog categories across a user - selected assortment of genomes . \n additionally , mycocosm includes predefined groups of fungi to enable users to ask questions for fungal genomes in a group context . \n two types of genome groups are available in mycocosm and shown in figure 4 : ( i ) phylogroups , consisting of phylogenetically related species ( corresponding to the nodes of the mycocosm tree ) , and ( ii ) ecogroups , containing fungi of similar lifestyle or ecology ( but which may be phylogenetically distant ) . both kinds of group offer consistent interfaces for comparative analyses . \n genome sizes and gene counts may be compared on the info page ( figure 4 ) , giving a coarse - grained overview . \n genes shared between genomes within a group can be explored using precomputed markov clustering ( 32 ) of the full set of protein sequences in the group . \n derived from all - versus - all blast alignments of the proteins , these gene clusters can be thought of as protein \n families. the clusters can be filtered to show genes shared between all , or some , organisms in the group , or to find genes unique to them as described in details in help pages . \n each cluster is linked to a page listing all the genes of the cluster with graphical display of protein domains , intron \n a larger genome - scale synteny calculated by vista ( 23 ) is available from the synteny menu of individual genome portals , where dot - plots , for example , can illustrate the full spectrum of micro- , meso- and macro - synteny between different pairs of dothideomycete species ( 31 ) . \n this phenomenon is limited to this class of fungi and illustrates the utility of the group - centric approach for comparative genome analysis . \n even though all major nodes of the mycocosm tree are represented by at least one sequenced genome , many fungal clades remain unrepresented . \n the 250 + annotated genomes in mycocosm are a small fraction of the total number of fungal species , estimates of which range from 1.5 million to as high as 5.1 million ( 33,34 ) . \n thus , sampling of the fungal tree of life by genomics is sparse , and likely has left many biologically interesting clades unexplored . \n this undersampling will surely limit our attempts to understand functional diversity and evolution through fungal genomes , and will hamper metagenomics studies of fungal communities , where a broad array of reference genomes is required to interpret complex sequence data . to encourage the scientific community to participate in determining what gaps in the fungal tree of life will be filled in next , every node of mycocosm \n nominate link to enable users to recommend new genomes for sequencing via the 1000 fungal genomes project ( http://1000.fungalgenomes.org ) . following this link from a given node \n , families of fungi with no , or only one , sequenced genomes ( figure 5 , green and yellow rows ) display a \n nominate button , which invites users to describe the species , access jgi user guidelines and provide dna and rna samples to jgi for sequencing ( if approved by peer review ) . \n the 1000 fungal genomes project aims to have at least two sequenced genomes for every family of fungi . through this and other jgi community sequencing projects ( 35 ) \n , we aim to fill the remaining gaps in the fungal tree of life . to enable visibility of ongoing jgi genome projects , the projects menu of mycocosm ( http://jgi.doe.gov/projects ) lists each project s status , principal investigator and other pertinent information . \n combined with other genome projects listed in the gold database ( 36 ) and other sources , they form a \n master list helps us better focus our sequencing efforts on unexplored regions of the fungal tree of life . \n thus , we integrate a full genome project cycle ( from sequencing target selection through assembly and annotation , to biology - driven data analysis ) into mycocosm enabling users to be active contributors to this process . \n since our last report ( 3 ) , mycocosm has grown to host > 250 publicly available fungal genomes ( figure 1 ) , 80% of which were sequenced by jgi and 20% by other groups added for comparative purposes . \n individual genomes , or biologically relevant groups of them , may be searched using keywords or sequence , investigated using mycocosm analytical tools , and downloaded for custom analyses . \n the genomes sequenced by jgi are shown in blue and those sequenced by others are shown in red . \n the genomes sequenced by jgi are shown in blue and those sequenced by others are shown in red . \n also in the past two years , all mycocosm nodes have been populated with newly sequenced and annotated genomes including the recently activated nodes for glomeromycota , entomophthoromycotina , kickxellomycotina , blastocladiomycota , neocallimastigomycota and others . \n several new branches such as xylonomycetes , zoopagomycotina and cryptomycota have been added for a more complete picture of the fungal tree of life ( figure 2 ) . \n several model fungi have been added to mycocosm , for which genes are linked to the corresponding records in curated databases such as the saccharomyces genome database ( 4 ) , the aspergillus genome database ( 5 ) and others . \n genbank records for jgi - sequenced fungal genomes are linked to mycocosm using jgidb qualifiers ( http://www.ncbi.nlm.nih.gov/genbank/collab/db_xref/ ) . \n each node of the tree is linked to the corresponding group page and portals for individual genomes within the group . \n each node of the tree is linked to the corresponding group page and portals for individual genomes within the group . \n omics data can be explored in depth , in a single - genome context ( figure 3 ) . \n genomes in mycocosm are also grouped for comparative genomics analyses ( figure 4 ) , into two kinds of groups : phylogenetic and ecological . \n phylogenetic groups are represented ( and linked to ) by the nodes of the mycocosm tree , and facilitate comparative analyses of organisms with a shared evolutionary history . \n ecological groups represent a curation effort in which fungi of similar lifestyles ( e.g. endophytes , mycorrhizal symbionts , plant pathgens , etc . ) \n have been assembled into groups that are linked to the chapters of the genomics encyclopedia of fungi ( 6 ) . \n red bars indicate n. crassa genes predicted by the broad institute and uploaded into mycocosm . \n the four tracks with brown bars illustrate snps derived from resequencing of mutant strains of n. crassa ( 7 ) . \n the two pink curves represent transcriptome profiling using rna - seq during n. crassa growth under two different conditions . \n a phylogroup containing seven annotated genomes of fungi from mucoromycotina is shown on the left . \n an ecogroup with seven annotated genomes of phylogenetically diverse endophytes is shown on the right . \n red bars indicate n. crassa genes predicted by the broad institute and uploaded into mycocosm . \n the four tracks with brown bars illustrate snps derived from resequencing of mutant strains of n. crassa ( 7 ) . \n the two pink curves represent transcriptome profiling using rna - seq during n. crassa growth under two different conditions . \n a phylogroup containing seven annotated genomes of fungi from mucoromycotina is shown on the left . \n an ecogroup with seven annotated genomes of phylogenetically diverse endophytes is shown on the right . to encourage the research community to participate in the further growth of mycocosm \n , users can now nominate diverse fungal species for sequencing ( figure 5 ) in the context of the 1000 fungal genomes project ( http://1000.fungalgenomes.org ) . \n nominated species will be peer reviewed , and , if approved , will be sequenced , annotated and fully integrated into mycocosm s comparative genomics framework . \n green and yellow rows highlight families with no , or only one , sequenced genome , where additional species can be nominated for sequencing via the use of the nominate button . \n nomination requires user registration and commitment to provide jgi with dna and rna samples for sequencing . \n 1000 fungal genomes nomination page . over 500 families of fungi and associated genome projects are displayed . \n green and yellow rows highlight families with no , or only one , sequenced genome , where additional species can be nominated for sequencing via the use of the nominate button . \n nomination requires user registration and commitment to provide jgi with dna and rna samples for sequencing . \n for genome comparison to produce meaningful results , application of the same set of functional annotation databases to all genomes is required . for genomes sequenced and annotated outside of jgi , the existing gene models are fed into the functional annotation part of the pipeline , using the same databases used for annotation of jgi genomes , to ensure consistent references for genome comparisons . \n all fungi sequenced at jgi are annotated using the jgi annotation pipeline , which integrates an array of tools for gene prediction , annotation and analysis ( 8) . using repeat - masked genome assemblies as input , protein - coding gene models are predicted using a combination of gene predictors of three general kinds : ab initio , homology - based and transcriptome - based . \n the ab initio fgenesh ( 9 ) and genemark ( 10 ) are specifically trained for the given genome . \n homology - based fgenesh+ ( 9 ) and genewise ( 11 ) are seeded by blastx ( 12 ) alignments of fungal sequences in ncbi s nonredundant protein database . \n transcriptome - based models are predicted from assembled rna - sequencing data derived from the cultured fungus . for each genomic locus , \n the best representative gene model is selected based on a combination of protein homology and transcriptome support ; these make up a gene catalog. in addition to protein - coding genes , trnas are predicted using trnascan - se ( 13 ) . \n signalp ( 14 ) is used to detect the sequence motifs responsible for protein localization , tmhmm ( 15 ) identifies possible transmembrane domains and interproscan ( 16 ) predicts functional domains from pfam ( 17 ) and other databases . \n protein alignments to the ncbi s nonredundant ( http://www.ncbi.nlm.nih.gov ) , swiss - prot ( 18 ) , kegg ( 19 ) and kog ( 20 ) databases additionally facilitate functional interpretation . \n interpro , kegg and swiss - prot hits are used to map gene ontology ( go ) terms ( 21 ) . \n detailed annotation reports from these methods are provided on every coding gene s protein page . \n additionally , summaries listing numbers of genes by category in the go , kegg and kog classifications are accessible from the portal menu , and can be compared with other selected genomes to explore gene family expansions and contractions across genomes . \n predicted gene models , along with different lines of supporting evidence including transcriptomics and similarity to proteins in other genomes , are displayed on a genome browser ( figure 3 ) . \n the browser , which is based on the ucsc genome browser ( 22 ) , displays genomic features as horizontal tracks , which can be customized to the needs of each user . \n for example , predicted gene models are linked to annotation reports , while genome conservation tracks are linked to vista point ( 23 ) . \n two new types of data , single - nucleotide polymorphisms ( snps ) and gene expression profiles , have been added to the browser , to enable the visualization of resequencing and transcriptomics data , respectively ( figure 3 ) . \n these are important additions to the resources developed , for example , for model fungi such as the ascomycete neurospora crassa ( 7 ) or the basidiomycete schizophyllum commune ( 24 ) . predicted gene models , and their annotations , \n can be improved through the process of manual curation , which is open to all authorized users and coordinated by the principal investigator of each project . \n such collective efforts were critical for the analysis of several fungal genomes ( 2431 ) . \n additionally , users can upload custom tracks to the browser and share them , either with specified collaborators or globally . this capability to upload data for individual genes or entire genomes , makes mycocosm a powerful and customizable data exchange resource for the community . \n the wealth of genomes in mycocosm creates an opportunity to compare groups of genomes , and the need for efficient tools to enable these comparisons . \n mycocosm therefore includes tools that integrate single genomes into a comparative context , such as the ability to visualize variation in gene counts in different go , kegg and kog categories across a user - selected assortment of genomes . \n additionally , mycocosm includes predefined groups of fungi to enable users to ask questions for fungal genomes in a group context . \n two types of genome groups are available in mycocosm and shown in figure 4 : ( i ) phylogroups , consisting of phylogenetically related species ( corresponding to the nodes of the mycocosm tree ) , and ( ii ) ecogroups , containing fungi of similar lifestyle or ecology ( but which may be phylogenetically distant ) . both kinds of group offer consistent interfaces for comparative analyses . \n genome sizes and gene counts may be compared on the info page ( figure 4 ) , giving a coarse - grained overview . \n genes shared between genomes within a group can be explored using precomputed markov clustering ( 32 ) of the full set of protein sequences in the group . \n derived from all - versus - all blast alignments of the proteins , these gene clusters can be thought of as protein \n families. the clusters can be filtered to show genes shared between all , or some , organisms in the group , or to find genes unique to them as described in details in help pages . \n each cluster is linked to a page listing all the genes of the cluster with graphical display of protein domains , intron \n a larger genome - scale synteny calculated by vista ( 23 ) is available from the synteny menu of individual genome portals , where dot - plots , for example , can illustrate the full spectrum of micro- , meso- and macro - synteny between different pairs of dothideomycete species ( 31 ) . \n this phenomenon is limited to this class of fungi and illustrates the utility of the group - centric approach for comparative genome analysis . \n even though all major nodes of the mycocosm tree are represented by at least one sequenced genome , many fungal clades remain unrepresented . \n the 250 + annotated genomes in mycocosm are a small fraction of the total number of fungal species , estimates of which range from 1.5 million to as high as 5.1 million ( 33,34 ) . thus , sampling of the fungal tree of life by genomics is sparse , and likely has left many biologically interesting clades unexplored . \n this undersampling will surely limit our attempts to understand functional diversity and evolution through fungal genomes , and will hamper metagenomics studies of fungal communities , where a broad array of reference genomes is required to interpret complex sequence data . to encourage the scientific community to participate in determining what gaps in the fungal tree of life will be filled in next , every node of mycocosm \n nominate link to enable users to recommend new genomes for sequencing via the 1000 fungal genomes project ( http://1000.fungalgenomes.org ) . following this link from a given node \n , families of fungi with no , or only one , sequenced genomes ( figure 5 , green and yellow rows ) display a \n nominate button , which invites users to describe the species , access jgi user guidelines and provide dna and rna samples to jgi for sequencing ( if approved by peer review ) . \n the 1000 fungal genomes project aims to have at least two sequenced genomes for every family of fungi . through this and other jgi community sequencing projects ( 35 ) , we aim to fill the remaining gaps in the fungal tree of life . to enable visibility of ongoing jgi genome projects , the projects menu of mycocosm ( http://jgi.doe.gov/projects ) lists each project s status , principal investigator and other pertinent information . \n combined with other genome projects listed in the gold database ( 36 ) and other sources , they form a \n master list helps us better focus our sequencing efforts on unexplored regions of the fungal tree of life . \n thus , we integrate a full genome project cycle ( from sequencing target selection through assembly and annotation , to biology - driven data analysis ) into mycocosm enabling users to be active contributors to this process . \n since the release of its first fungal genome 10 years ago , the number of fungal genomes sequenced by jgi has jumped to > 200 . \n collecting , integrating and visualizing these genomes , and those in sequencing pipeline , for efficient comparative analysis requires new approaches and tools . especially , functional genomics will quickly reveal putative functions of a large number of genes identified only through genome sequencing ( as opposed to smaller - scale biochemical and genetic studies ) . \n new interactive tools for transcriptomics , epigenomics , population genomics and metagenomics will therefore be developed and integrated into mycocosm , in support of data analysis and utilization , and hypothesis development . \n director , office of science , office of biological and environmental research , life sciences division , us department of energy [ de - ac02 - 05ch11231 ] . \n funding for open access charge : us department of energy contract [ no . de - ac02 - 05ch11231 ] .", "role": "user" }, { "content": "mycocosm is a fungal genomics portal ( http://jgi.doe.gov/fungi ) , developed by the us department of energy joint genome institute to support integration , analysis and dissemination of fungal genome sequences and other omics data by providing interactive web - based tools . \n mycocosm also promotes and facilitates user community participation through the nomination of new species of fungi for sequencing , and the annotation and analysis of resulting data . by efficiently filling gaps in the fungal tree of life \n , mycocosm will help address important problems associated with energy and the environment , taking advantage of growing fungal genomics resources .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the rapidly increasing use of microwave radiation , has raised public concern about possible detrimental effects of non - ionizing radiation sources , which work in this frequency range . \n radio detection and ranging ( radar ) equipments send and transmit high - power radio frequency ( rf ) waves by producing a high - voltage and high frequency alternating electrical current . \n radar workers are routinely exposed to pulsed high frequency electromagnetic fields ( emf ) , which are produced to locate and identify the presence , direction or range of airplanes , ships , control towers or other , usually moving objects . \n nowadays , radar systems , which operate at rf between 300 mhz and 15 ghz , are widely used for navigation , aviation , national defense , weather forecasting , and even speed control ( hand - held police radars ) . as \n radiations emitted by radar systems must travel long distances to detect objects , the power must be relatively high at transmission site . \n recent studies conducted on the health effects of occupational exposure to military radar radiations indicate some detrimental effects such as induction of oxidative stress ( decreased glutathione concentration vs. increased concentration of malondialdehyde ) , reduced fertility , increased level of dna damage and chromatid breaks . furthermore , some non - emf hazards such as radar equipment - related electrical injury are also reported . \n there are also reported risks such as increased incidence of hemolymphatic cancers that can be caused by microwaves generated by radars or ionizing radiation produced by electronic devices producing the microwaves . on the other hand , \n there are published reports that could not show any detrimental effect in radar workers . in a 40-year controlled longitudinal belgian study , \n no increase in all - cause mortality in military personnel who were in close contact with radar equipments was found . \n the aim of this study was to assess if occupational exposure of military radar personnel affect their general health . \n this study was conducted on apparently healthy male and female workers employed in airport surveillance radar sites with a frequency range of 14 - 18 ghz . in this study , health effects of these radiations in personnel who routinely work with radar systems are investigated . after obtaining informed consent , 100 workers ( mean age of 33.42 6.87 years , ranged 24 - 50 years ) including 91 males and 9 females , participated in the study . \n a previously approved questionnaire including personal information , job status , possibility of exposure to other sources of emf ( mobile phones , cathode ray tubes ( crt ) , etc ) and adverse health symptoms ( self reported ) was used . the 28-item general health questionnaire ( ghq ) initially developed by goldberg and hillier to screen for somatic symptoms , anxiety , and insomnia , social dysfunction , and severe depression \n was used as a self - administered tool for assessment of general mental health , and mental distress . \n the validity and reliability of the persian version of this questionnaire , which is understandable to almost every iranian , was approved previously . \n a modified bracy simple visual reaction time test that was developed in the center for research in radiation sciences ( crrs ) , shiraz university of medical sciences , was used in this study . \n visual reaction time ( vrt ) of all participants was recorded with a simple blind computer - assisted - visual reaction time test . to evaluate participants sustained attention and response time , \n the participants were asked to respond as quickly as possible by a single right click on a computer mouse when a red square on the display was replaced by a green one . \n the students had to perform some preliminary tests for orientation with the test . in this \n after orientation , to reduce random variation of measurements , each test was repeated 7 times in both real and sham exposure phases . \n wechsler memory scale - iii ( wms 1991 ) test was performed on all participants . \n the test includes four subtests including forward and backward digit span , paired words , and word recognition . to perform the wms digit span memory test , \n participants were asked to repeat back a list of digits , which were spoken live - voice , by an expert member of our research team at a rate of approximately one digit per second . \n this study was conducted on apparently healthy male and female workers employed in airport surveillance radar sites with a frequency range of 14 - 18 ghz . in this study , health effects of these radiations in personnel who routinely work with radar systems are investigated . after obtaining informed consent , 100 workers ( mean age of 33.42 6.87 years , ranged 24 - 50 years ) including 91 males and 9 females , participated in the study . \n a previously approved questionnaire including personal information , job status , possibility of exposure to other sources of emf ( mobile phones , cathode ray tubes ( crt ) , etc ) and adverse health symptoms ( self reported ) was used . \n the 28-item general health questionnaire ( ghq ) initially developed by goldberg and hillier to screen for somatic symptoms , anxiety , and insomnia , social dysfunction , and severe depression was used as a self - administered tool for assessment of general mental health , and mental distress . \n the validity and reliability of the persian version of this questionnaire , which is understandable to almost every iranian , was approved previously . \n a modified bracy simple visual reaction time test that was developed in the center for research in radiation sciences ( crrs ) , shiraz university of medical sciences , was used in this study . visual reaction time ( vrt ) of all participants was recorded with a simple blind computer - assisted - visual reaction time test . to evaluate participants sustained attention and response time , \n the participants were asked to respond as quickly as possible by a single right click on a computer mouse when a red square on the display was replaced by a green one . \n the students had to perform some preliminary tests for orientation with the test . in this stage , reaction time \n after orientation , to reduce random variation of measurements , each test was repeated 7 times in both real and sham exposure phases . \n wechsler memory scale - iii ( wms 1991 ) test was performed on all participants . \n the test includes four subtests including forward and backward digit span , paired words , and word recognition . to perform the wms digit span memory test , \n participants were asked to repeat back a list of digits , which were spoken live - voice , by an expert member of our research team at a rate of approximately one digit per second . \n as shown in table 1 , the mean age of the participants was 33.42 6.87 ( ranged 24 - 50 ) years \n . forty - eight percent of the participants had worked 8 hours or less than 8 hours per day , while 48% and 2% of the participants had worked 9 - 10 hours per day and more than 10 hours per day , respectively . \n only 1% of the participants had worked less than 5 days per week , while 84% and 15% of the participants had worked 5 days per week and 6 days per week , respectively . moving to work experience as a cardinal factor that determines the occupational health effects , 20% of the participants had work experiences of 24 months or less while 30% , 35% , and 15% had work experiences in the range of 25 - 148 , 49 - 120 , and more than 121 months , respectively . \n on the other hand , considering the average distance of the participants from radar antennas , 33% had worked in distances of 4 meters or less , while 47% and 20% had worked in distances of 5 - 10 meters and more than 10 meters , respectively . \n demographic and occupational characteristics of the sample ( n = 100 ) mean ( sd ) ghq-28 scores of participants in all subsets and the scores in each subsection of somatic symptoms , anxiety / insomnia , social dysfunction , and severe depression are shown in table 2 . \n the mean score of ghq in all subsets was 0.44 0.52 while these scores for somatic symptoms and anxiety / insomnia were 1.03 0.49 and 0.99 0.58 , respectively . \n the ghq scores for social dysfunction and severe depression were 1.08 0.34 and 0.44 0.52 , respectively . \n thirty percent of the participants have reported that rather more than usual they had recently been feeling in need of a good tonic ( question#2 ) . in response to this question that if they have recently been feeling run \n down and out of sorts ( question#3 ) , 31% responded rather more than usual . in response to this question that if they have recently been getting any pain in their head ( question#5 ) , 29% responded rather more than usual . \n regarding feeling of tightness or pressure in their head ( question#6 ) , 24% responded rather more than usual . on the other hand , in response to this question that if they had difficulty in staying asleep once you were off ( question#9 ) , 20% responded rather more than usual . \n regarding feeling constantly under strain ( question#10 ) , 37% responded rather more than usual and 10% responded \n much more than usual . considering been getting edgy and bad - tempered ( question#11 ) , 32% responded rather more than usual and 7% responded \n much more than usual . in response to this question that if they have been able to enjoy their normal day - to - day activities ( question#21 ) , 31% responded \n as shown in table 3 the number of work hours per day could not affect the ghq-28 scores of participants . \n on the other hand , work experience [ table 4 ] and the distance [ table 5 ] from the antenna played no role in mean ghq - scores of the participants . \n mean ( sd ) ghq-28 scores of participants in each subsection of somatic symptoms , anxiety / insomnia , social dysfunction , and severe depression mean ( sd ) ghq-28 scores of participants with different hours of work per day mean ( sd ) ghq-28 scores of participants with different work histories mean ( sd ) ghq-28 scores of participants who work in different distances from the antenna the relationship between reaction time and the participants work experience chi - square test showed statistically significant relationship between work experience and forward digit span ( p < 0.001 ) . \n on the other hand , significant relationships were found between work experience and reverse digit span ( p < 0.001 ) , word recognition ( p \n there were also significant relationships between age of the participants and the majority of these short - term memory indices i.e. , forward digit span ( p < 0.003 ) , reverse digit span ( p < 0.011 ) , and word recognition ( p = 0.001 ) . \n the relationship between age and paired words was not statistically significant ( p < 0.001 ) . \n after adjustment for age , forward digit span , reverse digit span , word recognition and paired words remained associated with work experience . the relationship between reaction time and the participants work experience \n chi - square test revealed a statistically significant relationship between work experience and reaction time ( p < 0.001 ) . \n again , there was a significant relationship between participants age and the reaction time ( p < 0.001 ) . \n chi - square test could not show any statistically significant relationship between average distance of participants work place from the radar antenna and short - term memory indices ; forward digit span ( p = 0.590 ) , reverse digit span ( p = 0.107 ) , word recognition ( p = 0.172 ) and paired words ( p = 0.631 ) . \n this test also could not reveal any significant relationship between distance and reaction time ( p = 0.200 ) . \n the results of a linear regression analysis showed that the work experience had a significant positive correlation with reaction time ( r square = 0.556 , p < 0.001 ) . \n neither work experience ( r square = 0.003 , p = 0.602 ) nor distance ( r square = 0.005 , p = 0.479 ) had any significant positive correlation with total score of ghq . \n on the other hand , work experience had a significant positive correlation with forward digit span ( r square = 0.162 , p < 0.001 ) , reverse digit span ( r square = 0.223 , p < 0.001 ) , word recognition ( r square = 0.250 , p < 0.001 ) and paired words ( r square = 0.264 , p < 0.001 ) . \n the findings of the ghq-28 test indicated that at least 20 - 39% of the radar workers reported different problems such as needing a good tonic , feeling run down and out of sorts , headache , tightness or pressure in the head , insomnia , getting edgy , and bad - tempered . \n interestingly , 47% of the radar workers reported feeling under strain ( 37% rather more than usual and 10% much more than usual ) . on the other hand , in response to this question that if they have been able to enjoy their normal day - to - day activities , 31% responded \n it was also shown that work experience had significant relationships with reaction time and short - term memory indices such as forward digit span , reverse digit span , word recognition , and paired words . \n results obtained in this study generally confirm the findings of other investigators who have reported detrimental health effects of the occupational exposure to radar radiations such as decreased sperm motility and viability in highly exposed group compared to those of the lowly exposed and control groups . increased sperm dysmorphia and alteration in quality of semen in response to changes in microwave frequency , distance , intensity , exposure time and quality of shielding , increase in frequency of micronuclei . on the other hand , \n these findings are not in generally in line with those reports that showed biological alterations without major clinical implications such as increased igg , igm , and iga level and decreased count of lymphocytes and t8 cells or even some beneficial bio effects such as lower all - cause mortality rate in military conscripts who served in battalions with anti - aircraft radars versus controls . \n investigation of the general and more specifically mental health that is believed to be an integral and essential component of health was among the main goals of this study . \n the world health organization ( who ) constitution states : health is a state of complete physical , mental and social well - being and not merely the absence of disease or infirmity . in this light , mental health is more than the absence of mental disorders or disabilities . while exposure to radiofrequency radiation has not consistently been shown to have an effect on well - being or self - reported symptoms such as headache , fatigue , dizziness , and concentration difficulties , our study showed that a considerable portion of the radar workers participated in this study suffer from problems such as needing a tonic , feeling run down and out of sorts , headache , tightness or pressure in the head , insomnia , getting edgy , and bad - tempered . despite much dissimilarity , \n our findings are clearly in contrast with some recent studies that report lack of evidence for a direct association between frequency and severity of non - specific physical symptoms and higher levels of emf exposure . \n altogether the results obtained in this study indicate that occupational exposure to radar microwave radiations may be linked to some adverse health effects . in this light , \n attempts for reducing exposure of radar workers to radiofrequencies generated by radar systems should be considered as a critical goal .", "role": "user" }, { "content": "introduction : radar workers are exposed to pulsed high frequency electromagnetic fields . in this study , \n health effects of these radiations in personnel who routinely work with radar systems are investigated.materials and methods : the 28-item general health questionnaire was used as a self - administered tool for assessment of general mental health and mental distress . \n one hundred workers occupationally exposed to radar radiations ( 14 - 18 ghz ) participated in the study . \n visual reaction time was recorded with a simple blind computer - assisted - visual reaction time test . to assess \n the short - term memory , wechsler memory scale - iii test was performed.results:twenty to 39% of the radar workers reported different problems such as needing a good tonic , feeling run down and out of sorts , headache , tightness or pressure in the head , insomnia , getting edgy and bad - tempered . furthermore , 47% of the radar workers reported feeling under strain . in response to this question that if they have been able to enjoy their normal day - to - day activities , 31% responded less than usual . \n it was also shown that work experience had significant relationships with reaction time and short - term memory indices i.e. , forward digit span , reverse digit span , word recognition and paired words.conclusion:to the best of our knowledge , this is the first study to show that occupational exposure to radar microwave radiation leads to changes in somatic symptoms , anxiety and insomnia , social dysfunction , and severe depression . \n altogether these results indicate that occupational exposure to radar microwave radiations may be linked to some adverse health effects .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: pam4 , a new monoclonal antibody ( mab ) also known as clivatuzumab , is absent from the normal tissues , as well as breast cancer , liver cancer , prostate cancer , and renal cancer . \n it is reactive with greater than 80% of pancreatic cancer and has a limited reactivity with ovarian cancer , stomach cancer , colon adenocarcinoma , and lung cancer [ 13 ] . \n in addition , pam4 is also expressed in its precursor lesions , pancreatic intraepithelial neoplasia ( panin ) , and intraductal papillary mucinous neoplasia ( ipmn ) in pancreatic cancer . \n pancreatic cancer is one of the deadliest of the solid malignancies with a 5-year survival rate of 35% [ 4 , 5 ] . \n it is the fourth commonest cause of cancer - related death among men and women in the united states . in 2013 , \n an estimated 45,220 people in the usa were diagnosed with pancreatic cancer , and 38,460 died of the disease . \n most cases of pancreatic cancers have advanced stage at time of diagnosis with a median survival of less than 1 year . \n the dismal prognosis can be partly attributed to the absence of early symptoms , late diagnosis , and the poor response to radio- and chemotherapy . \n how to establish a methodology to define benign pancreatitis form pancreatic malignancy or metastatic carcinomas remains to be investigated . \n although ca19 - 9 is the most widely investigated and evaluated marker for testing pancreatic cancer diagnosis , the sensitivity and specificity are not optimal . with rapid advances in imaging technology , ultrasound , computerized tomography ( ct ) , magnetic resonance imaging ( mri ) , \n positron emission tomography ( pet ) , and pet - ct technologies play an important role in the diagnosis of pancreatic cancer . \n surgical resection has been the only modality curative treatment for pancreatic cancer , but the majority of patients present at a late stage when the disease does not respond to surgical therapy . \n radiation and/or chemical therapy have a limited impact on the control of pancreatic cancer , resulting in the rapid regrowth of the tumor [ 7 , 11 ] . \n thus , there is an urgent need to develop new means for early diagnosis and new therapeutic approaches to improve the clinical outcome of the deadly disease . \n , pam4 is discussed with a focus on its potential as a serum marker for diagnosis and as a target of both radioimmunodiagnostic and radioimmunotherapeutic agents in pancreatic cancer due to its limited distribution on normal tissues and other solid tumors . \n pam4 , a monoclonal antibody to muc1 , is an lgg1 immunoglobulin produced by immunization of mice with mucin purified from the xenografted ripi human pancreatic cancer originally a mucinous , moderately differentiated tumor in the head of the pancreas . \n muc1 is a transmembrane glycoprotein associated with cell transformation , invasion , migration , apoptosis , cellular interactions , immune regulation , and drug resistance [ 1216 ] . \n pam4 recognizes a unique and novel epitope which is not reactive with the peptide core of mucin and distinct from that of b72.3 , ca19 - 9 , dupan2 , span1 , nd2 , cea , and lewis antigens [ 2 , 17 ] . \n recent studies show that pam4 is reactive with the c - terminal region of the muc5ac . \n actually the carbohydrate structures are not the part of the pam4 epitope but are necessary to maintain the correct peptide conformation . \n furthermore , the pam4 epitope was found to be highly sensitive to heat , reduction of disulfide bonds , proteolytic digestion , or deglycosylation . \n although the detailed characteristic of the pam4 epitope is unknown , it is thought to be dependent on muc1 glycosylation status in recent studies . \n there is a growing body of evidence that pam4 is highly reactive with pancreatic cancer . in the original study by gold and coworkers , \n the immunoreactivity of pam4 with pancreatic cancer was evaluated by immunohistochemistry using frozen section tissues of patients . \n all but four pancreatic cancers ( 21/25 , 23 primary and 2 metastatic ) were immunoreactive with pam4 . \n pam4 reactivity showed weak positive staining of 40% ( 10 of 26 ) of colorectal cancer , 20% ( 1 of 5 ) of gastric cancer , and 6.6% ( 1 of 15 ) of lung cancer . \n interestingly , staining was restricted to the ductules ; minor staining of a few scattered ductule cells was observed . \n none of the breast cancer , ovarian cancer , liver cancer , prostate cancer , and renal cancer was stained . however , compared to its weak staining in the goblet cells along the gastrointestinal tract , strong staining was present in pancreatic cancer . \n this was confirmed in a large study by gold et al . who evaluated the immunoreactivity with pam4 in 320 invasive cancer specimens by tissue microarrays . \n in the study , pam4 expression was present in 48 of 55 ( 87% ) pancreatic cancers , 6 of 40 ( 15% ) stomach cancers , 7 of 76 ( 9% ) colon adenocarcinomas , 4 of 24 ( 17% ) ovarian cancers , 4 of 40 ( 10% ) lung cancers , 0 of 50 ( 0% ) breast cancers , and 0 of 35 ( 0% ) hepatocellular cancers . \n invasive pancreatic cancer can arise from three different noninvasive precursor lesions , including pancreatic intraepithelial neoplasias ( panin ) , intraductal papillary mucinous neoplasms ( ipmn ) , and mucinous cystic neoplasms ( mcns ) [ 18 , 19 ] . \n a hypothesis that has been proposed is that pam4 may be present during precursor lesions transition to invasive pancreatic adenocarcinoma . \n assessed the expression of the pam4-reactive muc1 by immunohistology in a study cohort of 55 invasive adenocarcinomas , 63 pancreatic intraepithelial neoplasias ( panin ) , 36 intraductal papillary mucinous neoplasms ( ipmn ) , and 11 normal pancreases . \n pam4-reactive muc1 was absent from normal pancreas , but it was identified in 87% of invasive cancers with no striking correlation with the clinical stage of disease . there was a trend for those tumors that were better differentiated to show the higher expression of the pam4-reactive muc1 . \n most importantly , pam4 is abundantly present in the earliest stages of pancreatic adenocarcinoma and its expression remains high in all stages of panin patients . \n for example , pam4 labeled 94% ( 44 of 47 ) of the panin patients tissues in the earliest stage ( stages 1a and 1b ) , 91% ( 10 of 11 ) of stage ii , 40% ( 2 of 5 ) of stage iii , and 86% ( 31 of 36 ) of ipmn . on the basis of these studies , it is concluded that pam4 is highly restricted to pancreatic adenocarcinoma and its precursor lesions , but it is also expressed to a lesser degree in other solid tumors . \n it is not useful in detecting early cancers and defining pancreatic cancer from pancreatitis and other benign lesions due to its poor specificity and sensitivity . \n pam4 can be shed from tumors and detected in serum . in recent years , the role of serum pam4 in the diagnosis of pancreatic cancer has been evaluated . \n for pam4 in a well - defined study group of 68 carcinomas , 29 chronic pancreatitides , and 19 healthy volunteers . \n apart from overall diagnostic performance of pam4 in the study , stage - dependent evaluation showed increasing sensitivities at advanced tumor stages with a sensitivity of 62% at stage i ( n = 21 ) , 86% at stage ii ( n = 14 ) , and 91% at advanced stages 3 and 4 ( n = 33 ) . another article by gold et al . examined the presence of pam4-reactive muc1 as a serum marker for pancreatic cancer with a sensitivity of 77% and a specificity of 95% . \n a total of 283 subjects were evaluated , including 53 pancreatic cancer patients , 87 pancreatitis patients , 100 other cancer patients , and 43 healthy volunteers . as with the pam4 immunoassay , \n none of the healthy specimens and only four of 87 pancreatitis patients ( 5% ) were positive above a cut off of 10.2 units / ml . \n however , of the 87 pancreatitis samples , the positive rate of ca19 - 9 was 37% . \n a direct pairwise comparison of pam4 and ca19 - 9 immunoassays for discrimination of pancreatic cancer and pancreatitis resulted in a significant difference , with the pam4 immunoassay demonstrating superior sensitivity and specificity . \n approximately seven years later , gold tested the pam4 in a large study group of 298 pancreatic ductal adenocarcinomas ( pdac ) , 99 other cancers , 120 benign pancreases , and 79 healthy controls reaching 76% sensitivity and 96% specificity . \n the specificity was significantly greater for the pam4 assays than ca19 - 9 assays , particularly with regard to chronic pancreatitis ( 86% and 68% , resp . ) . besides good overall high diagnostic performance , the detection rate for patients with respect to stage i disease was 64% and was considerably higher for patients with advanced disease ( 85% ) . \n pam4 antigen levels were significantly higher in patients with pdac than in other patient groups . \n at the same time , they evaluated the combination of pam4 and ca19 - 9 in serial testing and obtained an improved sensitivity ( 84% ) for the overall detection of pdac without a significant loss of specificity ( 82% ) compared with either assay alone in 474 specimens . \n some reported that both pam4 and ca19 - 9 were present simultaneously in the same serum , but others reported that they were independent of each other . \n for the most part , sera level from patients with pancreatic cancers arising from other tissues of origin did not have detectable levels of the pam4 antigen . from these studies , \n serum pam4 was reactive with a higher percentage of pancreatic cancer and gave a greater overall intensity of reaction at equivalent concentrations compared to serum ca19 - 9 . \n it also appeared that pam4 showed a superior sensitivity and specificity for discrimination of pancreatic cancer from pancreatitis than did ca19 - 9 . \n combining pam4 and ca19 - 9 can lead to an improvement in diagnostic accuracy for discriminating pancreatic cancer from pancreatitis and other solid tumors . in the near future \n on the other hand , it is obvious that a serum - based biomarker would provide a clinically more valuable and cost - effective tool for the early detection and diagnosis of pancreatic cancer . \n modern imaging modalities , like ultrasound , ct , mri , pet , and pet - ct , provide essential information for detection , diagnosis , and management of pancreatic cancer [ 8 , 9 ] . however , there are many limitations with respect to the detection of small lesions , as well as for discriminating pancreatic cancer and precursor lesions from pancreatitis . \n detection of small , early stage pancreatic adenocarcinoma in the asymptomatic patient is crucial for the increased survival rates . \n monoclonal antibody ( mab ) based imaging holds the potential to impact these problems . taking into account the high specificity of pam4 in pancreatic cancer , several lines of work support the use of pam4-based radioimmunotargeting agents for pancreatic cancer imaging . \n there are several radiolabeled pam4 agents that have been developed and some are being evaluated in preclinical and/or clinical studies , such as i - pam4 , in - pam4 , tc - pam4 , and y - pam4 . \n more than a decade ago , gold and colleagues used postadministration imaging of i - labeled murine pam4 ( i - mpam4 ) to assess tumor targeting in the four different human pancreatic cancer models ( aspc1 , bxpc3 , hs766 t , and capan1 ) that represent the range of expected differentiation of this tumor type . \n after intravenous administration of i - mpam4 there was preferential localization of radioactivity in each tumor line as assessed by the tumor : nontumor ratios and tumor : blood ratios . \n tumor / nontumor ratios for pam4 were always greater than for nonspecific , isotype - matched ag8 . \n at the same time , the blood activity of i - mpam4 was significantly lower than ag8 over the period of observation . \n the specific tumor concentration of pam4 increased levels of pam4 protein ( from 10 g to 100 g ) . \n there was no evidence of pam4 targeting to nontumor tissues except for splenic uptake in capan1 tumor , which may be due to that pam4 released from the tumor became entrapped in the spleen or that circulating antigen - antibody complexes were deposited in the spleen . \n other studies also showed similar results [ 24 , 25 ] . in these studies , \n radiolabeled pam4 showed specific localization of the primary orthotopic and metastatic tumors without significant accumulation in noncancer sites . \n of further note , microautoradiography was performed on 5 m sections through the tumor . in initial clinical trials by mariani et al . \n , i - mpam4 was injected into five patients with suspected pancreatic cancer ( postoperation pathology confirmed pancreatic cancer in four of the five patients , whereas the fifth patient was diagnosed with chronic pancreatitis ) . \n they found a quite satisfactory pattern of distribution of the i - mpam4 with good radioactivity accumulation in primary pancreatic cancer and metastatic pancreatic cancer . \n furthermore , they found no severe adverse clinical reactions and no abnormal results of blood chemistry tests , whereas low nonspecific radioactivity accumulation in the liver , spleen , and bone marrow was due to the blood pool . \n immunoscintigraphy showed clear tumor uptake in all four pancreatic cancer patients , but failed to find in the pancreatitis patients . \n significant uptake of i - mpam4 in the tumor lesions was observed at relatively late times , starting about 7296 hours after tracer injection . \n the tumor lesions detected by immunoscintigraphy ranged in size from bulky lesions to liver metastases about 1 - 2 cm . in another study of five metastatic pancreatic cancer patients who received i - mpam4 igg ( n \n = 2 ) or tc - mpam4 fab ' ( n = 3 ) , gold et al . observed definitive tumor localization in four of five patients ; the fifth had no staining with mpam4 by immunohistology . \n consistent with previous findings , mpam4 specifically targetd not only can primary tumors but also metastatic lesions in pancreatic cancer patients . \n these data indicate the favorable tumor - targeting potential of radiolabeled mpam4 for diagnostic in primary and metastatic pancreatic cancer patients by immunoscintigraphy . \n murine mabs have a short survival time and induce a human anti - mouse antibody ( hama ) response . \n thus humanized pam4 ( hpam4 ) and chimeric pam4 ( cpam4 ) based on mpam4 are being evaluated in preclinical and/or clinical studies . \n the specificity and biodistribution characteristics of i - labeled cpam4 ( i - cpam4 ) and in - labeled cpam4 ( in - cpam4 ) were shown to be similar to that of i - mpam4 as described above [ 24 , 26 ] . in these studies , \n accumulation of cpam4 within the capan1 tumor - bearing mice was 2.8-fold higher than nonspecific hll2 ( anti - cd22 antibody ) , with peak levels of cpam4 occurring on day 4 after injection . \n tumor / blood radiation dose ratios were 3.6 and 0.6 for yttrium-1 , 4 , 7 , 10-tetraazacyclododecane - n , n , n , n-tetra - acetic acid ( dota ) cpam4 ( y - dota - cpam4 ) and y - dota - hll2 , respectively . \n gulec et al . investigated the biodistribution of in - labeled humanized pam4 ( in - hpam4 ) in patients suffering from pancreatic cancer in a phase i clinical trial [ 2729 ] . \n pancreatic cancers were clearly visible at 24 hours after injection and the visibility was progressively prominent on the subsequent images . \n there was no qualitative difference apparent in the biodistribution of in - hpam4 at the two doses ( 10 mg and 100 mg total hpam4 ) . \n thus , the hpam4 was suitable for the scintigraphic visualization of patients with pancreatic cancer . \n the group of cardillo developed bspam4 , a divalent and bispecific f(ab')2 mab , that was generated from chimeric pam4 fab ' and murine 734 fab ' fragments and then used in conjunction with 2 peptide haptens , in - labeled ac - phe - lys ( dtpa)-tyr - lys ( dtpa)-nh2 ( in - imp-156 ) and tc - labeled ac - lys ( dtpa)-tyr - lys ( dtpa)-lys ( thiosemicarbazonyl - glyoxyl - cysteinyl-)-nh2 ( tc - imp-192 ) [ 3033 ] . to confirm the tumor targeting specificity and delivery of bspam4 to the tumor \n , the biodistribution of this bspam4 was investigated in capan1 tumor - bearing mice using i - labeled bspam4 ( i - bspam4 ) . \n they found significantly higher amount of radioactivity in the tumor with i - bspam4 as compared with nontargeting i - labeled bsrit antibody and significantly greater tumor : nontumor ratios with i - bspam4 than directly radiolabeled pam4 f(ab')2 or pam4 whole igg . \n furthermore , it is demonstrated that both in - imp-156 and tc - imp-192 were suitable to detect pancreatic adenocarcinoma xenograft tumors pretargeted with bspam4 . \n approximately 4 years later , gold and colleagues developed a novel humanized tri - fab bispecific antibody . \n the bispecific antibody , tf10 , was divalent form mab - pam4 and monovalent for mab-679 and can react against the histamine - succinyl - glycine hapten [ 3436 ] . \n biodistribution studies and nuclear imaging of the radiolabeled tf10 and/or tf10-pretargeted hapten - peptide ( imp-288 ) were conducted in nude mice bearing capan1 human pancreatic cancer xenografts . \n they found greater tumor : nontumor ratios for tf10-pretargeted in - imp-288 as compared with in - imp-288 alone and in - hpam4 alone and superior images for tf10-pretargeted in - imp-288 compared with in - imp-288 alone . \n moreover , tf10 cleared rapidly from the blood and nontumor tissues , while maintaining high signal strength at the tumor site . \n of special note , the majority of these tumors were 0.5 cm in diameter . \n these studies demonstrated the feasibility of the pretargeted bspam4 and tf10 for nuclear imaging of human pancreatic cancer xenograft tumors in nude mice . \n thus , pam4-based radioimmunoimaging is not only used for determining focal , size , range , and location of pancreatic cancer , but also for early detecting of the small lesions which can not be detected by conventional imaging modalities . \n besides the usefulness of pam4 as a target of radioimmunodiagnostic agents , radiolabeled pam4 has also been tested for selective treatment of pancreatic cancer . \n hpam4 radiolabelled with -emitting radioisotopes , such as yttrium-90 ( y ) , has been used for the radioimmunotherapy ( rait ) of pancreatic cancer in clinical trials . \n animal studies consistently show that administration of i - pam4 to orthotopic transplants of capan1 tumors exhibited marked regression of tumors and significantly ( p < 0.001 ) extended survival time with few toxic effects as compared with untreated control group [ 25 , 29 , 37 ] . \n i - pam4 provided at least 3-fold longer extended survival time than untreated controls in animals bearing tumors of 0.5 and 1.0 cm groups and more than 2-fold increase in the very large tumor burden of 2.0 cm . \n furthermore , it provided cure for small tumors ( 0.25 cm ) and a 60% cure rate for large tumors ( 1.0 cm ) . on the other hand , \n a significant extended survival was observed for the group receiving 2 doses compared to the group receiving only 1 dose in tumor burden of 1.0 cm . \n y may prove the superior option because it has a greater energy emission , shorter half - life , and longer path length of radiation emission than i . \n thus , cardillo et al . compared the antitumor effects in mice bearing capan1 xenograft tumors ( ~1.0 cm ) between the y - pam4 and i - pam4 . \n they found that y - pam4 provided significantly greater growth inhibition and longer median survival time than the i - pam4 ( p < 0.035 ) . \n these studies provide a rationale for initiating phase i clinical study for therapy of pancreatic cancer with pam4 . \n recent studies have looked at the antitumor activity of the radiolabeled pam4 in combination with gemcitabine chemo / radiosensitization agent [ 17 , 3840 ] . \n capan1 xenograft model was treated with gemcitabine alone , low dose i - cpam4 or y - dota - cpam4 alone , or the two agents in combination . \n this study showed marked antitumor synergy when gemcitabine was combined with low dose i - cpam4 or y - dota - cpam4 . \n increased antitumor activity with prolonged median survival time was doubled for the combined treatment regimen compared with treatment with gemcitabine alone and low dose i - cpam4 alone . \n furthermore , two cycles of the combined y - dota - cpam4 and gemcitabine yielded significant tumor regression and increased median survival compared to only 1 cycle , gemcitabine alone , y - dota - cpam4 alone , and those untreated . \n it is important to note that gemcitabine did not interfere with the biodistribution of radiolabeled antibody . \n a similar set of studies on treatment with double the dose of i - cpam4 with gemcitabine resulted in superior antitumor activity with tumor growth inhibition and 2-fold increased median survival time than treatment with i - hll2 ( a isotype - matched , humanized ll2 anti cd22 antibody ) with gemcitabine . \n given the higher accumulation of radioactivity with bspam4 to pancreatic cancer , gold and colleagues conducted studies to evaluate bspam4 as an immunotargeting agent for pancreatic cancer therapy . in recent years \n , they pursued the efficacy of tf10/ y - peptide pretargeting in capan1 xenografts model . \n radiation dose estimates suggested that tf10/ y - peptide pretargeting would provide a greater antitumor effect than y - pam4 . in another study by karacay and colleagues , tf10-y - imp-288 combined with gemcitabine in capan1 xenografts model significantly enhanced survival as compared with tf10-y - imp-288 alone . \n moreover , weekly fractionation of the pt - rait ( pretargeted radioimmunotherapy ) improved the responses as compared with a single treatment . \n thus , pam4-based pt - rait with y hapten peptide is an effective treatment for pancreatic cancer in animal model , and when combined with dose fractionation of the pt - rait , further improvements in therapeutic response were observed . with the current preclinical rait - gemcitabine studies , it is important to note that a significant and substantial antitumor effect was observed without evidence of life - threatening toxicity . in the study by glazer and colleagues , \n tumor sizes were measured weekly by exposing panc-1 and capan1 human pancreatic carcinoma xenografts to an rf ( radiofrequency ) field 36 hours after treatment with pam4 antibody - conjugated aunps ( gold nanoparticles ) . \n they found that capan1 tumors exposed to rf fields after pam4-aunp treatment were significantly smaller and began between weeks 1 and 2 . furthermore , both panc-1 and capan1 tumors treated with pam4-aunp followed by rf field exposure were necrotic compared with control tumors treated with rf field exposure or pam4-aunp alone . \n importantly , this occurred without any evidence of injury to selected normal tissues ( liver , spleen , lung , and kidney ) , changes in animal behavior and habits , or unexplained animal death throughout the course of the experiment . \n two phase i clinical trials of y - clivatuzumab tetraxetan ( y - hpam4 ) have been completed . \n these studies were designed to test the safety , maximum tolerated dose ( mtd ) , tumor responses , immunogenicity , and pharmacokinetics of y - hpam4 . in one study , 21 patients ( 17 patients with stage iv and 4 patients with stage iii ) initially received 3 to 5 mci of in - hpam4 , followed 1 week later by a single dose of y - hpam4 with y doses of 15 ( n = 8) , 20 ( n = 9 ) , and 25 mci / m ( n = 4 ) . \n however , one patient withdrew before y - hpam4 at the 15.0 mci / m dose level after developing gastric outlet obstruction from disease progression . \n administration was well tolerated in all patients and the mtd of y - hpam4 was established at 20 mci / m , with expected dose - limiting myelosuppression . \n antitumor activity was assessed by ct - based response evaluation criteria in solid tumors ( recist ) . out of the 20 patients treated , 3 patients had transient partial response and 4 patients had stable disease at 4-week evaluations . \n they achieved 32% to 52% shrinkage of the sum of the longest diameters of their target lesions at 4-week evaluations . \n the median overall survival ( os ) was 4.3 months , including 6 patients surviving 9.3 to 22.2 months . \n in particular , the treatment of smaller - sized tumors seems to be attractive as it was demonstrated that median os are approximately 3.5 times longer in maximum lesions 4.5 \n pharmacokinetic analysis showed that the serum of in - pam4 was 4.6 0.9 days for initial 15 patients and 3.8 0.5 days for the final 6 patients . \n ca19 - 9 velocity stabilized or decreased for 4 weeks after treatment in 5 of 20 patients ( 25% ) . in the other study , patients received gemcitabine 200 mg / m weekly for 4 weeks with in - pam4 given in the first week and y - hpam4 given once weekly for the next 3 weeks ( cycle 1 ) . \n 19 patients receive dose - escalation weekly y doses of 6.5 mci / m , 9.0 mci / m , 12.0 mci / m , and 15.0 mci / m . \n 19 patients subsequently received weekly doses of 9.0 mci / m or 12.0 mci / m . \n a total of 38 patients ( 33 patients with stage iv and 5 patients with stage iii ) were treated using this schedule and the mtd of y - hpam4 was 12 mci / m weekly for 3 weeks for cycle 1 , with 9.0 \n the dose - limiting toxicity ( dlt ) included grade 3/4 thrombocytopenia or neutropenia in 28 of 38 patients after cycle 1 and in all retreated patients . \n out of the 38 patients treated , 6 patients ( all with stage iv disease ) had partial response and 16 had stable disease as their best response . \n the 38 treated patients had a median overall survival ( os ) of 7.7 months , including 11.8 months for those who received repeated cycles ( 46% ( 6 of 13 patients ) 1 year ) , with improved efficacy at the higher radioimmunotherapy doses . in only one patient , an elevated titer of anti - hpam4 antibodies ( haha ) was observed . \n to ca19 - 9 , 33% of patients had a decrease of > 50% and 27% of patients had a decrease of > 75% from baseline after the first cycle at all dose levels . \n the results of this study showed that y - hpam4 is safe and had antitumor activity in pancreatic cancer patients . \n pam4 is an lgg1 immunoglobulin that has limited reactivity with nonpancreatic cancers and is absent from the normal pancreas . \n pam4 is highly reactive with pancreatic adenocarcinoma and its precursor lesions , which makes it a good candidate for pancreatic cancer detection and therapy . in serum analysis \n , pam4 has a superior sensitivity and specificity for pancreatic cancer compared to ca19 - 9 . \n combining pam4 and ca19 - 9 can lead to an improvement in diagnostic accuracy for discriminating pancreatic cancer from pancreatitis and pancreatic cancer from other solid tumors . taken together , pam4 not only is a good biomarker for pancreatic cancer diagnosis , but also might be a supplementary marker for pancreatic cancer diagnosis . thus far , \n preclinical and clinical trials of radiolabeled pam4 as a target of both immunodiagnostic and immunotherapeutic agents have shown great potential in the imaging and therapy of pancreatic adenocarcinoma . \n overall , pam4 is a promising new means to explore . in the near future , pam4 may be implemented into clinical routine for diagnosis , radioimmunodetection , radioimmunotherapy , and management of pancreatic adenocarcinomaand , possibly , may be seen in the field of radioimmunoguided surgery .", "role": "user" }, { "content": "pam4 , a new monoclonal antibody ( mab ) known as clivatuzumab , is highly reactive with pancreatic cancer and precursor lesions . \n it is absent from the normal tissues and has limited reactivity with nonpancreatic cancer . \n the detailed characteristic of the pam4 epitope is unknown but recent studies have shown that it is dependent on muc1 glycosylation status . \n the limited pam4 expression pattern makes it an attractive candidate for management of pancreatic adenocarcinoma . \n in addition , pam4 is a serum biomarker for diagnosis of pancreatic cancer . \n several different radiolabeled immunodiagnostic and immunotherapeutic agents of pam4 have been developed and some are being evaluated in preclinical and/or clinical studies . \n the review will focus on pam4 and its potential utility for the diagnosis , radioimmunodetection , and radioimmunotherapy of pancreatic cancer .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: this goal is achieved by thorough chemo mechanical preparation followed by three dimensional obturation of the root canal system . although mechanical instrumentation can remove a significant number of bacteria from the root canal system , the bacteria remaining in the intricacies of the canal can cause or sustain periradicular tissue inflammation . \n therefore , mechanical instrumentation of the pulp space is accompanied by use of different types of irrigation solutions . \n according to current literature , sodium hypochlorite and 2% chlorhexidine remains to be the most preferred irrigating solutions . \n however , it can cause soft - tissue inflammation if expressed out of the confines of the root canal . \n however , at 2% concentration , which is most commonly used in endodontics , may have toxic effects on host tissues if expressed beyond the confines of the root canal and may impair healing \n various parts of the plants like root , bark , seed and leaves have been an important source of medicine since thousands of years . in recent years \n a predominant interest has been observed in evaluating different plant extracts for their antimicrobial properties against bacteria causing dental caries and periradicular pathology . a study by murray et al . \n evaluated the possible use of morinda citrifolia juice as an alternative to sodium hypochlorite as an irrigant . \n berberine , a plant alkaloid isolated from many medicinal plants , when combined with chx was found to be comparable to sodium hypochlorite in its bactericidal efficacy . \n india has a rich flora of medicinal plant species that are widely distributed throughout the country . \n mimusops elengi , locally known as bakul is a small to large tree found all over india . \n the plant finds an important place in the indigenous system of medicine and its various parts are used in the treatment of various systemic diseases including dental problems . \n the bark of m. elengi is acrid , astringent and is used as a gargle for odontopathy , inflammation and bleeding gums . \n every part of the tree has been used as traditional medicine for household remedy against various human ailments . \n most of the parts of the plant such as fruits , seeds , leaves , bark and roots contain compounds with proven antiseptic , antiviral , antipyretic , anti - inflammatory , antiulcer and antifungal properties . \n ocimum sanctum , popularly known as tulsi is a time - tested premier medicinal herb that is used in ayurvedic medicine since ancient times . \n it has made an important contribution to the modern research due to its large number of medicinal properties . \n different parts of the plant have shown antimicrobial , anti - inflammatory , analgesic , antipyretic , antiulcer , antidiabetic , antioxidant and anticancer activity . \n the ayurvedic name of the plant is guduchi , giloy or amrita . in india , \n the extract of the plant is used as a remedy for many diseases including diabetes , hepatitis etc . \n , the plant finds a special mention for its use in tribal or folk medicine in different parts of the country . \n the drug has been subjected to extensive phytochemical , pharmacological and clinical investigations and many interesting findings have been reported . \n this study was aimed to compare the antimicrobial efficacy of various concentrations of selected medicinal plants like a. indica ( neem ) , o. sanctum ( tulsi ) , m. elengi ( bakul ) , t. cardifolia ( giloy ) and chx against common endodontic pathogens such as enterococcus faecalis , streptococcus mutans and staphylococcus aureus . \n the leaves of neem and tulsi , stem of giloy and bark of bakul were collected from the courtyard . \n all the plant materials were identified by the senior professor at l. m. college of pharmacy , ahmedabad . \n plant materials were washed with distilled water and dried under the shade for 10 - 12 days . \n the powdered material was again dried in an oven at 40c for 4 h and used for extraction . accurately weighed 50 g of powdered leaf sample \n this process was repeated until the residual marc got exhaustively extracted and finally extracts were pooled and evaporated in rota - evaporator . \n the extracts were concentrated under partial vacuum at 80c to dryness , leaving behind thick semi - solid residue . \n this extract was dissolved in dimethyl sulfoxide ( dmso ) to get six different concentrations to be tested . \n the microbial strains investigated in the study were obtained from imtech - chandigarh , india . \n the strains are e faecalis ( mtcc 439 ) , s. mutans ( mtcc 497 ) , and s. aureus ( mtcc 737 ) . \n the test microorganisms were subcultured on specific media procured by himedia laboratory pvt . ltd . \n , mumbai , india and incubated aerobically at 37c for 24 h. a total of six wells were made into a nutrient agar plate using sterile cork borer ( 6 mm . in diameter ) and inoculums containing 1 10 cfu / ml of bacteria were spread on the solid plate with the bacterial suspension . \n 100 l of the working solution of different medicinal plant extract carrying different concentration of the medicine was filled in the wells with the help of micropipette . \n the plates were then incubated at 37c for 24 h in an aerobic environment . after overnight incubation \n , the plates were observed for the zone of inhibition and the diameters of the inhibition zone in millimeters were measured using a scale . \n minimum inhibitory concentration ( mic ) and minimum bactericidal concentration ( mbc ) were determined using the micro broth dilution method . \n the collected data was analyzed using the following statistical test ( spss version 17 , inc . \n chicago , usa ) \n mean value and standard deviationone - way analysis of variancebonferroni post - hoc test to carry out multiple comparisons in bacterial inhibition zones between the groups ( p < 0.05 ) . \n mean value and standard deviation one - way analysis of variance bonferroni post - hoc test to carry out multiple comparisons in bacterial inhibition zones between the groups ( p < 0.05 ) . \n the leaves of neem and tulsi , stem of giloy and bark of bakul were collected from the courtyard . \n all the plant materials were identified by the senior professor at l. m. college of pharmacy , ahmedabad . \n plant materials were washed with distilled water and dried under the shade for 10 - 12 days . \n the powdered material was again dried in an oven at 40c for 4 h and used for extraction . accurately weighed 50 g of powdered leaf sample \n this process was repeated until the residual marc got exhaustively extracted and finally extracts were pooled and evaporated in rota - evaporator . \n the extracts were concentrated under partial vacuum at 80c to dryness , leaving behind thick semi - solid residue . \n this extract was dissolved in dimethyl sulfoxide ( dmso ) to get six different concentrations to be tested . \n the microbial strains investigated in the study were obtained from imtech - chandigarh , india . \n the strains are e faecalis ( mtcc 439 ) , s. mutans ( mtcc 497 ) , and s. aureus ( mtcc 737 ) . \n the test microorganisms were subcultured on specific media procured by himedia laboratory pvt . ltd . \n , mumbai , india and incubated aerobically at 37c for 24 h. a total of six wells were made into a nutrient agar plate using sterile cork borer ( 6 mm . in diameter ) and inoculums containing 1 10 cfu / ml of bacteria were spread on the solid plate with the bacterial suspension . \n 100 l of the working solution of different medicinal plant extract carrying different concentration of the medicine was filled in the wells with the help of micropipette . \n the plates were then incubated at 37c for 24 h in an aerobic environment . after overnight incubation , \n the plates were observed for the zone of inhibition and the diameters of the inhibition zone in millimeters were measured using a scale . \n minimum inhibitory concentration ( mic ) and minimum bactericidal concentration ( mbc ) were determined using the micro broth dilution method . \n the test microorganisms were subcultured on specific media procured by himedia laboratory pvt . ltd . \n , mumbai , india and incubated aerobically at 37c for 24 h. a total of six wells were made into a nutrient agar plate using sterile cork borer ( 6 mm . in diameter ) and inoculums containing 1 10 cfu / ml of bacteria were spread on the solid plate with the bacterial suspension . \n 100 l of the working solution of different medicinal plant extract carrying different concentration of the medicine was filled in the wells with the help of micropipette . \n the plates were then incubated at 37c for 24 h in an aerobic environment . after overnight incubation , \n the plates were observed for the zone of inhibition and the diameters of the inhibition zone in millimeters were measured using a scale . \n minimum inhibitory concentration ( mic ) and minimum bactericidal concentration ( mbc ) were determined using the micro broth dilution method . \n the collected data was analyzed using the following statistical test ( spss version 17 , inc . \n chicago , usa ) \n mean value and standard deviationone - way analysis of variancebonferroni post - hoc test to carry out multiple comparisons in bacterial inhibition zones between the groups ( p < 0.05 ) . \n mean value and standard deviation one - way analysis of variance bonferroni post - hoc test to carry out multiple comparisons in bacterial inhibition zones between the groups ( p < 0.05 ) . \n the current study showed that all the plant extracts and 2% chx exerted antibacterial activity against selected endodontic pathogens . \n the antimicrobial activities of the test agents were in direct proportion with the concentration used . \n the effect of different concentrations of neem , tulsi , bakul , giloy and 2% chx on selected microorganisms is tabulated in table 1 . \n values of zone of inhibition of different concentrations of tested agents minimum inhibitory and minimum bactericidal concentrations of the tested agents it is interesting to note that even at the lowest concentration , all the tested agents showed significant antimicrobial activity . o. sanctum ( tulsi ) showed highest zone of inhibition against s. mutans at 3 mg concentration . \n m. elengi ( bakul ) was most effective against e. faecalis at 3 mg concentration , whereas a. indica , o. sanctum and t. cardifolia showed no inhibitory effect at lower concentration . \n chx was most effective agent showing highest zone of inhibition at the highest concentration against s. aureus . \n at the same time it was most consistent of all the medicaments tested , showing inhibitory effect against all the three pathogens at all selected concentrations . \n in the current study , we explored four medicinal plants such as a. indica ( neem ) , o. sanctum ( tulsi ) , m. elengi ( bakul ) and t. cardifolia ( giloy ) as well as 2% chlorhexidine for their antimicrobial effectiveness against target endodontic pathogens like e. faecalis , s. mutans and s. aureus . \n it acts on available carbohydrate in the mouth , breaking it down with the production of lactic acid and subsequent demineralization of tooth structure . \n s. mutans along with s. aureus is frequently isolated from primary endodontic infection , as well as in root filled teeth . \n the presence of these microorganisms is also found to be more strongly associated with pre - operative symptoms and presence of swelling . \n e. faecalis remains to be the most frequently identified species in canals of root filled teeth with periapical lesions as established by different molecular methods from time to time . \n this may be due to its ability to survive the effects of a wide range of antimicrobial solutions and intracanal medicaments used during endodontic treatment procedures . \n the root canal is hardly a nutrient rich medium , but e. faecalis may survive on serum components from the dentinal fluid . \n therefore , even in a well debrided and coronally well - sealed root canal , remaining or surviving cells of e. faecalis may still grow and utilize local sources of energy and nutrients . \n the difference in antimicrobial activity at this concentration was statistically significant when compared with other agents like neem and bakul ( p < 0.05 ) . \n it has also shown its antimicrobial property against s. aureus and e. faecalis . however , in lower concentrations , e. faecalis showed resistance against tulsi with mic value of 1 mg . \n the results of our study are in agreement with previous studies where different concentrations of tulsi have been used against all three tested microorganisms . \n the biological properties of the plant has been attributed to the presence of active compounds like ursolic acid , flavonoids ( epigenin , orientin and vicenin ) , and phenolic compounds ( cirsilineol , circimaritin , isothymusin , eugenol ) . \n the leaves of tulsi contain 0.7% volatile oil comprising about 71% eugenol and 20% methyl eugenol . \n eugenol is the most prominent phytoconstituents present in this plant which may be responsible for antimicrobial activity . \n however , the difference with other agents was statistically insignificant ( p < 0.05 ) . \n the extract was found to be effective against streptococci isolated from tooth tartar of dental patients , thus confirming the traditional claim . in a similar study , \n a concentration of 450 g was found to be inhibitory for the growth of most of the tested salivary microflora . \n our study has shown that the extract is effective at even lower concentration with mic value of 250 g . \n methanolic extracts may show greater activity because more phytoconstituents are leached in it when compared to other extracts . \n different types of glycosides , alkaloids , phenols , tannins and saponins have been screened in the methanolic extract of this plant . \n neem extract has shown antimicrobial activity against e. faecalis and s. mutans in previous in vitro studies . \n prashant et al . , demonstrated that neem stick extract produced maximum zone of inhibition against s. mutans at 50% concentration . even at 5% concentration , \n bohora et al . , concluded that neem leaf extract has a significant antimicrobial effect against e. faecalis , candida albicans and mixed culture . \n our study has shown the leaf extract of neem is very effective against s. mutans and s. aureus with mic value of 125 g . \n where 10% concentration at the highest volume of 75 l was not effective on e. faecalis . \n it was effective only at the highest concentration of 50% and at the highest volume of 75 l . \n neem contains different active phytoconstituents such as alkaloids , glycosides , trepenoids , steroids and tannins . \n neem has been found to be highly effective in the treatment of periodontal diseases , thus exhibiting its biocompatibility with human pdl fibroblasts . \n the use of neem as an endodontic irrigant might be recommended because it is biocompatible antioxidant and thus not likely to cause severe injuries to patients . \n bitter test associated with this plant can be altered by the addition of sweeteners and flavors to increase the patient compliance and acceptability . \n nearly 2% chx showed the most consistent antimicrobial activity against all three pathogens with mic value of < 0.0625% . in our study \n we have used six different concentrations of chx with two fold reduction ( 2% , 1% , 0.5% , 0.25% , 0.125% and 0.0625% ) . \n this has been found to be more effective in the least time when compared with other concentrations of chx ranging from 0.002% to 2% . \n chx is active against a wide range of micro - organisms , such as gram - positive and gram - negative bacteria , bacterial spores , lipophilic virus , yeast and dermatophytes being bacteriostatic at lower concentrations and bactericidal at high concentration . \n it shows substantial antimicrobial effect against common endodontic pathogens like s. aureus , porphyromonas gingivalis , porphyromonas endodontalis , prevotella intermedia , e. faecalis , c. albicans and s. mutans . the antimicrobial effect is because of reaction of chx molecule with negatively charged groups on the cell surface , causing an irreversible loss of cytoplasmic constituents , membrane damage and enzyme inhibition . at higher concentrations \n chx results in extensive cell damage , coagulation of cytoplasm and precipitation of proteins and nucleic acids . \n however , it is ineffective against e. faecalis and s. aureus at lower concentrations with mic value of 500 g . \n this plant has been subjected to chemical investigations extensively and a number of chemical constituents belonging to different groups such as trepenoids , alkaloids , lignans and flavonoids , tannins , cardiac glycosides and steroids have been reported . which may account for the antimicrobial property of this agent . \n similar results have been observed in previous studies where this plant extract has shown promising results against the pathogens used in our study . \n under the limitations of this study , it can be concluded that a. indica , o. sanctum , t. cardifolia , m. elengi and chlorhexidine have antimicrobial effects against the endodontic pathogens like s. mutans , s. aureus and e. faecalis . however , further preclinical and clinical trials are required to evaluate the cytotoxicity and safety issues of these plant extracts before they can be recommended as an endodontic irrigant or intracanal medicament . furthermore \n , looking at the polymicrobial nature of endodontic infections these agents needs to be tested for their antimicrobial effectiveness against a wide range of microorganisms including strict anaerobes .", "role": "user" }, { "content": "objective : to check the antimicrobial activity of azadirachta indica ( neem ) , ocimum sanctum ( tulsi ) , mimusops elelngi ( bakul ) , tinospora cardifolia ( giloy ) and chlorhexidine gluconate ( chx ) on common endodontic pathogens like streptococcus mutans , enterococcus faecalis and staphylococcus aureus.materials and methods : the agar diffusion test was used to check the antimicrobial activity of the methanolic extracts of the medicinal plants along with chx . \n six different concentrations of the tested agents were used for the study . \n the values of zone of inhibition were tabulated according to the concentration of the tested agent and data was statistically analyzed using anova and bonferroni post- hoc tests . \n the minimum inhibitory concentration ( mic ) and minimum bactericidal concentrations ( mbc ) values were also recorded.results:all the plants extracts showed considerable antimicrobial activity against selected endodontic pathogens . at 3 mg . \n concentration , o.sanctum was the most effective against s. mutans , m. elengi showed highest zone of inhibition against e.faecalis , whereas chx was the most effective agent against s.aureus . \n chx was also the most consistent of all the medicaments testes , showing inhibitory effect against all the tree pathogens at all the selected concentrations.conclusions:the methanolic extract of a.indica , o.sanctum , m. elengi , t.cardifolia and chlorhexidine gluconate has considerable antimicrobial activity against s. mutans , e. faecalis and s. aureus .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: infectious keratitis is a potentially blinding ocular condition of cornea which can cause severe visual loss if not treated at early stage . \n if the appropriate antimicrobial treatment is delayed , only 50% of the eyes gain good visual recovery . \n it can be caused by bacteria , virus , fungus , protozoa , and parasites . \n the common risk factors for infectious keratitis include ocular trauma , contact lens wear , recent ocular surgery , preexisting ocular surface disease , dry eyes , lid deformity , corneal sensational impairment , chronic use of topical steroids , and systemic immunosuppression [ 25 ] . \n the common pathogens include staphylococcus aureus , coagulase - negative staphylococcus , pseudomonas aeruginosa , streptococcus pneumonia , and serratia species . the majority of community acquired cases of bacterial keratitis resolve with empiric treatment and do not require culture . \n corneal scraping for culture and sensitivity is indicated for corneal ulcers that are large in size , central in location , extend from middle to deep stroma , associated with pain , simultaneous presence of anterior chamber reaction or hypopyon , poor vision , and presence of corneal abscess or unresponsive to broad spectrum antibiotic therapy . \n recent studies have shown increasing evidence of resistance of microbes to antimicrobial agents [ 79 ] . \n microorganisms develop resistance due to chromosomal mutation , expression of latent chromosomal genes by induction or exchange of genetic material via transformation [ 9 , 10 ] . \n this can cause continued progression of the disease process despite the use of broad spectrum antibiotics . \n the purpose of this study was to review the newer treatments available for treating the infectious keratitis including those which are resistant to the antimicrobial therapy . \n a pubmed literature search was conducted up to april 2012 using the following key words : infectious keratitis , microbial keratitis , infective keratitis , new treatments for infectious keratitis , fourth generation fluoroquinolones , moxifloxacin , gatifloxacin , collagen cross - linking , and photodynamic therapy . \n articles reporting the efficacies of using fourth - generation fluoroquinolones or photodynamic therapy in the treatment of infectious keratitis were selected and analyzed . during selection of the articles , prospective studies had a higher ranking than the retrospective studies , and clinical / in vivo studies had higher ranking than in vitro studies . \n corneal ulcer or infectious keratitis is a serious condition of cornea that requires prompt management . when a patient presents with the features of infectious keratitis , clinical history and detailed clinical examination guide to the category of high risk or low risk characteristics . \n presence of history of ocular trauma , contact lens use , preexisting ocular surface disease , history of long term or injudicious use of topical steroids , large size of ulcer , and central location of ulcer are considered to be high risk characteristics . according to the american academy of ophthalmology guidelines for bacterial keratitis \n , most of the cases of community acquired infectious keratitis respond to the empirical treatment with antibiotics . \n corneal scraping is indicated for corneal ulcers that are large in size , central in location , extend from middle to deep stroma , associated with pain , simultaneous presence of anterior chamber reaction or hypopyon , poor vision , and presence of corneal abscess or unresponsive to broad spectrum antibiotic therapy . \n the culture - guided approach consists of taking a sample of corneal tissue by corneal scraping or biopsy and performing microbiological tests to determine the type of bacterial organisms and their sensitivity to the particular group of antibiotics . \n however , empirical antibiotics will usually be started after microbiological specimens have been collected if there is clinical suspicion of infection . \n they inhibit dna gyrase ( topoisomerase ii ) and topoisomerase iv enzyme , which are key enzymes involved in dna replication and transcription . \n dna gyrase on the other hand is the main target for gram - negative bacteria . \n nalidixic acid , the first generation fluoroquinolone , was used to treat urinary tract infection . \n the increasing incidence of resistance to earlier generation fluoroquinolones pointed to the need of newer generation antibiotics [ 13 , 14 ] . \n the second - generation fluoroquinolones include ciprofloxacin and ofloxacin ; third - generation fluoroquinolones include levofloxacin , fourth - generation fluoroquinolones include moxifloxacin and gatifloxacin . \n the advances in molecular structures of fourth - generation fluoroquinolones , that is , moxifloxacin and gatifloxacin , resulted in inhibition of both dna gyrase and topoisomerase iv in gram - positive bacteria . \n these changes increase the antibiotic potency against gram - positive organisms while maintaining their broad spectrum activities against gram - negative bacteria . \n these structural modifications also reduce the risk of development of resistant organisms since two concomitant mutations are necessary for the development of resistance [ 1618 ] . \n furthermore , the structure of moxifloxacin is resistant to bacterial cells ' efflux mechanism , thus enhancing its potency to kill bacteria . \n ophthalmic application of fluoroquinolones began in the 1990s when the second generation fluoroquinolones like ciprofloxacin and ofloxacin were available in topical form . \n they were used for the treatment of infectious keratitis and conjunctivitis [ 19 , 20 ] . in this paper \n , we reviewed the literature and looked into the clinical use of fourth - generation fluoroquinolones in the treatment of infectious keratitis . \n the potency of antibiotics against bacteria is reflected by the minimum inhibitory concentration ( mic ) obtained for different organisms during microbiological analysis . \n a drug with a low mic for a particular organism means that it has a potent antibiotic effect on this particular organism . \n kowalski et al . determined the mic90s of 177 bacterial keratitis isolates to ciprofloxacin , ofloxacin , levofloxacin , gatifloxacin , and moxifloxacin . \n they found that the mic90s for gram - positive bacteria were significantly lower for fourth - generation fluoroquinolones than second- or third - generations , especially for fluoroquinolone - resistant staphylococcus aureus ( 3.0 ug / ml in moxifloxacin and gatifloxacin versus 64.0 ug / ml in levofloxacin , ciprofloxacin , and ofloxacin ) . however , ciprofloxacin ( 2nd generation ) is still better than the third - and fourth - generation fluoroquinolones against gram - negative organisms including pseudomonas aeruginosa ( ciprofloxacin 0.125 ug / ml , ofloxacin 1.5 ug / ml , levofloxacin 0.5 ug / ml , moxifloxacin 0.75 ug / ml , gatifloxacin 0.38 ug / ml ) . among the two fourth - generation fluoroquinolones , moxifloxacin demonstrated statistically lower mic90s for most gram - positive bacteria ; gatifloxacin on the other hand was noted to have lower mic90s for most gram - negative bacteria . \n collected 772 bacterial isolates from cases of bacterial keratitis in multiple centers in the united kingdom and tested against standard and new antibiotics . among the fluoroquinolones ( ciprofloxacin , ofloxacin , levofloxacin , and moxifloxacin ) \n , moxifloxacin demonstrated the lowest mics for both gram - positive and gram - negative bacteria . \n chawla et al . identified 292 bacterial isolates from consecutive cases of suspected bacterial keratitis and reviewed their microbiological response to cefazolin , tobramycin , gatifloxacin , and moxifloxacin . \n susceptibilities to moxifloxacin and gatifloxacin were similar : 92.8% and 95.5% of all the bacterial isolates were susceptible to moxifloxacin and gatifloxacin , respectively . \n only 83.6% and 90.1% of the isolates were susceptible to cefazolin and tobramycin , respectively . \n a few other studies have tried to look into the in vitro susceptibilities of bacterial isolates obtained from ocular infections such as blepharitis , conjunctivitis , keratitis , and endophthalmitis to the commonly prescribed antibiotics . \n similar results regarding fluoroquinolones were obtained in these studies in which the fourth - generation fluoroquinolones were generally superior to other generations of fluoroquinolones in their actions on gram - positive bacteria [ 2427 ] . \n though consistent results were obtained for gram - positive organisms among these studies , in the study by oliveira et al . \n , ciprofloxacin had lower mics than the two fourth - generation fluoroquinolones for gram - negative bacteria , especially for pseudomonas species . \n the results of in vitro studies may not be directly translated to clinical effectiveness because there are no susceptibility breakpoints for topically applied antibiotics to the eye . \n three clinical trials were found in the literature investigating on the clinical efficacy of the fourth - generation fluoroquinolones in treating infectious keratitis . \n they recruited 229 patients with bacterial keratitis and randomized to three treatment groups , the moxifloxacin ( 1.0% ) group , the ofloxacin ( 0.3% ) group , and the combined fortified tobramycin ( 1.33%)/cefazolin ( 5.0% ) group . \n all the patients were given hourly instillation of the topical antibiotics in the first 48 hours then tapered off according to the protocol until after the 7th day when frequency of instillation will be adjusted according to clinical response . \n of the bacterial isolates obtained , none of them were resistant to moxifloxacin , 2.5% were resistant to ofloxacin , 2.8% to ciprofloxacin , 14.8% to cefazolin , 1.6% to tobramycin , and 17.5% to chloramphenicol . \n the cure rate , the mean time to cure , the clinical sign score , and the rate of serious complications were not significantly different among the three groups . \n two patients reported stinging and one developed ulceration of the inferior bulbar conjunctiva after applying antibiotics eyedrops , all of them were from the fortified treatment group . \n another study conducted by parmar et al . compared the effect of topical gatifloxacin 0.3% , a fourth - generation fluoroquinolone , with ciprofloxacin 0.3% , a second - generation fluoroquinolone , for the treatment of patient with bacterial keratitis and ulcer size of at least 2 mm . \n this study recruited a total of 104 patients randomized to the two treatment group , with in - patient hourly instillation of topical antibiotics until the ulcer began to heal with dosing frequencies adjusted accordingly . \n culture results revealed that significantly larger proportion of both gram - positive and gram - negative bacteria were susceptible to gatifloxacin than ciprofloxacin . \n 96.2% of gram - positive cocci were susceptible to gatifloxacin versus 60.4% to ciprofloxacin ; all gram - positive bacilli were susceptible to gatifloxacin but only 75% were susceptible to ciprofloxacin ; 92.9% of gram - negative bacilli were susceptible to gatifloxacin compared to 85.7% to ciprofloxacin . even for pseudomonas aeruginosa , \n clinically , 95.1% of patients in gatifloxacin group enjoyed good response and complete healing of ulcer , which was significantly higher than the ciprofloxacin group in which only 80.9% of patients had complete healing . the mean time taken for \n the latest clinical study of these kinds was conducted by shah et al . in 2010 . \n a total of 61 patients were randomized to three groups comparing the clinical effects of moxifloxacin 0.5% , gatifloxacin 0.5% , and combined fortified tobramycin 1.3%/cefazolin 5% on bacterial keratitis . \n all the patients suffered clinically from bacterial keratitis with ulcer size between 2 mm and 8 mm . in this study , \n topical antibiotics were instilled hourly for the first 4872 hours and then tapered off according to the study protocol . of \n the bacterial isolates tested , 5.2% were resistant to tobramycin and 10.4% were resistant to cefazolin . \n . the cure rates of the fortified antibiotics group was 90% and of the gatifloxacin and moxifloxacin group 95% . \n however , the difference was not statistically significant . the mean duration to heal , the final visual acuity , and the size of the corneal opacities at the end of the study were also found to be statistically insignificant . \n bacteria and fungi produce enzymes which have ability to digest human collagen and cause corneal melting . \n collagen cross - linking ( cxl ) is a technique that uses riboflavin and ultraviolet - a irradiation to cause a strengthening effect in corneal tissue which enhances its rigidity [ 3133 ] . \n the interactive effect of riboflavin with uv - a irradiation strengthens formation of chemical bonds between collagen fibrils in the corneal stroma and helps in increasing resistance against enzymatic digestion . \n it is an important micronutrient which plays a key role in maintaining health in human beings . \n it was demonstrated by japanese scientists that when riboflavin was exposed to visible or uv light , it could be used to inactivate the rna containing tobacco mosaic virus . since that discovery \n , this phenomenon has been used in several subspecialties of medicine to inactivate viruses , bacteria , and parasites [ 3639 ] . \n the photoactivation of riboflavin causes damage to rna and dna of microorganisms by oxidation processes and causes lesions in the chromosomal strands . \n in addition , the ultraviolet irradiation itself has sporicidal and virucidal effects [ 40 , 41 ] . the procedures of collagen cross - linking used in the treatment of infectious keratitis are almost identical to the standard protocol of treatment of keratoconus , with the exception that after application of anaesthetic eyedrops , only loose epithelium and the epithelium around the infectious site were removed in infectious keratitis [ 4244 ] . \n the purpose of removing the corneal epithelium is to achieve adequate penetration of riboflavin eye drops . \n riboflavin ( riboflavin / dextran solution 0.50.1% ) is instilled over the surface of cornea for a period of 2030 minutes at an interval of 2 - 3 minutes . \n this is followed by illumination of the cornea using a uv - x lamp , uv - a 365 nm , with an irradiance of 3.0 mw / cm and total dose of 5.4 j / cm . \n spoerl et al . showed that cross - linked corneas had increased resistance against enzymatic digestion by proteinases and collagenase . \n conducted an in vitro study to demonstrate the antimicrobial properties of riboflavin / uva ( 365 nm ) against common pathogens . \n they found this treatment to be effective against certain bacteria such as staphylococcus aureus ( sa ) , staphylococcus epidermidis ( se ) , methicillin - resistant s. aureus ( mrsa ) , pseudomonas aeruginosa , and drug - resistant streptococcus pneumoniae but ineffective against candida albicans . in a study by kashiwabuchi et al . , the authors did not find treatment with uva + riboflavin to be effective against trophozoites of acanthamoeba in vitro or in vivo . despite being ineffective in the in vitro test , in a case report by garduovieyra et al . and , \n ya , uva + riboflavin was shown to be effective in the treatment of acanthamoeba keratitis . \n their patients showed rapid reduction in ocular symptoms and ulcer size [ 48 , 49 ] . \n corneal cxl was initially used in conditions of corneal ectasia , for example , keratoconus . \n collagen cxl increases the biomechanical strength of cornea and helps in halting the progression of keratoconus [ 43 , 50 ] . \n mller et al . showed that cxl was able to improve healing in patients with corneal melting secondary to contact lens - related infectious keratitis . \n series of 5 patients with antibiotics treatment - resistant infectious keratitis demonstrated the efficacy of uva / riboflavin treatment in halting the progression of corneal melting . in a study by makdoumi et al . which consisted of 7 eyes , corneal melting was arrested and complete epithelialization achieved in all cases after collagen cross - linking treatment with riboflavin . \n for the two patients presented with hypopyon , the hypopyon regressed two days after cxl . in the most recent study by makdoumi et al . , cxl has been successfully used as the primary treatment in the subjects with infectious keratitis . \n only 2 out of the 16 patients in the study required antibiotics ; one required amniotic membrane transplantation . \n ferrari et al . also reported a case of escherichia coli keratitis with no improvement with topical and systemic antibiotics but started to heal after cxl was used . \n the in vitro studies of the mic of different antibiotics against keratitis isolates have provided an idea of the potencies of the fourth - generation fluoroquinolones moxifloxacin , gatifloxacin , and tobramycin - cefazolin against pathogens for infectious keratitis . \n however , we can not compare their relative potencies because they belong to different classes of antibiotics ( fluoroquinolones , aminoglycosides , cephalosporins ) which possess different mechanisms of action . \n the fourth - generation fluoroquinolones are found to be either similar to or better than earlier generations fluoroquinolones ( e.g. , ciprofloxacin , ofloxacin , levofloxacin ) in killing causative bacteria in infectious corneal ulcer [ 21 , 22 , 2447 ] . \n generally , moxifloxacin and gatifloxacin have higher potencies against gram - positive organisms while maintaining its broad - spectrum activities against gram - negative organisms . \n however , ciprofloxacin is still better than the third- and fourth - generation fluoroquinolones against gram - negative bacteria including pseudomonas aeruginosa . \n as discussed , in vitro potency may not translate directly to clinical efficacy because the latter is also affected by the tissue penetration and the final tissue concentration of the antibiotics . \n however , since topical antibiotic eye drops in ocular tissues can usually achieve ten- to hundred - folds higher concentrations than the usual mic for organisms [ 54 , 55 ] , even if a bacterial species is found to be resistant to a particular antibiotic in vitro , clinically it may still respond to that antibiotic . \n also , moxifloxacin has an advantage over other fluoroquinolones such as gatifloxacin and levofloxacin in that it is able to achieve higher conjunctival , corneal , and aqueous concentrations [ 5660 ] . \n mic was also noted to be correlated to the corneal scar size after healing of infectious keratitis . \n for every two - fold increase in mic , there will be a 0.33 mm increase in the diameter of the scar , though it is not found to be correlated with the best corrected visual acuity . \n therefore , the lower mics of the fourth - generation fluoroquinolones shown in the in vitro studies imply potentially better healing of the corneal ulcer [ 2127 ] . the results of the three clinical trials correlate well with the results of the in vitro studies in that fourth - generation fluoroquinolones were comparable to fortified antibiotics and were better than the second - generation fluoroquinolones in the treatment of infectious keratitis [ 2830 ] . the antibiotic resistance rates of the bacterial isolates were consistently lower in moxifloxacin and gatifloxacin than almost all other antibiotics . however , it is important to note that in the study by constantinou et al . \n , the percentage of gram - positive bacteria constituted 76.2% of all the bacterial isolates and gram - negative bacteria constituted 23.8% . \n in contrast , the hong kong and the united kingdom studies reported a different spectrum of pathogens in bacterial keratitis , with 46.8% gram - positive and 53.2% gram - negative in hong kong , and 38.9% gram - positive and 61.1% gram - negative in the united kingdom . since \n fourth - generation fluoroquinolones are known to have higher potency against gram - positive bacteria and lower potency than ciprofloxacin in the inhibition of pseudomonas aeruginosa [ 21 , 27 ] , the comparable efficacies of moxifloxacin , ofloxacin , and combined fortified tobramycin / cefazolin may not be reproducible in countries like hong kong and the united kingdom , especially when pseudomonas aeruginosa only constituted 7% of all the isolates in constantinou 's study but 36.4% and 49.1% in hong kong and the united kingdom . \n the cure rate by moxifloxacin could possibly be lower than that reported by constantinou et al . \n ( 81.3% gram - positive and 18.7% gram - negative ; 10.7% were pseudomonas aeruginosa ) and shah et al . \n ( culture positive cases : 85.5% gram - positive and 14.5% gram - negative ; 11.3% were pseudomonas aeruginosa ) . moreover , though the treatment failure rates were not significantly different , we can see that the actual percentage of treatment failure was lower in the fortified tobramycin / cefazolin group ( 0.0% ) than the moxifloxacin group ( 10.6% ) and the ofloxacin group ( 6.6% ) . again , though not statistically significant , the mean durations to cure were shorter in the fortified tobramycin / cefazolin group ( 38.2 days ) and moxifloxacin group ( 36.4 days ) when compared with the ofloxacin group ( 46.2 days ) . \n parmar et al . also reported that despite statistically insignificant , only 50% ( 1 out of 2 ) of the patients in the gatifloxacin group with pseudomonas keratitis healed compared to 100% ( 5 out of 5 ) in the ciprofloxacin group . \n this suggests that gatifloxacin may be less effective than ciprofloxacin against pseudomonas aeruginosa . by sample size calculation based on an estimated difference of 15% among groups , \n > 85% of overall response rate and 85% probability of detecting a difference , clinical studies need 77 subjects for each treatment group ( i.e. , 154 for studies involving two intervention groups and 231 for studies involving three intervention groups ) in order to achieve sufficient power to identify the clinical differences concerned . since the number of patients was too small in the study conducted by shah et al . \n ( around 50 patients per group ) , their results may not be able to reach a statistically significant level despite that a genuine difference exists . \n thus , the data of these studies should be interpreted carefully and may only be seen as a supplement to other larger studies . \n the minimally invasive technique of cxl initially used in the management of ectatic conditions of cornea such as keratoconus , pellucid marginal degeneration , and iatrogenic keratectasia following laser in situ keratomileusis ( lasik ) has been effectively used for treatment of infectious keratitis with or without the risk of corneal melting . \n recent study has demonstrated the efficacy of this treatment modality in the primary treatment of infectious keratitis . \n topical fourth - generation fluoroquinolones , namely , moxifloxacin and gatifloxacin , are good alternatives to combination of fortified antibiotics in the management of infectious keratitis \n low antibiotics resistances to these two fluoroquinolones are expected in view of their structural modifications and dual inhibition mechanisms . however , since moxifloxacin and gatifloxacin may not be as potent as ciprofloxacin or tobramycin against gram - negative organisms such as pseudomonas aeruginosa , further studies are warranted to compare the response of pseudomonas infections to these antibiotics before we can conclude that the new fluoroquinolones are as potent as the standard combination of fortified antibiotics in the management of infectious keratitis . to date , only a few papers in the literature have reported the effect of photodynamic therapy ( collagen cxl ) in the management of infectious keratitis . \n the results of these trials are promising and imply that this new treatment modality may be useful in the treatment of resistant infectious corneal ulcer or as an adjunct for standard antibiotic treatment . however , since all of the published studies regarding cxl as the treatment of infectious keratitis were either based on animals or small numbers of patients , larger scale randomized , controlled trials should be conducted to evaluate the additional beneficial effects of cxl in infectious keratitis on top of conventional topical antibiotics . furthermore , more evidence is required before it will be advisable to use cxl as the first line treatment for infectious corneal ulcers .", "role": "user" }, { "content": "purpose . to review the newer treatments for bacterial keratitis . \n data sources . \n pubmed literature search up to april 2012 . study selection . \n key words used for literature search : infectious keratitis , microbial keratitis , infective keratitis , new treatments for infectious keratitis , fourth generation fluoroquinolones , moxifloxacin , gatifloxacin , collagen cross - linking , and photodynamic therapy . \n data extraction . over 2400 articles were retrieved . \n large scale studies or publications at more recent dates were selected . \n data synthesis . \n broad spectrum antibiotics have been the main stay of treatment for bacterial keratitis but with the emergence of bacterial resistance ; there is a need for newer antimicrobial agents and treatment methods . \n fourth - generation fluoroquinolones and corneal collagen cross - linking are amongst the new treatments . in vitro studies and prospective clinical trials \n have shown that fourth - generation fluoroquinolones are better than the older generation fluoroquinolones and are as potent as combined fortified antibiotics against common pathogens that cause bacterial keratitis . \n collagen cross - linking was shown to improve healing of infectious corneal ulcer in treatment - resistant cases or as an adjunct to antibiotics treatment . conclusion . \n fourth - generation fluoroquinolones are good alternatives to standard treatment of bacterial keratitis using combined fortified topical antibiotics . \n collagen cross - linking may be considered in treatment - resistant infectious keratitis or as an adjunct to antibiotics therapy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: transperineal prostate brachytherapy is one of the definitive treatment options for localized prostate cancer [ 14 ] . \n post - implantation dosimetry is a crucial component of treatment as it enables assessment of the delivered dose to the prostate and peri - prostatic structures , assesses the position of the prostate implants , and gives feedback to the radiation oncologist regarding quality of the implantation technique [ 1 , 3 , 5 ] . \n in addition , potential areas of underdosing may be addressed with further implantation or external beam boost as appropriate . \n conventionally , post - brachytherapy data has been performed using computed tomography ( ct ) imaging largely because of its widespread availability , low cost , and convenience [ 1 , 6 ] . \n soft tissue structures including the prostate gland , intra- and peri - prostatic structures are contoured on sequential transaxial images . \n dose - volume histograms ( dvhs ) are subsequently generated with visual representations of the isodose contours . \n dosimetry is typically expressed as the parameter d90 , defined as the minimum dose covering 90% of the prostate volume and is one of the most important predictive parameters for biochemical control in prostate cancer [ 1 , 7 ] . \n there are many known challenges to defining the contours of prostatic and peri - prostatic structures on ct images given the relatively poor soft tissue contrast [ 1 , 7 , 8 ] . \n increased inter - observer variability and variations in dosimetry results with increased doses delivered to the prostate were demonstrated with ct - derived contours [ 711 ] . while postbrachytherapy dosimetry is traditionally derived from ct , prior studies have described superior delineation of clinically relevant prostatic and peri - prostatic soft tissue structures on magnetic resonance imaging ( mri ) compared to ct [ 7 , 8 ] . \n specifically , t2-weighted mri sequence offers superior soft tissue definition compared to ct and contours on t2-weighted mri sequences have demonstrated greater reproducibility compared to ct - derived contours [ 10 , 12 ] . \n additionally , prostate volume on t2-weighted mri more closely approximates the volume assessed by transrectal ultrasound and volume at surgical resection [ 1316 ] . \n we have developed a specialized high resolution , contrast enhanced mri ( hr - cemri ) sequence optimized for the prostate gland , which is distinctly different from routine mri examination . \n this hr - cemri sequence provides additional information to supplement the t2-weighted sequence with improved delineation of soft tissue structures , and a more accurate localization of brachytherapy seeds within the prostate and the identification of misplaced seeds within the peri - prostatic structures . \n as previously reported , a specialized hr - cemri enables clear and robust delineation of brachytherapy seeds within a diffusely , contrast - enhanced , prostate gland while maintaining detailed borders of adjacent clinically relevant structures . \n treatment regimens derived from mri - based dosimetry data may reduce complications to adjacent organs and structures including the rectum , penile bulb , and neurovascular bundles . \n the purpose of this study was to evaluate prostatic and peri - prostatic dosimetry data from postbrachytherapy ct - based contours compared to hr - cemri - based contours . \n this study also builds off our prior work where we compared mri - based contour using hr - cemri and t2-weighted sequences . \n we hypothesized that hr - cemri enables a more accurate dosimetry assessment based on its superior ability to discriminate the prostate , intra- , and peri - prostatic structures as compared to ct . \n within a nine month period , 15 patients who were treated for prostate cancer with brachytherapy met the institutional inclusion criteria for prostate brachytherapy : 1 ) stage t2 ; 2 ) positive findings in < 50% of biopsy cores ; 3 ) prostate - specific antigen < 10 ng / ml ; 4 ) gleason score < 7 ; and 5 ) prostate gland volume < 50 cc . \n all patients were treated with palladium-103 implants ( inter - source , ibt intersource , mallinckrodt medical b.v . \n exclusion criteria included : general contraindications for mri ( e.g. pacemaker , orbital shrapnel ) and disorders interfering with endorectal coil examination ( e.g. proctitis , extreme hemorrhoids , and active inflammatory bowel disease with rectal involvement ) . \n of the 15 patients , 11 patients were eligible to participate in this study under an irb approved protocol , and standard informed consent was obtained . \n one of the patients refused to participate in the study and one patient was consented before mri screening revealed that the patient had a pacemaker . \n of the remaining 13 patients , two had hr - cemri data sets that were incompatible with the software platform used for dosimetry . \n the 11 enrolled patients received post - planning ct evaluations ( standard of care ) at three to five following seed placement . \n post - treatment hr - cemri was also obtained at three to five weeks post - treatment . \n the ct and hr - cemri were performed within 10 days of one another ( mean interval between ct and hr - cemri , 2 days ; range : 9 days ) . \n patients underwent rectal enema ( relaxyl clyster , nycomed - amersham , a unit of ge healthcare , chalfont st . \n local anesthesia of the anal region with topical lidocaine gel application was performed before the hr - cemri examinations ( xylocain 2% gel , astrazeneca plc , london , uk ) . to reduce bowel peristalsis , 0.5 mg glucagon ( glucagen , \n novo nordisk a / s , bagsvaerd , denmark ) was administered i.v . just before the hr - cemri examinations and 0.5 mg during the examinations ( added to saline syringe in automated injection system ) . \n all examinations were performed on a 1.5 t scanner with a pelvic phased - array surface coil ( magnetom vision , siemens ag , munich , germany ) combined with a disposable endorectal prostate coil ( ecoilt , medrad , inc . \n the endorectal coil was connected to the pelvic phased - array surface coil , and combined images were obtained . \n all images were analytically corrected for the reception profile of the endorectal and pelvic phased - array coils . \n sagittal and transverse half - fourier single - shot turbo spin - echo ( tse ) sequences were first obtained to check coil position . \n high - resolution t1- and t2-weighted images were obtained in the transverse plane with a 16 cm field of view ( fov ) , matrix with 256 frequency - encoding steps , and 192 phase - encoding steps yielding in - plane spatial resolution of 0.63 0.93 mm , phase direction right left , 100% phase over sampling . \n the t2-weighted sequence was a dual echo tse sequence that was acquired from below the apex of the prostate to above the seminal vesicles with the following parameters : repetition time msec / first effective echo time msec / second effective echo time msec 4000/83/165 , echo train length of 8.3 , slice thickness ( st ) 3 mm , no intersection gap , 28 slices , three signals averaged ( acquisition time : 10 min , 48 s ) . \n high resolution , contrast enhanced mri imaging was performed after bolus injection of contrast media using a fast 3d - gradient echo sequence with a temporal resolution of 1 min , 35 s. the imaging parameters included : repetition time msec / echo time msec of 8.1/4 ; flip angle of 18 degrees ; fov 160 cm ; matrix of 256 192 ; and st 3 mm , with no gap . \n two precontrast and five postcontrast acquisitions were obtained in succession with no delay between acquisitions . \n gadopentetate dimeglumine ( magnevist , bayer ag , leverkusen , germany ) was injected as a bolus at a dose of 0.1 mmol / kg of body weight by an automated injection system ( spectris mri injection system , medrad , inc . \n , pittsburgh , pa , usa ) at a rate of 4 ml / s during the last seconds of the second precontrast acquisition . \n this standardized time protocol assured that the injection of contrast was completed exactly before the first postcontrast acquisition started . the last time point data set was used to determine the number and locations of brachytherapy seeds . \n all examinations were supervised by one of two investigators , thereby ensuring consistency of the imaging protocol . \n non - contrast - enhanced ct was performed with a transverse section of 5 mm thickness with a pitch factor of 1.5 on a single - row spiral ct scanner ( somatom emotion , siemens ag , munich , germany ) , according to routine clinical protocol at our institution . because we intended to compare the routine standard of care ct protocol with the hr - cemri , we did not match slice thickness ; postimplantation dosimetric studies were routinely performed with 5 mm ct images . \n transaxial ct and hr - cemri images were transferred to a computer workstation running the interplant ct based post - planning application ( elekta ab , stockholm , sweden ) . \n this algorithm is based on the hough transform of the ct images to determine the location of the implanted radioactive seeds . \n two independent expert readers outlined the contours of the prostate gland , penile bulb ( pb ) , anterior rectal wall ( arw ) , urethra , and bilateral neurovascular bundles ( nvb ) on each ct and hr - cemri for all 11 patients ( total of 44 observations ) . \n readers creating contours were a radiologist and a radiation oncologist trained by a radiologist for contouring . to prevent hr - cemri information from influencing the ct analyses , ct and hr - cemri images from all 11 patients were randomized so that the readers were blinded to the patient data . from these independent ct and hr - cemri contours , \n dosimetry was reported in terms of d90 , d100 , v100 , v120 , and v150 . \n d90 and d100 were defined as the minimum dose covering 90% and 100% of volume of prostate gland and clinically relevant intra- and peri - prostatic structures , respectively . \n v100 , v120 , and v250 were defined as the percentage volume of the tissue receiving at least 100% , 120% , and 150% of the prescribed minimal peripheral dose ( mpd ) , respectively . \n these parameters were calculated for the prostate , urethra , pb , arw , and bilateral nvb . for each imaging modality ( ct and hr - cemri ) , the data from the two readers was used to calculate a single mean value of a dosimetric parameter ( v100 , v120 , v150 , d90 , and d100 ) for every patient . \n means and standard deviation are reported along with difference in ct and hr - cemri values ( denoted as delta , ) . a linear mixed - effects model was chosen to account for within - patient correlation resulting from individual measurements from two different readers . \n a compound symmetry variance - covariance structure was used to model within - patient correlation . \n all statistical analyses were performed using sas 9.1 software ( sas institute , cary , nc ) . \n within a nine month period , 15 patients who were treated for prostate cancer with brachytherapy met the institutional inclusion criteria for prostate brachytherapy : 1 ) stage t2 ; 2 ) positive findings in < 50% of biopsy cores ; 3 ) prostate - specific antigen < 10 ng / ml ; 4 ) gleason score < 7 ; and 5 ) prostate gland volume < 50 cc . \n all patients were treated with palladium-103 implants ( inter - source , ibt intersource , mallinckrodt medical b.v . \n exclusion criteria included : general contraindications for mri ( e.g. pacemaker , orbital shrapnel ) and disorders interfering with endorectal coil examination ( e.g. proctitis , extreme hemorrhoids , and active inflammatory bowel disease with rectal involvement ) . \n of the 15 patients , 11 patients were eligible to participate in this study under an irb approved protocol , and standard informed consent was obtained . \n one of the patients refused to participate in the study and one patient was consented before mri screening revealed that the patient had a pacemaker . \n of the remaining 13 patients , two had hr - cemri data sets that were incompatible with the software platform used for dosimetry . \n the 11 enrolled patients received post - planning ct evaluations ( standard of care ) at three to five following seed placement . \n post - treatment hr - cemri was also obtained at three to five weeks post - treatment . \n the ct and hr - cemri were performed within 10 days of one another ( mean interval between ct and hr - cemri , 2 days ; range : 9 days ) . \n patients underwent rectal enema ( relaxyl clyster , nycomed - amersham , a unit of ge healthcare , chalfont st . \n local anesthesia of the anal region with topical lidocaine gel application was performed before the hr - cemri examinations ( xylocain 2% gel , astrazeneca plc , london , uk ) . to reduce bowel peristalsis , 0.5 mg glucagon ( glucagen , \n novo nordisk a / s , bagsvaerd , denmark ) was administered i.v . just before the hr - cemri examinations and 0.5 mg during the examinations ( added to saline syringe in automated injection system ) . \n all examinations were performed on a 1.5 t scanner with a pelvic phased - array surface coil ( magnetom vision , siemens ag , munich , germany ) combined with a disposable endorectal prostate coil ( ecoilt , medrad , inc . \n the endorectal coil was connected to the pelvic phased - array surface coil , and combined images were obtained . \n all images were analytically corrected for the reception profile of the endorectal and pelvic phased - array coils . \n sagittal and transverse half - fourier single - shot turbo spin - echo ( tse ) sequences were first obtained to check coil position . \n high - resolution t1- and t2-weighted images were obtained in the transverse plane with a 16 cm field of view ( fov ) , matrix with 256 frequency - encoding steps , and 192 phase - encoding steps yielding in - plane spatial resolution of 0.63 0.93 mm , phase direction right left , 100% phase over sampling . \n the t2-weighted sequence was a dual echo tse sequence that was acquired from below the apex of the prostate to above the seminal vesicles with the following parameters : repetition time msec / first effective echo time msec / second effective echo time msec 4000/83/165 , echo train length of 8.3 , slice thickness ( st ) 3 mm , no intersection gap , 28 slices , three signals averaged ( acquisition time : 10 min , 48 s ) . \n high resolution , contrast enhanced mri imaging was performed after bolus injection of contrast media using a fast 3d - gradient echo sequence with a temporal resolution of 1 min , 35 s. the imaging parameters included : repetition time msec / echo time msec of 8.1/4 ; flip angle of 18 degrees ; fov 160 cm ; matrix of 256 192 ; and st 3 mm , with no gap . \n two precontrast and five postcontrast acquisitions were obtained in succession with no delay between acquisitions . \n gadopentetate dimeglumine ( magnevist , bayer ag , leverkusen , germany ) was injected as a bolus at a dose of 0.1 mmol / kg of body weight by an automated injection system ( spectris mri injection system , medrad , inc . , \n pittsburgh , pa , usa ) at a rate of 4 ml / s during the last seconds of the second precontrast acquisition . \n this standardized time protocol assured that the injection of contrast was completed exactly before the first postcontrast acquisition started . the last time point data set was used to determine the number and locations of brachytherapy seeds . \n all examinations were supervised by one of two investigators , thereby ensuring consistency of the imaging protocol . \n non - contrast - enhanced ct was performed with a transverse section of 5 mm thickness with a pitch factor of 1.5 on a single - row spiral ct scanner ( somatom emotion , siemens ag , munich , germany ) , according to routine clinical protocol at our institution . because we intended to compare the routine standard of care ct protocol with the hr - cemri , we did not match slice thickness ; postimplantation dosimetric studies were routinely performed with 5 mm ct images . \n transaxial ct and hr - cemri images were transferred to a computer workstation running the interplant ct based post - planning application ( elekta ab , stockholm , sweden ) . \n this algorithm is based on the hough transform of the ct images to determine the location of the implanted radioactive seeds . \n two independent expert readers outlined the contours of the prostate gland , penile bulb ( pb ) , anterior rectal wall ( arw ) , urethra , and bilateral neurovascular bundles ( nvb ) on each ct and hr - cemri for all 11 patients ( total of 44 observations ) . \n readers creating contours were a radiologist and a radiation oncologist trained by a radiologist for contouring . to prevent hr - cemri information from influencing the ct analyses , ct and hr - cemri images from all 11 patients were randomized so that the readers were blinded to the patient data . from these independent ct and hr - cemri contours , \n dosimetry was reported in terms of d90 , d100 , v100 , v120 , and v150 . \n d90 and d100 were defined as the minimum dose covering 90% and 100% of volume of prostate gland and clinically relevant intra- and peri - prostatic structures , respectively . \n v100 , v120 , and v250 were defined as the percentage volume of the tissue receiving at least 100% , 120% , and 150% of the prescribed minimal peripheral dose ( mpd ) , respectively . \n these parameters were calculated for the prostate , urethra , pb , arw , and bilateral nvb . \n for each imaging modality ( ct and hr - cemri ) , the data from the two readers was used to calculate a single mean value of a dosimetric parameter ( v100 , v120 , v150 , d90 , and d100 ) for every patient . means and standard deviation are reported along with difference in ct and hr - cemri values ( denoted as delta , ) . \n a linear mixed - effects model was chosen to account for within - patient correlation resulting from individual measurements from two different readers . \n a compound symmetry variance - covariance structure was used to model within - patient correlation . \n all statistical analyses were performed using sas 9.1 software ( sas institute , cary , nc ) . \n statistically significant differences were noted in v100 , v120 , and v150 with a greater percentage of prostate volume receiving the prescribed dose in ct - derived contours compared to hr - cemri - derived contours , table 1 . \n the mean ( standard deviation ) values from ct and hr - cemri contours , respectively , were as follows : v100 ( 98.5 1.5% and 96.2 3.6% , p = 0.003 ) , v120 ( 96.8 2.7% and 93.7 4.8% , p = 0.002 ) , and v150 ( 92.6 4.7% and 88.7 6.6% , p = 0.002 ) . \n similarly , a higher minimum dose covering 90% and 100% of volume of prostate gland was noted in ct - derived prostate contours , table 2 : d90 ( 167.6 27.7 and 150.3 35.5 , p = 0.012 ) and d100 ( 72.1 18.3 and 53.9 20.2 , p = 0.006 ) . \n please note the superior seed - tissue contrast of the hr - cemr image : with the prostate gland homogeneously hyperintense ( grey ) and seeds causing signal voids ( black ) , delineating two displaced seeds ( arrows ) in proximity to the denonvillier 's fascia / rectal wall , which is not well appreciated on the ct image . \n t2-weighted image image does not visualize all of the seeds as clearly as the hr - cemr image percentage volume of prostate gland and clinically relevant intra- and peri - prostatic structures receiving 100% , 120% , and 150% of prescribed dose n number of observations , sd standard deviation , difference between mean ct and mri values , ct computed tomography scan , mri magnetic resonance imaging , l nvb left neurovascular bundles , r nvb right neurovascular bundles , pb \n penile bulb minimum dose ( gy ) covering 90% and 100% of volume of prostate gland , and clinically relevant intra- and peri - prostatic structures a similar analysis was performed for intra- and peri - prostatic structures including urethra , arw , right and left nvb , and pb . the mean v100 from ct and hr - cemri contours , respectively , was : urethra ( 81.0 6.6% and 88.7 7.8% , p = 0.027 ) , arw ( 8.9 5.8% and 2.8 1.7% , p \n < 0.001 ) , left nvb ( 77.9 21.9% and 51.5 18.0% , p = 0.002 ) , right nvb ( 69.2 18.0% and 43.1 22.4% , p = 0.001 ) , and pb ( 0.09 0.3% and 11.4 \n a similar statistically significant difference was noted in dosimetric parameters v120 and v150 for all peri - prostatic structures , table 1 . \n the mean d90 derived from ct and hr - cemri contours , respectively , was : urethra ( 81.6 19.3 and 109.4 31.5 , p = 0.041 ) , arw ( 2.5 3.4 and 0.11 0.05 , p = 0.003 ) , left nvb ( 98.2 33.9 and 58.6 12.9 , p = 0.001 ) , right nvb ( 87.5 32.5 and 55.5 20.3 , p = 0.001 ) , and pb was ( 11.2 4.9 and 12.4 9.2 , p = 0.554 ) . for the pb , the analysis comparing minimum dose covering 100% of volume attained significance ( 4.9 3.1 and 2.6 2.6 , p = 0.03 ) . \n statistically significant differences were noted in v100 , v120 , and v150 with a greater percentage of prostate volume receiving the prescribed dose in ct - derived contours compared to hr - cemri - derived contours , table 1 . \n the mean ( standard deviation ) values from ct and hr - cemri contours , respectively , were as follows : v100 ( 98.5 1.5% and 96.2 3.6% , p = 0.003 ) , v120 ( 96.8 2.7% and 93.7 4.8% , p = 0.002 ) , and v150 ( 92.6 4.7% and 88.7 6.6% , p = 0.002 ) . \n similarly , a higher minimum dose covering 90% and 100% of volume of prostate gland was noted in ct - derived prostate contours , table 2 : d90 ( 167.6 27.7 and 150.3 35.5 , p = 0.012 ) and d100 ( 72.1 18.3 and 53.9 20.2 , p = 0.006 ) . \n please note the superior seed - tissue contrast of the hr - cemr image : with the prostate gland homogeneously hyperintense ( grey ) and seeds causing signal voids ( black ) , delineating two displaced seeds ( arrows ) in proximity to the denonvillier 's fascia / rectal wall , which is not well appreciated on the ct image . \n t2-weighted image image does not visualize all of the seeds as clearly as the hr - cemr image percentage volume of prostate gland and clinically relevant intra- and peri - prostatic structures receiving 100% , 120% , and 150% of prescribed dose n number of observations , sd standard deviation , difference between mean ct and mri values , ct computed tomography scan , mri magnetic resonance imaging , l nvb left neurovascular bundles , r nvb right neurovascular bundles , pb \n penile bulb minimum dose ( gy ) covering 90% and 100% of volume of prostate gland , and clinically relevant intra- and peri - prostatic structures \n a similar analysis was performed for intra- and peri - prostatic structures including urethra , arw , right and left nvb , and pb . the mean v100 from ct and hr - cemri contours , respectively , was : urethra ( 81.0 6.6% and 88.7 7.8% , p = 0.027 ) , arw ( 8.9 5.8% and 2.8 1.7% , p \n < 0.001 ) , left nvb ( 77.9 21.9% and 51.5 18.0% , p = 0.002 ) , right nvb ( 69.2 18.0% and 43.1 22.4% , p = 0.001 ) , and pb ( 0.09 0.3% and 11.4 17.2% , p = 0.005 ) . \n a similar statistically significant difference was noted in dosimetric parameters v120 and v150 for all peri - prostatic structures , table 1 . \n the mean d90 derived from ct and hr - cemri contours , respectively , was : urethra ( 81.6 19.3 and 109.4 31.5 , p = 0.041 ) , arw ( 2.5 3.4 and 0.11 0.05 , p = 0.003 ) , left nvb ( 98.2 33.9 and 58.6 12.9 , p = 0.001 ) , right nvb ( 87.5 32.5 and 55.5 20.3 , p = 0.001 ) , and pb was ( 11.2 4.9 and 12.4 9.2 , p = 0.554 ) . for the pb , the analysis comparing minimum dose covering 100% of volume attained significance ( 4.9 3.1 and 2.6 2.6 , p = 0.03 ) . \n topographic knowledge and radiation dose delivered to the prostate and clinically relevant structures have implications in the appropriate management and treatment of prostate cancer . \n accurate contouring for dosimetry data is vital to understanding potential dose - related complications to these structures . \n damage to the penile bulb and adjacent erectile structures have been correlated with erectile dysfunction , and damage to the neurovascular bundles has also been correlated with erectile dysfunction after radiation therapy . \n the findings in this study are congruent and reflective of prior studies postulating that mri based contours are superior to ct based contours for dosimetry assessments given the superior soft tissue contrast on mri of these clinically relevant structures . \n this study expands upon prior studies utilizing hr - cemri based contours , which demonstrated strong , statistically significant differences in prostate dosimetry compared to ct . \n greater v100 , v120 , v150 , d90 , and d100 values were seen on ct derived contours compared to hr - cemri derived contours . \n a similar observation was seen for dosimetry of the rectum . additionally , the level of statistical significance between ct and hr - cemri - derived contours of the prostate and anterior rectal wall progressively increased over v100 , v120 , and v150 values . \n we believe that these results reflect an overestimation of the volumes of the prostate gland and anterior rectal wall based on ct due to its poor soft tissue contrast compared to hr - cemri . \n these differences are reflected in the larger d90 and d100 values for ct - derived contours of the prostate and anterior rectal wall compared to the hr - cemri derived contours of these structures . \n the urethra and penile bulb were two structures where greater values of v100 , v120 , and v150 were observed for hr - cemri derived contours . \n smaller v100 , v120 , and v150 values were observed in ct - derived contours of the urethra and penile bulb compared to hr - cemri - derived contours . \n we postulate that these findings are due to limited soft tissue contrast on ct and a resulting inability to distinguish the borders of the prostatic urethra from the surrounding prostate gland and the penile bulb from the prostate apex . \n larger v100 , v120 , and v150 values were observed for the neurovascular bundles on ct - derived contours compared to hr - cemri - derived contours ; similarly , larger d90 and d100 values were also observed for ct - derived contours of the neurovascular bundles . \n we believe that while the location of the neurovascular bundles can be assessed on ct , the size and margins of the neurovascular bundles are not as clearly delineated when compared to hr - cemri - based contours . \n the findings in our study are supported by prior studies whereby statistically significant differences between prostate volumes on ct compared to mri were noted with prostate volumes on ct being 1.3 times larger than mri [ 16 , 1823 ] . \n mri - delineated volume of the prostate is smaller compared to ct - delineated volume especially at the prostate apex attributed to improved differentiation of the prostate from the base of the seminal vesicles [ 16 , 18 ] . \n these studies also described an associated increased in ct - derived dosimetry compared to mri - derived dosimetry in the prostate [ 1822 ] . \n debois et al . investigated differences in dosimetry data derived from ct and mri noting that the volume of the rectum receiving 80% of the prescribed dose was smaller for the treatment plans using mri - based assessment compared to a ct - based assessment . \n sannazzari et al . evaluated differences in dosimetry derived from ct versus mri noting that approximately 10% of the rectal volume could be spared when using mri for prostate delineation \n . additionally , krempien et al . showed that the mean dose delivered to the rectum could be reduced from 74.9% to 64.2% of the prescribed dose using mri - based contours compared to ct - based contours . \n this study also builds off of our prior research which demonstrated the added value of using hr - cemri , and t2-weight sequences for improved targeted seed implantation analysis and enhanced quality control . \n the advantage of using a hr - cemri protocol is the late contrast phase of enhancement , which provides improved localization of seeds and highly detailed delineations of the prostate gland and adjacent clinically relevant intra- and peri - prostatic structures . in a recently published study , ohashi et al . compared differences in dosimetry data for the prostate gland from ct- and ce - mri - derived contours . in that study , there were no statistically significant differences between the d90 and v100 estimated by ct - based and mri - based dosimetry . \n evaluated ct and mri - based dosimetry for the prostate gland only , clinically relevant intra and peri - prostatic structures were not included in the dosimetric assessment . in contradistinction \n , we used an automated seed detector for calculating ct- and mri - based dosimetry minimizing counting errors and potential reader bias , a process which we believe is likely to provide more accurate dosimetry data . \n we have also expanded upon the study of ohashi et al . by evaluating dosimetry of the adjacent clinically relevant intra- and peri - prostatic structures . \n dosimetry of these clinically relevant structures is imperative for minimizing potential radiation - induced morbidity and identifying patients potentially at risk for post - brachytherapy complications . \n detailed information regarding brachytherapy seed locations and knowledge of radiation dose delivered to adjacent organs can be addressed earlier through medical or interventional treatment , and the patient can be prepared for certain side effects . for example , several seeds placed close to the rectal wall , the patient can be prepared for diarrhea and patients can be followed more closely to avoid complications from rectal bleeding and diarrhea . \n conventionally , post - treatment dosimetry has been based on ct - derived contours , however , a prior study described an overestimation of prostate volume attributed to impaired delineation of the prostate from the anterior rectal wall which if used for pre - treatment planning purposes could potentially result in an increased radiation dose to the rectum and increased potential for post - radiation toxicity . \n therefore , dose limitation to these clinically and functionally relevant intra- and peri - prostatic structures is important for reducing overall patient morbidity [ 7 , 8 ] . despite these known limitations , \n ct remains the modality of choice for post - brachytherapy dosimetry in most practices [ 8 , 9 ] . \n prior studies have demonstrated numerous advantages to using prostate mri for pre - treatment planning including reduced toxicity and may alter the side affect profile [ 25 , 26 ] . \n performing pre - treatment and early post - treatment , prostate mri could ultimately lead to lower patient morbidity and improved clinical outcomes . \n firstly , our sample size is relatively small and a larger scale study should be performed before extrapolation to a generalized population . secondly , we could not prove the actual volumes of the prostate and adjacent structures ( urethra , arw , nvb , and pb ) since we did not have a reference standard , as our patients did not undergo surgery and excised gross pathology specimens were therefore unavailable . \n instead , we relied upon the results of two independent , blinded readers in a retrospective consensus to provide a reference standard for this study . \n thirdly , hr - cemri was performed using a 3 mm slice thickness and ct was performed using 5 mm slice thickness . \n we believe that the impact of using slightly different slice thicknesses is small as the number of seeds detected on ct and mri were similar . \n therefore , we believe that the difference in slice thickness between hr - cemri and ct was sufficient to detect the seeds and to perform the dosimetry studies . for some structures such as the prostate gland , ct overestimates the volume of the prostate gland and underestimates the volume of adjacent clinically relevant peri - prostatic structures . \n we believe that using a ct slice thickness of 3 mm would not improve the shortcomings of ct , and that difference in calculated volumes and dosimetry data is secondary to the limited soft tissue contrast and restricted ability to delineate the prostate capsule and adjacent structures . \n lastly , there may be slight spatial distortion by the endorectal coil on hr - cemri . \n on the other hand , this distortion is predictable and may be taken into account for volume measurements . \n the use of 3-tesla hr - cemri and an external phased array coil is attractive for patient convenience and would eliminate this potential area of distortion , however , further investigation is needed . in conclusion , these results demonstrate that there are differences in ct- and hr - cemri - derived volumes and calculated doses delivered to the prostate gland and adjacent clinically relevant structures . \n statistically significant differences between adjacent intra- and peri - prostatic structures on ct compared to hr - cemri - based contours are felt to result from the superior soft tissue contrast on hr - cemri , particularly using a sequence obtained in the late enhancement phase over conventional ct . \n accurate dosimetric assessment of these clinically and functionally relevant structures is critical to guiding future treatments and reducing overall patient morbidity . \n the results of this study suggest that hr - cemri is superior to ct for the calculation of post - brachytherapy dosimetry data for the prostate , and the intra- and peri - prostatic structures . \n post - brachytherapy dosimetry can serve as a quality control to the implant done which may translate into the clinical outcomes . \n while this study was specifically investigating brachytherapy dosimetry , we believe that our findings will be useful to guide treatment choices for prostate cancer patients . \n ", "role": "user" }, { "content": "purposeto assess detailed dosimetry data for prostate and clinical relevant intra- and peri - prostatic structures including neurovascular bundles ( nvb ) , urethra , and penile bulb ( pb ) from postbrachytherapy computed tomography ( ct ) versus high resolution contrast enhanced magnetic resonance imaging ( hr - cemri).material and methodseleven postbrachytherapy prostate cancer patients underwent hr - cemri and ct imaging . computed tomography and hr - cemri images were randomized and 2 independent expert readers created contours of prostate , intra- and peri - prostatic structures on each ct and hr - cemri scan for all 11 patients . \n dosimetry data including v100 , d90 , and d100 was calculated from these contours.resultsmean v100 values from ct and hr - cemri contours were as follows : prostate ( 98.5% and 96.2% , p = 0.003 ) , urethra ( 81.0% and 88.7% , p = 0.027 ) , anterior rectal wall ( arw ) ( 8.9% and 2.8% , p < 0.001 ) , left nvb ( 77.9% and 51.5% , p = 0.002 ) , right nvb ( 69.2% and 43.1% , p = 0.001 ) , and pb ( 0.09% and 11.4% , p = 0.005 ) . \n mean d90 ( gy ) derived from ct and hr - cemri contours were : prostate ( 167.6 and 150.3 , p = 0.012 ) , urethra ( 81.6 and 109.4 , p = 0.041 ) , arw ( 2.5 and 0.11 , p = 0.003 ) , left nvb ( 98.2 and 58.6 , p = 0.001 ) , right nvb ( 87.5 and 55.5 , p = 0.001 ) , and pb ( 11.2 and 12.4 , p = 0.554).conclusionsfindings of this study suggest that hr - cemri facilitates accurate and meaningful dosimetric assessment of prostate and clinically relevant structures , which is not possible with ct . \n significant differences were seen between ct and hr - cemri , with volume overestimation of ct derived contours compared to hr - cemri .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: granular cell tumor ( gct ) is a rare benign neoplasm of the skin and was first described by abrikossoff in 1926 . due to their subtle presentation , these tumors are often misdiagnosed clinically , and a histopathological examination leads to the correct diagnosis . \n they are commonly located on the tongue , upper respiratory tract , breast , and upper extremities . according to the reported cases , they have rarely been located on the torso . here \n , we report a 58-year - old female patient with a gct on an unusual location . \n she presented with a 4-year history of a slowly growing mass , with a dimension of 5 4 cm on her left waist , diagnosed as a gct at the histopathological examination . \n a 58-year - old female patient presented with the complaint of a slowly growing mass on her left waist for 4 years . \n the lesion was neither painful nor tender . in the past , she had frequently developed furuncles on the body ; so , at first , she thought it was a furuncle and tried several times to force it manually to discharge its contents . \n there was no discharge , and it continued to increase in size . on clinical examination , a single , firm , purple - colored , mobile subcutaneous nodular lesion with well - defined borders was noticed ( fig . \n the subcutaneous nodule was rather big with a dimension of 5 4 cm , and there was no surface change on the overlying skin . \n a 3-mm punch biopsy was performed , and the histopathological examination of he sections demonstrated diffuse infiltration of the dermis with tumoral nests . \n the immunohistochemistry ( ihc ) with s100 , neuron - specific enolase , and cd68 antibodies revealed a strongly positive staining ( fig . \n the diagnosis of gct was made , and the lesion was completely excised by the plastic surgeon . \n the histopathological examination of the excised specimen revealed no lymphovascular invasion , necrosis , high - rate mitotic activity , or cellular atypia . \n postoperatively , the patient 's recovery was uneventful , and 15 months after surgery , the patient had no local recurrence or metastases . \n gct was originally named granular cell myoblastoma , but currently , gct is considered to be neural in origin according to immunohistochemical studies . \n , there is a female preponderance , and usually , the reported cases occurred between the third and fifth decades . \n these tumors mostly present as a painless mass in the subcutaneous tissue ; however , they may rarely be multicentric at the time of diagnosis . \n familial cases and cases of congenital gct have been reported to be associated with multiple lesions . \n the tumor can be localized on the skin or submucosa of various locations . in 30 - 45% of cases \n , gct affects the skin , followed by the area of the head and neck , where the most common location is the tongue and oral cavity . \n other affected locations are the breast , the gastrointestinal tract , the respiratory tract , the thyroid gland , the urinary bladder , the central nervous system , and the female genitalia . \n torrijos - aguilar et al . showed that 3 out of 34 patients had involvement of the back . \n reported a case of subcutaneous gct in the lumbar region in a 31-year - old male patient . \n gct of the skin mostly presents with a symptomatic slowly growing solitary nodule with overlying normal skin . \n since the clinical presentation of cutaneous gct does not have any specific features , it is not always considered in the differential diagnosis . \n these cells contain a large amount of dense cytoplasmic lysosomes which yield a granular image under the microscope . \n immunohistochemical stains are positive for s100 , neuron - specific enolase , and vimentin , whereas tumoral cells are not stained with epithelial , melanocytic , muscle , endothelial , and glial cell markers . \n the clinical differential diagnosis of gct in the subcutaneous tissue includes dermatofibroma ( fibrous histiocytoma ) , lipoma , adnexal tumors , neurofibroma , and schwannoma , all of which could be differentiated by histopathological and immunohistochemical features . \n dermatofibromas clinically present with brownish nodules and often have the dimple sign ; histopathology reveals a dermal mass composed of close whorls of spindled fibroblasts or histiocytes . \n lipomas are very common subcutaneous soft nodules composed of encapsulated tumor or normal fat cells . \n sometimes , neurofibromas and schwannomas show granular changes in limited parts of the tumor , but these are never extensive through the tumor to create a diagnostic challenge . \n on the other hand , basal cell carcinomas , melanomas , leiomyomas , leiomyosarcomas , dermatofibrosarcomas , angiosarcomas , dermatofibromas , and ameloblastomas have granular cell variants in a pathological manner , which can be differentiated from gct with immunohistochemical studies . in our case , \n the tumor was composed of typical neoplastic cells with a granular eosinophilic cytoplasm , which stained positive for s100 , neuron - specific enolase , and cd68 ; therefore , with these distinctive histopathological and immunohistochemical features our patient was diagnosed as having gct . \n gct mostly behaves in a benign fashion , but malignant transformation can be recognized in 1 - 2% of cases . \n it is a challenge to predict the malignant behavior at the time of diagnosis . when the tumor size is > 4 cm , the risk of malignancy is increased . but \n liu et al . stated that metastases usually occur when the tumor arises from a visceral or deep location . \n fanburg - smith et al . defined histopathological criteria to identify malignant gct : ( 1 ) the presence of necrosis ; ( 2 ) the emergence of spindle cells ; ( 3 ) a vacuolar nucleus with an enlarged nuclear body ; ( 4 ) an increase in mitotic activity ( 2 mitoses/10 high - power fields ) ; ( 5 ) high nuclear - to - cytoplasmic ratio , and ( 6 ) pleomorphism . \n if none of these features are seen , the tumor is considered to be benign . \n if 3 or more criteria are met , it is considered to be malignant , and if 1 - 2 criteria are met , it is atypical . also , gcts of the skin may show locally invasive features . \n reported that the tumor infiltrated arrector pili muscles in 23% of 119 cases and had a perineural spread in 66% . in our case , the size of the tumor was > 4 cm ; however , it presented as a nonulcerated and painless nodule with a slow growth rate . \n additionally , the histopathological examination revealed no change in favor of a malignant transformation , such as lymphovascular invasion , necrosis , mitosis , or pleomorphism ; and 15 months after surgery , the patient still showed no signs of local recurrence or metastases . \n radiotherapy and chemotherapy have not shown to be effective in the clinical course of recurrent or malignant disease . in a recent report of a patient with recurrent malignant gct , \n the patient was treated with pazopanib ( a multi - kinase inhibitor ) 800 mg / day based on data from a phase 3 trial for metastatic soft - tissue sarcoma . \n although a large diameter is a feature of malignant gct , here , we reported a rare case with a cutaneous gct localized on the trunk , which did not present malignant features clinically and histopathologically . \n \n the authors declare that there was no financial support and there are no conflicts of interest .", "role": "user" }, { "content": "granular cell tumor ( gct ) is a rare benign neoplasm of the skin that accounts for 0.5% of all soft - tissue tumors . \n the tumor mostly presents with a symptomatic slowly growing solitary nodule and overlying normal skin ; therefore , it is not always considered in the differential diagnosis . here \n , we report a 58-year - old female patient who presented with a 4-year history of a slowly growing mass , with a dimension of 5 4 cm on her left waist , diagnosed as a gct at the histopathological examination . \n the neoplastic cells had centrally located nuclei and granular eosinophilic cytoplasm and stained positively for s100 , neuron - specific enolase , and cd68 antibodies . \n fifteen months after surgery , the patient still showed no signs of local recurrence or metastases . \n although a large diameter is a feature of malignant gct , our case with cutaneous gct was localized on the trunk and did not present malignant features clinically and histopathologically .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: williams campbell syndrome , also known as bronchomalacia , is a rare disorder characterized by a deficiency of cartilage in subsegmental bronchi , leading to distal airway collapse and bronchiectasis . \n there have been few reports about patients affected by saccular bronchiectasis , paracicatricial emphysema , and diminished cartilage . \n this report presents a 57-year - old woman with progressive dyspnea , cough , sputum production , and fever . \n the clinical and laboratory examination revealed that the patient had a respiratory infection due to bronchiectasis caused by williams \n although a rare syndrome , when patients signs and symptoms include recurrent respiratory infections , bronchiectasis , productive cough , and dyspnea , williams campbell syndrome should be included in the differential diagnosis . \n williams campbell syndrome is a rare disorder characterized by a deficiency of cartilage in subsegmental bronchi , leading to distal airway collapse and bronchiectasis \n campbell syndrome results from the absence of cartilage rings beyond the first and second bronchial divisions with resultant bronchiectasis , which typically affects the fourth- to sixth - order bronchi . \n the symptoms and prognosis ultimately depend on the extent of cartilage maldevelopment of the bronchi . \n although the syndrome has been best described in children with recurrent pneumonia and broncho - obstructive symptoms such as coughing and wheezing , there have been recent descriptions in adults as well.1,2 \n a 57-year - old woman presented in the emergency department complaining of progressive dyspnea for the previous 5 days . on clinical examination she had productive cough with clear sputum and intermittent fever . \n she was a lifelong nonsmoker but with multiple hospitalizations due to respiratory infections and asthma - like episodes from the age of 8 years . during the past 15 years \n the patient was treated symptomatically with antibiotics , nebulizer bronchodilators , and long - term oxygen therapy ( 2 l / min/24 hours ) . \n her family past medical history included her 30-year - old sister s sudden death from unknown reasons and her mother s infection from tuberculosis . \n at the time of admission her axillary temperature was 38c and blood pressure 120/70 mmhg . \n the patient was in respiratory insufficiency with an arterial ph of 7.46 , pco2 of 56 mmhg , po2 of 72 mmhg , and hco3 of 30 mmol / \n lung auscultation revealed widespread bilateral crepitating and crackles over the lower part of both lungs . \n laboratory data showed an elevated erythrocyte sedimentation rate of 100 mm / h and a white blood count of 9000/l without peripheral blood eosinophilia , and c - reactive protein was 9.3 mg / dl . \n her chest x - ray demonstrated increased lung volumes and revealed multiple ring shadows in lungs that were almost symmetrical in distribution and more apparent in the mid and lower zones . \n there was the sense of air - fluid levels in some of them corresponding to cystic bronchiectasis . also , there was thickening of the interstitial network . \n total serum immunoglobulin ( ig)e concentration was elevated at 2500 u / ml ( normal range 0165 u / ml ) . immediate cutaneous reaction to aspergillus fumigates was not available at the time of the patient s hospitalization ; nevertheless , a. fumigatus - specific serum ige levels were 1.37 u / ml . this is essential for the diagnosis of allergic bronchopulmonary aspergillosis.3 total serum igg , iga , and igm levels were quantified to rule out hypogammaglobulinemia and did not reveal any deficiencies . \n antinuclear and antineutrophilic cytoplasmic antibody tests were performed to exclude churg strauss syndrome , and the results were negative . \n there was a reduced forced vital capacity of 1200 ml ( 43.35% pred ) , reduced expiratory volume in 1 second of 720 ml ( 30.7% pred ) with tiffeneau index , reduced expiratory volume in 1 second / forced vital capacity of 76.29 , and carbon monoxide - diffusing capacity of 28% . \n a contrast - enhanced computed tomography ( ct ) scan of the chest demonstrated central cylindrical / cystic bronchiectasis involving segmental / subsegmental bronchi , bronchial wall thickening with air - fluid levels , and mucus plugging with predominant localization in the lower lobes . \n there was ground glass and tree - in - bud scattered in all lobes , a finding consistent with pneumonitis and acute bronchiolitis . \n chest ct also revealed a mosaic picture , which also emerges in all lobe findings consistent with bronchiolitis obliterans . \n collapse of bronchi with distal air trapping , the result of an excessively compliant bronchial wall , particularly in the left and right lower lobe , was also present ( figure 2 ) . \n the bronchoalveolar lavage fluid obtained from the patient for an acid - fast bacillus was negative on multiple occasions , but the same p. aeruginosa was again isolated . \n a diagnosis of saccular bronchiectasis due to williams campbell syndrome was made based on clinicoradiological findings , laboratory testing , and past medical history . \n genetic testing was planned , but the patient refused further investigations due to financial constraints . \n the patient was treated with intravenous antibiotics ; third - generation cephalosporins , ciprofloxacin , and acetylcysteine ; and chest physiotherapy , and was discharged after 1 month . \n written informed consent was obtained from the patient upon discharge for publication of this case report and all accompanying images . \n in 1960 , williams and campbell first reported the unusual pattern of bronchiectasis in f i ve patients whose disease presented in infancy with similar clinical features . \n they noted markedly compliant , soft central bronchi that ballooned on inspiration and collapsed on expiration . in this syndrome , \n bronchiectasis due to deficiency in cartilage of the third- to sixth - order bronchi generation is observed . \n the syndrome is usually presented in childhood , with recurrent pneumonia and broncho - obstructive symptoms such as coughing and wheezing . \n nevertheless , adult cases have been reported without pathologic confirmation.2,46 the symptoms and prognosis depend on the extent of cartilage maldevelopment . \n ct imaging demonstrates bilateral cylindrical / cystic bronchiectasis distal to the third - generation bronchi ( segmental / subsegmental ) with hyperinflation of the lung.4,7 on expiration , collapse of the bronchi with distal air trapping is observed as the result of an excessively compliant bronchial wall . \n the trachea and central bronchi remain normal in caliber , a distinguished feature of this disease . \n the mechanism for the deficiency in cartilage is not well understood ; no evidence suggests that cartilage deficiency occurs outside of the bronchi.8,9 in addition , regarding diagnostic exams , bronchoscopy is often unrevealing.10 a genetic background and familial occurrence are also reported.1012 the compliant bronchi collapse during coughing , leading to poor airway drainage . \n subsequently , progressive obstructive disease develops , causing hyperinflation of the lung and segmental or lobar collapse . \n recurrent destruction of the bronchial tree and inadequate clearance of mucus result in further damage to the lung parenchyma.8,9 the long - term prognosis is variable , with rapid clinical deterioration and death in some children and prolonged survival in others.13 no specific treatment exists for williams campbell syndrome . \n prophylaxis from exacerbations remain the basis of treatment.14,15 prophylaxis can be achieved if an oral or intravenous antibiotic is given for 710 days or until sputum production decreases . for severe cases , \n several different antibiotics may be used sequentially in a continuous regimen to minimize bacterial resistance . \n transplantation has been reported in a patient with severe respiratory symptoms from williams campbell syndrome , but the patient died 1 year later . upon postmortem examination \n it was observed that the main bronchi had bronchomalacia , which was attributed to a respiratory infection during the postsurgery period.1 moreover , when necessary , based on the patient s symptoms ( bronchospasm and thick , tenacious sputum ) , a bronchodilator , combined with postural drainage and chest percussion , can help remove secretions \n . respiratory exercise with free flow and bronchoscopy may be used to help mobilize secretions . \n hypoxia requires oxygen therapy.14 noninvasive positive airway pressure can be used when respiratory acidosis exists.16 other acquired and congenital conditions associated with bronchiectasis , including ciliary dyskinesia , cystic fibrosis , allergic bronchopulmonary aspergillosis , and immunoglobin deficiencies , must be excluded . \n differential diagnosis of saccular bronchiectasis includes cystic fibrosis , allergic bronchopulmonary aspergillosis , -1 antitrypsin deficiency , ig deficiency , radiation fibrosis , tuberculosis , immotile ( dyskinetic ) cilia syndrome , mounier - kuhn syndrome , and williams campbell syndrome . \n when patients signs and symptoms include recurrent respiratory infections , bronchiectasis , productive cough , and dyspnea , williams campbell syndrome should be included in the differential diagnosis .", "role": "user" }, { "content": "introductionwilliams campbell syndrome , also known as bronchomalacia , is a rare disorder characterized by a deficiency of cartilage in subsegmental bronchi , leading to distal airway collapse and bronchiectasis . \n there have been few reports about patients affected by saccular bronchiectasis , paracicatricial emphysema , and diminished cartilage . \n these are all characteristic of williams \n campbell syndrome.case presentationthis report presents a 57-year - old woman with progressive dyspnea , cough , sputum production , and fever . \n the clinical and laboratory examination revealed that the patient had a respiratory infection due to bronchiectasis caused by williams \n campbell syndrome , which was undiagnosed in the patient until then.conclusionalthough a rare syndrome , when patients signs and symptoms include recurrent respiratory infections , bronchiectasis , productive cough , and dyspnea , williams campbell syndrome should be included in the differential diagnosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: axonal regeneration and remyelination after peripheral nerve injury can be robust with significant functional recovery in contrast to the central nervous system where long white matter tract regeneration is absent or minimal . \n after peripheral nerve transection , for example , after tumor resection , wallerian degeneration characterized by macrophage infiltration , axonal membrane digestion , and retraction and proliferation of scs occurs in the distal nerve segment . \n the detached scs from the degenerating axons upregulate the expression of nerve growth factor ( ngf ) and its low - affinity receptor p75ngfr . for a period of time \n regeneration occurs from the proximal stump by axonal sprouting and elongation and continues into the distal stump or nerve transplant . \n the status of a nerve transplant is critical for successful nerve regeneration . while nerve regeneration through schwann - cell - enriched basal lamina tubes can reestablish connections with peripheral targets such as skin and muscle , a number of issues , such as navigation of axons across a complex nerve injury site where scarring can occur and appropriate targeting to peripheral end structures are major clinical concerns . \n although local endogenous scs play an important role in regeneration of peripheral nerve , transplantation of additional schwann cells into a lesion site was shown to assist this regenerative process [ 7 , 8 ] . \n nerve repair combined with transplantation of myelin - forming cell is a relatively simple , rapid , and efficient means of peripheral nerve repair . \n moreover , functional nerve regeneration requires not only axonal sprouting and elongation , but also remyelination and appropriate ion channel deployment at the node of ranvier [ 8 , 9 ] . \n the combination of surgical nerve repair and transplantation of peripheral myelin - forming cells has been shown to enhance axonal regeneration and remyelinate demyelinated fibers in experimental models and is currently being investigated in clinical studies [ 7 , 11 ] . in nerve defect injuries treated with autologous nerve transplantation , \n the nerve fibers within the transplant contain a high number of schwann cells which are indirectly transplanted ; the viability and activity of these indirectly engrafted schwann cells may be critical to optimize success of the nerve graft . the importance of the schwann cells and their basal lamina for axonal regeneration is well established [ 4 , 10 , 12 ] . \n loss of viable schwann cells in a nerve graft results in a reduced neurotrophic support with an attendant reduction in regeneration [ 13 , 14 ] . \n thus , the holding conditions for nerve segments removed for nerve grafting are critical for both sc preservation and potential success of the graft . in the present study , \n we compared various holding conditions including temperature and medium for short - term preservation ( up to 3 hours ) followed by determination of schwann cell viability assessed by two independent test methods after dissociation of excised nerve segments as used for nerve transplantation . \n experiments were performed in accordance with the german animal welfare guidelines for the care and use of laboratory animals . the hannover medical school and the nds . \n for preparation of adult schwann cells , adult male sprague - dawley rats were deeply anesthetized and sciatic nerves were removed . \n the sciatic nerves were desheathed , minced , and washed with 10 ml serum - free dmem low glucose ( 1 \n g / l ) with l - glutamine ( paa , pasching austria ) , transferred to a 15 ml tube ( tpp , europe , switzerland ) and washed by centrifugation . for enzymatic dissociation , 15 mg lyophilized collagenases a and \n d ( roche , mannheim , germany ) were dissolved in 10 ml serum - free dmem ; the nerve tissue was incubated at 37c and 5% co2 for 20 min followed by trituration through a fire - polished siliconized pasteur pipette and washed for three times with dmem containing 10% fcs . \n the cells were resuspended and either seeded onto two 25 cm cell culture flasks ( tpp , europe , switzerland ) coated with laminin ( engelbreth - holm - swarm murine sarcoma basement membrane , sigma - aldrich , steinheim , germany ) for immunocytochemical characterization or plated onto 96-well plates for cell viability assay . \n the viability of schwann cells was measured before and after incubation for 1 hr , 2 hrs , and 3 hrs in selected media ( see below ) at 4c , 37c , and 18c ( figure 1 ) . \n the purity of the prepared schwann cells was determined by indirect immunofluorescence staining for schwann cell characteristic marker anti - s100 ( polyclonal rabbit , dako , glostrup , denmark ) and visualized with secondary antibody alexa fluor 546 ( secondary antibody , donkey anti - rabbit , invitrogen , karlsruhe , germany ) . \n quantification of purity was obtained by counting immunopositive s100 cells in ratio to the number of nuclei . \n viability of schwann cells of sciatic nerves after incubation in selected media was measured by the celltiter - blue ( ctb ) cell viability assay ( promega , madison , wi , usa ) , the celltiter 96 aqueous nonradioactive cell proliferation assay ( promega , madison , wi , usa ) , which indicates cell viability on the basis of cell metabolism . \n the ctb assay uses the capacity of viable cells reducing the dye resazurin to resorufin , which emits fluorescence at 590 nm . \n the intensity of fluorescence is proportional to the number of viable cells . as second independent test to verify results , the celltiter 96 aqueous assay contains a tetrazolium compound ( mts ; [ 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2h - tetrazolium , inner salt ] ) and pms ( phenazine methosulfate ) as an electron coupling reagent . \n the absorbance of formazan can be measured at 490 nm and the quantity of absorbance is directly proportional to the number of viable cells . \n selected media for storage were ( 1 ) isotonic sodium chloride ( nacl 0.9% , deltaselect gmbh , dreieich ) , ( 2 ) dmem low glucose ( 1 \n g / l ) supplemented with l - glutamine ( paa , pasching , austria ) and 10% fcs ( fetal calf serum , biochrom ag , berlin , germany ) and 1% penicillin / streptomycin ( biochrom ag , berlin , germany ) , ( 3 ) hannover bioreactor medium ( hbrm ; consisting out of 1000 ml dmem - f12 ( biochrom ag berlin , germany ) , 10 ml / insulin - transferrin - selenium - a supplement ( gibco ) , 456 iu prednisolone , 400 iu insulin 108 mg / ml glucagon , 10 l soludecortin ( 10 mg / ml ) , 5 ml amphomoronal ( biochrom ag , berlin , germany ) , 20 ml hepes ( biochrom ag , berlin , germany ) , 50 mg hyaluronic acid ( sigma aldrich , germany ) , 5 mg / l penicillin / streptomycin ( biochrom ag , berlin , germany ) and ( 4 ) leibovitz 's medium ( l-15 medium with l - glutamine mit 25 mm hepes , paa , pasching , austria ) . \n after incubation , schwann cells were seeded onto 96-well plates ( nunc , ny , usa ) with 5000 schwann cells / well . \n after 1 hr , 2 hrs , and 3 hrs , 20 l of the ctb - reagent was added to the dissociated cells and measurements were performed after incubation according to the suppliers ' specifications . \n the background fluorescence or absorbance of microtiter plates with tested medium and lacking cells was subtracted from these data . \n all statistical analysis of data was performed using sigmastat software ( spss , chicago , il , usa ) . \n all data were evaluated using one - way anova and post hoc analysis using the student - newman - keuls method . \n standardized 2 cm segments of rat sciatic nerve were removed and schwann cells were prepared for culture . \n schwann cell viability was determined after incubation in either saline , dmem , hbrm , or leibovitz 's solution ( n = 3 per group ) for 0 hr , 1 hrs , 2 hrs , and 3 hrs . for each medium condition and time point , \n metabolic activity was studied at three separate temperatures : 4c , room temperature 18c , and 37c ( figure 1 ) . \n metabolic activity was studied upon dissociation of the schwann cells of rat sciatic nerves after incubation in the selected four media conditions and measured by ctb ( figure 2 for line chart and figure 3 for bar chart ) . \n schwann cell metabolic activity incubated at 4c ( figure 2(a ) and figure 3(a ) , resp . ) \n was decreased at 1 hr and remained decreased in the 2 hrs and 3 hrs groups . in general , at 4c the metabolic activity was the lowest for the dmem condition . \n thus , schwann cell metabolic activity in culture was reduced with time with all three media significantly . \n the cell viability was more than reduced to half within the first hour in all four experimental groups . the greatest schwann cell viability in this set of experiments at 4c \n could be observed in saline where cell metabolic activity was significantly higher than in dmem and hbrm . \n the lowest viability was obtained at 4c in dmem with about 70% reduction in metabolic activity within the first hour followed by a reduction , nearly complete loss of metabolic activity , of 99.7% to 0.3% after 3 hours . \n figure 3(b ) , resp . ) , metabolic activity of cultured schwann cells determined by ctb decreased for the dmem and hbrm conditions , nominally was unchanged for the leibovitz 's medium and marginally increased in saline over time ( figures 2(b ) and 3(b ) ) . \n the reduction in metabolic activity was observed in dmem with most loss of cell viability within the first hour of more than 90% . \n an increase of cell metabolic activity ( 132% ) with incubation in saline occurred within the first 2 hours of cell activity followed by a continued reduction of approximately 10% within the third hour . \n thus , the best schwann cell activity at room temperature could be seen in the saline group over the three - hour period with increase of cell metabolism . \n metabolic activity for schwann cells incubated at 37c and measured by ctb increased for those incubated in hbrm , leibovitz and saline ( figure 2(c ) and figure 3(c ) , respectively ) . \n activity of schwann cells in hbrm increased nearly 4-fold within the first hour followed by a slight reduction at the 2-hour time point , but still showing an increase in cell metabolism of 318% at the 3-hour time point . \n incubation in leibovitz 's medium showed a similar 4-fold increase of schwann cell metabolism within the first hour followed by continued decrease within the next 2 hours of observation period . \n after the three - hour period , there is still an increase of activity of 100% noticeable . \n schwann cells metabolism after incubation in saline showed a 3-fold increase within the first hour resulting in an increase of activity of 120% after 3 hours . \n the increase in metabolic activity for these hbrm , saline , and leibovitz 's medium peaked at 1 hr after nerve incubation at 37c . \n metabolic activity was reduced for all three conditions at 2 hrs and 3 hrs , but remained higher than at 0 hr . for nerves , \n the metabolic activity remained continuously high when incubated with hbrm at 2 and 3 hrs , indicating a broader time window for postincubation schwann cell metabolic activity than the other 3 media . \n additionally , schwann cell metabolism was also assessed as absorbance measured with mts at 4c ( figure 4(a ) ) , room temperature ( figure 4(b ) ) , and at 37c ( figure 4(c ) ) incubated in the described media . at 4c \n , all conditions resulted after 3 hours in massive reduction of cell viability . at room temperature , \n optimal cell viability with increase of schwann cell metabolism can be seen after incubation in hbrm at 37c as observed by determination of cell viability by reducing resazurin to resofurin with ctb in figure 2 . thus , schwann cell metabolic activity over time in culture from ex vivo nerves incubated in one of four media was generally reduced at 4c and room temperature incubation temperatures over a time window for three hours as measured by ctb and mts independently . \n most reduction in cell viability was observed within the first hour of incubation in both tests of more than 50% in all media at 4c . for incubation at 37c , schwann cell metabolic activity was increased for nerve segments incubated in hbrm , leibovitz , and saline over the observation period of three hours . \n but , there was no increase at 37c in schwann cell metabolic activity incubated in dmem . while schwann cell metabolic activity peaked at the 1 hr nerve incubation time point and declined for leibovitz 's and saline , the activity remained high even at the 2- and 3-hour time points . \n most reduced cell viability was observed after 3-hour incubation of schwann cells in dmem at 4c . \n optimal cell viability with increase of schwann cell metabolism can be seen after incubation in hbrm at 37c . \n in this study , we demonstrated that schwann cell metabolic activity is dependent on several factors including temperature , holding media , incubation , and holding time . the greatest increase in metabolic activity of all these groups \n was observed at 37c over a period of three hours . here , a significant increase in metabolic activity could be observed in leibovitz 's medium and hbrm with a 3-fold increase after incubation of 3 hours in hbrm . \n saline resulted in moderate increase of 120% in comparison to the other groups at 37c . observing just 1 hour of incubation period at 37c , \n best results were observed in correspondence to 3 three hours in saline , leibovitz 's medium , and hbrm with maximum activity with a 4-fold increase after 1 hour in both conditions . \n most decrease in cell metabolic activity was observed at nerves incubated at 4c in all 4 experimental groups . \n cell metabolism was reduced to half after 3 hours in the saline group and was close to zero metabolic activity in the dmem group . \n the dmem group resulted in all three temperature conditions in most reduction in cell metabolism activity . \n it is important to point out that our data demonstrated that incubation in the commonly used , the culture medium of schwann consisting of dmem with 10% serum did not result at any time point , and temperature in an increase , but instead in a significant decrease in cell metabolism activity within the three hour observation period . \n thus , dmem is suboptimal as a medium for preservation of schwann cell metabolism and alternatives should be considered . \n schwann cells play an important role in peripheral nerve regeneration ; and poor survival of schwann cells is thought to influence the outcome of nerve transplantation . reduced number of schwann cells after suboptimal storage conditions of donor nerve removed for autologous cell transplantation , for example , in traumatic nerve defect injuries or after wide tumor resection , could lead to a reduction in growth factor production , less axonal guidance of elongating axons resulting in increased sprouting , and failure to connect to peripheral targets or even painful neuroma formation . for improvement of peripheral nerve regeneration , it was shown that additional transplantation of schwann cells leads to more directed growth of regenerating axons and a significant better functional result with a greater nerve conduction velocity after crush lesion and after microsurgical repair [ 810 ] . \n the survival of schwann cells could be experimentally improved by overexpression of polysialic acid or addition of fk506 [ 16 , 17 ] . moreover , pre - degeneration of nerve grafts resulted in improvement of nerve regeneration based on the activation of schwann cells [ 1720 ] . \n the efficacy of 27 days of 14-day pre - degeneration in dmem of rat schwann cell culture was described in a recent study by kraus et al . \n moreover , further experimental studies demonstrated the importance of seeded schwann cells to improve the efficacy of acellular nerve grafts or artificial nerve guidance channels [ 23 , 24 ] to improve effectiveness of nerve repair . \n addition of schwann cells to muscle as nerve guidance in peripheral nerve defect injuries resulted in significant better functional and histological results than without cell supplement indicating the important role of schwann cells for enhancement of axonal regeneration and remyelination after injury . \n schwann cell - seeded bioartificial nerve conduits are subjects of several ongoing studies to improve functional results after nerve repair and to bridge extended nerve defects [ 24 , 25 ] . \n thus , incubation for optimal schwann cell metabolic activity of donor nerve or of schwann cell suspension for direct transplantation is essential and underlines the importance of our presented data . to verify our observed results , we performed independent test methods including using the ctb and mts assay for comparison of cell metabolism according to previous reports [ 26 , 27 ] . \n we archived similar results with all test methods demonstrating optimal cell viability of schwann cell metabolism after 3-hour incubation in hbrm at 37c . \n in contrast to previous reports , we directly investigated schwann cell viability which has a critical influence on the histological and functional results after nerve repair and nerve transplants after dissociation in a short period of time of three hours which is clinical relevant . \n previous reports examined schwann cell proliferation after 2 days and 3 days of culture . here , progressive increase of proliferation over 3 days could be observed . \n successful storage of peripheral nerve before transplantation after this time could be demonstrated in an experimental study in rats by using polyphenol to reduce oxidative stress . in this study , \n nerve segments were kept for up to 30 days in polyphenol solution followed by determination of nerve viability by calcein - am / ethidium homodimer staining . in another study , storage in polyphenol solution was compared to conventional university of wisconsin solution for long - term peripheral nerve banking . \n the results demonstrated the enhancement of schwann cell metabolism and optimal schwann cell viability after incubation at 37c with usage of either leibovitz or hbrm up to three hours . \n the commonly used saline solution at room temperature demonstrated a slight increase in cell metabolism at 37c . to obtain optimal results after nerve transplantation \n , removed nerves should be stored in the described conditions with usage of leibovitz 's medium or hbrm in 37c upon transplantation . \n additional experimental studies will determine if the presented results in vitro could be confirmed in vivo . \n with regard to clinical application , increased sc viability in autologous nerve transplants could result in enhanced axonal regeneration and remyelination leading to improved functional outcome after nerve grafting .", "role": "user" }, { "content": "strategies for improvement of nerve regeneration and optimal conditions to prevent schwann cell ( sc ) loss within a nerve transplant procedure are critical . \n the purpose of this study was to examine sc viability , which plays an important role in peripheral nerve regeneration , under various incubation conditions up to three hours . to address this issue , \n schwann cell metabolic activity was determined using different independent test methods . \n the following experimental conditions were compared : scs prepared from nerves were incubated in ( 1 ) isotonic saline solution ( 2 ) dulbecco 's modified eagles medium as used for cell culturing , ( 3 ) hannover bioreactor medium , and ( 4 ) leibovitz 's medium . \n sc metabolic activity of excised rat sciatic nerve was determined at 4c , 18c , and 37c over 3 hrs . \n the results indicate that sc activity was optimized by the usage of leibovitz 's medium or hbrm at 37c . \n greater sc viability at the time of surgical nerve grafting could contribute to improved axonal regeneration and remyelination after nerve transplantation , and thus more successful functional recovery .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: infection with mycobacterium tuberculosis ( mtb ) , the causative agent of tuberculosis ( tb ) , was responsible for 1.5 million deaths and 9 million cases of tb in 2013 , according to the world health organization . while only 510% of individuals infected with mtb progress to active tb disease , approximately one - third of the world population , or over 2 billion people , are estimated to have latent mtb infection ( ltbi ) . \n latently infected individuals control mtb infection and are clinically asymptomatic but retain a significant risk of progressing to tb by reactivation of latent mtb when immune compromised . \n this is due to the ability of mtb to persist within granulomatous lesions in the lungs of individuals and the inability of host immunity to completely eradicate mycobacteria from host tissues . \n granuloma formation is initiated by mtb - infected macrophages and continues with the development of multinucleated giant cells ( mgcs ) and lipid - filled foamy macrophages surrounded by a ring of lymphocytes encapsulated in a fibrotic cuff [ 5 , 6 ] . \n although macrophages and t cells play a central role in the formation of the granuloma , the complete cellular composition of the human granuloma throughout mtb infection remains unclarified and other cell types , including dendritic cells ( dcs ) , neutrophils , and b lymphocytes , are present and have been shown to contribute to cellular recruitment and the maturation of the granuloma . \n thus , granulomas are a testament to the involvement of both innate and adaptive immune cells in the human immune response to tb . \n huge strides have been made towards understanding the acute and chronic t cell response to mtb infection from studies in animal models , but the earliest encounters between mtb and the human innate immune system are incompletely understood . \n investigations in animal models of tb , human clinical and epidemiological studies on the genetics of mycobacterial susceptibility , and in vitro work with primary human cells strongly indicate that innate immune responses play a major role in determining the outcome of tb by helping control bacterial load and through shaping the nature and magnitude of adaptive immune responses [ 810 ] . while innate antimicrobial pathways that are activated early and throughout infection play a role in limiting disease , myeloid cells also serve as the primary niches for mtb replication . \n moreover , mtb has evolved multiple strategies to modulate innate immune responses and prevent optimal activation of adaptive immunity . \n thus , understanding the crosstalk between innate and adaptive immune cells in human tb is critical for identifying novel targets of immunomodulatory therapies and for elucidating mechanisms of protective immunity . \n however , innate immune responses to mtb infection in humans remain relatively poorly understood , largely because of the inherent difficulties in studying lung - specific immunity in humans . \n this review will focus on the key innate immune cell types implicated in the human response to mtb , the interaction of innate immune cells with mtb , and their influence on adaptive immune responses and the course of disease \n . we will also review specific human immunogenetics studies that link perturbations in innate immunity to mycobacterial susceptibility . \n the major innate cell types that have been studied in humans are macrophages , neutrophils , dcs , and natural killer ( nk ) cells . recently \n , other cell types not classically defined as immune cells , such as airway epithelial cells , have been shown to contribute to the immune response against mtb in animal models of tb and in vitro studies with human cell lines . however \n , this review will focus on the roles of the classically defined innate immune cells in human tb as these cells serve as both the primary cellular niches for mtb replication as well as the initial sources of immune pressure to contain infection . \n alveolar macrophages are one of the first host cell types to encounter mtb in the lungs following aerosol transmission . while macrophages function as the first line of defense against mtb infection , early interactions between macrophages and mtb favor the bacteria \n thus , macrophages are a major cellular niche for bacterial replication during early infection and serve as reservoirs for persistent bacteria within the lung granulomas during chronic infection . in human tb , several aspects of macrophage functions have been investigated , including phagocytosis of bacteria , induction of antimicrobial pathways , and responsiveness to interferon gamma ( ifn- ) ( figure 1 ) . \n a number of receptors recognizing a wide variety of mycobacterial ligands play a role in human macrophage phagocytosis of mtb . \n collectins ( e.g. , surfactant proteins a and d and mannose - binding lectin ) , c - type lectins ( e.g. , mannose receptor , dc - sign , and dectin-1 ) , toll - like receptors ( tlrs ; e.g. , tlr-2 , tlr-4 , and tlr-9 ) , and many others have been implicated in the recognition and uptake of mycobacterial glycolipids , lipoproteins , and carbohydrates . of these , the best characterized are mannose - binding lectin ( mbl ) and mannose receptor ( mr ) . \n mbl belongs to a family of soluble c - type lectins , called collectins , which are involved in the recognition and clearance of apoptotic cells via calreticulin and cd91 mediated phagocytosis . during mtb infection \n in addition to recognition of mtb ligands and phagocytosis , macrophage receptors are also involved in the activation of specific downstream pathways . as an example , mr , a transmembrane c - type lectin , ligates mtb lipoarabinomannan and activates macrophage peroxisome proliferator activated receptor gamma ( ppar ) expression in a phospholipase a2 and tlr-2 dependent manner [ 14 , 15 ] . \n in contrast to the avirulent vaccine strain mycobacterium bovis bacillus calmette - gurin ( bcg ) , virulent mtb activates macrophage ppar and induces the production of cyclooxygenase 2 and il-8 , which regulate inflammatory responses via arachidonic acid metabolites and the recruitment of neutrophils , respectively . \n these studies suggest that the earliest mtb interactions with macrophages at the level of receptor - mediated phagocytosis can influence the ensuing inflammatory response . \n moreover , it is likely that mtb manipulates these responses in order to promote its survival and dissemination . \n no single receptor has been demonstrated to be essential for macrophage phagocytosis of mtb during human infection and it is clear that mtb is recognized by numerous receptors which induces a network of coordinated receptor - mediated signaling pathways that lead to distinct gene expression profiles of infected macrophages at different stages of disease . \n studies centered on the gene expression profiles of mtb - infected macrophages have largely been explored in murine cells , though a few studies have examined proinflammatory cytokine profiles in mtb - infected human macrophages [ 16 , 17 ] as well as global gene expression after infection of in vitro blood monocyte - derived macrophages or human monocytic cell lines with mtb [ 1822 ] . \n these early gene profiling studies in infected human macrophages provided evidence for the importance of ifn- transcription in suppressing mtb gene expression , highlighted a prominent role for il-1 and other proinflammatory cytokines at early and late timepoints after infection , and showed that macrophage responses to pathogenic mycobacteria differed from responses to infection with nonpathogenic mycobacteria [ 1822 ] . \n additionally , transcriptional profiling studies of blood monocyte - derived human macrophages after mtb infection in vitro have provided corollary evidence for the importance of known factors such as il-12 in combating mtb as well as new insights into other factors not known to be important previously , including macrophage - derived chemokine ccl22 ( mdc ) and macrophage inflammatory protein-1 ( mip-1/ccl3 ) . \n importantly , a study that examined gene expression of ex vivo stimulated macrophages from tb patients resulted in the association of ccl1 with tb susceptibility . \n studies that investigate gene expression profiles of primary macrophage cells from patients with tb are limited but are required to yield the most relevant insights into how mtb interacts with human macrophages in vivo . with a few exceptions , the gene expression studies in mtb - infected human macrophages and macrophage cell lines highlighted here have validated and supplemented data derived from other mechanistic studies in human monocytic cell lines and mouse cells . \n much remains unknown about the gene expression profile of mtb - infected primary macrophages from tb patients and studies utilizing primary samples from tb cohorts will provide the best insight into the human macrophage response to mtb infection in vivo . \n insights into the survival and replication of mtb within macrophage phagosomes have largely been derived from studying murine macrophages , and studies on mtb manipulation of phagosomal function in human macrophages have been relatively limited . \n interestingly , recent studies have examined alveolar macrophages from the bronchoalveolar lavage ( bal ) of patients coinfected with mtb and hiv [ 24 , 25 ] and demonstrate that mtb resides within relatively nonacidified compartments in otherwise functionally capable macrophages . \n this suggests that the phagosome in human macrophages is specifically modulated by mtb to make it a preferential niche and further studies will be needed to clarify mechanisms of immune evasion that specifically target the human macrophage phagosome . \n tools developed for the assessment of innate immune functions , including vacuole acidification and superoxide burst , will be important in answering questions as to why bacteria are able to replicate within otherwise hostile environments [ 26 , 27 ] . \n the ifn- pathway remains a critical pathway for resistance against mycobacterial infection , as highlighted by increased susceptibility to mycobacterial infections in humans with genetic impairments in the il-12/stat-1 pathway [ 8 , 9 , 28 , 29 ] , though in vitro evidence indicates that ifn- alone does not fully limit mtb replication in human macrophages and that vitamin d signaling pathways augment macrophage ifn- responsiveness [ 3037 ] . \n vitamin d was shown to act synergistically with ifn- to augment antimycobacterial activity in human monocytes . \n vitamin d treatment enhances a variety of important downstream pathways in macrophages , including autophagy , phagosomal maturation , and the production of antimicrobial peptides [ 30 , 35 ] . \n additional studies have demonstrated that the bioactive 1,25-dihydroxyvitamin d3 can restrict mtb replication within infected human macrophages in a phosphatidylinositol 3-kinase - dependent and tlr - dependent manner . \n mechanistically , vitamin d upregulates gene expression of macrophage hcap-18 , which encodes for the antimicrobial peptide ll-37 ( cathelicidin ) , and ll-37 trafficking to mtb - containing phagosomes is purported to mediate the antimycobacterial effects of vitamin d [ 31 , 32 ] . \n mtb contains numerous pathogen associated molecular patterns ( pamps ) that are recognized by a variety of cell surface and intracellular pattern recognition receptors ( prrs ) on macrophages . \n for example , tlr2 recognizes mycobacterial mannosylated lipoarabinomannans and engagement of this receptor - ligand pair leads to downstream nf-b activation and inducible nitric oxide synthase ( inos ) gene transcription . \n nos2 and nos3 expression has been implicated in the production of nitric oxide ( no ) in human macrophages and clear induction of macrophage nos2 mrna can be seen in the bal of tb patients compared to healthy controls [ 35 , 40 ] . \n in contrast to murine studies , no seems to have limited bactericidal or bacteriostatic effects against mtb during in vitro infection of human alveolar macrophages and primary monocytes post - ifn- treatment [ 39 , 41 ] , suggesting that the critical immune responses to mtb garnered from studies in animal models may not be as important during human infection . \n alternatively , antimycobacterial effects of no may in fact occur in vivo within the lung microenvironment . \n the ifn-/il-12 axis is critical in host resistance to mtb in mice and in humans [ 4246 ] . \n clinical observations of increased levels of ifn- in the pleural fluid and bal of patients with confirmed pulmonary tb compared to healthy controls suggest that ifn- plays a prominent role in human tb infection [ 4750 ] . \n while murine macrophages activated by ifn- alone show distinctly augmented capacity for antimycobacterial functions compared to untreated macrophages , human macrophages require additional factors such as vitamin d , in addition to ifn- , to maximize antimycobacterial functions . \n this is perhaps due to mtb - mediated inhibition of critical stat1 protein - protein interactions with camp response element binding ( creb ) binding protein [ 5153 ] , leading to hyporesponsiveness to ifn- stimulation . \n additionally , mhc class ii expression , normally upregulated after ifn- activation of macrophages , is downregulated after mtb infection of human macrophages via decreased expression of class ii transactivator ( ciita ) [ 52 , 54 , 55 ] . \n this may play a role in dampening adaptive immune responses by attenuating t cell recognition of infected macrophages and could explain the reported defects in antigen recognition by mtb - specific lymphocytes in the granuloma . \n overall , macrophages are clearly at least capable of restricting mtb bacilli given appropriate activation signals from antigen specific t cells and the local lung microenvironment . \n however , questions remain regarding whether effective juxtaposition of infected macrophages and activated t cells occurs within the confines of the lung . \n studies aimed at answering basic questions about infected macrophages in human tb , including signaling pathways subverted during infection , the activation status of mtb - infected human alveolar macrophages , and the crosstalk between macrophages and t cells within infected lungs , are critical for developing immunomodulatory therapies for tb . during infection , neutrophils phagocytose bacteria discharge antimicrobial effectors from their granules and constitute a potent population of effector cells that can mediate both antimycobacterial activity and immunopathology in human tb ( figure 2 ) . \n this is because release of factors such as elastase , collagenase , and myeloperoxidase by neutrophils during their respiratory burst indiscriminately damages bacterial and host cells alike . \n neutrophils are the most abundant cell type found in the bal and sputum of active pulmonary tb patients and are second only to lymphocytes within lungs . \n one study found an inverse correlation between the development of pulmonary tb and the number of neutrophils in peripheral blood of contacts of active tb patients and in vitro depletion of neutrophils from whole blood led to poor induction of antimicrobial peptides ( amps ) and failure to restrict bcg and mtb growth . \n apoptotic neutrophils and purified neutrophil granules , both of which still contain active antimicrobial peptides , have been demonstrated to be taken up by infected macrophages and can lead to impairment of bacterial replication in vitro . \n apart from their degranulation capacity , neutrophils have recently been implicated in a more immunoregulatory role during mtb infection . \n interaction between programmed death ligand 1 ( pd - l1 ) on myeloid cells and programmed death receptor ( pd-1 ) on lymphocytes is thought to promote the development of dysfunctional , or exhausted , lymphocyte responses during chronic infections [ 6062 ] . \n recent transcriptional profiling studies determined that cell surface expression of programmed death ligand 1 ( pd - l1 ) by neutrophils was primarily responsible for high levels of pd - l1 expression in whole blood of active tb patients . \n another study described a 393 blood - based transcript signature that differentiated active tb infection from healthy individuals with ltbi . from this , the authors derived an 86-gene signature that corresponded to neutrophil expression of type i and type ii interferon inducible genes that distinguished active tb infection from other inflammatory conditions . \n it will be important to extend such global transcriptional analyses to the lung , which is the primary site of mtb infection in pulmonary tb . indeed , a recent study utilizing biopsy samples from a variety of human tissues to investigate the steady - state t cell compartment in different places throughout the body demonstrated that different tissue compartments , including the lung , contained distinct t cell populations and it is likely that the same principles apply to innate immune populations during states of infection . \n since neutrophils comprise a significant percentage of cells that infiltrate the lung during human tb , it will be important to determine their roles in lung tissue and their contribution to uncontrolled inflammation and immunopathology . \n dcs are the primary antigen presenting cells that initiate adaptive immune responses through their capacity to present antigen , their costimulatory capacity , and secretion of t - helper polarizing cytokines ( figure 3 ) . in mouse models of tb \n , it has been shown that dcs constitute a significant population of cells harboring mtb in vitro and in vivo [ 66 , 67 ] . however \n , whether or not human dcs serve as a major cellular niche for mtb replication in vivo remains unclear . in vitro studies in monocyte - derived dcs \n suggest low levels of bacterial replication within these dcs , but further studies are needed to substantiate these observations . \n monocyte - derived human dcs express mannose receptors , cd11b , cd11c , and dc - sign , all of which are capable of recognizing mtb ligands . \n indeed , dc - sign has been shown to serve as a major receptor for mtb entry into dcs via recognition of manlam . under homeostatic conditions , dc - sign functions by binding icam-2 on endothelial surfaces to allow for efficient dc migration . during mtb infection , \n ligation of dc - sign by mtb manlam leads to the induction of the anti - inflammatory cytokine il-10 , which has been implicated in the impairment of dc maturation and expression of costimulatory molecules . \n other studies suggest that manlams are capable of inducing a negative signal that inhibits il-12 production through both mannose receptor and dc - sign . \n these data suggest that mtb may be modulating dc functions in order to prevent optimal induction of host adaptive immunity . \n subversion of dc functions by mtb represents an ideal strategy for slow growing mtb to evade adaptive immunity . \n manipulation of dc maturation , cytokine production , and antigen presentation will affect the kinetics , nature , and magnitude of the t cell response and can provide mtb with time to establish a foothold within the lungs . \n studies that show impaired ability of mtb - infected monocyte - derived dcs to stimulate lymphoproliferation of nave and memory cd4s and cd8s provide strong evidence suggesting that mtb infection of dcs can impair t cell responses during human infection . \n since mtb is a slow growing organism , antigen availability , especially at the early stages of infection , may be an additional reason for poor t cell responses . under homeostatic conditions , \n dcs are able to retain peptide - mhc complexes at the cell surface much more efficiently than macrophages , primarily due to the downregulation of membrane associated ring - ch-1 protein ( march1 ) , a ubiquitin e3 ligase that helps recycle cell surface mhc complexes [ 73 , 74 ] . mhc class ii cycling from the phagosome to the plasma membrane \n is induced by dc maturation when tlrs first engage mtb ligands but may occur before the availability of loadable mtb antigens , thereby leading to mtb immune evasion from cd4 t cells . \n these data might suggest that mtb antigens are not properly represented during the initiation of adaptive immune responses and may lead to an overabundance of antigen specific t cells that are specific for antigens that may not be relevant at different stages of infection . \n it has been previously shown that bcg vaccination fails to elicit human t cell responses to latency associated mtb antigens and vaccination strategies implementing latency associated antigens have shown some promise in the mouse model . \n the dc plays a central role in the presentation of any mtb antigen throughout infection and future studies must look to the dc in order to understand why certain antigens are under or nonrepresented at the t cell level . \n many questions remain regarding the mechanisms that mtb employs to manipulate dcs and the subsequent consequences of that manipulation on the nature , kinetics , and magnitude of the adaptive immune response . \n studies in humans will remain limited as dcs are poorly represented in bal , and peripheral blood derived dcs may not be representative of dcs found in the lungs . \n nevertheless , it will be important to pursue mechanistic studies on lung dc biology during mtb infection in humans as well as in animal models of tb , including in mice and nonhuman primates where immunological reagents are readily available . \n nk cells act early during infection , are not mhc - restricted , and depend upon licensing based on engagement of various activating receptors found on their cell surface by ligands upregulated by stressed or infected target cells ( figure 4 ) . \n various mtb cell wall components , such as mycolic acids , are direct ligands for the natural cytotoxicity receptor ( ncr ) nkp44 on nk cells , and human nk cells exhibit the capacity to lyse mtb - infected macrophages in vitro [ 79 , 80 ] . \n additionally , nk cells can also produce ifn- and il-22 , which can inhibit intracellular growth of mtb in vitro by enhancing phagolysosomal fusion , or can promote the production of ifn- from cd8 t cells by stimulating il-15 and il-18 production from mtb - infected monocytes in vitro . \n studies on the functionality of nk cells in human tb are limited , but there are indications that nk cells may be functionally impaired during tb . \n patients newly diagnosed with pulmonary tb display decreased frequencies of nk cell subsets , coinciding with lowered expression of nkp30 , nkp46 , and ifn- . \n anti - tb treatment regimens leading to reductions in mycobacterial load have been shown to partially restore cytolytic capabilities of nk cells . \n furthermore , nk cells in patients with tuberculous pleurisy express high levels of icam-1 , important for the establishment of the immunological synapse , chemokine receptors , and tlr expression , and are able to activate autologous lymphocytes under ex vivo conditions . \n in addition to direct killing , nk cells can also promote t cell proliferation via cd54 , tnf , gm - csf , and il-12 and , upon recognition of an nk ligand , ulbp1 can restrict the expansion of regulatory t cells in an nkg2d / nkp46 dependent manner . \n these cells are sensitive to the local microenvironment and monocyte produced il-10 has been shown to impair nk cell lytic capacity and decrease expression of activating nk cell receptors . \n very little is known about nk cells in human tb , but evidence suggests that they play a role in restricting bacterial growth indirectly , via promotion of cd8 and t cell responses , and directly , via killing of mtb - infected monocytes and macrophages [ 79 , 80 ] . \n the success of mtb infection likely hinges upon its early interactions with cells of the innate immune system . \n macrophages and neutrophils can take up and kill bacteria but can be subverted by mtb to promote chronic inflammatory conditions harmful to the lung . \n additionally , dcs are central to the generation of mtb - specific t cells that can bolster immunity but are manipulated to establish poor or misdirected t cell responses . \n nk cells are capable of directly and indirectly promoting killing of mtb , but their functional capacity is diminished and little is known about how well they are activated during infection . \n each cell type has distinct roles to play in defending the host against mtb , but they are also readily coopted into helping mtb establish a long term infection . \n the difficulties of in vivo and lung in situ human studies are major roadblocks towards the understanding of innate immune responses during mtb infection , but population based immunogenetics studies can offer important insights into innate immune pathways critical for antimycobacterial immunity . \n historically , our knowledge regarding human innate and adaptive immune pathways involved during mtb infection stems from clinical observations in patients suffering from mendelian susceptibility to mycobacterial diseases ( msmd ) and then validated in murine models of tb . \n patients suffering from msmd have genetic polymorphisms that predispose them to infections with various environmental mycobacteria as well as infection with classically avirulent mycobacteria such as bcg , though a significant portion of msmd patients also suffer from disseminated tb . \n the importance of innate immunity in combating mycobacterial infections is highlighted in patients with mutations in two innate immune autosomal genes ( il12b and il12r1 ) , who suffer widespread and recurrent mycobacterial infections early in life [ 8 , 28 , 29 ] . \n fortunately , individuals with polymorphisms in the il-12 locus can receive treatment with exogenous il-12 and are less likely to suffer from fatal infections , highlighting a role for macrophage and/or dc - derived il-12 in the generation of ifn- responses that control infection . \n mutations in il12r1 are among the most common genetic factors associated with msmd resulting in susceptibility to primary mycobacterial infections [ 8 , 28 ] . \n however , bcg vaccination of these individuals can confer resistance , which indicates that il-12 signaling , and ifn- responses dependent on il-12 , may not be completely required for secondary immunity [ 8 , 28 ] . \n additionally , mutations in the leucine zipper domain of nf-b essential modulator ( nemo , also known as inhibitor of nf-b kinase subunit gamma or ikk- ) , encoding an intracellular protein involved in the activation of the nf-b pathway , has been demonstrated to predispose individuals to recurrent mycobacterial infections due to a lack of il-12 production from monocytes and dcs . \n immunogenetics studies have also implicated other innate pathways , especially those related to pathogen sensing or cytokine and chemokine production , in immunity to mycobacterial infection . \n polymorphisms in tlr2 , tlr9 , tlr1 , tlr8 , and the intracellular signaling molecule tirap have all been associated with susceptibility to mycobacterial infection . \n the mechanisms for the association between tlr and mycobacterial infection are still unclear and studies in the murine model of tb seem to indicate redundant roles for tlrs and tlr - associated molecules such as myd88 in the generation of adaptive immune responses to mtb [ 95100 ] . aside from prrs , \n individuals with mutations in the inflammasome pathway have provided insight into the regulatory role of the inflammasome during mycobacterial infection . \n a gain of function gene variant in caspase-1 coupled with a loss of function for inhibitory caspase recruitment domain family member 8 ( card8 ) promotes inflammatory diseases such as rheumatoid arthritis , but macrophages isolated from these individuals are more efficient at restricting mtb growth in vitro . \n polymorphisms in the il1 gene cluster and macrophage chemoattractant protein 1 ( mcp-1 ) also predispose individuals to tb , presumably due to an inadequate inflammatory response against infection [ 102104 ] . \n indeed , il-1 responses in humans seem to be linked to higher eicosanoid induction that curtails excessive inflammation promoted by type i ifns . \n collectively , these data suggest that the inflammasome pathway , and il-1 in particular , may be critical in promoting enhanced immunity against mtb in humans . in another example , a population with low serum levels of vitamin d3 metabolites displayed increased susceptibility to active tb , validating in vitro results from human primary cells . \n these examples highlight the idea that immunogenetic studies on a population level are important parallel approaches that strengthen in vitro derived results in elucidating genes important in immunity against mtb . \n human immunogenetic studies provide an attractive avenue for the validation of several mechanisms of resistance against mtb observed in animal models of tb and can complement observations from in vitro human cells , but the innate immune response against pathogens , especially one as complex as mtb , is multigenic and very complex . \n it will be interesting , and potentially very rewarding , to examine innate immune genes in studies examining individuals who are highly exposed to mtb but who do not progress to active tb disease . \n this relatively resistant population , for example , health care workers in high - burden tb settings , should provide important clues to how the innate immune response may successfully handle mtb infection . \n innate immunity is a crucial component of the immune response against mtb but has received relatively little attention in studies of human tb . while myeloid cells serve as niches for bacterial replication , innate antimicrobial pathways activated early and throughout infection play a role in limiting disease and serve as potent regulators of antigen - specific adaptive immunity . \n tb disease results when pathological responses that promote chronic inflammation and lung damage dominate over protective responses that limit disease and eliminate bacteria . \n there is growing evidence indicating that innate immune cells are uniquely positioned to determine that balance between protective and pathogenic immune responses in human tb . \n however , mtb employs myriad potent mechanisms for evading antimicrobial responses and subverting the innate immune crosstalk with adaptive immunity , thereby tilting the balance towards pathological rather than protective immune responses . \n further study of human innate immune pathways during mtb infection will be important for developing host - directed immunomodulatory therapies for tb . \n further , a greater understanding of how innate immune responses impact adaptive immunity is critical for designing efficacious tb vaccines .", "role": "user" }, { "content": "tuberculosis ( tb ) remains a serious global public health problem that results in up to 2 million deaths each year . \n tb is caused by the human pathogen , mycobacterium tuberculosis ( mtb ) , which infects primarily innate immune cells patrolling the lung . \n innate immune cells serve as barometers of the immune response against mtb infection by determining the inflammatory milieu in the lungs and promoting the generation of adaptive immune responses . \n however , innate immune cells are also potential niches for bacterial replication and are readily manipulated by mtb . \n our understanding of the early interactions between mtb and innate immune cells is limited , especially in the context of human infection . \n this review will focus on mtb interactions with human macrophages , dendritic cells , neutrophils , and nk cells and detail evidence that mtb modulation of these cells negatively impacts mtb - specific immune responses . \n furthermore , this review will emphasize important innate immune pathways uncovered through human immunogenetic studies . \n insights into the human innate immune response to mtb infection are necessary for providing a rational basis for the augmentation of immune responses against mtb infection , especially with respect to the generation of effective anti - tb immunotherapeutics and vaccines .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: although the indications for cholecystectomy in the presence of polypoid lesions in adults have been established , they remain to be clearly defined in children because of the limited experience . \n we report an unusual case of a polypoid lesion of the gallbladder in an adolescent boy , which was successfully treated by laparoscopic cholecystectomy . \n a 14-year - old male presented with a four - month history of recurrent right upper quadrant abdominal pain . the initial episode , which began suddenly and persisted for three days , had been severe enough to warrant admission to the hospital . \n after his discharge from the hospital , the pain recurred once a week , and sometimes lasted for several days . \n physical examination at our institution ( westchester county medical center ) revealed inconsistent right upper quadrant tenderness with an occasional positive murphy 's sign . \n all laboratory results were normal , including complete blood cell count , liver function tests and serum amylase . \n initial ultrasound of the gallbladder done at a community hospital had revealed the presence of multiple small gallstones . \n a repeat ultrasound examination demonstrated a 3 mm polypoid lesion in the body of the gallbladder , close to hartmann 's pouch ( figure 1 ) . \n computerized tomography of the abdomen was normal , and failed to demonstrate the polypoid lesion in the gallbladder . \n histological examination revealed a benign 2 mm adenomatous polyp in the body of the gallbladder , close to the hartmann 's pouch ( figure 2 ) . \n after cholecystectomy the patient 's symptoms completely disappeared . he has remained well and pain - free after two years of follow - up . \n polypoid lesions of the gallbladder have been the subject of controversy in the medical literature . \n the most accepted classification was proposed by christensen and ishak , who classify the lesions as benign tumors , pseudotumors , and malignant neoplasms . over 90% of the polyps \n adenomas of the gallbladder account for only 1% of all lesions , but they are important because of their potential transformation to invasive carcinoma . \n it is characterized by late diagnosis and extremely poor prognosis with five - year survival of less than 5% . \n the importance of early diagnosis is paramount in these cases , since the only survivors have been reported following early cholecystectomy . \n polypoid lesions are mainly composed of heterotopic tissues , the most common one being ectopic gastric mucosa , followed by ectopic pancreatic and thyroid tissue . in our search of the literature we did not find any reports of adenomas of the gallbladder in children . for diagnostic purposes \n , ultrasound seems to have the best sensitivity and specificity . computerized tomography with oral cholecystographic enhancement has been reported to be successful in equivocal cases . in the present case computerized tomography failed to demonstrate the polyp . in the adult population , accepted indications for cholecystectomy in the presence of polypoid lesions of the gallbladder include polyps over 10 mm in diameter , patient age over 50 years , sessile polyps , associated gallstones , possibility of malignancy and the presence of symptoms regardless of the size of the polyp . the experience with polypoid lesions of the gallbladder in children \n however , because the presence of these lesions in the gallbladder of children has been associated with acalculous cholecystitis and because the long - term effects of their presence in the gallbladder are unknown , we currently recommend cholecystectomy in all children with such lesions . \n laparoscopic cholecystectomy , which is now well accepted as a safe procedure in the pediatric population , even in small children , should be the procedure of choice unless there are specific contraindications for its use .", "role": "user" }, { "content": "polypoid lesions of the gallbladder in children are rare . \n we report a case of a gallbladder polyp in a 14-year - old boy who presented with recurrent right upper quadrant abdominal pain . \n ultrasound examination of the abdomen revealed a polypoid lesion of the gallbladder . \n his symptoms resolved after laparoscopic cholecystectomy . \n histological examination of the gallbladder demonstrated a benign adenomatous polyp . \n although the experience with polypoid lesions of the gallbladder in children is limited , we currently recommend cholecystectomy because these lesions are associated with acalculous cholecystitis , and because their long - term effects are unknown .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in western countries there has been a large and mainly unexplained rise in incidence of non - hodgkin 's lymphoma ( nhl ) in recent years . \n several aetiological factors for nhl are known , including genetic and environmental or occupational factors . \n familial aggregation of lymphoproliferative malignancies ( malignant lymphoma and lymphatic leukaemia ) has been reported repeatedly but accounts for only a small proportion of lymphoma cases . \n most of the familial cases are sibling pairs either alone or in combination with other affected relatives . \n a population - based study in israel among first - degree relatives of patients with lymphomas showed that only 0.7% of the lymphoma patients had a history of lymphoma in one or more relatives . in some families , \n no histological subtype appears to predominate in familial cases . here , a family in which all three living male siblings of asian descent developed nhl is presented . \n this patient was born in 1936 in east java ( indonesia ) , as were his three younger brothers . \n his father worked as a tea planter and died in 1944 at age 38 in a prisoner - of - war camp . \n a younger brother also died in a prisoner - of - war camp at age 6 . in east java \n he smoked forty pack years and had always been healthy until 1981 when follicular lymphoma stage iiia was diagnosed at age 45 . \n he was treated with twelve cycles of cop ( cyclophosphamide , oncovin and prednisone ) . in 1994 \n he developed a relapse of his indolent lymphoma with mediastinal and abdominal localization for which again cop chemotherapy was given . in 1997 a second relapse of his lymphoma with mediastinal localization was noted . \n the second living brother was born in 1937 . in the netherlands he worked as a construction fitter visiting several factories . \n he also smoked ( approximately twelve pack years ) and had always been healthy until december 1993 when at age 56 diffuse large b - cell lymphoma ( dlbcl ) was diagnosed , stage ii a with localizations in the axilla , cervical region and nasopharynx . \n primary treatment consisted of six cycles of chop ( cyclophosphamide , oncovin , adriamycine and prednisone ) , which resulted in a complete remission . \n the leukaemia was treated with daunorubicine and cytarabine followed by a course of high - dose cytarabine . \n after an initial response a relapse of his leukaemia occurred in july 2004 . at the moment \n the third living brother was born in 1942 . as a technician he worked with acids , alkalis , cyanide and metals . \n he smoked eight pack years and was well until march 2004 when dlbcl stage iva was diagnosed with paravertebral localization and myelum compression causing neurological symptoms . \n he was treated initially with chop chemotherapy , in total eight cycles , followed by rituximab infusions , four cycles . \n unfortunately , three months after completion of the therapy he developed a relapse with cervical and retroperitoneal localizations . \n neurological examination , including ct and mri of the brain , did not reveal meningeal involvement but the cerebrospinal fluid was positive for lymphoma cells . \n the family history was unremarkable for other types of cancer and did not meet clinical criteria for li - fraumeni syndrome or any of the other known human tumour syndromes . \n this patient was born in 1936 in east java ( indonesia ) , as were his three younger brothers . \n his father worked as a tea planter and died in 1944 at age 38 in a prisoner - of - war camp . \n a younger brother also died in a prisoner - of - war camp at age 6 . in east java \n he smoked forty pack years and had always been healthy until 1981 when follicular lymphoma stage iiia was diagnosed at age 45 . \n he was treated with twelve cycles of cop ( cyclophosphamide , oncovin and prednisone ) . in 1994 \n he developed a relapse of his indolent lymphoma with mediastinal and abdominal localization for which again cop chemotherapy was given . in 1997 a second relapse of his lymphoma with mediastinal localization was noted . \n the second living brother was born in 1937 . in the netherlands he worked as a construction fitter visiting several factories . \n he also smoked ( approximately twelve pack years ) and had always been healthy until december 1993 when at age 56 diffuse large b - cell lymphoma ( dlbcl ) was diagnosed , stage ii a with localizations in the axilla , cervical region and nasopharynx . \n primary treatment consisted of six cycles of chop ( cyclophosphamide , oncovin , adriamycine and prednisone ) , which resulted in a complete remission . \n the leukaemia was treated with daunorubicine and cytarabine followed by a course of high - dose cytarabine . \n after an initial response a relapse of his leukaemia occurred in july 2004 . at the moment \n the third living brother was born in 1942 . as a technician he worked with acids , alkalis , cyanide and metals . \n he smoked eight pack years and was well until march 2004 when dlbcl stage iva was diagnosed with paravertebral localization and myelum compression causing neurological symptoms . \n he was treated initially with chop chemotherapy , in total eight cycles , followed by rituximab infusions , four cycles . \n unfortunately , three months after completion of the therapy he developed a relapse with cervical and retroperitoneal localizations . \n simultaneously he was diagnosed with right - sided oculomotor nerve palsy . neurological examination , including ct and mri of the brain , did not reveal meningeal involvement but the cerebrospinal fluid was positive for lymphoma cells . \n the family history was unremarkable for other types of cancer and did not meet clinical criteria for li - fraumeni syndrome or any of the other known human tumour syndromes . \n risk of nhl has been found significantly increased in relatives of people with haematological malignancies , especially among siblings , although the absolute risk is small . \n it has been estimated that the absolute lifetime risk for a first - degree relative of an nhl case of developing nhl is 3.6% ( compared with a population risk of 2.1% ) and higher if the index case had an aggressive subtype of nhl . \n aggregation of nhl seems to be stronger for siblings and for male relatives and among relatives of early - onset ( < 50 years ) nhl cases . with the exception of chronic lymphocytic leukaemia and indolent lymphoma , most affected families present with diverse lymphoproliferative and other haematological malignancies . \n this diversity is not completely unexpected as lymphoma and leukaemia have common cellular origins , and some types have common genetic somatic changes or share common aetiological factors . \n a recent study using the swedish family - cancer database calculated standardized incidence ratios ( sirs ) for histopathology - specific subtypes of nhl in offspring with nhl whose parents or siblings were affected with different types of lymphoproliferative malignancies . a family history of nhl significantly increased the risk for nhl ( sirparent = 1.8 ; sirsibling = 1.9 ) and for diffuse large b - cell lymphoma ( sirparent = 2.3 ) , follicular lymphoma ( sirsibling = 2.3 ) , and b - cell lymphoma not otherwise specified ( nos ) ( sirsibling = 3.4 ) . for a parental history of histopathology - specific concordant cancer , the risks \n were significantly increased for diffuse large b - cell lymphoma ( sir = 11.8 ) , follicular nhl ( sir = 6.1 ) , plasma cell myeloma ( sir = 2.5 ) , and chronic lymphocytic leukaemia ( sir = 5.9 ) . in general , familial aggregation of lymphoproliferative malignancies \n may be coincidental or may be caused by ( combinations of ) shared genetic and environmental risk factors . in rare cases , familial aggregation is associated with rare hereditary tumour syndromes such as li - fraumeni syndrome or hereditary immunodeficiency syndromes . apart from those cases occurring in families meeting the criteria of li - fraumeni ( like ) syndrome , constitutional p53 mutations are rare in cases of familial aggregation of lymphoma . \n some multiple - case families have been found to have various types of immune deficiency disorders . \n the immunological disorders range from x - linked lymphoproliferative syndrome and ataxia telangiectasia to subtle laboratory findings like a disturbance in t cell function , decreased t cell number , or increased immunoglobulins . in other families risk factors are unclear . an argument in favour of genetic predisposition playing a role is the fact that various investigators have demonstrated that anticipation is present in familial nhl . \n anticipation is a phenomenon characterised by an increase in severity of clinical symptoms or a decrease in the age of onset in successive generations . \n a possible non - genetic explanation is that the parents and children have been simultaneously exposed to a causative environmental agent , the difference in age of onset reflecting the generational difference . \n however , this does not explain cases in families who did not live together and cases where parents were diagnosed with nhl many years after their children were . \n a population - based case - control study in the united states showed that certain non - genetic risk factors , including exposure to a chlorinated hydrocarbon pesticide , plywood , fibreboard or particleboard and history of liver diseases ( other than hepatitis or cirrhosis ) ( or = 6.5 , 95% ci : 1.2 - 36.2 ) , increased the risk of nhl in patients with a family history of haematological malignancies compared to patients without such family history . \n another study could not confirm that a family history of cancer modifies the association of agricultural exposures with nhl and a more recent study showed no evidence that aetiological associations varied between familial nhl and nonfamilial nhl cases . \n in general , it is therefore still difficult to pinpoint interactions between shared inherited and environmental risk factors with respect to nhl development . in the present family , \n no signs of impaired immunity were present ; however , neither cancer predisposing germline gene mutations nor exposure to viruses or environmental carcinogens can be excluded . \n all three affected brothers may have been exposed to possible carcinogenic materials during work , and all three were smokers . \n tobacco use has been suggested to increase the risk of nhl , but the results of epidemiological studies have been inconsistent . \n the combined effects of genetic susceptibility and tobacco use could possibly lead to nhl . at diagnosis , one brother had indolent lymphoma and two had aggressive lymphoma of follicle centre cell origin . \n it is possible that this was a transformed lymphoma , which originated also from an indolent lymphoma , but this could not be substantiated by available clinical and morphological data . \n the leukaemia of case 2 could have been secondary to chemotherapy or could have been a second primary haematological malignancy , which would then again suggest possible predisposition . in conclusion : in this case report we have presented a quite remarkable clinical finding in three male siblings who developed malignant lymphoma . \n all of them are still alive . shared genetic or environmental risk factors , or combinations of these , remain to be identified in this family . \n ", "role": "user" }, { "content": "a family is reported in which three male siblings of asian descent developed non - hodgkin 's lymphoma ( nhl ) . \n case 1 was diagnosed with indolent follicular lymphoma stage iiia at age 45 . \n case 2 presented with large b - cell lymphoma stage iib at age 56 . \n chromosomal investigation of the peripheral blood did not show abnormalities . \n chemotherapy induced a complete remission . \n however , after a period of nearly ten years he developed acute myeloid leukaemia . \n case 3 developed large b - cell lymphoma stage iva at age 52 . \n cytogenetic analysis in peripheral blood was normal . shared genetic and environmental risk factors remain to be identified in this family . \n familial aggregation of nhl is uncommon . in some families , various forms of immunodeficiency \n have been found . \n in addition to coincidental clustering of cases , and rare cases explained by known tumour syndromes such as li - fraumeni ( like ) syndrome , other familial cases may share as yet unknown genetic and/or environmental risk factors .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: conventional scanning transmission electron microscopy ( stem ) is limited by the range of specimens appropriate for analysis , specifically the dry and solid samples suitable for placement in a high vacuum \n . however , many scientific and technological questions concern nanoscale materials and processes in liquid environment . \n samples fully embedded in liquid can now be studied with stem using a concept that involves a microfluidic chamber assembled in the specimen holder for transmission electron microscopy ( tem ) and stem1 . \n this newly developed technique has become increasingly popular , as it provides new insight into important processes of various research topics , including the growth , dissolution , and aggregation processes of nanoparticles23456 . \n . the sample loading and image acquisition for liquid - phase stem is different than for stem of dry samples and involve a protocol that requires dedicated training . \n the microfluidic system consists of two silicon microchips supporting silicon nitride ( sin ) membrane windows transparent for the electron beam at 200 kev of energy12 ( see figure 1a ) . \n details of the dimensions and of the handling of these microchips can be found elsewhere1213 . \n the aunps are immobilized at the top window ( with respect to a downward - traveling electron beam ) or float in the liquid . \n nanoscale spatial resolution in stem is obtained by scanning the electron beam over the aunps and collecting transmitted scattered electrons using the annular dark field ( adf ) detector9 . \n the two microchips are placed in a small slot in the tip of the liquid flow tem holder1 ( the holder operates for both stem and tem but is referred to as the tem holder ) . \n one of the microchips contains a spacer so that a liquid compartment is formed between the microchips . \n o - rings on both sides of the two microchips provide vacuum sealing of the liquid compartment13 ( see figure 1b ) . \n the aim of this article is to demonstrate the basic steps of sample loading and data acquisition so that interested users may find easy access to this emerging new technique . \n a system available from a specific company is used , but the protocol is also valid for systems of other companies . \n the technique is more complex than conventional tem and stem , and a number of practical aspects must be considered when working with a liquid holder system13 . \n most important of all is to ensure that the liquid compartment is correctly assembled , thus providing a thin liquid layer and a vacuum seal . \n therefore , it is highly important to work cleanly and to prevent the formation of dust during the preparation and assembly of the liquid flow tem holder . in particular , \n the o - rings and the two silicon microchips need to be free from all contamination . \n even small particles of dust on one of the microchips may severely increase the thickness of the assembled cell , which may prevent the achievement of a useful spatial resolution . \n a vacuum seal is important so that no contamination or damage will be left in the electron microscope after the experiment . \n the operation of the electron microscope is straightforward , but it requires some extra steps compared to microscopy of solid samples . with increasing liquid thicknesses , more electrons are absorbed and scattered by the liquid ; a measurement of the liquid thickness is essential . \n finally , the protocol explains how images are taken and how dynamic processes can be studied . \n two silicon microchips with silicon nitride ( sin ) membrane windows are positioned between two o - rings . \n the liquid is enclosed between the sin membrane and is thus separated from the vacuum in the electron microscope . a focused electron beam scans over the sample \n gold nanoparticles ( aunps ) are immobilized within the liquid at the sin membrane but can also move in the liquid . \n ( b)schematic side view cross section of the stack of two microchips with o - rings \n the reflection of the two si microchips clearly shows the groove on the backside of two microchips . \n ( c ) after 2 min , the si microchips are transferred to the second beaker filled with ethanol . \n after another 2 min , the si microchips are transferred to a cleanroom tissue for drying . \n ( a ) the liquid flow tem holder with plastic tubing and a syringe for liquid flow . \n ( b ) the tip of the liquid flow tem holder removed from the holder shaft , the lid of the liquid cell compartment , o - rings , and two silicon microchips . \n ( c ) the liquid cell compartment showing one o - ring , the slot for the microchip placement . \n ( d ) different tweezers on a dust - free surface ( aluminum foil ) . \n ( e ) the lid of the liquid cell compartment with its two o - rings . \n ( f ) two silicon microchips with sin membrane windows . left : the sample microchip without a spacer ; right : the cover microchip with a 200 m spacer . \n cleaning of the microchips prepare a workspace with a low dust level in a laminar airflow hood with a dust particle filter . \n clean a light microscopy glass slide with a fiber - free tissue and pure ethanol for placement and transport of the microchips . place the glass slide on a cleanroom tissue in a petri dish . \n select 5 base microchips ( without a spacer ) for sample placement and 5 microchips with a spacer 200 nm thick . \n note : the window dimensions are 20 x 400 m and the sin thickness is 50 nm . since there is some tolerance on the dimensions , it is recommended to check the dimensions using a light microscope \n . use carbon - coated tweezers to remove the microchips from the storage box and place them on the glass slide . \n also be careful with handling the microchips to avoid cracking their sharp edges , which can cause problems due to silicon particles residing on the microchip or to later leakages . \n note : training for the procedure to remove the microchips from the sticky surface can be performed on ( cheap ) dummy microchips . \n note : the steps involving acetone are performed in a fume hood for chemical safety . \n fill the first one with 40 - 60 ml of acetone and the other with 40 - 60 ml of ethanol . \n note : it is important to use hplc - grade liquids also for this step in the protocol . transfer the microchips into the beaker with acetone in order to remove the protective resist layer . \n gently move the beaker by hand to effectively rinse the microchips , but be careful not to turn the microchips upside down see figure 2 . \n after 2 min , remove the microchips and quickly transfer them into the beaker with the ethanol . \n gently move the beaker by hand with ethanol for 2 min to remove any residues of the resist layer . \n note : do not let the microchips dry out during transfer to avoid the deposition of debris . remove the microchips from the beaker and place them onto a new cleanroom tissue . \n let them dry for a few minutes and transfer the microchips onto the light microscope glass slide in the petri dish . \n note : the wet microchips can easily flip around , turn upside down , or stick to the tweezers when being released . \n this can be avoided by pressing the microchips softly on the filter paper and pulling the tweezers away in the horizontal direction . \n run a 5 min cleaning program to render the surface of the silicon nitride membrane hydrophilic and to remove hydrocarbons . note : suitable settings applied for our plasma cleaner are : 70 mtorr , gas flow of 11.5 sccm for o2 and 35.0 sccm for ar , 50 w forward radio frequency ( rf ) target , 5 w rf range , and max reflected rf . \n put the glass slide with the microchip back into the petri dish , close the lid , and transfer it to the light microscope . examine the microchips under a light microscope for possible membrane ruptures or remaining dirt particles . \n take special care with the window areas and check for small spots indicating a rupture of the membrane . \n close the petri dish and store it in the laminar airflow workbench . \n 2 . \n preparation of the sample on the microchips \n prepare an aqueous aunp solution ( citrate stabilized ) by mixing small amounts of the stock solutions containing 30 nm - diameter , citrate - stabilized aunps at a concentration of ~3 m. place the microchips on a clean , sticky surface in a transport box for droplet application / sample deposition . \n place a droplet ( 1 - 2 l ) of the sample solution on the sin membrane side of the freshly plasma - cleaned microchip ( use a microchip without a spacer ) and let the solution dry in the laminar airflow workbench . \n note : this procedure can be repeated in order to increase the concentration of aunps on the sin membrane . \n apply 1 l of deionized water to the microchip for the removal of salt and/or surfactants . \n note : a sufficiently large number of aunps will have adhered to the microchip and will not be washed away in water anymore . \n use the prepared sample microchips within 4 h , as the sin loses its hydrophilic rendered surface properties over time , which may cause the liquid to behave differently during an experiment . \n cleaning the liquid flow tem holder \n clean all tools ( tweezers and a screw driver ) that will be in contact with vacuum parts using acetone and ethanol in an ultrasonic bath and place them on the dust - free surface provided by a piece of new aluminum foil placed on the work bench . \n note : the tools do not have to be extensively cleaned if one is sure that they are clean for work with vacuum parts . \n gloves can be avoided if one is capable of handling the equipment without touching the vacuum parts.place the liquid flow tem holder under the binocular light microscope in such a way that the tip of the holder containing the liquid chamber can be observed . \n see figure 3.remove the lid of the holder tip and place it on the dust - free surface . \n note : the titanium lid is sensitive to scratches caused by harder materials like the tweezers . it is recommended to use polymer - coated tweezers for sensitive materials.prepare at least 1 - 2 ml of pure water ( hplc grade ) . note : if one does not use hplc - grade liquid , then it is recommended to check that the liquids used do not contain micro particles that could possibly lead to clogs of the flow system ; filter the liquid as needed with a micro - pore filter.use a glass syringe ( 1 ml ) to flush the whole flow system with 0.5 ml of pure water . \n it is recommended to use a microfluidic syringe pump system . use a pipette and/or filter paper to remove the liquid being ejected in the liquid cell compartment . \n dry the holder tip afterwards using filter paper and/or a pipette.use the light microscope to check that the tip of the holder is clean and dry . \n if needed , wash the tip of the holder with water or ethanol to remove any solid residues that might have been left behind by the dried solution . \n also check inside the o - ring grooves and remove the remainders of liquid with a small piece of cleanroom tissue . \n note : if the holder does not become clean with this procedure , then it is recommended to remove the tip from the holder and clean it in acetone for 2 min and in ethanol for another 2 min using an ultrasonic bath.inspect all further parts of the tip ( o - rings , lid , and screws ) under the light microscope and remove dust , fibers , etc ... note : occasionally , small pieces originating from the screws or the si microchips must be removed as well . \n the lid and screws can be cleaned using ultrasound , as explained for the tip . \n avoid placing the o - rings frequently in ethanol , as it may make the o - rings brittle over time , diminishing their vacuum tightness . \n the system is operated without vacuum grease , but if sealing problems occur , vacuum grease can be used.reinsert the o - rings into the respective grooves of the holder and check that they fit and do not protrude on any side of the groove.keep the liquid flow tem holder free from dust until sample loading ( e.g. , by covering it with aluminum foil ) . \n clean all tools ( tweezers and a screw driver ) that will be in contact with vacuum parts using acetone and ethanol in an ultrasonic bath and place them on the dust - free surface provided by a piece of new aluminum foil placed on the work bench . \n note : the tools do not have to be extensively cleaned if one is sure that they are clean for work with vacuum parts . \n gloves can be avoided if one is capable of handling the equipment without touching the vacuum parts . \n place the liquid flow tem holder under the binocular light microscope in such a way that the tip of the holder containing the liquid chamber can be observed . \n see figure 3 . remove the lid of the holder tip and place it on the dust - free surface . \n note : the titanium lid is sensitive to scratches caused by harder materials like the tweezers . \n note : if one does not use hplc - grade liquid , then it is recommended to check that the liquids used do not contain micro particles that could possibly lead to clogs of the flow system ; filter the liquid as needed with a micro - pore filter . \n use a glass syringe ( 1 ml ) to flush the whole flow system with 0.5 ml of pure water . \n it is recommended to use a microfluidic syringe pump system . use a pipette and/or filter paper to remove the liquid being ejected in the liquid cell compartment . \n use the light microscope to check that the tip of the holder is clean and dry . \n if needed , wash the tip of the holder with water or ethanol to remove any solid residues that might have been left behind by the dried solution . remove pieces of dust or remainders of fibers as well . carefully \n remove these pieces with tweezers , thereby avoiding scratching the titanium surface . also check inside the o - ring grooves and remove the remainders of liquid with a small piece of cleanroom tissue . note \n : if the holder does not become clean with this procedure , then it is recommended to remove the tip from the holder and clean it in acetone for 2 min and in ethanol for another 2 min using an ultrasonic bath . \n inspect all further parts of the tip ( o - rings , lid , and screws ) under the light microscope and remove dust , fibers , etc ... note : occasionally , small pieces originating from the screws or the si microchips must be removed as well . \n the lid and screws can be cleaned using ultrasound , as explained for the tip . \n avoid placing the o - rings frequently in ethanol , as it may make the o - rings brittle over time , diminishing their vacuum tightness . \n the system is operated without vacuum grease , but if sealing problems occur , vacuum grease can be used . reinsert the o - rings into the respective grooves of the holder and \n keep the liquid flow tem holder free from dust until sample loading ( e.g. , by covering it with aluminum foil ) . assembling the liquid flow tem holder note : \n the following procedure describes the loading procedure of microchips in a specimen holder with optimal orientation for stem . in this configuration \n , the base microchip with the sample will be the upper microchip once transferred into the microscope . \n for tem , the highest spatial resolution is obtained at the bottom of the liquid cell with respect to a downward - traveling electron beam . \n use curved tweezers to grab the sample microchip on the long side and place it inside the slot ( pocket ) in the tip of the liquid flow tem holder . keep the sin side facing upwards . \n check the correct placement of the microchip in the slot using a binocular light microscope . note : if the o - ring below the microchip is not correctly placed , the microchip may protrude from the slot.place a droplet of 0.3 l of the filtered liquid for the experiment on the sample microchip using a micropipette . if necessary , fix the microchip in place with tweezers , as the capillary forces of the droplet may pull the microchip out of its pocket.use upside down curved tweezers to take the second microchip ( the one with the spacer layer ) . carefully turn the microchip upside down . \n place the spacer microchip on the base microchip in the slot . note : this procedure needs to be done sufficiently quickly to avoid the drying of the droplet on the sample microchip.inspect the correct placement using a binocular light microscope while moving a piece of light - reflecting material below the tip of the specimen holder . \n both microchips must be aligned exactly parallel to achieve the best overlap of the sin windows . \n note : in case the windows do not overlap , the microchips can be repositioned by pushing at one side with a tip of the tweezers , but avoid moving the microchips too much , as the sin membrane can be damaged easily . \n some microchips come with a crossed configuration ( the window of one microchip is perpendicular to the window in the other microchip ) ; this configuration facilitates the alignment of the two microchips yet also reduces the field of view in the electron microscope.take the front side of the specimen chamber lid with the tweezers and turn it upside down . without touching the microchips , place the rear side of the lid on the tip . \n slowly open the tweezers in such a way that the lid solely rests on the lower branch of the tweezers . carefully lower the lid until it rests on the two microchips . remove the tweezers.recheck the alignment of the windows of both microchips . if necessary , remove the lid , adjust the positioning of the microchips , and position the lid again.place the screws and fix them in their usual places . \n check the alignment of the two windows . if necessary , remove the screws again and adjust the microchips . \n note : do not fix the screws too tightly , as this may cause damage . \n a vacuum seal is achieved when the screws just tighten.check the sealing by initiating a liquid flow through the system using a flow rate of 4 l / min . \n if no leaking is observed on either side of the tip , this is a good indication of the vacuum tightness.transfer the holder to the vacuum pump station and check the vacuum tightness . \n note : it is recommended to test the pump station with a dummy holder prior to usage.transfer the holder to the electron microscope in its enclosure to prevent it from collecting dust \n use curved tweezers to grab the sample microchip on the long side and place it inside the slot ( pocket ) in the tip of the liquid flow tem holder . \n check the correct placement of the microchip in the slot using a binocular light microscope . note : if the o - ring below the microchip is not correctly placed , the microchip may protrude from the slot . \n place a droplet of 0.3 l of the filtered liquid for the experiment on the sample microchip using a micropipette . if necessary , fix the microchip in place with tweezers , as the capillary forces of the droplet may pull the microchip out of its pocket . \n use upside down curved tweezers to take the second microchip ( the one with the spacer layer ) . carefully turn the microchip upside down . place the spacer microchip on the base microchip in the slot . \n note : this procedure needs to be done sufficiently quickly to avoid the drying of the droplet on the sample microchip . inspect the correct placement using a binocular light microscope while moving a piece of light - reflecting material below the tip of the specimen holder . \n both microchips must be aligned exactly parallel to achieve the best overlap of the sin windows . \n note : in case the windows do not overlap , the microchips can be repositioned by pushing at one side with a tip of the tweezers , but avoid moving the microchips too much , as the sin membrane can be damaged easily . \n some microchips come with a crossed configuration ( the window of one microchip is perpendicular to the window in the other microchip ) ; this configuration facilitates the alignment of the two microchips yet also reduces the field of view in the electron microscope . \n take the front side of the specimen chamber lid with the tweezers and turn it upside down . without touching the microchips , place the rear side of the lid on the tip . \n slowly open the tweezers in such a way that the lid solely rests on the lower branch of the tweezers . carefully lower the lid until it rests on the two microchips . remove the tweezers . recheck the alignment of the windows of both microchips . if necessary , remove the lid , adjust the positioning of the microchips , and position the lid again . \n check the alignment of the two windows . if necessary , remove the screws again and adjust the microchips . \n note : do not fix the screws too tightly , as this may cause damage . \n check the sealing by initiating a liquid flow through the system using a flow rate of 4 l / min . \n if no leaking is observed on either side of the tip , this is a good indication of the vacuum tightness . \n note : it is recommended to test the pump station with a dummy holder prior to usage . transfer the holder to the electron microscope in its enclosure to prevent it from collecting dust . \n adjusting the electron microscope for stem note : the operation of the electron microscope described in this protocol is based on standard procedures that can be found in the user manual . \n the protocol describes the required detail beyond standard procedures for data acquisition on liquid specimens . \n adjust the settings of the stem microscope as follows : set the probe current to 0.18 na and the convergence semi - angle of the electron beam to 20 mrad by selecting a spot size of 4c and the objective aperture of 30 m . \n select an 8 cm camera length.make note of the indicated current density measured at the fluorescence screen while the adf detector is inserted . remove the specimen holder . \n note : this current value is needed later on to estimate the thickness of the liquid.start the liquid flow with pure water . do n't exceed a flow of 2 l / min.insert the liquid flow tem holder in the electron microscope and start evacuation . \n if the vacuum level is standard and the duration of the pumping procedure does not exceed the normal evacuation time ( of about 1 min ) by a factor of two , insert the holder.open the beam valve when the vacuum of the main sample chamber is in the range that allows its opening . insert the adf detector by pressing the adf button . \n note : this protocol refers to an adf detector positioned above the phosphor screen of the electron microscope.set the microscope in continuous image acquisition mode using an image size of 512 x 512 pixels , a pixel dwell time of 2 s , and a magnification of 20,000 . \n search for the sin window by translating the stage in the x and y directions . \n note : the microchips block any electrons passing through the sample towards the detector ; signal is only visible at the location of the sin . \n sometimes , it is easier to find the sin window by viewing the fluorescence screen.once the window has been found , adjust the contrast and brightness settings ( using the respective knobs ) so that the edge of the window becomes visible . \n move the edge towards the middle of the field of view by pressing the x- and y - translation buttons of the specimen stage . \n press the reset button of the objective lens . note : the brightness must be largely reduced compared to a vacuum sample on account of strong scattering in the liquid.proceed by coarse focusing the sharp corner at the edge of the sin window by adjusting the vertical position ( z - translation ) of the specimen stage . \n verify that the sample position is at the eucentric height by rotating the stage by 5 and rotating it back . \n features of the sample and the corner of the sin window should not shift at low magnifications . note : close the beam valve if not operating the microscope , since scanning at the same position for a longer time may result in sample damage and the formation of bubblesreadjust the vertical position as needed to place the window edge in the middle of the viewing area again . store the position of the stage using the store button of the software.move to a position where small pieces of debris or other objects of high contrast ( e.g. , aunps ) are present by translating the stage in the x and y directions . adjust the focus of the objective lens so that all objects appear sharp in focus.make note of the current density measured at the phosphor screen visible via the operating software , indicating the transmitted current through the liquid holder and through the opening of the adf detector . calculate the thickness of the liquid cell using equation 1 . proceed only if the liquid thickness has been determined and does not exceed 3 m . note : the thickness of the liquid cell can be determined by the ratio of the measured current density with and without the sample using the following equation14 \n equation 1 with tsin the thickness of the amorphous silicon nitride membrane and twater the thickness of the water layer . \n the mean free path lengths amount to lsin = 0.79 m of sin,= and lwater = 3.0 m of water for the detector opening semi - angle of 35 mrad14.carefully observe the liquid at lower magnifications to ensure that gas bubbles are not present . \n gas bubbles can be prevented by using continuous liquid flow and probe current lower than 0 . \n 5 na.translate the stage in the x and y directions until an area containing at least 20 aunps has been found . \n set the image size to 1,024 x 1,024 pixels , the pixel dwell time to 19 s , and the magnification to 400,000 . \n note : once images have been obtained in which the aunps are visible with strong contrast and sharp edges ( see figure 6 ) , one can be sure that the experiment is correctly set up . in case \n unexpected problems occur , do not proceed with the experiment but make sure to resolve the cause . \n adjust the settings of the stem microscope as follows : set the probe current to 0.18 na and the convergence semi - angle of the electron beam to 20 mrad by selecting a spot size of 4c and the objective aperture of 30 m . \n make note of the indicated current density measured at the fluorescence screen while the adf detector is inserted . remove the specimen holder . \n note : this current value is needed later on to estimate the thickness of the liquid . \n do n't exceed a flow of 2 l / min . insert the liquid flow tem holder in the electron microscope and \n if the vacuum level is standard and the duration of the pumping procedure does not exceed the normal evacuation time ( of about 1 min ) by a factor of two , insert the holder . open the beam valve when the vacuum of the main sample chamber is in the range that allows its opening . insert the adf detector by pressing the adf button . \n note : this protocol refers to an adf detector positioned above the phosphor screen of the electron microscope . set the microscope in continuous image acquisition mode using an image size of 512 x 512 pixels , a pixel dwell time of 2 s , and a magnification of 20,000 . \n search for the sin window by translating the stage in the x and y directions . \n note : the microchips block any electrons passing through the sample towards the detector ; signal is only visible at the location of the sin . \n sometimes , it is easier to find the sin window by viewing the fluorescence screen . \n once the window has been found , adjust the contrast and brightness settings ( using the respective knobs ) so that the edge of the window becomes visible . \n move the edge towards the middle of the field of view by pressing the x- and y - translation buttons of the specimen stage . \n press the reset button of the objective lens . note : the brightness must be largely reduced compared to a vacuum sample on account of strong scattering in the liquid . \n proceed by coarse focusing the sharp corner at the edge of the sin window by adjusting the vertical position ( z - translation ) of the specimen stage . \n verify that the sample position is at the eucentric height by rotating the stage by 5 and rotating it back . \n features of the sample and the corner of the sin window should not shift at low magnifications . \n note : close the beam valve if not operating the microscope , since scanning at the same position for a longer time may result in sample damage and the formation of bubbles readjust the vertical position as needed to place the window edge in the middle of the viewing area again . store the position of the stage using the store button of the software . \n move to a position where small pieces of debris or other objects of high contrast ( e.g. , aunps ) are present by translating the stage in the x and y directions . \n adjust the focus of the objective lens so that all objects appear sharp in focus . \n make note of the current density measured at the phosphor screen visible via the operating software , indicating the transmitted current through the liquid holder and through the opening of the adf detector . \n proceed only if the liquid thickness has been determined and does not exceed 3 m . note : the thickness of the liquid cell can be determined by the ratio of the measured current density with and without the sample using the following equation14 \n equation 1 with tsin the thickness of the amorphous silicon nitride membrane and twater the thickness of the water layer . \n the mean free path lengths amount to lsin = 0.79 m of sin,= and lwater = 3.0 m of water for the detector opening semi - angle of 35 mrad14 . carefully observe the liquid at lower magnifications to ensure that gas bubbles are not present . \n gas bubbles can be prevented by using continuous liquid flow and probe current lower than 0 . \n 5 na . translate the stage in the x and y directions until an area containing at least 20 aunps has been found . \n set the image size to 1,024 x 1,024 pixels , the pixel dwell time to 19 s , and the magnification to 400,000 . \n note : once images have been obtained in which the aunps are visible with strong contrast and sharp edges ( see figure 6 ) , one can be sure that the experiment is correctly set up . in case \n unexpected problems occur , do not proceed with the experiment but make sure to resolve the cause . \n stem of the dissolution of aunps \n remove the liquid flow tem holder from the microscope and stop the liquid flow.prepare at least 1 ml of a solution of 0.1 m of sodium chloride in hplc - grade water in a glass syringe.adjust the flow system to a velocity of 20 l / min and flush the whole flow system with 0.3 ml of the saline solution . \n use filter paper to collect the liquid being ejected on the other end of the tubing . \n afterwards , re - adjust the flow system to 2 l / min.check the integrity of the sin window using a binocular light microscope . \n if no leakage is observed , reinsert the liquid flow tem holder into the microscope.check the vacuum indication of the pre - vacuum chamber and the duration of evacuation . \n if the vacuum level is standard and the duration of the pumping procedure does not exceed the normal evacuation time ( of about 1 min ) by a factor of two , insert the holdermove the stage back of the microscope back to its previous position using the stored stage position \n . set the microscope in continuous image acquisition mode using an image size of 512 x 512 pixels , a pixel dwell time of 2 s , and a magnification of 20,000x . \n adjust the contrast , brightness , focus , and eucentric height , as described in steps 3.1.7-3.1.9.find a location of interest by translating the stage in the x and y directions . \n set the image size to 1,024 x 1,024 pixels , the pixel dwell time to 2 s , and the magnification to 500,000 . \n record a series of stem images by manually pressing the acquisition button once the previous image has been recorded . \n note : the aunps start to dissolve as soon as the electron beam is scanned over the sample . \n it is also possible to use software for the automated collection of a series of images into a movie . \n prepare at least 1 ml of a solution of 0.1 m of sodium chloride in hplc - grade water in a glass syringe . \n adjust the flow system to a velocity of 20 l / min and flush the whole flow system with 0.3 ml of the saline solution . \n use filter paper to collect the liquid being ejected on the other end of the tubing . \n if no leakage is observed , reinsert the liquid flow tem holder into the microscope . \n check the vacuum indication of the pre - vacuum chamber and the duration of evacuation . \n if the vacuum level is standard and the duration of the pumping procedure does not exceed the normal evacuation time ( of about 1 min ) by a factor of two , insert the holder move the stage back of the microscope back to its previous position using the stored stage position \n . set the microscope in continuous image acquisition mode using an image size of 512 x 512 pixels , a pixel dwell time of 2 s , and a magnification of 20,000x . \n adjust the contrast , brightness , focus , and eucentric height , as described in steps 3.1.7 - 3.1.9 . \n find a location of interest by translating the stage in the x and y directions . \n set the image size to 1,024 x 1,024 pixels , the pixel dwell time to 2 s , and the magnification to 500,000 . \n record a series of stem images by manually pressing the acquisition button once the previous image has been recorded . \n note : the aunps start to dissolve as soon as the electron beam is scanned over the sample . \n it is also possible to use software for the automated collection of a series of images into a movie . \n disassembling and cleaning the tem holder after the experiment \n when the liquid - phase tem experiments are completed and the holder is retracted from the electron microscope , clean the tubing , the liquid chamber , and its components in order to remove any solid particles or remaining salt that might influence future experiments.loosen the rear screw slightly so that it is still fixed in its slot but the lid can be removed easily . loosen the front screw , remove it , and place it in a dust - free environment.remove the lid and place it in dust - free environment for storage.remove the two microchips from the pocket . \n separate them by dipping them carefully in water or in the remaining solution of the experiment . \n place the microchips on tissue paper with the sin membrane side upward and let them dry in air for further analysis.remove the o - rings and clean the respective grooves with hplc - grade water . store the o - rings in a dust - free environment.use a glass syringe ( 5 ml ) to flush all tubing ( input and output ) , each with 5 ml of hplc - grade water . \n after flushing , use a pipette and/or filter paper to remove the remaining liquid from the liquid compartment.inspect the tip of the tem holder and remove residues like broken edges of the silicon microchips , fibers , or dust . \n return the o - rings to their grooves.store the tem holder and its components in a dust - free environment . \n when the liquid - phase tem experiments are completed and the holder is retracted from the electron microscope , clean the tubing , the liquid chamber , and its components in order to remove any solid particles or remaining salt that might influence future experiments . \n loosen the rear screw slightly so that it is still fixed in its slot but the lid can be removed easily . \n loosen the front screw , remove it , and place it in a dust - free environment . \n separate them by dipping them carefully in water or in the remaining solution of the experiment . \n place the microchips on tissue paper with the sin membrane side upward and let them dry in air for further analysis . \n remove the o - rings and clean the respective grooves with hplc - grade water . \n use a glass syringe ( 5 ml ) to flush all tubing ( input and output ) , each with 5 ml of hplc - grade water . collect the liquid with a small beaker placed below the tem holder tip . after flushing , \n use a pipette and/or filter paper to remove the remaining liquid from the liquid compartment . inspect the tip of the tem holder and \n procedure alternative to 3.2 : stem of moving gold nanoparticles note : a different assembly procedure is required to study the movement of aunps in liquid . \n load the aunps on the silicon microchip immediately before inserting them in the tem holder in step 2.2 . \n keep the sample covered by a liquid layer at all times in order to avoid a strong attachment of the aunps to the sin membrane . \n load the aunps on the silicon microchip immediately before inserting them in the tem holder in step 2.2 . \n keep the sample covered by a liquid layer at all times in order to avoid a strong attachment of the aunps to the sin membrane . \n ( a ) the liquid cell compartment with the smaller o - ring placed in its groove . \n the inset shows the side view at such angle that the microchip is visible from light reflection . \n ( c - d ) a droplet of the solution is added to the microchip . \n ( a ) to locate the sin window , the stage is moved towards the brightest signal . \n the silicon microchip is thin enough for some electrons to pass through close to the window . \n ( b ) the edge of the focused sin window showing some aunps appearing bright on the dark ( less scattering ) sin membrane window . \n the images show under - focused , in focus , and over - focused situations . \n 1 . cleaning of the microchips prepare a workspace with a low dust level in a laminar airflow hood with a dust particle filter . clean a light microscopy glass slide with a fiber - free tissue and pure ethanol for placement and transport of the microchips . place the glass slide on a cleanroom tissue in a petri dish . \n select 5 base microchips ( without a spacer ) for sample placement and 5 microchips with a spacer 200 nm thick . \n note : the window dimensions are 20 x 400 m and the sin thickness is 50 nm . since there is some tolerance on the dimensions , it is recommended to check the dimensions using a light microscope . \n use carbon - coated tweezers to remove the microchips from the storage box and place them on the glass slide . \n also be careful with handling the microchips to avoid cracking their sharp edges , which can cause problems due to silicon particles residing on the microchip or to later leakages . \n note : training for the procedure to remove the microchips from the sticky surface can be performed on ( cheap ) dummy microchips . \n note : the steps involving acetone are performed in a fume hood for chemical safety . \n fill the first one with 40 - 60 ml of acetone and the other with 40 - 60 ml of ethanol . \n note : it is important to use hplc - grade liquids also for this step in the protocol . transfer the microchips into the beaker with acetone in order to remove the protective resist layer . \n gently move the beaker by hand to effectively rinse the microchips , but be careful not to turn the microchips upside down see figure 2 . \n after 2 min , remove the microchips and quickly transfer them into the beaker with the ethanol . gently move the beaker by hand with ethanol for 2 min to remove any residues of the resist layer . \n note : do not let the microchips dry out during transfer to avoid the deposition of debris . remove the microchips from the beaker and place them onto a new cleanroom tissue . \n let them dry for a few minutes and transfer the microchips onto the light microscope glass slide in the petri dish . \n note : the wet microchips can easily flip around , turn upside down , or stick to the tweezers when being released . \n this can be avoided by pressing the microchips softly on the filter paper and pulling the tweezers away in the horizontal direction . \n run a 5 min cleaning program to render the surface of the silicon nitride membrane hydrophilic and to remove hydrocarbons . note : suitable settings applied for our plasma cleaner are : 70 mtorr , gas flow of 11.5 sccm for o2 and 35.0 sccm for ar , 50 w forward radio frequency ( rf ) target , 5 w rf range , and max reflected rf . \n put the glass slide with the microchip back into the petri dish , close the lid , and transfer it to the light microscope . examine the microchips under a light microscope for possible membrane ruptures or remaining dirt particles . \n take special care with the window areas and check for small spots indicating a rupture of the membrane . \n 2 . preparation of the sample on the microchips \n prepare an aqueous aunp solution ( citrate stabilized ) by mixing small amounts of the stock solutions containing 30 nm - diameter , citrate - stabilized aunps at a concentration of ~3 m. place the microchips on a clean , sticky surface in a transport box for droplet application / sample deposition . place a droplet ( 1 - 2 l ) of the sample solution on the sin membrane side of the freshly plasma - cleaned microchip ( use a microchip without a spacer ) and let the solution dry in the laminar airflow workbench . note : this procedure can be repeated in order to increase the concentration of aunps on the sin membrane . \n apply 1 l of deionized water to the microchip for the removal of salt and/or surfactants . \n note : a sufficiently large number of aunps will have adhered to the microchip and will not be washed away in water anymore . \n use the prepared sample microchips within 4 h , as the sin loses its hydrophilic rendered surface properties over time , which may cause the liquid to behave differently during an experiment . \n cleaning the liquid flow tem holder \n clean all tools ( tweezers and a screw driver ) that will be in contact with vacuum parts using acetone and ethanol in an ultrasonic bath and place them on the dust - free surface provided by a piece of new aluminum foil placed on the work bench . \n note : the tools do not have to be extensively cleaned if one is sure that they are clean for work with vacuum parts . \n gloves can be avoided if one is capable of handling the equipment without touching the vacuum parts.place the liquid flow tem holder under the binocular light microscope in such a way that the tip of the holder containing the liquid chamber can be observed . \n see figure 3.remove the lid of the holder tip and place it on the dust - free surface . \n note : the titanium lid is sensitive to scratches caused by harder materials like the tweezers . it is recommended to use polymer - coated tweezers for sensitive materials.prepare at least 1 - 2 ml of pure water ( hplc grade ) \n . note : if one does not use hplc - grade liquid , then it is recommended to check that the liquids used do not contain micro particles that could possibly lead to clogs of the flow system ; filter the liquid as needed with a micro - pore filter.use a glass syringe ( 1 ml ) to flush the whole flow system with 0.5 ml of pure water . \n it is recommended to use a microfluidic syringe pump system . use a pipette and/or filter paper to remove the liquid being ejected in the liquid cell compartment . \n dry the holder tip afterwards using filter paper and/or a pipette.use the light microscope to check that the tip of the holder is clean and dry . \n if needed , wash the tip of the holder with water or ethanol to remove any solid residues that might have been left behind by the dried solution . remove pieces of dust or remainders of fibers as well . \n also check inside the o - ring grooves and remove the remainders of liquid with a small piece of cleanroom tissue . note : if the holder does not become clean with this procedure , then it is recommended to remove the tip from the holder and clean it in acetone for 2 min and in ethanol for another 2 min using an ultrasonic bath.inspect all further parts of the tip ( o - rings , lid , and screws ) under the light microscope and remove dust , fibers , etc ... note : occasionally , small pieces originating from the screws or the si microchips must be removed as well . \n the lid and screws can be cleaned using ultrasound , as explained for the tip . \n avoid placing the o - rings frequently in ethanol , as it may make the o - rings brittle over time , diminishing their vacuum tightness . \n the system is operated without vacuum grease , but if sealing problems occur , vacuum grease can be used.reinsert the o - rings into the respective grooves of the holder and check that they fit and do not protrude on any side of the groove.keep the liquid flow tem holder free from dust until sample loading ( e.g. , by covering it with aluminum foil ) . \n clean all tools ( tweezers and a screw driver ) that will be in contact with vacuum parts using acetone and ethanol in an ultrasonic bath and place them on the dust - free surface provided by a piece of new aluminum foil placed on the work bench . \n note : the tools do not have to be extensively cleaned if one is sure that they are clean for work with vacuum parts . \n gloves can be avoided if one is capable of handling the equipment without touching the vacuum parts . \n place the liquid flow tem holder under the binocular light microscope in such a way that the tip of the holder containing the liquid chamber can be observed . see figure 3 . \n remove the lid of the holder tip and place it on the dust - free surface . \n note : the titanium lid is sensitive to scratches caused by harder materials like the tweezers . it is recommended to use polymer - coated tweezers for sensitive materials . \n note : if one does not use hplc - grade liquid , then it is recommended to check that the liquids used do not contain micro particles that could possibly lead to clogs of the flow system ; filter the liquid as needed with a micro - pore filter . \n use a glass syringe ( 1 ml ) to flush the whole flow system with 0.5 ml of pure water . \n use a pipette and/or filter paper to remove the liquid being ejected in the liquid cell compartment . \n use the light microscope to check that the tip of the holder is clean and dry . \n if needed , wash the tip of the holder with water or ethanol to remove any solid residues that might have been left behind by the dried solution . \n carefully remove these pieces with tweezers , thereby avoiding scratching the titanium surface . also check inside the o - ring grooves and remove the remainders of liquid with a small piece of cleanroom tissue . note : if the holder does not become clean with this procedure , then it is recommended to remove the tip from the holder and clean it in acetone for 2 min and in ethanol for another 2 min using an ultrasonic bath . \n inspect all further parts of the tip ( o - rings , lid , and screws ) under the light microscope and remove dust , fibers , etc ... note : occasionally , small pieces originating from the screws or the si microchips must be removed as well . if necessary , briefly clean the vacuum parts with hplc - grade ethanol . the lid and screws \n avoid placing the o - rings frequently in ethanol , as it may make the o - rings brittle over time , diminishing their vacuum tightness . \n the system is operated without vacuum grease , but if sealing problems occur , vacuum grease can be used . reinsert the o - rings into the respective grooves of the holder and \n keep the liquid flow tem holder free from dust until sample loading ( e.g. , by covering it with aluminum foil ) . assembling the liquid flow tem holder note : \n the following procedure describes the loading procedure of microchips in a specimen holder with optimal orientation for stem . in this configuration \n , the base microchip with the sample will be the upper microchip once transferred into the microscope . \n , the highest spatial resolution is obtained at the bottom of the liquid cell with respect to a downward - traveling electron beam . \n use curved tweezers to grab the sample microchip on the long side and place it inside the slot ( pocket ) in the tip of the liquid flow tem holder . keep the sin side facing upwards . \n check the correct placement of the microchip in the slot using a binocular light microscope . note : if the o - ring below the microchip is not correctly placed , the microchip may protrude from the slot.place a droplet of 0.3 l of the filtered liquid for the experiment on the sample microchip using a micropipette . if necessary , fix the microchip in place with tweezers , as the capillary forces of the droplet may pull the microchip out of its pocket.use upside down curved tweezers to take the second microchip ( the one with the spacer layer ) . carefully turn the microchip upside down . \n place the spacer microchip on the base microchip in the slot . note : this procedure needs to be done sufficiently quickly to avoid the drying of the droplet on the sample microchip.inspect the correct placement using a binocular light microscope while moving a piece of light - reflecting material below the tip of the specimen holder . both microchips must be aligned exactly parallel to achieve the best overlap of the sin windows . \n note : in case the windows do not overlap , the microchips can be repositioned by pushing at one side with a tip of the tweezers , but avoid moving the microchips too much , as the sin membrane can be damaged easily . \n some microchips come with a crossed configuration ( the window of one microchip is perpendicular to the window in the other microchip ) ; this configuration facilitates the alignment of the two microchips yet also reduces the field of view in the electron microscope.take the front side of the specimen chamber lid with the tweezers and turn it upside down . without touching the microchips , \n slowly open the tweezers in such a way that the lid solely rests on the lower branch of the tweezers . carefully lower the lid until it rests on the two microchips . remove the tweezers.recheck the alignment of the windows of both microchips . \n if necessary , remove the lid , adjust the positioning of the microchips , and position the lid again.place the screws and fix them in their usual places . \n check the alignment of the two windows . if necessary , remove the screws again and adjust the microchips . \n note : do not fix the screws too tightly , as this may cause damage . \n a vacuum seal is achieved when the screws just tighten.check the sealing by initiating a liquid flow through the system using a flow rate of 4 l / min . \n if no leaking is observed on either side of the tip , this is a good indication of the vacuum tightness.transfer the holder to the vacuum pump station and check the vacuum tightness . \n note : it is recommended to test the pump station with a dummy holder prior to usage.transfer the holder to the electron microscope in its enclosure to prevent it from collecting dust . note : each commercial holder comes with an enclosure . \n use curved tweezers to grab the sample microchip on the long side and place it inside the slot ( pocket ) in the tip of the liquid flow tem holder . \n check the correct placement of the microchip in the slot using a binocular light microscope . note : if the o - ring below the microchip is not correctly placed , the microchip may protrude from the slot . \n place a droplet of 0.3 l of the filtered liquid for the experiment on the sample microchip using a micropipette . if necessary , fix the microchip in place with tweezers , as the capillary forces of the droplet may pull the microchip out of its pocket . \n use upside down curved tweezers to take the second microchip ( the one with the spacer layer ) . carefully turn the microchip upside down . place the spacer microchip on the base microchip in the slot . \n note : this procedure needs to be done sufficiently quickly to avoid the drying of the droplet on the sample microchip . inspect the correct placement using a binocular light microscope while moving a piece of light - reflecting material below the tip of the specimen holder . \n both microchips must be aligned exactly parallel to achieve the best overlap of the sin windows . \n note : in case the windows do not overlap , the microchips can be repositioned by pushing at one side with a tip of the tweezers , but avoid moving the microchips too much , as the sin membrane can be damaged easily . \n some microchips come with a crossed configuration ( the window of one microchip is perpendicular to the window in the other microchip ) ; this configuration facilitates the alignment of the two microchips yet also reduces the field of view in the electron microscope . \n take the front side of the specimen chamber lid with the tweezers and turn it upside down . without touching the microchips , place the rear side of the lid on the tip . \n slowly open the tweezers in such a way that the lid solely rests on the lower branch of the tweezers . \n carefully lower the lid until it rests on the two microchips . remove the tweezers . \n if necessary , remove the lid , adjust the positioning of the microchips , and position the lid again . \n check the alignment of the two windows . if necessary , remove the screws again and adjust the microchips . \n note : do not fix the screws too tightly , as this may cause damage . \n check the sealing by initiating a liquid flow through the system using a flow rate of 4 l / min . \n if no leaking is observed on either side of the tip , this is a good indication of the vacuum tightness . \n note : it is recommended to test the pump station with a dummy holder prior to usage . \n transfer the holder to the electron microscope in its enclosure to prevent it from collecting dust . \n adjusting the electron microscope for stem note : the operation of the electron microscope described in this protocol is based on standard procedures that can be found in the user manual . \n the protocol describes the required detail beyond standard procedures for data acquisition on liquid specimens . \n adjust the settings of the stem microscope as follows : set the probe current to 0.18 na and the convergence semi - angle of the electron beam to 20 mrad by selecting a spot size of 4c and the objective aperture of 30 m . \n select an 8 cm camera length.make note of the indicated current density measured at the fluorescence screen while the adf detector is inserted . remove the specimen holder . \n note : this current value is needed later on to estimate the thickness of the liquid.start the liquid flow with pure water . do n't exceed a flow of 2 l / min.insert the liquid flow tem holder in the electron microscope and start evacuation . \n if the vacuum level is standard and the duration of the pumping procedure does not exceed the normal evacuation time ( of about 1 min ) by a factor of two , insert the holder.open the beam valve when the vacuum of the main sample chamber is in the range that allows its opening . insert the adf detector by pressing the adf button . \n note : this protocol refers to an adf detector positioned above the phosphor screen of the electron microscope.set the microscope in continuous image acquisition mode using an image size of 512 x 512 pixels , a pixel dwell time of 2 s , and a magnification of 20,000 . \n search for the sin window by translating the stage in the x and y directions . \n note : the microchips block any electrons passing through the sample towards the detector ; signal is only visible at the location of the sin . \n sometimes , it is easier to find the sin window by viewing the fluorescence screen.once the window has been found , adjust the contrast and brightness settings ( using the respective knobs ) so that the edge of the window becomes visible . \n move the edge towards the middle of the field of view by pressing the x- and y - translation buttons of the specimen stage . \n press the reset button of the objective lens . note : the brightness must be largely reduced compared to a vacuum sample on account of strong scattering in the liquid.proceed by coarse focusing the sharp corner at the edge of the sin window by adjusting the vertical position ( z - translation ) of the specimen stage . \n verify that the sample position is at the eucentric height by rotating the stage by 5 and rotating it back . \n features of the sample and the corner of the sin window should not shift at low magnifications . note : close the beam valve if not operating the microscope , since scanning at the same position for a longer time may result in sample damage and the formation of bubblesreadjust the vertical position as needed to place the window edge in the middle of the viewing area again . store the position of the stage using the store button of the software.move to a position where small pieces of debris or other objects of high contrast ( e.g. , aunps ) are present by translating the stage in the x and y directions . \n adjust the focus of the objective lens so that all objects appear sharp in focus.make note of the current density measured at the phosphor screen visible via the operating software , indicating the transmitted current through the liquid holder and through the opening of the adf detector . \n proceed only if the liquid thickness has been determined and does not exceed 3 m . \n note : the thickness of the liquid cell can be determined by the ratio of the measured current density with and without the sample using the following equation14 \n equation 1 with tsin the thickness of the amorphous silicon nitride membrane and twater the thickness of the water layer . \n the mean free path lengths amount to lsin = 0.79 m of sin,= and lwater = 3.0 m of water for the detector opening semi - angle of 35 mrad14.carefully observe the liquid at lower magnifications to ensure that gas bubbles are not present . \n gas bubbles can be prevented by using continuous liquid flow and probe current lower than 0 . \n 5 na.translate the stage in the x and y directions until an area containing at least 20 aunps has been found . \n set the image size to 1,024 x 1,024 pixels , the pixel dwell time to 19 s , and the magnification to 400,000 . \n note : once images have been obtained in which the aunps are visible with strong contrast and sharp edges ( see figure 6 ) , one can be sure that the experiment is correctly set up . in case unexpected problems occur , \n adjust the settings of the stem microscope as follows : set the probe current to 0.18 na and the convergence semi - angle of the electron beam to 20 mrad by selecting a spot size of 4c and the objective aperture of 30 m . \n make note of the indicated current density measured at the fluorescence screen while the adf detector is inserted . remove the specimen holder . \n note : this current value is needed later on to estimate the thickness of the liquid . \n do n't exceed a flow of 2 l / min . insert the liquid flow tem holder in the electron microscope and \n if the vacuum level is standard and the duration of the pumping procedure does not exceed the normal evacuation time ( of about 1 min ) by a factor of two , insert the holder . open the beam valve when the vacuum of the main sample chamber is in the range that allows its opening . insert the adf detector by pressing the adf button . note : this protocol refers to an adf detector positioned above the phosphor screen of the electron microscope . set the microscope in continuous image acquisition mode using an image size of 512 x 512 pixels , a pixel dwell time of 2 s , and a magnification of 20,000 . \n search for the sin window by translating the stage in the x and y directions . \n note : the microchips block any electrons passing through the sample towards the detector ; signal is only visible at the location of the sin . \n sometimes , it is easier to find the sin window by viewing the fluorescence screen . \n once the window has been found , adjust the contrast and brightness settings ( using the respective knobs ) so that the edge of the window becomes visible . \n move the edge towards the middle of the field of view by pressing the x- and y - translation buttons of the specimen stage . \n press the reset button of the objective lens . note : the brightness must be largely reduced compared to a vacuum sample on account of strong scattering in the liquid . \n proceed by coarse focusing the sharp corner at the edge of the sin window by adjusting the vertical position ( z - translation ) of the specimen stage . \n verify that the sample position is at the eucentric height by rotating the stage by 5 and rotating it back . \n features of the sample and the corner of the sin window should not shift at low magnifications . note : close the beam valve if not operating the microscope , since scanning at the same position for a longer time may result in sample damage and the formation of bubbles readjust the vertical position as needed to place the window edge in the middle of the viewing area again . store the position of the stage using the store button of the software . move to a position where small pieces of debris or other objects of high contrast ( e.g. , aunps ) are present by translating the stage in the x and y directions . adjust the focus of the objective lens so that all objects appear sharp in focus . \n make note of the current density measured at the phosphor screen visible via the operating software , indicating the transmitted current through the liquid holder and through the opening of the adf detector . \n proceed only if the liquid thickness has been determined and does not exceed 3 m . note : the thickness of the liquid cell can be determined by the ratio of the measured current density with and without the sample using the following equation14 \n equation 1 with tsin the thickness of the amorphous silicon nitride membrane and twater the thickness of the water layer . \n the mean free path lengths amount to lsin = 0.79 m of sin,= and lwater = 3.0 m of water for the detector opening semi - angle of 35 mrad14 . carefully observe the liquid at lower magnifications to ensure that gas bubbles are not present . \n gas bubbles can be prevented by using continuous liquid flow and probe current lower than 0 . \n 5 na . translate the stage in the x and y directions until an area containing at least 20 aunps has been found . \n set the image size to 1,024 x 1,024 pixels , the pixel dwell time to 19 s , and the magnification to 400,000 . \n note : once images have been obtained in which the aunps are visible with strong contrast and sharp edges ( see figure 6 ) , one can be sure that the experiment is correctly set up . in case unexpected problems occur , do not proceed with the experiment but make sure to resolve the cause . \n stem of the dissolution of aunps \n remove the liquid flow tem holder from the microscope and stop the liquid flow.prepare at least 1 ml of a solution of 0.1 m of sodium chloride in hplc - grade water in a glass syringe.adjust the flow system to a velocity of 20 l / min and flush the whole flow system with 0.3 ml of the saline solution . \n use filter paper to collect the liquid being ejected on the other end of the tubing . \n afterwards , re - adjust the flow system to 2 l / min.check the integrity of the sin window using a binocular light microscope \n . if no leakage is observed , reinsert the liquid flow tem holder into the microscope.check the vacuum indication of the pre - vacuum chamber and the duration of evacuation . \n if the vacuum level is standard and the duration of the pumping procedure does not exceed the normal evacuation time ( of about 1 min ) by a factor of two , insert the holdermove the stage back of the microscope back to its previous position using the stored stage position \n . set the microscope in continuous image acquisition mode using an image size of 512 x 512 pixels , a pixel dwell time of 2 s , and a magnification of 20,000x . \n adjust the contrast , brightness , focus , and eucentric height , as described in steps 3.1.7-3.1.9.find a location of interest by translating the stage in the x and y directions . \n set the image size to 1,024 x 1,024 pixels , the pixel dwell time to 2 s , and the magnification to 500,000 . \n record a series of stem images by manually pressing the acquisition button once the previous image has been recorded . \n note : the aunps start to dissolve as soon as the electron beam is scanned over the sample . \n it is also possible to use software for the automated collection of a series of images into a movie . \n prepare at least 1 ml of a solution of 0.1 m of sodium chloride in hplc - grade water in a glass syringe . \n adjust the flow system to a velocity of 20 l / min and flush the whole flow system with 0.3 ml of the saline solution . \n use filter paper to collect the liquid being ejected on the other end of the tubing . \n afterwards , re - adjust the flow system to 2 l / min . check the integrity of the sin window using a binocular light microscope . \n if no leakage is observed , reinsert the liquid flow tem holder into the microscope . \n check the vacuum indication of the pre - vacuum chamber and the duration of evacuation . \n if the vacuum level is standard and the duration of the pumping procedure does not exceed the normal evacuation time ( of about 1 min ) by a factor of two , insert the holder move the stage back of the microscope back to its previous position using the stored stage position \n . set the microscope in continuous image acquisition mode using an image size of 512 x 512 pixels , a pixel dwell time of 2 s , and a magnification of 20,000x . \n adjust the contrast , brightness , focus , and eucentric height , as described in steps 3.1.7 - 3.1.9 . \n find a location of interest by translating the stage in the x and y directions . \n set the image size to 1,024 x 1,024 pixels , the pixel dwell time to 2 s , and the magnification to 500,000 . \n record a series of stem images by manually pressing the acquisition button once the previous image has been recorded . \n note : the aunps start to dissolve as soon as the electron beam is scanned over the sample . \n it is also possible to use software for the automated collection of a series of images into a movie . \n disassembling and cleaning the tem holder after the experiment \n when the liquid - phase tem experiments are completed and the holder is retracted from the electron microscope , clean the tubing , the liquid chamber , and its components in order to remove any solid particles or remaining salt that might influence future experiments.loosen the rear screw slightly so that it is still fixed in its slot but the lid can be removed easily . \n loosen the front screw , remove it , and place it in a dust - free environment.remove the lid and place it in dust - free environment for storage.remove the two microchips from the pocket . \n separate them by dipping them carefully in water or in the remaining solution of the experiment . \n place the microchips on tissue paper with the sin membrane side upward and let them dry in air for further analysis.remove the o - rings and clean the respective grooves with hplc - grade water . store the o - rings in a dust - free environment.use a glass syringe ( 5 ml ) to flush all tubing ( input and output ) , each with 5 ml of hplc - grade water . \n after flushing , use a pipette and/or filter paper to remove the remaining liquid from the liquid compartment.inspect the tip of the tem holder and remove residues like broken edges of the silicon microchips , fibers , or dust . \n return the o - rings to their grooves.store the tem holder and its components in a dust - free environment . \n when the liquid - phase tem experiments are completed and the holder is retracted from the electron microscope , clean the tubing , the liquid chamber , and its components in order to remove any solid particles or remaining salt that might influence future experiments . loosen the rear screw slightly so that it is still fixed in its slot but the lid can be removed easily . \n loosen the front screw , remove it , and place it in a dust - free environment . \n separate them by dipping them carefully in water or in the remaining solution of the experiment . \n place the microchips on tissue paper with the sin membrane side upward and let them dry in air for further analysis . \n remove the o - rings and clean the respective grooves with hplc - grade water . \n use a glass syringe ( 5 ml ) to flush all tubing ( input and output ) , each with 5 ml of hplc - grade water . collect the liquid with a small beaker placed below the tem holder tip . \n after flushing , use a pipette and/or filter paper to remove the remaining liquid from the liquid compartment . inspect the tip of the tem holder and \n procedure alternative to 3.2 : stem of moving gold nanoparticles note : a different assembly procedure is required to study the movement of aunps in liquid . \n load the aunps on the silicon microchip immediately before inserting them in the tem holder in step 2.2 . \n keep the sample covered by a liquid layer at all times in order to avoid a strong attachment of the aunps to the sin membrane . \n load the aunps on the silicon microchip immediately before inserting them in the tem holder in step 2.2 . \n keep the sample covered by a liquid layer at all times in order to avoid a strong attachment of the aunps to the sin membrane . \n ( a ) the liquid cell compartment with the smaller o - ring placed in its groove . \n the inset shows the side view at such angle that the microchip is visible from light reflection . \n ( c - d ) a droplet of the solution is added to the microchip . \n ( a ) to locate the sin window , the stage is moved towards the brightest signal . \n the silicon microchip is thin enough for some electrons to pass through close to the window . \n ( b ) the edge of the focused sin window showing some aunps appearing bright on the dark ( less scattering ) sin membrane window . \n the images show under - focused , in focus , and over - focused situations . \n the liquid flow tem holder was used to study the behavior of aunps in liquid . \n aunps were stably immobilized on the sin membrane in pure water and were imaged with nanoscale resolution using liquid - phase stem ( figure 6 ) . \n the current density on the phosphor screen measured for a dry test sample was 20 pa / cm , while it amounted to 8 pa / cm with the liquid flow tem holder inserted . using equation 1 , twater = 2.4 0.5 m , much larger than what was expected based on the spacer thickness of 200 nm . nevertheless , the thickness is not too large for the imaging of the aunps with nanometer spatial resolution . \n the liquid thickness was thicker than the 200 nm set by the spacer due to bulging of the sin membranes , non - flatness of the microchips , and debris residing on the microchips . \n for pure water , the aunps maintain their shape during imaging16 , although reactive radiolysis products ( eaq , h , h , oh ) originating from the interaction of the electron beam with water may oxidize single gold atoms , leading to a change of shape of the aunps15 . \n however , when the liquid flow system was used to introduce chloride ions in a second experiment , the stability of the aunps changed . \n chloride ions are capable of stabilizing oxidized gold atoms in the form of tetrachloroaureat , aucl4 . \n figure 7 shows that the aunps slowly dissolved during a stem imaging time - lapse series , similar to results reported earlier16 . for the used electron dose rate \n the movements of aunps in water were studied in a third experiment ( figure 8) . \n prior to the experiment , the liquid flow tem holder was cleaned in order to remove any traces of salt . \n differing from the first experiment , an alternative sample preparation approach was used to achieve a weaker attachment of the aunps to the sin membrane14 . in this experiment , \n the aunp solution was placed on the silicon microchip and assembled in the liquid flow tem holder without letting the solution dry out . in this way \n , the aunps easily detached from the sin membrane upon imaging at the dose rate used . \n some of the aunps moved away from the field of view into the bulk solutions , while the remaining aunps remained within the field of view in close proximity to the sin window . \n , these agglomerates also detached from the sin membrane and moved out of the field of view and into the solution . \n figure 6 : scanning transmission electron microscopy ( stem ) micrograph of aunps 30 nm in diameter at the top of a pure water layer . \n the image size was 1,024 x 1,024 pixels , the pixel dwell time was 19 s , the pixel size was 0.73 nm , and the magnification was 400,000x . \n the electron dose was thus 7.1 x 10 e / nm . the current density measured on the phosphor screen was 8 pa / cm , so the liquid thickness was calculated to amount to 2.4 m . \n ( a - d ) images extracted from the time - lapse series of stem images at 30 s intervals . \n the aunps gradually dissolve in liquid as a consequence of the presence of chloride ions . \n the pixel dwell time was 2 s , the frame time of the time lapse series was 1.75 s , the pixel size was 0.44 nm , and the magnification was 500,000x . \n ( a ) sin membrane with aunps , of which several are selected with arrows . \n ( b ) motion tracks of the selected aunps ( see a ) . some aunps move away from the field of view during the time of imaging . \n the remaining aunps move laterally along the sin membrane and start agglomerating . upon reaching a critical cluster size , they dispatch from the membrane and move away from the field of view.the pixel dwell time was 1 s \n , the frame time was 0.52 s , the pixel size was 1.8 nm , and the magnification was 120,000x . \n the electron dose per image was 3.5 x 10e / nm and the liquid thickness was 2.4 m . \n the described protocol enables stem of aunps in a liquid , including the observation of dynamic processes . \n however , several aspects must be considered when working with the liquid flow tem holder . \n for instance , broken edges of the si microchip or large particles on the o - rings may result in leakage of the liquid cell . on \n the other hand , large particles ( > 200 nm ; e.g. , dust or si debris ) on the sin membrane may result in an increased thickness of the liquid cell , leading to a low imaging contrast or to a low spatial resolution and may even cause sin windows to break . \n importantly , residues of salt or other chemicals may influence the outcome of the experiments in an undesired way . \n therefore , it is crucial that the different steps of sample preparation and holder assembly are carried out carefully and in a clean and dust - free environment . \n the thickness of the liquid cell determines the achievable resolution , as well as the contrast of the obtained images17 . \n this thickness can be adjusted via spacers located on one of the two si microchips . \n depending on the dimensions of the sample , different thicknesses of the liquid cell can be realized . for the study of aunps , \n it is possible to use small spacers ( 200 - 500 nm ) , while whole eukaryotic cells need larger spacers of up to 5 m . the thickness of the liquid cell is further influenced by the bulging of the sin membrane windows resulting from the pressure difference between the liquid cell and the surrounding vacuum . \n thus , in order to minimize the thickness of the liquid cell , it is recommended to use small sin membrane windows . in case \n it is difficult to find an overlap between two small windows , they can be assembled in a crossed configuration using a different base microchip . \n alternative configurations largely prevent bulging and consist of a monolithic microchip18 or membrane windows supported by pillars19 , but those exhibit disadvantages regarding sample loading . \n one of the most challenging aspects of the current technology is the lack of precise control over the liquid thickness . \n often , the liquid is much thicker than what is expected from the spacer dimensions used , as was shown here . \n several groups used closed liquid chambers4202122 ; these systems have some advantages regarding spatial resolution , as the liquid thickness can be reduced by inducing a bubble in the liquid . \n alternatively , the sin windows can be forced to collapse , leading to a thinner liquid layer . \n thirdly , the enclosure of other thinner windows exists ( e.g. , graphene)23 , also resulting in much thinner liquids than what is possible with the system described in this protocol . \n however , it is impossible to flow liquid in those systems . as for any high resolution microscopy technique , a number of experimental aspects must be considered . \n the most important aspect is the interaction of the electron beam with the liquid or the sample . \n in addition to radiation damage , which limits the achievable spatial resolution for many solid samples24 , the liquid samples are also influenced by electron beam - generated radiolysis products1525 . \n since these products may influence the experiment , careful data interpretation and experimental design are essential26 . \n adf stem is more powerful for imaging nanoparticles of a high atomic number ( z ) in larger thicknesses of the liquid cell , while tem gives better contrast on low - z materials and is typically faster but requires thinner liquid layers3 . instead of using the adf detector , the bright field ( bf ) detector \n is sometimes used to image the liquid cell , since bf stem is advantageous for imaging low - z materials in thick layers27 . with increasing thickness of the liquid cell , more current is needed . \n it should also be noted that an inversion of contrast is observed in the adf detector for very thick liquids ( > 10 m for water ) . \n the liquid conditions were changed between our experiments by removing the holder from the microscope and exchanging both the sample and the liquid . \n in addition to changing the salt concentration , it is readily possible to change other properties of the liquid by flowing in different liquids ( e.g. , one may use buffer solutions in order to set a specific ph16 or may introduce organic solutions or other additives ) . \n it is also possible to change the liquid while the holder is still inserted in the microscope by flowing liquids through the microfluidic system . \n however , in this case , it is unknown at which time point the liquid at the sample changes . \n it is also noteworthy that microchips supporting electrodes are available , so nanoscale electrochemistry experiments can be carried out28 \n . the objects of study are not limited to aunps in water , but a wide variety of specimens can be studied using the protocol described above , including silica , titanium oxide , and polymers . \n if movements of the objects are too fast to capture in an image within the acquisition , the viscosity can be reduced by an order of magnitude by using a mixture of 50% glycerol and 50% water . from the aforementioned points , \n when working with liquid - phase stem , the most important disadvantages to consider are that : 1 ) any experiment is influenced by the dynamic interaction of the electron beam with the entire specimen ( the object under observation , the liquid , and the sin membranes ) ; 2 ) sample handling is tedious , and it is often difficult to achieve a thin liquid layer because the sample or the microchips contain some micrometer - sized particles ; 3 ) the liquid thickness usually differs largely from the intended thickness set by the spacer ; and 4 ) spatial resolution and contrast strongly depend upon the liquid thickness and the difference between the change density of the object under observation and the liquid . presently , ample methods exist for the microscopy of objects in liquid with nanometer spatial resolution . \n electron microscopy in amorphous ice is a powerful technique29 , but the involved experimental procedures are delicate , not all experiments allow the preparation of the sample in ice , and time - resolved experiments are impossible . \n x - ray microscopy3031 could in principle be used , but it has a limited spatial resolution and is not widely available in laboratories . \n electron microscopy in liquid seems the most powerful technique for direct microscopy of nanoscale objects and processes in liquid . \n liquid - phase tem and stem are not yet routine analytical techniques but are still developing . the number of parameters to take into account is considerable , and it is often difficult to reproduce experimental results . moreover , \n quantitative data is difficult to obtain because the effects under investigation are intertwined with processes occurring as a result of the electron beam . \n the protocol described here aims to standardize the experimental protocol , thereby accounting for all relevant base aspects of the experiment . \n we hope that this protocol will lead to better reproducibility of experimental work in this emerging field . \n ", "role": "user" }, { "content": "samples fully embedded in liquid can be studied at a nanoscale spatial resolution with scanning transmission electron microscopy ( stem ) using a microfluidic chamber assembled in the specimen holder for transmission electron microscopy ( tem ) and stem . \n the microfluidic system consists of two silicon microchips supporting thin silicon nitride ( sin ) membrane windows . \n this article describes the basic steps of sample loading and data acquisition . \n most important of all is to ensure that the liquid compartment is correctly assembled , thus providing a thin liquid layer and a vacuum seal . \n this protocol also includes a number of tests necessary to perform during sample loading in order to ensure correct assembly . \n once the sample is loaded in the electron microscope , the liquid thickness needs to be measured . \n incorrect assembly may result in a too - thick liquid , while a too - thin liquid may indicate the absence of liquid , such as when a bubble is formed . \n finally , the protocol explains how images are taken and how dynamic processes can be studied . \n a sample containing aunps is imaged both in pure water and in saline .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: most stroke survivors display a degree of motor , sensory , perception , or language \n dysfunction1 , 2 . \n these people have difficulty performing their occupations \n continually owing to their impairment even after returning to the community3 , 4 . in \n particular , \n patients who have had a left hemiparetic stroke experience poorer rehabilitation \n outcomes , longer hospital admissions , and greater dependence on others in activities of \n daily living ( adl ) than patients who have had a right hemiparetic stroke . \n the specific factors underlying the negative \n outcomes caused by hemineglect have been reported previously5 . \n hemineglect is a disorder that can reduce a person s ability to \n look , listen , or make movements toward one - half of their environment . \n therefore , patients \n with hemineglect display a limited response to rehabilitation in the recovery of independent \n performance in daily activities , as well as social and leisure activities6 . patients who have a left hemiparetic stroke have also been shown to exhibit specific \n behavioral patterns due to motor and perception disabilities , thereby affecting their \n abilities to carry out many everyday tasks such as eating , reading , and getting dressed on \n the right side only7 . \n this hemineglect \n makes it difficult for patients to be involved in instrumental activities of daily living \n ( iadl ) , recreational activities , and social roles when they transition from the \n rehabilitation setting to their communities . \n the purpose of this study was to examine the \n relationship of motor and processing skills with iadl in individuals who have hemineglect \n after a left hemiparetic stroke . \n thirty - five patients who had had a left hemiparetic stroke participated in this study . \n the \n inclusion criteria for participation in this study were as follows : ( 1 ) community - dwelling \n adults who had had a stroke ; ( 2 ) adults with hemineglect after having a left hemiparetic \n stroke ; ( 3 ) adults who provided consent ; ( 4 ) sufficient cognitive ability to understand and \n follow simple verbal instructions , as indicated by a mini - mental state examination score of \n 24 ; ( 5 ) sufficient visual acuity to conduct the experimental process ; and ( 6 ) absence of \n other neurological diseases other than stroke . \n all the participants were informed of the \n purpose and procedures of the study , after which signed consent was obtained . \n this study was \n conducted in accordance with the interventional ethical guidelines and the declaration of \n helsinki . \n three clinical measurement tools were used , including activity card sorting \n ( acs ) , assessment of motor and processing skills ( amps ) , and a modified barthel index ( mbi ) . \n the acs \n assessment by occupational therapists was designed to help patients describe their \n occupational histories and their social , instrumental , and leisure activities . \n the tool is \n composed of 89 photographs depicting the performance of various activities , including 20 \n instrumental activities , 35 low physical - demand leisure activities , 17 high physical - demand \n leisure activities , and 17 social activities , and allows for the calculation of the \n percentage of activity retained . \n the amps is an observational assessment \n that allows for the simultaneous evaluation of motor and process skills , and their effect on \n the ability of an individual to perform complex or instrumental and personal activities of \n daily living . \n motor skills are the \n observable goal - directed actions people perform during adl in order to move themselves or \n the task objects . \n processing skills refer to the ability of an individual to logically \n sequence the actions related to the adl over time9 . \n the mbi is an easily administered 10-item tool for assessing \n self - care and mobility adl . \n it takes approximately 5 to 10 minutes to complete if the \n observational method is used . \n a higher number is associated with a greater likelihood of \n being able to live at home with a degree of independence after hospital discharge . \n this study used assumptions for regression analysis to investigate the relationship between \n instrumental adl , motor and process skills , and recreational activities . \n thirty - five participants with left hemiparetic stroke participated in this study ( 22 males , \n 13 females , aged 57.1 16.9 years ) . \n table \n 1table 1.demographic characteristics of the subjectscharacteristicright brain damage ( n=35)gendermale22female13age ( years)57.1 16.9etiologyhemorrhage18infarction17onset period ( months)40.7 27.5brunnstrom stage4.1 1.4mmse - k27.0 2.5data are presented as mean sd . \n the mbi scores revealed that participation in leisure and social \n activities was affected ( table 2table 2.results of the analysis of the influencing factors of the recovery of functions \n after a left hemiparetic stroke in community - dwelling patientsdependent variableindependent variablebstandard erroriadlmotor skill1.6591.809process skill20.5940.308*mbi1.1488.678*leisuremotor skill9.6054.971process skill1.9785.077mbi0.4270.177*social participationmotor skill6.7427.220process skill11.4717.374mbi0.9330.257**p<0.05 ) . \n previous studies have reported that patients who have had a left hemiparetic stroke showed \n specific behavioral patterns due to motor and perception disabilities7 . \n these behavioral patterns include the inability to orient \n or respond to stimuli on the side contralateral to the brain lesion . \n this specific \n behavioral pattern is associated with a greater risk of falls , longer stay in rehabilitation \n facilities , and poorer functional recovery . \n for this reason , these patients do not \n participate in iadl , leisure , or social activities . therefore , stroke rehabilitation could \n influence their participation in iadl , leisure , and social activities . \n the results of this study show that participation in iadl was affected by a reduction in \n the processing skills of amps and that participation in leisure and social activities \n affected the independence of daily living as assessed using the mbi . \n in other words , \n participation in iadl correlates with perceptual and cognitive functions , and participation \n in leisure and social activities affects independence . \n a limitation of this study was that it did not evaluate the sensory or language functions \n associated with participation in iadl . \n therefore , future research that evaluates various \n functions in patients who have had a left hemiparetic stroke will clarify the results of \n this study . \n nevertheless , the results of this study have clinical implications for \n rehabilitation intervention because left hemiparetic stroke has been identified as a factor \n that affects processing skills and independent daily living .", "role": "user" }, { "content": "[ purpose ] the purpose of this study was to evaluate the relationships between daily \n activities , information processing , and motor skills in individuals with hemineglect after \n having a left hemiparetic stroke . \n [ subjects and methods ] the instrumental activities of \n daily living of 35 patients ( 22 male and 13 female ; age : 57.1 16.9 years ) with \n hemineglect after having a left hemiparetic stroke were assessed by using three clinical \n measurement tools , including activity card sorting , assessment of motor and process \n skills , and the modified barthel index . \n [ results ] the results of the regression analysis \n indicated that the patients processing skills in instrumental activities of daily living \n after having a left hemiparetic stroke were reduced . \n participation in leisure and social \n activities was also affected as assessed by using the modified barthel index . \n [ conclusion ] \n this study supports the clinical need for rehabilitation intervention after a left \n hemiparetic stroke to improve patients processing skills and independence in performing \n activities of daily living .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 37-year - old caucasian woman presented to the emergency department with a two - day history of fevers , conjunctival hyperemia , abdominal cramps , myalgias , vaginal discharge and diffuse erythroderma prominent on her upper thorax , inner thighs and perineum . \n ten days before her presentation , she began using the divacup ( diva international inc , usa ) , a brand of menstrual cup for menstrual blood collection ( figure 1 ) . \n she used appropriate hygiene when handling and changing the cup , but retrospectively reported causing a small abrasion during one of her initial insertions . \n her subsequent menses became heavier and longer than normal . by day 7 , she noticed an episode of black vaginal discharge followed two days later by yellow purulent discharge along with subjective fevers , at which point she stopped using the menstrual cup . \n she presented to the emergency department the following day , after continuing to feel unwell . on initial examination , she looked unwell and had an oral temperature of 37.2c , blood pressure of 98/65 mmhg and a heart rate of 132 beats / min . \n no other obvious source of sepsis was found during physical examination . despite receiving aggressive intravenous fluid resuscitation and antibiotic therapy , including linezolid and piperacillintazobactam \n , she remained hypotensive for the next 24 h. vaginal examination revealed yellow discharge and mild menstrual bleeding , but no cervical motion tenderness . \n the menstrual cup was not present because it had been removed before presenting to hospital . \n her blood and urine cultures , methicillin - resistant staphylococcus aureus screening , clostridium difficile toxin assay and nasopharyngeal swab for respiratory viruses were negative ( table 1 ) . during the next 24 h , \n the patient clinically deteriorated ; she had a temperature of 39.1c , a blood pressure of 76/45 mmhg and a heart rate of 137 beats / min . \n she continued to receive aggressive intravenous fluids and was transferred to a high - acuity observational unit . \n subsequently , intravenous clindamycin was added to her antibiotic regimen with probable diagnosis of menstrual toxic shock syndrome ( tss ) . within 24 h of receiving clindamycin , \n the patient remained stable on her antibiotic regimen , ultimately being discharged in good health eight days postadmission . \n she remained stable for the next two weeks , at which point she was seen at the infectious diseases outpatient clinic at university hospital , london health sciences centre ( london , ontario ) . \n the term toxic shock syndrome was first coined in 1978 in a lancet publication describing the symptom complex in children eight to 17 years of age with an acute febrile illness ( 1 ) . \n it did not come to public attention until 1980 , when an association between tss and young menstruating women using tampons was discovered ( 2 ) . \n risk factors included the use of high - absorbency tampons and prolonged , continual usage ( 3 ) . \n cases occurring in men and nonmenstruating women were thereafter identified and it was recognized that tss can occur in any population . \n there has been a recently published report of recurrent tss in a 15-year - old girl even after she ceased to use tampons ( 4 ) . \n increased public awareness and change in the composition of tampons to less - absorbent materials led to a substantial decrease in the incidence of menstrual tss over the next decade ( 3 ) . \n menstrual tss is a severe , multisystem , toxin - mediated disease associated with multiorgan failure ( table 2 ) ( 5 ) . considering these criteria , the clinical findings of our patient and her laboratory data fulfill the criteria of a \n s aureus tss toxin 1 ( tsst-1 ) is responsible for multiorgan failure in nearly all ( 95% ) patients with menstrual tss . \n . this toxin acts as a superantigen , stimulating excessive and nonconventional t cell activation and , subsequently , cytokine expression ( 7 ) . \n superantigens bypass normal major histocompatibility complex - restricted antigen recognition and activate 30% of host t cells , while conventional antigen presentation activates only approximately 0.01% of the host t cell population ( 8) . eventually , significant cytokine release causes multiorgan failure . \n detection of tsst-1 is not required for the diagnosis of tss and this test is only available in some research laboratories . \n theoretically , clindamycin suppresses the protein synthesis and , as a result , more effectively inhibits toxin production compared with vancomycin , which inhibits cell wall synthesis . \n linezolid has also been successfully used to treat nonmenstrual tss and has been shown to decrease tsst-1 production ( 10 ) . to our knowledge , we report the first case of menstrual tss that was successfully treated with combination of linezolid and clindamycin . although rapid clinical improvement has been previously described with the use of linezolid in tsst-1-producing s aureus , our patient remained hypotensive while receiving linezolid ( 10 ) . \n although both clindamycin and linezolid inhibit bacterial protein synthesis and , therefore , toxin production , our patient remained hypotensive until clindamycin was included in her antibiotic regimen . \n further experimental and comparative studies are required to determine the inhibitory effects of these two medications against tsst-1 . \n menstrual cups are a reusable alternative to conventional tampons . designed to collect rather than absorb menstrual flow , \n they are made of silicone and worn internally ( figure 1 ) . in a recent multicentre randomized controlled trial by howard et al ( 11 ) , the use of tampons was compared with the divacup in a total of 110 women . \n the results demonstrated that overall satisfaction was higher among users of the divacup , with 91% of users stating they would continue using it . \n the present case report identified increased vaginal irritation with the divacup compared with tampons , but was not powered to detect a difference in infectious complications ( 11 ) . \n tierno ( 12 ) explained the probable reasons for the association between hyperabsorbable tampons and tss as follows : \n accumulation of blood in the polyester foam cubes and chips of carboxymethylcellulose.increase of vaginal ph in menstruation from 4.2 to around 7.4.existence of both oxygen and carbon dioxide in the vagina during menstruation . \n these three main factors provide a condition for s aureus growth . in a narrative review , vostral ( 13 ) , concluded that the gelled carboxymethylcellulose , in essence , acted like agar in a petri dish , providing a medium on which the bacteria may grow . \n menstrual cups are made of silicone or rubber , and carboxymethylcellulose is not used in their structure . \n however , because of accumulation of blood , menstrual cups appear to provide a medium for bacterial growth with the same three conditions mentioned above . \n menstrual blood in the uterine environment is sufficient to promote the growth of s aureus in the lower genital tract . as such \n , the menstrual cup appears to provide a necessary milieu for s aureus growth during menstruation . \n high placement of a previously handled cup , an abundant volume of menstrual blood and mucosal irritation within the vagina may be considered as other probable contributing factors . to our knowledge , the present report is the first to detail the association between a menstrual cup and menstrual tss . \n we present here a rare case in a 37-year - old woman who met all six centers for disease control and prevention ( georgia , usa ) criteria ( 5 ) for confirmed tss after wearing a menstrual cup for the first time . \n the term toxic shock syndrome was first coined in 1978 in a lancet publication describing the symptom complex in children eight to 17 years of age with an acute febrile illness ( 1 ) . \n it did not come to public attention until 1980 , when an association between tss and young menstruating women using tampons was discovered ( 2 ) . \n risk factors included the use of high - absorbency tampons and prolonged , continual usage ( 3 ) . \n cases occurring in men and nonmenstruating women were thereafter identified and it was recognized that tss can occur in any population . \n there has been a recently published report of recurrent tss in a 15-year - old girl even after she ceased to use tampons ( 4 ) . \n increased public awareness and change in the composition of tampons to less - absorbent materials led to a substantial decrease in the incidence of menstrual tss over the next decade ( 3 ) . \n menstrual tss is a severe , multisystem , toxin - mediated disease associated with multiorgan failure ( table 2 ) ( 5 ) . considering these criteria , the clinical findings of our patient and her laboratory data fulfill the criteria of a \n s aureus tss toxin 1 ( tsst-1 ) is responsible for multiorgan failure in nearly all ( 95% ) patients with menstrual tss . \n . this toxin acts as a superantigen , stimulating excessive and nonconventional t cell activation and , subsequently , cytokine expression ( 7 ) . \n superantigens bypass normal major histocompatibility complex - restricted antigen recognition and activate 30% of host t cells , while conventional antigen presentation activates only approximately 0.01% of the host t cell population ( 8) . eventually , significant cytokine release causes multiorgan failure . \n detection of tsst-1 is not required for the diagnosis of tss and this test is only available in some research laboratories . \n theoretically , clindamycin suppresses the protein synthesis and , as a result , more effectively inhibits toxin production compared with vancomycin , which inhibits cell wall synthesis . \n linezolid has also been successfully used to treat nonmenstrual tss and has been shown to decrease tsst-1 production ( 10 ) . to our knowledge , we report the first case of menstrual tss that was successfully treated with combination of linezolid and clindamycin . although rapid clinical improvement has been previously described with the use of linezolid in tsst-1-producing s aureus , our patient remained hypotensive while receiving linezolid ( 10 ) . \n although both clindamycin and linezolid inhibit bacterial protein synthesis and , therefore , toxin production , our patient remained hypotensive until clindamycin was included in her antibiotic regimen . \n further experimental and comparative studies are required to determine the inhibitory effects of these two medications against tsst-1 . \n menstrual cups are a reusable alternative to conventional tampons . designed to collect rather than absorb menstrual flow , \n they are made of silicone and worn internally ( figure 1 ) . in a recent multicentre \n randomized controlled trial by howard et al ( 11 ) , the use of tampons was compared with the divacup in a total of 110 women . \n the results demonstrated that overall satisfaction was higher among users of the divacup , with 91% of users stating they would continue using it . \n the present case report identified increased vaginal irritation with the divacup compared with tampons , but was not powered to detect a difference in infectious complications ( 11 ) . \n tierno ( 12 ) explained the probable reasons for the association between hyperabsorbable tampons and tss as follows : \n accumulation of blood in the polyester foam cubes and chips of carboxymethylcellulose.increase of vaginal ph in menstruation from 4.2 to around 7.4.existence of both oxygen and carbon dioxide in the vagina during menstruation . \n these three main factors provide a condition for s aureus growth . in a narrative review , \n vostral ( 13 ) , concluded that the gelled carboxymethylcellulose , in essence , acted like agar in a petri dish , providing a medium on which the bacteria may grow . \n menstrual cups are made of silicone or rubber , and carboxymethylcellulose is not used in their structure . \n silicone itself does not support microbiological growth . however , because of accumulation of blood , menstrual cups appear to provide a medium for bacterial growth with the same three conditions mentioned above . \n menstrual blood in the uterine environment is sufficient to promote the growth of s aureus in the lower genital tract . \n as such , the menstrual cup appears to provide a necessary milieu for s aureus growth during menstruation . \n high placement of a previously handled cup , an abundant volume of menstrual blood and mucosal irritation within the vagina may be considered as other probable contributing factors . to our knowledge , \n the present report is the first to detail the association between a menstrual cup and menstrual tss . \n we present here a rare case in a 37-year - old woman who met all six centers for disease control and prevention ( georgia , usa ) criteria ( 5 ) for confirmed tss after wearing a menstrual cup for the first time .", "role": "user" }, { "content": "toxic shock syndrome ( tss ) is caused by toxic bacteria and has been associated with prolonged , continual use of high - absorbency tampons . \n this article documents the first case of tss associated with the use of a menstrual cup in a 37-year - old woman . \n the authors also discuss the history of tss associated with tampon use and the mechanisms by which menstrual cups may also lead to the syndrome .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: translation from the genetic information contained in mrna to the amino acid sequence of a protein is performed on the ribosome , a large ribonucleoprotein complex composed of three rna molecules and over 50 proteins . \n the ribosome is a molecular machine that catalyzes the synthesis of a polypeptide from its substrate , aminoacyl - trna . \n ribosomes that translate a problematic mrna , such as that lacking a stop codon , can stall at its 3 end and produce an incomplete , potentially deleterious protein . \n trans - translation is known as the highly sophisticated system in bacteria to recycle ribosomes stalled on defective mrnas and add a short tag - peptide to the c - terminus of the nascent polypeptide as the degradation signal [ 14 ] ( figure 1 ) . \n thus , the tagged polypeptide from truncated mrna is preferentially degraded by cellular proteases including clpxp , clpap , lon , ftsh , and tsp [ 1 , 57 ] , and truncated mrna is released from the stalled ribosomes to be degraded by rnases . \n the process of trans - translation is facilitated by transfer - messenger rna ( tmrna , also known as 10sa rna or ssra rna ) , which is a unique hybrid molecule that functions as both trna and mrna ( figure 2 ) . \n it comprises two functional domains , the trna domain partially mimicking trna and the mrna domain , which includes the coding region for the tag - peptide , surrounded by four pseudoknot structures [ 1014 ] . \n as predicted from the trna - like secondary structure , the 3 end of tmrna is aminoacylated by alanyl - trna synthetase ( alars ) like that of canonical trna [ 15 , 16 ] . \n the function as trna is a prerequisite for the function as mrna , indicating the importance of the elaborate interplay of the two functions . \n trans - translation has been proposed : ala - tmrna somehow enters the stalled ribosome , allowing translation to resume by switching the original mrna to the tag - encoding region on tmrna . \n how does tmrna enter the stalled ribosome in the absence of a codon - anticodon interaction ? \n how does tmrna , 4- or 5-fold larger than trna , work in the narrow space in the ribosome ? \n several factors , including ef - tu [ 1720 ] , smpb [ 2123 ] , and ribosomal protein s1 [ 2224 ] , have been identified as tmrna - binding proteins . \n ef - tu delivers ala - tmrna to the ribosome like aminoacyl - trna in translation . unlike s1 [ 2527 ] \n , smpb serves as an essential factor for trans - translation in vivo and in vitro . \n it binds to the trna - like domain ( tld ) of tmrna [ 23 , 2830 ] and ribosome to perform multiple functions during trans - translation , including enhancement of aminoacylation efficiency of tmrna [ 22 , 23 , 31 ] , protection of tmrna from degradation in the cell [ 19 , 28 ] , and recruitment of tmrna to the stalled ribosome [ 21 , 23 ] . \n nmr studies have revealed that smpb consists of an antiparallel -barrel core with three helices and flexible c - terminal tail residues that are disordered in solution [ 32 , 33 ] . here , we review recent progress in our understanding of the molecular mechanism of trans - translation facilitated by tmrna and smpb , which is being revealed by various chemical approaches such as directed hydroxyl radical probing and chemical modification as well as other biochemical and structural studies . \n a cell - free trans - translation system coupled with poly ( u)-dependent polyphenylalanine synthesis was developed using escherichia coli crude cell extracts . later , several trans - translation systems were developed using purified factors from e. coli [ 31 , 34 , 35 ] or from thermus thermophilus . \n these systems have revealed that ef - tu and smpb , in addition to the stalled ribosome and ala - tmrna , are essential and sufficient for the first few steps of trans - translation including the binding of ala - tmrna to the ribosome , peptidyl transfer from peptidyl - trna to ala - tmrna , and decoding of the first codon on tmrna for the tag peptide . besides \n , these systems have also provided a basis for investigating the molecular mechanism of trans - translation by chemical approaches . \n ivanova et al . performed chemical probing to analyze the interaction between smpb and a ribosome . \n bases of rrna are protected from chemical modification with dimethylsulfate or kethoxal by smpb , indicating that there are two smpb - binding sites on the ribosome ; one is around the p - site of the small ribosomal subunit and the other is under the l7/l12 stalk of the large ribosomal subunit . \n the capacity of two smpb molecules to bind to a ribosome is in agreement with results of other biochemical studies [ 37 , 38 ] . \n . showed a crystal structure of aquifex aeolicus smpb in complex with the tmrna fragment corresponding to tld , which confirmed results of earlier biochemical studies showing that tld is the crucial binding region of smpb . \n it also suggested that smpb orients toward the decoding center of the small ribosomal subunit and that smpb structurally mimics the anticodon arm . \n this is in agreement with a cryo - em map of the accommodated state complex of ribosome / ala - tmrna / smpb [ 3941 ] . \n a truncation of the unstructured c - terminal tail of smpb leads to a loss of trans - translation activity [ 42 , 43 ] . in spite of its functional significance \n , cryo - em studies have failed to identify the location of the c - terminal tail of smpb in the ribosome due to poor resolution . \n we performed directed hydroxyl radical probing with fe(ii)-babe to study the sites and modes of binding of e. coli smpb to the ribosome ( figure 3 ) . \n fe(ii)-babe is a specific modifier of the cysteine residue of a protein , which generates hydroxyl radicals to cleave the rna chain . \n cleavage sites on rna can be detected by primer extension , allowing mapping of amino acid residues of a binding protein on an rna - based macromolecule . \n this is an excellent chemical approach to study the interaction of a protein with the ribosome [ 4447 ] . \n we prepared smpb variants each having a single cysteine residue for attaching it to an fe(ii)-babe probe . using directed hydroxyl radical probing , we succeeded in identifying the location of not only the structural domain but also the c - terminal tail of smpb on the ribosome . \n it was revealed that there are two smpb - binding sites in a ribosome , which correspond to the lower halves of the a - site and p - site and that the c - terminal tail of a - site smpb is aligned along the mrna path towards the downstream tunnel , while that of p - site smpb is located almost exclusively around the region of the codon - anticodon interaction in the p - site . \n this suggests that the c - terminal tail of smpb mimics mrna in the a - site and p - site and that these binding sites reflect the pre- and posttranslocation steps of trans - translation . \n the probing signals appear at interval 3 , residues of the latter half of the c - terminal tail , suggesting an helix structure , which has been predicted from the periodical occurrence of positively charged residues . \n the main body of smpb mimics the lower half of trna , and the c - terminal tail of smpb mimics mrna both before and after translocation , while the upper half of trna is mimicked by tld . upon entrance of tmrna into the stalled ribosome \n , the c - terminal tail of smpb may recognize the vacant a - site free of mrna to trigger trans translation . \n after peptidyl transfer to ala - tmrna occurring essentially in the same manner as that in canonical translation , translocation of peptidyl - ala - tmrna / smpb from the a - site to the p - site may occur . during this event , \n the extended c - terminal tail folds around the region of the codon - anticodon interaction in the p - site , which drives out mrna from the p - site . \n ala - tmrna / smpb forms a complex with ef - tu and gtp in vitro , and this quaternary complex is likely to enter the empty a - site of the stalled ribosome . \n this complex forms an initial binding complex with the stalled ribosome like the ternary complex of aminoacyl - trna , ef - tu , and gtp does with the translating ribosome . in normal translation , \n the correct codon - anticodon interaction is recognized by universally conserved 16s rrna bases , g530 , a1492 and a1493 , which form the decoding center . \n when a cognate trna binds to the a - site , a1492 , and a1493 flip out from the interior of helix 44 of 16s rrna , and g530 rotates from a syn to an anticonformation to monitor the geometry of the correct codon - anticodon duplex . \n this induces gtp hydrolysis by ef - tu , allowing the cca terminal of trna to be accommodated into the peptidyl transferase center . in the context of trna mimicry , \n we have recently shown that interaction of the c - terminal tail of smpb with the mrna path in the ribosome occurs after hydrolysis of gtp by ef - tu . according to a chemical probing and nmr study , smpb interacts with g530 , a1492 , and a1493 . \n how these bases recognize smpb to trigger the following gtp hydrolysis is yet to be studied . \n it should be noted that recent crystal structures have revealed that these bases recognize the a - site ligands ( aminoacyl - trnas , if-1 , rf-1 , rf-2 and rele ) in different ways during translation [ 50 , 55 , 56 ] . \n cryo - em reconstructions of the preaccommodated state of the ribosome / ala - tmrna / smpb / ef - tu / gdp/ kirromycin complex of t. thermophilus have shown that two smpb molecules present in a complex , one binding to the 50s ribosomal subunit at the gtpase - associated center and the other binding to the 30s subunit near the decoding center [ 39 , 41 ] . \n the latter smpb is not found in the accommodation complex of t. thermophilus and e. coli [ 3941 ] . \n thus , the following model has been proposed : two molecules of smpb are required for binding of ala - tmrna to the stalled ribosome and one of them is released from the ribosome concomitant with the release of ef - tu after hydrolysis of gtp , so that the 3-terminal of tmrna is oriented toward the peptidyl - transferase center . \n however , several reports have argued against the requirement of two smpb molecules for trans - translation : smpb has been reported to interact with tmrna in a 1 : 1 stoichiometry in the cell [ 57 , 58 ] , and crystal structures of smpb in complex with tld have been reported to exhibit a 1 : 1 stoichiometry of tmrna and smpb [ 29 , 59 ] . \n further studies are required to assess the stoichiometry of smpb in the preaccommodation state complex . \n we have recently shown that the c - terminal tail of smpb is required for the accommodation of ala - tmrna / smpb into the a - site rather than the initial binding of ala - tmrna / smpb / ef - tu / gtp to the stalled ribosome . \n we have also shown that the tryptophan residue at 147 in the middle of the c - terminal tail of e. coli smpb has a crucial role in the step of accommodation . \n our results further suggest that the aromatic side chain of trp147 is required for interaction with rrna upon accommodation . \n it has been shown that trans - translation can occur in the middle of an mrna in vitro , although the efficiency of trans - translation is dramatically reduced with increase in the length of the 3 extension from the decoding center [ 34 , 35 ] . \n this may be a result of competition of the 3 extension of mrna and the c - terminal of a - site smpb for the mrna path . \n the ribosome stalled on the middle of intact mrna in a cell might be rescued by trans - translation via cleavage of mrna at the a - site or by alternative ribosome rescue systems [ 6163 ] . \n how does the stalled ribosome select the first codon on tmrna without an sd - like sequence ? \n it is reasonable to assume that some structural element on tmrna is responsible for positioning the resume codon in the decoding center just after translocation of peptidyl - ala - tmrna / smpb from the a - site to the p - site . in e. coli , \n the coding region for the tag peptide starts from position 90 of tmrna , which is 12 nucleotides downstream of pk1 . indeed , pk1 is important for efficiency of trans - translation , whereas changing the span between pk1 and the resume codon does not affect determination of the initiation point of tag - translation . \n a genetic selection experiment has revealed strong base preference in the single - stranded region between pk1 and the resume codon , especially 4 and + 1 ( position 90 ) . \n several point mutations in this region encompassing 6 to 1 decrease the efficiency of tag - translation , while some of them shift the tag - initiation point by 1 or + 1 to a considerable extent [ 59 , 60 ] , indicating that the upstream sequence contains not only the enhancer of trans - translation but also the determinant for the tag - initiation point . \n evidence for interaction between the upstream region and smpb has been provided by a study using chemical probing . \n e. coli smpb protects u at position 5 from chemical modification with cmct . the structural domain of smpb rather than the c - terminal tail \n the protection at 5 was suppressed by a point mutation in the tld critical to smpb binding , suggesting that smpb serves to bridge two separate domains of tmrna to determine the resume codon for tag - translation . \n mutations that cause 1 and + 1 shifts of the start point of tag - translation also shift the site of protection at 5 from chemical modification by 1 and + 1 , respectively , indicating the significance of the fixed span between the site of interaction on tmrna with smpb and the resume point of translation : translation for the tag - peptide starts from the position 5 nucleotides downstream of the site of interaction with smpb . \n such a functional interaction of the upstream region in tmrna with smpb is also supported by the results of another genetic study showing that a - to - c mutation at position 86 of e. coli tmrna that inactivates trans - translation both in vitro and in vivo is suppressed by some double or triple mutations in smpb . in agreement with these studies , \n recent cryo - em studies have suggested that the upstream region in tmrna interacts with smpb in the resume ( posttranslocation ) state [ 68 , 69 ] . \n the initiation shift of tag - translation can also be induced by the addition of a 4,5- or 4,6-disubstituted class of aminoglycoside such as paromomycin or neomycin [ 70 , 71 ] , which usually causes miscoding of translation by binding to the decoding center on helix 44 of the small subunit to induce a conformational change in its surroundings . \n aminoglycosides also bind at helix 69 of the large subunit , which forms the b2a bridge with helix 44 in close proximity of the decoding center in the small subunit , to inhibit translocation and ribosome recycling by restricting the helical dynamics of helix 69 . taken together \n , these findings suggest the significance of interaction of the proximity of the decoding center with any portion of smpb or tmrna for precise tag - translation . \n it should be noted that hygromycin b , which binds only to helix 44 , does not induce initiation shift of tag - translation . \n along with the functional mimicry of tld / smpb , a similar behavior of tmrna / smpb to that of canonical trna+mrna in the ribosome through several hybrid states , a / t , a / a , a / p , p / p , and p / e , has been assumed . \n cryo - em studies have shown the location of the complex of tmrna with the main body of smpb in the a / t and a / a states [ 39 , 40 ] , and a directed hydroxyl radical probing has revealed the positions of smpb in the a / a and p / p states . \n the existence of stable smpb binding sites in the a - site and p - site suggests the requirement of translocation , as in canonical translation \n concomitantly with translocation , mrna and p - site trna are released from the stalled ribosome . \n considering the different c - terminal tail structures of a - site smpb and p - site smpb , the c - terminal tail would somehow undergo conformational change from the extended form to the folded form . \n the next translocation is thought to move tmrna / smpb to the e - site . \n these ribosomal processes should involve extensive changes in the conformation of tmrna as well as in the modes of interactions of tmrna with smpb and the ribosome [ 76 , 77 ] . according to chemical probing studies , secondary structure elements of tmrna remain intact in a few steps of trans - translation including pre- and posttranslocation states [ 7779 ] . \n another study has suggested 1 : 1 stoichiometry of tmrna to smpb throughout the processes of translation for the tag peptide . \n recently , the movement of trna during translocation has been revealed by using time - resolved cryo - em . \n not only classic and hybrid states but also various novel intermediate states of trnas were revealed . \n although the intermediate states during trans - translation remain unclear , results of future structural studies including chemical approaches should reveal tmrna / smpb and ribosome dynamics . \n various chemical approaches in addition to cryo - em and x - ray crystallographic studies have been revealing the molecular mechanism of trans - translation . \n tmrna forms a ribonucleoprotein complex with smpb , which plays an essential role in trans - translation . based on a directed hydroxyl radical probing towards smpb , \n we have proposed a novel molecular mechanism of trans - translation ( figure 4 ) . in this model , \n an elegant collaboration of a hybrid rna molecule of trna and mrna and a protein mimicking a set of trna and mrna facilitates trans - translation . \n initially , a quaternary complex of ala - tmrna , smpb , ef - tu , and gtp may enter the vacant a - site of the stalled ribosome to trigger trans - translation , when a set of ala - tld of tmrna and the main body of smpb mimicking the upper and lower halves of aminoacyl - trna , respectively , recognizes the a - site free of trna . \n after hydrolysis of gtp by ef - tu , the c - terminal tail of smpb mimicking mrna interacts with the decoding center and the downstream mrna path free of mrna , allowing ala - tld / smpb to be accommodated . \n while several proteins including smpb have been proposed to mimic trna or its portion , smpb is the first protein that has been shown to mimic mrna . \n smpb is also the first protein of which stepwise movements in the ribosome are assumed to mimic those of trna in the translating ribosome . \n our model depicts an outline of the trans - translation processes in the ribosome , although the following issues should be addressed . \n how do the intermolecular interactions between tmrna and ribosome , between tmrna and smpb , and between ribosome and smpb as well as the intramolecular interactions within tmrna and within smpb change during the course of the trans - translation processes ? \n is ef - g required for translocation of tmrna / smpb having neither an anticodon nor the corresponding codon from the a - site to the p - site ?", "role": "user" }, { "content": "since accurate translation from mrna to protein is critical to survival , cells have developed translational quality control systems . \n bacterial ribosomes stalled on truncated mrna are rescued by a system involving tmrna and smpb referred to as trans - translation . here , \n we review current understanding of the mechanism of trans - translation . \n based on results obtained by using directed hydroxyl radical probing , we propose a new type of molecular mimicry during trans - translation . \n besides such chemical approaches , biochemical and cryo - em studies have revealed the structural and functional aspects of multiple stages of trans - translation . \n these intensive works provide a basis for studying the dynamics of tmrna / smpb in the ribosome .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: timely and effective management of acute pain has been one of the biggest challenges of modern medicine . about two - thirds of patients admitted to hospitals still suffer from uncontrolled pain despite extensive research and education vis - - vis pain management . \n quality assurance efforts in pain management consist of methods to establish pain management protocols , to monitor their application , and to assess the benefits they provide to the patients . the quality of pain management that results from these efforts can be evaluated by assessment of various pain management outcomes , patients satisfaction being one of them . \n health - care facilities routinely use patient satisfaction evaluations to identify methods of practice improvement and better care provision . \n patient satisfaction with post - operative pain management depends on a number of variables including patients expectations , intensity of pain experienced , promptness of acute pain service response , effectiveness of treatment and health - care professionals attitude . \n the american pain society in quality assurance standards for relief of acute and cancer - related pain [ table 1 ] specifies that patient satisfaction with pain management must be surveyed in clinical practice . \n institute is a tertiary care hospital that caters to multiple emergency situations including bomb blasts , mass causalities and road traffic accidents and is hence faced with a huge burden of trauma and injury . \n it also provides care to a range of complicated tertiary care surgical patients brought in from all parts of the country besides elective surgical patients . \n it is an anaesthesia consultant - led service where everyday care is provided by dedicated pain nurses and anaesthesia residents with the help of ward nurses . \n the current audit was conducted to monitor the quality of care provided by acute pain management service ( apms ) , to develop a reliable tool for assessing patient satisfaction with apms , and to identify different variables affecting patient satisfaction with an aim to improve the overall quality of service . \n data were collected over a 3-month period on 102 consecutive , adult patients , who were provided care by apms and consented to participate . a questionnaire was designed and administered to each patient on the day of discharge , before going home . \n the questionnaire was delivered , explained to the patient and filled out by an independent , unbiased person who had no link with apms . \n this was achieved by assigning this task to a medical student visiting from another medical school , and not known to the apms team or patients , except for one of the authors who briefed her about the questionnaire . \n the questionnaire consisted of two parts : part i comprised patient 's demographics including age , gender , surgical speciality , surgical procedure , post - operative analgesic modality and co - analgesics used . \n six of these questions had options to respond on a 5-point likert scale arranged from highest to lowest . \n no options while at the end , patients were encouraged to give their comments / opinions in an open - ended manner . \n all statistical analyses were performed using statistical packages for social science version 19 ( spss inc . , \n chicago , il , usa ) . mean and standard deviation were computed for age , and \n a total of 132 patients were managed by apms during the 3 months of the survey , of which 102 agreed to participate . \n the analgesic modalities used and the surgical specialties are provided in table 3 . for co - analgesia , patients received paracetamol , a combination of paracetamol with tramadol or ketorolac . \n diclofenac suppository and paracetamol were administered as co - analgesics to patients undergoing gynaecological operations . \n the expectation of experiencing severe pain was higher than the pain actually experienced , as shown in figure 1 . \n analgesic modality and surgical speciality of the patients ( n=102 ) comparing pain expected by patients and pain actually experienced in post - operative period ( n = 102 ) of the patients followed up by apms during the study period , 56.9% received interventions within h of the call given for inadequate pain relief or management of side effects , 13.7% were managed within 1 h , 2% within 12 h and 1% after 2 h of the call , while 26.4% did not require any intervention by apms and were free of pain and side effects . after interventions by apms , excellent to very good pain relief was reported by 72% of the patients , moderate pain relief by 25.3% , while 2.7% reported poor pain relief . \n attentiveness and sensitivity of apms staff were considered very good to excellent by 91% of patients , fair by 8% , while 1% considered the service as poor . \n about 79.4% planned to use the same modality in future and 81.4% intended to recommend it to their friends / family . \n the overall experience with apms was considered good to excellent by 97% of the patients [ figure 2 ] . \n response of patients regarding acute pain management service staff and management progress ( n = 102 ) patients comments regarding their pain management ( n=12 ) \n the results of this study show that multimodal analgesia was used in all patients included in the survey which is part of current recommendations for best analgesic practice . \n there is a scarcity of strong opioid analgesics in our country and even in centres where morphine and fentanyl are available , their supply is limited and erratic . in resource - limited set - ups , careful selection of the available drugs and techniques \n it has rightly been said that the solution to the problem of inadequacy of post - operative pain management does not actually lie in the acquisition of expensive medication or development and use of new techniques , but rather in the optimal utilisation of already available drugs , techniques and facilities . \n thus , a combination of regional technique and multimodal analgesia , which most of our patients received , was the best available option for providing effective pain relief in the post - operative period . \n define assessment of quality care as determining whether individuals can access the healthcare structures and processes of care which they need , and whether the care received is effective. one method of evaluating users perception of a service is to assess their satisfaction with the care they receive . \n the american pain society in quality assurance standards for relief of acute and cancer - related pain specifies that patient satisfaction with pain management must be surveyed in clinical practice . \n assessment of patient satisfaction is of particular importance if the aim is to improve service to achieve better outcomes and improved quality of life . \n furthermore , a satisfied patient is said to be more likely to comply with the prescribed treatment and hence has a better chance of earlier recovery . \n it is easy to assume that effective pain relief would correlate highly with patients satisfaction with their pain management . \n however , earlier research has shown that patients may be highly satisfied with their pain management even when they have reported considerable levels of pain during their hospital stay . \n this imposes difficulty in interpreting the results of patient satisfaction surveys on pain management , and explanation needs to be sought for the high satisfaction scores even with inadequate pain relief . in our survey , even though pain management interventions by apms were required in a significant number of patients and 28% of the patients had moderate to poor pain relief despite the interventions , 97% of the patients reported their overall experience regarding pain management as good to excellent . \n the response time of apms staff and their attitude and attentiveness might have played a role in defining the level of patient satisfaction since more than 70% of our patients received pain management interventions within 1 h of the call given to apms . furthermore , 91% of our patients reported attentiveness and sensitivity of the apms staff as very good to excellent . \n thus , one of the reasons for the high rate of patient satisfaction in our study could be a professional and courteous attitude of apms . \n lin has provided a similar explanation for high satisfaction scores even with high pain levels in his patients and states that caring attitude of the staff may be one of the reasons for high overall satisfaction levels in patients suffering with pain . \n our results show that patients expectation of experiencing severe pain was higher than the pain actually experienced by them . \n it has been claimed that patient 's expectations have a strong effect on degree of patient 's satisfaction about an experience . \n squires states that the ratio between expectations and perception of an experience results in the level of satisfaction for the person making the judgement . \n the fact that majority of our patients ( 70.6% ) expected severe pain post - operatively , but not as many ( 44% ) suffered from it , could have been one of the reasons for majority being satisfied with the service . \n more than half of the patients included in the survey ( 54% ) were not aware that apms was a part of anaesthesia department . \n this identifies the need for the conduct of public awareness sessions regarding pain management by dedicated acute and chronic pain physicians and nurses . \n such sessions would make the patients aware that pain relief is their basic right ; pain - relieving medicines are accessible and who to turn to in case of unrelieved pain . in addition , apms staff needs to introduce the team members and the service provided by them to the patients and their families in adequate detail during apms rounds so that they can be traced back whenever patients need help . despite the high satisfaction scores in our study , we identified some shortcomings , which need to be addressed with the aim of formulating and implementing strategies for improvement . \n more than 4% patients waiting for over an hour to receive analgesia is one of the identified parameters requiring improvement . \n similarly , at least , four patients complained of severe pain on waking up from anaesthesia in the recovery room [ table 4 ] , which was not addressed in a timely manner . \n this highlights the need for apms team to make a process for timely provision of pain management in the recovery room and wards . \n one of the strengths was that it was conducted by an unbiased person , unrelated to the apms . \n that person had not participated in the care of the patients and patients plausibly expressed their honest opinion rather than feeling obliged to respond positively . \n in addition , it was a clinically relevant exercise as far as improving the quality of care was concerned . \n questions were developed with a view to identifying the areas requiring improvement in apms care . \n apms team re - strategized their care plan after the data analyses . that made the entire exercise clinically relevant and useful . \n once developed , this tool will be utilised at repeated intervals to audit the performance of apms . where limitations are concerned \n , high patient satisfaction may have been related to professional and caring attitude of apms personnel rather than superior pain relief measures . \n furthermore , there were no open - ended questions for in - depth assessment of patients experience . \n we largely succeeded in our objective strategy to monitor the quality of care provided by apms and to identify areas requiring improvement in a satisfaction survey of patients receiving care by apms by an unbiased person . \n based on the present survey , we aim to develop that as a tool to gauge quality care on a regular basis . \n \n ", "role": "user" }, { "content": "background and aims : assessment of patient satisfaction is an important tool for monitoring the quality of care in hospitals . \n the aim of this survey was to develop a reliable tool to assess patient satisfaction with acute pain management service ( apms ) and identify variables affecting this so that care can be improved.methods:a questionnaire was developed and administered to patients after being discharged from apms care by an unbiased person . \n data collected from record included patient demographics , surgical procedure , analgesic modality , co - analgesics and dynamic and static pain scores . questions included pain expected and pain experienced , apms response time , quality of pain relief with treatment , professionalism of apms team , overall experience of pain relief and choosing / suggesting same modality for themselves / family / friends again . \n five - point likert scale was used for most of the options . \n statistical analysis was done using spss 19.results:frequency and percentages were computed for qualitative observation and presented on pie chart and histogram . \n seventy - one per cent patients expected severe pain while 43% actually experienced it . \n about 79.4% would choose same analgesia modality in future for self / family / friends . \n ninety - nine per cent found apms staff courteous and professional . \n about 89% rated their experience of pain management as excellent to very good.conclusion:the survey of patients satisfaction to monitor the quality of care provided by apms provided positive inputs on its role . \n this also helps to identify areas requiring improvement in care and as a tool to gauge the quality of care .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: aging has become an emerging health problem and is considered the most challenging health issue worldwide . \n it has been reported that 90% of the older population in the us have been using at least one medication.1 the complex process of aging , which causes changes in physiological function , can affect the pharmacodynamics and pharmacokinetics of the medication taken by older populations.2 in addition , the use of multiple medications due to multiple comorbid conditions may also lead to the use of potentially inappropriate medications ( pims ) , which place medication users at higher risk for adverse drug reaction . \n pim has been defined as the use of medication with risk greater than benefit , inappropriate dosing duration , prescriptions that lead to clinically significant drug drug and drug disease interactions , and the under - use of potentially beneficial medications.3 pims among the older population have continued to be a significant problem worldwide.4,5 this scenario is particularly common among nursing home residents due to the high prevalence of frailty , multiple comorbidities , and functional limitations.6 pims have been reported to be common among the elderly with a prevalence of 40%50% among nursing home residents7,8 and 19%28% among community dwelling patients.7,9,10 in malaysia , the number of institutions for the elderly is increasing . \n there are few residential homes and long - term care facilities that are fully funded by the government . \n the majority of nursing homes are operated by private sector and nongovernmental organizations with some financial support from the government . \n there are no dedicated physicians and/or pharmacists working in the nursing homes to provide continuous medical care . \n also , routine medication review processes are not being conducted in nursing homes in malaysia as they are in other developed countries . \n the residents are sent to either government hospitals or primary health care clinics for medical treatment . \n health related quality of life ( hrqol ) is now considered as an essential outcome measure for assessing the effectiveness of medical intervention . \n a study , which was conducted using the database from the 1996 medical expenditure panel survey , has shown that pim is a predictor for and is associated with poor patient hrqol.11 recent studies have shown a significant improvement in hrqol among patients who are taking safer and more appropriate drugs.12,13 from the local perspective , there is only one study that has been recently published on pims use among older populations.14 the prevalence of pims use among nursing home residents was reported to be high at 32.7% using beers criteria.14 however , no data have been reported focusing on the changes of hrqol among older people prescribed with pims . \n hence , the current study aims to investigate the association between the use of pims and the changes observed in the hrqol among older nursing home residents . \n a prospective follow - up study was conducted at four nongovernmental nursing homes in penang , malaysia . \n i of the study , the baseline data from all the nursing homes were collected over a 2 month period from january 2011 through february 2011 . \n each recruited patient from phase i of the study was followed up after a 3 month period ( phase ii ) . \n all residents of 65 years of age or over with nursing home stay for at least 3 consecutive months and who were taking at least one prescribed medication for 7 days prior to the recruitment were included in the study . \n the exclusion criteria were residents with medical diagnoses of dementia ( or those taking antidementia drugs ) , those who refused to participate in the study , or those who were unable to participate in the study due to delirium or were unable to respond , communicate , and present with complete cognitive and functional disability . \n the demographic , clinical , and medications data of residents were collected using medical records review and interviews of residents where necessary . functional status for residents \n was assessed using katz activities of daily living.15 this scale reflects dependence in six primary functions , ie , bathing , dressing , toileting , continence , walking , and eating . the scores of this scale ranges from 0 ( independence ) to 6 ( high dependency ) . \n the cognitive function of the residents was screened using the mini - cog exam,16 which is a tool comprising three - item recall and the clock drawing test ( cdt ) with sensitivity ranging from 76%99% , and specificity ranging from 89%93% . \n patients who fail to recall all three items after the cdt distractor are classified as possibly demented . \n the residents who are able to recall one or two of the items are classified based on the cdt . \n an abnormal cdt equates with possibly demented and a normal cdt is considered normal and equates with non - demented . \n the mini - cog was developed as a screening tool to identify patients with possible dementia . \n the mini - cog tool was not used as an exclusion tool in this study . \n all residents who fulfill the inclusion criteria were assessed at baseline for hrqol using the euroqol tool , which comprised of euroqol-5 dimension ( eq-5d ) and euroqol - visual analog scale ( eq - vas).17 the first part is considered a descriptive system that is used to evaluate health function in 5 dimensions ( mobility , self - care , usual activities , pain / discomfort , and anxiety / depression ) . \n the results were classified based on the scoring system categorized as : no problem ( score 1 ) ; some problem ( score 2 ) ; and extreme problem ( score 3 ) . \n , the euroqol index is a single weighted health index , which was converted from 243 possible combinations of health states by applying the weights from the york tariffs.18 values of the euroqol index can range from 0.594 to 1 and a negative index score implies a quality of life worse than death . the second part is a self - administered eq - vas used to evaluate current and general health status . \n the residents were asked to assess their health status by drawing a line from a box that represents your health status today to a point on eq - vas that represents heath status . \n a score of 100 indicates the best health status , while a score of zero indicates the worst health status.17 permission was obtained from the euroqol group to use both the english and malay versions of the eq-5d . \n both versions have been validated for use among malaysian populations.19 pims use in this population was assessed using the screening tool of older person s potentially inappropriate prescriptions ( stopp ) criteria20,21 at baseline and after a period of 3 months . \n residents medications in the last 7 days prior to interview were assessed for the identification of pims . \n stopp is a tool used to identify pims and potential adverse drug reactions among older people . \n it consists of 65 clinically significant criteria for pim . for the convenient use of the criteria , \n inter - rater reliability of stopp criteria is good , with a kappa coefficient of 0.75.20 the comparison of the differences in the baseline variables between the pim and non - pim group was conducted using student s t - test for normally distributed data , pearson s chi - squared test was used for categorical data , and mann - whitney u - test was used for non - normally distributed data . \n unpaired t - test was used to measure the change in the quality of life ( [ qol ] qol = qols after 3 months minus baseline qols ) between the pim group and non - pim group , and to evaluate whether pims affected individual baseline of qols during the 3 month follow - up . \n in addition , chi - square test was used to compare the changes of pims at baseline and 3 months later . \n the data were analyzed using pasw ( predictive analytics software ) statistics 18.0 ( spss inc . , \n this study was approved by the local ethics committee ( medical research and ethics committee [ mrec ] , ministry of health , malaysia ) , and carried out in accordance with the declaration of helsinki . \n a prospective follow - up study was conducted at four nongovernmental nursing homes in penang , malaysia . \n i of the study , the baseline data from all the nursing homes were collected over a 2 month period from january 2011 through february 2011 . \n each recruited patient from phase i of the study was followed up after a 3 month period ( phase ii ) . \n all residents of 65 years of age or over with nursing home stay for at least 3 consecutive months and who were taking at least one prescribed medication for 7 days prior to the recruitment were included in the study . \n the exclusion criteria were residents with medical diagnoses of dementia ( or those taking antidementia drugs ) , those who refused to participate in the study , or those who were unable to participate in the study due to delirium or were unable to respond , communicate , and present with complete cognitive and functional disability . \n the demographic , clinical , and medications data of residents were collected using medical records review and interviews of residents where necessary . functional status for residents \n was assessed using katz activities of daily living.15 this scale reflects dependence in six primary functions , ie , bathing , dressing , toileting , continence , walking , and eating . the scores of this scale ranges from 0 ( independence ) to 6 ( high dependency ) . \n the cognitive function of the residents was screened using the mini - cog exam,16 which is a tool comprising three - item recall and the clock drawing test ( cdt ) with sensitivity ranging from 76%99% , and specificity ranging from 89%93% . \n patients who fail to recall all three items after the cdt distractor are classified as possibly demented . \n the residents who are able to recall one or two of the items are classified based on the cdt . \n an abnormal cdt equates with possibly demented and a normal cdt is considered normal and equates with non - demented . \n the mini - cog was developed as a screening tool to identify patients with possible dementia . \n the mini - cog tool was not used as an exclusion tool in this study . \n all residents who fulfill the inclusion criteria were assessed at baseline for hrqol using the euroqol tool , which comprised of euroqol-5 dimension ( eq-5d ) and euroqol - visual analog scale ( eq - vas).17 the first part is considered a descriptive system that is used to evaluate health function in 5 dimensions ( mobility , self - care , usual activities , pain / discomfort , and anxiety / depression ) . the results were classified based on the scoring system categorized as : no problem ( score 1 ) ; some problem ( score 2 ) ; and extreme problem ( score 3 ) . \n moreover , the euroqol index is a single weighted health index , which was converted from 243 possible combinations of health states by applying the weights from the york tariffs.18 values of the euroqol index can range from 0.594 to 1 and a negative index score implies a quality of life worse than death . \n the second part is a self - administered eq - vas used to evaluate current and general health status . \n the residents were asked to assess their health status by drawing a line from a box that represents your health status today to a point on eq - vas that represents heath status . \n a score of 100 indicates the best health status , while a score of zero indicates the worst health status.17 permission was obtained from the euroqol group to use both the english and malay versions of the eq-5d . \n pims use in this population was assessed using the screening tool of older person s potentially inappropriate prescriptions ( stopp ) criteria20,21 at baseline and after a period of 3 months . \n residents medications in the last 7 days prior to interview were assessed for the identification of pims . \n stopp is a tool used to identify pims and potential adverse drug reactions among older people . \n it consists of 65 clinically significant criteria for pim . for the convenient use of the criteria , \n inter - rater reliability of stopp criteria is good , with a kappa coefficient of 0.75.20 \n the comparison of the differences in the baseline variables between the pim and non - pim group was conducted using student s t - test for normally distributed data , pearson s chi - squared test was used for categorical data , and mann - whitney u - test was used for non - normally distributed data . \n unpaired t - test was used to measure the change in the quality of life ( [ qol ] qol = qols after 3 months minus baseline qols ) between the pim group and non - pim group , and to evaluate whether pims affected individual baseline of qols during the 3 month follow - up . \n in addition , chi - square test was used to compare the changes of pims at baseline and 3 months later . \n the data were analyzed using pasw ( predictive analytics software ) statistics 18.0 ( spss inc . , chicago , il , usa ) . \n this study was approved by the local ethics committee ( medical research and ethics committee [ mrec ] , ministry of health , malaysia ) , and carried out in accordance with the declaration of helsinki . \n of the total population ( n=460 ) residing in four nursing homes , 211 ( 45.7% ) residents were included in the study . \n the remaining 249 residents were excluded for the following reasons : residents not able to participate due to delirium or unable to respond to interview questions [ n=91 ] , < 65 years old ( n=11 ) , not taking any prescribed medications ( n=77 ) , less than 3 month stay in a nursing home ( n=2 ) , diagnosis of dementia ( n=32 ) , and those who refused to participate ( n=36 ) . during the follow up period ( phase ii ) , \n 12 residents were excluded from this study for reasons such as leaving home or on holiday ( n=5 ) , hospitalized due to fall and vascular ulcer ( n=2 ) , not able to participate ( n=2 ) , and death ( n=3 ) . \n the most common comorbidities among participants were hypertension ( 71.1% ) followed by diabetes mellitus ( 27.1% ) , stroke ( 12.3% ) , osteoarthritis ( 11.8% ) , and ischemic heart disease ( 7.1% ) . \n the median number of medications prescribed was four ( range of one to 14 ) from a total of 989 medications . \n the prevalence of pims identified by stopp criteria at baseline was 23.7% ; 64 pims affecting 50 residents . \n the most common pims detected were first generation antihistamine ( 23.4% ) , followed by prescriptions of duplicate drug class ( including two angiotensin receptor blockers , two first generation antihistamines , and alpha-2 blockers ) ( 15.6% ) , glibenclamide or chlorpropamide with type 2 diabetes mellitus ( 10.9% ) , and anticholinergic to treat extrapyramidal side effects of neuroleptic medications ( 9.4% ) . \n other less common medications were prolonged use ( > 1 week ) of first generation antihistamines ( 7.8% ) , benzodiazepines ( 4.7% ) , and neuroleptics ( 1.7% ) as shown in table 2 . reassessment of pims after 3 months showed that there was a decrease in the prevalence of pims to a prevalence of 18.6% , affecting 37 residents . \n the prevalence of residents who were still taking pims was 15.2% ( n=32 ) , while 7.1% ( 15 ) of the residents stopped taking pims . \n the number of prescribed medications in phase ii decreased from 989 at baseline to 911 . \n pearson s chi - squared test analysis was used to assess the association between pims with the 5 dimensions of eq-5d at baseline . \n results showed that there were no significant differences in all of the 5 dimensions among residents with and without stopp pims ( table 3 ) . \n table 4 shows that there were no significant differences in hrqol measured by eq-5d index ( p=0.135 ) and by eq - vas ( p=0.666 ) among residents with and without pims . \n the changes in hrqol among residents with pims were assessed by comparing differences in the mean score index of eq-5d and eq - vas between baseline and the 3 months follow - up period . \n no significant differences were seen in eq-5d score ( p=0.07 ) and eq - vas score ( p=0.34 ) among residents with stopp pims and without stopp pims ( table 5 ) . \n several published studies have in fact reported the relationship between hrqol and the use of pims.11,12,22,23 all of these studies were conducted in either hospitals or ambulatory care settings , but none of them focused on a nursing home setting in malaysia , in particular . \n this study shows that the rate of pims was lower ( 23.7% ) compared to other studies . \n a study that was conducted across different health care settings using stopp criteria in spain reported higher prevalence ; 36% in a public primary clinic , 54% a in hospital geriatric clinic , and 50% in assisted nursing homes.24 different prescribing practices tailored to local health care systems and the number of medications may explain the variations observed . \n the number of prescriptions has been identified as a significant predictor of inappropriate use of medications and hrqol.23,25 the population of this study was taking a median of four medications , which is slightly lower compared to the ones taken in the developed countries . \n for example , in an australian study , the average number of medications utilized by elderly residents was seven.26 hence , the low rate of medication use may contribute to the lower rate of pims observed . during the follow - up phase , lower prevalence of pims \n was observed in this study compared to baseline ( 18.6% versus 23.7% , respectively ) . \n this could be due to the decrease in the utilization of prescribed medications during the follow - up phase . \n first generation antihistamine was still identified as the most common prescribed pim although it was the most common stopped pim during the 3 month follow - up . \n pims due to glibenclamide prescriptions with type 2 diabetes mellitus remained the same in terms of numbers ( seven cases ) although the percentage was higher in phase ii than at baseline ( 17.1% versus 10.9% , respectively ) . \n the main result of this study showed no statistically significant association between pims and hrqol . \n pims showed no statistical significant differences based on any eq-5d descriptive system and eq - vas score at baseline and after 3 months . \n on average , the eq-5d and eq - vas score was above 0.60 and 70 , respectively . in a study conducted among older community dwellers , a higher eq-5d index ( 0.7 ) \n was reported compared to the current study , but a similar eq - vas score was reported.23 the discrepancy could be due to better health status of their study population , which consists of a general population of noninstitutionalized individuals compared to a nursing home population in the present study . however , the same eq - vas value can be due to individual perception of the current residents health status in this study , which was largely influenced by many factors including better self - acceptance of health conditions among nursing home residents . \n another study by olsson et al examined the association between medication qualities measured by the medication appropriateness index and hrqol measured by the eq-5d in a group of elderly people discharged from hospitals.12 their study population achieved a lower score compared to this study ; mean eq-5d \n < 0.5 and mean eq - vas < 60 . hospitalized patients would have slightly lower hrqol because they were admitted for acute medical conditions and may have loss of activities of daily living during the recuperation period . \n one study has shown that hospitalizations were associated with functional decline among elderly patients.27 consequently , these may have lowered the eq-5d measurement on hrqol . \n although the majority of the studies do not show any significant difference or a relationship between pims and hrqol,22,23 one study , which employed one question on global self - rated health status , showed a significant decrease in self - perceived health status in the elderly.11 this result was mainly attributed to the tool used for the outcome measurement . \n although the method utilized may contribute for estimation bias , it was reported that the tool was widely used with proven predictive validity and substantial reliability in epidemiological research.11 one group of researchers suggested that the use of the disease - specific hrqol scale might provide more specific and receptive results for the measurement of the impact of pims towards patient s hrqol.23 such argument was on the basis that generic quality of life measures may not be sensitive to nonsevere illnesses . however , there are no data from the literature to support this statement . \n the use of eq-5d to assess hrqol is considered as a point of strength in this study . \n it is a standardized measure of health status developed by the euroqol group that is applicable to a wide range of health conditions and treatments with a simple descriptive profile and a single index value for health status . \n wolfs et al showed that the eq-5d is well suited for evaluating hrqol among population with cognitive impairment.28 in a recent study , eq-5d was found to be user friendly and a potential predictor of mortality and first hospitalization among the elderly.29 although regional variation in term valuations or weightings may contribute to different outcomes , it should not be considered as a major limitation . \n the author adopted the eq-5d index derived from the uk population due to unavailability of local term valuation . \n the application of the valuations among a malaysian population may differ due to dissimilar sociodemographic characteristics and cultural perceptions towards health status . \n the strength of this study lies in the high reliability for all assessments as they were conducted only by one researcher . \n all interviews were conducted in english , malay , or , when necessary , with the most appropriate dialect with an assigned interpreter . \n the researcher followed a script that was used to ensure consistency when assessing the residents . \n although the study was conducted using a robust method , there are several limitations that are worth mentioning here . \n first , small sample size may have contributed to the result observed in the hrqol . \n the current findings could not be generalized to the entire malaysian elderly population due to the special population group limited to nursing homes . \n although this study was a multicenter study , it focused on one state only in northern malaysia . \n second , the lower prevalence of pims identified could be due to under reporting due to older residents with the diagnosis of dementia being excluded in this study ; demented patients are reportedly more prone to be prescribed with pims.30 third , the researchers did not perform the under - treatment assessment among the nursing homes , which can affect the rate of pims and the consequent change in hrqol . \n finally , inclusion of four centers may lead to variation of the pims rate due to different prescribing patterns from different hospitals and clinicians . \n this study indicates that pims are relatively prevalent in the malaysian nursing homes as detected by stopp criteria . \n although there were no statistically significant changes observed in terms of the hrqol among the nursing home residents , the study does provide baseline information and challenges faced in terms of the quality use of medications . a larger study with a longer follow - up period should be conducted throughout malaysia to give more insight into this issue . aside from this \n , new policies should be implemented implicating the involvement of pharmacists to provide a routine comprehensive medication review in the nursing homes to improve medication use among the elderly .", "role": "user" }, { "content": "backgroundnursing home residents are mainly older people with multiple diseases and taking multiple medications . \n the quality use of medication and its association with health related quality of life ( hrqol ) have not been reported in malaysia . \n this study aims to investigate the association between the use of potentially inappropriate medications ( pims ) and the changes observed in the hrqol among older nursing home residents.methodsa prospective follow up study was conducted at four nongovernmental organization nursing homes in penang , malaysia . \n older residents ( 65 years old ) taking at least one prescribed medication were included . \n residents with pims were identified by using screening tool of older person s potentially inappropriate prescriptions ( stopp ) criteria . \n hrqol was assessed using euroqol-5 dimension ( eq-5d ) and euroqol - visual analog scale ( eq - vas ) at baseline and after a 3-month follow up . \n the association of pims with hrqol was analyzed using mann - whitney u test.resultsthe median age of the 211 participants was 77 years ( interquartile range 7282 years ) and the median number of prescription medicines was four ( interquartile range three to six ) . \n the prevalence of pims was 23.7% and 18.6% at baseline and 3 months later , respectively . \n the most commonly prescribed pims in decreasing order were first generation antihistamine , prescriptions of duplicate drug class , glibenclamide with type 2 diabetes mellitus , and anticholinergic to treat extrapyramidal side effects of neuroleptic medications . at baseline \n , there was no significant difference among residents with or without pims in each bracket of eq-5d , eq-5d index , or eq - vas scores . \n comparison of the differences in the mean score index of eq-5d between baseline and after 3 months also showed no statistically significant differences.conclusionpims were found to be relatively common among older nursing home residents . \n however , no significant changes were observed in hrqol among these residents . \n further studies with a bigger sample size and longer follow up period are required to establish this association .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the primary outputs of muscle function at the elbow and forearm include elbow flexion and \n extension , and forearm supination and pronation1 . \n the rotation of the forearm , as in pronation and supination , are \n important motions used in everyday life in performing tasks such as turning keys or door \n handles , bringing food to the mouth and performing personal hygiene activities2 . \n the forearm muscles involved in rotation \n include the supinator , biceps brachii , extensor carpi radialis , brachioradialis , extensor \n pollicis longus and abductor pollicis longus . \n in particular , the actions of the supinator \n and biceps brachii muscles produce the supination motion3 . \n maintaining the safety of the \n joints requires that they return to their proper position after movements , and that they \n maintain their integrity with minimal movement . \n the process of proprioception has a \n fundamental effect on the stability of the joints and in balance control5 , 6 . \n the \n proprioception process involves muscle spindles , golgi tendon organs , articular and \n cutaneous mechanoreceptors , and enables position sense , movement sense and force sense7 . in a position - matching task , position sense \n measures the target angle of the joint that is tested . \n ju et al.10 concluded that repeated passive exercise resulted in a \n significant improvement of joint position sense . \n however , lattanzio and petrella11 suggested that repetitive passive \n movements deleteriously affect of proprioception capabilities . \n hazneci et al.12 reported that \n isokinetic exercises positively affected passive position sense , the stabilization of joints \n and proprioceptive acuity . \n active exercises such as tai chi have been found \n to decrease position errors in subjects completing a position matching task13 , 14 . \n however , ju et al.8 found that repetitive active exercise had a negative impact on joint \n proprioception . \n other experimental studies have shown that active exercises negatively \n affect proprioception because exercise fatigue can disturb position sense15 , 16 . \n several studies have been performed on elbow and forearm proprioception , but most of these \n were conducted in order to evaluate flexion and extension15 , 17 , 18 . \n although forearm supination is very important for the proper \n functioning of the upper limbs , there have been few scientific studies on this topic , and \n studies of proprioception are rare . \n therefore , this study was conducted in order to \n investigate the effect of repetitive passive movement ( rpm ) and repetitive active movement \n ( ram ) on the proprioception capabilities involved in forearm supination . \n a total of 23 healthy right - hand dominant volunteers participated in this study ( table 1 ) . \n the inclusion criteria for the subjects \n were as follows : no upper extremity diseases , no sensory deficits , no limited range of \n motion ( rom ) of the upper extremities , no psychological or emotion problems . \n the study \n protocol was approved by the institutional review board of sahmyook university . for the repositioning test of supination position sense in the right forearm \n , we used a \n biodex ( biodex multi - joint system 2 , biodex corp , ny , usa ) which includes an \n electrogoniometer which is sensitive to 1 increments . \n the starting position of measurement was the elbow flexed at 90 , midway \n between pronation and supination . in this starting position , \n the biodex device display unit \n was set to 0. position sense is generally evaluated using repositioning tests such as active or passive \n angle reproduction19 . \n this study \n conducted both the measurement of passive angle repositioning ( par ) and active angle \n repositioning ( aar ) . in par , the subjects forearms were passively moved to the target angle \n by the machine , whereas in aar , the subjects actively moved their forearms to the target \n angle . par and \n aar assessments were executed using the method described by ju et al.10 for par , the forearm was rotated by the \n machine with the subject s forearm in a starting position between 0 and 80 relative to the \n target supination angle by random selection . \n the forearm was held at the target angle for 5 seconds , and then passively returned to the \n starting position with a rest period of 10 seconds . \n the subject then actively reproduced the \n selected target supination angle which had been passively positioned by the device . \n the \n subject pressed a handheld stop button when they felt they had reproduced the correct target \n supination angle . \n the set of repositioning tests was performed three times and the subject \n rested for 20 seconds between each test . in order to avoid any learning effect during the \n measurements , we chose different angle settings for each test . for aar \n , the subjects actively moved their forearms to the target supination angle , \n approximately 0~80 , by random selection . \n all \n subjects were measured at pre - test prior to intervention , and at post - test after the \n intervention . \n all measurements were repeated three times , with a one - minute break between \n measurements . \n all subjects randomly performed both rpm and ram exercises for two days . at random , \n one of \n the interventions was assigned on the first day with the remaining intervention performed on \n the second day in order to avoid a learning effect . \n the rpm exercise was performed with the biodex using the system s passive exercise module . \n the device was set to move in a passive supination - pronation mode within a 0 to 80 range \n with a repetition of 60 times . \n the ram exercise was carried out using the biodex system s isokinetic exercise \n module with an angular velocity of 120/s . \n the subjects were instructed to perform the \n supination ( concentric ) and pronation ( eccentric ) exercises within a range of 0 to 80 for \n 60 repetitions . \n each exercise was performed in three sets , with a one - minute break after \n each set . \n the analysis used the paired t - test for differences in the position sense \n error score before and after the intervention . \n abbreviations : rpm , repetitive passive movement ; ram , repetitive active movement ; par , \n passive angle repositioning ; aar , active angle repositioning . \n * p<0.05 , * * p<0.01 : \n significant difference between baseline and after the intervention . \n abbreviations : rpm , repetitive passive movement ; ram , repetitive active movement ; par , \n passive angle repositioning ; aar , active angle repositioning . * \n the position sense error scores at pre- and post - test are shown in table 2 . in the rpm test \n there was a statistically significant \n decrease in the aar error score between pre- and post - test ( meansd : 6.532.89 vs. \n 4.752.13 ; p=0.008 ) , as well as in the par error score ( 7.653.51 vs. 5.843.20 ; \n p=0.039 ) . in the ram test , there was a statistically significant increase in the aar error \n score in between pre- and post - test ( 6.532.89 vs. 8.053.48 ; p=0.041 ) , as well as in the \n par error score ( 7.653.51 vs. 9.633.48 ; p=0.041 ) . the comparison of the error scores of the position sense in both the rpm and ram tests \n after the movement intervention are shown in table \n 3 . there was a statistically significant difference in the aar error scores in rpm , \n 1.782.92 , versus ram , 1.523.35(p=0.001 ) , as well as in the par scores in rpm , \n 1.813.95 , versus ram , 1.984.38(p=0.002 ) . \n proprioception plays a role in detecting small changes in the movement of joint location \n through the sensory receptors in muscle spindles of the joints and muscles20 , 21 . \n proprioception enables neuromuscular control of dynamic restraints \n and segmental movements , and delivers position information to the motor control system6 , 22 . \n loss of proprioception capability leads to microtrauma , re - injury \n of previously damaged joints , deficits in postural control and joint instability24 , 25 . accordingly , \n fitzgerald26 reported \n that closed - chain exercise is more effective at facilitating proprioceptors than open - chain \n exercise , and therapeutic exercises such as sensorimotor training27 , proprioceptive feedback training28 and re - education exercise of proprioceptors29 have been reported to be effective at \n improving proprioceptor senses . in this study , we studied passive and active movements . \n friemert et al.19 \n evaluated the effects of a continuous active motion ( cam ) device on joint proprioception , \n and found a significant increase in joint position sense after the cam exercise . \n the goal of our study was to determine which exercise type , rpm or ram , was more effective \n for proprioception training . in the present study \n , the accuracy of proprioception was measured using a biodex , and there \n was a significant difference in both active repositioning and passive repositioning found in \n rpm , both before and after intervention ( p<0.05 ) . \n changing the pattern of rpm resulted in \n a decrease in the error score of position sense . \n friemert et al.19 found that , after rpm \n exercise , the proprioception error was reduced . \n ju et al.10 had 15 subjects perform ram and rpm exercises , and the ram \n exercises resulted in an increase in proprioception error scores while rpm resulted in a \n decrease . \n this result was the same as the one found in our study , indicating that rpm \n exercises reduce proprioception errors . \n passive movements play a role in the activation of mechanical receptors and increase \n activity in the contralateral sensorimotor cortex , supplementary motor area , bilateral \n inferior parietal cortex , secondary somatosensory areas and ipsilateral cerebellum of the \n brain9 , 30 . \n this activation of the brain enables the position of joints to be \n determined by sensory inputs from the peripheral system , allows the planning of movements , \n controls the motor response by comparing the sensory input signals and output signals , and \n provides a significant input to the ability to sense joint position23 . \n for all of these reasons , we should expect that \n repetitive passive movement would function to reduce error in the sensation of position . in ram \n , there was a significant difference observed in both the aar and par , both before \n and after the intervention ( p<0.05 ) . \n allen et \n al.31 reported that forearm concentric \n and eccentric exercises increased position matching errors and reduced the accuracy of the \n sense of position18 , 32 . \n brockett et al.15 argued that eccentric exercise increases errors in the sense of \n position . \n this result supports the finding of our study that ram exercise increases error in \n position sense . \n the intensity of brain activation can be influenced by proprioceptive stimulation at the \n joint33 . \n active exercise results in fatigue at the joint , whereas passive \n exercise does not . \n continuous high - intensity exercise causes muscle fatigue which increases \n the error in the position sense by reducing the threshold sensitivity of fibers in the \n muscle spindles15 , 35 , 36 . \n therefore , we should \n expect that continuous active movement would increase errors in the position sense . \n a limitation of the present study was that it is difficult to generalize research results \n using young and healthy persons to the elderly and people whose forearms are injured or \n impaired . \n this was not a randomized controlled trial ( rct ) and the number of study subjects \n was small . \n therefore , future studies should include more subjects or be conducted as a rct \n with participants of different ages and subjects whose forearms are injured or impaired . \n we conducted this study in order to examine which of ram or rpm exercise is more effective \n for training forearm proprioception . \n the results of show that ram exercise increased \n proprioception errors and rpm reduced them . \n . therefore , we recommend the use of rpm exercise in \n clinical situations in order to improve proprioception ability related to the use of the \n forearm and stability of joints .", "role": "user" }, { "content": "[ purpose ] this study was conducted in order to investigate the effect of repetitive \n passive movement and repetitive active movement on proprioception in forearm supination . \n [ subjects ] this study had a cross - sectional design . \n twenty - three right - handed healthy \n subjects were recruited . \n all subjects randomly received both repetitive passive movement \n and repetitive active movement ( repetitive passive / active movement at 120/s with 60 \n repetitions over a 080 range ) . \n active and passive joint repositioning of all subjects \n was measured using the error score for position sense , both before and after repositioning \n intervention . \n [ results ] in the repetitive passive movement test , there was a statistically \n significant decrease in the pre- versus post - repositioning error scores in the active and \n passive angle examinations . in the repetitive active movement test , there was a \n statistically significant increase in pre- versus post - repositioning error scores in the \n active and passive angle examinations . in the comparison of position sense \n , there was a \n statistically significant decrease in both active and passive angle repositioning error \n scores in repetitive passive movement versus repetitive active movement . \n [ conclusion ] \n repetitive passive movement improved the proprioception results for forearm supination , \n compared to repetitive active movement . \n results of this study indicate that repetitive \n passive movement can be recommended to clinicians for rehabilitation therapy as it \n provides greater proprioception benefits .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: since its introduction in the late 1980s , laparoscopic cholecystectomy ( lc ) has been used as a gold standard for management of symptomatic gallstone disease , replacing almost completely the open cholecystectomy ( oc ) [ 13 ] . \n it is commonly followed by less pain , shorter hospitalization , and faster recovery owing to the reduced magnitude of the initial surgical insult and lower systemic immune impairment . \n however , positive co2 pneumoperitoneum , abdominal wall distention , and peritoneal acidosis may activate the additional factors that affect the outcome of operations , leading to both the potentiation of surgical trauma [ 4 , 5 ] , and the beneficial immune - modulating effect , linked with the augmentation of il-10 , attenuation of tnf production [ 68 ] , and diminishing effect on surgery - induced imbalance in pro-/anti - inflammatory cytokines [ 9 , 10 ] . \n cellular mechanisms underlying these effects are , however , very complex , since surgical manipulation or pneumoperitoneum and laparotomy may alter the expression of 116 and 398 splenic t - cell genes , respectively , that might be involved in signal transduction , chemotaxis , and cell cycle of lymphocytes . in the present study \n , we tried to analyze the perioperative changes in cytotoxic t lymphocytes ( ctls ) and natural killer ( nk ) cells after lc and oc , since , particularly , these cells are involved in immune surveillance and have the crucial roles in the prevention or attenuation of disease through their ability to eliminate infected or transformed cells [ 1215 ] . \n their cytoplasm is rich in granules composed of complexes of proteoglycan in association with the pore - forming protein perforin ( p ) and a family of serine proteinases , known as granzymes that are released into the intercellular space on interaction of nk cells or ctl with a target cell . whether granzyme entry into the target cell cytoplasm occurs directly after perforin pore formation in the plasma membrane or after endosomolysis is still debated [ 1215 ] . \n according to the original model , p acts by forming a cell membrane pore through which granzymes pass into the target cell , where they cleave specific substrates that initiate dna fragmentation and caspase - dependent or caspase - independent apoptotic cell death . \n however , more recently , it was proposed that granzymes might be endocytosed independently of p and that p acts to release granzymes that are sequestered in endosomes into the cytosol of the target cell . \n in addition , there is a possibility that p triggers ca influx , which may activate rapid coendocytosis of granzymes and p into giant endosomes , followed by p - mediated release of granzymes to the cytosol [ 1215 ] . in circulating nonactivated lymphocytes \n , cytotoxicity is restricted to nk cells , / tcr t cells , and a subpopulation of cd8 cells , which constitutively express perforin but its expression can be induced in many cd4 , mhc class ii restricted ctl , in cd8 ctl as well as in cd4cd25foxp3 t regulatory cells [ 1215 ] . moreover , \n the expression of p in t cells might be a useful marker for functionally activated cytotoxic cells in situ . trying to determine the early postoperative effects of classic and laparoscopic cholecystectomy on these events , in this study we analyzed the p content in the pbmnlc before and 24 hours after the operations . \n furthermore , in an attempt to link these events with the intensity of preoperative cholestasis and inflammation induced by gallstones , we correlated these data with the blood concentrations of acute phase proteins and markers of cholestasis , such as bilirubin ( bil ) , alkaline phosphatase ( ap ) , and hepatic enzymes . \n the data showed that perforin - dependent cytotoxic mechanisms are only moderately affected by different types of operations , but that the preoperative cholestasis and hepatic injury may significantly increase the number of peripheral blood cells containing the perforin . \n in a prospective , nonrandomized study that was approved by ethical committee of medical faculty , university of rijeka , we analyzed the immune functions of 23 patients submitted to conventional , open cholecystectomy ( oc ) and 21 patients undergoing laparoscopic cholecystectomy ( lc ) for symptomatic cholecystolithiasis . \n mean age for the conventional group was 61.8 years ( range 31 to 85 ) for 13 women and 10 men . \n for lc , mean age was 55.5 years ( range 28 to 82 ) ; this group consisted of 13 women and 8 men . \n laparoscopic cholecystectomy was carried out in a standardized technique using 4 troacars and a pneumoperitoneum of 14 mm hg . \n mean operative duration was 90 minutes ( range 74139 ) for oc and 120 minutes ( range 90150 ) , for lc without statistically significant difference , showing that the two groups were comparable for the demographic and surgery - related parameters ( table 1 ) . \n there were also no statistically significant differences in the standard hematological parameters , such as red and white cells counts , hematocrit , and platelets ( not shown ) but group of patients chosen for classic cholecystectomy had significantly greater preoperative cholestasis ( figure 1 ) , since laparoscopic cholecystectomy with insufflations of co2 was avoided in patients with chronic cholecystolithiasis . \n therefore , this group of patients had significantly higher levels of total bilirubin ( 57.6 versus 13.1 mol / l , p < .04 ) , ap ( 216.4 versus 64.0 \n iu / l ; p < .02 ) , ggt 273.03 versus 28.96 iu / l ; p < .004 ) , ast ( 56.3 versus 24.4 ; p < .05 ) , alt ( 95.42 versus 28.9 iu / l ; p < .009 ) , as well as the higher levels of crp ( 28.57 versus 4,84 mg / l ; p < \n the patients with acquired or inherited immunodeficiencies and those who developed postoperative complications were excluded from the study . \n blood samples were collected preoperatively and on postoperative day 1 and tested for hematological and immunological parameters . \n twenty healthy persons , consisting of laboratory personnel and blood volunteer donors ( 10 females and 10 males ) , corresponding by age and sexes to the examined patients groups were also studied . \n heparinized venous blood ( 10 ml ) was diluted and separated on lymphoprep ( nycomed pharmaas , oslo , norway ) for 20 minutes on 800 g. cells accumulating at the interface were washed twice in rpmi 1640 and resuspended at a final concentration of 1 10 peripheral blood lymphocytes per sample in fluorescent - activated cell sorting ( facs ) buffer . \n viability was assessed by trypan blue and was always around 98% . for staining of surface markers on human t and nk cells , \n the following phycoerythrin-(pe)- conjugated moab , obtained from becton dickinson ( mountain view ) were used : anti - cd3 , anti - cd4 , anti - cd8 , anti - cd16 , and anti - cd56 ) . for the detection of intracellular perforin \n a murine antihuman perforin moab g9 ( moab ; igg2b ) was purified from balb / c ascites . \n the method for the simultaneous detection of perforin ( intracellular antigen ) and cell surface antigens is described in detail elsewhere . \n briefly , peripheral blood mononuclear cells ( pbmnlc ) were aliquoted ( 10 per aliquot ) and washed in facs buffer , then fixed in 100 l pbs containing 4% paraformaldehyde , ph 7.4 , for 10 minutes at room temperature . after two washes in facs buffer , the cells were permeabilized with saponin buffer ( 0.1% saponin ) ( sigma , poole , dorset ) for 20 min at room temperature . \n murine monoclonal antibody reacting with human perforin ( p ) moab - g9 ( igg2b , purified from balb / c ascites ) was added to the suspension of cells in saponin , at final concentration of 810 g per sample and incubated for 30 minutes at room temperature . \n all further steps , secondary antibody , fitc - conjugated goat - antimouse ig ( becton dickinson , san jose , calif , usa ) , and rising procedures were performed in saponin buffer . \n cells surface antigens ( cd3 , cd4 , cd8 , cd16 , and cd56 ) were then stained in facs buffer at a final concentration of monoclonal antibody of 10 g / ml ( becton dickinson ) and 100 l were added to the pelleted cells . \n after 30-minutes incubation at + 4c , cells were washed with facs buffer and stained with avidin - phycoerythrin ( 20 g / ml , becton dickinson ) for 30 min . \n the standard preoperative workup for predicting choledocholithiasis in both group of patients included liver function tests and abdominal ultrasound . \n liver transaminases ( alt , ast ) , liver cholestasis tests ( gamma - glutamyl transpeptidase - ggt , and alkaline phosphatase - alp ) and liver clearance tests ( total and conjugated bilirubin - bil ) were determined by enzymatic calorimetric methods , using routine laboratory techniques with roche reagents in a roche - hitachi modular - p800 clinical chemistry module ( roche , mannhein , germany ) . \n statistical significance was calculated by two - tailed student 's t - test for paired samples , and by mann - whitney u - test for the evaluation of differences between the groups . \n test of correlation and linear regression analyses were made by statistical software statistics for windows , kernel release 5.5 ( statsoft , inc . \n linear regression equations were generated using a pearson - product moment correlation and analyzed for differences of covariance . \n data are reported as mean sem or as median values , with 25th75th percentiles in parentheses . \n immune status of patients undergoing classic , open ( oc ) , or laparoscopic ( lc ) cholecystectomy was evaluated before and 24 hours after the operations . \n comparison of the data was then made between the pre- and postoperative values in the same group , between the preoperative values in the oc and lc groups as well as between the preoperative values in groups of patients elected for operations and the control group , consisting of healthy blood donors of corresponding age . \n analysis included standard determination of surface antigens on lymphatic cells and two color analysis , with simultaneous determination of surface markers and intracellular content of perforin . \n standard immunological tests revealed that preoperative numbers of t lymphocytes ( cd3 , cd4 , and cd8 ) and nk cells ( cd16and cd56 ) in both groups were in normal ranges for healthy , adult people . \n furthermore , no differences were found in preoperative values of both t ( figure 2(a ) ) and nk cells ( figure 2(b ) ) in blood of patients elected for oc and lc groups as well as in the postoperative values of all t lymphocytes and cd16 nk cells . \n classic cholecystectomy , however , slightly decreased the percentage of cd56nk cells ( 18.7% versus 15.4% ; p < .05 ) , as shown on figure 2(b ) . \n data were then analyzed by double labeling of cd surface marker and perforin and presented as a fraction of total peripheral blood lymphocytes containing perforin ( tp cells ) and as a percentage of double positive t ( figure 3(a ) ) or nk cells ( figure 3(b ) ) . \n the significant postoperative difference was found only after lc , which decreased the fraction of cytotoxic cd8pcells from 13.5 to 10.2% ( p \n < .05 ) , as it is presented on figure 3(a ) and on representative histogram ( figure 3(c ) ) , showing perforin expression on the gated cd8 t cells , before and after lc . comparison with healthy control revealed , however , that preoperative values of tp and cd3p cells in patients elected for oc were significantly higher than normal values ( 30.78% and 16.05% versus 27.3% and 10,68% , resp . ; p < .05 ) ( figure 3(a ) ) , as well as that all patients elected for operations had , preoperatively , lower fractions of perforin positive nk cells ( figure 3(b ) ) , since in oc group cd16p cell fraction fell from 20.16% to 14.14% ( p < .05 ) and cd56p cells from 20.74% to 13.63% ( p < .05 ) and in lc group to 10.71% ( p < .05 ) and to 11.64% ( p < .001 ) , respectively . \n increased expression of perforin in t cells ( cd3p and cd4p ) and lower expression of perforin in nk cells ( cd16p ) in preoperative blood of patients elected for classic cholecystectomy versus control subjects are presented also by the representative density plots ( figure 4(a ) and 4(b ) , resp . ) . \n the procedure of double labeling of peripheral blood lymphocytes by flow cytometry permitted also the measurement of mean fluorescence intensity ( mfi ) , which correlates with a number of perforin molecules present in the cells . by applying standard parameters for fsc , ssc , fl1 and fl2 , we thus , analyzed mfi for perforin in subsets of t lymphocytes ( cd3p , cd4p , cd8p ) and nk cells ( cd16p and cd56p ) . \n as presented on figure 5(b ) and on representative histogram ( figure 5(c ) ) we noticed slight upregulation of perforin content only after lc in cd56pcells ( p < .05 ) . \n the data , however , clearly showed that lymphatic subpopulation ( cd3 , cd4 , cd16 and cd56 ) of patients undergoing the classic cholecystectomy contained , preoperatively , the higher quantities of perforin in their granules in comparison with patients selected for lc ( figures 5(a ) , 5(b ) , and 6 ) . the findings of the marked changes in the proportions and mfi of perforin - expressing cells in preoperative blood suggested that these events might be related with the previously described greater cholestasis and inflammation in patients elected for classic cholecystectomy ( figure 1 ) . to test this possibility \n the concentrations of crp , hepatic enzymes and bilirubin in preoperative sera of all patients undergoing to the operations were , individually , in each person correlated with the percentage of perforin positive cells and with mfi for perforin in lymphocytes subpopulations found in preoperative samples of blood . \n it was found ( figure 7 ) that concentration of crp was in a very high positive correlation with percentage of total number of perforin positive cells ( r = 0.5218 ; p < .002 ) , cd3p ( r = 0.49576 ; p < .006 ) and the fraction of p cells among cd4 subset of cells ( r = 0.47551 ; p < \n .006 ) as well as in the negative correlation with the fraction of pcells among cd16 cells ( r = 0.3752 ; p < .041 ) . the data ( figure 8) revealed also the presence of positive correlation between the concentration of ap in serum and proportion of cd4p cells ( r = 0.50240 ; p < .001 ) as well as the presence of negative correlation between ap and proportion of pcells among the cd8cells ( r = 0.3645 ; p < .04 ) , and between the concentration of total bilirubin and proportion of p cells in cd8 cells ( r = 0.3655 ; p < .034 ) . however , although these data suggested that cholestasis and inflammation have induced a switch in immune response toward the cd4pcells , it was also found that higher concentrations of alt in sera increased the mfi of perforin in cd16 ( r = 0.409 ; p < .016 ) and cd56cells ( r = 0.509 ; p \n < .002 ) , suggesting that remaining nk cells , owing to the increased content of p probably obtained a higher cytotoxic activity ( figure 9 ) . \n trying to contribute to the elucidation of profound immunological dysfunctions induced by surgical trauma [ 111 ] and mechanisms that regulate the p expression in cytolytic cells [ 1215 ] , in this study we analyzed primarily the changes in perforin expressing peripheral blood lymphatic cells after oc and lc . \n the data showed that in early postoperative period , the type of operation minimally affected the p - related events , since only lc decreased the percentage of circulating cd8pcells ( figures 3(a ) , 3(c ) ) and increased the mfi of perforin in cd56cells ( figures 5(b ) , 5(c ) ) , suggesting that the pneumoperitoneum with insufflations of co2 had a stimulating effect on cytolytic activity of nk cells and contributed to distribution of ctl in the tissue . \n changes might be related with lower operative stress , extracellular acidification or selective activation of different macrophage subpopulation [ 111 ] but need further characterization , particularly , owing to our findings that immune outcome of cholecystectomy might be markedly influenced by the intensity of preoperative inflammation and cholestasis . in our study \n this , obviously , influenced the number of perforin expressing cells in both groups of patients since they , preoperatively , had significantly lower proportions of cd16p and cd56p cells ( figures 3(b ) and 4(b ) ) . \n similarly , augmented proportions of tp cells , cd3p cells and cd4p cells ( figures 3(a ) and 4(a ) ) were found in patients elected for oc , which preoperatively , had higher preoperative levels of crp , ap , b , ast and alt ( figure 1 ) , suggesting that preoperative inflammation and cholestasis affected the perforin - related events . \n the hypothesis was confirmed by linear regression analyses , made in all patients elected for the operations , which clearly showed that the concentration of crp in the serum was in high positive correlation with the percentage of tp cells , cd3p and cd4p cells and in negative correlation with the fraction of p cells among the cd16 nk cells ( figure 7 ) . \n moreover , an additional effect of cholestasis was confirmed by finding of positive correlation between ap in the serum and fraction of cd4p cells , and negative correlation of both ap and bilirubin with fraction of p cells among cd8 cells ( figure 8) . taken together , the data imply that , in patients with gallstones , the inflammation and chronic cholelithiasis had particularly stimulated the generation of cytotoxic cd4p cells , decreasing simultaneously the circulating levels of cd8p t cells and cd16pnk cells ( figures 3 , 4 , 6 , and 7 ) , probably owing to their greater homing into the insulted liver tissue . however , based on the fact that alt was in high positive correlation with mfi of perforin in cd16 and cd56cells ( figure 9 ) , we speculated also that hepatic injury might increased the content of perforin per cell in remaining circulating nk cells . \n the data are in high agreement with current knowledge about the influence of inflammation and injuries on cytotoxic cells of innate [ 18 , 19 ] and adaptive immunity [ 20 , 21 ] and point to the liver as an important organ for maintenance of self - tolerance and elimination of potentially dangerous cells that arose during the cholestasis and hepatic damages in patients with gallstones . \n the mechanisms are unclear , since the consequences of obstructive jaundice are complex and involve a number of immune effectors that contribute to a variety of immunological derangements [ 22 , 23 ] as well as to hepatic regeneration [ 24 , 25 ] and fibrosis . in this context \n it could be speculated that destruction of intrahepatic bile ducts or the appearance of aberrant cholangiocytes has initially stimulated the intrahepatic nk cells , leading to cholangiocyte killing and apoptosis by the granzyme / perforin pathway or by activation of death receptors belonging to the tumor necrosis factor ( tnf ) receptor superfamily and trail , as it was reported in the bile duct - ligated mice and in patients with the primary biliary cirrhosis , where the activation of hepatic nk cells led to exacerbated damage on liver tissues [ 23 , 28 , 29 ] . \n noteworthy , higher cytotoxicity might be induced by activation of several classes of killer lectin - like receptors ( e.g. , nkg2d and natural cytotoxicity receptors ) , that are commonly expressed by human nk cells as well as by tcr and tcrcd8 t lymphocytes and specifically interact with stress - inducible molecules , such as mica , micb , and ulbp , which might be displayed by stressed or altered self cells and by virus - infected cells . \n furthermore , since cholestatic jaundice is often followed by bacteriemia [ 22 , 23 ] , for our data showing the correlation of cd4p cells with the serum levels of crp and ap ( figures 7 and 8) might be relevant that in inflammatory bowel diseases with uncontrolled immune responses to bacterial flora were found cd4 ( + ) nkg2d ( + ) t - cell clones that were involved in perforin - mediated killing of the targets expressing mica . \n it should be , however , emphasized that cd4p cells t cells , activated in the liver , might belong also to cd4nkt cells or to cd4cd25 regulatory t cells , since these autoreactive t cells clones also participate in perforin - mediated killing . \n the former , which might be activated by glycolipid antigens , are characterized also by rapid activation and secretion of large amounts of numerous types of cytokines that in turn interact with a multitude of other cell types [ 3235 ] , while the latter are known to participate in the control of autoantigen recognition and the development of autoreactive t cells clones , by mechanisms that include direct killing of cytotoxic cells through cell - to - cell contact , inhibition of cytokine production by cytotoxic cells and direct secretion of immunomodulatory cytokines , such as tgf- and interleukin-10 [ 3639 ] , acting together with other cd4 cells as crucial regulators of adaptive and innate immune responses . in conclusion , \n our data show that in early postoperative period only laparoscopic cholecystectomy moderately affected perforin - expressing cells in peripheral blood , decreasing the percentage of cd8p cells and increasing the content of perforin in cd56 cells . \n however , pointing to the complexity of physiological and immunological derangements induced by cholelitiasis and obstructive jaundice , we also show that preoperative cholestasis and hepatic injury , might have a marked influence on perforin - related aspects of cytotoxic t and nk cells and final interpretation of data obtained by classic or laparoscopic cholecystectomy .", "role": "user" }, { "content": "perforin-(p- ) related characteristics of cytotoxic t lymphocytes and natural killer cells were investigated in peripheral blood of patients subjected to open ( oc ; n = 23 ) or laparoscopic cholecystectomy ( lc ; n = 21 ) and healthy controls ( n = 20 ) . blood samples were obtained preoperatively and 24 hours after the surgeries , and the data were correlated with the intensity of cholestasis and concomitant inflammation , determined by functional hepatic tests . \n postoperative differences were found to be minimal : oc decreased only the percentage of cd56 + cells , while lc decreased the fraction of cd8+p+ cells and augmented the mean fluorescence intensity of p in cd56 cells . \n patients elected for oc had , however , higher preoperative numbers of total p+ , cd3+p+ , and cd4+p+ cells than patients elected for lc and healthy controls , while both groups of patients , preoperatively , had lower fraction of cd16+p+ and cd56+p+ cells . \n these changes were in high correlation with blood concentrations of crp , ap , and alt , emphasizing the link between the preoperative cholestasis and inflammation and p - dependent cytotoxic mechanisms .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: pediatric cerebral venous sinus thrombosis ( cvst ) is rare and it can significantly cause neurological adverse outcomes in patients7 ) . \n the annual incidence of cvst is 0.67 per 100000 children7 ) . because half of the events occurred during the neonatal period , the incidence of cvst is 0.34 per 100000 in non - neonate children per year27 ) . \n there are various risk factors of pediatric cvst including thrombophilic states , acute systemic illness , chronic systemic diseases , and head and neck disorders7 ) . \n head and neck disorders are more common in non - neonates ( 1 month to 18 years old)7 ) . \n the diagnosis of cvst after a minor head injury is not easy because of the rarity of occurrence , so a high degree of suspicion is the most important factor to the diagnosis of a patient presenting progressive ambiguous symptoms such as headaches , vomiting , and imbalance23 ) . even though anticoagulation is recommended for the treatment of pediatric cvst19 ) , close observation can be a mainstay therapy for cvst caused by a minor head injury17 ) . \n we report on one pediatric case of early spontaneous recanalization of sigmoid sinus thrombosis after a closed minor head injury with a literature review . \n a 10-year - old male fell while riding a bicycle on the road . on the day of the fall , he had no definite symptoms ; however , he complained of a mild , intermittent headache and nausea five days after the incident and visited the hospital . \n his neurological state was normal and there were no blood stains in the ear , nose , or throat . \n the brain computed tomography ( ct ) revealed a linear fracture , small amounts of epidural hematomas and pneumocephalus in the right occipital area . \n when compared to the left side , a higher density lesion within the right sigmoid sinus was found ( fig . \n 1 ) . the brain magnetic resonance image ( mri ) showed the effusion and hemorrhage in the right mastoid air cell and a signal intensity , which was suspected to be thrombus , in the right sigmoid sinus ( fig . \n 2 ) . the brain magnetic resonance venography ( mrv ) revealed an absence of a flow signal between the right sigmoid sinus and the jugular bulb , which was confirmed to be sigmoid sinus thrombosis ( fig . \n 3a ) . during the physical examination , he showed no papilledema , intracranial hypertension , or otogenic infections such as otitis media . \n his blood tests , including complete blood count , prothrombin time , partial thromboplastin time , antithrombin iii , protein c activity , and protein s activity , were in the normal ranges . \n the patient was treated conservatively because the patient 's symptoms were mild and gradually improved . \n he was discharged with a full recovery on the 4th day in the hospital . on the 10th day after discharge , \n the laboratory tests , including a prothrombotic evaluation and a physical examination , were performed . \n due to concern regarding the progression of the previous sinus thrombosis , the brain mrv was re - checked , and it showed the recovery of the flow signal in the right sigmoid sinus ( fig . \n the spontaneous recanalization of sigmoid sinus thrombosis occurred within about three weeks of the trauma . \n his vomiting may have been caused by gastrointestinal problems , and it ceased the following day . \n the exact mechanism of sinus thrombosis following a closed head injury is unknown , although several theories have been suggested16171824 ) . \n one possible mechanism is a direct injury with a linear fracture crossing the wall of the dural sinus16 ) . \n it may also be caused by a rupture of the small sinusoids , an injury to the endothelial lining , or an extension of thrombus from the emissary veins18 ) . \n the other suggested mechanism is a temporary alteration in the coagulation after a head injury , disturbances in the blood flow ( venous stasis ) , or damage to the capillary endothelium , all of which may predispose a person to thrombosis24 ) . \n compared with adult groups , cvst following a closed head injury in children has a number of different characteristics . \n for example , pediatric patients tend to be affected more often than adults by posttraumatic venous sinus thrombosis because of the immaturity of their cerebral venous collateral vasculature6 ) . \n children with posttraumatic sinus thrombosis show delayed neurological symptoms , such as headaches , vomiting , irritability , or gait ataxia23 ) . in another study , children were shown to be more likely to experience seizures and mental changes , while adults were more likely to experience headaches and diplopia10 ) . the diagnosis should be made early in the course of this pathology in order to begin the treatment as well as to prevent complications that could become fatal . \n a high degree of clinical suspicion is the most important factor in the early diagnosis of cvst in pediatric patients23 ) . \n the confirmation of the diagnosis relies on the demonstration of thrombus by detailed neuroimaging techniques , such as a contrast ct with venography , an mrv , or a cerebral angiography . \n sometimes cvst can be identified on brain ct scans as clots in the cortical veins , namely the \" cord sign \" and the \" dense vein sign\"5 ) . \n this is caused by clots filled with dural sinus as well as filling defects in the superior sagittal sinus , or the so - called \" empty delta sign\"20 ) . \n a brain mri with the addition of an mrv is the most sensitive imaging tool for diagnosing cvst , which non - invasively provides a direct visualization of the dural sinuses and any sinus flow abnormalities21 ) . \n a cerebral angiography can be performed if the previously mentioned examinations are inaccurate or ambiguous , although the interpretation can sometimes be challenging because transverse sinus hypoplasia or aplasia could be identified through the angiography in the general population22 ) . \n therefore , we suggest that an mri with an mrv is the best choice of imaging tools . in our case , \n a brain ct showed a \" dense vein sign \" in the sigmoid sinus ( fig . \n 1d ) , and thrombus in the right sigmoid sinus demonstrated a low signal intensity in a t2-weighted image and an iso - signal intensity in a t1-weighted image on the brain mri ( fig . \n treatment planning should be based on clinical findings and etiologies17 ) . in cases of adult cvst \n , several articles generally recommend anticoagulation therapy ( act ) and even aggressive treatments such as endovascular thrombolytic therapy or surgical thrombectomy in severe cases41618 ) . \n some authors suggested the use of endovascular balloons as an alternative in cases of anticoagulation and decompressive craniectomy3 ) ; however , most pediatric patients with csvt from minor head injury had favorable outcomes regardless of the treatment strategies17 ) . \n some authors recommended that anticoagulation be reserved for patients presenting a papilledema or complaining of persistent headache , vomiting , or disequilibrium17 ) . \n we agreed with their opinions and treated our patient conservatively , because the patient 's symptoms were mild and non - persistent . \n anticoagulants , such as heparin , can be used to treat thrombosis ; however , there is an increased risk for a venous hemorrhagic infarction21 ) . \n therefore , some authors recommended low - molecular - weight heparin as a proper choice for treating cvst with intracranial hemorrhages instead of heparin because of concerns regarding aggressively increasing hemorrhages19 ) . \n there are several studies about cvst following a closed head injury in pediatrics ( table 1 ) . \n the frequently involved locations were the sigmoid sinus ( 69.6% ) and the transverse sinus ( 52.2% ) . \n in researching the literatures , it was found that most cases ( 60.9% ) were treated conservatively and had favorable outcomes , including two cases with recurrent headaches . \n five cases of act and three surgical cases also had favorable outcomes . the radiologic confirmation of recanalization was performed in 13 cases and most of them were diagnosed by only a brain ct or only a brain mri rather than a combination of these tests with an mrv . \n the mechanism of spontaneous recanalization is unknown . a case of spontaneous recanalization within one month in cvst is extremely rare . even though the precise mechanism of recanalization is still obscure , \n it was reported that the regression of acute deep vein thrombosis begins early and is accompanied by a significant increase in the endogenous fibrinolytic agent , tissue plasminogen activator1215 ) . \n although cvst following a closed head injury is still rare in children and spontaneous recanalization within one month has not been reported , pediatric cvst following a mild head injury and spontaneous recanalization may not be that rare because a lesion that may recover uneventfully may frequently be misread . \n cvst should be suspected in patients with posttraumatic symptoms , even in pediatric cases of mild head injuries , because csvt could lead to catastrophic outcomes , such as a large venous infarction . \n treatment should be based on clinical findings and outcomes and should consist of measures that counteract thrombosis .", "role": "user" }, { "content": "cerebral venous sinus thrombosis ( cvst ) following a closed head injury in pediatric patients is a rare condition , and an early spontaneous recanalization of this condition is extremely rare . \n a 10-year - old boy was admitted with a mild , intermittent headache and nausea five days after a bicycle accident . \n the brain computed tomography showed an epidural hematoma at the right occipital area with pneumocephalus due to a fracture of the occipital skull bone . \n the brain magnetic resonance imaging and the magnetic resonance venography demonstrated a flow signal loss from the right sigmoid sinus to the right jugular vein . \n the diagnosis was sigmoid sinus thrombosis , so close observations were selected as a treatment for the patient because of his gradually improving symptoms ; however , he complained of vomiting 14 days the after conservative treatment . \n the patient was readmitted for a further examination of his symptoms . \n the laboratory and the gastroenterological examinations were normal . \n due to concern regarding the worsening of the sigmoid sinus thrombosis , the brain magnetic resonance venography was rechecked and it revealed the recanalization of the venous flow in the sigmoid sinus and in the jugular vein .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: wt c57bl/6 mice , csf2rb mice and the congenic strain b6.sjl-ptprc pepc / boyj ( b6.sjl ) were from the jackson laboratory . \n mice were maintained in our specific pathogen - free animal facility according to institutional guidelines . \n experiments used sex- and age - matched mice at 6 - 16 weeks of age . \n 1a was determined by microarrays for the long - term hematopoietic stem cell ( lt - hsc ) , flt3 multi - potent progenitor ( flt3 mpp ) , common myeloid progenitor ( cmp ) , granulocyte - macrophage progenitor ( gmp ) , common lymphoid progenitor ( clp ) , common dendritic cell progenitor ( cdp ) , bone marrow ( bm ) pre - cdc ( precdc ) , splenic pdc , splenic cd8 dc and splenic cd8 dc . in fig . \n 1b , lineage markers included ter119 , nk1.1 , b220 , mhcii , cd3 , and cd11b . for fig . \n 1c , cmp were lincd16/32-flt3ckit , cdp were lincd16/32flt3ckitcd115 , and pre - cdc were lincd16/32-flt3ckitcd11c . for fig . \n 1d - f , gating is as follows ; dcs , cd11cmhcii ; neutrophils ( pmn ) , ly6gcd11b ; monocytes ( mono ) , ly6ccd11bly6 g ; red pulp macrophages ( rpm ) , autofluorescent f4/80 ; nk cells nk1.1cd3 ; cd8 t cells ( cd8 t ) cd3cd8cd4 ; cd4 t cells ( cd4 t ) , cd3cd4cd8 ; and b cells , cd19b220siglech . in fig . \n 2 , pdcs were gated as cd11cmhcii cells ; resident dc as cd11cmhcii cells ; and migratory dcs as cd11cmhcii cells . in fig . 2c \n , tissues were stained spleen , b220 ( blue ) ; f4/80 ( red ) ; gfp ( green ) ; lymph node b220 ( blue ) , cd169 ( red ) and gfp ( green ) ; small intestine cd4 ( blue ) , -catenin ( red ) and gfp ( green ) ; peyer 's patch cd4 ( blue ) , b220 ( red ) and gfp ( green ) . in fig . \n 2d , bm cells were cultured for 9 days with flt3 ligand , treated with media , interleukin 4 ( il-4 ) , interferon gamma ( ifn- ) , granulocyte - macrophage colony - stimulating factor ( gm - csf ) , and heat - killed listeria monocytogenes egd ( hklm ) for 24 hours . \n wt c57bl/6 mice , csf2rb mice and the congenic strain b6.sjl-ptprc pepc / boyj ( b6.sjl ) were from the jackson laboratory . \n mice were maintained in our specific pathogen - free animal facility according to institutional guidelines . \n experiments used sex- and age - matched mice at 6 - 16 weeks of age . \n 1a was determined by microarrays for the long - term hematopoietic stem cell ( lt - hsc ) , flt3 multi - potent progenitor ( flt3 mpp ) , common myeloid progenitor ( cmp ) , granulocyte - macrophage progenitor ( gmp ) , common lymphoid progenitor ( clp ) , common dendritic cell progenitor ( cdp ) , bone marrow ( bm ) pre - cdc ( precdc ) , splenic pdc , splenic cd8 dc and splenic cd8 dc . in fig . \n 1b , lineage markers included ter119 , nk1.1 , b220 , mhcii , cd3 , and cd11b . for fig . \n 1c , cmp were lincd16/32-flt3ckit , cdp were lincd16/32flt3ckitcd115 , and pre - cdc were lincd16/32-flt3ckitcd11c . for fig . \n 1d - f , gating is as follows ; dcs , cd11cmhcii ; neutrophils ( pmn ) , ly6gcd11b ; monocytes ( mono ) , ly6ccd11bly6 g ; red pulp macrophages ( rpm ) , autofluorescent f4/80 ; nk cells nk1.1cd3 ; cd8 t cells ( cd8 t ) cd3cd8cd4 ; cd4 t cells ( cd4 t ) , cd3cd4cd8 ; and b cells , cd19b220siglech . in fig . \n 2 , pdcs were gated as cd11cmhcii cells ; resident dc as cd11cmhcii cells ; and migratory dcs as cd11cmhcii cells . in fig . 2c \n , tissues were stained spleen , b220 ( blue ) ; f4/80 ( red ) ; gfp ( green ) ; lymph node b220 ( blue ) , cd169 ( red ) and gfp ( green ) ; small intestine cd4 ( blue ) , -catenin ( red ) and gfp ( green ) ; peyer 's patch cd4 ( blue ) , b220 ( red ) and gfp ( green ) . in fig . \n 2d , bm cells were cultured for 9 days with flt3 ligand , treated with media , interleukin 4 ( il-4 ) , interferon gamma ( ifn- ) , granulocyte - macrophage colony - stimulating factor ( gm - csf ) , and heat - killed listeria monocytogenes egd ( hklm ) for 24 hours .", "role": "user" }, { "content": "the transcription factors c - myc and n - myc encoded by myc and mycn , respectively , regulate cellular growth1 and are required for embryonic development2,3 . \n a third paralog , mycl1 , is dispensable for normal embryonic development but its normal biologic function has remained unclear4 . to examine the in vivo function of mycl1 \n , we generated an inactivating mycl1gfp allele that also reports mycl1 expression . \n we found that mycl1 was selectively expressed in dendritic cells ( dcs ) of the immune system and controlled by irf8 , and that during dc development , mycl1 expression was initiated in the common dc progenitor5 ( cdp ) concurrent with reduction in c - myc expression . \n mature dcs lacked expression of c - myc and n - myc , but maintained l - myc expression even in the presence of inflammatory signals , such as gm - csf . \n all dc subsets developed in mycl1-deficient mice , but several dc subsets , such as migratory cd103 + cdcs in the lung and liver , were significantly reduced at steady state . \n importantly , loss of l - myc by dcs caused a significant decrease in the in vivo t - cell priming during infection by listeria monocytogenes and vesicular stomatitis virus . \n the replacement of c - myc by l - myc in immature dcs may provide for myc transcriptional activity in the setting of inflammation that is required for optimal t - cell priming6 .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: hepatocellular carcinoma ( hcc ) is one of the most common cancers and its incidence is increasing worldwide.1 as the treatment of hcc has remarkably improved , the survival of patients with hcc has been prolonged . \n consequently , extrahepatic metastasis of hcc is now diagnosed more frequently and the incidence of bone metastasis from hcc is also increasing.2,3 however , cases of extrahepatic hcc without a detectable primary liver tumor have rarely been reported ; in fact , bone metastasis from hcc , single or multiple , without the presence of a primary tumor has been reported in only six cases worldwide.4 - 9 because of insufficient experience with these cases , diagnostic and treatment approaches for these patients are challenging . here , we present a case of metastatic hcc arising from the pelvic bone without a primary focus . \n a 73-year - old man was admitted to our hospital for evaluation of severe back pain and right leg pain for 1 month . \n the medical history of patient revealed that he was diagnosed as a hepatitis b virus ( hbv ) carrier about 20 years earlier , but was lost to follow up . \n initial laboratory findings were as follows : white blood cell count 4,830/l , hemoglobin 15.2 g / dl , platelets 138,000/l , total protein 7.8 g / dl , albumin 4.4 g / dl , aspartate aminotransferase ( ast ) 31 iu / l , alanine aminotransferase ( alt ) 35 \n iu / l , total bilirubin 1.0 mg / dl , alkaline phosphate 98 iu / l , prothrombin time 14 second ( inr 1.21 ) , alpha - fetoprotein ( afp ) 15.01 ng / ml , and protein induced by vitamin k absence or antagonist - ii ( pivka - ii ) 864 mau / ml . \n hepatitis b virus surface antigen ( hbsag ) and hepatitis b e antigen ( hbeag ) were positive . \n hepatitis b e antibody ( hbeab ) , hbv - dna with polymerase chain reaction , and serological markers of hepatitis c were negative . \n he belonged to child - turcotte - pugh class a. for evaluation of the pelvic mass , computed tomography ( ct ) and magnetic resonance imaging ( mri ) scans were performed . \n they demonstrated a 1310 cm expansile mass that involved the right iliac bone ( fig . \n 1 ) . the patient underwent an incisional biopsy with the impression of a malignant bone tumor . \n however , on pathological examination , the tumor was composed of polygonal cells with ample cytoplasm and trabecular pattern . in immunohistochemical stains , these tumor cells were positive for cytokeratin ( ae1/ae3 ) , hepatocyte paraffin 1 ( heppar1 ) , and glypican-3 , which confirmed the diagnosis of hcc ( fig . \n tumor cells were negative for cd56 , chromogranin a and synaptophysin , which are the markers of neuroendocrine differentiation . to find the primary focus , abdominal ct , mri , positron emission tomography ( pet ) \n we diagnosed this case as an isolated metastatic hcc of the pelvic bone without the presence of a primary cancer in the liver . \n surgical resection of the tumor was recommended , but the patient refused an operation because of old age and the large size of the tumor . \n he started radiotherapy in the pelvic area with a total dose of 5,100 cgy in 17 fractions . \n one week after the end of radiotherapy , transarterial chemoembolization ( tace ) was performed in the metastatic hcc of the pelvic bone via the right internal iliac artery ( adriamycin 50 mg and 20 ml of lipiodol ) . \n then , the patient was treated with five cycles of systemic chemotherapy based on 5-fluorouracil ( 5-fu , 1,000 mg / m on days 1 , 2 , and 3 ) and cisplatin ( 90 mg \n / m on day 2 every 4 weeks ) . after the completion of chemotherapy , the tumor became almost necrotic . \n the afp and pivka - ii levels decreased to the normal ranges ( 2.85 ng / ml and 28 mau / ml , respectively ) . \n as the treatment resulted in near complete regression of the tumor , the patient underwent close follow - up without chemotherapy . \n however , 12 months after chemotherapy , a ct scan revealed multiple lung metastases in both lungs with increasing afp and pivka - ii levels ( 182 ng / ml and 38 mau / ml , respectively ) . \n he was treated with two cycles of systemic chemotherapy with the same regimen ( 5-fu 1000 mg / m on days 1 , 2 and 3 and cisplatin 90 mg / m on day 2 ) . \n after two cycles of chemotherapy , the patient refused additional chemotherapy and we provided him with supportive care thereafter . even though the lung metastases were newly developed , primary \n hcc had not been detected in the sequential radiological examinations , including abdominal ct and pet ct scans . \n in this case , the final diagnosis was an isolated pelvic bone metastasis from hcc with unknown primary origin . \n extrahepatic metastases from unknown primary hcc are exceptionally rare and only a few case reports of bone metastasis have been documented.4 - 9 the hypothesis for explaining this unusual phenomenon is that the metastases are from a microhepatocellular carcinoma , which regressed spontaneously or was destroyed by the activated immune system.6,7,10 however , the carcinogenesis mechanism as well as the natural history of this rare phenomenon is not well - known yet.7 thus , the diagnostic approach and treatment have been performed on an individual basis . \n although the nature of tumor cell could be confirmed by histological examination including immunohistochemical stains , we had to make a differential diagnosis with hepatoid adenocarcinoma and hcc development from ectopic liver.11 - 13 indeed , as there is no specific pathologic finding that could distinguish metastatic hcc from hepatoid adenocarcinoma or hcc arising from ectopic liver , information about involved organ , the presence of chronic liver disease and the degree of liver disease have been used as additional basis for differential diagnosis in previous studies.4 - 9 for example , reporting on a case of hcc in chest wall without unknown origin , asselah et al4 made a final diagnosis of hcc arising in ectopic liver tissue , considering that the patient was not at high risk factors of hcc development and that the tumor developed in only parietal muscular tissue , which is an uncommon site for an hcc metastasis . in our case , we also had to make a diagnosis considering not only the pathological examination but also the clinical features of our case , even though we made a different diagnosis comparing from previous case . \n at first , in our case , neither hepatoid cells with large eosinophilic cytoplasm nor normal liver tissue was observed at microscopic histological examination , which could be shown in hepatoid adenocarcinoma or hcc arising from ectopic liver.9,14 second , 1 year after treatment , new metastases developed in lung , which is the most common metastatic site of hcc.3,15 in previous studies , lung metastases from hepatoid adenocarcinoma or hcc arising from ectopic liver have rarely been reported.16,17 moreover , to our knowledge , there is no report that hepatoid adenocarcinoma or ectopic liver developed from pelvic bone , even though they can originate from various organs.14,16,18 for these reasons , we made a final diagnosis of metastatic hcc with unknown primary hcc . \n however , we admit that our diagnosis may not be definitely confirmed in that histological was insufficient , as the specimen obtained from an incisional biopsy did not have non - cancerous tissue . \n it can also be argued that a liver biopsy would be necessary for evaluating primary hcc in the liver . \n coban et al19 reported a patient who presented an isolated extrahepatic hcc of the chest wall without a primary focus . \n the patient had hbv - related liver cirrhosis , and a diffusely nodular and heterogeneous echogenic pattern was shown in ultrasonography , but there was no evidence of hcc in the liver \n . however , a liver biopsy was performed , and histological examination confirmed a diffuse type of hcc . \n but , we thought that the benefit of a biopsy was uncertain in our case because the patient had no clinical evidence of liver cirrhosis , and the liver parenchyma was smooth without a mass or infiltrating lesion . \n moreover , we performed ct , mri , pet scans , and angiography to find primary hcc , but no evidence of a primary liver tumor was found . \n however , even though a primary tumor was not found in our case , an intensive search for primary hcc should be carried out when extrahepatic metastasis is observed as the initial presentation . \n although there is no standard treatment for extrahepatic metastasis without a primary focus , aggressive treatment including surgical resection results in good prognosis if a solitary lesion exists.4,6,8,9 iosca et al6 reported a case that presented with an isolated left iliac bone metastasis from a primary unknown hcc . \n instead , we treated him with combined modalities including radiotherapy , tace and systemic chemotherapy . \n although chemotherapy and radiotherapy have not been demonstrated to increase the survival rate of hcc patients with bone metastasis , their ability to reduce pain and to increase quality of life has been reported in previous studies.15,20 in our case , back and leg pain were relieved after treatment . \n moreover , tace was performed without complications to the pelvic bone metastasis in our case . \n indeed , tace was successfully performed for bone metastasis of hcc in previous studies,6,21 and these results suggest that tace could be considered as a treatment option for a bone metastasis from hcc . \n even though multiple lung metastases developed , the tumor was well controlled for 12 months after the treatment . in conclusion \n , we think that individualized and multimodality treatment would be beneficial in such cases . in summary , we reported a rare case of metastatic hcc of the pelvic bone without a known primary origin . \n in such cases , tissue biopsy and radiological examination should be performed and diagnosis should be made based on both pathological examination and clinical features .", "role": "user" }, { "content": "reports of metastatic hepatocellular carcinoma ( hcc ) without a primary liver tumor are rare . here \n we present a case of isolated hcc that had metastasized to the pelvic bone without a primary focus . a 73-year - old man presented with severe back and right - leg pain . \n radiological examinations , including computed tomography ( ct ) and magnetic resonance imaging ( mri ) , revealed a huge mass on the pelvic bone ( 1310 cm ) . \n he underwent an incisional biopsy , and the results of the subsequent histological examination were consistent with metastatic hepatocellular carcinoma . \n the tumor cells were positive for cytokeratin ( ae1/ae3 ) , hepatocyte paraffin 1 , and glypican-3 , and negative for cd56 , chromogranin a , and synaptophysin on immunohistochemical staining . \n examination of the liver by ct , mri , positron - emission tomography scan , and angiography produced no evidence of a primary tumor . \n radiotherapy and transarterial chemoembolization were performed on the pelvic bone , followed by systemic chemotherapy . \n these combination treatments resulted in tumor regression with necrotic changes . \n however , multiple lung metastases developed 1 year after the treatment , and the patient was treated with additional systemic chemotherapy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: patients with end - stage renal disease ( esrd ) who receive dialysis confront the burdens of long - term illness and numerous physical problems . \n the selected patients from gorgan dialysis centre were randomly assigned into an empowerment group ( n = 40 ) and a control group ( n = 40 ) . \n instruments comprised scales of empowerment and the strategies used by people to promote health ( supph ) . \n the data were analyzed by descriptive and inferential statistics through spss ( version 17 ) . \n the results indicate that scores of the empowerment ( p 0.001 ) and self - care self - efficacy ( p = 0.003 ) in the empowerment group showed a significantly greater improvement than the control group . \n the study supports the effectiveness of the empowerment program to promote empowerment level and self - care self - efficacy of hemodialysis patients . \n chronic renal failure ( crf ) is a process of noticeable consistent and irreversible decrease in the number of nephrons , which can lead to end - stage renal disease ( esrd ) . \n they should not only know about the disease and its treatment , but also handle it and adapt to various changes in their lifestyles and behaviors in their life . coping with this disease , \n its treatment complications , and promotion of patients quality of life need patients participation in treatment and care , which is a product of an increase in their knowledge , a change in their attitude , and attaining self - care skills . \n numerous researches have already shown that patients education brings about health provision and decreases complications of the chronic diseases . in the past , \n most of the health - related professional education used to be designed based on a medical model to solve acute problems in health provision . \n meanwhile , former researches have constantly shown that the patients can not follow the lifestyle decided and defined by others . \n crf patients education has gradually moved from mere knowledge toward interactive method in self - care and decision making . \n 1990 ) suggested the approach in which the role and responsibility of the patients in their daily care is increased , which is now known as patients empowerment program training model versus traditional medical model . \n jones and meleis ( 1993 ) defined empowerment as a concept of social process in detection , promotion , and enhancement of individual 's ability in confrontation with needs , as well as problem solving and getting equipped with the necessary resources to manage their life . \n ( 1999 ) respect empowerment philosophy as enabling the patients to make informed decisions and play an active role in programming and decision making in their health - related activities . based on bandura 's self - efficiency theory , \n an individual 's perception from their abilities brings about their attaining self - care behavior to achieve the desired results . \n the patients who are self - confident about their abilities in administration of self - care are more interested in doing these duties . \n although empowerment researches are limited in esrd patients , the results of administrated empowerment programs have proved their effect in crf patients . in a study of tsay and hung ( 2004 ) , the effect of empowerment program on empowerment level and self - care self - efficacy in patients undergoing hemodialysis was shown . \n now , this study has tried to answer the question of how much do the patients feel capable of following self - care behavior if they attain empowerment ? \n the population studied included 80 male and female crf patients who had a file in dialysis center of panje azar hospital in gorgan , iran , referring to the center for dialysis . \n the sample size was calculated as 80 subjects based on the article of tsay and hung with a power of 80% and p value of 5% . \n convenient random sampling was utilized to select the subjects . after obtaining consent from the selected subjects , \n they were randomly divided into two groups of study ( n = 40 ) and control ( n = 40 ) . \n the data were collected by a three - section questionnaire : 1 ) personal characteristics and the data about the disease ( age , sex , education level , marital status , occupation , and the time of undergoing dialysis ) ; 2 ) empowerment scale ( es ) ; and 3 ) the strategies used by people to promote health ( supph ) . \n the questionnaire of empowerment was designed in english by michigan diabetes research and education centre in 2000 . in the present study , \n the brief form of diabetes empowerment questionnaire ( an 8-item tool ) was used . in the study of tsay and \n hung , this tool was used for the patients undergoing hemodialysis , after some lexical changes and confirmation of validity and reliability were made . to calculate validity based on the standard method , \n the respondents , based on the answer related to their condition , chose a number from 1 to 5 ( absolutely disagree = 1 to agree = 5 ) . the second questionnaire ( supph ) \n this questionnaire was also translated to persian and back translated to english , and finally its level of consistency was calculated . \n reliability of the questionnaires was tested through random distribution of the questionnaires to 20 patients undergoing hemodialysis , who were different from the study and control groups . \n internal correlation of empowerment and supph questionnaires were r = 0.86 and r = 0.93 , respectively . \n educational intervention included empowerment program in which anderson and funnell five - study process was used ( problem precise search , emotions expression , detecting long - term goals , designing a program to achieve the goals , and evaluation ) . \n the patients were divided into educational groups , and educational sessions were held for them twice a week for 1 month . \n the sessions tried to provide the patients with more opportunities to learn through their struggles about the disease , its related emotions , and efficient strategies . \n the filled questionnaires were picked up once before the intervention and once 6 weeks after that . \n the data were analyzed by descriptive and inferential statistics through spss ( version 17 ) . \n the subjects comprised 80 patients undergoing hemodialysis . demographic characteristics of the subjects have been presented in table 1 . \n demographic characteristics of the subjects the subjects mean age was 47.9 ( 12.62 ) years , and 57.5% of the subjects were females , 75% were married , and 40% were jobless . \n about 53.8% were illiterates or had primary school education , and 31.3% used to undergo hemodialysis for over 36 months . \n there was no significant difference between the study and control groups ( p > 0.05 ) . \n the variables before and after intervention have been presented in \n table 2 . as indicated in the table , \n the mean scores of empowerment level of these patients in crf are low in both groups ( m = 53.21 ) . \n mean score of self - care self - efficacy was m = 53.21 , which is low . \n pearson correlation test was used to investigate the association between empowerment level and self - care self - efficacy . \n this test showed that there was a direct significant association between empowerment level and self - care self - efficacy of the patients studied before intervention ( r = 0.54 , p 0.001 ) so that patients self - care increased by increase of empowerment level . \n the t - test was used to investigate the effect of intervention on empowerment level . \n comparison of differences in total scores in both groups revealed that the increase of empowerment level scores in the study group was significantly different compared to the control . \n mean score differences of empowerment level before and after intervention was 4.8 in the study group and 0.5 in the control group ( t = 6.3 , p 0.001 ) . \n the t - test was used to compare the mean scores of self - care self - efficacy in each group ( study group showed a higher mean after intervention ) . \n mean score differences of self - care self - efficacy before and after intervention were 7.99 and 0.63 in the study and control groups , respectively ( t = 3.09 , p = 0.003 ) . \n comparison between mean and sd of empowerment and self - care self - efficacy in study and control groups before and after intervention \n one of the hypotheses of the present study was when the study group receive empowerment program , the subjects would benefit from a higher empowerment level and a better self - care self - efficacy , which was proved as there was a significant difference in mean scores of empowerment level and self - care self - efficacy . \n this difference can be as a result of the effect of empowerment program on the subjects , which concords with the results of tsay and hung 's study . \n anderson et al . studied a group of diabetic patients who attended empowerment educational sessions and attained better power to cope with socio - psychological concerns accompanied with diabetes . \n it should be noticed that the level of empowerment in the present study was lower before intervention compared to other studies from other countries . \n for instance , in the study of tsay and hung , the level of empowerment was reported to be moderate , but in the present study , this level was lower . \n superficial and inadequate education can be the reason for this issue , which can be absolutely promoted through new methods such as empowerment . in the present study , \n the patients who underwent empowerment program experienced higher level of self - care self - efficacy , which is consistent with study of tsay and hung . as a tight association \n was observed between self - care self - efficacy and the level of empowerment , it can be concluded that the empowered patients were more confident about their abilities in self - care . \n argue that self - management and self - efficacy are among the empowerment process outcomes which are related to the disease and treatment . \n lev and owen also reason that the patients who are more assured about administration of self - care behavior are more interested to follow that . \n the results of this study showed that the level of empowerment and self - care self - efficacy was increased after conducting empowerment program . \n it can be concluded that nurses should consider that patients education based on empowerment program is a modern educational method in which the patients can exchange their experiences in addition to having active participation in learning .", "role": "user" }, { "content": "background : patients with end - stage renal disease ( esrd ) who receive dialysis confront the burdens of long - term illness and numerous physical problems.materials and methods : this was a quasi - experimental study . \n the selected patients from gorgan dialysis centre were randomly assigned into an empowerment group ( n = 40 ) and a control group ( n = 40 ) . \n instruments comprised scales of empowerment and the strategies used by people to promote health ( supph ) . \n data were collected at baseline and at 6 weeks following the intervention . \n the data were analyzed by descriptive and inferential statistics through spss ( version 17).results : the results indicate that scores of the empowerment ( p 0.001 ) and self - care self - efficacy ( p = 0.003 ) in the empowerment group showed a significantly greater improvement than the control group.conclusions:the study supports the effectiveness of the empowerment program to promote empowerment level and self - care self - efficacy of hemodialysis patients .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 22-year - old woman was referred for abdominal discomfort and urinary frequency , and at abdominal sonography a huge cyst was detected in the left lower quadrant . \n the left abdomen contained a palpable mass , but digital rectal examination revealed nothing of significance . \n plain radiography revealed a large soft tissue mass lying in the left abdomen ( fig . \n 1a ) , and abdominal ct showed a homogeneous unilocular cystic mass lying anterior to the left kidney , which was compressed and shifted posteriorly by it ( fig . \n the mass had a thin , enhancing rim , caused the left ureter to shift laterally ( fig . \n 1c ) , and extended to the level of bifurcation of the left common iliac artery ( figs . 1d , e ) . \n the patient 's serum ca 19 - 9 level was less than 5u / ml , and ca 125 was 17u / ml , each within the normal range . a benign retroperitoneal cyst such as a lymphangioma or mesenteric cyst was thus the more probable differential diagnosis ; a neoplasm originating from the ovary or pancreas was less likely . via the left paramadian approach , the mass was surgically excised , and was found to measure 2013 cm . \n it ruptured during the procedure , and light yellowish , slightly mucous fluid was aspirated . \n the gross specimen consisted of a 1 - 5mm - thick cystic wall , lined by papillary fronds of glandular epithelium with a ciliated border and containing arrays of smooth muscle ( figs . \n tailgut cyst , or retrorectal hamartoma , is a congenital lesion believed to originate from the remnant of the tailgut . during its development \n the embryo possesses a true tail , which reaches its largest diameter at the ' 35th ' day of gestation . \n the anus develops above the tail on the ' 56th ' day , by which time the latter has completely regressed . \n remnants of the tailgut or neurenteric cord may be the origin of tailgut cysts ( 8) , and these thus occur in the anatomic region where tailgut vestiges presumably would reside ( 2 ) . \n most tailgut cysts are located in the presacral retrorectal space , and one report has described a retrorectal tailgut cyst with a daughter lesion in the perirenal area ( 2 ) . \n we believe that exophytic lateral growth from the retrorectal space or vestiges of the neurenteric canal adjacent to the left kidney is the possible cause of an unusual perirenal location . \n the differential diagnoses of retrorectal masses include a diverse entity of congenital inflammatory , neurogenic , osseous , or other miscellaneous tumors , among which the characteristics of teratoma , epidermoid and dermoid cyst , rectal duplication cyst and anal cyst may be similar to those of tailgut cyst . \n epidermoid and dermoid cysts are usually unilocular and are lined by stratified squamous epithelium ; the latter have dermal appendages but the former do not . \n duplication cysts are also unilocular and are lined by epithelium similar to that of the gastrointestinal and respiratory tracts . \n the epithelium , often with villi , crypts and glands , simulates normal mucosa of the gut . \n the main distinctive feature is a well - formed muscular wall overlying two layers of muscular bundles containing a nerve plexus . \n tailgut cysts are usually multicystic or multiloculated , and are lined by a wide variety of epithelia which varies from cyst to cyst , or even within the same cyst , and includes the stratified squamous , transitional , stratified columnar , ciliated pseudostratified columnar , and gastric types . in most cases the cyst contains focal , well - formed smooth muscle fibers ; the muscle bundles , however , are often disorganized and are present focally , unlike the well - formed continuous two - layer muscle coat seen in duplication cysts ( 3 ) . in our case , \n papillary fronds of glandular epithelium with a ciliated border lined the cystic wall , which also contained arrays of smooth muscle . \n focal positive staining for smooth muscle was , in addition , detected immunohistochemically . at ct , \n tailgut cyst has been reported as a well - margined retrorectal mass with varying attenuation values . \n most cases do not involve calcification , the detection of which may favor the diagnosis of a dermoid cyst , teratoma , or other tumor of osseous origin . for differentiation between this cyst and other malignanct tumors , the presence , at ct , of a smooth margin and the absence of invasion of surrounding structures is also helpful . \n if however , the locules contain inflammatory or keratinized debris , differentiation between a cyst and a solid mass may be difficult ( 5 , 6 ) . at mri , \n tailgut cysts are seen as unilocular and well circumscribed at t1-weighted imaging and homogeneously hyperintense at t2-weighted imaging ( 1 ) , or have a multilocular honeycomb appearance with thin internal septation ( 5 ) . \n the mri appearance of an epidermal cyst in the retrorectal space has also been described as unilocular ( 10 ) . for the evaluation of a retrorectal mass , \n the ability of mri to detect calcification is limited , particularly where the exclusion of dermoid cyst or teratoma would be helpful . \n using fat suppression techniques , however , mri can reliably diagnose fatty tumors , and because of high intrinsic tissue contrast , solid components can more easily be excluded ( 5 ) . \n tailgut cysts most commonly involve middle - aged women , but can occur at any age , including infancy . \n they may present as an asymptomatic mass during physical examination or at childbirth , and if infected , are often misdiagnosed as pilonidial cyst , anorectal fistula , or recurrent retrorectal abscess . \n discomfort while sitting , and rectal bleeding , are common symptoms ( 3 , 6 ) , and malignant change , a rare complication , has occasionally been documented ( 3 ) . the clinical significance of a tailgut cyst mainly concerns the morbidity that can result if its true nature is not suspected and definite surgery is not undertaken . \n the potential for infection , the recurrence of perirenal fistulas , and the possibility of malignant transformation emphasize the importance of early complete surgical excision of these lesions ( 3 , 8 , 9 ) . in conclusion , \n typically , they occur in the presacral retrorectal space , but are also found , for example , in the perirenal space , where tailgut vestiges presumably would reside .", "role": "user" }, { "content": "the authors describe a case in which a tailgut cyst occurred at an unusual location in a 22-year - old woman referred for abdominal discomfort and urinary frequency . \n the left abdomen contained a palpable mass , found at imaging studies to be a homogeneous , unilocular and cystic , and anterior to the left kidney . \n after surgical excision , it was shown to be a tailgut cyst .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: sildenafil citrate ( pde -5 inhibitor ) as a vasodilator increases utero - placental blood flow and potentiates fetal growth . \n in this study , a case was examined and sildenafil was administered for her . it was found that sildenafil improved the uterine blood flow with a favorable fetal outcome at delivery . \n sildenafil , as a vasodilator has emerged as a potential management option in the treatment of intra uterine growth retardation ( iugr ) and preeclampsia by later normalization in velocimetric profile . \n fetal growth restriction ( fgr ) is a major cause of perinatal mortality and morbidity . \n fgr is a wide - ranging pregnancy problem with a number of possible mechanisms leading to reduced fetal growth . \n some pregnancies with fetal growth restriction have elevated peripheral maternal vascular resistance in uterine arteries and hence poor perinatal outcome . \n such pregnancies , if resistance values are normalized in later trimesters have a significantly better outcome ( 1 ) . \n sildenafil citrate increases uterine blood flow and potentiates estrogen - induced vasodilation ( 2 ) . in this paper , \n a case of early onset fetal growth restriction was reported where administration of sildenafil citrate could normalize the uteroplacental insufficiency with a favorable fetal outcome . \n a 32 year old g4p0l0a3 attended our out patient department ( opd ) in january 2013 with 12 weeks of pregnancy . \n she had regular antenatal check - ups , until 14 weeks ; she required an emergency cerclage for cervical incompetence . \n she had a normal anomaly scan with no other co - morbid condition . at 26 weeks and 3 days \n the case had reduced amniotic flow index with reduced umbilical artery diastolic flow , middle cerebral artery brain sparing effect and estimated fetal weight of around 600 gr . \n after 3 days showed absent umbilical artery end diastolic flow with brain sparing effect . in the umbilical artery doppler , \n pulsatility index ( pi ) was 1.28 , resistive index ( ri ) was 0.64 and systole / diastole ratio ( s / d ) was 3.47 . \n next , sildenafil citrate 50 mg bd was used and its amount gradually increased in 7 days to 50 mg tds with continuous fetal surveillance . \n doppler showed improved uteroplacental blood flow with estimated fetal weight of around 800 gr and hence pregnancy could be continued to another 3 weeks . \n now , pi was 0.81 , ri was 0.40 and s / d was 2.22 . with the diagnosis of fgr with uteroplacental insufficiency , \n unfortunately , doppler again showed absent end diastolic flow after a few days and 2 doses of 12 mg betamethasone injection were administered for her 24 hr apart . \n repeat doppler after 3 days showed reversed end diastolic flow . at a gestational age of 30 weeks , then , patient and her husband were counseled regarding the need for emergency caesarean section and the associated risks of perinatal morbidity and mortality . \n a live male baby of 800 gr was delivered and shifted to neonatal intensive care unit ( nicu ) for further management . \n after 80 days of nicu care , the baby was finally discharged healthy with a weight of 2.3 kg . \n after 1 month of discharge , mother and infant came for follow up and both were doing perfectly well . \n in pregnancies with fetal growth restriction and without preeclampsia , a reversible increased myo - metrial arterial tone by phosphodiesterase inhibition has been reported in vitro ( 3 ) . \n sildenafil citrate induces vasodilation through inhibition of type 5 phosphodiesterase ( pde5 ) ( 4 ) . \n therefore , inhibiting pde5 delays the breakdown of cgmp and increases vasodilation ( 5 ) . \n a recent report suggested that sildenafil citrate stimulates vasodilation in myo - metrial biopsies collected from iugr pregnancies at the time of cesarean section ( 4 ) . in this study , \n sildenafil with fetal growth restriction was used in an attempt to induce vasodilatation and improve uteroplacental perfusion resulting in improved doppler indices . \n to achieve optimal fetal growth , adequate blood flow in uteroplacental vascular function is essential . \n abnormal vasculature adaptation , resulting in aberrant blood flow , has been implicated as a possible cause of fetal growth restriction ( fgr ) though samangaya et al . ruled out prolonged pregnancy in women with preeclampsia using sil - denafil ( 7 ) . \n sildenafil , as a vasodilator has also emerged as a potential management option in the treatment of fgr and preeclampsia by later normalization in velocimetric profile . \n ", "role": "user" }, { "content": "backgroundpregnancies with early onset fetal growth restriction have poor perinatal outcome . \n sildenafil citrate ( pde -5 inhibitor ) as a vasodilator increases utero - placental blood flow and potentiates fetal growth.case presentationin this study , a case was examined and sildenafil was administered for her . it was found that sildenafil improved the uterine blood flow with a favorable fetal outcome at delivery.conclusionsildenafil , as a vasodilator has emerged as a potential management option in the treatment of intra uterine growth retardation ( iugr ) and preeclampsia by later normalization in velocimetric profile .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: age - related macular degeneration ( amd ) is the main cause of legal blindness ( visual acuity lower than 20/200 ) in the western world in people aged over 55 years . \n it is a degenerative and progressive macular disease that results in loss of central vision with significant functional impairment . \n the most severe vision loss occurs in the neovascular form of amd ( nvamd ) , involving choroidal neovascularization associated with retinal edema . even when amd does not lead to blindness \n worldwide , 25 million to 30 million people have severe visual loss due to amd . \n the prevalence of amd in spain is estimated between 1.3% ( 65 to 74 years ) and 5.7% ( aged 75 years ) of population , accounting for approximately 485.000 potential patients . \n since nowadays life expectancy is growing the prevalence of amd is likely to increase , hence its diagnosis and treatment might represent an important challenge . \n therapies currently approved for nvamd include laser photocoagulation , photodynamic therapy , and the new drugs capable of inhibiting vascular growth . the vascular endothelial growth factor ( vegf ) inhibitors demonstrated improved visual outcomes compared with other therapies , becoming the first - line therapy for nvamd . \n the phase iii marina and anchor trials with ranibizumab were designed with fixed monthly injections over a period of two years [ 7 , 8 ] . however , as this treatment strategy is difficult to undertake in the regular clinical practice , other alternative approaches have been proposed by some retina specialist societies from several european countries , like the spanish society of retina and vitreous ( serv ) , recommending an initial loading dose followed by maintenance injections on an as - needed basis ( prn : per re nata ) according to visual acuity and optical coherence tomography ( oct ) changes . likewise , three german ophthalmologic societies ( der retinologischen gesellschaft , der deutschen ophthalmologischen gesellschaft und des berufsverbands der augenrzte deutschlands e.v . ) and the prescription guidelines in france recommend an initial 3-month upload phase of monthly injections and retreatment to prevent disease progression if there is evidence of disease activity or vision deterioration . \n monitoring visits are recommended at monthly intervals following the upload phase in germany and in spain . \n although some recent clinical practice studies have assessed the compliance with these guidelines [ 1115 ] , nothing has been published regarding the spanish situation . in order to face the future needs of nvamd patients , \n therefore , the aim of the present study was to survey the diagnosis and management of patients with nvamd treated with antiangiogenic intravitreal therapy in terms of clinical practice in spanish public health centers . \n an observational retrospective study was conducted to assess the diagnostic management , therapeutic approach , and use of resources in spanish public health centers for patients with nvamd treated with ranibizumab or bevacizumab as first line . \n the inclusion criteria considered were ( 1 ) patients older than 18 years ; ( 2 ) patients diagnosed with nvamd on the first or second eye between february and june 2009 ; and ( 3 ) patients followed up since the diagnosis of nvamd in the same center . \n twelve ophthalmologists specialized in nvamd from different tertiary care public spanish hospitals participated in this study . \n patients were selected consecutively to avoid selection bias and each one was observed for a maximum period of two years . the selected eye for \n whenever both eyes were diagnosed at the same visit , the studied eye was the one with better corrected visual acuity ( va ) . if va was the same , the right eye was then selected . \n the study was approved by the spanish agency of medicines and medical devices ( agencia espaola de medicamentos y productos sanitarios ) and the ethical review board of each participating center . \n clinical variables concerning the study eye were collected at baseline and at every follow - up visit , which could be treatment - related or not treatment - related . \n baseline visits recorded the number of times that a diagnostic technique ( biomicroscopy , fluorescein angiography ( fa ) , and oct ) was used . \n the aim of each follow - up visit was to perform a clinical assessment of the patient : symptoms , lesion size ( number of disc areas : < 1 , 1 - 2 , > 2 ) , foveal thickness ( measured in microns ) , macular thickness ( measured in microns ) , and va ( measured with snellen or etdrs charts ) . \n the type of treatment and dose administered for nvamd were also recorded , as well as the number of annual injections . \n the administration of an initial loading dose was considered as the injection of 3 doses in a period of maximum 60 15 days between the first and third doses of ranibizumab or bevacizumab . to assess \n the evolution of clinical variables several temporal frames were defined : 3 , 6 , 12 , and 24 months after the diagnosis of the study eye . \n the nearest follow - up visits to each temporal frame ( 1 month ) were included in the analysis of that frame . \n results were expressed as mean and standard deviation ( sd ) for the continuous variables and as the number and percentage of patients per category for categorical variables . \n the evolution of clinical variables was assessed by t - student or cochran's - q tests , depending on the variables characteristics ( continuous or categorical , resp . ) . \n early treatment diabetic retinopathy study ( etdrs ) scores were converted to snellen scores using a transformation table by patel et al . . \n thereafter , snellen fractions were approximately converted to letter count according to an equivalence table . \n data analysis was made using spss ( version 19 ) and sas software ( version 9.2 ) . \n a total of 221 patients fulfilled the inclusion criteria and 208 were finally included in the analysis . \n a summary of the sociodemographic characteristics of the study population and the study eye is provided in table 1 . \n of the 208 patients studied , 133 ( 63.9% ) had nvamd in only one eye and 75 ( 36.1% ) in both . smoking history was observed in 19.7% of patients : current smoker ( 5.8% ) and former smoker ( 13.9% ) . \n the referral of patients was to general ophthalmologists or other retina specialists in 68.3% of cases , emergency services in 23.6% of cases and general practitioners or optometrists for the rest of the patients . \n a total of 95.7% , 76.4% , and 93.8% of patients underwent biomicroscopy , fa and oct , respectively . of note , 67.8% of cases underwent all the three techniques to establish the diagnosis of nvamd . \n the mean time between the appearance of symptoms and the diagnosis of the study eye was 1.9 2.3 months . \n the administration of first - line treatment took place 14.9 29.6 days after diagnosis in average . \n the decrease of foveal thickness was in average 87.80 85.88 m , 85.29 97.74 m , 82.24 104.01 m , and 83.73 126.52 m at 3 , 6 , 12 , and 24 months after diagnosis . \n the decrease of macular thickness was in average 34.81 48.72 m , 37.16 66.50 m , 35.26 61.73 m , and 27.92 56.44 m at 3 , 6 , 12 , and 24 months after diagnosis . \n thus , at baseline , the mean of foveal and macular thickness was 368.55 125.14 m and 304.59 63.41 m , respectively . and \n at the end of the study , mean foveal and macular thicknesses were 267.12 104.18 m and 265.71 30.70 m , respectively . \n mean va gains of + 6.45 12.93 , + 3.84 15.17 , + 2.41 16.59 , and + 3.13 19.64 letters were observed at 3 , 6 , 12 , and 24 months of follow - up compared with baseline , respectively ( figure 1 ) . \n thereafter , the response decreased until one year of follow - up , when stabilized above the baseline values until the end of the study . \n mean va observed at baseline was of 47.93 18.57 letters ( 0.25 or 20/80 approximately ) , and at the end of the study it was of 52.99 22.24 letters ( 0.35 or 20/63 approximately ) . \n patients who were treated early after the diagnosis ( less than 7 days ) gained va ( + 6.37 letters in average ) , whereas patients treated later than 14 days after the diagnosis lost va ( 4.41 letters in average ) ( p < 0.001 ) . \n a total of 2802 visits were recorded , of which 1230 were treatment - related . at the end of the study , patients had received on average 6.1 intravitreal injections of antiangiogenic drugs : 4.5 1.8 during the first year and 1.6 2.1 during the second year . \n overall , 14.7% of the visits were performed following the recommendation of monthly visits established by the serv . during the first and second years of the study a mean of 66.0 57.6 and 82.5 53.1 days between consecutive follow - up visits \n a mean of 5.4 2.8 and 3.6 2.2 follow - up visits were performed per patient during the first and second year , respectively . \n most patients received ranibizumab ( 96.2% , n = 200 ) as antiangiogenic treatment , although an off - label use of bevacizumab was also reported ( 5.3% , n = 11 ) . during the second year of follow - up about half of the patients ( 51.4% ) received antiangiogenic treatment ( 50% , n = 104 with ranibizumab ; 3.8% , n = 8 with bevacizumab ) for nvamd . \n a total of 105 patients ( 50.5% ) did not receive a loading dose . those patients with a loading dose ( 49.5% , n = 103 ) showed better results regarding final va and decrease in foveal and macular thickness over the follow - up period . in particular , mean va gains at 3 , 6 , 12 , and 24 months of follow - up among the group of patients who received a loading dose were + 9.06 12.92 , + 6.69 15.65 , + 5.75 17.86 , and + 4.93 20.31 letters , respectively ; whereas the group without an initial loading dose gained in average + 4.58 13.30 , 0.65 15.54 , + 2.64 16.22 , and + 4.14 17.84 letters at 3 , 6 , 12 , and 24 months of follow - up , respectively . \n thus , at the end of the study both groups showed similar va improvements ( figure 2 ) . \n the difference reported at 6 months of follow - up between both groups was statistically significant ( p = 0.0038 ) . \n total injections received per patient were similar in both groups : a mean of 4.3 2.1 and 1.6 2.1 injections were recorded in the group without an initial loading dose during the first and second years , respectively , and a mean of 4.7 1.8 and 1.6 2.1 injections were recorded in the other group during the first and second years , respectively . \n one particular participating center stood out among the others due to a more proactive treatment regimen , consisting of more treatment - related visits instead of follow - up visits . over the study period this center performed a mean of 10.8 treatment - related visits per patient against 5.3 for the rest of the centers . \n patients recruited ( n = 33 ) in this hospital obtained substantially greater va gains compared with patients of the rest of the centers . \n this observational retrospective study , performed in several public health centers in spain , identified that the management of patients with nvamd treated with vegf inhibitors in routine clinical practice was variable and far away from that recommended by the european specialist guidelines in terms of treatment - related and not treatment - related visits . \n for example , the serv guideline and three german ophthalmologic societies recommend a loading treatment initiation followed by monthly follow - up visits to detect early recurrences and perform prompt retreatments to avoid as much as possible the permanent anatomic and functional damage [ 9 , 10 ] . \n the results previously described showed that , at the end of the first year , patients gained in average only 2.4 letters from baseline and slightly more than 3 letters at the end of the study period . \n these gains are lower than those observed in the pivotal trials with fixed monthly regimen or strict prn schemes with monthly visits [ 18 , 19 ] . these differences can be explained by the wide variability found , which was related to time between first symptoms and diagnosis , time between diagnosis and initiation of treatment , and large follow - up visits intervals . \n the delay in the nvamd diagnosis is likely to be caused by a lack of knowledge about the disease , but the treatment delay could be due to the different regional health systems and the accessibility to them . \n the large follow - up visit intervals and the fall of the use of antiangiogenic treatment observed during the second year of the study might be due to the big clinical burden in the ophthalmology departments of the public health system in spain that makes a proper monitoring of the increasing nvamd population more complicated . \n the initial va gain observed at the first 3 months was mainly attributable to patients who received an initial loading dose . \n nevertheless , these patients gradually lost this greater gain and ended the follow - up period close to the gain achieved by the group of patients who did not receive the loading dose . \n this can be explained with the fact that , at the end of the study , both groups received a similar number of injections . as reported by the catt research group \n , the effect of initial monthly doses disappears once the treatment regimen is not strict and proactive . \n the maximum improvement observed in va at 3 months of follow - up is in accordance with other recent clinical practice studies in sweden , germany , denmark , and france , where a peak of va gain occurred after 3 months of treatment followed by a decrease of the response . \n few treatment administrations have been recorded in this study , and this fact could be explained by the low number of follow - up visits performed . as it has been reported in the catt study , a prn treatment approach for nvamd patients could offer similar results to fixed monthly injections during the first year of treatment . \n unfortunately , a monthly fixed regimen or monthly follow - up visits are hardly feasible in the current clinical practice due to the economic costs and/or the clinical burden in ophthalmology departments of the public health system in spain . therefore , further studies assessing the benefits and the costs associated to a stricter treatment regimen would be of interest . \n it is worthy to mention the case of the public hospital with the highest rate of treatment - related visits . \n this center performs a more proactive treatment approach than the rest of the centers as more treating than monitoring visits are performed . in addition , va outcomes obtained in this center are substantially better than the overall gains obtained in this study . \n although one center out of 12 is not representative , the results found in this hospital support the findings reported in other studies , such us the marina and anchor clinical trials that demonstrated efficacy of ranibizumab with monthly injections , and some recent studies , which demonstrated a higher response as the number of injections increases [ 20 , 21 ] . \n in addition , this approach consisting in lower number of follow - up visits but more treatment visits could be affordable to obtain good va results in overloaded health systems where monthly monitoring is not possible and the patient is exposed to large intervals between retreatment with vegf inhibitor drugs , thus increasing the chance of disease reactivation and irreversible damage accumulation . \n postponing retreatment until there is evidence of ongoing active disease might be leaving it too late . \n design limitations are those typically seen in retrospective studies , such as the lack of data in some medical records or the fact that the information is not directly collected from the patient . however , a retrospective design was the most appropriate in order to achieve the objectives of the present study . \n another consideration is concerning the two scoring systems ( snellen and etdrs charts ) , which are known to show differences , particularly in patients with nvamd and poor va . nevertheless , as values are shown in terms of changes in the scores , there is no risk of bias in the results . in conclusion , \n our results show the need for a more standardized approach in the management and diagnosis of nvamd patients treated with vegf inhibitors in spain . \n other clinical practice studies [ 12 , 13 , 15 ] achieved the same conclusion in other european countries . \n an early diagnosis , a proactive approach , and close follow - up monitoring might be the key to successfully manage this degenerative disease . \n earlier treatment including an initial loading dose followed by a stricter reinjection schedule could longer maintain va gains in better values . \n an effort should be made to increase the adherence to the retina specialist guidelines in order to offer the best va outcomes to nvamd patients , while new treatments or nvamd management are explored and validated . avoiding reactivation of the disease \n should be considered as an aim of the nvamd treatment instead of retreating disease reactivation , since a permanent damage is usually accumulated and never recovered , especially if the monitoring surveillance is not as often as it should be . due to treatment cost and the significant impact that vision loss can have on quality of life , economic evaluations comparing current clinical practice and stricter reinjection regimens could bring valuable information in order to help the decision making process and to standardize a more appropriate treatment schedules .", "role": "user" }, { "content": "purpose . to survey the management of patients with neovascular age - related macular degeneration ( nvamd ) in spain \n . methods . an observational retrospective multicenter study was conducted . \n the variables analyzed were sociodemographic characteristics , foveal and macular thickness , visual acuity ( va ) , type of treatment , number of injections , and the initial administration of a loading dose of an antiangiogenic drug . \n results . \n 208 patients were followed up during 23.4 months in average . during the first and second years , patients received a mean of 4.5 1.8 and 1.6 2.1 injections of antiangiogenic drugs , and 5.4 2.8 and 3.6 2.2 follow - up visits were performed , respectively . \n the highest improvement in va was observed at 3 months of follow - up , followed by a decrease in the response that stabilized above baseline values until the end of the study . \n patients who received an initial loading dose presented greater va gains than those without . conclusions . \n our results suggest the need for a more standardized approach in the management and diagnosis of nvamd receiving vegf inhibitors . to achieve the visual outcomes reported in pivotal trials , an early diagnosis , proactive approach ( more treating than follow - up visits ) , and \n a close monitoring might be the key to successfully manage nvamd .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in a study in the previous issue of critical care , thooft and colleagues investigated the impact of increasing mean arterial pressure ( map ) by norepinephrine ( ne ) on systemic hemodynamics and organ perfusion in a series of patients with septic shock . \n the increase in map from 65 to 85 mm hg was associated with increased cardiac output and mixed venous blood oxygen saturation ( svo2 ) and a decreased blood lactate level . \n the increase in map was also associated with improvement of the microcirculation state as assessed by near - infrared spectroscopy ( nirs ) at the thenar eminence level in 13 patients and by sidestream dark field ( sdf ) imaging at the sublingual level in 6 of them . \n nirs technology allows investigators to evaluate the functionality of the thenar eminence microcirculation through the measurement of the muscle tissue oxygen saturation ( sto2 ) and its changes in response to a vascular occlusion test ( vot ) . \n sdf videomicroscopy allows investigators to assess the sublingual microvascular blood flow and capillary density by using several indices . \n the presence of marked microvascular abnormalities detected by each of these techniques has been associated with increased mortality in septic shock . before being enrolled , \n the patients of thooft and colleagues had already been stabilized at an map of 65 mm hg with fluid therapy and ne administration and their svo2 was above 65% , in accordance with surviving sepsis campaign guidelines . \n although these goals appeared to have been achieved , severe derangements of organ perfusion were detected by both the nirs and sdf techniques . \n this agrees with the concept that , in septic shock , microcirculatory abnormalities can persist despite apparent correction of macrocirculatory abnormalities . \n however , it is still unclear whether the persistence of microcirculatory abnormalities at the early phase is related only to intrinsic septic organ / tissue injury or is a consequence of insufficient macro - hemodynamic resuscitation and , in particular , achievement of a still suboptimal organ perfusion pressure . \n current recommendations suggest an map of at least 65 mm hg given that , in patients with a history of hypertension or other vascular comorbidities or in those with increased abdominal pressure , a higher level of map may be required . \n however , increasing the doses of ne carries the theoretical double risk of ( a ) decreasing cardiac output and oxygen delivery through an increased afterload effect and ( b ) worsening tissue perfusion through excessive peripheral vasoconstriction . \n recent studies have evaluated the effects on cardiac output and organ perfusion markers of using ne to increase map from 60 ( or 65 ) mm hg to 85 ( or 90 ) mm hg in patients with septic shock [ 8 - 10 ] . \n all of the studies supported the idea that , in spite of the increase in cardiac output , achieving the upper map target is not always associated with a remarkable improvement in organ perfusion . \n in contrast to previous studies , the study by thooft and colleagues demonstrated that an map target of 85 mm hg might be more appropriate than 65 mm hg for the microcirculation . \n one of the strengths of the study is that these results were found by using two different techniques : nirs and sdf imaging . \n the higher sto2 reperfusion slope ( during a vot ) at the highest level of map suggests that some degree of microvascular recruitment occurred at this level , confirming results found in patients with severely hypotensive sepsis . \n in addition , increasing map from 65 to 85 mm hg significantly improved two of the sdf - derived indices : the perfused vessel density and the microvascular flow index . \n this suggests that both microvessel recruitment and microcirculatory blood flow increased at the map of 85 mm hg . \n these findings can be the result either of a proper perfusion pressure effect in some pressure - dependent areas or of the increase in systemic blood flow observed at the highest level of map . \n the association of increases in cardiac output with ne - induced increases in map is a common finding that has been reported previously [ 8 - 13 ] . clearly , the results of thooft and colleagues argue against the idea that , owing to excessive vasoconstriction , ne could exert deleterious effects on the microcirculation when an map of 85 mm hg is targeted . \n it is important to note that 85 mm hg is still low compared with map values of the healthy population , especially in the age group of the study by thooft and colleagues . because the sdf analysis was conducted on only 6 of the 13 patients in the study by thooft and colleagues , the interpretation of their data must be cautious . \n it must be underlined that , using study designs similar to that of thooft and colleagues in the early phase of septic shock , jhanji and colleagues and dubin and colleagues reported no overall change in sublingual sdf - derived variables with ne - induced increases in map ( above 60 mm hg in 16 patients and 65 mm hg in 20 patients , respectively ) . nevertheless , dubin and colleagues reported an inverse correlation between the baseline level of the sublingual microcirculation state and the microcirculatory response to the ne - induced increase in map from 65 to 85 mm hg . \n thus , septic patients with normalized microcirculation ( after initial hemodynamic resuscitation ) might not benefit from any additional increase in map above 65 mm hg . \n in contrast , septic patients with persistent altered microcirculation , though surviving sepsis campaign recommended endpoints are achieved , might benefit from a further increase in map beyond the ' magic ' value of 65 mm hg . \n the results of thooft and colleagues are in agreement with this sensible concept , which clearly needs to be implemented in clinical practice . \n this paper , like other recent ones , has the merit of bringing to light the idea that , at least during the early phase of sepsis , the microcirculation is not dissociated from the macrocirculation , despite what is claimed by pioneers of the microcirculation evaluation . \n more importantly , the paper suggests that bedside assessment of microcirculation might help clinicians to define the optimal level of macrocirculatory resuscitation targets ( for example , map and svo2 ) in each patient . \n map : mean arterial pressure ; ne : norepinephrine ; nirs : near - infrared spectroscopy ; sdf : sidestream dark field ; sto2 : muscle tissue oxygen saturation ; svo2 : mixed venous blood oxygen saturation ; vot : vascular occlusion test . \n ", "role": "user" }, { "content": "the surviving sepsis campaign guidelines suggest targeting a mean arterial pressure of at least 65 mm hg to maintain organ perfusion pressure during septic shock . however , the optimal mean arterial pressure can be higher in patients with a history of hypertension or other vascular comorbidities or in those with increased abdominal pressure . in a given individual , the adequate mean arterial pressure target can be difficult to define with the routine hemodynamic parameters ( for example , cardiac output , central or mixed venous blood oxygen saturation , and urine output ) . near - infrared spectroscopy and sidestream dark field imaging have emerged as promising technologies for monitoring the microcirculation at the bedside . \n these new methods could provide additional clues to help define the adequate blood pressure to target during the resuscitation phase of septic shock .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: nucleobase analogues , which are structurally \n similar to the canonical nucleobases adenine , guanine , cytosine , uracil , \n and thymine , play an important role in biochemistry . \n many nucleobase \n analogues are actively used as drugs for chemotherapy and various other diseases or as fluorescence markers in biomolecular research . \n oftentimes , the close structural relation \n to the parent nucleobases is responsible for the usefulness of a given \n nucleobase analogue . for example , many nucleobase analogues can substitute \n the canonical nucleobases in dna and thus affect the properties of \n dna . despite this structural similarity \n , the photochemical properties \n of nucleobase analogues can drastically differ from the ones of their \n parent nucleobases . \n the canonical nucleobases are known to exhibit \n ultrafast relaxation to the ground state after irradiation with uv \n light , which gives dna a high stability against uv - induced damage . \n in contrast , for a large number of nucleobase analogues , slow internal conversion to the ground state , luminescence , and intersystem crossing \n is reported . \n this difference is correlated with the fact that the \n excited - state potential energy surfaces ( pes ) are sensitive to the \n functionalization of the molecule and even small changes in the relative \n energies of the pes can lead to drastically different excited - state \n dynamics . \n for this reason , the incorporation of nucleobase analogues \n into dna can severely affect its photostability . thiated nucleobases \n ( thiobases ) , where one or more oxygen atoms of a canonical nucleobase \n are exchanged for sulfur , are a very good example of the above - described \n behavior . \n thiobases are found in several types of rna but also have been employed as drugs . \n for example , 6-thioguanine \n ( 6tg ) is a very important cancer and anti - inflammatory drug , listed \n as an essential medicine by the who . \n interestingly , \n a side effect of 6tg treatment is an 100-fold increase in the incidence \n of skin cancer , which has been attributed \n to its very different photochemistry in comparison with guanine . \n similarly , 2-thiouracil \n ( 2tu ) has been historically used as an antithyroid drug ( 6-n - propyl-2-thiouracil is currently \n listed as essential by the who ) and has \n shown some potential for the development of cytostatika , heavy - metal antidotes , or photosensitizers for photodynamical therapy . as with 6tg , the different photophysics and photochemistry \n of 2tu in comparison with uracil could lead to significant side effects \n in potential medical applications of 2tu . \n the \n uv absorption spectrum and excited states of 2tu have been studied \n in detail . \n the first band of the uv absorption spectrum has a maximum \n at approximately 270 nm , with the band extending to about 350 nm . additionally , this band shows either a shoulder or a second maximum \n at around 290 nm , depending on solvent . \n hence , a large portion of the absorption band lies in the uv b \n range . \n * state has been observed in the circular dichroism \n ( cd ) spectra of 2-thiouridine and 2-thiothymidine at about 320 nm , but analogous cd spectra \n for the nonchiral 2tu can not be measured . \n time - resolved spectroscopy \n of 2tu was reported in the microsecond regime and the femtosecond regime . \n for both \n 2tu and the closely related 2-thiothymine ( 2tt ) , all studies report a near - unity quantum yield for \n intersystem crossing ( isc ) and significant phosphorescence . \n isc leads \n to the formation of long - lived and often very reactive triplet states \n and is therefore responsible for the loss of photostability \n . moreover , \n in the presence of oxygen , reactive oxygen species ( e.g. , singlet \n oxygen ) can be generated , ultimately leading to dna damage in a biological \n environment . despite the solid evidence of the high isc rate \n of 2tu , \n the detailed mechanism leading to the population of the harmful \n triplet states is still not yet understood . \n pollum and crespo - hernndez reported ultrafast ( subpicosecond resolution ) \n transient absorption spectra of 2tu and found that the first step \n after excitation to the s2 ( * ) state , which is mainly responsible for the first absorption band , \n is an ultrafast ( < 200 fs ) internal conversion to the s1 ( n * ) state , from where isc occurs with a time constant of \n 300400 fs . from a theoretical point of view \n , the topology \n of the excited - state pes of 2tu was investigated in two recent studies . \n cui and fang reported a large quantity \n of excited - state minima and crossings , using the multiconfigurational \n caspt2//casscf methodology ( complete active space perturbation theory//complete \n active space self - consistent field ) and imposing planarity ( cs symmetry ) in almost all optimizations . \n they characterized three ( reportedly competing ) pathways : s2 s1 t1 , s2 \n t2 t1 , and s2 t3 t2 t1 . \n however , because \n it can be expected that most stationary points on the excited - state \n pes exhibit some degree of out - of - plane distortions , the isc mechanisms \n reported by these authors are not reliable . \n indeed , gobbo and borin ( also using caspt2//casscf ) found several nonplanar \n geometries , among them a * minimum \n and a conical intersection between * and s0 . \n even though the structural details were different \n than in the previous study , the latter \n authors also reported two similar mechanisms , s2 \n s1 t1 and s2 t2 t1 , as the most likely reaction pathways . \n although ultrafast transient absorption spectroscopy suggests s2 s1 t1 as the most probable pathway , it seems that \n a complete understanding of the photophysics of 2tu has not been reached \n yet . \n a clear identification of the relaxation pathway from theoretical \n calculations should be obtained by means of dynamical simulations , \n for example , using the surface hopping nonadiabatic method sharc(35,36 ) developed in our group , which allows for a simultaneous \n description of internal conversion and isc . as a reference for future \n excited - state dynamics simulations , \n in this paper we report a thorough \n account of all relevant excited - state minima and crossings of 2tu \n calculated at the highest affordable level of theory , i.e. , including \n electronic correlation by means of caspt2 , not only in the energy \n calculations but also in the determination of the geometries . \n this \n study therefore extends and complements the existing studies of cui \n and fang and gobbo and borin , providing the most accurate energies and geometries \n reported so far . \n moreover , the paths connecting the optimized structures \n were investigated using large - active - space and large - basis - set calculations \n to assess the viability of smaller active spaces and smaller basis \n sets for caspt2-based excited - state dynamics , which will be reported \n in an upcoming publication . \n experimental and theoretical \n studies confirm that 2tu exists in the gas phase and solution only \n in one tautomeric form , with a thione and a keto group and the prototropic \n hydrogens attached to the nitrogen atoms . \n hence , in this study we focus \n exclusively on this tautomer , whose structure and the numbering of \n all atoms are given in figure 1 . \n structure of the most stable tautomer of 2tu and atom numbering . to find all structures that might \n be relevant for the excited - state dynamics of 2tu , \n first , sa(4 + 3)-casscf(14,10)/def2-svp \n ( averaging over 4 singlet and 3 triplet states in a single casscf calculation ) was employed , using the molpro 2012 suite . \n second , using columbus 7 , we employed mrcis / cc - pvdz ( multireference \n configuration interaction including single excitations ) with a cas(6,5 ) \n reference space based on sa(4 + 2)-casscf(12,9 ) orbitals . \n both methods \n were used to optimize minima and crossing points between states of \n the same and of different multiplicity . \n third , the minima were additionally \n optimized using ms(3/3)-caspt2/cc - pvdz ( multistate caspt2 including 3 singlets or 3 triplets ) based on sa(4/3)-casscf(12,9 ) \n orbitals ( state - averaging over 4 singlets or 3 triplets \n in separate casscf calculations ) . \n these ms - caspt2(12,9 ) calculations were \n performed with molcas 8.0 , the ipea shift was set to zero and no level shifts were employed . at all \n levels of theory , the douglas kroll \n the composition \n of the various active and reference spaces is described in the next \n subsection . \n single - point energies were calculated at the same \n mrcis and ms - caspt2 levels of theory as used for optimizations . \n additionally , single - point calculations ( at geometries optimized with ms - caspt2(12,9 ) ) were performed using sa(6/4)-caspt2 , with the default \n ipea shift , no level shifts , and the dkh hamiltonian ( the complete \n procedure is abbreviated as ms - caspt2(16,12 ) in the \n following ) . for these calculations , \n the energies from the ms - caspt2(16,12 ) calculations serve as reference \n for the computationally much more efficient mrcis / cc - pvdz and ms - caspt2(12,9)/cc - pvdz \n computations . \n state dipole moments were calculated with single - state \n caspt2(16,12)/ano - rcc - vqzp , because they are not available at ms - caspt2 \n level of theory . \n figure 2 shows the orbitals of the largest active \n space employed in the cas(16,12 ) calculations , together with the composition \n of the reduced active and reference spaces used in this work . in the \n largest case \n , the active space contains all the and * \n orbitals , the no and ns lone pairs and the cs , cs * pair . \n the indices used in the orbital labels refer to the \n atom(s ) where the orbital is ( are ) mostly localized . \n the figure is \n organized such that in the upper row all orbitals corresponding to \n the acrolein moiety ( plus the cs ) are listed , whereas the lower row collects the orbitals localized \n on the thiourea moiety . \n the numerical indices of the orbitals refer to the atom where the \n largest part of the orbital is localized . except for the orbitals \n on the right \n , the upper row depicts the acrolein - like orbitals , whereas \n the lower row depicts the thiourea - like orbitals . at some geometries , it was not possible to obtain a correct \n cas(16,12 ) active space and \n thus the active space was reduced to cas(14,11 ) \n by excluding the no orbital . \n the reason for this exclusion \n is that at the affected geometries , the no * state \n is very high in energy and therefore would necessitate a larger number \n of states in the state - averaging procedure . \n however , because such \n a strategy would deteriorate the description of the more relevant \n lower states , the no orbital was eliminated from the active \n space . \n the cs , cs * pair is not relevant for the \n description of planar and almost planar geometries , but in the case \n of c2 pyramidalization these orbitals mix with the \n orbitals and hence should be included in the active space . yet , and \n as shown later , a cas(12,9 ) active space without the cs , cs * pair leads to a qualitatively correct description of the pess . \n for the mrcis level of theory , mainly used for the preliminary optimization \n of crossing points , a reference space cas(12,9 ) is still too large \n and hence was reduced to cas(6,5 ) , including the 5 , s , ns , 2 * and 6 * orbitals . \n table 1 presents the excited - state energies calculated at the ms - caspt2-optimized \n ground - state geometry . in the following , \n all numbers mentioned in \n the discussion are from the most accurate ms - caspt2(16,12)/ano - rcc - vqzp \n calculations , unless noted otherwise . \n casscf and ss - caspt2 results \n are available in the supporting information in table s1 . \n sa(4/3)-casscf(12,9 ) + ms(3/3)-caspt2/cc - pvdz , \n ipea = 0.0 au . sa(4 + 2)-casscf(12,9 ) \n + mrcis(6,5)/cc - pvdz . \n sa(6/6)-casscf(14,10 ) \n + ss - caspt2/ano - l - vdzp , ipea = 0.0 au . sa(4 + 3)-casscf(16,11 ) + caspt2/cc - pvdz , ipea = 0.0 au \n its calculated dipole moment is 4.29 \n d ( ss - caspt2 ) , which compares very well with the experimental value \n of 4.21 d. the lowest excited singlet \n state ( s1 ) of 2tu is the ns2 * state , where 2 * is the antibonding \n * orbital located mostly on the c2 atom . \n hence , \n s1 describes an excitation that is local to the thiourea \n moiety of the molecule ; the dipole moment of this state is very similar \n to the ground - state dipole moment ( 4.29 d at ss - caspt2 ) . \n the calculated \n vertical excitation energy is 3.77 ev ( the lower - level calculations \n in table 1 agree to \n within 0.1 ev ) . with an oscillator strength of approximately zero , \n however , \n in the cd spectra of 2-thiouridine and \n 2-thiothymidine the ns * \n state appears at 3.8 ev , which fits very well with the calculated \n energy . \n the s2 has s6 * character \n and describes an excitation from the s orbital , \n localized on the sulfur atom , to the 6 * orbital , which is mostly localized on \n c6 . as already noted in the literature , \n this is a charge - transfer state and hence it possesses \n a large dipole moment , 5.15 d ( ss - caspt2 ) . \n the energy of the state , \n 4.25 ev , is in line with the experimental value of 4.3 ev . \n the calculated \n oscillator strength is 0.35 and therefore , this state ( together with s2 * , see below ) dominates the low - energy side \n of the first band of the uv absorption spectrum . \n the third excited \n state ( s3 ) has no6 * character ; i.e. , \n it corresponds to an excitation from the oxygen lone pair to the * \n orbital mostly localized on c6 . unlike s1 and \n s2 \n , this state can not be described by the more economic \n ms - caspt2(12,9 ) and mrcis calculations because they both exclude the \n no orbital from the active / reference spaces . \n the energy \n of this state is 4.65 ev , comparable to the values of gobbo and borin and of cui and fang . \n because the oscillator strength of this state is close to zero , \n it should not contribute to the absorption spectrum . \n this state shows a comparably small \n dipole moment of 2.66 d. the fourth excited state ( s4 ) has s2 * character and is located at 4.72 \n ev . \n importantly , the values reported in the literature with lower \n levels of theory are underestimated and give rise \n to a different energetic order , where the s2 * is below no6 * in these studies . \n this difference is \n due to the use of the multistate caspt2 approach in our work , which \n allows the correct mixing of the states , in contrast to single - state \n caspt2 . in the ms - caspt2 calculations , \n the interaction of s2 * with the ground state leads to an increase \n in energy of s2 * , whereas no6 * is down - shifted due to the interaction with ns6 * ( s5 ) , leading to the different \n state ordering . \n s2 * carries a significant \n oscillator strength ( 0.15 , although 0.26 at ss - caspt2 level ) and together \n with s6 * is responsible for the double - peak \n form of the absorption spectrum , as seen in several solvents . \n the highest computed singlet \n state ( s5 ) is predicted at 5.16 ev and has ns6 * character . \n again , due to the use of ms - caspt2 ( ns6 * interacts with no6 * , leading to a \n blue shift of ns6 * ) this state is higher in energy \n than in the ss - caspt2 calculations of gobbo and borin . \n because the ms - caspt2(12,9 ) calculations do \n not describe the no6 * state , no blue - shifting of ns6 * occurs ; consequently , the ms - caspt2(12,9 ) \n value is comparable to the ss - caspt2 value of gobbo and borin . \n the lowest triplet state , t1 , of 2tu is of s2 * character at the franck condon geometry ; \n its energy is predicted to be 3.51 ev . this energy is slightly higher \n than the ms - caspt2(12,9 ) result and the value reported by gobbo and \n borin . \n the t2 state is of ns2 * character ( and hence the triplet counterpart \n of s1 ) and is located at 3.88 ev . \n the third triplet state \n t3 , with an energy of 4.11 ev , involves an excitation from \n a orbital localized on the c5=c6 bond to the antibonding 6*. finally , the last triplet state calculated , \n t4 , has an energy of 4.85 ev and , being the counterpart \n of s3 , is dominated by no6 * character . unlike \n with the singlet states , all employed methods predict the same energetic \n ordering of the lowest triplet states . \n compared to the most \n accurate ms - caspt2(16,12 ) results , the ms - caspt2(12,9 ) values and \n the ss ones given by gobbo and borin systematically \n predict lower excitation energies , especially for the triplet states . \n this discrepancy can be largely attributed to the different zero - order \n hamiltonian ( ipea shift ) used in these calculations . setting the ipea \n shift to zero ( as in the ms - caspt2(12,9 ) \n calculations and in ref ( 34 ) ) systematically stabilizes open - shell states and hence \n predicts excitation energies too low . as shown by some authors , combining low - quality ( double- ) basis sets with an ipea shift \n of zero can lead to significant error compensation , because small \n basis sets tend to increase the excitation energy , counteracting the \n effect of neglecting the ipea shift . \n furthermore , the multistate treatment \n in our ms - caspt2(16,12 ) calculations increases most of the excitation \n energies , because the ground state is stabilized by the interaction \n with the * states . \n though all the caspt2 calculations give qualitatively similar results , \n the mrcis calculations do not accurately describe the excited states \n of 2tu , indicating the need of a higher excitation level or a larger \n reference space . \n the inclusion of only single excitations is thus \n not optimal for the excited - state dynamics of 2tu , despite the appealing \n fact that mrcis - based dynamics would be much cheaper than caspt2-based \n dynamics . \n one advantage of mrcis is , though , that it can be used to \n optimize crossing points including some dynamical correlation ( unlike \n casscf ) , whereas these optimizations are currently not possible with \n caspt2 . \n notably , the oscillator strength of the * states obtained by the different levels of theory differ considerably . \n although mrcis and ref ( 34 ) predict the s2 * state to be the brightest , the \n ms - caspt2(16,12 ) calculations suggest that the lower - energy s6 * state is brighter ( 0.35 for s6 * vs 0.15 for s2 * ) . \n this behavior is due to the \n ms - caspt2 treatment , because at ss - caspt2 the oscillator strengths \n are approximately equal ( 0.25 vs 0.26 ; table s1 in the supporting information ) . \n the oscillator strengths \n were also computed with eom - ccsd / cc - pvtz using molpro ( results given in table s1 ) and it was \n found that the lower - energy s6 * state is also \n brighter ( 0.39 vs 0.08 ) , in agreement with the ms - caspt2(16,12 ) calculation . \n intriguingly , the experimental absorption spectra show two maxima with approximately equal \n intensity or a band with a shoulder , depending on the solvent . unfortunately , \n with the present calculations , it is not possible to distinguish whether \n the experimental spectrum can be assigned to two states of similar \n oscillator strengths ( and therefore the ms - caspt2 and eom - ccsd intensities \n are incorrect ) or due to two states of different oscillator strengths \n gaining comparable intensity by vibronic effects . in summary , \n it was shown that our best ms - caspt2 vertical excited - state calculations \n are in excellent agreement with experiment . \n smaller - scale ms - caspt2 \n calculations , employing smaller basis sets and active spaces , can \n also describe the lowest excited states reasonably well , although \n it has to be stressed that this accuracy is partly due to error compensation , \n where smaller basis sets lead to higher excitation energies , whereas \n setting the ipea shift to zero results in lower excitation energies . \n furthermore , it has been shown that the inclusion of all relevant \n orbitals within an ms - caspt2 calculation is necessary to obtain all \n excited states and the correct energetic ordering . in the following , \n we focus on the relaxation of 2tu after excitation to the lowest bright \n state , s6 * ( s2 ) . assuming that \n the excited states above s2 do not play a role in the deactivation \n path , \n they are not included in the ms - caspt2(12,9 ) calculations . in \n the ms - caspt2(16,12 ) calculations , higher states are still included \n to scrutinize that this assumption is correct ( table s2 in the supporting information ) . using ms - caspt2(12,9 ) , minima for the s0 , s1 , s2 , and t1 states have been optimized . in \n the case of s2 and t1 , two different minima \n have been found in each state , corresponding to the s2 * and s6 * , as well as s2 * and s6 * characters , hinting at avoided crossings \n with higher states . \n the obtained geometries are depicted in figure 3 and the relevant \n geometrical parameters are reported in table 2 . to avoid confusion , \n the energies \n of all states at all geometries are given in the supporting information in table s2 . \n prototypical geometries of the critical points of 2tu . below the \n label for each geometry , we list states whose minima / crossings are \n related to the respective geometry , e.g. , the minimum of s6 * and the ns2*/s6 * crossing have geometries similar to ( c ) . \n q is the puckering amplitude;b is the boeyens symbol \n for six - membered rings . \n energies are in ev , r and q in , and angles a and pyramidalization \n angles p ( defined in the supporting information ) in degrees . \n states are labeled according to energetic \n order ( s0 , s1 , ... ) and wavefunction character . \n we note here \n that all energies mentioned in the following are from the ms - caspt2(16,12)/ano - rcc - vqzp \n calculations , with the ms - caspt2(12,9)/cc - pvdz energies given in parentheses . \n n \n bonds ( r12 , r23 , r34 , r61 , recall figure 1 ) \n are approximately equal , with values from 1.38 to 1.42 . \n the \n c c bonds have r45 = 1.46 \n ( single bond ) and r56 = 1.36 ( double \n bond ) . \n these and all other bond lengths compare reasonably well to \n the best - estimate values of ref ( 40 ) , but our bonds are systematically too long due \n to the use of a double- basis set in the optimizations . compared to the ground - state minimum , the minimum of the ns2 * ( s1 state ) shows no major differences in the bond \n lengths , except for the c2=s bond , which is much \n longer than for s0 . \n the most important geometrical feature \n of this minimum is the strong pyramidalization at c2 , leading \n to the sulfur atom being strongly displaced out of the molecular plane \n ( figure 3b ) . although \n the ring itself is still almost planar , a slight puckering of the \n c2 atom away from the sulfur atom is noticeable ( e2 in boeyens notation ) . \n the minima of s2 * ( s2 ) and s2 * ( t1 ) are structurally \n very similar to the ns2 * minimum ( also figure 3b ) , because in all these states \n the 2 * orbital is populated . \n these minima also feature a mostly planar \n ring with bond lengths and angles similar to the those of the ground \n state , a slight puckering and strong pyramidalization at c2 and a strongly enlarged c2=s bond . however , the s2 * and s2 * structures show \n an even larger pyramidalization angle p7213 than the ns2 * minimum . \n the energies of the ns2 * , s2 * , and s2 * minima are fairly low ( table 2 ) , and from comparison with the energies of the other minima , \n it is apparent that c2 pyramidalization is a highly probable \n process in the deactivation . \n , we checked \n the existence of the c2-pyramidalized minima for t1 and s1 with mrcis as well as the methods used \n in ref ( 34 ) ( sa(6/6)-casscf(14,10)/ano - l - vdzp ) \n and ref ( 27 ) ( ub3lyp / aug - cc - pvdz , \n only t1 ) and found in all cases that the optimizations \n yielded pyramidalized geometries . \n one can thus safely assume that \n c2-pyramidalized minima exist in 2tu , analogous to the \n ones reported for the related compounds 6-aza-2-thiothymine ( n * , n * ) \n and thiourea ( n * ) . \n we also identified a second minimum on the s2 adiabatic \n potential energy surface , where the wave function character is s6*. this geometry ( figure 3c ) features bond inversion ( i.e. , short bonds \n become longer and long ones shorter , compared to the ground state ) \n in the ring , an elongated c2=s bond , and puckering \n and quite notable pyramidalization on c6 , due to a weakening \n of the c = s bond and the increased electron density at c6 . \n the counterpart on the t1 potential ( figure 3d ) with s6 * character also shows an elongated c5=c6 bond , no bond inversion but pyramidalization \n at n3 , and a slight , boat - like distortion of the ring . \n the t1 energy at this minimum is 3.35 ev ( 2.96 ev ) . due to limitations in the existing implementations \n of the caspt2 method \n , it was not possible to optimize crossing points \n at this level of theory . \n instead , crossing points were optimized at \n casscf(14,10)/def2-svp and mrcis(6,5)/cc - pvdz levels of theory . \n because \n these geometries are not necessarily points of degeneracy at the more \n accurate caspt2 level of theory , the crossing geometries were refined \n with the help of linear interpolation in internal coordinates ( liic ) \n scans between the casscf or mrcis crossing points and the corresponding \n caspt2 minima . \n single - point calculations along the liic paths were \n carried out at the ms - caspt2(12,9)/cc - pvdz level to locate the geometry \n with the smallest energy gap between the relevant states . only at \n the latter geometries , constituting the best estimate of the crossing \n point at ms - caspt2(12,9 ) level , \n note that we discuss only the \n ms - caspt2-refined geometries in the following , but not the geometries \n optimized at the casscf or mrcis level of theory . the refined geometries \n are reported in the supporting information . \n we report first a conical intersection between the ns2 * and s6 * ( s1/s2 ) \n states . \n because this structure is located close to the s6 * minimum , it has a very similar geometry , yet \n featuring a slightly more pronounced pyramidalization at c6 ( recall figure 3c ) . \n the geometry was obtained from a liic scan between the ms - caspt2-optimized s6 * minimum and the casscf(14,10)-optimized s6*/ns2 * crossing point . \n at the ms - caspt2(12,9 ) level of theory , the energies of s1/s2 are 3.79/3.79 \n ev , which is only 0.04 ev above the s6 * minimum . \n hence , it could be expected that the system very quickly relaxes to \n s1 after reaching the s2 ( s6 * ) minimum . \n one should note that the crossing is slightly moved at \n the more accurate ms - caspt2(16,12 ) level of theory , according to the \n corresponding s1/s2 energies ( 3.73/3.92 ev ) . \n another conical intersection between ns2 * and s2 * ( s1/s2 ) was located \n on the liic between the conical intersection optimized at mrcis(6,5 ) \n level and the ms - caspt2-optimized ns2 * minimum . \n the geometry \n is similar to the ones of the ns2 * and s2 * minima , featuring strong c2 pyramidalization . \n however , it is distinguished by a c = s bond length of about \n 2.3 ( figure 3e ) ; at this bond length , the ns and s orbitals become approximately degenerate , leading to a degeneracy \n of the ns2 * and s2 * states . \n the energies \n of the involved states are 4.24/4.29 ev ( 4.07/4.08 ev ) , making this \n crossing much less accessible than the previous one . \n it might , however , \n be a relaxation pathway for molecules otherwise trapped in the s2 ( s2 * ) minimum . \n a conical intersection \n connecting the ns2 * ( s1 ) with the ground \n state is depicted in figure 3f . \n it was optimized at mrcis level and shows c2 pyramidalization , but with an even larger pyramidalization angle p7213 of about 56 ( 127 is 90 ) , and also strong pyramidalization at n1 . \n it appears that c2 pyramidalization destabilizes the s0 much more than the s1 , which leads to the crossing . \n this type of perpendicular pyramidalization is also known from other \n systems , e.g. , 6-thioguanine or uracil . \n the energies of this s0/s1 crossing are 3.39/3.93 ev ( 3.56/3.85 ev ) , showing a significant \n energy gap between the involved states . however , given the energy \n of the ns2 * minimum ( 3.47 ev at ms - caspt2(16,12 ) , \n or 3.33 ev at ms - caspt2(12,9 ) ) , this crossing is not expected to be \n an important relaxation pathway , in agreement with the experimental \n observation of near - unity isc yields . in passing , \n we note that we were not able to reproduce \n the ethylenic s0/s1 conical intersection described \n by gobbo and borin . a minimum energy crossing point between s1 and t2 ( ns2 * ) \n was found from a liic connecting the ns2 * minimum and the \n s1/t2 crossing optimized at mrcis level of theory . \n the energies of s1/t2 are 3.51/3.60 ev ( 3.42/3.33 \n ev ) , which is less than 0.1 ev above the s1 minimum energy . \n the existence of this singlet \n triplet crossing in direct vicinity \n of the s1 minimum ( the geometry is also of c2-pyramidalized type as in figure 3b and only slightly different from the s1 minimum geometry ) is crucial to the very efficient isc channel in \n 2tu . at the crossing geometry , \n the soc between the involved states \n is about 130 cm , in apparent contradiction to \n el - sayed s rule , because both \n states are of ns2 * character . \n however , due to strong nonplanarity , \n the states involved are not strictly ns2 * , enhancing spin \n the last crossing found is a conical intersection \n between s2 * and ns2 * ( t1/t2 ) , which was obtained from a liic scan between \n the mrcis - optimized t1/t2 crossing and the s1 minimum . \n this crossing is located at 3.31/3.39 ev ( 3.21/3.26 \n ev ) , slightly below the singlet \n this crossing \n allows for ultrafast internal conversion from ns2 * to s2 * and subsequent relaxation to the s2 * minimum . \n the efficient relaxation to s2 * and the resulting very small ns2 * population is likely the reason that pollum and crespo - hernndez did not find any evidence of the ns2 * state . to establish the \n photodeactivation reaction paths , additional liic scans \n have been \n carried out to connect the minima and the calculated crossing points . \n three chains of liics have been constructed : s0 s2 * ns2*/s2 * ns2 * ( path i ) ; s0 s6 * ns2*/s6 * ns2 * ( path ii ) , both ending at the s1 minimum ; and ns2 * ns2*/ns2 * s2*/ns2 * s2 * s6 * ( path iii ) , which \n leads from the s1 minimum to the t1 minima and \n hence is the continuation of both paths i and ii . \n the three liic chains are depicted side - by - side \n in figure 4 , together \n with the assumed relaxation pathway . \n the upper panel ( a ) shows the ms - caspt2(12,9)/cc - pvdz \n energies ; the lower panel ( b ) shows the reference energies from ms - caspt2(14,11)/ano - rcc - vtzp . \n open black circles mark the proposed relaxation pathway , full black \n circles mark minima discussed in the text , and crosses mark crossing \n points . \n the calculations were performed with ms - caspt2(12,9)/cc - pvdz \n and with ms(4/3)-caspt2(14,11)/ano - rcc - vtzp ( with the default ipea \n shift ) . only the smaller cas(14,11 ) active space was used because \n for c2-pyramidalized geometries the no * states are very high in energy and hence the no orbital could not be kept in the active space along the complete \n path . for both methods , an imaginary level shift of 0.2 au was used to avoid intruder states and to obtain \n smooth potentials . \n figure s2 in the supporting information presents the same liic paths using single - state \n caspt2 , showing almost quantitative agreement of ss- and ms - caspt2 . \n hence , we are confident that our ms - caspt2 calculations provide a \n correct description of the relaxation pathways , without suffering \n from the possible artifacts of ms - caspt2 calculations as discussed \n by serrano - andrs et al . due to the presence of two competing minima on the s2 pes the s2 \n * and s6 * minima there \n are two possible relaxation routes ( paths i and ii ) leading the system \n away from the franck condon region . based on static calculations \n alone , \n it is not possible to know which s2 minimum is reached \n after excitation ; dynamics simulations are necessary to clarify this \n issue . \n however , considering that path i necessitates the motion of \n the heavy sulfur atom , it is conceivable that the system will initially \n follow path ii . \n path ii is much more efficient for s2 s1 internal conversion than path i. with respect \n to the s6 * minimum ( path ii ) , the neighboring \n s1/s2 conical intersection ( ns2*/s6 * ) is less than 0.1 ev higher in energy , \n and structurally very similar . \n conversely , from the s2 * minimum ( path i ) a barrier of about 0.3 ev needs to be surmounted \n to reach the s1/s2 crossing point ( ns2*/s2 * ) . \n a slightly smaller barrier \n separates the two s2 minima ; hence it could be possible \n that trajectories initially following path i eventually relax through \n path ii . \n isc should not be able to compete with ic at this point in \n the dynamics because along path i no triplet states are close in energy \n to the s2 minimum and relaxation through path ii is expected \n to be exceptionally fast . \n both path i and path ii coalesce at \n the s1 ( ns2 * ) minimum , from where path iii \n leads to the t1 minima . \n the s1 pes around the \n minimum is quite flat and only a very small barrier of 0.05 ev ( 0.09 \n ev ) needs to be overcome to reach a crossing point with the t2 . because the system should be trapped in the s1 state ( the s0/s1 conical intersection is about \n 0.5 ev above the s1 minimum ) , it is very likely that 2tu \n will eventually undergo intersystem crossing to the t2 state . \n the large soc and the small energy gap between s1 and t2 support the experimentally observed isc time scale of 300400 \n fs . \n as can be seen in the liic \n scans , from the s1/t2 crossing a barrierless \n path is available to reach the t1/t2 conical \n intersection and to immediately decay to t1 , followed by \n relaxation to the t1 ( s2 * ) minimum . \n because \n both the t1/t2 crossing point and the s2 * minimum also show c2 pyramidalization , \n no large atomic motion is necessary to accomplish decay to t1 . \n however , besides the s2 * ( t1 ) minimum , a second t1 minimum with s6 * character and a very similar energy exists . \n only a small barrier \n of about 0.12 ev ( 0.10 ev ) separates the two minima , so that it can \n be expected that the system will equilibrate between them . \n based on \n quantum chemistry alone , it is not possible to judge how the system \n will relax to these two minima . \n the calculated energies of the s6 * and s2 * minima are 3.35 \n and 3.21 ev ( 2.96 and 2.96 ev ) and hence both fit quite well with \n the value of 3.17 ev of the zero zero emission of phosphorescence \n reported by taherian et al . \n however , \n the large peak at the zero zero emission of the phosphorescence spectrum might indicate that the \n geometries of the s0 and the emitting triplet state are \n not very different , which could be a hint that the emitting triplet \n is s6*. on the contrary , the same authors concluded \n that the t1 minimum is likely to be nonplanar on the basis \n of the polarization of the phosphorescence emission . \n clearly , dynamical \n simulations are needed to clarify the relative importance of the two \n t1 minima . from the computational point of view , \n it is important to note that the ms - caspt2(12,9)/cc - pvdz level of \n theory can reproduce all important features of the excited - state pes , \n compared to ms - caspt2(14,11)/ano - rcc - vtzp ( figure 4 ) . \n especially the singlet potentials are \n very similar , whereas the triplet states show slightly larger deviations . \n for example , around the s6 * minimum the t2 and t3 states are above the s2 at the \n ms - caspt2(14,11 ) level , whereas they are close to each other at ms - caspt2(12,9 ) \n level . \n furthermore , ms - caspt2(12,9 ) seems to overstabilize the t1 minima in comparison with the other states , which might be \n a case where the errors of basis set effect and ipea shift do not \n cancel out as it is the case around the franck condon region . \n in summary , \n the deviations between ms - caspt2(12,9 ) and the larger \n calculations are acceptable , considering that a ms - caspt2(12,9)/cc - pvdz \n single point calculation is about 10 times faster than ms - caspt2(14,11)/ano - rcc - vtzp \n and almost 100 times faster than ms - caspt2(16,12)/ano - rcc - vqzp . \n one \n should stress , however , that this close agreement is only due to error \n compensation in the small calculation , where the increase in excitation \n energy due to a small basis set ( like cc - pvdz ) is canceled to a large \n degree by the effect of setting the ipea shift to zero . \n this error \n compensation is in line with others reported in the literature . in summary , we then conclude that our calculations indicate \n s2 s1 t2 \n t1 to be the primary relaxation pathway for 2tu . \n we expect \n direct s2 s1 t1 isc to be only a side channel , because around the s1 minimum \n the s1t1 energy gap is always larger \n than the s1t2 gap and the s1t1 soc is smaller than the s1t2 soc ( 50 and 150 cm , respectively ) . \n this \n conclusion is contrary to the findings of cui and fang and gobbo and borin , who reported that direct s2 s1 \n t1 isc should occur . \n the finding that isc involves the \n t2 is not considered by pollum and crespo - hernndez , who reported s2 s1 t1 on the basis of transient absorption spectroscopy \n . \n however , the presence of the t1/t2 conical intersection \n and the small energetic gap between those states allow for ultrafast \n internal conversion from t2 to t1 , with a very \n low transient t2 population which thus might be hard to \n observe . \n a comprehensive study \n of the excited - state potential energy surfaces of 2-thiouracil has \n been reported , employing accurate multireference quantum chemical \n methods up to ms - caspt2(16,12 ) , basis sets of up to quadruple- \n quality and geometries optimized at ms - caspt2 level . \n the results show \n that the lowest s1 minimum is strongly pyramidalized at \n c2 and that two relaxation paths allow to reach this minimum \n from the franck condon region . from the s1 minimum \n , \n the t2 triplet state can be accessed nearly barrierlessly , \n and substantial spin \n the relaxation is expected to ultimately \n lead to one of two t1 minima , one with a slight boat - like \n conformation of the pyrimidine ring , the other with c2 pyramidalization . \n in summary , the photochemical reaction sequence is s2 \n s1 t2 t1 . as a methodological note , \n the results from ms - caspt2(16,12)/ano - rcc - vqzp \n are compared to ms - caspt2(12,9)/cc - pvdz , where in the latter calculations \n the ipea shift was set to zero . \n the two \n methods show a very good agreement , all relevant parts of the pes \n are accurately reproduced by the computationally much more efficient \n ms - caspt2(12,9 ) method . \n one can therefore conclude that nonadiabatic \n dynamics simulations at this level of theory should produce an accurate \n picture of the deactivation of 2tu .", "role": "user" }, { "content": "accurate \n excited - state quantum chemical calculations on 2-thiouracil , employing \n large active spaces and up to quadruple- quality basis sets \n in multistate complete active space perturbation theory calculations , \n are reported . \n the results suggest that the main relaxation path for \n 2-thiouracil after photoexcitation should be s2 \n s1 t2 t1 , and that \n this relaxation occurs on a subpicosecond time scale . \n there are two \n deactivation pathways from the initially excited bright s2 state to s1 , one of which is nearly barrierless and should \n promote ultrafast internal conversion . \n after relaxation to the s1 minimum , small singlet \n triplet energy gaps and spin orbit \n couplings of about 130 cm1 are expected to facilitate \n intersystem crossing to t2 , from where very fast internal \n conversion to t1 occurs . \n an important finding is that 2-thiouracil \n shows strong pyramidalization at the carbon atom of the thiocarbonyl \n group in several excited states .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: endocannabinoid signaling at the g - protein \n coupled receptors cb1 and cb2 is activated by \n the lipid messengers n - arachidonoylethanolamine ( anadamide ) \n and 2-arachidonoylglycerol \n ( 2-ag ) , which are metabolized by fatty acid amide hydrolase ( faah ) \n and monoacylglycerol lipase ( magl ) , respectively . \n anandamide \n and 2-ag are thought to be produced on demand in postsynaptic neurons , \n since both chemical messengers have low aqueous solubility that may \n preclude vesicular storage . \n retrograde \n signaling to cb1 on the presynaptic neurons then initiates \n a cascade that regulates calcium and potassium ion channels . \n reuptake \n of endocannabinoids is still a matter of some debate , though it is \n believed to be preceded by amide hydrolysis , hence the tone of endocannabinoid \n signaling in the central nervous system is regulated by faah and magl . \n distortion in the cannabinoid system has been linked to a wide variety \n of pathologies including eating disorders , neurodegenerative disorders , \n anxiety , depression , pain , and inflammation . \n faah in particular shows promise as a therapeutic target since selective \n inhibitors of this enzyme have not been shown to contribute to hypomotility , \n hyper - reflexia , and cb1 receptor downregulation , nor to \n be candidates for substance abuse , in contrast to magl inhibitors . \n several faah inhibitors including urb597 and pf-04457845 ( figure 1 ) have advanced to phase i and ii clinical trials for treatment of \n pain , cannabis dependence , and schizophrenia . \n structures of faah inhibitors \n urb597 and pf-04457845 and pet imaging \n agents [ c]curb and [ f]dopp . \n accurate quantification of faah activity in the \n living human brain \n under normal and diseased states would assist in understanding the \n role that the endocannabinoid system plays in these conditions , and \n could provide a valuable tool for drug development . positron emission \n tomography ( pet ) is a noninvasive molecular imaging technique that \n uses positron - emitting radionuclides to prepare functional probes \n with high sensitivity and is administered at a dose that leads to \n minimal perturbation of the underlying biological state . \n several pet \n radiotracers for faah have been reported , including anadamide analogues , carbon-11 labeled pf-04457845 and a fluorine-18 labeled derivative , [ c]mk-3168 , a c - methyl labeled urb597 analogue , and related [ c - carbonyl]-o - arylcarbamates prepared by co2-fixation in the presence of an organic base . among pet radiotracers for faah , only two have \n been reported in human studies , namely [ c]mk-3168 and [ c - carbonyl]-6-hydroxy-[1,1-biphenyl]-3-yl cyclohexylcarbamate ( [ c]curb ) . \n this \n scaffold has been fruitful for development of selective faah cns probes \n due to the mechanism of inhibition by covalent modification of the \n ser241-ser217-lys142 active site , \n which is unusual for serine hydrolases . \n quantification of faah activity with [ c]curb \n was first \n performed by ex vivo biodistribution studies in rats . \n high brain uptake ( 1.62.4 suv , standardized \n uptake value ) was followed by low washout , which is expected from \n an irreversible tracer . \n radiotracer uptake was irreversible , consistent \n with known faah distribution , and could \n be blocked by pretreatment with urb597 and other faah inhibitors . \n human imaging studies showed rapid and high brain uptake of [ c]curb with regional peak and plateau concentrations greatest \n in the putamen and thalamus compared to other regions , matching human postmortem data . \n a two - tissue compartment model \n with irreversible trapping was found to be optimal , and the composite \n parameter k3 provided a sensitive \n measure of faah activity . while [ c]curb appears \n to be a very promising radiotracer \n for faah , it is limited by the half - life of carbon-11 ( c , t1/2 = 20.4 min ) , which necessitates \n an on - site cyclotron for radiotracer production and poses many practical \n challenges for its widespread use . in light of the potential demonstrated \n by [ c]curb \n , a fluorine-18 ( f , t1/2 = 109.7 min ) labeled o - arylcarbamate , \n [ f]3-(4,5-dihydrooxazol-2-yl)phenyl ( 5-fluoropentyl)carbamate \n ( [ f]dopp ) , has been prepared in a three - step radiosynthesis \n and also evaluated in rats . \n similar to \n [ c]curb , [ f]dopp showed irreversible and \n specific binding , with regional distribution consistent with faah \n distribution . \n however , the stability of [ f]dopp in rat \n plasma was low , as less than 5% of radioactivity was associated with \n the parent compound 5 min after radiotracer administration . \n though \n the observed metabolism is likely associated with rodent carboxylesterases \n that are not present in human plasma , rapid consumption \n of the parent radiotracer could have a profound effect on modeling \n outcome parameters of its distribution . in order to advance [ f]dopp for human studies \n , we sought to evaluate the kinetics \n and metabolism of this radiotracer in higher species and with plasma \n input function correction . \n we are also interested in determining the \n sensitivity of [ f]dopp binding by pretreatment with faah \n inhibitors in a dose dependent manner , prior to evaluation of this \n radiotracer in human subjects . in the present study \n , we conducted \n pet imaging of [ f]dopp in nonhuman primates to assess \n brain uptake , washout , regional distribution , and kinetic modeling \n of this tracer following pretreatment studies . \n precursors for the synthesis of [ f]dopp were prepared \n by literature procedures with minor modifications . chemical yields and characterization data closely matched previously \n published values . \n a ge pettrace 16.5 \n mev cyclotron was \n used for [ f]fluoride production by the o(p , n)f nuclear reaction to irradiate o - enriched water . \n synthesis of [ f]dopp was performed manually using minor \n modifications to the previously reported automated procedure . specifically , [ f]fluoride drying \n was conducted as follows : a solution consisting of 14.4 mg of 4,7,13,16,21,24-hexaoxa-1,10-diazabicyclo[8.8.8]hexacosane \n ( crypt-222 ) , and 3 mg of k2co3 in 1 ml of 10% \n ( v / v ) water in acetonitrile was used to elute [ f]fluoride \n from the ion - exchange resin and into a conical glass vial . \n the vented \n vial was heated to 90 c under continuous nitrogen gas flow . \n when no liquid was visible in the vial , it was removed from heat , \n anhydrous acetonitrile ( 1 ml ) was added , and the heating was resumed \n until dryness . \n the \n remainder of the radiosynthesis was conducted as previously described , with the exceptions of reaction temperatures \n for [ f]fluoride incorporation and amine deprotection , \n which were increased to 100 c from the previously reported 80 \n c . \n urb597 was purchased from cayman chemicals \n and formulated in saline with 5% ethanol and 5% tween 80 . \n all solutions \n were filtered through a 0.22 m filter into a sterile empty \n vial and were tested for sterility and pyrogen content . \n an aliquot \n of the pretreatment solution for injection was withdrawn and analyzed \n by hplc to determine urb597 concentration . \n all animal studies were performed in \n accordance with the national institutes of health guide for the care \n and use of laboratory animals and were approved by the massachusetts \n general hospital institutional animal care and use committee . \n three adult baboons ( papio anubis , 2m/1f , 34 \n years old , 10.115.6 kg ) , deprived of food for 12 h prior to \n imaging experiments , were included in the study . \n one baseline and \n two pretreatment experiments were conducted for a total of three imaging \n sessions . \n intramuscular ketamine ( 10 mg / kg ) was administered for animal \n preparation and intubation . \n baboons were catheterized antecubitally \n for hydration and radiotracer injection , and a radial arterial line \n was placed for plasma and metabolite analysis . for maintenance of \n anesthesia throughout the imaging study , \n baboons were provided 12% \n isoflurane ( forane ) in a mixture of medical oxygen . \n vital signs including end \n tidal co2 , spo2 , heart rate , respiration rate , \n and blood pressure were monitored and maintained within normal ranges \n during the studies . \n pet and mri images were acquired on a 3 t \n siemens tim - trio with \n a brainpet insert ( siemens , erlangen , germany ) . \n a custom pet / mri compatible \n 8-channel array coil for nonhuman primate brain imaging was used to \n improve image signal and quality . \n dynamic pet image acquisition was \n initiated concurrently with the administration of the radiotracer \n ( 4.99 0.20 mci , 3 scans ) in a homogeneous solution of 10% ethanol \n and 90% isotonic saline , and continued for a duration of 120 min . \n a high - resolution anatomical scan using multiecho mprage sequence \n ( tr = 2530 ms , te1/te2/te3/te4 = 1.64/3.5/5.36/7.22 ms , ti = 1200 \n ms , flip angle = 7 , and 1 mm isotropic ) \n was acquired for anatomic \n coregistration . for pretreatment studies , baboons were administered \n urb597 ( 200 or 300 g / kg , iv ) 10 min prior to radiotracer administration . \n blood was sampled from \n the radial arterial line nominally every 10 s for the first 3 min \n ( 1 ml each ) after radiotracer administration , followed by \n sampling at 5 , 10 , 20 , 30 , 45 , 60 , and 90 min time points ( 3 \n ml each ) for plasma and metabolite analysis . \n arterial samples were \n centrifuged to obtain plasma , which was then removed ( 200 l \n for samples collected during the first 3 min ; 600 l for all \n later samples ) and placed in an automated gamma counter using a 350600 \n kev window , and cross - calibrated with the pet scanner . beginning with \n the arterial sample acquired at 5 min after radiotracer administration , \n an aliquot ( 600 l ) of plasma was added to acetonitrile ( 600 \n l ) and centrifuged for 13 min to obtain protein - free \n plasma ( pfp ) . \n an aliquot ( 600 l ) of pfp was diluted with deionized \n water ( 3 ml ) and loaded onto a customized automated robot , fitted \n with phenomenex strata - x 500 mg spe cartridges that were primed with \n ethanol ( 2 ml ) and deionized water ( 20 ml ) . \n solutions of pfp were \n loaded on spe cartridges and then extracted sequentially with 4 ml \n of 100% ( twice ) , 90% , 85% , 80% , 75% , and 60% water , followed by 100% \n acetonitrile . \n each eluent sample \n was counted in an automated gamma counter to determine the presence \n of radiolabeled metabolites . \n an aliquot \n of [ f]dopp formulated in 10% ethanolic saline ( 10 l ) \n was added \n to a sample of baboon plasma ( 0.8 ml ) . \n the mixture was gently mixed \n by repeated inversion and incubated for 10 min at room temperature . \n following incubation , a small sample ( 20 l ) \n was removed to \n determine the total radioactivity in the plasma sample ( at ; at = abound + aunbound ) . \n an additional \n 0.2 ml of the plasma sample was placed in the upper compartment of \n a centrifree ultrafiltration device ( amicon , inc . \n the upper part of the device and the \n membrane were discarded , and an aliquot ( 20 l ) from the collection \n cup was removed to determine the fraction of radioactivity that passed \n through the membrane ( aunbound ) . \n plasma \n protein binding is reported as the free fraction of radioactivity \n ( aunbound / at ) . \n pet data were registered \n to the black baboon brain atlas using \n jip tools optimized for nonhuman primate data processing ( www.nitrc.org/projects/jip ) . \n image registration was carried out on high - resolution t1-weighted anatomical mri images using a 12 \n degree of freedom linear algorithm and a nonlinear algorithm to the \n atlas brain . \n twelve volumes \n of interest ( vois ) were defined according to the black baboon brain \n atlas . \n time activity curves ( tacs ) \n were extracted from the amygdala ( amyg ) , dorsal lateral prefrontal \n cortex ( dlpfc ) , hippocampus ( hip ) , primary motor cortex ( m1 ) , nucleus \n accumbens ( nac ) , posterior cingulate cortex ( pcc ) , putamen ( put ) , \n orbitofrontal cortex ( ofc ) , supplementary motor area ( sma ) , thalamus \n ( tha ) , caudate ( cau ) , and cerebellum ( cb ) vois for analysis . \n compartmental \n models ( one - tissue ( 1tcm ) , two - tissue ( 2tcm ) , and three - tissue ( 3tcm ) \n compartmental models ) with and without irreversible binding were carried \n out in pmod using the metabolite - corrected arterial blood as input \n function . \n a composite parameter k3 , where equals k1/k2 , was determined for all vois from all scans and plotted \n in figure 4 . \n a two - way anova was applied to \n compare regional k3 values between \n baseline and the two pretreatment scans using graphpad prism ( prism6 , \n graphpad software inc . , \n la jolla , ca , usa ) . because a 2tcm with \n irreversible binding ( 2tcmi ) provides the best \n fits in regional analysis , voxelwise maps \n were then obtained using \n 2tcmi from the dynamic pet data using pmod ( pxmod module ) . in order \n to implement a 2tcmi fitting on noisy voxelwise tacs , we implemented \n a published method to reduce the number of parameters being estimated . \n specifically , instead of fitting the model for \n voxelwise k2 , a k1/k2 ratio representing the distribution \n volume of free plus nonspecific binding of a high binding region ( i.e. , \n basal ganglia ) was first estimated . \n [ f]dopp was \n prepared by a multistep radiosynthesis that involved radiofluorination \n of a protected alkyl amine , deprotection , and coupling with a diaryl \n carbonate under buffered conditions to form the desired fluorine-18 \n labeled carbamate . \n both the protected amine precursor and the diaryl \n carbonate precursor were prepared using literature procedures with minor modifications . \n the synthesis of [ f]dopp \n was adapted from the previously reported method , which made use of an automated radiosynthesis module for \n synthesis and purification . \n in addition to a modified [ f]fluoride - drying procedure , in the manual synthesis both the radiofluorination \n and deprotection steps were conducted at slightly higher temperatures \n ( 100 c compared to 80 c ) . \n specific activities in excess \n of 5.4 cimol were obtained for the \n imaging studies . \n after radiotracer \n injection , rapid brain uptake was observed in baboon brain at baseline \n by in vivo pet imaging ( figure 2a and figure s1 in the supporting information ) . \n an initial whole - brain activity peak was observed at 45 s , and \n uptake reached a maximum of 2.1 suv beginning at 55 min , with little \n washout thereafter ( figure 2b ) . \n activity curves are \n greatest for the putamen and anterior cingulate cortex , reaching 2.8 \n suv in each , and lowest in the temporal and occipital cortices , where \n peak activity was only 2.2 and 2.3 suv , respectively . the nominal \n rank order was maintained both in the initial uptake peak and during \n the plateau phase . \n ( a ) summed baseline pet / mr image 090 min post \n tracer injection . \n image data is normalized to injected dose and animal weight ( kbq / ml / mci / kg ) . \n ( b ) whole brain ( wb ) baboon time activity curves for [ f]dopp at baseline and after pretreatment with urb597 . \n activity \n curves after pretreatment . for summed pet / mr images after pretreatment , \n see the supporting information . \n urb597 is a carbamate - based inhibitor that , within \n the brain , is \n selective for faah . \n pretreatment of baboons \n with 200 or 300 g / kg urb597 iv showed only modest reduction \n in whole brain radioactivity uptake at peak ( 1.8 suv ) and plateau \n ( 1.9 suv ) levels ( figure 2b and figure s2 in \n the supporting information ) . \n the modest \n effect on radiotracer uptake likely reflects the opposing influences \n of increased delivery of [ f]dopp due to peripheral blocking \n ( figure 3 , vide infra ) and \n blocking of faah binding sites in the central nervous system ( cns ) . \n there is scant literature on higher doses of urb597 administered intravenously \n to nonhuman primates , and given the complete \n blocking observed in rat , experimental \n higher dosing regimens were not considered to be justified in the \n present study . \n the limited whole brain blocking of faah observed in \n nonhuman primates at this level of pretreatment with urb597 also provides \n an excellent opportunity to evaluate the sensitivity of [ f]dopp and kinetic modeling approaches to quantification of faah \n with high sensitivity . \n selectivity of [ f]dopp for faah \n has been previously demonstrated in rats using relatively high doses \n of urb597 ( 2 mg / kg ) , or a more potent urea - based faah inhibitor , pf-04457845 . parent fraction data from arterial plasma at baseline \n and after \n pretreatment at two different doses of urb597 ( 200 or 300 g / kg \n iv ) . \n the rate of metabolism of [ f]dopp is rapid at baseline \n and significantly decreased by pretreatment with the faah inhibitor \n urb597 . \n this compares favorably with [ c]curb in humans , where free fraction in plasma was estimated \n at 0.9% . \n unmetabolized [ f]dopp in arterial plasma peaked at 11.9 suv , 40 s after radiotracer \n administration , and declined to 2.0 suv after just 3 min and to 0.05 \n suv at 70 min postinjection ( see figure s3 , supporting \n information ) . \n less than 5% of radioactivity in plasma was \n associated with the parent compound at 50 min postadministration ( figure 3 ) . following pretreatment with urb597 ( 300 g / kg , \n iv ) , [ \n f]dopp in arterial plasma peaked at 13.1 suv at \n 29 s and declined to 2.0 suv at 3.7 min and to 0.05 suv at 71 min . \n the observed slight increase in plasma concentration at early time \n points after pretreatment is consistent with moderate blocking of \n faah in the brain as well as peripheral metabolic enzymes . \n indeed , the stability of [ f]dopp in vivo was significantly augmented after pretreatment with urb597 . by way \n of comparison with baseline , at 50 min postadministration , \n metabolism of the parent compound did not reach 95% until \n approximately 113 min postinjection . \n this confirms our previous hypothesis \n that the rapid peripheral metabolism of [ f]dopp observed \n in rodents would not translate to higher species . to determine the \n optimal kinetic parameters \n for faah quantification using [ f]dopp , a number of different \n tissue - compartment models ( tcms ) were evaluated with the data from \n a baseline scan and two pretreatment scans ( urb597 , 200 , and 300 g / kg \n iv , 10 min prior to radiotracer administration ) . \n consistent \n with a previous human study , the 2tcmi \n was found to give a good fit for the data in all scans . \n the 3tcmi \n did not outperform the 2tcmi as judged by the percent errors of the \n fits and resulted in comparable outcome measurements . \n the composite \n parameter k3 was used to quantify \n faah activity in regional vois . \n the regional k3 values at baseline ranged from 0.09 to 0.16 ml / cm / min ( figure 4 ) . by way of comparison , \n the average k3 value for [ c]curb in selected human brain regions \n was 0.14 ml / cm / min . \n the trend \n and rank order of regional k3 values \n also correspond well with previously reported human imaging analysis \n with [ c]curb . \n regional k3 values showed significant reduction of faah binding when \n comparing both pretreatment scans to baseline condition ( one - way anova \n with tukey correction for multiple comparisons , p < 0.0001 ) , while the two pretreatment doses did not cause different \n levels of blockade ( p > 0.05 ) . \n however , trends \n of \n dose - dependent blocking are evident for most brain structures evaluated . \n putamen and amygdala showed the highest k3 at baseline , while cortical regions such as occipital ( v1 ) \n and motor ( m1 ) cortices had the lowest values . across brain regions , k3 values were reduced by 42.2 \n 4.5% by pretreatment with 200 g / kg urb597 , and by 45.1 \n 6.0% at the 300 g / kg level . regional brain k3 values for \n baseline and at both pretreatment doses with urb597 . \n amyg , amygdala ; \n cau , caudate ; cb , cerebellum ; dlpfc , dorsal lateral prefrontal cortex ; \n hip , hippocampus ; m1 , primary motor cortex ; nac , nucleus accumbens ; \n ofc , orbitofrontal cortex ; pcc , posterior cingulate cortex ; put , putamen ; \n sma , supplementary motor area ; tha , thalamus ; v1 , primary visual cortex . as a 3tcmi would significantly \n increase the complexity and computational \n burden of generating voxelwise maps , the 2tcmi was used to generate \n voxelwise maps . \n figure 5 shows the voxelwise k3 maps overlaid on their high - resolution \n anatomical mri under baseline conditions and with 300 g / kg \n pretreatment . in accordance to regional analysis , basal ganglia ( in \n particular the putamen ) and \n nonhuman \n primate brain k3 maps \n overlaid on their anatomical mri ( a ) at baseline and ( b ) after pretreatment \n with 300 g / kg urb597 . among the challenges of developing irreversible covalent \n enzyme \n inhibitors for pet are achieving selectivity for the enzyme target \n and a rate of enzyme inhibition that is not limited by flow . \n pretreatment \n studies with faah inhibitors prior to administration of either [ c]curb or [ f]dopp have shown that both of these radiotracers exhibit \n high selectivity for faah . \n human studies with [ c]curb \n have also proven that faah activity as quantified by this radiotracer \n is not dependent on cerebral blood flow . \n although the potential effects of cerebral blood flow were not directly \n measured in the present study , it is possible to use the values of \n microparameters derived from kinetic modeling to assess whether tracer \n distribution is flow - limited . \n specifically , the ratio of k3/k2 has been proposed as \n a useful metric for this purpose , and values within the range of 0.10.3 \n are predictive of an optimal balance of high tracer uptake without \n flow - limited distribution . \n since a high k3 is indicative of rapid specific binding , a \n value above this range is suggested to indicate flow dependence , while \n a value below this range will likely translate to poor uptake and \n low signal . over all of the rois \n analyzed , the mean k3/k2 value was 0.18 , which \n is within the optimal range . \n since [ f]dopp is an \n irreversible inhibitor of faah , \n pet measurements with this compound provide a measure of enzyme activity , as opposed to enzyme availability , which could be measured with reversible inhibitors in the same \n manner as a ligand receptor interaction . \n the effects of anesthesia are known to play a role in pet \n imaging of g protein coupled receptors and enzyme targets in the cns . \n the effects of isoflurane anesthesia used in \n the present study , as necessary for imaging in nonhuman primates , \n present a potential confounding factor for translation of [ f]dopp for quantification of faah activity in conscious humans . \n in summary , we report that [ f]dopp \n rapidly crosses \n the nonhuman primate blood \n brain barrier and shows low washout \n in regions consistent with faah distribution and the distribution \n of [ c]curb in human brain imaging studies . \n we further \n report on the evaluation of kinetic modeling parameters and found \n that k3 displays sensitivity to \n pretreatment with a faah inhibitor , urb597 . \n as predicted , [ f]dopp is rapidly metabolized in vivo and at a reduced \n rate after pretreatment with urb597 . in combination with the previously \n reported data in rats , these data are \n suggestive that [ f]dopp exhibits high specific binding \n and that distribution is not flow dependent , attributes that will \n ultimately be characterized in human subjects . \n the radiosynthesis \n of [ f]dopp has been validated for human use , and preparations \n for clinical research studies are underway .", "role": "user" }, { "content": "fatty \n acid amide hydrolase ( faah ) regulates endocannabinoid signaling . \n [ 11c]curb , an irreversibly binding faah inhibitor , has \n been developed for clinical research imaging with pet . \n however , no \n fluorine-18 labeled radiotracer for faah has yet advanced to human \n studies . \n [ 18f]dopp ( [ 18f]3-(4,5-dihydrooxazol-2-yl)phenyl \n ( 5-fluoropentyl)carbamate ) has been identified as a promising 18f - labeled analogue based on rodent studies . \n the goal of this \n work is to evaluate [ 18f]dopp in nonhuman primates to support \n its clinical translation . \n high specific activity [ 18f]dopp \n ( 56 cimol1 ) was administered \n intravenously ( iv ) to three baboons ( 2m/1f , 34 years old ) . \n the distribution and pharmacokinetics were quantified following a \n 2 h dynamic imaging session using a simultaneous pet / mr scanner . \n pretreatment \n with the faah - selective inhibitor , urb597 , was carried out at 200 \n or 300 g / kg iv , 10 min prior to [ 18f]dopp administration . \n rapid arterial blood sampling for the first 3 min was followed by \n interval sampling with metabolite analysis to provide a parent radiotracer \n plasma input function that indicated 95% baseline metabolism \n at 60 min and a reduced rate of metabolism after pretreatment with \n urb597 . \n regional distribution data were analyzed with 1- , 2- , and \n 3-tissue compartment models ( tcms ) , with and without irreversible \n trapping since [ 18f]dopp covalently links to the active \n site of faah . \n consistent with previous findings for [ 11c]curb , the 2tcm with irreversible binding was found to provide the \n best fit for modeling the data in all regions . \n the composite parameter k3 was therefore used to evaluate whole \n brain ( wb ) and regional binding of [ 18f]dopp . \n pretreatment \n studies showed inhibition of k3 across all brain regions ( wb baseline : 0.112 ml / cm3/min ; \n 300 g / kg urb597 : 0.058 ml / cm3/min ) , suggesting that \n [ 18f]dopp binding is specific for faah , consistent with \n previous rodent data .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the odontogenic fibroma is a benign neoplasm of odontogenic ectomesenchymal origin , characterized by relatively mature collagenous fibrous tissue with varying amount of odontogenic epithelium . \n it can occur in central or peripheral location , the latter being more common by a 1.4:1 ratio . \n a slight female predominance has been seen in a literature review by daley et al . \n age at diagnosis varies widely with a peak in the third and fourth decades of life . \n the world health organization ( who ) defined it as a benign odontogenic neoplasm of fibroblastic origin characterized by relatively mature collagenous fibrous tissue and varying amounts of odontogenic epithelium with potential to occur in either a central or an extraosseous location . the extraosseous counterpart is designated as peripheral odontogenic fibroma . \n it appears as a firm , slow - growing and usually sessile gingival mass covered by normal appearing mucosa . \n clinically , it can not be distinguished from common fibrous gingival lesions . encountered mainly on facial gingiva of mandible , with incisor - canine and premolar area being the most common sites , they seldom cause displacement of teeth . \n connective tissue ranges from loose ( almost myxomatous ) to markedly cellular or to relatively acellular and well organized . \n islands / strands of odontogenic epithelium are scattered throughout connective tissue , which may be prominent / scarce . \n dysplastic dentin , amorphous ovoid cementum like calcifications and trabeculae of osteoid may also be present . \n the peripheral odontogenic fibroma shows histopathologic features similar to those of the central odontogenic fibroma ( who ) type . in the past , \n some authors had designated clinically and histopathologically lesions similar to peripheral odontogenic fibroma as odontogenic gingival epithelial hamartoma / peripheral fibroblastic dentinoma , odontogenic epithelial hamartoma . \n the reason for it being referred to as odontogenic gingival epithelial hamartoma in the past is a reflection of the authors placing more emphasis on the epithelial component rather than the fibroblastic component . \n it does not appear to be a hamartoma because hamartomas are developmental , while in this particular study by baden , lesions reported as hamartomas appeared only in sixth and seventh decades of life rather than during the development of dentition , which means that they were not hamartomas . at one time , the terms peripheral ossifying fibroma and peripheral odontogenic fibroma were used quite interchangeably till gardener published a clarification in terminology . \n while the former one is a commonly found reactive lesion with well - formed bone , numerous giant cells and only rarely , if present , odontogenic epithelial rests , the latter one , which is quite rare , has extensive odontogenic epithelium with occasionally found dysplastic dentin / cementum like calcifications and only rarely , giant cells are present . \n the origin of both the lesions is quite different and so is the biologic behavior . \n the former is a benign tumor of connective tissue origin with a marked tendency to recur , while the latter is of odontogenic mesenchymal origin whose recurrence is not known exactly but is reported to vary from very low to as high as 38.9% . \n buchner et al . presented nine cases of peripheral odontogenic fibroma that illustrate the variety of its histopathologic findings . \n they also suggested that the term who type to be used to distinguish it from peripheral ossifying fibroma . \n the first detailed clinicopathologic study of peripheral odontogenic fibroma was published by daley et al . \n clinical data from this study indicate that the lesion is more common than reported previously and also that it has a significant recurrence rate . \n another study by buchner presents the relative frequency of peripheral odontogenic tumors ( pots ) , in which it was found that peripheral odontogenic fibroma accounted for 51.1% of the total pots . \n however , pots themselves are quite rare , consisting of only 0.05% of all oral biopsy specimens . \n being a rare lesion itself , the literature mostly consists of case reports[31013 ] of rarer forms or presentations of the same lesion which consist of diffuse , multifocal type and diffuse associated with ocular , skin lesions . \n in the past , some authors had designated clinically and histopathologically lesions similar to peripheral odontogenic fibroma as odontogenic gingival epithelial hamartoma / peripheral fibroblastic dentinoma , odontogenic epithelial hamartoma . \n the reason for it being referred to as odontogenic gingival epithelial hamartoma in the past is a reflection of the authors placing more emphasis on the epithelial component rather than the fibroblastic component . it does not appear to be a hamartoma because hamartomas are developmental , \n while in this particular study by baden , lesions reported as hamartomas appeared only in sixth and seventh decades of life rather than during the development of dentition , which means that they were not hamartomas . at one time , the terms peripheral ossifying fibroma and peripheral odontogenic fibroma were used quite interchangeably till gardener published a clarification in terminology . while the former one is a commonly found reactive lesion with well - formed bone , numerous giant cells and only rarely , if present , odontogenic epithelial rests , the latter one , which is quite rare , has extensive odontogenic epithelium with occasionally found dysplastic dentin / cementum like calcifications and only rarely , giant cells are present . \n the origin of both the lesions is quite different and so is the biologic behavior . \n the former is a benign tumor of connective tissue origin with a marked tendency to recur , while the latter is of odontogenic mesenchymal origin whose recurrence is not known exactly but is reported to vary from very low to as high as 38.9% . \n buchner et al . presented nine cases of peripheral odontogenic fibroma that illustrate the variety of its histopathologic findings . \n they also suggested that the term who type to be used to distinguish it from peripheral ossifying fibroma . \n the first detailed clinicopathologic study of peripheral odontogenic fibroma was published by daley et al . \n clinical data from this study indicate that the lesion is more common than reported previously and also that it has a significant recurrence rate . \n another study by buchner presents the relative frequency of peripheral odontogenic tumors ( pots ) , in which it was found that peripheral odontogenic fibroma accounted for 51.1% of the total pots . \n however , pots themselves are quite rare , consisting of only 0.05% of all oral biopsy specimens . \n being a rare lesion itself , the literature mostly consists of case reports[31013 ] of rarer forms or presentations of the same lesion which consist of diffuse , multifocal type and diffuse associated with ocular , skin lesions . \n a 30-year - old female presented in the department of periodontics , srcdsr , with a localized gingival swelling in relation to interdental gingiva of mandibular left canine - first premolar region [ figure 1 ] . \n it was present since 1 year and had slowly grown to this size , causing displacement of both the teeth and creating a space between them . \n patient gave a vague history of presence of similar growth in the same region around 11 years back which she got excised in a government hospital , but no records could be obtained regarding that either from the patient or from the hospital . on examination , \n the swelling was approximately 0.8 1 cm in size [ figure 2 ] , was found to be sessile , nonlobulated , sharply demarcated but otherwise of the same color as the surrounding mucosa . on palpation , it had a fibrotic consistency . \n complete full mouth periodontal examination revealed the presence of generalized 3 - 4 mm deep pockets and subgingival flecks or complete bands of calculus . \n patient had a very poor oral hygiene . a clinical diagnosis of generalized mild to moderate chronic periodontitis with focal fibrous hyperplasia / irritation fibroma was made . \n iopa intra oral periapical radiograph ( iopa ) of the involved area was taken which revealed a horizontal bone loss [ figure 3 ] . \n excisional biopsy was done along with open flap debridement as the patient was suffering from periodontitis . \n the growth was removed with an internal bevel incision and root surface was scaled and planed thoroughly . \n periodontal pack was placed and the patient was recalled after 7 days for pack and suture removal . at follow - up , the area seemed to heal well . \n the patient is getting treated for periodontitis now and will remain on a regular follow - up of 3 months in the future . \n pre - operative photograph mesiodistal length of excised lesion radiograph of the area post - operative photograph ( 5-week follow - up ) microscopically , the lesion showed partially circumscribed tumor mass exhibiting interlacing fascicles of collagen fibers and scattered abundant odontogenic nests and strands [ figure 5 ] . \n intervening connective tissue also consisted of numerous localized areas of chronic inflammatory cells ( mainly plasma cells ) and few multinucleated giant cells . \n the overlying epithelium was hyperplastic , parakeratinized stratified squamous epithelium with thin , long rete ridges . \n the differential diagnosis includes inflammatory lesions such as fibrous hyperplasia , fibroma , giant cell fibroma , peripheral ossifying fibroma , pots , peripheral giant cell granuloma , and pyogenic granuloma . \n peripheral odontogenic fibroma does not involve the underlying bone and only sometimes shows areas of calcification on radiograph . \n the lesion itself showed no calcification , while the reason for interdental bone loss is periodontitis since it is generalized . \n armas et al . have published a case report of recurrence of peripheral odontogenic fibroma three times and the last one occurred not only after a gap of 11 years which is the longest reported time of recurrence , but also presented in association with a central odontogenic fibroma although there were no radiographic findings the first two times . \n this would emphasize the importance of radiographic investigation and follow - up of such type of cases . \n tooth displacement , which is generally not caused by this lesion , was present in this case most likely because of the presence of generalized periodontitis that makes the tooth amenable to pathologic migration . due to the nonavailability of previous records \n , we can not say whether it is a recurrence of the same lesion after a long period of 11 years or another independent lesion . \n the literature also indicates the presence of another pathological entity , namely fibrous hyperplasia exhibiting odontogenic rests , which was eliminated from differential diagnosis on the basis that the epithelium found in our specimen was actually large in amount as seen in the photomicrograph . \n it is further stressed that as far as the excisional part is concerned , mucogingival problem is not created unless and until the attached gingiva is involved , which is not quite usual , or rather it has not been commented upon except in one of the case reports . \n however , if it is involved , grafting procedures can be done . in our case , \n , we stress upon the radiographic and histopathologic investigation of all gingival growths in addition to regular follow - ups of all such patients .", "role": "user" }, { "content": "odontogenic tumors mainly occur as intraosseous growths but sometimes may present in a peripheral location on the gingiva where they are referred to as peripheral odontogenic tumors ( pots ) which are a rare entity , the most common of them being the peripheral odontogenic fibroma that is an otherwise uncommon , slowly growing , benign odontogenic neoplasm of the periodontal soft tissues . in fact , peripheral odontogenic fibroma is the only pot that is more frequent than its central counterpart . although considered to be with a potential to recur after excision , the actual recurrence rate is not known due to paucity of literature . \n this paper presents a case report along with review of the available literature and reinforces the importance of patient follow - up in addition to radiographic and histological examination of seemingly innocuous gingival exophytic lesions .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: however , excessive uncontrolled anger and that triggered by trivial issues is often considered harmful . \n several psychoanalytic theorists and clinicians have suggested that conflicts and difficulties in coping with anger play a central role in the onset and persistence of depression . \n depression has also been conceptualized as a kind of self - directed anger and noted a propensity toward hatred and hostility has been noticed in patients with depression , based on temperament or early experience . in line with this \n , a positive association has been found between the severity of depression and levels of hostility and anger experience , but could not be related to measures of expressed anger and could only be partially related to suppressed anger . \n non - pharmacological approaches play a significant role in the management of depression and anger individually . \n they have an additive effect to pharmacological treatment and also are considered as first line of management in mild - moderate cases of depression as well as anger . cognitive - behavioral therapy ( cbt ) , the most frequently practiced non - pharmacological therapy aims to reduce symptoms directly and to implement strategies designed to build better problem - solving skills . in a meta - analysis , \n the efficacy of cbt in anger management was found to have a large effect size of 0.7 and had an impact on all dimensions - anger reduction , anger suppression , anger provocation , anger - related physiological arousal and in managing dysfunctional coping tendencies associated with anger . \n though anger symptoms are more common among depressed patients , there are limited literatures on its management in depressed patients . \n we present the case of a male suffering from moderate depressive episode with associated anger outburst and had a significant decrease in anger symptoms due to add - on cbt unmanageable with only pharmacotherapy . \n mr . a , a 27-year - old single hindu male , educated up to intermediate , with no significant past history of any psychiatric or medical illness , presented with chief complaints of depressed mood , initial and terminal insomnia and diminished appetite , excessive easy fatigability , anhedonia , excessive irritability , frequent anger outbursts , physical and verbal abuse , acts of deliberate self - harm for a duration of 3 - 4 months with progressive increase in intensity of symptoms over the time . \n his pre - morbid history revealed impulsive traits , frequent irritability and outbursts of anger , inability to handle criticism and difficulty in maintaining friends and relationships . \n however , there was no history of physical violence or conflict with others . however , currently , there was a significant increase in intensity and frequency of anger outbursts and irritability along with the depressive symptoms . \n depressive episode of moderate intensity was diagnosed and rating on beck depression inventory ( bdi ) and hamilton depression rating scale ( hdrs ) were 11 and 18 respectively . \n escitalopram was started , which was gradually increased from 5 to 20 mg / day . though his depressive symptoms showed response to medications \n non - pharmacological treatment based on cognitive - behavioral approach was started mainly to deal with his anger - related problem . \n the total therapy lasted over 4 weeks , which included a total of 11 sessions of 45 - 90 min / session . \n the objective of the therapy was to decrease impulsivity , arousal and expression of anger , increase his capacity to tolerate anger , channel his energy in prosocial ways and exert a better control over tension and anxiety even in tense situations . \n psychoeducation , activity scheduling , self - monitoring of anger and associated physical cues and negative thoughts , relaxation and distraction techniques and cognitive restructuring were used to attain the above objectives . \n second , he was asked to maintain a diary of his anger outbursts , which included recording the antecedents , behaviors and consequences of his anger . in addition , patient was also instructed to rate and record the intensity of anger on a scale of 0 to 10 . \n an activity schedule was prepared in collaboration with the patient and he was advised to follow it regularly in a proper way . \n themes that emerged out of the assessment was that trivial events like things not done as per subject 's wish and cues like heartbeat , hot flushes and irregular breathing increased his anger . \n this often led to impulsive acts like self - harm or violent behavior , which later led to the deep sense of guilt and disturbed his inter - personal relationship(s ) . to control the autonomic cues , \n distraction technique was suggested in the form of moving away from the arousing situation , keep calm and at the same time imagine pleasurable image or fantasy and feel good about it . \n he reported that whenever he got angry , he was able to identify the feeling that caused anger ( e.g. , fear , hurt , disappointment ) . \n further , he could contain his anger , used positive thoughts and expressed it in a respectful way . \n overall , there was about 70% improvement in his perceived ability to control his anger . \n a decrease in bdi and hdrs scores from moderate to mild severity was also noticed during this time , which finally resolved over time . before termination of sessions , importance of practicing the techniques even after resolution of depressive symptoms \n the main aim of cbt in anger management is regulation of anger by understanding and monitoring personal anger patterns and acquisition of skills involving more adaptive alternatives to provocation . \n previous studies have revealed that patients with anger attacks are significantly more depressed , anxious and have ideas of hopelessness compared to patients without anger attacks and they were more likely to meet criteria for cluster b ( histrionic , narcissistic , borderline and antisocial ) personality disorders in comparison to depressed patients without anger attacks . \n this case highlights the efficacy of cbt as a maintenance treatment for depressive illness with expressed anger , without any significant side - effect . \n patient had improvement in anger outburst , mood and overall social functioning , where pharmacotherapy alone failed to show a response . \n however , he described a greater sense of control over his anger due to cbt . \n these findings are in line with those of previous studies . in a 15-month follow - up study on anger reduction among college students , \n the treatment groups reported a significant decrease in intensity and frequency of trait anger , provoked anger , anger - related physiological arousal , anger suppression and expressed anger compared to control group . \n similar results have been demonstrated among male adolescents with conduct disorder and forensic patients with added improvement in anger control , more positive expression of anger and use of more adaptive strategies for coping with stress . \n cbt has also been proved to be efficacious in decreasing anger and aggressive driving behaviors in response to common anger - provoking stimulus among general population . to conclude \n , this case report demonstrates the efficacy of cbt in specifically decreasing anger symptoms among subjects with depressive disorder , which was not manageable with pharmacotherapy . \n thus , there is a need to focus on practicing specific anger management techniques on patients with axis-1 disorder(s ) , which has irritability and anger as its symptoms .", "role": "user" }, { "content": "people with depressive illness often have symptoms of overt or suppressed anger . \n those with anger traits face exaggerated problem during symptomatic period of depression . \n pharmacological management helps in control of depressive and anxiety symptoms , but rarely address anger symptoms . \n non - pharmacological management like cognitive - behavioral therapy ( cbt ) is effective in depression as well as in anger management , but is not used frequently in anger associated or exacerbated by depression . \n we present the case of a 27-year - old male suffering from moderate depressive episode with associated anger outburst . \n he underwent cbt , which resulted in a significant decrease in anger symptoms as well as in severity of depression .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the prevalence of individuals who are classified as overweight or obese is increasing all over the world , representing a primary health concern due to the relationship between obesity and a number of diseases , disabilities , comorbidities , and mortality [ 1 , 2 ] . \n the definition of obesity should consider not only the increase of body weight but more precisely the increase in body fat mass [ 35 ] . \n however , body composition evaluation is rarely performed in overweight and obese subjects , and the diagnosis is often achieved just considering body mass index ( bmi = kg / m ) . \n even important government institutions suggest to use bmi to determine the presence of overweight and obesity . \n the widespread use of bmi depends on its safety and minimal costs , and also on a rash and uncritical use of an epidemiological tool in clinical practice , conflicting with the advice of the inventor of bmi who first applied it to epidemiology . in 1972 , the physiology professor and obesity researcher ancel keys published a landmark study encompassing more than 7,400 men in five countries . \n keys examined which of the height - weight formulas matched up best with each subject 's directly measured fat mass ( fm ) . \n it turned out that the best predictor was qutelet 's index : body weight divided by height squared . \n but bmi was explicitly cited by keys as being appropriate for population studies and inappropriate for individual diagnosis . \n nevertheless , due to its simplicity , it came to be widely used for individual diagnosis , despite its inappropriateness . \n in fact , while bmi can be considered an important tool in epidemiological surveys , different papers stated the limitations of the use of bmi in single individuals [ 811 ] because of its incapacity to distinguish body components ( fat mass and lean body mass in particular ) . on the contrary , it is pivotal to have a reliable estimation of fm both at the initial as well as at the outcome evaluation of obese subjects . \n the purpose of this study is to verify the determinants of body composition in a population of overweight and obese subjects and to propose a different model of estimation of fm of these subjects when reliable equipments for the evaluation of body composition are not available . \n this study was based on the baseline data from a randomised controlled trial aimed at the evaluation of the effects of 2-month consumption of a combination of bioactive food ingredients on changes in body composition , satiety control , thermogenesis , and serum markers of lipolysis . \n the study was performed under the approval of the ethics committee of the department of internal medicine and medical therapy at university of pavia and registered at clinicaltrials.gov ( clinical trial registration no . \n the informed consent to the study was obtained by all the participants or their legal representatives . \n healthy males and females aged from 25 to 45 years , with a bmi greater than 25 \n kg / m and less than 35 kg / m , were eligible for the study . \n individuals who were pregnant or lactating or had any disease potentially affecting body composition and laboratory evaluation were excluded from the study ; especially , severe hepatic or renal disease , unstable cardiovascular disease , uncontrolled hypertension , active cancer , and surgery for weight loss were the main exclusion criteria . \n after a 12-hour fasting , and abstinence from water since midnight , the subjects arrived at around 8:00 am , using motorised transportation , at the endocrinology and clinical nutrition unit of azienda di servizi alla persona di pavia , university of pavia ( italy ) and at the dietetic and metabolic unit , villa delle querce clinical rehabilitation institute in rome ( italy ) . \n blood sampling for routine blood analysis and for the measurements of leptin , adiponectin , ghrelin , insulin , glycerol , and free fatty acid levels , as well as the assessment of body composition by dual energy x - ray absorptiometry ( dxa ) and anthropometry , was performed in the fasting state at baseline . \n body composition was measured using dxa ( lunar prodigy dexa , ge medical systems , waukesha , wi ) . \n the in vivo coefficients of variation were 4.2% and 0.48% for fat and lean mass , respectively . \n central fat , defined as the approximation of the visceral fat , was assessed with dxa , measuring the fat percentage corresponding to an ideal rectangle defined from the upper edge of the second lumbar vertebra to the lower edge of the fourth lumbar vertebra . \n the vertical sides of this area were the continuation of the lateral sides of the rib cage . \n the following anthropometric measurements were performed in all subjects : body weight and height ; biceps ( bsf ) , triceps ( tsf ) , suprailiac ( sisf ) , and subscapular ( sssf ) skinfold thicknesses ; waist circumference ( w ) , hip circumference ( h ) , arm circumference ( ac ) , and calf circumference ( cc ) . in order to avoid the interassessor variability , \n anthropometric variables were measured by a unique investigator following a standardized technique body weight and height ; biceps ( bsf ) , triceps ( tsf ) , suprailiac ( sisf ) , and subscapular ( sssf ) skinfold thicknesses ; waist circumference ( w ) , hip circumference ( h ) , arm circumference ( ac ) , and calf circumference ( cc ) . in order to avoid the interassessor variability , \n anthropometric variables were measured by a unique investigator following a standardized technique using the aforementioned anthropometric parameters , the following variables were calculated : body mass index ( bmi ) : weight ( kg)/height ( m);waist to hip ratio ( whr);arm muscle area ( ama ) ( cm ) = ac(tsf)/4;arm fat area ( afa ) ( cm ) = ( ac/4)ama;muscle arm circumference ( mac ) ( cm ) = ac(tsf ) . bioimpedance analysis ( bia ) . whole - body impedance vector components , resistance ( r ) , reactance ( xc ) , and phase angle ( pa ) , were measured with a single - frequency 50 khz analyzer sta - bia ( akern bioresearch srl , pontassieve , florence , italy ) . \n other parameters like body cell mass ( bcm : the protein rich compartment which is affected in catabolic states ) and hydration status ( total body ( tbw ) , extracellular ( ecw ) , and intracellular water ( icw ) ) were derived from electrical data . \n the external calibration of the instrument was checked with a calibration circuit of known impedance value . \n estimations of ffm and fm by bia were obtained using gender - specific , bia prediction equations recently developed by sun et al . in a large population that included extremes of bmi values . the fat mass index ( fmi ) \n was calculated through the normalisation of fm , obtained by the bia , for height : fmi = fm ( kg)/height ( m ) . \n body mass index ( bmi ) : weight ( kg)/height ( m ) ; waist to hip ratio ( whr ) ; arm muscle area ( ama ) ( cm ) = ac(tsf)/4 ; arm fat area ( afa ) ( cm ) = ( ac/4)ama ; muscle arm circumference ( mac ) ( cm ) = ac(tsf ) . \n subjects were instructed to fast over 12 hours and to refrain from any form of exercise for 48 hours , before blood collection . \n female subjects were tested during the early follicular phase of their menstrual cycles ( days 310 ) . \n fasting venous blood samples were drawn between 08.00 and 10.00 am . blood collection and handling \n were carried out under strictly standardized conditions , and clinical chemistry parameters were detected with dedicated commercial kits . in particular , \n total cholesterol , triacylglycerol , hdl- and ldl - cholesterol , free fatty acid ( ffa ) , glycerol , glucose , insulin , c - reactive protein ( crp ) , plasma acylated and unacylated ghrelin , adiponectin , and leptin serum levels were measured . \n insulin resistance was evaluated using the homeostasis model assessment ( homa ) and quantitative insulin sensitivity check index ( quicki ) using the following formulas : homa - ir = [ ( fasting insulin , u / ml ) ( plasma glucose , mmol / l)]/22.5 , quicki = 1/[log(glucose , mg / dl ) + log(insulin , u / ml ) ] . \n homa - ir = [ ( fasting insulin , u / ml ) ( plasma glucose , mmol / l)]/22.5 , quicki = 1/[log(glucose , mg / dl ) + log(insulin , u / ml ) ] . \n data were described as mean and standard deviation ( sd ) if continuous and as percentage if categorical . \n we considered fm from dxa as the outcome variable and all the anthropometric , bioimpedance , and laboratory data as potential explicative variables . \n the predictive values of bmi and fm from bia were compared to the fm from dexa ( overall predictive value , sensitivity , specificity , positive , and negative predictive values ) . \n therefore , we considered the following cut - off values for the definition of obesity : fm 25% for men and 35% for women \n ( at dxa and bia ) ; the variance analysis and the student t - test was used to assess the significance of differences in the averages ; the to compare the frequencies observed with those expected ; pearson 's to evaluate the correlation existing between two continuous variables . \n variables univariately proven to correlate with the outcome variable were entered a pool of potential contributors in multiple regression analysis . \n we estimated models using a forward likelihood stepwise method ( cut - off probability for entry : 0.05 ) . with each \n added variable , the discriminant function was recalculated , and any variable that no longer met the significance level was removed from the equation ( cut - off probability for removal : 0.1 ) . \n some variables with similar biological significance were excluded from the logistic analysis , in order to avoid the confounding effect of collinearity ( verified with pearson 's r , t - test , or ) . \n the best fitting model was chosen according to the value of the correlation coefficients r ( comparing the explained variance of the model 's predictions with the total variance of the data ) and the adjusted r ( r adj ) , considering a correction for inclusion of variables . \n 19891999 ) and the win episcope 2.0 ( facultad de veterinaria di saragozza ( e ) , wageningen university ( n ) , and university of edinburgh ( gb ) ) statistical software packages . \n one hundred and three overweight or obese subjects were included in the study : 74 women ( aged 41.5 10.2 years ) and 29 men ( aged 43.8 8.1 years ) ; baseline characteristics are summarized in table 1 . \n bia showed a good predictive value in classifying subjects as obese when compared to dxa ( overall predictive value 85.3% , sensitivity 85% ) , while bmi exhibited a very bad performance ( overall predictive value 48.5% , sensitivity 47.5% ) ( table 2 ) . \n the results of the univariate analysis considering the correlation between fm from dxa and all anthropometric , bioimpedance , and laboratory parameters ( table 3 ) showed thata good correlation was found between fm from dxa and bmi ( r = 0.74 ) , afa ( r = 0.59 ) , waist and hip circumferences ( r = 0.75 ) . although it is slightly lower , a statistically significant correlation \n was also observed between fm from dxa and skinfold thicknesses , waist , arm , and calf circumferences ; a good correlation was present between fm from dxa and fm from bia ( r = 0.91 ) and fmi ( r = 0.86 ) ; a good correlation was shown between fm from dxa and crp ( r = 0.43 ) and leptin levels ( r = 0.57 ) , and leptin / adiponectin ratio ( r = 0.42 ) . \n although it is slightly lower , a statistically significant correlation was observed between fm from dxa and insulinemia , homa , and quicki indexes . \n a good correlation was found between fm from dxa and bmi ( r = 0.74 ) , afa ( r = 0.59 ) , waist and hip circumferences ( r = 0.75 ) . \n although it is slightly lower , a statistically significant correlation was also observed between fm from dxa and skinfold thicknesses , waist , arm , and calf circumferences ; a good correlation was present between fm from dxa and fm from bia ( r = 0.91 ) and fmi ( r = 0.86 ) ; a good correlation was shown between fm from dxa and crp ( r = 0.43 ) and leptin levels ( r = 0.57 ) , and leptin / adiponectin ratio ( r = 0.42 ) . although it is slightly lower , a statistically significant correlation \n was observed between fm from dxa and insulinemia , homa , and quicki indexes . \n the multivariate regression analysis was performed using only the independent variables significantly correlated with the outcome variable in the univariate analysis : bmi , afa , h , and fm from bia , fmi , crp , leptin , and lar . in the block model of the regression analysis , \n all the selected variables were included and r and r adj of the model were , respectively , 0.88 and 0.87 . \n the strength of association between fat mass from dxa and independent variables was , in descending order , greater for fm from bia ( r = 0.91 ; r = 0.75 ) , bmi ( r = 0.73 ) , afa ( r = 0.59 ) , leptin ( r = 0.57 ) , fmi ( r = 0.42 ) , crp ( r = 0.42 ) , and lar ( r = 0.41 ) . with the forward stepwise , \n three variables ( fmi , crp , and lar ) were omitted ; r , r adj , and the strength of association between fat mass from dxa and independent variables remained unchanged . \n when bmi entered the regression equation ( at the third step ) , it accounted for 1.6% to the variance of the model ( sig f change = 0.001 ) . \n different models considering alternatively bmi or fm from bia together with leptin and crp levels were verified . \n the model including fm from bia showed a better correlation ( greater r and r adj ) than the model using bmi ( tables 4 and 5 ) . \n the inclusion in the model of the fmi instead of the fm from bia did not result in any improvement of the model . the results and models identified have maintained their substantial validity for both genders and for different classes of bmi ( less than or greater than 30 kg / m ) or age ( less than or greater than 30 years ) ( data not shown ) . \n the results of the study showed that the bmi did not represent the main predictor of fm from dxa . \n fm from bia and hip circumference showed a better association with fm from dxa than bmi . \n these data were confirmed by the predictive value analysis where bmi showed a performance similar to a coin flip . \n the boundary between health and disease in malnutrition ( over- and undernutrition ) in terms of body composition is crucial to accurately define criteria for intervention , and in particular methods and intensity of nutritional intervention , but it still represents a clinical challenge to be addressed . \n the index appeared for the first time in an article published on proceedings of the academy of sciences titled recherches sur le poids de l'homme aux diffrens ges in 1833 . \n taking into account a number of aspects , from his average arm strength to the age at which he marries . \n the equation was used to describe the standard proportions of the human build the ratio between body weight and height in the average adult . using data \n collected from several hundred countrymen , he found that body weight varied not in direct proportion to height but in proportion to the square of height ( people 10% taller than average tended to be about 21% heavier ) . \n it is therefore not a measurement of adiposity , but merely an imprecise mathematical estimation , as shown in many papers [ 1923 ] . \n even if bmi represents an important epidemiological tool , as evidenced by the study by ancel keys , when considering the single individual , it can not be considered a reliable diagnostic tool to define the degree of obesity that is necessary to define the intensity of the clinical interventions ( nutritional , psychological , rehabilitation , surgical , and pharmacological interventions ) that can be applied to the overweight or obese patient . \n the reason is that the bmi is not able to accurately assess the body composition , especially in terms of fm , ffm , and water content , whereas it is useful in defining the severity of obesity . \n it means that the predictive ability of bmi to identify obese subjects ( fm > 25% for men and \n > 35% for women ) is very poor , as shown in our study . \n in addition , the bmi is not able to discriminate two broad categories of subjects that deserve special attention in their therapeutic and rehabilitative pathway : patients suffering from sarcopenic obesity \n , who have a more marked disability , due to their reduced ffm , and the normal weight - obese subjects whose fm is increased despite a normal bmi , having a higher risk of comorbidities such as hyperlipidemia , coronary artery disease , hypertension , and diabetes . furthermore , change in bmi predicts neither change in fm nor in ffm , as demonstrated in different categories of patients [ 25 , 26 ] . finally , different studies show that bmi / fm relation is curvilinear especially at higher bmis with a different association at different levels of bmi . \n bmi significantly underestimates prevalence of obesity when compared to dxa direct measurement of body fat percentage . in our study \n , the predictive capacity of bmi to correctly classify subjects as obese is very low . in our sample , despite considering only overweight or obese subjects , bmi explained just 74% of the variance of fm . in other studies , based on the general population , \n the results are even worst . on the other hand , despite representing the reference method in clinical practice to define body composition , dxa presents some critical aspects related to the fact that it is not available in all facilities treating obese subjects , to the necessity to use the same dxa device and analysis software for longitudinal evaluation and studies , and to its structural limitations that do not allow , in most cases , an effective assessment in particular of patients with a bmi > 40 mg / m . \n hence , we still need to measure and estimate body composition , reflecting nutritional intakes , losses , and expenses over time . \n therefore , practical tools for this purpose and clinically useful biomarkers remain to be identified , in order to better characterize obese subjects and target their therapeutic and rehabilitative approaches . \n in contrast with body weight and bmi , techniques for body composition measurement allow the measurement of tissue losses , by analyzing separately ffm and fm . \n moreover , different authors suggest that ffm and fm should be better normalized for body height ( ffmi = ffm ( kg)/height ( m ) ) ; fmi = fm ( kg)/height ( m ) , similarly to normalization of body weight for height through bmi calculation , to express the results of body composition [ 28 , 31 , 32 ] . in our study , this normalization did not improve the predictive value of the multivariate regression models . \n if anthropometry has not indifferent limits linked to the principles and clinical applications of bia have been described in different studies since many years and reviewed in two position papers of the espen [ 36 , 37 ] . \n the measurement of total body impedance allows the estimation of total body water by assuming that hydration status is constant . from total body water \n ( 60% is the proportion of body weight attributable to water in healthy adult ) , assuming that in muscle there is about 73% of water , and using validated equations and reference values , it is possible to estimate ffm and , by the difference between body weight and ffm , body fat , indirectly [ 38 , 39 ] . because of its simplicity , noninvasiveness , low - cost , quickness of use at bedside , and high interoperator reproducibility , \n bia has emerged as the technique of choice for the systematic and repeated evaluation of ffm ( and fm ) in clinical practice . as already stated by deurenberg , however , several factors limit the valid application of bia in the severely obese state : the assumption of a constant hydration status , body geometry , and body water distribution . \n different attempts were made to improve the predictive capacity of anthropometric parameters and bioimpedance analysis implementing their results with different biochemistry parameters ( leptin , adiponectin , insulin levels , etc . ) \n , models considering fm from bia together with leptin concentrations seem to be better correlated with fm from dxa . in other studies , \n the use of leptin levels improved the precision of bmi adjustment , whereas , as verified in our study , adiponectin to leptin / adiponectin ratio , insulin , and ghrelin levels did not . \n this effect was attributed to hyperleptinemia among obese subjects ( in particular in women ) . \n it was previously suggested to incorporate leptin adjustments into a more accurate diagnosis of obesity considering also that a significant decrease of leptin affects long - term weight control [ 43 , 44 ] . \n moreover , increased leptin levels are associated with the inflammatory process and potentially the entire increased morbidity of obesity [ 45 , 46 ] . \n first of all , it was a cross - sectional study ; longitudinal data would allow the quantification of outcomes related to adiposity in particular in normal bmi population and in sarcopenic obese subjects . \n furthermore , our study was based on a convenience sample of small size considering only subjects with bmi between 25 and 40 kg / m and aged between 18 and 57 years . \n therefore , the results that we found must be verified in other age classes and for bmi groups below and above this range . \n finally , an accurate definition of fat mass is necessary as one pivotal criterion for clinical interventions , in particular in tailoring nutritional intervention and to document its effectiveness . considering that the bmi can not be a reliable predictor of fm \n , we can hypothesize that the use of bia in combination with other biomarkers ( leptin levels in particular ) could be very useful in defining the clinical features of the obese patient in order to better address the therapeutic and rehabilitative approaches , as long as the cost / effectiveness of dxa will not be favorable .", "role": "user" }, { "content": "background . \n the prevalence of overweight and obesity is increasing and represents a primary health concern . \n body composition evaluation is rarely performed in overweight / obese subjects , and the diagnosis is almost always achieved just considering body mass index ( bmi ) . \n in fact , whereas bmi can be considered an important tool in epidemiological surveys , different papers stated the limitations of the use of bmi in single individuals . aim . to assess the determinants of body composition in overweight and obese subjects \n . methods . in 103 overweight or obese subjects ( 74 women , aged 41.5 10 years , and 29 men , aged 43.8 8 years ) , \n a multidimensional evaluation was performed including the assessment of body composition using dual energy x - ray absorptiometry ( dxa ) , anthropometry , bioimpedance analysis ( bia ) , and biochemical parameters ( total cholesterol , triacylglycerol , hdl- and ldl - cholesterol , free fatty acids and glycerol , glucose , insulin , c - reactive protein , plasma acylated and unacylated ghrelin , adiponectin , and leptin serum levels ) . \n results . \n bmi does not represent the main predictor of fm estimated by dxa ; fm from bia and hip circumference showed a better association with fm from dxa . \n moreover , models omitting bmi explained a greater part of variance . \n these data are confirmed by the predictive value analysis where bmi showed a performance similar to a coin flip .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the terms congenitally missing , absence , developmental hypodontia , and tooth agenesis are all expressions used to describe the failure of 1 to 5 permanent teeth to form ; this is a relatively common occurrence with an incidence of 3 - 8% in the general population.1,2 with the exception of third molars , the most frequently observed missing teeth are mandibular second premolars and maxillary lateral incisors . \n to answer this question , orthodontists must know the developmental stages of the permanent dentition . \n odontogenesis of second premolars has been reported to show greater variability than other permanent teeth.2,3 while moorrees et al.4 showed that the calcification of second premolars are initiated between 2 and 2.5 years of age , nolla5 reported that the crypt of mandibular second premolars is usually apparent at 3 years of age . \n the results of another longitudinal study indicated that second premolar formation is initiated at 3 - 3.5 years of age in most cases.6 because of the large variability in odontogenesis , an orthodontist should ideally wait until a patient is 5 - 6 years old before giving the final agenesis diagnosis decision for mandibular second premolars . \n treatment of congenital tooth absence consists of 2 main treatment options : the first option involves replacing the residual space with implants or fixed prostheses and closing the spaces by moving the adjacent teeth into the residual space ; the second option is to retain the deciduous tooth if its roots seem adequate , but modify its morphology if necessary . \n however , if the second op tion is chosen , orthodontists must keep in mind that prosthesis will have to be constructed anyway if the root of a deciduous tooth resorbs later in life . if not contraindicated , closing the space between missing teeth with the patient 's own teeth is the most preferable option for both orthodontist and the patient . \n when this option is chosen , the orthodontist may perform this treatment without hesitation , including the extraction of the mandibular second deciduous molars to permit mesial drift of the first permanent molars spontaneously or orthodontically if the patient is over 6 years old . \n however , the risk involved in this treatment approach is presented in this case report that demonstrates how we approached orthodontic treatment in an 8.5-year follow - up study of an 8-year - old girl exhibiting late odontogenesis of a mandibular right second premolar . \n a female patient aged 8 years and 1 month was referred to the department of orthodontics in the faculty of dentistry at cumhuriyet university with a major complaint of maxillary anterior crowding . \n a detailed intraoral examination revealed that the patient was in early deciduous dentition and had a well - aligned mandibular arch and class ii molar relationship on both sides ; additionally , her maxillary left lateral incisor was in cross - bite . \n a panoramic radiograph showed that the permanent mandibular second premolars were absent ( figure 1 ) , and lateral cephalometric evaluations revealed that the patient had a slightly high vertical growth pattern ( table 1 ) . \n the main treatment plan included the following objectives : obtaining a functional occlusion , correcting the cross - bite of the maxillary lateral incisor , and closing the mandibular deciduous second molar space by mesial movement of the permanent first molars . \n the first alternative was to retain the deciduous second molars , as the roots were adequate , and to distalize the maxillary first molars to achieve a class i molar relationship in addition to correcting the cross - bite of the maxillary left lateral incisor . \n however , the patient had a vertical growth pattern ; if the roots of deciduous second molars would resorb later in life , then the residual space would need to be rehabilitated with an implant prosthesis . \n the second alternative involved the extraction of the deciduous second molars followed by mesialization of the permanent first molars into the extraction space , despite the prolonged treatment time to move the first permanent molar about 8 mm . in this second treatment plan , \n the case was evaluated in detail and the options were proposed to her parents ; finally , the second alternative was chosen considering the vertical growth pattern of the patient and the cost of the implant prosthesis . \n the cross - bite of the maxillary left lateral incisor was corrected by using a removable appliance , including a labiolingual spring , for 2 months . \n interestingly , a developing mandibular right second premolar was clearly observed on a panoramic radiograph approximately 17 months later when the patient was 9 years and 6 months old ( figure 2 ) . \n the germ of the maxillary left third molar was also seen at the same time . following this development , we revised the treatment plan and decided to wait for possible odontogenesis of the permanent left premolar as well as evaluate the calcification process of the right premolar . while there was no evidence of mandibular left second premolar odontogenesis at 2 years after the first appointment \n ( when the patient was 10 years and 2 months old ) , calcification of the maxillary right third molar and crypt formation of the mandibular right third molar were observed ( figure 3 ) . \n however , at this time the deciduous left second molar roots had resorbed , even though its successor was absent . \n three years and 2 months after the first appointment , the mandibular left third molar 's crypt formation was observed in addition to advancement of the other third molars and calcification of the mandibular right second premolar . \n because the formation of all third molars occurred and there was no evidence of mandibular left second premolar odontogenesis , we considered this premolar to be congenitally absent . \n following the revised treatment plan , the deciduous left second molar was extracted and the permanent left first molar was allowed to drift mesially ( figure 4 ) . \n in addition , the maxillary left permanent second premolar was also extracted to establish a class i molar relationship . \n a removable appliance was constructed for both the lower and upper arch , and necessary adjustments were made to achieve parallel movement . \n after all permanent teeth reached occlusion , except the third molars and mandibular right second premolar , 0.018-inch slot roth prescription brackets ( american orthodontics ) were placed on both arches ; leveling started with 0.012-inch nickel - titanium archwires . \n the spaces were closed , midlines were corrected , class i molar and canine relationships were achieved , and growth pattern remained almost stable after 19 months of fixed appliance therapy ( table 1 ) . \n the mandibular right second premolar became exposed within the oral cavity 7 years and 4 months after the initial appointment ( figure 5 ) and reached occlusion 15 months after first exposure ( figure 6 ) . \n previous studies have revealed that mandibular second premolars exhibit the greatest variations in differentiation and calcification among all teeth , except for the third molars.2,3 calcification of these teeth usually begins approximately 2 - 2.5 years of age , with 2 standard deviations at less than 3.5 - 4 years of age ; crown formation is usually completed by 6 - 8 years.4 however , the calcification of mandibular second premolars at approximately 5 - 6 years of age is not a rare condition.6,7 second premolar agenesis can usually be confirmed when the patient is 8 - 9 years of age , because reasonably few second premolars form after this age.6 in the case presented here , initial radiographs showed that the mandibular second premolars were absent when the girl was 8 years and 1 month old . \n however , we observed that this patient unexpectedly developed late formation of the right second premolar at almost 10 years of age . according to our assessment at that time , we could not presume the possibility of this late formation of second premolars in an 8-year - old girl . \n moreover , we were not surprised to find that the patient did not develop second premolars beneath the mandibular second deciduous molars at this age because that is the con genital tooth absence most commonly seen in this region \n . consequently , we created a treatment plan that included the extraction of deciduous second molars and mesialization of permanent first molars . \n fortunately , this treatment procedure was never followed through ; because of the late formation of the right second premolar observed at a subsequent follow - up , and the treatment plan was revised . in cases \n where there is an absence of a successor tooth , lindqvist8 recommends extraction of the retained mandibular deciduous second molar within the period between 8 years of age and completion of root development for the first permanent molar in order to obtain maximum space closure by bodily drift of the adjacent teeth . \n however , in a few cases , such as the one reported here , this approach might induce irreversible consequences is the overlying deciduous teeth is not retained until the roots of the successor teeth have formed . delay in tooth formation \n is considered a milder representation of tooth agenesis.9 - 11 one study revealed that , compared to the control group , a group of children affected by hypodontia experienced a significant delay in dental development.12 moreover , rune and sarns13 presented data suggesting a tendency toward excessive retardation of tooth formation in teeth contralateral to missing teeth . however , a tooth contralateral to the late - developed second premolar was not formed in the case presented in our study . \n studies investigating the genetic and molecular genetic causes of agenesis have begun to identify genes important in tooth agenesis.9 the transcription factor genes msx1 and pax9 were the first genes identified for nonsyndromic tooth agenesis.14,15 although both genes affect third molars , a significantly higher frequency of agenesis associated with mutations in msx1 than in pax9 has been found for second premolars and maxillary first premolars.9 third molar agenesis was suggested to be a complex anomaly that may be related to delayed calcification of posterior teeth.16 however , in the case presented here , all third molars were developed ; consequently , this situation demonstrated that there was no association between the developmental absence of third molars and the delayed formation or agenesis of the second premolar . \n this finding was similar to the results presented by previous case reports.17 - 19 these findings therefore suggest that the cause of the delayed formation of the mandibular right second premolar with a congenital absence of a contralateral premolar might be the result of msx1 mutation . \n overall , this case demonstrated that orthodontists should always be aware that unusual circumstances can occur , especially when treating growing patients . to reduce the risk of misdiagnosis \n furthermore , periapical radiographs should be taken at regular intervals every 6 months in growing patients exhibiting tooth agenesis . \n consequently , follow - up radiography should be performed prior to giving a final hypodontia diagnosis decision , especially after deciduous second molar extraction but before space closure .", "role": "user" }, { "content": "in this report , we present the case of a girl with delayed odontogenesis of a lower second premolar for which she was followed up for 8.5 years . \n congenital absence of permanent mandibular second premolars was observed at the initial radiographic examination at 8 years and 1 month . \n one year later , during the treatment period , an unexpected odontogenesis of a right second premolar was diagnosed on follow - up radiography . \n the original treatment plan was revised and a new plan was successfully implemented . \n th is unusual case showed that the orthodontist 's clinical philosophy must be flexible because unexpected situations can arise , especially when treating growing patients .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: international digestive endoscopy network ( iden ) is organized by korean society of gastrointestinal endoscopy ( ksge ) and the korean gastrointestinal endoscopy research foundation . \n iden 2012 ( www.iden2012.org ) was the second annual meeting , held on june 9 to 10 , 2012 at grand hilton hotel convention hall , seoul , korea . \n iden 2012 was designed to offer participants from all over the world with opportunities to share up - to - date knowledge about basic and clinical aspects of gastrointestinal ( gi ) endoscopy and to engage in in - depth discussion with worldwide well - known experts . \n the organizing committee had this dream of forming the ' international network ' connecting the world through the ' digestive endoscopy.'1 during iden 2012 , scientific programs were held in two or three rooms designated for upper gi ( ugi ) , lower gi ( lgi ) , pancreatobiliary ( pb ) categories , respectively , as shown in table 1 . \n twenty - two speakers were invited from overseas ; more specifically , 13 from japan , five from usa , one from hong kong , one from united kingdom , one from italy , and one from belgium . \n in addition , total of 92 korean endoscopists participated the event as chairperson , speaker , and/or discussant ( fig . \n , there were 62 invited lectures , 28 case - based discussions , 20 video lectures , and 6 breakfast with the experts . \n invited lectures and case - based discussions were grouped into 11 sessions according to their categories . \n small group participants of breakfast with the experts in early mornings shared their vivid and updated experiences with worldwide experts . \n there were a total of 598 participants registered from 12 countries , including other asian countries ( cambodia , hong kong , japan , kazakhstan , malaysia , mongolia , and vietnam ) , europe ( belgium , italy , and uk ) , and usa as well as korea . \n a total of 70 abstracts were submitted , and 18 of them were presented at the three video forum sessions in the fields of ugi , lgi , and pb . \n videos were of excellent quality showing the highest level of scientific research , skills , and technologies in the practice of endoscopy . among these 18 abstracts presented at the video forum , \n 6 outstanding abstracts were selected as the ' best video ' in three categories of ugi , lgi , and pb . the presenters of each video were awarded a plaque and a prize of 500 us dollars . \n fifty - two abstracts were presented as poster presentation during the meeting in the emerald hall . among 152 posters , \n three outstanding posters were selected as the ' best poster ' in three categories of ugi , lgi , and pb . the presenters of each poster were also awarded a plaque and a prize of 300 us dollars . \n twenty - two global and domestic pharmaceutical and medical device companies sponsored the meeting and provided luncheon symposium in the plenary presentation . \n the exhibition was held at convention hall lobby and emerald hall , open to all participants for 2 days . in the iden 2012 \n , all attendees could catch up the latest knowledge and share the newest experience about gi endoscopy through the invited lectures , case discussions , and video lectures . \n on the 1st day , participants reviewed the role of endoscopy in gastroesophageal reflux disease;2 endoscopic treatment of subepithelial lesions and stricture / leakage ; endoscopic ultrasound ( eus ) in the estimation of early gi cancers;3 colonoscopy , enteroscopy , and computed tomography / magnetic resonance imaging in inflammatory bowel disease ; large balloon dilatation for large bile duct stone ; and tissue acquisition for bile duct disease . \n on the 2nd day , they reviewed everything about endoscopic submucosal dissection and endoluminal stents,4,5 management of gi bleeding , how to explore small bowel disease , advanced techniques for pb visualization , and how to approach eus - guided pb drainage . \n i am certain that it showed good model for globalization and internationalization of local endoscopy society . \n iden 2013 will be held on june 8 to 9 , 2013 at grand hilton hotel convention hall , seoul , korea .", "role": "user" }, { "content": "international digestive endoscopy network ( iden ) is an international meeting covering scientific subjects of diverse topics about upper gastrointestinal ( gi ) endoscopy , colonoscopy , endoscopic ultrasonography , and pb endoscopy . \n iden is organized by korean society of gastrointestinal endoscopy and the korean gastrointestinal endoscopy research foundation , and took its first step in 2011 in seoul , korea . \n iden inaugurated a new era of diagnostic and therapeutic gi endoscopy . \n iden 2012 was designed to offer participants from all over the world with opportunities to share up - to - date knowledge about basic and clinical aspects of gi endoscopy and to engage in in - depth discussion with worldwide well - known experts . during the 2 days of meeting \n , there were 62 invited lectures , 28 case - based discussions , 20 video lectures , and 6 breakfast with the experts . \n there were a total of 598 participants registered from 12 countries , including asian countries , europe , and usa as well as korea .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: arginine methylation \n is a posttranslational modification catalyzed \n by protein arginine n - methyltransferases ( prmts ) . \n this family of enzymes transfers the methyl group from s - adenosyl - l - methionine ( adomet , sam ) to the guanidino group \n of specific arginine residues , leading to mono- or dimethylated arginine \n residues and releasing s - adenosyl - l - homocysteine \n ( adohcy , sah ) as a co - product . \n this posttranslational modification \n regulates a wide diversity of biological processes , from chromatin \n remodeling , signal transduction , rna splicing , and dna repair to cell \n proliferation and differentiation . in humans , \n nine prmts have been identified \n so far and are classified into two major groups , type i ( prmt1 , -3 , \n -4 , -6 , and -8 ) and type ii ( prmt5 and -9 ) according to the specificity \n and stereochemistry of the methylated product . \n type i prmt enzymes \n catalyze the formation of asymmetric -n , n - dimethylarginine ( adma ) residues , \n whereas the formation of symmetric -n , n - dimethylarginine ( sdma ) residues \n is maintained by type ii enzymes . \n prmt1 , the predominant mammalian \n type i enzyme , is identified by yeast two - hybrid screening . \n prmt1 is ubiquitously expressed and responsible \n for over 85% of the arginine methylation in mammalian cells . \n for instance , prmt1 is an essential element in \n the oncogenic mll fusion complexes and confers an aberrant transcriptional \n activation property critical for the induction of leukemia . \n importantly , given the close \n correlation of prmt1 activity with the up - regulation of serum -n , n - asymmetric dimethyarginine amino acid , which \n is an endogenous nitric oxide synthase ( nos ) inhibitor , prmt1 has \n causal relationship with broad cardiovascular implications and inflammatory \n responses such as diabetes and hypertension . \n prmts \n belong to a highly conserved family of proteins in eukaryotes \n with a conserved catalytic methyltransferase domain . \n the three - dimensional \n structures of a few type i prmts have been determined . \n the structure of the mammalian prmt1 revealed a two - domain architecture \n composed of a common adomet binding domain and a barrel - like domain \n with the active site situated between them . given that the amino acid \n sequences constituting the adomet binding region in prmts are largely \n invariant , specificity in the binding of target proteins likely plays \n a major role in the substrate selective methylation performed by these \n enzymes . \n the selective inhibition of specific prmts over others is \n highly desirable and could yield potential new therapeutics with minimum \n off - target toxicity . \n also , isoform - selective inhibitors are powerful \n chemical genetic tools for dissecting the enzymatic functions of prmt1 \n with spatial and temporal resolution in selected disease pathways . \n a steady progress has been witnessed in \n the past years in developing \n prmt chemical modulators . \n adomet analogues such as sinefungin \n and methylthioadenosine were used in the early stage as chemical tools \n for studying prmt function , regardless of their pan - antimethylation \n activity . \n interestingly , recent work showed that some compounds containing \n the structural scaffold of adomet linked to arginine motifs can lead \n to inhibitors with certain isoform selectivity . \n substrate - based \n inhibitors have particular value for obtaining cocrystal structures \n of the enzyme substrate complex , thus being useful molecular \n tools for understanding substrate recognition mechanism . on the other \n hand , a number of small molecule prmt inhibitors \n have been reported \n such as ami-1 , stilbamidine and allantodapsone , rm65 , pyrazoles , benzo[d]imidazoles , ns-1 , among others . \n it should be cautioned that some of these compounds , e.g. , ami-1 , \n ns-1 , and a36 , most likely target the histone substrate rather than \n the prmt1 enzyme . notwithstanding \n recent progress , \n considerable challenges remain as to how to achieve high potency and \n selectivity . \n more diverse chemical structures are waiting to be discovered \n or designed in order to meet the need of basic biology research and \n therapeutic development . \n herein we report diamidine - type compounds \n for selective inhibition \n of prmt1 over other prmts ( carm1 , prmt5 , and prmt6 ) . \n the activity \n of diamidine compounds as therapeutic agents is previously known : \n inhibition of tachyzoite proliferation against neospora caninum and toxoplasma gondii , interaction with nuclear dna topoisomerase ii , erg / dna complex modulation which is important during gene \n expression , and the use as antileishmanial \n agent . \n 2,5-bis(4-amidinophenyl)furan \n ( furamidine , compound 1 ) has been shown to concentrate \n in the cell nucleus and delay parasite maturation , serving as an anti - plasmodium vivax agent or potent antiparasitic agent in vitro or in \n vivo . because of its ability to disrupt \n mitochondrial membranes , 1 can be used as an antimicrobial \n agent too . despite such wide applicability \n , \n the use of diamidines for prmt inhibition has not been reported previously \n except for stilbamidine . \n we studied a number of diamidine compounds \n for prmt inhibition , and several showed clear selectivity for prmt1 . \n kinetic data and computer modeling suggest that compound 1 targets the active site pockets of prmt1 . \n in this work , we \n attempted to develop prmt - selective inhibitors containing diamidine \n groups . \n spannhoff and co - workers previously reported that a diamidine \n compound , stilbamidine , inhibited prmt1 activity at the micromolar \n level . \n since then , however , no further \n reports have been invested on diamidine - based prmt inhibitors . \n our \n rationale in considering diamidines for prmt inhibition was the close \n resemblance of the amidine group to the guanidine moiety of the substrate \n arginine . to test this hypothesis , we assessed a series of diamidine \n compounds for prmt1 inhibition ( figure 1 ) . \n in addition to inhibiting prmt1 , the representative member of type \n i arginine methyltransferases , we also tested the effect of the compounds \n on the activity of type ii methyltransferase prmt5 , with the purpose \n of gaining type i and/or type ii selective inhibitors . \n we used the \n typical radiometric p81 filter binding assay to measure the effect \n of these diamidines on the activity of prmt1 and prmt5 . in the assay , \n [ h]-labeled adomet and a histone 20-aa h4 peptide from \n the n - terminal tail of histone h4 ( denoted h4 - 20 ) were used as substrates . \n the initial screening for both prmt1 and prmt5 inhibition was performed \n at 20 m of each compound , and the results are summarized in table s1 . \n it is clear that different compounds \n showed varied degrees of inhibitory activity toward prmt1 and prmt5 . \n for instance , while 21 showed only very weak activity , 2 was found to block more than 85% of the activity for both \n prmt1 and prmt5 . \n structures of tested amidine compounds . in consideration of the significance of isoform - selective \n inhibitors , \n we are particularly interested in those hits that selectively inhibited \n prmt1 or prmt5 activity . \n in this regard , compound 1 ( furamidine , \n also known as db75 ) showed more than \n 75% inhibition of prmt1 while it had only 11% inhibition against prmt5 , \n which demonstrates that 1 likely is a selective inhibitor \n of prmt1 . \n indeed , the ic50 of 1 was determined \n to be 9.4 m for prmt1 and 166 m for prmt5 ( table 1 ) . \n thus , compound 1 exhibited selective \n inhibition for prmt1 over prmt5 . also , the analogue 5 showed comparable potency and selectivity to 1 , with \n ic50 of 7.2 m for prmt1 and 186 m for prmt5 . \n stilbamidine , previously reported as a prmt1 inhibitor , was tested \n for comparison and showed ic50 values of 15.2 m \n for prmt1 and 44.1 m for prmt5 . \n thus , the selectivity of stilbamidine \n proved to be inferior to both compound 1 and compound 5 . \n ic50 values of different \n diamidine compounds were tested by filter - binding assay with 1 m \n h4(120 ) peptide , 0.5 m [ h]adomet , 0.04 \n m prmt1 , and prmt5 , and incubation was with varying concentrations \n of each compound at 30 c for 8 min . for assay on carm1 and prmt6 , \n 1 m histone h3.1 \n was used instead of 1 m h4(120 ) \n peptide , and the reaction time was 1 h. prmts are largely \n categorized into two classes , type i and type ii , with prmt1 being \n representative of type i and prmt5 of type ii . \n compound 1 showed clear type i selectivity \n based on the ic50 data for prmt1 and prmt5 . in an effort \n to determine the selectivity profile of the diamidine compounds on \n other type i prmts , \n coactivator - associated arginine methyltransferase \n 1 ( carm1 , prmt4 ) and prmt6 were examined ( table 1 ) . \n all the experiments were accomplished with the same radioactive \n p81 filter binding methylation assay . \n it is an interesting observation \n that the diamidine compounds tested here , 1 and 5 and stilbamidine , showed stronger inhibition for prmt1 over \n the other prmts . in particular , the activities of these diamidine \n compounds were much weaker toward carm1 and prmt6 . \n together , the data \n in table 1 demonstrated that 1 and 5 are prmt1-selective inhibitors . \n the data shown in table s1 offer some interesting insights about \n the sar of the diamidine compounds in prmt1 and prmt5 inhibition . \n first , the activities of the diamidine compounds are sensitive to \n alkylation of the terminal amidine moiety . \n compounds 9 , 12 , 17 , 18 , and 22 having alkyl and 26 having phenyl substituents on the \n amidine all showed reduced activity in comparison with 1 . \n likely , these hydrophobic substituents decrease the hydrogen bond \n donor effect of the diamidine that is important for prmt1 binding . \n steric hindrance is also a factor : the bulkiness on the diamidine \n termini clearly reduces activities . \n for example , compound 18 ( with the cyclohexyl substituent ) showed a weaker activity than 9 and 12 , which contained cyclopentyl and cyclopropyl \n substituents , respectively . \n phenyl substitution was even more detrimental \n than alkylation ( e.g. , 26 versus 18 ) . both \n of the amidine groups seem to be required for efficient inhibition \n of prmt1 . \n this can be seen from the activity differences between 25 and 1 , 14 and 4 , \n and 24 and 5 , the first of which lost one \n amidine group and showed decreased activity . \n it is possible that either \n the hydrogen bond donating ability or the positive charge of the amidine \n group plays a critical role in binding to prmt1 . \n the replacement \n of the oxygen heteroatom in the furan ring of compound 1 with s or se atom ( compounds 4 and 3 ) \n had almost no effect on activity , probably because these three atoms \n have a similar stereoelectronic property . \n however , replacement with \n nh ( 6 ) caused a bigger loss in activity , as nh has an \n additional hydrogen atom . \n compound 28 , with a phenyl \n substituent on the pyrrole ring , almost lost all activity , likely \n because of increased steric bulkiness . \n the anti - prmt1 activities of \n the diamidine compounds are also sensitive to the changes on the two \n benzene rings . \n the ortho substitution with a nitrogen atom especially \n decreased activity ( e.g. , 7 and 10 in comparison \n with 1 ) . on the other hand , \n the meta substitution was \n less sensitive , as seen in 5 that was equally potent \n as 1 . \n the sar property of the diamidine compounds \n for prmt5 inhibition \n is different from that for prmt1 inhibition . \n the most striking feature \n is that the amidine group ( at least one of the two ) seems not to be \n essential for prmt5 inhibition . \n compounds 8 and 14 lost one amidine group compared with 4 , but \n they exhibited a stronger potency for prmt5 . \n these results may suggest \n that monoadimine compounds might be more favorable than diamidine \n for prmt5 inhibition . \n furthermore , alkylation of the diamidine termini \n offered a positive contribution for prmt5 inhibition . \n compounds 9 , 12 , 17 , 18 , and 26 had an alkyl or phenyl group on the diamidine , and all \n of them showed better activities than 1 that contained \n unmodified diamidines . \n this phenomenon may be an indication that the \n hydrogen bonding effect of the amidine moiety in prmt5 binding is \n not as important as the hydrophobic interaction inferred . \n also , compound 28 is more hydrophobic and bigger in size than 1 and showed stronger activity for prmt5 , suggesting that stronger \n hydrophobicity and bigger size at the central five - member - ring position \n might be a favorable factor for prmt5 inhibition . \n overall , our biochemical \n data suggest that prmt5 prefers to bind those ( di)amidine molecules \n with higher hydrophobicity and more bulkiness . \n as seen vide infra , \n our computational analysis shows that prmt1 has a more compact cavity \n than prmt5 , and this difference could be an explanation for the selective \n inhibition of prmt1 by compounds 1 and 5 . since 1 is structurally simple and is one \n of the best hits among the tested diamidine compounds for prmt1 , we \n focused on this compound for further mechanistic characterization . \n to elucidate the inhibition mechanism of compound 1 , \n steady - state kinetic characterization was conducted . in this study \n , \n the initial velocities of prmt1 were measured at several selected \n concentrations of the inhibitor over a range of varied concentrations \n of the h4 - 20 peptide while fixing the concentration of [ h]sam . \n the data were plotted with velocities versus h4 - 20 concentration \n in figure 2a . \n double - reciprocal plot was also \n shown with 1/velocity versus 1/[h4 - 20 ] ( figure 2b ) . for a more quantitative analysis , the michaelis \n menten \n kinetic data were fit to the following equation:1where [ s ] \n is the concentration \n of the h4 - 20 peptide . from the fitting we obtained a kis of 2.6 m and a kii of 38 m . \n the kis value is about \n 14-fold smaller than kii value , which \n implies that 1 has a strong nature of competitive inhibition \n with respect to the peptide substrate . in the double - reciprocal plot , \n a series of straight lines were intersected closely in the second \n quadrant , also supporting a pseudo - competitive pattern of inhibition . \n ( a ) and ( c ) \n are michaelis menten plots , and ( b ) and ( d ) \n are double - reciprocal plot of initial velocities versus varied concentrations \n of h4 - 20 or [ h]sam . \n concentration of 1 was \n selected at 0 m ( ) , 10 m ( ) , 20 m \n ( ) , 30 m ( ) , and 40 m ( ) . in ( a ) \n and \n ( b ) , the concentration of [ h]adomet was fixed at 3 \n m , and in ( c ) and ( d ) , the concentration of h4 - 20 was fixed \n at 15 m . \n a similar experiment \n was done in which the initial velocities were \n checked at several selected concentrations of 1 over \n a range of varied [ h]sam concentration when fixing h4 - 20 \n concentration ( figure 2c ) . \n after the data were \n processed in an analogous way , a kis of \n 16 m and a kii of 26 m were \n obtained by fitting with eq 1 . \n the resemblance \n of the kis and kii values suggests that compound 1 is classic \n noncompetitive inhibitor with respect to sam . \n it is possible that \n compound 1 has the capacity to bind both free and sam - bound \n prmt1 . in the double - reciprocal plot , \n a series of straight lines show \n a pattern of intersection close to the x - axis , further \n supporting the classic noncompetitive nature of inhibition ( figure 2d ) . \n to further validate that compound 1 is primarily a \n competitive inhibitor of prmt1 with respect to the substrate h4 - 20 , \n we conducted a competitive fluorescence anisotropy binding assay in \n which a fluorescein - labeled h4 peptide ( h4-fl ) was used as a substrate \n ligand for prmt1 binding . \n we introduced varied concentrations of 1 into a mixture \n containing a fixed concentration of prmt1 and h4-fl to examine the \n competition between 1 and h4-fl . \n as shown in figure 3 , when concentration of 1 was increased , \n the anisotropy value of the mixture decreased accordingly and reached \n a plateau of about 0.055 . \n these data clearly illustrated that compound 1 indeed competes with h4-fl for binding to prmt1 , which is \n in accordance with the results of radiometric steady - state kinetic \n characterization . \n further study showed that 1 did not \n target the substrate peptide ( figure s-1 in the supporting information ) , excluding the possibility of ligand \n competitive binding measurement with fluorescence anisotropy : \n fluorescence \n anisotropy ( 524 nm ) of h4-fl and prmt1 complex at different concentrations \n of compound 1 . \n the concentrations of h4-fl and prmt1 \n were kept constant at 0.2 and 2.0 m , respectively . \n to date , \n no crystal structures \n of human prmt1 ( hprmt1 ) have been solved . \n however , the highly conserved rattus norvegicus prmt3 ( rprmt3 , pdb code 1f3l ) and human prmt3 ( hprmt3 , pdb code 3smq(45 ) ) structures are available . the rat - prmt1 \n x - ray structures ( pdb codes 1or8 , 1ori , 1orh ) are not well suited as templates for homology \n modeling because the crystals were obtained at a nonphysiological \n ph of 4.7 and an important helical segment near the binding pocket \n was not resolved ( residues 140 ) . \n thus , we generated a homology \n model for the active form of hprmt1 on the basis of the rprmt3 and \n hprmt3 x - ray structures . \n the sequence identity between the individual \n enzymes is sufficiently high for this approach ; the residues within \n the binding pocket especially are highly conserved ( hprmt1 and hprmt3 , \n 47% overall sequence identity ; hprmt1 and rprmt3 , 49% overall sequence \n identity for the conserved core containing the sam - binding site and \n the c - terminal barrel - like domain ) . to better understand the \n mechanism underlying the selective binding of compounds 1 and 5 to prmt1 versus other prmts ( e.g. , prmt5 ) , we \n carried out docking calculations with autodock4.2 using as targets the hprmt1 homology model and the x - ray \n structure of hprmt5 , respectively . in these calculations , \n the region \n encompassing the sam - binding site and substrate arginine site was \n included in the bounding box for docking . \n subsequently , the energy \n profile and stability of the predicted structures for the docked complexes \n were assessed through extensive molecular dynamics ( md ) simulations \n and molecular mechanics / poisson boltzmann solvent - accessible \n surface area ( mm - pbsa ) calculations . \n the steady - state \n kinetic analysis and fluorescence anisotropy binding assay showed \n that compound 1 acted as a primarily competitive inhibitor \n with respect to h4 - 20 , while noncompetitive versus [ h]sam \n md simulations and mm - pbsa calculation of the hprmt1 and hprmt5 in \n the presence of sah were also performed to rationalize the differences \n in inhibition patterns . \n table 2 and table s2 showed the averaged binding free energies \n for protein ligand complexes along with corresponding decomposition \n by energy terms . \n the estimated binding \n free energy gb was 27.0 \n kcal mol for the hprmt11 complex \n and 12.4 kcal mol for the hprmt51 complex . \n similarly , gb of the hprmt15 complex was lower than that of \n the corresponding hprmt55 complex by 22.5 kcal \n mol ( table s2 ) . \n this \n trend agrees with our experimental observation that compounds 1 and 5 bind more favorably to hprmt1 . \n we further \n analyzed the free energy components to determine the dominant interactions \n responsible for the observed binding specificity . according to the \n components of the binding free energy ( table 2 and table s2 ) , both the intermolecular \n ( gas phase ) van der waals and electrostatic interactions \n the electrostatic solvation ( gpolar ) disfavors binding because of desolvation penalty for the ligand \n and prmt . \n nonpolar solvation , which corresponds to the burial of solvent - accessible \n surface area ( sasa ) upon binding , gives a slightly favorable contribution . \n in order to identify the binding \n mode and the detailed interactions \n responsible for stabilizing compound 1 and compound 5 in the hpmrt1 and hprmt5 structures , the binding free energy \n was decomposed into individual residue contributions and key residues \n for binding to hprmt1 and hprmt5 are shown in figure 4 and figure s2 . in agreement with the available experimental data , \n compound 1 and compound 5 bind the hprmt1 \n active site and \n were found to be the stronger inhibitors of hprmt1 \n when compared to hprmt5 . a common feature of compound 1 and compound 5 binding to hprmt1 is the interaction \n ( via hydrogen bonding ) of amidine groups with the acidic residues \n glu129 , glu144 , and glu153 of hprmt1 ( figure 4 and figure s2 , left panels ) . \n one of the \n amidine groups extends into the channel , which accommodates the substrate \n arginine during catalysis . \n this amidine group is well placed to gain \n optimal interactions with glutamic acid residues glu144 and glu153 , \n reported to be essential for binding and catalysis . \n notably , the compound 1 and compound 5 scaffold stretches out partially into the sam adenine binding \n site , slightly overlapping with the cofactor methyl donor group and \n forming hydrogen bonds between the second amidine group of the ligand \n and residue glu129 of hprmt1 . \n this binding mode explains why compound 1 is mainly a peptide substrate - competitive inhibitor and \n partially competes with [ h]sam from the steady - state kinetic \n analysis and fluorescence anisotropy binding assay , since compound 1 and compound 5 interact with glu144 and glu153 \n by disrupting the binding with the substrate . \n the calculations also \n show that sah binds slightly more favorably to prmt compared to compound 1 and compound 5 ( table 2 and table s2 ) . \n several hydrophobic ( met146 , \n met155 , and thr158 ) and ( try35 , phe36 , and \n tyr39 , yfxy motif ) interactions are detected between the compound 1 and compound 5 ligands and hprmt1 . \n the yfxy \n motif in the n - terminal helix x is invariant among all known \n prmts . in rprmt3 , f218 ( yfxy ) \n forms edge to face hydrophobic interaction \n with adenine groups of adohcy , and tyr217 and tyr221 ( yfxy ) , whose \n hydroxyl groups point to the active site residue glu335 . \n previously \n it was determined that deleting helix x indeed reduced cofactor \n cross - linking and abolished enzyme activity in prmt1 , suggesting important \n roles of helix x both for cofactor binding and for catalysis . \n compound 5 differs from compound 1 by a single nitrogen atom ( amidinophenyl group ) replacing \n carbon and thus shares similar orientation to the latter compound \n in the hpmrt1 active site \n . predicted binding modes of compound 1 in prmt1 and \n prmt5 from docking ( autodock 4.2 ) and molecular dynamics simulation \n ( namd 2.8 ) . \n residue interaction energies from mm / pbsa \n energy decomposition for ( a ) prmt1 and ( b ) prmt5 . \n ( c , d ) binding modes \n of compound 1 with ( c ) prmt1 and ( d ) prmt5 . the best \n docking pose obtained from autodock for 1 in complex \n with the hprmt1 homology model ( based on 1f3l(44 ) and 3smq(45 ) ) and x - ray hprmt5 ( 4gqb ) was selected \n for md simulation . \n dominant structures for the hprmt11 and hprmt51 complexes from the last 20 ns of \n md trajectory clustering analysis were used for visualization . \n prmt \n residues engaging the ligand are explicitly shown in ball and stick \n representation . \n the protein ( in cartoon representation ) is colored \n according to the residue contribution values in the free energy decomposition \n from red ( negative ) to blue ( positive ) . \n figure 4 and figure \n s2 ( right panel ) showed the interaction modes of compound 1 and compound 5 with hpmrt5 . \n both compounds \n showed a similar type of interaction with the residues of the binding \n pocket . \n one amidine group of compound 1 makes electrostatic \n and hydrogen bond interactions with glu435 and glu444 , whereas the \n second guanidine group is involved in hydrogen bonding to asp419 . \n in the case of compound 5 , glu435 and glu444 form hydrogen \n bonds and electrostatic interactions with one guanidine group . in \n addition \n , several hydrophobic interactions were formed between the \n ligands and residues leu315 , leu316 , leu319 , leu436 , leu437 , met420 , \n and pro314 in the hprmt5 active site \n . however , the energy contributions \n of these residues to ligand binding in hprmt5 are below 5 kcal / mol \n ( from free energy decomposition ) ( figure 4 and figure s2 , right panels ) . \n thus , electrostatic \n interactions between the amidine of compound 1 and compound 5 and the carboxylate of glu in the hprmt1 structure may facilitate \n inhibition of prmt1 . the differences in the binding modes for \n diamidines ( compounds 1 and 5 ) to hprmt1 \n and hprmt5 are directly linked \n to the differences in computed binding free energy gb and to the experimentally observed selectivity . \n the curvature associated with the planar ligand structure \n enables diamidines to partially occupy the cofactor site and also \n span the substrate arginine binding site . \n thus , the shape of the diamidine \n inhibitor is compatible with the shape of the cavity formed by the \n adjacent substrate / cofactor sites in prmts . \n for the same reason compound 1 has also been known to favorably bind dna in the minor groove \n ( because of compatible curvature ) . \n next , we evaluated the selectivity \n of compounds 1 and 5 in terms of electrostatic \n and shape complementarity ( figure 5 and figure s3 ) . both binding pockets in prmt1 and \n prmt5 \n were found to be electrostatically highly complementary to the \n ligands ( figure 5a and figure 5b ; figure s3a and s3b ) . with both \n pockets \n the difference in gb ( and correspondingly in selectivity ) arises from the better \n shape complementarity of compounds 1 and 5 for the prmt1 pocket ( figure 5c and figure 5d ; figure s3c and s3d ) . in prmt1 , \n the tighter fit of the inhibitors to the binding pocket \n correlates with the larger computed affinity gb . \n by contrast , prmt5 exhibits a larger , partially solvent \n exposed pocket and binds the ligands less tightly in agreement with \n the smaller computed affinity gb . \n therefore , the shape and rigidity of the diamidine ligands could \n be tuned to exploit differences in the binding cavities among prmts , \n thus providing an avenue to design more selective prmt inhibitors . \n electrostatic \n and shape complementarity in diamidine binding to \n prtm1 and prmt5 : ( a ) electrostatic potential surface for the binding \n pocket of prmt1 with compound 1 ; ( b ) electrostatic potential \n surface for the binding pocket of prmt5 with compound 1 ; ( c ) shape of the binding cavity of prmt1 ( red ) with compound 1 ( blue ) ; ( d ) shape of the binding cavity of prmt5 ( red ) with \n compound 1 ( blue ) . \n the best docking pose obtained from \n autodock for 1 in complex with the hprmt1 homology model \n ( based on 1f3l(44 ) and 3smq(45 ) ) and x - ray \n hprmt5 ( 4gqb ) was selected for md simulation . \n dominant \n structures for the hprmt11 and hprmt51 complexes from the last 20 ns of md trajectory clustering \n analysis were used for visualization , the same as for figure 4c , d . \n the charges of proteins were assigned using \n pdb2pqr server and electrostatic potential \n was calculated using apbs . \n the electrostatic \n potential varied from 10kbt / e to + 10kbt / e and was depicted using chimera in panels a and b from red to blue , respectively . \n the ligand in panels a and b is color - coded by am1bcc charge from \n red ( negative ) to blue ( positive ) . \n prmt1 is highly \n expressed in many different kinds of tumors as shown from gene expression \n data from the oncomine web site . \n first , we wanted to verify whether \n compound 1 inhibited the prmt1 enzymatic activity in \n cells . \n it is known that the aly protein ( also called yra in yeast ) \n is heavily methylated on the n terminal region and c terminal region \n flanking the rna binding domain from the literature and from our unpublished data . \n we used asym24 antibody \n which has been used widely as a generic antibody for methylarginine \n recognition to detect the protein methylation status of gfp - aly fusion \n protein in 293 t cells treated with 1 for 15 h. gfp - aly \n was immunoprecipitated with gfp antibody ( allele biotech ) . in a comparison \n of lane 1 with lane 2 with and without compound 1 treatment \n ( figure 6a ) , it was shown that the expression \n level of the methylated gfp - aly protein was significantly reduced \n when the cells were treated with 20 m compound 1 when the equal amount of total gfp - aly protein was loaded onto both \n lanes ( with or without compound 1 treatment ) . \n therefore , \n we confirmed that the drug is permeable to cell membrane and inhibits \n cellular prmt1 activity . \n 20 m 1 was added to 293 t cells for 15 h before \n harvest . \n 20 m 1 was added to the cell culture for 3 days \n before harvesting for cell viability assay . as a control , \n the cells \n were treated with the same amount of dmso as that added in drug treated \n samples . \n the y - axis is the percentage of viable cells \n in drug treated group by viable cells in control group as denominator . \n hel cells are with jak2 v617f mutation . \n cmk cell , cmy cell , cms cell , and chrf cells are with trisomy 21 . \n we have investigated the cell viability with 10 different \n leukemia \n cell lines treated with 20 m compound 1 . \n we measured \n the number of viable cells in culture every day in 3 consecutive days . \n we found that compound 1 inhibited cell growth for most \n of the leukemia cell lines except hel cells which have jak2v617f mutations . \n interestingly , we found cell lines derived from down s syndrome \n patients and mll - af9 patient ( such as cmy , chrf-288 - 11 , and molm-13 \n cells ) are more sensitive to prmt1 inhibitor 1 than cell \n lines from other mutation backgrounds ( such as hel , jurkat , and hl-60 \n cells ) \n . the detailed mechanisms of the hypersensitivity would be a \n subject of further investigation . \n we \n reported a set of diamidine compounds that showed micromolar \n prmt inhibition . among these compounds , \n 1 and 5 showed potent selective inhibition for prmt1 compared with the other \n prmts such as carm1 , prmt5 , and prmt6 . \n compound 1 is \n cell membrane permeable and can effectively inhibit prmt1 activity \n intracellularly . \n compound 1 also inhibited cell proliferation \n in a panel of leukemia cell lines with different genetic lesions . \n interestingly , compound 1 is a well - established inhibitor \n in a number of previous applications which were described in the introduction . \n however , the function of 1 as a selective prmt inhibitor had not been previously established . \n the mechanism for the higher affinity of compound 1 for \n prmt1 rather than the other prmts such as prmt5 was explored by examining \n the detailed ligand \n our combined computational and experimental results \n support that these rigid crescent - shaped compounds span the adjacent \n substrate and cofactor binding sites . \n the positively charged amidine \n functional group serves as an anchor point to ensure binding to the \n peptide site of prmt . \n this dual mode of inhibition was confirmed by \n kinetic experiments wherein diamidines showed a primarily competitive \n mode of inhibition for the substrate and a classical noncompetitive \n ( i.e. , partially competitive ) inhibition toward the cofactor . \n further \n work would be of value to optimize this class of diamidine compounds \n by rational design to improve their selectivity and/or potency in \n prmt inhibition . \n the disclosed diamidine prmt inhibitors will be useful \n chemical probes to investigate new functions of prmts in biology . \n david boykin s group at georgia \n state university , with > 95% purity based on chn elemental analysis , h and c nmr , and mass spectrometry . \n his6x - tagged prmt1 \n was expressed in recombinant pet28b vector transformed escherichia \n coli bl21(de3 ) and purified on ni - nta beads . \n gst - tagged carm1 \n and his6x - tagged prmt6 were expressed and purified as previously described . to obtain ha - tagged prmt5 , freshly growing \n human embryonic kidney 293 t ( hek 293 t ) cells were co - transfected with \n recombinant plasmid pcdna3-ha - prmt5 and plasmid pcmv - sport6-wdr77 \n ( a gift from dr . \n the co - transfected cells were made \n into lysate by using cold m - per mammalian protein extraction reagent . \n ha - prmt5 inside the lysate was purified on ha - peptide agarose beads \n by eluting with 2 mg / ml ha - peptide in 1 tbs before protein concentration \n using ultrafiltration . \n filter \n binding assay was carried \n out in 0.65 ml plastic tubes with a 30 l reaction volume at \n 30 c . \n the reaction buffer was composed of 50 mm hepes ( ph 8.0 ) , \n 50 mm nacl , 1 mm edta , and 0.5 mm dtt . \n 0.5 m tritium labeled s - adenosyl - l - methionine ( [ h]sam , perkinelmer ) \n was used as methyl donor , and 1 m histone h4(120 ) was \n used as the methyl acceptor . \n typically , 6 l of varied \n concentrations of each candidate inhibitor in reaction buffer was \n added into the wells prior to the addition of 18 l of mixture \n composed of [ h]sam and a certain kind of prmt in the same \n reaction buffer . \n the 24 l mixture was incubated at room temperature \n for 5 min before the reaction was started by adding 6 l of \n h4(120 ) dissolved in reaction buffer . \n after incubation \n for an appropriate period of time , 20 l of the reaction mixture \n was aspirated and spread onto anionic p81 filter paper disks ( whatman ) . \n the paper disks loaded with reaction mixture were dried in air for \n 2 h and then washed with 1 l of 50 mm nahco3 ( ph 9.0 ) solution \n for 15 min three times . \n then the paper disks were dried in air overnight \n before transfer of the disks into 3.5 ml vials full of scintillation \n oil , and the amount of methylation was quantified by scanning the \n vials on a scintillation counter ( beckman coulter , brea , ca ) or a \n microbeta2 ( perkinelmer ) . \n the kcat and km of prmt1 for h4(120 ) was obtained \n by measuring the initial velocity of reaction at different concentrations \n of h4(120 ) and fitting the kinetic data with michaelis \n the ki for compound 1 was calculated by using the equation ki = ic50/(1 + [ s]/km ) . \n fluorescence anisotropy \n of fluorescein - labeled peptides was measured on a fluoromax-4 spectrofluorometer \n ( horiba jobin yvon ) . \n the competitive binding of 5 to prmt1-h4(120)fl solution was measured using the fluorescence \n anisotropy mode in a similar manner as described previously . \n 0.2 m h4(120)fl and 2 m \n prmt1 were mixed , and increasing concentrations of 5 stock \n were added until the fluorescence anisotropy signals leveled off . \n the anisotropy values at 524 nm from several scans were plotted as \n a function of inhibitor concentration . \n sequences and structures of rattus norvegicus protein \n arginine methyltransferase 3 ( rprmt3 ) , \n the human prmt3 ( hprmt3 ) , and the human prmt5 ( hprmt5 ) were downloaded \n from the protein data bank ( pdb codes 1f3l,3smq , and 4gqb(53 ) ) . the sequence of the hprmt1 ( genbank \n accession number np_938074.2 ) was aligned against the sequence of hprmt3 \n and rprmt3 with the clustalw alignment server ( http://www.ebi.ac.uk/tools/msa/clustalw2/ ) . \n then the homology model of the hprmt1 was built using modeler \n 9v10 software based on the alignment with the hprmt3 and rprmt3 as \n templates . \n the molecular structures of compounds 1 and 5 were generated by omega 2.4.3 program \n ( openeye scientific software ) . \n the atomic \n coordinates of hprmt1 ( homology model ) and hprmt5 ( crystal structure ) \n were used as the receptor model for docking . \n the initial blind docking \n used a grid box of 120 120 120 points in three dimensions \n with a spacing of 0.375 centered on the whole adomet - binding \n domain and -barrel domain and indicated that the major interacting \n region was located between the two domains . \n accordingly , further docking \n was carried out centered at the adomet - binding site and substrate \n arg site with a grid box of 64 64 64 points in three \n dimensions with a spacing of 0.375 . \n the best docking pose \n obtained from autodock for compound 1 and compound 5 in complex with the hprmt1 and hprmt5 was selected for molecular \n dynamics ( md ) study . \n the steady - state kinetic analysis and fluorescence \n anisotropy binding assay indicate that compound 1 is \n mainly a substrate - competitive inhibitor of prmt1 for h4(120 ) \n versus [ h]sam . therefore , to ensure completeness of the \n mm / pbsa analysis , we also modeled sah bound to prmt1 and prmt5 in \n the md simulations . \n all energy minimizations and molecular dynamics \n simulations were performed with namd 2.8 using ff99sb force field parameters for the protein and gaff parameters for the \n ligands ( compound 1 and compound 5 ) in explicit solvent ( tip3p water ) . \n the systems were then minimized for 5000 steps with backbone atoms \n fixed followed by 5000 steps of minimization with harmonic restraints \n to remove unfavorable contacts . \n the systems were then gradually brought \n up to 300 k and run for 50 ps in the nvt ensemble while keeping the \n protein backbone restrained . \n the equilibration was continued for another \n 2 ns in the npt ensemble , and the harmonic restraints were gradually \n released . \n the 30 ns production simulation was performed in the npt \n ensemble ( 1 atm and 300 k ) without constraints . \n a short - range cutoff \n of 10 was used for the short - range nonbonded interactions with \n a switching function at 8.5 . \n the long - range electrostatic interactions \n were treated with a smooth particle mesh ewald method . \n the r - respa multiple time step method was employed with a 2 fs integration time step \n for bonded , 2 fs for short - range nonbonded interactions , and 4 fs \n for long - range electrostatic interactions . \n the free \n energy of binding for ligands ( 1 , 5 , and \n sah ) to hprmt1 and hprmt5 was estimated using the mm - pbsa method in \n amber 9.0 as the average over the last \n 20 ns ( 2000 frames ) from the trajectories . \n the mm - pbsa method combines \n molecular mechanics , poisson boltzmann electrostatics for polar \n solvation free energy , nonpolar solvation energy based on solvent - accessible \n surface area , and normal - mode analyses for entropy to calculate the \n binding free energy for the protein complexes . \n the interaction \n energies were decomposed into contributions \n from the ligands and hprmt1 or hprmt5 residue pairs . \n the same dynamics \n trajectories utilized in the mm - pbsa calculations were used for the \n energy decomposition . \n electrostatic potentials were calculated using \n apbs and mapped onto the molecular surface \n corresponding to the prmt1 and prmt5 binding . \n ptraj module \n of amber tools 12 and vmd were used for \n the analysis of trajectories and structural visualization . \n cell viability was measured by celltiter - glo \n viability kit ( promega , madison wi ) . \n 10001500 cells were seeded \n in individual wells of a 96-well plate , with 100 l culture \n volume per well . \n all these leukemia cell lines were grown in rpmi \n medium plus 10% fetal bovine serum . \n 20 m 1 or \n the same amount of dmso was added to the culture . at 0 , 24 , 48 , 72 \n h after drug treatment , 100 l of celltiter - glo reagent was \n added to each well . \n luminescence signals , which are proportional to \n cell viability in each well , were measured by microplate reader ( biotek , \n winooski , vt ) we \n made a stable cell \n line from 293 t cells expressing gfp - aly growing in dmem medium plus \n 10% fetal bovine serum . \n with this cell line , we made whole cell extract \n with h lysis buffer ( 150 mm nacl , 20 mm tris , ph 7.8 , 0.5 mm etda , \n 0.2 mm pmsf , 1 mm naf , 1 mm sodium orthovanadate , 1% np-40 , 1 mm dtt ) . \n the cells in h lysis buffer were incubated on ice for 30 min before \n being cleaned by spinning at 12000 g for 20 min . conjugated \n gfp antibody beads ( allele biotech inc . , san diego , ca ) were used \n to pull down gfp fusion protein . \n page \n gels and detected by asym24 antibody ( millipore ) in western blot assay \n ( chemiluminescence reagents ) .", "role": "user" }, { "content": "protein arginine methylation is a \n posttranslational modification \n critical for a variety of biological processes . \n misregulation of protein \n arginine methyltransferases ( prmts ) has been linked to many pathological \n conditions . \n most current prmt inhibitors display limited specificity \n and selectivity , indiscriminately targeting many methyltransferase \n enzymes that use s - adenosyl - l - methionine \n as a cofactor . here \n we report diamidine compounds for specific inhibition \n of prmt1 , the primary type i enzyme . \n docking , molecular dynamics , \n and mm / pbsa analysis together with biochemical assays were conducted \n to understand the binding modes of these inhibitors and the molecular \n basis of selective inhibition for prmt1 . \n our data suggest that 2,5-bis(4-amidinophenyl)furan \n ( 1 , furamidine , db75 ) , one leading inhibitor , targets \n the enzyme active site and is primarily competitive with the substrate \n and noncompetitive toward the cofactor . \n furthermore , cellular studies \n revealed that 1 is cell membrane permeable and effectively \n inhibits intracellular prmt1 activity and blocks cell proliferation \n in leukemia cell lines with different genetic lesions .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: azathioprine ( aza ) is an imidazole derivative of mercaptopurine ; antagonizes purine metabolism and may inhibit synthesis of dna , rna , and proteins . \n it may also interfere with cellular metabolism and inhibit mitosis . the 6-thioguanine nucleotides appear to mediate the majority of azas immunosuppressive and toxic effects . among other indications , \n aza is approved by the food and drug administration for the treatment of inflammatory bowel disease , mainly for the maintenance of remission . \n we report a case of perforating dermatosis associated to aza in a patient with ulcerative pancolitis . \n a 26-year - old previously healthy woman was admitted with profuse diarrhea and fever , having been diagnosed with ulcerative pancolitis confirmed by biopsy . \n this flare was controlled with only one complete cycle of systemic steroids , and afterwards , maintenance treatment was started with mesalazine . \n three days later , she developed a well - characterized adverse reaction to several preparations of mesalazine ( pentasa , claversal ) and developed profuse diarrhea . \n three weeks later , the patient presented with a slightly pruritic lesions on the dorsum of the hands that had appeared progressively . \n physical examination revealed reddish , umbilicated papules , 5 to 10 mm in diameter , with adherent central keratotic plugs [ figures 1 and 2 ] . lesions were located mostly on the hands and a few of them on the lateral aspects of the neck . \n umbilicated erythematous papules with adherent central keratotic plug on the dorsum of the hands detail of a keratotic papule on knuckles of the right hand a biopsy from a lesion on the back of the hands revealed a particular pattern of superficial dermal necrosis , with trans - epidermal elimination of verticalized collagenous fibers and necrotic debris , without any association with follicular structures consistent with perforating dermatosis ( pd ) [ figures 3 and 4 ] . at low power magnification \n the lesion reveals irregular acanthosis of the epidermis with accumulation of slighty basophilic collagen in the dermal papillae and a keratotic corneal plug ( h and e stain 4 ) a close - up view of particular pattern of superficial dermal necrosis , with transepidermal elimination of verticalized collagenous fibers . \n ( masson stain 40 ) following clinical and laboratory investigations , treatment with tacrolimus 0.1% ointment was started with improvement of symptoms but without disappearance of lesions . \n aza was withdrawn , and mesalazine was started with subsequent improvement of the skin involvement within few days . \n aza , a 6-mercaptopurine ( 6-mp ) analogue , has been used for crohn 's disease and ulcerative colitis for over 30 years , mainly as a steroid - sparing agent . \n side - effects occur in about 10% to 15% of patients with inflammatory bowel disease treated with aza . \n the most commonly encountered problems are nausea , vomiting , and malaise , especially if the dose is increased too rapidly . \n the other types of side - effects can be divided into 4 categories : dose - dependent ( such as bone marrow depression ) , dose - independent ( including cutaneous lesions ) , infectious , and neoplastic ones . among the clinical side - effects of aza , cutaneous signs and symptoms emerge as an infrequent problem that rarely results in discontinuation of treatment . \n a few case reports exist of disorders in the neutrophilic dermatosis spectrum , including erythema nodosum - like eruptions and acute disseminated exanthematous pustulosis induced by aza . \n however , to the best of our knowledge , perforating dermatosis has not been reported in association with aza . \n perforating dermatosis has been described in association with diabetes , chronic renal disease , and malignancy as well as following various inflammatory cutaneous conditions , but it has never been related to inflammatory bowel disease . in the absence of underlying renal or diabetic problems in our patient , we speculate that perforating lesions are different stages of a common pathological process rather than a chance finding \n . this is supported by the temporal relationship with the aza administration and the subsequent disappearance of the lesions after aza withdrawn . \n this led us to speculate a possible casual relationship between the administration of aza and the development of perforating dermatosis . \n drug - induced maculopapular rashes , with histological findings suggestive of perforating collagenosis , have previously been described in an oncological patient treated with bevacizumab , as well as under other different drugs like sirolimus , penicillamine , gefitinib , indinavir , and sorafenib.[811 ] pathogenesis of pd is poorly understood . \n aza suppresses intracellular inosinic acid synthesis , thereby interfering with adenine and guanine ribonucleotide production . \n this reduction in intracellular purine synthesis results in decreased numbers of circulating b and t lymphocytes , reduced immunoglobulin synthesis , and diminished interleukin-2 secretion . \n these immune disorders could cause a malfunction of fibroblasts in people with genetic susceptibility to produce focal damage to collagen and the elimination of the disrupted collagen through the epidermis . \n we hypothesize that tgfb3 could play a role in the pathogenesis of this entity , as overexpression of this factor has been reported in patients with perforating dermatosis . \n we speculate that this immunological disorder induced by aza in susceptible individuals could be related to perforating dermatosis . to our knowledge , this is the first report of a possible correlation between aza and perforating disorders and may initiate further investigation in similar observations .", "role": "user" }, { "content": "azathioprine ( aza ) is an imidazole derivative of mercaptopurine . \n it antagonizes purine metabolism , and it may inhibit synthesis of dna , rna , and proteins . \n the 6-thioguanine nucleotides appear to mediate the majority of azas immunosuppressive and toxic effects . \n while cutaneous adverse side - effects are not uncommon , perforating dermatosis has not been reported in association to aza . \n we speculate that immunological disorders induced by aza in susceptible individuals could be related to perforating dermatosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: ewing 's sarcoma is a malignant nonosteogenic primary tumor of the bone , which is mainly seen in the diaphysis of the long bones and the flat bones of the pelvis in young patients . originally , james ewing described it as a tumor arising from undifferentiated osseous mesenchymal cells ; however , recent studies suggest that ewing 's tumor may be neuroectodermally derived from the primitive neural tissue.1 this tumor is stated to comprise approximately 6% of the total malignant bone tumors , but is exceptionally rare in the small bones of hands and feet , where the reported incidence is not more than 1%.2 \n a previously healthy 10-year - old girl presented with a large swelling arising from the right little finger of 6 months duration . \n the swelling was initially small and painless to start with and was associated with fever and chills . \n she was seen at a local hospital , where a radiograph was taken which revealed a cystic and lytic lesion of the little finger proximal phalanx [ figure 1 ] . \n it was diagnosed as osteomyelitis , and she was treated with analgesics and antibiotics . as the swelling and pain progressed , she was referred to this institute . \n the swelling was 6 6 cm , tender , pulsatile and firm in consistency . \n the fresh radiograph showed a large soft tissue mass with some calcification within and complete destruction of the phalanx [ figure 2a and b ] . magnetic resonance imaging ( mri ) \n scan of the hand revealed an ill defined expansible lesion in the proximal phalanx with marrow signal changes that were t1 hypointense and t2/short tau inversion recovery hyperintense with juxtacortical soft tissue mass [ figure 3 ] . \n fine needle aspiration cytology ( fnac ) of the lesion was performed and reported as having features of small blue round cell tumor . \n computed tomography ( ct ) of the chest , abdomen , and pelvis was normal . \n histopathology of excised tissue showed small round cells with high nuclear - cytoplasmic ratio and coarse chromatin with occasional pseudorosettes , suggestive of ewing 's sarcoma . \n the cells were periodic acid schiff positive and immunohistochemistry was positive for cd99 [ figure 4a and b ] . \n initial radiograph of hand anteroposterior view showing a cystic , lytic lesion with minimal periosteal reaction in the proximal phalanx ( a ) clinical photograph of hand showing swelling at the time of presentation to us about the size of a golf ball ( b ) . \n radiograph of hand anteroposterior view showing destruction of the entire phalanx with large soft tissue component magnetic resonance imaging in t1 and t2/soft tissue inflammatory response sequences showing the extent of the lesion in the little finger periodic acid schiff positivity of the cells seen ( a ) and immunohistochemistry showing positivity with cd99 ( b ) the patient was discharged and advised to review after 3 weeks for chemotherapy . \n however , the patient was non - compliant and returned about 4 months after the surgery with pain and swelling of the dorsum of the hand with dilated veins [ figure 5a ] \n blood investigations revealed hemoglobin of 9 g% and erythrocyte sedimentation rate ( esr ) 42 mm at 1 h. radiograph revealed cystic lesion in the third metacarpal diaphysis with sclerosis and minimal periosteal reaction [ figure 5b ] . \n mri scan showed marrow signal changes involving second , third and fourth metacarpal bones with cortical erosion and breakdown of third metacarpal bone [ figure 6 ] . \n the chest metastasis has partially resolved , and there is no local recurrence or evidence of metastasis to other sites . \n ( a ) clinical photograph at followup after 3 months shows discernible fullness over dorsum of the hand . \n ( b ) radiograph of hand anteroposterior view showing destruction of the third metacarpal with little periosteal reaction magnetic resonance imaging revealing marrow signal changes involving the second , third and fourth metacarpals with cortical breakdown of third metacarpal in t1 and t2 sequences \n ewing 's sarcoma is the second most common malignant primary bone tumor of childhood and adolescence.3 bernstein et al . , reporting 1426 patients from the european intergroup cooperative ewing sarcoma study , recorded only 1% of primary ewing 's sarcomas in the hand.4 case reports indicate that within the hand , the metacarpal is the most common locale.56 ewing 's sarcoma / primitive neuroectodermal tumor classically presents mimicking an acute infection with pain , swelling , and erythema in the affected area with associated leukocytosis and raised esr.7 siddiqui et al . reported a case of calcaneal ewing 's sarcoma with skip metastasis to adjacent tarsal bones.1 to the best of our knowledge , this is the first reported case of ewing 's sarcoma arising from phalanx of the hand with skip metastases to multiple metacarpals . \n investigative modalities done as a routine for tumor work up includes a radiograph of the part , mri scan , complete blood work up , chest x - ray , ct / ultrasonography of abdomen and tc 99 bone scan.7 \n f - fluorodeoxyglucose positron emission tomography - ct scan is a newer and excellent modality to detect unsuspected or unusual metastatic sites , monitor response to chemo or radiotherapy and to detect recurrence in primary skeletal ewing 's sarcoma.89 reinus et al . \n when studying the radiographic appearance of ewing 's sarcoma of hands and feet , found that the most common feature was that of a permeative bone lesion with poorly defined margins and an associated soft tissue mass.10 even in our patient , the early x - rays revealed a cystic and lytic lesion with large soft tissue mass with some sclerosis and negligible periosteal reaction . \n knowledge of the often atypical radiological appearance of ewing 's sarcoma of the hand is important in ensuring a prompt and accurate diagnosis.3 the differential diagnosis of this lesion includes osteomyelitis , spina ventosa , enchondroma , coccidioidomycosis , bone infarction and hand foot syndrome of sickle cell disease.3 the prognosis does not appear to be related to the radiographic appearance or dimension of the primary lesion but to the presence of known metastasis at the time of presentation.10 \n management , preferably at a specialist center by a multi disciplinary team , has included both local control , by either surgery , radiation or a combination of these , and systemic chemotherapy.5 with the advent of modern chemotherapy , the long term , 5-year survival rate has improved to approximately 70%.1112 with small soft tissue and bone sarcomas in the extremities , local control by surgery has been better than with primary radiotherapy . \n patients with hand lesions are recorded to have survived for more than 41 months and european intergroup study data showed a 68% overall 3 year survival rates in patients with distal extremity lesions.5 because ewing 's sarcoma and related tumors occur so rarely in the hand , there are no standardized treatment recommendations . \n based on current evidence , however , chemotherapy and wide local tumor resection should be considered the mainstays of treatment.6 \n the differential diagnosis of unusual finger swellings in children and the atypical radiographic picture this tumor should have high index of suspicion of ewing 's sarcoma . \n it is important to bear in mind that the presence of metastases is the most important prognostic factor and thus the need for accurate early diagnosis .", "role": "user" }, { "content": "ewing 's sarcoma is the second most common malignant primary bone tumor of childhood and adolescence affecting mainly the diaphysis of long bones and flat bones . \n this tumor is extraordinarily rare in small bones of the hand and presents as a swelling with atypical radiological features of cystic and lytic lesion with scant periosteal reaction . \n the common differential diagnosis include osteomyelitis , tuberculosis , enchondroma and benign tumors . \n moreover , skip metastasis to adjacent bones is even rarer . \n the prognosis of this condition is greatly influenced by the presence of metastasis at presentation , further emphasizing the importance of early diagnosis . \n multimodality treatment using surgery , radiotherapy and chemotherapy is currently recommended though no consensus exists . \n we report a case of ewing 's sarcoma of the little finger proximal phalanx which was initially missed and developed skip metastasis to several metacarpals within 4 months .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: diabetes mellitus is a group of metabolic disorders characterized by chronic hyperglycemia associated with symptoms like polydipsia , polyphagia , polyuria , blindness , weight loss or gain , sore heals , burning and tingling sensation , and so forth . \n diabetic population of the world in 2013 was 382 million and it has been projected to rise to 592 million by the year 2035 . \n diabetes has become a challenging health problem affecting the global population and the prevalence is higher in developing countries . among the top 10 countries having highest number of people with diabetes , \n there will be a 42% increase in the developed countries and a 170% increase in the developing countries in diabetic cases by 2030 . \n diabetes is associated with both macrovascular and microvascular complications , in which the major microvascular complication is diabetic neuropathy ( dn ) with a prevalence of 5060% . \n the neuropathy progresses with decreasing nerve functionality and nerve blood perfusion which may result in malnourished nerve and leads to permanent nerve damage . \n the clinical manifestations of diabetic neuropathy include numbness , burning and tingling sensation , and intractable pain . \n although hyperglycemia is considered to be a major pathophysiological factor in the development of diabetic neuropathy , the associated mechanisms are not fully understood yet . \n some of the major pathways like polyol pathway , advanced glycation end products , hexosamine flux , mitogen - activated protein kinases , altered activity of na / k - atpase , poly - adp ribose polymerase ( parp ) over activation , and cyclooxygenase-2 ( cox-2 ) activation have been reported to play a crucial role in development and progression of diabetic neuropathy ( figure 1 ) . \n nerve cells are prone to hyperglycemic injury as the neuronal glucose uptake is based on external glucose concentration which is 4 - 5-fold higher in diabetic subjects . \n it has been noted in experimental diabetes that the levels of neurotrophic support , including nerve growth factor and insulin like growth factor are reduced , which also contribute to malnourishment of nerves . \n all these pathways form a common platform with end result as neuronal dysfunction and nerve damage and this translates in the development of various clinical deficits seen in patients suffering from diabetic neuropathy . \n treatment of painful diabetic neuropathy presents a great challenge to clinicians due to poor diagnostic criteria and the limited treatment options available . \n currently , drugs in clinical use for diabetic neuropathic pain include tricyclic antidepressants , selective serotonin and noradrenaline reuptake inhibitors , anticonvulsants , and opioids . \n although there is a range of pharmacological agents available for treating the pain associated with diabetic neuropathy , only duloxetine and pregabalin are approved by us food and drug administration ( us fda ) for the treatment of diabetic neuropathic pain . however , as single agents , they are limited by incomplete efficacy , high cost , and dose limiting adverse effects [ 1416 ] . in spite of the voluminous research done in the field of diabetic neuropathy , clear understanding of the pathophysiology and the interwoven mechanisms are still lacking . \n there is a need to investigate futuristic , combinational , and other nonpharmacological approaches for alleviating dn and associated neuronal deficits . \n diabetic neuropathy is a syndrome which can affect both the somatic and autonomic divisions of the peripheral nervous system . in severe diabetic conditions , \n longer nerve fibres show an earlier loss of nerve conduction velocity with loss of their nerve terminals . \n the damaged nerve terminals are the reason for tingling and loss of sensation and reflexes are often first observed in the feet and then they ascend to affect other areas . \n one of the major causes for all these complications is reactive oxygen species ( ros ) produced from processes initiated and amplified under chronic hyperglycemic conditions . \n further , classical hyperglycemic pathways like polyol pathway , protein kinase c ( pkc ) pathway , formation of advanced glycation end products ( age pathway ) , and hexosamine pathway activation leads to aggravation of oxidative damage leading to vascular complications . in polyol pathway , \n aldose reductase enzyme converts glucose into sorbitol , which is then oxidized into fructose by sorbitol dehydrogenase ( sdh ) with nad as a cofactor . in case of hyperglycemic conditions , increase in oxidative stress directly results from the accumulation of sorbitol and indirectly through consumption of nadph , a cofactor for the regeneration of reduced glutathione ( gsh ) . \n increased flux through polyol pathway can decrease ( na / k ) atpase activity and studies suggested that decreased activity of this enzyme may activate pkc pathway . \n activation of pkc increases cytosolic phospholipase a2 activity and produces arachidonate and prostaglandin e2 ( pge2 ) which effectively inhibits cellular ( na / k ) atpase . persistent and excessive activation of several pkc isoforms initiates tissue injury by diabetes - induced ros , which leads to enhanced de novo synthesis of dag from glucose via triose phosphate . increased levels of triose phosphate concentrations can increase the formation of both methylglyoxal , a precursor of ages , and diacylglycerol ( dag ) , an activator of pkc . \n evidence suggests that the enhanced activity of pkc isoforms results in activation of various signalling mechanisms like mitogen - activated protein kinases ( mapk ) , nuclear factor kappa light chain enhancer of b cells ( nf-b ) , and thus leads to initiation of inflammation as depicted in figure 1 . \n overactivation of pkc has been also implicated in the decreased nitric oxide ( no ) production in smooth muscle cells and increased expression of fibrinolytic factor , plasminogen activator inhibitor ( pai-1 ) , tumor growth factor- ( tgf- ) , and nf-b activation in cultured endothelial cells and in case of vascular smooth muscle cells . \n age pathway activation results in production of many advanced glycation end products , which act on specific receptors like receptor for advance glycation end products ( rage ) present on monocytes and endothelial cells to increase the production of cytokines and adhesion molecules and also causes the alteration of protein structure . \n ages have been shown to have an effect on matrix metalloproteinases , which might damage nerve fibres . \n age receptor ligation can activate transcription of pleiotropic factor nf-b and thus enhances the production of various proinflammatory mediators ( figure 1 ) . \n hyperglycemia and insulin resistance induced excess fatty acid oxidation also appears to be reason for pathogenesis of diabetic complications . in hexosamine pathway , \n glucosamine-6-phosphate then converts into udp - n acetyl glucosamine with the help of specific o - glcnac transferases . \n evidence suggest that inhibition of gfat blocks hyperglycemia - induced transcription of both tgf- and tgf-1 . \n the mechanism behind the hyperglycemia - induced expression of genes such as pai-1 , tumor growth factor- ( tgf- ) , and tgf-1 is not clear . \n however , it has been observed that hyperglycemia causes a fourfold increase in o - glcn acylation of the transcription factor specificity protein 1 ( sp1 ) , which mediates hyperglycemia - induced activation of the plasminogen activator inhibitor-1 ( pai-1 ) promoter in vascular smooth muscle cells and of tgf-1 and pai-1 in arterial endothelial cells ( figure 1 ) . \n activation of pai-1 , tgf- , and tgf-1 causes accumulation of extracellular matrix which may lead to neuroinflammation associated with diabetic neuropathy . \n hyperglycemia induces activation of classical pathways like age , pkc , hexosamine , and polyol pathways to mediate cellular damage . \n however , the hyperglycemic cell injury is the result of cumulative occurrence of this cascade of pathways discussed in the previous section . \n generation of superoxide from mitochondrial electron transport chain is known to contribute towards hyperglycemia initiated various etiological pathways . \n hyperglycemia enhances the reducing equivalents to electron transport chain ( etc ) and the electrochemical potential across the inner mitochondrial membrane and hence increases superoxide production . \n superoxide inhibits glyceraldehyde phosphate dehydrogenase ( gapdh ) either directly or indirectly through parp mediated nadh depletion [ 30 , 31 ] . \n inhibition of gapdh by ros leads to accumulation of glycolytic intermediates upstream of this enzyme and redirected to initiate cellular pathways like age formation . \n once the ages are formed , they bind to rage and activate many other crucial pathways like nf-b and parp . \n hexosamine pathway which is activated through enhanced flux of fructose-6-phosphate and polyol pathway by elevated glucose levels . \n this , in turn , leads to osmotic stress in the cells which further takes the cell towards necrotic cell death . enhanced activity of mn - sod , a mitochondrial form of superoxide dismutase ( sod ) or overexpression of uncoupling proteins ( ucp-1 ) in experimental diabetic animals , prevents the development of vascular complications in the animals and also reduced oxidative stress mediated neuronal damage [ 31 , 32 ] . the mechanism for \n this neuroprotective effect can be the reduction of mitochondrial ros generation and the clearance of the notorious ros from the cells . \n in addition to the above theory , mitochondrial abnormalities and mitochondria associated oxidative stress stands at a central position in the pathogenesis of diabetic neuropathy . it has been noticed that defects in functioning of etc chain components compromises atp production and enhances the generation of free radicals . \n the free radicals generated causes damage to mitochondrial dna ( mt dna ) and nuclear dna ( n dna ) which in turn aggravates mitochondrial damage . \n this vicious cycle developed inside mitochondria produces intense oxidative stress and drives the cell towards apoptotic / necrotic death . \n it is an established fact that diabetes is known to affect the respiratory capacity of etc functional complexes and thus alters atp production ( figure 1 ) . \n mainly complex i and complex iii are known to be affected , which turn out to be electron leakage centres and thus inflates ros production . in addition to disturbed mitochondrial functionality , its dynamics ( size , shape , and number ) is also known to be affected in diabetic neuropathy . \n changes in mitochondrial morphology , movement characteristics can affect the transfer in axons which can lead to various sensorimotor changes . \n the glove and stocking pattern of thermal sensitivity is due to impairment in the anterograde axonal transport in sensory neurons . \n dysfunctional mitochondria can also mediate cell death through execution of apoptotic pathways , by releasing pro apoptotic factors from mitochondria into the cytosol . \n various experimental observations point towards the critical role of mitotoxicity in the pathophysiology of diabetic neuropathy . \n diabetic peripheral neuropathy is characterized by debilitating pain and sensory loss which leads to diminished quality of life . \n persistent hyperglycemia is believed to be underpinning for the neuroinflammation and nerve damage leading to the neuropathic pain . \n all the characterized classical pathways like polyol pathway , pkc pathway , mapk pathway , and increased production of ages could directly or indirectly initiate and progress the production of inflammatory mediators . especially the accumulation of age products of proteins and lipids \n stimulate the generation of inflammatory mediators and activation of transcription factor nf-b , a potent inducer of inflammatory processes . \n these ages act on various receptors present on microglia and macrophages stimulate production of cytokines like il-1 , il-6 , il-17 , tnf- , chemo attractant protein-1 , c - reactive protein and chemokines like ccl-2 , cxc , and so forth ( figure 1 ) [ 39 , 40 ] . \n nf-b is a transcription factor that upregulates the gene expression of proinflammatory cytokines and also is responsible for the induction of neuronal apoptosis . \n activation of nf-b also suppresses the expression of antioxidant genes by downregulating nrf-2 pathway and thus indirectly weakening the innate antioxidant defense ( figure 2 ) . \n persistent hyperglycemia induced inflammation also affects the structural features of neuron as the glycosylation of myelin protein alters its antigenicity causing infiltration of monocytes , macrophages , neutrophils from the blood circulation , and activation of glial cells of the nervous system [ 24 , 42 ] . these immune cells in turn secrete inflammatory cytokines which further damages myelin sheath and increases nerve excitability , thus leading to edema and neuroinflammation \n . the stimulated monocytes and immune cells have a vicious positive feedback loop for increasing the production of inflammatory mediators thus potentiating nerve catastrophe . \n the cytokines like il-1 , il-6 , and il-17 can sensitize the peripheral receptors causing neuropathic pain . additionally , neuroinflammation leads to nerve damage due to apoptosis induced by mapk signalling . \n tnf- also promotes the expression of cell adhesion molecules which are capable of decreasing the blood perfusion rate and thus decreases neurotrophic support . \n the released chemokines have been shown to produce hyperalgesia through the activation of chemokines receptors present on the nerves . \n hypoxia and ischemia created in diabetes also aggravate the neuroinflammation through the induction of inducible nitric oxide synthase ( inos ) , which releases no , a physiological mediator of inflammation . \n in large , activation of inflammatory cascade , proinflammatory cytokine upregulation , and neuroimmune communication pathways plays vital role in structural and functional damage of the peripheral nerves leading to the diabetic peripheral neuropathy . \n the oxidative stress induced ros and various constitutional inflammatory pathways are known to interact at multiple levels to produce plethora of pathophysiological outcomes ( figure 2 ) . \n hyperglycemia is known to increase metabolic flux through mitochondrial electron transport chain , leading to inefficient electron transfer through redox centres and hence generating superoxide anion . \n superoxide can also combine with nitric oxide ( no ) to produce peroxynitrite ( onoo ) , a potent reactant which causes nitration of several important proteins and leads to structural and functional damage . \n peroxynitrite mediated dna damage leads to activation of parp , a nuclear enzyme which causes transfer of poly - adp ribose units to dna by utilising nadh energy pool . \n necrotic cell death is known to release cellular debris , which further drives the inflammatory cells to the damaged spot and hence activates a local inflammatory episode ( figure 2 ) . \n activation of nrf2 pathway enhances the production of several antioxidant and cytoprotective enzymes through transcriptional facilitation of antioxidant response element ( are ) of genome . \n these enzymes include sod , gsh , ho-1 , and glutathione s - transferase ( gst ) . \n activation of this nrf2 pathway stands as one of the cellular homeostatic mechanisms to protect cells from enhanced oxidative stress . \n however , persistent nrf2 activation is subdued through hyperglycemia mediated erk activation , and hence redox homeostasis is failed in diabetic state as depicted in figure 2 . \n oxidative stress mediated inflammation is known to execute nf-b , activator protein-1 ( ap-1 ) , and mapk pathways . \n ros are known to activate inhibitory kappa b kinase ( ikk ) , which causes phosphorylation of ib , labeling it for ubiquitination mediated proteasomal cell death . \n release of free nf-b heterodimer from ib allows it to cross nuclear membrane and bind with kappa region of genome . \n transcriptional facilitation of this kappa region of genome enhances the production of inflammatory cytokines such as tnf- , il-6 , cox-2 , and inos as shown in figure 2 . \n upstream of this pathway , nf-b activation at cytosolic level is also facilitated by p38 mapk . \n this p38 mapk is known to be activated directly through hyperglycemia mediated apoptosis signal regulating kinase1 ( ask1 ) or indirectly through oxidative stress . \n oxidative stress is also known to activate stress activated protein kinases , that is , c - jun n - terminal kinases ( jnk ) , which further activates jun subunit of ap-1 and hence facilitate ap-1 mediated collagenase , tgf-1 , and other cytokines production ( figure 2 ) . \n although ap-1 involvement in the pathogenesis of dn needs to be explored , its activation can produce a local sequela of vascular inflammation and thus support the rationale for its participation in neuroinflammation . among the above mentioned pathways , the crosstalk between nrf2 and nf-b is critical both physiologically and pharmacologically . \n activation of nrf2 pathway is known to inhibit nf-b activation through reduced ros mediated ikk activation and by inhibiting the degradation of ib . \n further activation of nf-b competes with nrf2 for binding to antioxidant response element ( are ) , either directly or indirectly through recruiting histone deacetylase 3 ( hdac3 ) to the are region ( represented in figure 2 ) . interaction between these two pathways maintains the cellular homeostasis . \n however , diseases associated with excessive oxidative stress generation can cause imbalance in nrf2-nf-b axis and thus produce damaging consequences . \n there is much scientific evidence supporting the involvement of inflammatory pathways in direct peripheral nerve damage and neuroinflammation . \n however , a growing body of researchers suggests that neuroglial cells act as connecting link between oxidative stress and neuroinflammation . \n according to this theory , oxidative damage to glia produces excessive proinflammatory cytokines , which in turn acts on membrane receptors of neuronal cells and thus activates inflammatory pathways , causing neuroinflammation . \n there is also evidence supporting the role of vascular inflammation in the pathogenesis of diabetic neuropathy . \n accumulation of all these evidence suggests that neuroinflammation is not the sole episode underlying peripheral nerve damage but it is accompanied by inflammation and oxidative , nitrosative stress in the vasa nervorum and neuroglial cells . \n identification of pathomechanisms underlying disease pathogenesis is important to not only devise new treatment strategies but also be useful in discovering new disease biomarkers . \n biomarker identification can be useful to identify the extent of disease progression and thus can amplify the scope of better drug targeting . \n currently available diagnostic methods for dn include assessment of vibration perception threshold ( vpt ) and calculation of neuropathy disability score ( nds ) based on ankle reflexes and perception changes to variety of stimuli . \n newer techniques with minimal invasion or noninvasive operation include corneal confocal microscopy ( ccm ) and skin biopsy techniques . \n ccm allows the identification of corneal nerve fibre length and nerve density and thus can be used as diagnostic aid to quantify peripheral neuropathy . \n skin biopsy and consequent immunohistochemistry allow the quantification of the number of nerve fibres per unit area . \n however , these diagnostic procedures can be combined with examination of biochemical changes to accurately monitor the disease progression and response to treatment . \n based on the compelling evidence put forth by many research groups , it is being clear that oxidative stress mediated neurodegeneration and the accompanied inflammatory reactions play a prominent role in the pathogenesis of diabetic neuropathy . \n modulation of these pathways by pharmacological agents can prevent the functional and pathophysiological disturbances associated with peripheral neuropathy and can accelerate the discovery of new treatment strategies for diabetic neuropathy . some of the important categories of drugs which have potential to affect the oxidative stress and inflammatory pathways in relevance to peripheral neuropathy will be discussed in the following section . \n oxidative stress is also known to enhance the endoplasmic stress through accumulation of misfolded proteins . \n recently , the role of er stress in the pathogenesis of diabetic neuropathy has been well observed . \n oxidative damage to the er causes dysfunctional protein processing system and enhances the accumulation of nonfunctional proteins . \n administration of chemical chaperons such as trimethylamine oxide and 4-phenyl butyric acid was found to inhibit the diabetes associated oxidative stress in spinal cord and dorsal horn , reduce intraepidermal nerve fibre loss , and ameliorate peripheral nerve damage and thus it can be used as a therapeutic strategy for diabetic neuropathy . \n nitrosative stress is also considered to be equally contributing in the pathogenesis of diabetic neuropathy as similar to oxidative stress . primarily , peroxynitrite is the toxicant of this pathway which causes biomolecular damage and parp activation . \n use of peroxynitrite decomposition catalysts and parp inhibitors prevent the neuronal damage associated with diabetic neuropathy . \n several trails done with these agents could alleviate the biochemical and functional impairment produced due to diabetes in sciatic nerves and dorsal root ganglion ( drg ) neurons [ 63 , 64 ] . \n due to massive involvement of oxidative stress in the pathogenesis of diabetic neuropathy , several antioxidants have been tried in patients with diabetic neuropathy . \n alpha - lipoic acid , vitamin e , and acetyl - l - carnitine were studied clinically in several controlled prospective clinical trials [ 6567 ] . among them \n alpha - lipoic acid was shown to relieve sensory and functional deficits of dn and has been approved by fda for therapeutic use . \n impaired synthesis of vasoactive prostanoids and associated endothelial dysfunction is one of the pathological factors contributing to dn , which is initiated by both oxidative stress and inflammation . \n diabetic neuropathy is associated with compromised blood flow which results in lack of endonutritive blood supply to neurons which may be directly or indirectly related to oxidative stress directed endothelial damage in vasa nervorum . \n several vasodilators like angiotensin receptor antagonists , endothelin antagonists , phosphodiesterase inhibitors , calcium channel antagonists , nitro vasodilators , and prostanoid analogues have been tested in animal models of diabetes and among them angiotensin ii receptor antagonists ( e.g. , zd7155 ) and etb receptor antagonists ( e.g. , bms 182874 ) found to alleviate neurovascular deficits in stz induced diabetes model [ 70 , 71 ] . \n however , their clinical success needs to be explored to evaluate their therapeutic use in diabetic neuropathy \n . enhanced oxygen delivery to peripheral nerves result in increased nerve regeneration through counteraction of ischemic , hypoxic , inflammatory , and necrotic episodes associated with diabetic neuropathy . \n neuroinflammation occurs when there is a persistent release of proinflammatory mediators and the pathways are activated through corresponding cytokines in neuronal cells . \n the proinflammatory mediators include tnf- , il-6 , il-1 , cox-2 , and inos as well as several chemokines . \n antibodies or chemical agents against these cytokines and chemokines could alleviate the proinflammatory episode associated with diabetic neuropathy [ 42 , 73 ] . \n these agents are known to inhibit the consequences of inflammatory changes associated with neuroglial activation . \n transcriptional modulators of nf-b and mapk can provide a two - tier targeting approach for the prevention of neuroinflammatory changes in dn . \n nf-b and nrf2 pathways are two important pathways mediating cellular homeostasis through controlling oxidative stress and inflammation . as discussed in the above section , deregulation in the balance of nrf2nf-b axis may lead to several pathophysiological consequences and hence modulators of these pathways can be used to prevent such results . \n several natural inhibitors of nf-b like curcumin , resveratrol , and melatonin and small molecule modulators of this pathway ( bay 117082 , jsh23 ) were used in experimental diabetic animals [ 41 , 7476 ] . \n these drugs were shown to be promising by modifying the sensorimotor functional and proteomic changes associated with neuropathy . \n the use of nf-b inhibitors can prevent the age mediated proinflammatory cytokine production and thus halts the events associated with neuroinflammation . \n similarly , it is being observed that overt oxidative stress in neuronal cells is a pivotal pathogenetic mechanism in nerve damage , which can be prevented by enhancing nrf2 mediated are gene expression . \n several pharmacological antioxidants have been known to enhance nrf2 mediated antioxidant expression in experimental models of diabetic neuropathy and found to improve behavioural , functional , and biochemical characteristics associated with diabetes [ 77 , 78 ] . \n rather than individually targeting nrf2 and nf-b , pharmacological modulators of both transcription factors can produce a better therapeutic response by simultaneously enhancing nrf2 and inhibiting nf-b . \n since mitochondria are the primary source of super oxide , mitochondria targeted antioxidants can reduce the corresponding oxidative damage . \n several antioxidants like -lipoic acid and n - acetyl cysteine are shown to have therapeutic efficacy in animal and human diabetic neuropathy [ 68 , 79 ] . however , targeting the antioxidant molecules directly to the mitochondria not only reduces oxidative stress but also inhibits the other pathophysiological pathways associated with mitochondrial dysfunction . \n antioxidant molecules can be effectively conjugated to lipophilic cationic molecules like triphenyl phosphonium ( tpp+ ) and hence accumulate in the mitochondria based on the large negative potential inside the mitochondrial membrane . \n mito q , mito vitamin e , mito pbn , and so forth are the examples of drugs that were delivered to mitochondria in various experimental setups \n . other strategies like szeto - schiller ( ss ) peptides can also be conjugated to antioxidants to attain maximum concentration of drug inside the mitochondrial matrix . \n these peptides comprise four alternative aromatic / basic amino acid back bones and direct the targeted antioxidants to inner mitochondrial membrane . \n these ss peptides scavenge hydrogen peroxide and peroxynitrite radicals and are known to inhibit lipid peroxidation reactions effectively . \n these drugs have shown beneficial effect in the preclinical models of diabetic neuropathy and need to be further assessed clinically . \n along with mitochondrial antioxidants , drugs which can increase the mitochondrial function can alleviate bioenergetic crisis and etc dysfunction associated with dn . \n one such example of drugs includes pgc-1 modulators , which can rescue the mitochondrial dysfunction by enhancing the production of mitochondrial enzymes and mtdna transcription through nuclear respiratory factor 1 ( nrf1 ) activation . \n oxidative stress and neuroinflammation are identified to be pivotal pathophysiological triggers in various diabetes associated microvascular complications including diabetic neuropathy . \n the use of drugs targeting oxidative stress - inflammatory pathways was found to improve the sensorimotor and functional deficits associated with diabetic neuropathy . \n but their clinical success remained inferior due to complexity in cellular redox signalling pathways and its further interaction with cellular kinome , genome , and epigenome . since \n , redox imbalance produced in one pathway can elicit another pathway , combinational use of several strategies mentioned above could produce more beneficial effects than monotherapy . \n mitochondrial dysfunction is known to initiate the hyperglycemic cellular injury ; the use of drugs targeting mitochondria will find greater attention in the near future for the treatment of diabetic neuropathy . \n still , a lot of work is warranted to further elucidate the cross talk of oxidative stress , mitochondrial dysfunction , and inflammation in the pathophysiology of diabetic neuropathy .", "role": "user" }, { "content": "in diabetes , the chronic hyperglycemia and associated complications affecting peripheral nerves are one of the most commonly occurring microvascular complications with an overall prevalence of 5060% . among the vascular complications of diabetes , \n diabetic neuropathy is the most painful and disabling , fatal complication affecting the quality of life in patients . \n several theories of etiologies surfaced down the lane , amongst which the oxidative stress mediated damage in neurons and surrounding glial cell has gained attention as one of the vital mechanisms in the pathogenesis of neuropathy . \n mitochondria induced ros and other oxidants are responsible for altering the balance between oxidants and innate antioxidant defence of the body . \n oxidative - nitrosative stress not only activates the major pathways namely , polyol pathway flux , advanced glycation end products formation , activation of protein kinase c , and overactivity of the hexosamine pathway , but also initiates and amplifies neuroinflammation . \n the cross talk between oxidative stress and inflammation is due to the activation of nf-b and ap-1 and inhibition of nrf2 , peroxynitrite mediate endothelial dysfunction , altered no levels , and macrophage migration . \n these all culminate in the production of proinflammatory cytokines which are responsible for nerve tissue damage and debilitating neuropathies . \n this review focuses on the relationship between oxidative stress and neuroinflammation in the development and progression of diabetic neuropathy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the main pathological feature of alzheimer 's disease ( ad ) is the senile plaque containing aggregated amyloid peptide ( a ) . \n three genes have been identified as causative genes in familial ad ; the amyloid precursor protein ( app ) , presenilin-1 , and presenilin-2 genes . \n apolipoprotein e ( apo e ) is recognized as a genetic risk factor for familial and sporadic ad . \n in addition , variants of the sortilin - related receptor 1 ( sorl1 ) gene have also been associated with the disease [ 1 , 2 ] . \n the evidence from sorl1 suggested that intraneuronal a is significant in early pathogenesis for ad . \n recent findings showed that a oligomer is more toxic for neuronal cell [ 3 , 4 ] . \n there is widening recognition that the phosphatidylinositol-3-oh kinase ( pi3k)-akt - mtor signaling pathway is directly affected by a and especially a oligomer modulate cell survival through pi3k - akt pathway [ 3 , 57 ] . \n an impaired insulin - mediated signal transduction is one of the pathological features of neurodegenerative diseases . \n epidemiological studies note that type ii diabetes is risk factor for late - onset ad . \n intraneuronal a inhibits insulin receptors signaling in neurons by interfering with the association between akt1 to preclude akt1 activation . in ad brains , \n thus current reports revealed that the dysfunction of pi3k - akt - mtor system affect ad pathology . \n although genetic variability of pi3k has been reported to affect the risk for ad , there are few genetic researches about akt and ad . in this study , \n the association between six single nucleotide polymorphisms ( snps ) covering the akt1 gene and japanese sporadic ad was investigated . \n our sporadic japanese ad cases ( n = 180 , male : female = 79 : 101 ) were obtained from department of psychiatry , juntendo university hospital , tokyo , japan and department of psychiatry , juntendo koshigaya hospital , saitama japan . the mean age of the ad group ( 67.4 , s.d . \n 6.2 ) was not significantly different from that of the control group ( 64.4 , s.d . \n all the ad cases were diagnosed according to the nincds - adrda criteria , and none had familial history of ad . \n the control cases ( n = 130 , male : female = 63 : 67 ) were obtained from healthy volunteers from among staff of our hospital with no history of dementia or other neuropsychiatric diseases . \n the purpose and significance of this study were explained in detail to each patient and his / her family , and all subjects provided their informed consent . \n the study protocol was approved by the ethics committee of the juntendo university school of medicine . \n information on the single nucleotide polymorphisms snps was obtained from the snp database ( dbsnp ) established by the national center for biotechnology information . \n the chosen snps were validated , according to the dbsnp and have minor allele frequencies ( maf ) greater than 5% . \n six snps of the akt1 gene were genotyped using taqman technology on an abi7500 system ( applied biosystems , calif , usa ) . all probes and primers were designed by the assay - by - design tm service of applied biosystems . \n a standard pcr reaction was carried out using the taqman universal pcr master mix reagent kit in a 10 l volume . \n hardy - weinberg equilibrium ( hwe ) tests were carried out for all snps for both cases and controls . \n differences in the genotypic frequencies were evaluated using a case - control study design and applying the fisher 's exact probabilities test . \n linkage disequilibrium ( ld ) between the snps as well as a haplotype analysis was performed using snpalyse version 5 ( dynacom , yokohama , japan ) . \n ld , denoted as d , was calculated from the haplotype frequency using the expectation - maximization algorithm . \n a case - control haplotype analysis was performed using a permutation method to obtain the empirical significance . \n the global p values represent the overall significance of the observed versus expected frequencies of all the haplotypes considered together using the chi - squared test . \n the individual haplotypes were tested for association by grouping all others together and applying the chi - squared test with l df . \n all p values reported are two tailed , and statistical significance was defined as < 0.05 . \n logistic regression analyses were performed to estimate the relationship among onset of ad , apo e status , and six snps using spss software ver . 17.0 for windows ; ( chicago , ill . \n our sample set has the power to detect an odds ratio of at least 1.40 , assuming a significance level of 0.05 , power of 0.70 , and an exposure frequency of 0.25 in the controls . \n although four snps were found to be in hwe , controls of rs2494746 and rs2494743 were not in hwe marginally . \n genotypic distribution of the two polymorphisms showed significant difference between our cases and controls ( table 1 ) . \n other four snps linkage disequilibrium examination showed strong ld from rs1130214 to rs2494743 and from rs3730344 to rs7140735 ( table 2 ) . \n the frequency of the c - c - c - g - a - a haplotype was significantly higher in the ad group compared to controls ( table 3 ) . \n other two rare haplotypes also showed marginal association . to date , this is the first study to clarify genetic associations between common snps of the akt1 gene and ad . \n we found that two snps rs2494746 and rs2494743 studied here with japanese population were not in hwe . \n multiple regression analysis suggested that six snps of the akt1 gene did not associate with the risk for ad and logistic regression analysis for the akt1 snps , apo e and the onset of ad showed no synergetic association ( data not shown ) . \n snps which were not in hwe make us suppose that the regions around such snps are highly polymorphic \n . these snps would be triallelic snps , or there are large deletions or insertions generally . since we confirmed that the two snps are biallelic , potential large deletion or insertion might exist in the akt1 gene . \n these snps suggest that there are potential polymorphisms including insertion or deletion associated with the disease . reviewing our raw genotyping data , heterozygotes of control cases of those two snps \n previous genetic studies for schizophrenic patients are in debate [ 1518 ] . an original report identified akt1 as a potential schizophrenia susceptibility gene in families of european origins . \n the additional multi - snp haplotype analysis showed that specific haplotype is associated with lower akt1 protein levels . \n controversial results have been issued for japanese schizophrenic patients and akt1 [ 15 , 16 , 21 ] . \n the detailed ld analysis from these japanese studies suggested that there are two apparent ld blocks in the gene [ 21 , 22 ] . \n thus the akt1 gene is highly polymorphic , and functional snps might affect akt1 levels potentially . \n we believe that the small size of our dataset may account for the negative results . \n if the snps of the akt1 gene affect the onset of ad , the effects would be smaller than those of apo e4 . \n previous studies and our findings revealed that the regions of the akt1 gene are highly polymorphic for japanese population . \n although our pilot study could not show a genetic association between akt1 and ad , pi3k - akt - mtor system has an important role for pathophysiology of ad . \n denser snping studies would be needed for clarifying the genetic association between akt1 and ad . since \n the relationship between akt1 and ad remains inconclusive , a meta - analysis would be performed in the future .", "role": "user" }, { "content": "a recent paper reported that a oligomer causes neuronal cell death through the phosphatidylinositol-3-oh kinase ( pi3k)-akt - mtor signaling pathway . \n intraneuronal a , a main pathological finding of alzheimer 's disease ( ad ) , is also known as inhibiting activation of akt . \n this study aims to investigate whether single nucleotide polymorphisms ( snps ) of the akt1 gene are associated with ad . \n snps genotyped using taqman technology was analyzed using a case - control study design . \n our case - control dataset consisted of 180 ad patients and 130 age - matched controls . \n although two snps showed superficial positive , hardy - weinberg equilibrium ( hwe ) tests , and linkage disequilibrium ( ld ) analyses suggested that genetic regions of the gene are highly polymorphic . \n we failed to detect any synergetic association among akt1 polymorphisms , apolipoprotein e ( apo e ) , and ad . \n further genetic studies are needed to clarify the relationship between the akt1 and ad .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: ( 1967 ) as a chronic lung disease of preterm infants who required oxygen supply and mechanical ventilation for acute respiratory distress1 ) . \n the introduction of prenatal steroid therapy , gentle ventilation techniques , exogenous surfactant treatment , and intensive treatment of patent ductus arteriosus have minimized severe lung injury and improved the survival rate in preterm infants over the 40 years since the introduction of the bpd concept . \n the overall incidence of bpd , which is characterized by the need for oxygen at 36 weeks of gestation , is about 30% for infants with birth weight less than 1,000 g in the united states3 ) and 9.7% for infants with birth weight less than 1,500 g analyzed in a korean multicenter study4 ) . \n preterm infants with bpd usually have cardiovascular sequelae , such as pulmonary hypertension ( ph ) , cor pulmonale with right ventricular ( rv ) hypertrophy , systemic hypertension , left ventricular hypertrophy , and development of systemic - to - pulmonary collateral vessels5 ) . among these cardiovascular sequelae \n although little is known about the prevalence and mortality rate of ph , the prevalence of ph ranges from 8 to 25% and the mortality rate ranges from 14 to 50% in the bpd patients with ph6 - 9 ) . \n this review focuses on the precise evaluation of the severity of ph and the recent progress in the treatment of ph in the bpd patients . \n according to the classification of ph by the symposium at dana point in 2008 , bpd is considered to be a class 3 disorder , which is ph with lung disease and/or hypoxia10 ) ( table 1 ) . \n although the exact pathophysiological characteristics of ph in the bpd patients is unknown , several mechanisms have been proposed . \n abnormal lung circulation in the bpd patients , including both anatomical and physiologic abnormality , is related to the development of ph . \n the patients with bpd show reduction of small pulmonary arteries and an altered distribution of pulmonary arteries within the pulmonary interstitium11 ) , which cause reduction of alveolar - capillary surface area . \n this reduction in surface area causes impairment of gas exchange and increases the requirement for prolonged oxygen and ventilator treatment , which in turn , raise the risk for severe ph . \n these pulmonary vascular changes , which are characterized by decreased vascular growth and structure , in preterm infants also contribute to the abnormal cardiopulmonary sequelae of bpd12 ) . \n physiologic abnormalities of lung circulation include increased vascular tone and reactivity , hypertensive remodeling , and decreased vascular growth12 , 13 ) . \n previous studies using cardiac catheterization have shown that even mild hypoxia causes marked elevation of pulmonary artery pressure in the patients , including preterm infants with bpd14 ) . to achieve normal gas exchange , \n the lung tissue must undergo continuous growth and maintenance of the complex system of airways and vessels . \n however , disruption of angiogenesis and inhibition of pulmonary vascular growth during a critical period of postnatal lung growth impairs pulmonary alveolarization , which contributes to bpd and increases the risk for ph15 ) . \n systemic - to - pulmonary collateral vessels , including prominent bronchial arteries , also contribute to ph development in the bpd patients . \n significantly large collateral vessels may result in significant shunt flow to the lung and cause pulmonary congestion , ultimately requiring more ventilatory support and medications16 ) . in some cases , patients showed improvement of ph after embolization of large collateral vessels and required less supplemental oxygen and ventilatory support12 ) . \n early detection of ph may lead to earlier treatment with more aggressive respiratory support and cardiac medications , including pulmonary vasodilators , and other procedures to improve the outcome in the bpd patients . \n however , the diagnosis of ph in bpd patients is difficult because manifested symptoms and signs of ph may be subtle and may sometimes overlap with those of respiratory problems or infection . in this respect , \n screening of ph in the bpd patients is necessary to decrease morbidity and mortality from ph . \n ph in the bpd patients is defined as a condition characterized by a mean pulmonary artery pressure greater than 25 mmhg and pulmonary capillary wedge pressure less than 15 mmhg on cardiac catheterization in the resting state10 ) . \n cardiac catheterization is the gold standard for the diagnosis of ph ; however , since this procedure is very invasive and is not performed in all the centers with neonatal intensive care unit ( nicu ) , other diagnostic tools are used for the evaluation of ph in the bpd patients . \n electrocardiography ( ecg ) and echocardiography may be used as screening methods for ph in most centers with nicu . \n although ecg can be easily performed , it is known to have low sensitivity and positive predictive value for the diagnosis of rv hypertrophy in the precordial leads reflecting ph . in a recent study , \n puchaiski et al . also showed no significant relationship between ecg findings and echocardiographic estimation of pulmonary artery pressure17 ) . therefore \n , serial echocardiography , in spite of its several limitations , is recommended as the main screening tool for ph in the bpd patients in many centers . in seoul national university children 's hospital , we conduct monthly echocardiographic examination of the preterm infants with bpd in the nicu to screen for ph and of the follow - up patients with moderate to severe bpd in the cardiologic division after discharge from the hospital even though the patients did not have ph in the nicu . \n a report from boston children 's hospital recommended that echocardiographic screening for ph should be conducted in preterm infants with bpd who meet any of the following criteria : ( 1 ) extreme prematurity ( gestational age at birth of 25 weeks or birth weight of 600 g ) , ( 2 ) small for gestational age , ( 3 ) requirement for prolonged mechanical ventilatory support ( duration depends on age ) , ( 4 ) oxygen requirement out of proportion to the severity of lung disease , or ( 5 ) persistent poor growth despite adequate caloric intake8 ) . \n estimated systolic pulmonary artery pressure can be derived from the tricuspid regurgitant ( tr ) jet flow , which if present , is measured by echocardiography by using the modified bernoulli equation [ systolic pulmonary artery pressure=4(tr peak jet velocity)+right atrial pressure]18 ) . \n however , estimation of systolic pulmonary artery pressure may not be possible in all the patients . \n a recent study revealed that estimation of systolic pulmonary artery pressure was possible in only 61% of the young children with ph19 ) . in the absence of tr jet flow , other qualitative echocardiographic findings , including right atrial enlargement , rv hypertrophy and/or dilation , septal flattening , increased rv wall thickness , dilated main pulmonary artery , increased velocity of pulmonary valve regurgitation , and a short acceleration time of rv ejection into the pulmonary artery , can be used to detect ph ; however , the sensitivity of these findings is questionable10 , 12 ) . among these qualitative echocardiographic findings , \n interventricular septal configuration is very useful for evaluating the severity of ph in the bpd patients . \n systolic rv pressure can be graded according to the position of the interventricular septum : ( 1 ) < 50% of the systemic systolic pressure if the interventricular septum appears round at end - systole , ( 2 ) 50 - 100% of the systemic systolic pressure if the septum shows flattening at end - systole , and ( 3 ) 100% of the systemic systolic pressure if the interventricular septum bows into the left ventricle at end - systole ( fig . \n b - type natriuretic peptide ( bnp ) and n - terminal probnp ( nt - probnp ) are representatives of biomarker and showed good positive correlations with mean pulmonary artery pressure , pulmonary vascular resistance and mean right atrial pressure . \n bnp also showed good negative correlation with rv ejection fraction21 ) even though normal value of children 's age is not known well until now through extensive studies22 ) . \n we have to be alert if the bpd patients with ph show high serum level or increasing level of bnp or nt - probnp , because these parameters reflect disease status including severity . in some centers , cardiac catheterization \n is generally recommended to evaluate the severity of ph , to rule out unsuspected associated anatomic cardiac diseases , to define the presence of systemic - to - pulmonary collateral vessels , pulmonary venous obstruction , or left heart dysfunction , and to assess pulmonary vascular reactivity in patients who fail to respond to oxygen treatment alone12 ) . \n most patients with ph showed gradual resolution of ph over the first year of life because the damaged lung recovered and normal alveolarization completed . \n however , because some bpd patients with severe ph could experience fatal right heart failure and other complications from ph6 - 9 ) , meticulous and aggressive treatment of ph in the bpd patients is mandatory . \n the basis of the treatment of ph in the bpd patients is to correct the underlying lung disease . \n these underlying conditions include chronic gastroesophageal reflux and aspiration , airway problems , such as laryngotracheomalacia , subglottic stenosis , and vocal cord palsy , and other conditions that cause intermittent or persistent hypoxia12 ) . in case of repairable anatomic lesions to contribute to the ph , aggressive correction \n should be performed because the reduced vascular surface area in the bpd patients may result in significant hemodynamic injury caused by even a relatively small increase of left - to - right blood shunt through the patent foramen ovale , atrial septal defect , patent ductus arteriosus , or even other systemic - to - pulmonary collateral vessels12 ) . \n oxygen supply is the mainstay of the medical treatment of ph in the bpd patients . \n chronic hypoxia can induce pulmonary vascular constriction and aggravate ph , while sufficient oxygenation can be helpful in the recovery of damaged pulmonary tissue and normal growth of the lung . in this \n regard , oxygen saturation ( spo2 should be maintained at more than 93 - 95% in the patients with bpd23 ) . \n the oxygen supply should be discontinued when the spo2 is greater than 93 - 95% without oxygen supply . \n in particular , the bpd patients with ph should have an spo2 in the mid-90%24 , 25 ) . besides oxygen supply \n , some bpd patients with ph require selective pulmonary vasodilators to decrease pulmonary arterial pressure ; these medications subsequently decrease rv afterload and increase cardiac output from the rv . \n these actions result in an improvement of left ventricular filling and increase of systemic blood pressure and coronary perfusion26 ) . \n the currently used medications for selective pulmonary vasodilation include inhaled nitric oxide ( no ) , inhaled prostacyclins , sildenafil , and endothelin - receptor antagonist . \n these medications can dilate the pulmonary artery and decrease the rv afterload through different mechanisms . inhaled no \n selectively decreases pulmonary vascular resistance and increases systemic venous oxygen saturation by improving ventilation - perfusion match27 ) . inhaled no improves oxygenation in infants with known bpd28 ) and may be useful for long - term treatment of pulmonary hypertension29 ) . \n although long - term inhaled no treatment has been used in the bpd patients , especially those who require continuous mechanical ventilation , no study has reported such data to date . \n preventive low - dose inhaled no supply can reduce the incidence of bpd in the preterm infants with birth weight greater than 1,000 g , but it showed no effect in the infants with birth weight less than 1,000 g. therefore , the use of preventive inhaled no for bpd prevention is questionable30 , 31 ) . \n most patients require an initial inhaled no dose of 10 - 20 parts per million ( ppm ) for ph treatment and a maintenance dose of 2 - 10 ppm for weaning . because sudden discontinuance of inhaled no may cause rebound ph , other selective pulmonary vasodilators should be started before the discontinuance of inhaled no even though the patient 's condition is good32 ) . \n inhaled prostacyclin is less expensive and more readily available than inhaled no in the centers with nicu . \n aerosolized prostacyclin may be administered directly to the lung , and it causes vasodilation in the ventilated pulmonary regions ; it therefore minimizes the systemic side effects and helps avoid catheter - related complications in the patients33 ) . \n inhaled iloprost is the representative prostacyclin derivative ; it easily dissolves in normal saline and has a lower viscosity than other prostacyclin derivatives34 ) . \n the potential effect of inhaled iloprost for improving ph in the pediatric group has been established35 ) . \n a case study had reported an improvement caused by inhaled iloprost in the bpd patient with severe ph36 ) . for ensuring adequate improvement , inhalation should be performed 6 - 9 times a day because the half - life of the prostacyclin is extremely short . \n the occurrence of occasional bronchospasm may be a restricting factor in the use of inhaled prostacyclins by the bpd patients35 ) . \n sildenafil , a highly selective phosphodiesterase type-5 inhibitor , increases cyclic gmp in the pulmonary vascular smooth muscle cells and decreases pulmonary vascular resistance . the effect of sildenafil has been well proven in the patients with rv failure caused by ph32 ) . \n sildenafil also has a synergistic effect with other pulmonary vasodilators , such as inhaled no and inhaled iloprost , which have different pharmacologic mechanisms10 , 37 ) . \n a recent study on bpd patients with ph also showed that the use of sildenafil was safe and provided long - term beneficial effect38 ) . \n the recommended starting dose of sildenafil is 0.5 mg / kg every 8 h. if the patient shows no systemic hypotension , the dose can be gradually increased to get the desired effect or up to 2 mg / kg every 6 h over 2 weeks12 ) . \n endothelin - receptor antagonist inhibits the effect of endothelin-1 , which is a potent vasoconstrictor , and induces pulmonary vascular smooth muscle cell hyperplasia12 , 39 ) . \n bosentan is a representative non - selective endothelin - receptor antagonist that is orally administered . \n bosentan improves exercise capacity of the patients with ph by decreasing rv dilatation and by improving rv function and left ventricular blood filling without significant negative effect on systemic pressure40 , 41 ) . \n long - term randomized controlled studies have not been conducted in the patients with bpd using bosentan ; however , other studies have shown that bosentan improved ph and functional status in daily life6 , 42 ) . \n the recommended starting dose of bosentan is 1.5 mg / kg / l every 12 h. if the patient shows no hepatic dysfunction after 2 weeks , the dose may be increased up to 3 mg / kg / d every 12 h. during the treatment , regular liver function tests must be conducted because bosentan is known to be hepatotoxic43 ) . \n combination therapy , which involves the simultaneous prescription of more than one selective ph drug , has become the standard treatment in many centers . \n several case series have suggested that various drug combinations appear to be safe and effective10 ) ; however , long - term safety and efficacy have not been evaluated in the pediatric population . \n the advancements in pharmaceutical research will lead to the development of new selective pulmonary vasodilators in the near future . \n discontinuance of medications used for treating ph in the bpd patients should be determined only after serial echocardiography . \n if 2 consecutive serial echocardiographic examinations reveal normal or near - normal findings , weaning and discontinuance of medication for ph may be considered12 ) . \n because of an increase in the number of preterm infants and a decrease in the gestational age at birth , more patients are showing significant bpd and secondary ph . \n ph contributes significantly to the high morbidity and mortality in the bpd patients . to prevent ph and to ensure early treatment \n if ph is present , regular monitoring for ph with echocardiography and biochemical markers like bnp or nt - probnp is necessary in the bpd patients with greater than moderate degree . in the bpd patients with significant ph , multi - modality treatment , including treatment for correcting the underlying disease , oxygen supply ,", "role": "user" }, { "content": "an increase in the number of preterm infants and a decrease in the gestational age at birth have resulted in an increase in the number of patients with significant bronchopulmonary dysplasia ( bpd ) and secondary pulmonary hypertension ( ph ) . \n ph contributes significantly to the high morbidity and mortality in the bpd patients . \n therefore , regular monitoring for ph by using echocardiography and b - type natriuretic peptide ( bnp ) or n - terminal - probnp must be conducted in the bpd patients with greater than moderate degree to prevent ph and to ensure early treatment if ph is present . in the bpd patients with significant ph , multi - modality treatment , including treatment for correcting an underlying disease , oxygen supply , use of diverse selective pulmonary vasodilators ( inhaled nitric oxide , inhaled prostacyclins , sildenafil , and endothelin - receptor antagonist ) and other methods , is mandatory .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: tamoxifen , a selective estrogen receptor modulator ( serm ) is widely used in hormonal therapy for estrogen receptor - positive breast cancer . \n the side effects of tamoxifen usage include nausea , vomiting , hot flushes , skin rashes , alopecia and rarely thromboembolism \n . however , there are very few reports of acute pancreatitis due to tamoxifen - induced hypertriglyceridemia in the literature . \n a 50-year - old diabetic woman presented with stage iii , estrogen receptor - positive adenocarcinoma of the breast . \n she was on metformin ( 500 mg twice daily ) and her blood sugars and serum lipid levels were within the normal limits . \n she received three cycles of adriamycin - based neo - adjuvant chemotherapy followed by modified radical mastectomy . \n this was followed by three cycles of chemotherapy ( with cyclophosphamide , adriamycin and 5-fluorouracil ) and radiotherapy . \n three months later she presented with spontaneous onset of severe abdominal pain and vomiting of 5 days duration . on examination , \n her pulse rate was 115/minute , blood pressure 150/90 mmhg , respiratory rate 25/minute and temperature 100.2f . \n there was marked tenderness and guarding in the epigastric region and a hepatomegaly ( 2 cm below theright costal margin ) . \n pertinent laboratory values are as follows : serum amylase 778 iu / l , total cholesterol 785 mg / dl , triglycerides 4568 mg / dl , high - density lipoproteins ( hdl ) 12 mg / dl , alanine aminotransferase 35 iu / l , alkaline phosphatase 200iu / l , total bilirubin 0.8 mg / dl , fasting blood sugar ( fbs ) 166 mg / dl , post - lunch blood sugar ( plbs ) 285 mg / dl , hemoglobin 11.6 g / dl , total leukocyte count 16,500/mm with 85% neutrophils and c - reactive protein 15 \n ultrasonography of the abdomen showed a bulky pancreas and multiple peri - pancreatic and spleno - renal fluid collections . \n there were peripancreatic and left paracolic space collections communicating with pelvic and retroperitoneal spaces suggestive of acute pancreatitis [ figure 1 ] . \n contrast - enhanced computed tomography showing diffuse enlargement of the pancreas with heterogeneous enhancement and peripancreatic fluid collections hypertriglyceridemia secondary to tamoxifen usage was suspected as the cause of acute pancreatitis and the patient was treated with prompt withdrawal of the drug , intravenous fluids and analgesics for 5 days . \n simultaneously atorvastatin ( 10 mg once daily ) was stared to control the lipid levels . \n she showed a dramatic improvement with the resolution of her symptoms and return of lipid levels to normal by the end of 1month . \n the patient was started on letrozole ( 2.5 mg once daily ) and was under strict follow up . \n it can have a paradoxical estrogenic effect on lipid metabolism resulting in elevated triglyceride and chylomicron levels . increased blood levels of triglycerides causes lodging in pancreatic capillaries , resulting in ischemia and necrosis . \n the resultant release of pancreatic lipases causes release of free fatty acids from triglycerides followed by an inflammatory response . to our knowledge , \n the dosage of tamoxifen used in these reports was 20 mg / day in all but one case . \n in most cases , there was an antecedent history of dyslipidaemia which was lacking in the present case . \n however , it must be borne in mind that type 2 diabetes and dyslipidaemia may have a common genetic predisposition . \n the levels of triglycerides that precipitated acute pancreatitis ranged from 900 to 7000 mg / dl . \n the delay in the onset of symptoms in most of these reports was more than 6 months after initiation of therapy with tamoxifen . \n the outcome was favorable in most of these reports as was with the present case . \n an extensive overview on drug - induced pancreatitis by trivedi et al . was based on medication re - challenge to confirm association . \n however , in our patient no re - challenge was tried due to the fear of precipitating severe form of pancreatitis . a causal relationship with tamoxifen use \n could be established by the fact that there was no hypertriglyceridemia prior to the initiation of tamoxifen and withdrawal of the drug showed a prompt reversal . \n some clinicians recommend a reduced dose of tamoxifen ( 10 mg a day ) to lower the risk of hypertriglyceridemia . in a recent study , \n letrozole showed no significant adverse effects on serum lipid levels in women without hyperlipidaemia at baseline . \n a great deal of caution must be exercised and regular monitoring of lipid levels performed in predisposed individuals . at the first instance of suspicion \n , the drug should be discontinued and preferably no re - challenge tried due to risk of inducing acute severe pancreatitis . \n \n ", "role": "user" }, { "content": "tamoxifen has both antagonistic and agonistic tissue - specific actions . \n it can have a paradoxical estrogenic effect on lipid metabolism resulting in elevated triglyceride and chylomicron levels . \n this can cause life - threatening complications like acute pancreatitis . to our knowledge , \n very few cases of tamoxifen - induced pancreatitis have been reported in the literature . \n we report a case of severe hypertriglyceridemia and acute pancreatitis following tamoxifen use . \n a 50-year - old diabetic lady was on tamoxifen ( 20mg / day ) hormonal therapy for breast cancer . within 3 months of starting therapy , she developed hypertriglyceridemia and acute pancreatitis . \n laboratory values include : serum amylase 778 iu / l , total cholesterol 785 mg / dl , triglycerides 4568 mg / dl and high - density lipoproteins ( hdl ) 12 mg / dl . \n tamoxifen was substituted with letrozole and atorvastatin started . \n there was a prompt reversal of the adverse effects . \n effects on lipid profile must be considered while initiating tamoxifen in predisposed individuals as the consequences are life threatening .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the primary study objective was to determine whether the use of visual freeze indicators on vaccine boxes would assist health care providers in identifying vaccines that may have been exposed to potentially damaging temperatures and those incorrectly suspected of having been exposed to potentially damaging temperatures . \n the secondary objective was to assess vaccines at risk for exposure to potentially damaging temperatures . \n the study was conducted for 24 weeks at 27 sites in connecticut that participate in the vfc program , including group and solo practices , public health centers , and hospital pediatric clinics . \n study locations were recruited and selected by the connecticut chapter of the american academy of pediatrics and the connecticut department of public health . \n the primary endpoints measured in the study were ( 1 ) freeze events identified by triggered visual freeze indicators and ( 2 ) freeze events identified by temperature readings . \n secondary endpoints included ( 1 ) locations of triggered visual freeze indicators within vaccine refrigerators ; ( 2 ) type , number of doses , and value of vaccine with triggered visual freeze indicators ; ( 3 ) total inventory and value of vaccine that experienced a freeze event ; and ( 4 ) site and vaccine refrigerator characteristics ( mean number of vaccine refrigerators per site , types of refrigerators , types of temperature - monitoring devices used , and location of temperature - monitoring devices within the refrigerators ) . \n a variety of devices were used to monitor the temperature within refrigerators , including continuous monitoring devices , some of which were state - issued data loggers , thermometers , and digital displays on the outside of the refrigerator unit , plus freeze indicators . \n freeze indicators are either chemical or electronic in nature and provide a visual indication if the temperature falls lower than a preset temperature . \n the visual freeze indicator used in this study ( freezemarker l ; temptime corporation , morris plains , nj ) is a small , chemical freeze indicator composed of microscopic particles dispersed within a colloid . \n when the temperature reaches 32f 1.8f ( 0c 1c ) , the particles become unstable , overcoming the repulsive forces that keep them separate . as a consequence , \n the particles coagulate irreversibly and form an opaque white color that indicates a freeze event has occurred ( fig . \n freezemarker l visual freeze indicators maintained at temperatures higher ( left ) or lower ( right ) than their specified freeze set point . left , colloid is clear , allowing the green background to be easily visible . \n right , colloid has irreversibly agglomerated , preventing the green background from being visible , thereby indicating exposure to temperatures at or lower than the set point . \n a visual freeze indicator was affixed to each box of stored vaccine . to identify cold spots , \n visual freeze indicators were also placed in up to 76 locations throughout each vaccine refrigerator , including walls , shelves , and door . \n on - site staff was trained on the use and placement of visual freeze indicators , monitoring requirements , appropriate actions to take if a visual freeze indicator was triggered , and other requirements ; current cdc guidelines were also reinforced . \n existing vaccine storage and handling procedures adopted by the connecticut department of public health and directed by the cdc remained in effect . \n triggered freeze indicators inside the refrigerators and/or on boxes of vaccine were identified by on - site staff or field study assistants during weekly site visits . total vaccine doses by type , number of doses by type with triggered freeze indicators , locations of triggered freeze indicators within the refrigerator , temperature reading at the time of the event , and prior reading on the vaccine daily temperature log were recorded . \n the field study assistants also visited a site within 48 hours of a reported freeze event . \n all study data were collected on prespecified study forms and subsequently entered into an excel spreadsheet and transferred into sas software . \n summaries for quantitative variables include descriptive statistics ( mean , median , sd , minimum , maximum ) . \n the primary study objective was to determine whether the use of visual freeze indicators on vaccine boxes would assist health care providers in identifying vaccines that may have been exposed to potentially damaging temperatures and those incorrectly suspected of having been exposed to potentially damaging temperatures . \n the secondary objective was to assess vaccines at risk for exposure to potentially damaging temperatures . \n the study was conducted for 24 weeks at 27 sites in connecticut that participate in the vfc program , including group and solo practices , public health centers , and hospital pediatric clinics . \n study locations were recruited and selected by the connecticut chapter of the american academy of pediatrics and the connecticut department of public health . \n the primary endpoints measured in the study were ( 1 ) freeze events identified by triggered visual freeze indicators and ( 2 ) freeze events identified by temperature readings . \n secondary endpoints included ( 1 ) locations of triggered visual freeze indicators within vaccine refrigerators ; ( 2 ) type , number of doses , and value of vaccine with triggered visual freeze indicators ; ( 3 ) total inventory and value of vaccine that experienced a freeze event ; and ( 4 ) site and vaccine refrigerator characteristics ( mean number of vaccine refrigerators per site , types of refrigerators , types of temperature - monitoring devices used , and location of temperature - monitoring devices within the refrigerators ) . \n a variety of devices were used to monitor the temperature within refrigerators , including continuous monitoring devices , some of which were state - issued data loggers , thermometers , and digital displays on the outside of the refrigerator unit , plus freeze indicators . \n freeze indicators are either chemical or electronic in nature and provide a visual indication if the temperature falls lower than a preset temperature . \n the visual freeze indicator used in this study ( freezemarker l ; temptime corporation , morris plains , nj ) is a small , chemical freeze indicator composed of microscopic particles dispersed within a colloid . \n when the temperature reaches 32f 1.8f ( 0c 1c ) , the particles become unstable , overcoming the repulsive forces that keep them separate . as a consequence , \n the particles coagulate irreversibly and form an opaque white color that indicates a freeze event has occurred ( fig . \n freezemarker l visual freeze indicators maintained at temperatures higher ( left ) or lower ( right ) than their specified freeze set point \n . left , colloid is clear , allowing the green background to be easily visible . \n right , colloid has irreversibly agglomerated , preventing the green background from being visible , thereby indicating exposure to temperatures at or lower than the set point . \n a visual freeze indicator was affixed to each box of stored vaccine . to identify cold spots , \n visual freeze indicators were also placed in up to 76 locations throughout each vaccine refrigerator , including walls , shelves , and door . \n on - site staff was trained on the use and placement of visual freeze indicators , monitoring requirements , appropriate actions to take if a visual freeze indicator was triggered , and other requirements ; current cdc guidelines were also reinforced . \n existing vaccine storage and handling procedures adopted by the connecticut department of public health and directed by the cdc remained in effect . \n triggered freeze indicators inside the refrigerators and/or on boxes of vaccine were identified by on - site staff or field study assistants during weekly site visits . \n total vaccine doses by type , number of doses by type with triggered freeze indicators , locations of triggered freeze indicators within the refrigerator , temperature reading at the time of the event , and prior reading on the vaccine daily temperature log were recorded . \n the field study assistants also visited a site within 48 hours of a reported freeze event . \n all study data were collected on prespecified study forms and subsequently entered into an excel spreadsheet and transferred into sas software . \n summaries for quantitative variables include descriptive statistics ( mean , median , sd , minimum , maximum ) . summaries for qualitative variables include the number and percentage for each outcome . \n all 27 sites ( 100% ) experienced at least 1 and as many as 6 triggered freeze indicator events ( table 1 ) . \n vaccines were exposed to potentially damaging temperatures per triggered freeze indicator in 40 of 45 refrigerators ( table 2 ) . only 5 refrigerators ( 4 household , 1 pharmacy / medical type ) had no freeze indicator event . \n occurrence of a triggered freeze event triggered freeze indicator event by type of refrigerator used for vaccine storage a total of 66 triggered freeze indicator events occurred , only 1 of which was detected by a temperature - monitoring device , and this one was a remote , continuous temperature monitoring data logger located in a hospital pharmacy . \n most of these events ( 64.6% ) were found both in the refrigerators and on vaccine boxes ; 18.5% were found on vaccine boxes only and 16.9% were found in refrigerators only . of the 66 events , \n 34.8% were identified by office staff ; 57.6% , by the field study assistant ; 6.1% , by both office staff and the field study assistant ; and 1.5% , by others . \n a total of 46,954 doses of vaccine valued at $ 1,587,353 were stored in refrigerators experiencing freeze indicator events during the study . \n triggered visual freeze indicators were found on boxes containing 6566 doses ( 14.0% of total doses ) valued at $ 187,335 ( 11.8% of the total value ) . \n of all doses stored , 14,323 doses ( 30.5% ) were of highly freeze - sensitive vaccine valued at $ 388,820 ( 24.5% ) ; 1789 of these doses ( 12.5% ) valued at $ 46,670 ( 12.0% ) had triggered indicators on the boxes . \n the mean vaccine inventory in a single refrigerator at the time of a freeze indicator event was $ 24,051 , with values ranging from $ 563 to $ 110,275 . \n although triggered freeze indicators were found in locations throughout the refrigerators , 80.7% were on boxes of vaccine located on the top or second shelf ( table 3 ) . \n the number of locations within individual refrigerators with a triggered freeze indicator was as high as 32 in locations identified as cold spots . \n the temperatures recorded on vaccine temperature logs before freeze indicator events were within the 35f to 46f ( 2c to 8c ) range in 55 ( 98.2% ) of 56 instances ; 1 recording of 47f was observed . \n data indicating temperatures immediately before triggered freeze indicator events were not available for 10 events . within 43 of the 45 refrigerators for which the location of the temperature - monitoring device was reported , the main temperature - monitoring device was most frequently located in the front of the refrigerator ( 22/43 , 51.2% ) and least frequently in the middle ( 6/43 , 14.0% ) ( table 4 ) . \n the device was most frequently located on the top shelf ( 18/43 , 41.9% ) . \n secondary temperature - monitoring devices were reported in 17 ( 37.8% ) of 45 refrigerators . \n location of vaccine boxes with triggered visual freeze indicators location of main temperature - monitoring device within vaccine refrigerators ( number [ percentage ] ) \n the present study found that triggered freeze indicator events are common and that only 1 of the freeze events was identified by a temperature - monitoring device . \n these results confirm the value of the visual freeze indicator device used in this study as an early warning tool to detect the potential risk for vaccines to become ineffective because of exposure to freezing temperatures . \n the findings from the present study corroborate reports of vaccine wastage within provider offices and health care facilities . a 1998 to 1999 survey of 64 public - sector state and local health department immunization programs reported rates of vaccine wastage ranging from 1% to 5% ( mean , 2.6% ) . \n a wastage rate of 1% to 5% was also observed in a survey of 61 vfc program coordinators in 2002 . \n it is possible , however , that the rates reported in these surveys are low because another study found that 15% of refrigeration units had temperatures of 33.8f ( 1c ) or lower . \n the findings of the present study are also consistent with a study conducted in 2011 by the office of inspector general ( oig ) of the us department of health and human services . \n although most storage temperatures measured by monitoring devices during a 2-week period of the oig study were within required temperature ranges , vfc vaccines stored by 76% of the providers were exposed to inappropriate temperatures for 5 or more cumulative hours during that time . \n in addition , all 45 providers had 1 or more recorded temperatures that differed from those measured independently by oig investigators during the same 2-week period . \n these findings showed that vfc providers generally did not meet vaccine management requirements or maintain required documentation and prompted the oig to recommend that the cdc work with grantees and providers to improve compliance with vaccine storage requirements . \n specific recommendations regarding the handling and storage of vaccines were issued by the cdc in 2012 and subsequently updated in may 2014 . \n together , the findings of the oig study and the present study suggest that freeze events are far more common than previously reported . \n the reporting of patients being given vaccine that may have been ineffective because of temperature damage in hartford , conn , in 2014 demonstrates that difficulties with vaccine storage persist . \n the present study also showed that the variety of vaccine refrigeration units , even costly pharmacy / medical refrigerators , and the monitoring systems currently used are not infallible , indicating a need for complementary monitoring devices that can help providers identify when vaccines are at risk for damage due to freezing . \n this would give providers the opportunity to intervene to avoid both vaccine waste and the inadvertent administration of vaccines that have lost potency . \n visual freeze indicators can serve as early warning tools to complement temperature - monitoring devices such as data loggers . \n digital data loggers are recommended by the cdc for continuous temperature monitoring because these are capable of recording thousands of individual temperature readings . \n data loggers are generally battery - operated electronic devices with a sensor and an internal microprocessor that records data at intervals set by the user ; many also have an audible or visual alarm . \n a data logger thermometer is typically placed in 1 location inside the refrigerator . \n as a general rule , the closer the thermometer is placed to the actual location where vaccines are stored , the closer its readings will be to actual vaccine temperatures . \n this suggests that the temperature - monitoring device is less likely to accurately reflect the temperature of vaccines not placed adjacent to it . \n because only 1 temperature - monitoring device is required , most vaccines are not located in close proximity . \n in contrast , visual freeze indicators , which are placed on boxes of vaccine , are more likely to reflect the temperature of the vaccine to which they are affixed . \n visual freeze indicators have the added benefit of helping providers identify where 1 or more cold spots exist within a specific refrigerator and avoid storing vaccines in those locations where there is greater risk for freezing . \n visual freeze indicators can also be used to alert providers when temperature - monitoring devices are not functioning properly . \n the visual freeze indicator used in this study is currently being used to monitor shipments of selected vaccines to providers for the vfc program ; this device has also been used for distribution of the h1n1 vaccine within the united states . \n the reliability of the visual freeze indicator used in this study ( freezemarker l ) has been verified in independent testing of the leading chemical and electronic freeze indicators in 2010 by thermal packaging solutions . \n the test was conducted by micom laboratories , an international safe transit association certified laboratory in montreal , canada , \n using standards adopted by the national institute of standards and technology , us department of commerce . \n results from 20 samples showed that freezemarker l performed within its temperature specification of 32f 1.8f ( 0c 1c ) , with a performance range of 30.7f to 32.5f ( 0.7c to 0.3c ) . \n at the 27 sites in the present study , vaccine doses valued at approximately $ 1.6 million ( vfc and private pay combined ) were exposed to potentially damaging freeze temperatures . because it was not an objective of the study to assess the potency of vaccine identified as being exposed to a freeze event , it is unknown whether vaccine potency was compromised . \n limited data show that some vaccines are stable for weeks or months at freezing temperatures , whereas other vaccines , such as aluminum - adsorbed vaccines , are sensitive to freeze - thaw damage . \n hepatitis b vaccine , for example , has been shown to partially freeze with structural damage from 1 to 6 hours at 14f ( 10c ) but not at 21.2f ( 6c ) for up to 72 hours . however , agitation may hasten freezing , resulting in partial freezing with structural damage within 1 hour at 21.2f ( 6c ) . \n many providers not only report losing money on vaccinations because of the soaring prices of vaccines they purchase outside the vfc program and limited reimbursement but also are often responsible for the cost of vaccines lost because of freezing , as well as the expenses associated with revaccination . \n some providers have , in fact , curtailed or stopped administering vaccines , making it difficult for some patients to be vaccinated . \n beyond determining the frequency of a freeze event and identifying the amount of vaccine put at risk because of a freeze event , the present study demonstrated other findings that have important implications for clinical practice . \n although the standard of practice is to monitor temperatures using temperature - monitoring devices , all except 1 of the triggered freeze indicator events were identified by the visual freeze indicator rather than a temperature - monitoring device or visual inspection of vaccine . \n as identified by the oig study , thermometers used by providers did not accurately measure temperatures or providers did not accurately record the temperature readings . \n on average , refrigerator temperatures recorded by providers varied by 2f ( 1.1c ) from the temperatures independently measured by the study investigators , suggesting improperly calibrated thermometers . \n normal wear and tear of a temperature - monitoring device may cause its accuracy to drift over time . \n visual inspection is an unreliable method for determining vaccine potency , particularly for inactivated vaccines , which may give no visible indication of reduced or lost potency when frozen . \n by contrast , the shake test , first introduced in the late 1980s , has been used in the field to identify vaccines damaged by freezing temperature . until recently \n , the shake test had never been validated as a reference test by comparison with a gold standard . a 2010 study involving 475 vials of 8 different types of freeze - sensitive vaccines demonstrated that a properly conducted shake test has 100% sensitivity , 100% specificity , and 100% positive predictive value for detecting freeze damage to aluminum - based freeze - sensitive vaccines . \n once this is done , it takes approximately 10 minutes to properly conduct the test . \n a limitation of the shake test is that it is not appropriate for acellular vaccines . \n office of inspector general study investigators also found that thermometers were not always correctly placed within the refrigerators . \n the cdc recommends not placing the device in the door , near or against walls , close to cooling vents , or on the floor of the refrigerator . \n the cdc also recommends determining the location of the most reliable and consistent temperature within the refrigerator and storing the vaccines at this location with the temperature - monitoring device located nearby . \n in the present study , \n the temperature - monitoring device was most frequently located on the top shelf ( 41.9% ) , which is where cooling vents are often located . \n moreover , central placement of a single temperature - monitoring device is unlikely to detect temperature gradients in refrigerators , as was observed in this study . \n prospective investigation by the national institute of standards and technology , us department of commerce , also noted temperature variability within refrigerator units depending on location , particularly during frequent opening and closing of the door , as often occurs in clinical practice . \n the oig and other studies identified additional factors that place vaccines at risk for exposure to damaging temperatures within a provider s office . \n these factors include failure of the thermometer , battery , or refrigerator as well as frequent opening of the refrigerator door , refrigerator defrost cycles , room temperature increases , power outages , and use of inappropriate refrigerator equipment . in the present study , \n 7 of the 45 refrigerators were dormitory style , a type not recommended by the cdc . \n although there was no selection bias in the sites included in the study and a variety of provider sites , providers per site , vaccine doses administered per week , and refrigerator types were involved , it is not known whether the results of this study are generalizable to all providers within the vfc program or those who purchase vaccines privately . \n moreover , the total number of vaccine doses involved in this study represents less than 1% of all vfc doses distributed annually in the united states . \n furthermore , the course of action regarding use of triggered vaccines was a subjective decision based on visual inspection of the vaccine , previous temperature readings recorded on the temperature logs , and unpublished data regarding impact of exposure to freezing temperatures . \n these actions may or may not be reproducible under the guidance of a different inspector . \n finally , our study was conducted around the time of the release of the 2012 cdc vaccine recommendations . \n thus , comparison of provider practices observed during the study with those recommended in the 2012 cdc recommendations is meant for illustrative purposes only because adoption of guidelines into clinical practice often takes several years . \n consistent with the findings of the 2008 aim survey , in which providers expressed a strong interest in guidance related to vaccine storage and handling , we found providers eager to implement mitigating measures upon triggering of freeze indicators . \n these included moving vaccines away from cold spots and implementing cdc recommendations included in the vaccine storage and handling toolkit . \n in conclusion , visual freeze indicators have the potential to serve as an early warning of a freeze event and to assist providers as they work to protect patients with the most effective vaccines available . \n this visual tool can help providers better manage every dose of vaccine stored in their offices and thereby expand access to vaccine by avoiding unnecessary wastage . \n it is recommended that the cdc , in collaboration with grantees , providers , and industry , consider including a recommendation to affix visual freeze indicators to individual boxes of vaccine as an early warning tool to complement the storage and temperature - monitoring devices and equipment currently being used .", "role": "user" }, { "content": "backgroundthe aim of this study was to determine whether the use of visual freeze indicators on vaccines would assist health care providers in identifying vaccines that may have been exposed to potentially damaging temperatures.methodstwenty-seven sites in connecticut involved in the vaccine for children program participated . \n in addition to standard procedures , visual freeze indicators ( freezemarker l ; temptime corporation , morris plains , nj ) were affixed to each box of vaccine that required refrigeration but must not be frozen . \n temperatures were monitored twice daily.resultsduring the 24 weeks , all 27 sites experienced triggered visual freeze indicator events in 40 of the 45 refrigerators . \n a total of 66 triggered freeze indicator events occurred in all 4 types of refrigerators used . \n only 1 of the freeze events was identified by a temperature - monitoring device . \n temperatures recorded on vaccine data logs before freeze indicator events were within the 35f to 46f ( 2c to 8c ) range in all but 1 instance . a total of 46,954 doses of freeze - sensitive vaccine \n were stored at the time of a visual freeze indicator event . \n triggered visual freeze indicators were found on boxes containing 6566 doses ( 14.0% of total doses ) . \n of all doses stored , 14,323 doses ( 30.5% ) were of highly freeze - sensitive vaccine ; 1789 of these doses ( 12.5% ) had triggered indicators on the boxes.conclusionsvisual freeze indicators are useful in the early identification of freeze events involving vaccines . \n consideration should be given to including these devices as a component of the temperature - monitoring system for vaccines .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: islet amyloid polypeptide ( iapp ) is identified as a main constituent of the islet amyloid . \n this peptide is synthesized and secreted in parallel with insulin by the cell , and is considered to be associated with pathogenesis of human type 2 diabetes as a result of its amyloidogenicity . \n however , its pathophysiological role in normal subjects and type 2 diabetic patients is poorly understood . \n we identified the human iapp cdna and subsequently characterized the human iapp gene , and we also found a missense mutation at amino acid 20 ( agc to ggc ) , s20 g mutation registered as s53 g of the precursor protein , in japanese type 2 diabetic patients . \n the s20 g mutation is found only in the asian population and has a significantly higher frequency ( 2.6% ) than the nondiabetic population ( 0.8% ) . \n type 2 diabetic patients carrying the s20 g mutation appeared to have a relatively early onset and to suffer severe diabetes when there is a strong family history of lateonset type 2 diabetes . \n we reported that the g20iapp variants were more closely related to amyloidogenicity and cytotoxicity than wildtype iapp in vitro . \n however , there are little clinical data on how impairments of insulin secretion progress in patients carrying the s20 g mutation in vivo . \n type 2 diabetes is characterized by the reduction in insulin secretion that results from progressive cell dysfunction and loss of cell mass . \n however , little is known about the longterm courses of cell function in type 2 diabetic patients . in the present study , \n we first evaluated the decline of insulin secretion in japanese type 2 diabetic patients without the s20 g mutation ( nons20gt2dpatients ) over a more than 10year observation period , and then compared it with that of type 2 diabetic patients carrying the s20 g mutation ( s20gpatients ) . \n we followed the nons20gt2dpatients for more than 10 years and the s20gpatients for more than 5 years ( table 1 ) . \n we clinically observed all patients every 12 months during the followup period at the outpatient clinic in wakayama medical university hospital . \n type 2 diabetes was diagnosed based on the criteria of the japan diabetes association . \n we excluded patients who had an endocrine , hepatic or renal disorder ( serum creatinine > 97.2 mol / l ) and severe obesity ( body mass index 30 kg / m ) . \n we also excluded patients who had antiinsulin antibodies among the insulin treated patients . to assess \n the presence or absence of the s20 g mutation of the iapp gene , genomic dna of all patients were analyzed by direct dna sequencing . \n informed consent was obtained from all of the patients and procedures were carried out in accordance with the declaration of helsinki . \n first , during the lifestyle change to decrease weight and increase activity , the patients were treated with metformin 500750 mg / day . \n the sulfonylureas were initiated by tolbutamide , gliclazide , glimepiride or glibenclamide . they could be switched to glimepiride or glibenclamide and finally up to glimepiride 6 mg / day or glibenclamide 5 mg / day . \n when they could nt obtain a1c level < 8.4% after the treatment , they were initiated by insulin . in principle , they were not treated with thiazolidinediones , glinides , glucosidase inhibitors and dipeptidyl peptidase iv inhibitors . \n a1c was measured by the highperformance liquid chromatography method and estimated as a national glycohemoglobin standardization program equivalent value ( % ) calculated by the formula a1c ( % ) = hba1c ( japan diabetes society ; % ) + 0.4% . \n nons20gt2dpatients , type 2 diabetes patients without the s20 g mutation of the islet amyloid polypeptide gene ( iapp ) ; s20gpatients , type 2 diabetic patients with the s20 g mutation of the iapp gene . \n the cell function was evaluated by fasting serum cpeptide ( fcp ) levels and its responsiveness to intravenous glucagon stimulation , that is a 5min value ( 5cp ) after 1 mg glucagon injection as a bolus ( glucagon test ) . \n we measured fcp every 12 years and carried out a glucagon test at least once during the followup period . \n fcp in the 169 nondiabetic subjects ( fasting blood glucose < 6.1 mmol / l and without a family history of diabetes ) was also analyzed as a control ( 69 male ; mean age 62.4 2.6 [ from 22 to 85 ] years ; body mass index 22.9 2.7 kg / m ) . \n serum cpeptide was measured by immunoenzymometric assay ( st e test tosoh ii cpeptide ; tosoh , tokyo , japan ) . \n the withinrun and daytoday precisions ( coefficients of variation ) were 1.32.2% and 3.13.8% , respectively . \n we estimated the correlation between either fcp or 5cp and duration ( years after diagnosis ) using total points ( n = 527 for fcp and n = 169 for 5cp ) in the nons20gt2dpatients who individually had at least five measurements for fcp or two measurements for 5cp . for the estimation of annual decline of endogenous insulin secretion , \n the individual annual declines ( iad ; multiplied [ 1 ] by the annual change ) of fcp and 5cp were calculated from the slopes of the individual regression lines between either fcp or 5cp and duration . \n all the 70 nons20gt2dpatients and all the six s20gpatients , who had at least five measurements , were evaluated for the iad of fcp . \n we represented the slopes of the regression lines between fcp and duration in a representative nons20gt2dpatient ( figure 1a ) and the six s20gpatients ( figure 1b g ) . \n the 42 nons20gt2dpatients and the four s20gpatients who had undergone at least two glucagon tests were also evaluated for the iad of 5cp . \n the slopes obtained from the individual regression lines between fasting serum cpeptide level ( fcp ) and duration in ( a ) a representative type 2 diabetic patient who lacked the s20 g mutation of the islet amyloid polypeptide gene and ( a g ) the six type 2 diabetes patients who carried the s20 g mutation of the islet amyloid polypeptide gene ( the panels from b to g are listed in the patients order from 1 to 6 ) . \n statistical analysis was carried out by a student s ttest between two groups . by using analysis of covariance ( ancova ) \n , we also adjusted iad for average a1c level every 3 months during the followup course to compare them between the two groups . \n multiple regressions were used to estimate the correlation between cpeptide level and duration of diabetes using total points . \n we used cpeptide level as the outcome variable , and duration and the subject as the predictor variables . \n the pvalue from the analysis of variance table was used to determine the probability of the analysis . \n we followed the nons20gt2dpatients for more than 10 years and the s20gpatients for more than 5 years ( table 1 ) . \n we clinically observed all patients every 12 months during the followup period at the outpatient clinic in wakayama medical university hospital . \n type 2 diabetes was diagnosed based on the criteria of the japan diabetes association . \n we excluded patients who had an endocrine , hepatic or renal disorder ( serum creatinine > 97.2 mol / l ) and severe obesity ( body mass index 30 kg / m ) . \n we also excluded patients who had antiinsulin antibodies among the insulin treated patients . to assess \n the presence or absence of the s20 g mutation of the iapp gene , genomic dna of all patients were analyzed by direct dna sequencing . \n informed consent was obtained from all of the patients and procedures were carried out in accordance with the declaration of helsinki . \n first , during the lifestyle change to decrease weight and increase activity , the patients were treated with metformin 500750 mg / day . \n the sulfonylureas were initiated by tolbutamide , gliclazide , glimepiride or glibenclamide . they could be switched to glimepiride or glibenclamide and finally up to glimepiride 6 mg / day or glibenclamide 5 mg / day . \n when they could nt obtain a1c level < 8.4% after the treatment , they were initiated by insulin . in principle , they were not treated with thiazolidinediones , glinides , glucosidase inhibitors and dipeptidyl peptidase iv inhibitors . \n a1c was measured by the highperformance liquid chromatography method and estimated as a national glycohemoglobin standardization program equivalent value ( % ) calculated by the formula a1c ( % ) = hba1c ( japan diabetes society ; % ) + 0.4% . \n nons20gt2dpatients , type 2 diabetes patients without the s20 g mutation of the islet amyloid polypeptide gene ( iapp ) ; s20gpatients , type 2 diabetic patients with the s20 g mutation of the iapp gene . \n the cell function was evaluated by fasting serum cpeptide ( fcp ) levels and its responsiveness to intravenous glucagon stimulation , that is a 5min value ( 5cp ) after 1 mg glucagon injection as a bolus ( glucagon test ) . \n we measured fcp every 12 years and carried out a glucagon test at least once during the followup period . \n fcp in the 169 nondiabetic subjects ( fasting blood glucose < 6.1 mmol / l and without a family history of diabetes ) was also analyzed as a control ( 69 male ; mean age 62.4 2.6 [ from 22 to 85 ] years ; body mass index 22.9 2.7 kg / m ) . \n serum cpeptide was measured by immunoenzymometric assay ( st e test tosoh ii cpeptide ; tosoh , tokyo , japan ) . \n the withinrun and daytoday precisions ( coefficients of variation ) were 1.32.2% and 3.13.8% , respectively . \n we estimated the correlation between either fcp or 5cp and duration ( years after diagnosis ) using total points ( n = 527 for fcp and n = 169 for 5cp ) in the nons20gt2dpatients who individually had at least five measurements for fcp or two measurements for 5cp . \n for the estimation of annual decline of endogenous insulin secretion , the individual annual declines ( iad ; multiplied [ 1 ] by the annual change ) of fcp and 5cp were calculated from the slopes of the individual regression lines between either fcp or 5cp and duration . \n all the 70 nons20gt2dpatients and all the six s20gpatients , who had at least five measurements , were evaluated for the iad of fcp . \n we represented the slopes of the regression lines between fcp and duration in a representative nons20gt2dpatient ( figure 1a ) and the six s20gpatients ( figure 1b g ) . \n the 42 nons20gt2dpatients and the four s20gpatients who had undergone at least two glucagon tests were also evaluated for the iad of 5cp . \n the slopes obtained from the individual regression lines between fasting serum cpeptide level ( fcp ) and duration in ( a ) a representative type 2 diabetic patient who lacked the s20 g mutation of the islet amyloid polypeptide gene and ( a g ) the six type 2 diabetes patients who carried the s20 g mutation of the islet amyloid polypeptide gene ( the panels from b to g are listed in the patients order from 1 to 6 ) . \n statistical analysis was carried out by a student s ttest between two groups . by using analysis of covariance ( ancova ) \n , we also adjusted iad for average a1c level every 3 months during the followup course to compare them between the two groups . \n multiple regressions were used to estimate the correlation between cpeptide level and duration of diabetes using total points . \n we used cpeptide level as the outcome variable , and duration and the subject as the predictor variables . \n the pvalue from the analysis of variance table was used to determine the probability of the analysis . \n the clinical data of patients and the shift in the method of the treatment of the 70 nons20gt2dpatients at every 5 years are shown in table 1 and figure 2 , respectively . \n the prevalence of nons20gt2dpatients with insulin therapy gradually increased through the long clinical course . \n proportion of each therapy according to duration of diabetes in the type 2 diabetic patients who lacked the s20 g mutation of the islet amyloid polypeptide gene . \n open bars , gray bars , black bars represent the proportion of the patients ( % ) in each duration of diabetes who underwent diet therapy , oral hypoglycemic therapy and insulin therapy , respectively . in the nons20gt2dpatients , \n fcp was negatively correlated with duration of diabetes ( r = 0.841 , p < 0.001 ) , using 527 samples obtained from all of the 70 nons20gt2dpatients , who individually had at least five measurements ( figure 3a ) . \n 5cp during glucagon tests were also negatively correlated with duration ( r = 0.585 , p < 0.01 ) , using 154 samples obtained from the 42 nons20gt2dpatients who individually had at least two measurements ( figure 3b ) . \n fcp in the nondiabetic subjects was 0.558 0.241 nmol / l ( figure 3a , the arrow ) and fcp was not correlated with age ( r = 0.0005 , p = 0.996 , n = 169 ) . correlations between ( a ) fasting serum cpeptide level ( fcp ) and ( b ) 5min level of serum cpeptide level after the intravenous injection of 1 mg glucagon ( 5cp ) and duration of diabetes in the type 2 diabetic patients who lacked the s20 g mutation of the islet amyloid polypeptide gene . \n ( a ) fcp in the nondiabetic subjects are indicated as the arrow ( 0.558 0.241 \n nmol / l ; mean vales sd ) , and the dashed line indicates the virtual line extended the value horizontally . \n the mean iad of fcp in the 70 nons20gt2dpatients was calculated as 0.011 0.037 nmol / l / year ( figure 4a ) . \n the mean iad of fcp in the six type 2 diabetic patients carrying the s20 g mutation was calculated as 0.047 0.026 \n nmol / l / year , which was significantly greater than that of the 70 nons20gt2dpatients ( p = 0.025 , figure 4a ) . \n the significant difference was preserved , even after adjusted by a1c ( p = 0.047 ) . the mean iad of 5cp in the four patients with the s20 g mutation was also significantly greater than that in the 42 nons20gt2dpatients ( 0.138 0.055 nmol / l / year vs 0.022 0.012 \n nmol / l / year , p = 0.008 , figure 4b ) . \n ( a ) annual changes of fasting serum cpeptide level ( fcp ) in the type 2 diabetic patients without ( nons20gt2dpatients , n = 70 ) and those with the s20 g mutation of the iapp gene ( s20gpatients , n = 6 ) . \n ( b ) those who had 5min level of serum cpeptide level after the intravenous injection of 1 mg glucagon ( 5cp ) in the 42 nons20gt2dpatients and the four s20gpatients . \n individual values are shown as scatter plots and mean vales sd as columns , with statistical significance of the difference below columns . \n * p = 0.025 , * * p = 0.008 for the difference between the indicated groups . \n the present study has shown that endogenous insulin secretion in nonobese japanese type 2 diabetic patients gradually deteriorates and that the iad of fcp in the patients without the s20 g mutation of the iapp gene is calculated as 0.011 0.037 nmol / l / year by the longitudinal followup study . \n there are no reports of such a longterm followup study of more than 10 years measuring circulating cpeptide in type 2 diabetic patients . \n these results make it possible to evaluate the decline of the fcp in patients carrying s20 g and show that it is four times greater than that in patients who do not carry it . in type 2 \n diabetic patients , it is clear that progressive reductions in both cell mass and cell function are present . a longitudinal study that examined the course of islet dysfunction in patients with type 2 diabetes , the united kingdom prospective diabetes study , showed that the cell function estimated by the homeostasis model assessment index deteriorated during the first 6 years of observation in the type 2 diabetic patients without insulin therapy . in the present study , \n we also indirectly showed the reduction of cell function by the gradually increasing prevalence of insulin requiringpatients throughout the long clinical course ( figure 2 ) . \n furthermore , there are two reports of the histological examination of the cell that provide information on the relationship between cell mass and duration . \n both are crosssectional studies using autopsy samples . in one study using european type 2 diabetic patients ( n = 47 ) , the annual decline ratio of the cell mass was estimated as 1.7% per year to initial cell mass or 1.35% to the average cell mass in nondiabetic subjects by estimation of the simple linear regression line . \n the other report concerned cell mass of autopsy samples in lean japanese type 2 diabetic patients ( n = 14 ) and showed an approximately 2% mass reduction ratio to nondiabetic control subjects per year . in the present study , by using the mean iad of fcp , the annual reduction ratio of fcp to the mean fcp of nondiabetic subjects was calculated as 1.97% ( 0.011/0.558 ) . in contrast , the annual reduction ratio of fcp to the initial fcp ( fcp crosses to the regression line at duration 0 year ) in japanese type 2 diabetic patients was also reported to be approximately 1% by the crosssectional analysis . \n interestingly , through the accumulation of these data , although the number and the design of these studies are limited , it can be shown that the annual decline ratio of fcp is similar to that of the cell mass . \n we already reported that the g20iapp variant had greater amyloidogenicity and cytotoxicity than wildtype iapp in vitro , but little is known about its behavior in vivo or in humans . in the present study , although the number of the affected patients was limited , we clarified the faster progressive deterioration of insulin secretion in the affected type 2 diabetic patients than in that of the nons20gt2dpatients by using fcp . furthermore , glucagon test can be used as an easy assessment for the capacity of residual insulin secretion and it is informative for the choice of insulin therapy used in type 2 diabetic patients . as the results of the glucagon tests , it was confirmed that the decline of endogenous insulin secretion in the s20gpatients was also greater than that in the nons20gt2dpatients , even in the residual state . \n gathering together , these data of both fcp and 5cp provide new evidence for the stronger effect of the s20 g mutation on the cell dysfunction in human diabetes and can support the position that there is a stronger association of cytotoxicity with the g20iapp variant than wildtype iapp in vitro . \n more detailed study concerning the g20iapp variant in vivo or in humans might shed light on the mechanism of iappmediated cell loss and/or dysfunction in human type 2 diabetes . \n although we have suggested that there is a more rapid deterioration of insulin secretion in the s20gpatients than the nons20gt2dpatients , the result should also be interpreted carefully , because it has been studied in a limited number of patients . \n because of the limited number of patients , especially in the s20gpatients , the clinical features and underlying pathogenesis might be heterogeneous . however , these data depend on the longterm followup data of each patient , and that at least could partially compensate for the limitation of the small number of patients . \n it is hoped that there will be a study that analyzes a larger number of patients to elucidate the role of iapp in mutated and nonmutated type 2 diabetic patients . in conclusion \n , we established the annual decline of endogenous insulin secretion in nonobese japanese type 2 diabetic patients by longterm observation . \n the results clearly show that the decline of endogenous insulin secretion is more rapid in type 2 diabetic patients with the s20 g mutation than those without it . \n these results are not only clinically useful for the appropriate selection of therapy for type 2 diabetic patients , but also have the pathophysiologically important potential to reveal the mechanisms of cell dysfunction or loss associated with iapp .", "role": "user" }, { "content": "abstractaims / introduction : in order to clarify the enhanced cell dysfunction in type 2 diabetic patients carrying the s20 g mutation of the islet amyloid polypeptide gene ( s20gpatients ) , we first estimated the decline of insulin secretion in japanese type 2 diabetic patients without the s20 g mutation ( nons20gt2dpatients ) by longterm observation , and then compared it with that of the s20gpatients.materials and methods : we followed 70 nons20gt2dpatients ( body mass index < 30 kg / m2 ) for more than 10 years and six s20gpatients for more than 5 years . \n we measured fasting cpeptide ( fcp ) every 12 years and carried out a glucagon test at least once during the followup period . fcp and \n a 5min value of cpeptide after glucagon injection ( 5cp ) were used as the indices of insulin secretion . \n we excluded patients who had renal dysfunction and/or antiinsulin antibodies in the insulintreated patients . \n the individual annual declines were calculated from the slopes of the regression lines between cpeptide levels and duration ( years after diagnosis).results : the mean individual annual declines of both fcp and 5cp were significantly greater in the s20gpatients than the nons20gt2dpatients ( fcp ; 0.047 0.026 vs 0.011 0.037 \n nmol / l / year , p = 0.025 , 5cp ; 0.139 \n 0.055 vs 0.022 0.012 \n nmol / l / year , p = 0.008).conclusions : we established the annual decline of insulin secretion in the japanese type 2 diabetic patients by the longterm observation . \n the results show that the decline of insulin secretion is more rapid in the s20gpatients than the nons20gt2dpatients . \n ( j diabetes invest , doi : 10.1111/j.20401124.2011.00102.x , 2011 )", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the online version of this article ( doi:10.1007/s12079 - 009 - 0047 - 5 ) contains supplementary material , which is available to authorized users . \n the mammary gland undergoes periodic cycles of growth , differentiation and regression throughout adult life . \n normal mammary gland development is dependent on signals from growth factors , mammotrophic hormones , and tissue stroma , and the dysregulation of these process can lead to mammary epithelial hyperplasia and tumorigenesis . the hc11 cell line was derived from the comma1d cells , which originated from the mammary gland tissue of a pregnant balb / c mouse ( danielson et al . \n hc11 cells are an excellent model system for studying differentiation states of mammary epithelial cells . \n these cells retain important characteristics of normal mammary epithelial cells including the synthesis of the milk protein - casein in vitro upon treatment with lactogenic hormones ( ball et al . \n hc11 cells also exhibit normal ductal morphogenesis when injected into the cleared fat pad of syngeneic mice ( humphreys and rosen 1997 ) . a crucial event in the mammary epithelial cells \n is the activation of the epidermal growth factor ( egf ) receptor during the growth phase . in hc11 cells , \n activation of the egf receptor promotes growth and is required for the establishment of competence to respond to the lactogenic hormones . \n following egf removal , hc11 cells differentiate in vitro in response to the synergistic actions of insulin , glucocorticoids , and prolactin ( dip ) ( ball et al . \n however , the inclusion of egf in the lactogenic hormone mix blocks differentiation ( hynes et al . 1990 ; marte et al . 1995b ; merlo et al . 1996 ; peterson and haldosen 1998 ) . the regulatory mechanisms for signal transduction pathways controlling development of the mammary gland epithelium and the molecular switch from proliferation to differentiation have been studied in recent years . \n prolactin stimulation results in the phosphorylation and nuclear translocation of stat5 and stat5 binds to the -casein promotor initiating its transcription ( ali 1998 ; gouilleux et al . \n 1994 ; han et al . 1997 ; marte et al . 1995b ; stocklin et al . \n the activation of -casein transcription is enhanced by the glucocorticoid receptor ( nagaiah et al . \n 1981 ; stocklin et al . 1996 ) . while these studies addressed the requirements for milk protein transcription other changes contributing to lactogenic differentiation \n mammary epithelial cell differentiation was examined using two - dimensional gels and proteomic techniques to decipher differences between the protein patterns of growing versus differentiating cells ( desrivieres et al . \n this study identified approximately sixty proteins whose expression levels changed following four days of differentiation . \n these proteins include cytoskeletal components , molecular chaperones and regulators of protein folding and stability , calcium - binding proteins , and components of rna - processing pathways . \n more recently a proteomic study of nuclear protein changes in hc11 cells undergoing differentiation revealed differential expression of several transcription factors that have the potential to regulate mammary differentiation or development as well as proteasome subunits , hnrnps and hsps ( desrivieres et al . \n the profile of induced proteins provided insights into the mechanistic differentiation of hc11 mammary epithelial cells and the regulation of this process . \n gene expression profiling using dna microarrays allows the concurrent analysis of thousands of genes and has been applied to provide insight into the regulatory and functional pathways involved in mouse mammary gland development ( master et al . \n these studies measure transcription in all cells in the mammary gland including stroma and immune cells . in the study reported here , oligonucleotide microarrays containing approximately 20,000 genes were used to examine the gene expression patterns during lactogenic differentiation of the hc11 mammary epithelial cell line . \n the study confirms that hc11 cells undergoing lactogenic differentiation in culture recapitulate the process in the mammary gland . \n in addition , the results identify potential signaling pathways not previously associated with mammary differentiation . among the newly identified molecules contributing to lactogenic differention the rapid elevation of ctgf \n / ccn2 and osteopontin are highly significant as these proteins are known to play a role in tissue remodeling and the pathology of breast cancer . \n cell preparation hc11 mouse mammary epithelial cells were cultured in rpmi 1640 medium containing 10% fetal calf serum , 5 g / ml insulin , 10 mm hepes and 10 ng / ml epidermal growth factor ( egf ) ( cerrito et al . \n the cells were maintained in t75 flasks for 4 days after reaching confluence , then exposed to media without egf for 24 h. the cells were then incubated in dip differentiation media , serum - containing rpmi with dexamethasone ( 10 m ) , insulin ( 5 g / ml ) and prolactin ( 5 g / ml ) for 72 h and undifferentiated hc11 cells were maintained in growth media and these served as a control . in another set of experiments , control cells were incubated in dip differentiation media for 72 h , while experimental cells were incubated in dip differentiation media except that egf was present . \n rna preparation rna was extracted using trizol reagent ( invitrogen ) and rneasy maxi kit ( qiagen ) . \n rna samples were concentrated to greater than 1 mg / ml by centrifugation on a microcon 100 filter unit at 500 g. the concentration and 260/280 od ratio of the rna was determined by spectrophotometry and rna was stored at 80c . \n labeling , hybridization and analysis mouse ( development ) oligo microarrays were purchased from agilent technologies . \n the content on this microarray was derived from the national institute on aging / national institute of health cdna mouse clone set that includes genes from sequences of stem cells and very early - stage embryo cdna libraries . \n briefly , fluorescent crna was synthesized using low rna input fluorescent linear amplification kit from agilent technologies . \n 500 ng of total rna was used in each experiment . in the differentiation experiments , \n n = 5 ) , dip treated rna was labeled with cyanine 5-ctp , and control rna was labeled with cyanine 3-ctp . in differentiation blocking experiments , six slides were used ( n = 6 ) , egf treated dip rna was labeled with cyanine 5-ctp , while dip treated rna was labeled with cyanine 3-ctp . \n hybridization was carried out using in situ hybridization kit plus from agilent technologies , 750 ng of cyanine 3 and cyanine 5 labeled crna was used in each hybridization . \n hybridization continued at 60c for over 17 h. post hybridization washes includes 6 x ssc , 0.005% triton x-102 ( 10 min ) , and 0.1 x ssc , 0.005% triton x-102 ( 5 min ) followed by drying with nitrogen gas and immediate scanning . \n analysis of gene expression was performed using brb - array tools version 3 which was developed by biometrics research branch , nci ( http://linus.nci.nih.gov/brb-arraytools.html).in addition , a smaller study using oligonucleotides arrays representing 3800 genes ( atlas glass mouse 3.8 microarrays from clontech ) ( n = 4 ) was performed . \n fluorescent labeling of rnas was performed by using an atlas glass fluorescent labeling kit ( clontech laboratories ) according to manufacturer s protocol . synthesized first - strand cdnas from rna of hc11 cells with and without differentiation were labeled with fluorescent dyes , cy3 and cy5 ( amersham pharmacia biotech ) , respectively . \n the reciprocal labeling was used during the experiment , i.e. differentiation group was labeled with cy3 two times , and cy5 two times ; and the control group was labeled with cy5 two times , and cy3 two times . \n the quality of the labeling and the amount of each probe used were determined by absorbance measurement for cy3 and cy5 probes in a beckman du-600 scanner . \n hybridization of the microarrays was carried out in a hybridization solution for 16 h at 50c . \n the microarray slides were scanned and analyzed by using a genepix 4000b scanner in both cy3 and cy5 channels . \n the control value was obtained from four experiments and used to determine the differentiation induced gene up- or down - regulations . \n the average of the cy3 and cy5 signals from nine house - keeping genes were used to obtain a ratio value for normalization of the individual signals . \n much of the information obtained from the differentiation experiments analyzed on the smaller oligonucleotide based arrays , clontech 3.8 k arrays , were contained within the larger 20280 gene set data . \n however , supplemental file 3 contains the list of genes detected as differentially expressed during lactogenic differentiation of hc11 cells on 3.8 k arrays . statistical analysis of microarray normalization and analysis of the gene expression profiles \n were performed as follows : the spot was excluded if red and green intensity was below 30 . \n genes were excluded under any of the following conditions : less than 20 % of expression data had at least a 1.5 -fold change in either direction from gene s median value or if the percentage of data that was missing or filtered out exceeded 50%.in dip versus control experiments , there are 10813 genes that passed filtering criteria in total of 20280 genes . \n and the first 2479 genes are significant at the nominal 0.05 level of the paired t - test . \n in egf plus dip versus dip experiments , there are 1386 genes passed filtering criteria in total of 20280 genes . \n and the first 1129 genes are significant at the nominal 0.05 level of the paired t - test . \n generation of probes in order to generate dna hybridization probes , the accession number of interested gene was used to obtain the mrna sequence and primers were designed for rt - pcr to produce a dna fragment several hundred basepairs in length . \n rt - pcr products were inserted into a pcr2.1 ta cloning vector ( invitrogen ) and the identities of candidate clones were confirmed by dna sequence . \n double strand dna plasmid inserts were isolated by restriction endonuclease digestion of the pcr2.1 plasmid and the released dna fragment was gel purified for use as a hybridization probe . \n the fragments cloned and amplified include : pip , position 77 to 477 in cdna ( accession number nm_008843 ) ; klf9 ( bteb1 ) , position 932 to 1262 in cdna ( accession number nm_010638 ) ; sgk position 92 to 592 in cdna(accession number nm_011361 ) ; ap3 position 92 to 592 in cdna ( accession number nm_009681 ) ; spi - c position 362 to 862 in cdna(accession number nm_011461 ) . \n the probes and primers for ctgf / ccn2 , -casein , and actin have been described ( wang et al . \n northern blot and realtime pcr for northern blot experiments , hc11 cells were treated identically to the methods in the microarray experiment , and then exposed to dip differentiation media for 0 , 12 , 24 , 48 , 72 and 96 h , respectively . \n rna from mouse mammary gland at distinct stages of pregnancy and lactation were prepared as described ( wang et al . \n beta - actin probe was hybridized to the same membrane and scanned on packard beta scanner for normalization purposes . \n realtime pcr was performed using sybr green pcr kits and a 7500 realtime pcr instrument ( applied biosystems ) . \n primers include : actin forward 5 ttactgctctggctcctagca , reverse 5 gactcatcgtactcctgcttgc ; ctgf / ccn2 primers amplified a 500 bp fragment in the mouse ctgf 3utr , forward 5acagttgttcattagcgcac and reverse : 5ctatggtgtttggagtttga . \n expression vector construction the open reading frame of identified genes was tagged with the myc epitope tag by pcr and inserted into pcr3.1 vector ( invitrogen ) as described ( wang et al . \n lactogenic differentiation - induced gene expression in hc11 cells to follow the global changes in gene transcription in hc11 mouse mammary epithelial cells undergoing lactogenic differentiation , we employed an oligonucleotide based microarray technique . \n the experiments were performed with rna extracted from hc11 cells maintained in either growth media or hc11 cells exposed to lactogenic differentiation media containing dexamethasone , insulin and prolactin ( dip ) . \n hc11 cells undergoing lactogenic differentiation have a unique phenotypic appearance as clusters of enlarged cells in dome - like structures , referred to as mammospheres , appear in the culture ( fig . 1c ) . \n total rna was purified from the cells and fluorescent crna was synthesized . in the differentiation experiments \n ( n = 5 ) , rna from dip treated cells was labeled with cyanine 5-ctp , and rna from the control cells was labeled with cyanine 3-ctp . \n differences in gene expression were detected by hybridization of labeled rna to slide - based oligonucleotide microarrays . \n the nia mouse development oligonucleotide microarrays containing 20280 genes ( produced by agilent technologies ) were employed for the study . \n normalization and statistical analysis and the analysis of gene expression using brb - array tools version 3 was performed as described in the materials and methods section . \n a. hc11 mouse mammary epithelial cells were cultured in complete medium with egf for 4 days post confluence followed by incubation in the media without egf for 24 h. the cells were then stimulated with differentiation media containing dexamethasone ( 10 m ) , insulin(5 g / ml ) and prolactin ( 5 g / ml ) for 0 , 12 , 24 , 48 , and 72 h. rna was extracted and used for northern blots . \n b. northern blotting of genes exhibiting elevated expression in hc11 cells hybridized to rna from mouse mammary glands . \n the probes used in part a were hybridized to northern blots of rna extracted form mouse mammary glands at various stages of pregnancy and lactation . \n the rnas are from pregnancy days 10 , 12 and 16 ; lactation days 1 and 3 ; involution days 1 and 7 ; and np represents rna from non - pregnant mammary glands of adult female mice . \n the blots were hybridized to -actin as a loading control . c. hc11 cells undergoing lactogenic differentiation . \n control = untreated cells , dip = cells exposed to dip for 5 days . \n top panel : cells at magnification 200x ; bottom panel : cells at magnification of 500xin the experiments comparing hc11 cells induced to differentiate with hc11 control cells ( dip versus control ) , there were 10813 genes that passed filtering criteria from a total of 20280 genes on the nia microarrays . \n table 1 shows the partial list of genes exhibiting increased expression during lactogenic differentiation of hc11 cells and supplemental file 1 contains the information on the 998 genes that met the 2-fold change at the p value 0.05 . in the case studies carried out using the nia 20280 gene arrays fewer genes exhibited a significant reduction in expression than an increase in expression during the 72 h differentiation period . \n table 2 contains a partial list from the 20 genes exhibiting a minimum two - fold decrease . \n table 1elevation of gene expression following stimulation of hc11 cells with dipmean of log ratiogb accdescription17.067nm_010217.1connective tissue growth factor13.447nm_138314.1protein expressed in non - metastatic cells 711.15xm_150141.2loc2345749.52nm_009263.1secreted phosphoprotein 17.69bc009155.1microsomal glutathione s - transferase 17.64nm_022032.1p53 apoptosis effector related to pmp226.99nm_011326.1sodium channel , nonvoltage - gated 1 gamma6.44nm_009681.1adaptor - related protein complex ap-3 , sigma 1 subunit6.34nm_029083.1riken cdna 5830413e08 gene5.92bc036990.1metallothionein 15.85xm_123496.1tcfcp2-related transcriptional repressor 15.78nm_007621.1carbonyl reductase 25.77nm_138578.1bcl2-like5.76nm_012519.1calcium / calmodulin - dependent protein kinase ii , delta5.72nm_009976.1cystatin c5.42nm_010286.1glucocorticoid - induced leucine zipper5.15nm_009128.1stearoyl - coenzyme a desaturase 25.14nm_025610.1riken cdna 2410004d18 gene5.13nm_011361.1serum / glucocorticoid regulated kinase4.88ak009928.1riken cdna 2310051e17 gene4.82nm_011313.1s100 calcium binding protein a6 ( calcyclin)4.79af434663.1immunoglobulin superfamily , member 44.75nm_010730.1annexin a14.60nm_026217.1autophagy 12-like ( s. cerevisiae)4.60nm_025436.1sterol - c4-methyl oxidase - like4.52nm_010884.1n - myc downstream regulated 14.48xm_177182.1expressed sequence c853444.44nm_011400.1solute carrier family 2 ( facilitated glucose transporter)4.41nm_011803.1core promoter element binding protein4.41nm_010907.1nuclear factor of kappa light chain gene enhancer4.34nm_013470.1annexin a34.33nm_145942.13-hydroxy-3-methylglutaryl - coenzyme a synthase 14.21al080093.1expressed sequence au0676364.16xm_132485.1ras - related c3 botulinum substrate 14.11nm_010762.1myelin and lymphocyte protein , t - cell differentiation4.10nm_009983.2cathepsin d4.08af378830.1prostaglandin - endoperoxide synthase 24.05nm_145977.1riken cdna 2210413p12 gene4.01nm_146120.1gelsolin3.98bc020081.1riken cdna 2310016c08 gene3.95bc019207.1low density lipoprotein receptor3.95nm_053623.1expressed sequence au0181083.93nm_019971.1platelet - derived growth factor , c polypeptide3.92nm_013492.1clusterin3.89nm_008084.1glyceraldehyde-3-phosphate dehydrogenase3.87bc038392.1atpase , h+ transporting , lysosomal 70kd , v13.85nm_033079.1dna segment , chr 6 , miriam meisler 5 , expressed3.84bc037116.1adducin 3 ( gamma)regulation of gene expression in hc11 cells undergoing lactogenic differentiation . to determine the effect of lactogenic differentiation on gene transcription in hc11 cells oligonucleotide \n microarrays representing 20280 genes ( nia 20 k arrays from agilent technologies ) were hybridized with rna from dip treated hc11 cells . \n the rna was labeled with cyanine 5-ctp and control rna was labeled with cyanine 3-ctp . \n fluorescent crna was synthesized and hybridized in the differentiation experiments ( n = 5 ) as described in materials and methods . \n analysis of gene expression was performed using brb - array tools version 3 . in the hc11-dip versus hc11-control rna experiments , \n the first 2479 genes were significant at the nominal 0.05 level of the paired t - test , and 998 genes met the 2-fold change criteria . \n table 1 shows the first 50 genes with elevated expression in cells undergoing lactogenic differentiationtable 2genes exhibiting decreased expression following stimulation of hc11 cells with dipmean of log ratiogb accdescription0.66nm_007671.1cyclin - dependent kinase inhibitor 2c ( p18)0.59nm_009335transcription factor ap-2 , gamma0.56nm_007631.1cyclin d10.56mm.11987ests , moderately similar to pol2_mouse0.53mm.173695ests , moderately similar to cofactor forsp10.47af316985.1toll - like receptor 10.44nm_021355.1fibromodulin0.44m_008086.1growth arrest specific 10.37c012724.1insulin - like growth factor binding protein 2decreased gene expression in hc11 cells undergoing lactogenic differentiation . \n rna from hc11 cells undergoing lactogenic differentiation and hc11 control cells was analyzed for changes in gene transcription using oligonucleotide microarrays as described in the legend of table 1 . \n the results in table 2 show the genes with significantly decreased expression in hc11 cells undergoing lactogenic differentiation northern blotting of genes exhibiting elevated expression in hc11 cells undergoing lactogenic differentiation . \n a. hc11 mouse mammary epithelial cells were cultured in complete medium with egf for 4 days post confluence followed by incubation in the media without egf for 24 h. the cells were then stimulated with differentiation media containing dexamethasone ( 10 m ) , insulin(5 g / ml ) and prolactin ( 5 g / ml ) for 0 , 12 , 24 , 48 , and 72 h. rna was extracted and used for northern blots . \n the fold changes of gene expression of each probe normalized to -actin is shown . b. northern blotting of genes exhibiting elevated expression in hc11 cells hybridized to rna from mouse mammary glands . \n the probes used in part a were hybridized to northern blots of rna extracted form mouse mammary glands at various stages of pregnancy and lactation . \n the rnas are from pregnancy days 10 , 12 and 16 ; lactation days 1 and 3 ; involution days 1 and 7 ; and np represents rna from non - pregnant mammary glands of adult female mice . \n the blots were hybridized to -actin as a loading control . c. hc11 cells undergoing lactogenic differentiation . \n control = untreated cells , dip = cells exposed to dip for 5 days . \n top panel : cells at magnification 200x ; bottom panel : cells at magnification of 500x elevation of gene expression following stimulation of hc11 cells with dip regulation of gene expression in hc11 cells undergoing lactogenic differentiation . to determine the effect of lactogenic differentiation on gene transcription in hc11 cells oligonucleotide microarrays representing 20280 genes ( nia 20 k arrays from agilent technologies ) were hybridized with rna from dip treated hc11 cells . \n the rna was labeled with cyanine 5-ctp and control rna was labeled with cyanine 3-ctp . \n fluorescent crna was synthesized and hybridized in the differentiation experiments ( n = 5 ) as described in materials and methods . \n analysis of gene expression was performed using brb - array tools version 3 . in the hc11-dip versus hc11-control rna experiments , \n the first 2479 genes were significant at the nominal 0.05 level of the paired t - test , and 998 genes met the 2-fold change criteria . \n table 1 shows the first 50 genes with elevated expression in cells undergoing lactogenic differentiation genes exhibiting decreased expression following stimulation of hc11 cells with dip decreased gene expression in hc11 cells undergoing lactogenic differentiation . \n rna from hc11 cells undergoing lactogenic differentiation and hc11 control cells was analyzed for changes in gene transcription using oligonucleotide microarrays as described in the legend of table 1 . \n the results in table 2 show the genes with significantly decreased expression in hc11 cells undergoing lactogenic differentiation elevated expression of hormone - regulated genes , genes associated with cell cycle control or cell survival and tissue reorganization during lactogenic differentiation of hc11 cells the genes induced during lactogenesis included transcriptional regulatory factors , proteins involved in growth control and survival , tissue re - organization and proteins important for milk production . \n several previous studies performed on mouse mammary gland tissue reported alterations in the expression of genes that impact numerous pathways ( clarkson and watson 2003 ) ( gass et al . \n the majority of the studies examined changes in gene expression using rna that was derived from the multiple cell types making up the mammary glands . in the present study \n therefore , while our findings confirm many of the findings of previous studies , all the changes reported are restricted to epithelial cells . \n hence , some of the differences between hc11 cells and mammary tissue may be attributed to the lack of stromal or immune cell components in our analysis . \n some examples of the functional divisions represented among dip - regulated genes are included in table 3 . \n many of the changes relate to milk protein production , but transcription factors and regulators , genes for growth control and tissue reorganization are well represented as are genes regulated by glucocorticoids and prolactin . \n up - regulated genesprolactin regulated nm_008843prolactin induced protein nm_009972casein betadexamethasone regulated nm_011361serum / glucocorticoid regulated kinase nm_010286glucocorticoid - induced leucine zipper \n nm_010217ctgf / ccn2 nm_010730.1annexin a1milk production : including carbohydrate and lipid metabolism nm_019739.1fox o1 af378830.1prostaglandin - endoperoxide synthase 2 nm_013467alcohol dehydrogenase family 1 , subfamily nm_007607carbonic anhydrase 4 nm_007621.1carbonyl reductase 2 nm_009128.1stearoyl - coenzyme a desaturase 2 nm_025436.1sterol - c4-methyl oxidase - like nm_145942.13-hydroxy-3-methylglutaryl - coenzyme a synthase 1 nm_008084.1glyceraldehyde-3-phosphate dehydrogenase bc038392.1atpase , h+ transporting , lysosomal bc019207.1low density lipoprotein receptor nm_019703.1phosphofructokinase , platelet nm_134469.1farnesyl diphosphate synthetase nm_013820.1hexokinase 2 nm_010687.1like - glycosyltransferase nm_009270.1squalene epoxidase u12330.1sterol regulatory element binding factor nm_028803.1glucan ( 1,4-alpha- ) , branching enzyme 1 nm_007408.1adipose differentiation related protein xm_131456.2solute carrier family 31 , member 1 nm_011400.1solute carrier family 2glucose transporter ) nm_008489lipopolysaccharide binding proteinapoptosis nm_022032.1perp , p53 apoptosis effector nm_138578.1bcl2-like nm_026217.1autophagy 12-like u05989.1par-4 nm_019745.1programmed cell death 10 nm_013492.1clusterincytoskeleton , extracellular matrix , membrane structure nm_146120.1gelsolin nm_009071.1rho - associated coiled - coil kinase 1 xm_132485.1ras - related c3 botulinum substrate bc037116.1adducin 3 ( gamma ) nm_013470.1annexin a3 nm_011313.1s100 calcium binding protein a6 ( calcyclin ) bc013248.1kinesin family member 5b xm_130768.1laminin , alpha 5 nm_130448.1protocadherin 18 nm_007404.1adam-9 ( meltrin gamma ) d67076.1adamts-1 nm_009263.1secreted phosphoprotein / ostepontin nm_010217ctgf / ccn2 nm_010728.1lysyl oxidase nm_009983.2cathepsin d nm_144554.1claudin 4 bc038280.1caveolin , caveolae protein , 22 kda nm_016900.caveolin 2transcription factors and regulators nm_011461spi - c ets transcription factor xm_123496.1tcfcp2-related transcriptional repressor 1 nm_011803.1cpebp nm_057211.1kruppel - like factor 9 nm_019739.1fox o1 nm_010907.1inhibitor of nfkbgrowth control and signaling nm_007669.1cdk inhibitor 1a ( p21 ) nm_007635.1cyclin g2 nm_008960.1phosphatase and tensin homolog nm_010515.1insulin - like growth factor 2 receptor nm_021099.2kit oncogene nm_007918.1eukaryotic translation initiation factor 4e binding protein 1 nm_009721atpase , na+/k+transporting , beta 1 poly bc009155.1microsomal glutathione stransferase 1 nm_010884.1n - myc downstream regulated 1 nm_019971.1pdgf , c polypeptide nm_011057pdgf , b polypeptide nm_012671.1transforming growth factor alpha nm_011338small inducible cytokine a9 nm_011944mapkk nm_012519.1calcium / calmodulin - dependent protein kinase ii , delta af378830.1prostaglandin - endoperoxide synthase 2 bc038069.1igfbp5 bc002092.1v - maf oncogene family , protein gthe functional division of genes transcriptionally regulated in hc11 cells undergoing lactogenic differentiation . \n the list of genes that exhibit elevated expression in hc11 cells undergoing lactogenic differentiation are categorized in functional divisions . \n the list does not include all genes with 2-fold or greater increase and some genes are listed in more than one categorygenes exhibiting significant changes in expression as a result of dip - stimulation of hc11 cells were selected for analysis by northern blot to confirm the results obtained by microarray ( fig . \n 1a ) . the use of northern blotting for this aspect of the study allowed confirmation of the size of the mrna in addition to the amount of rna . \n northern blots of hc11 cell rna from cells stimulated with dip for 0 to 72 h were hybridized with specific probes as well as a probe for actin . \n following hybridization the results were quantified using a -scanner and the fold changes in expression were obtained by normalization to -actin expression . \n the normalized data revealed a positive correlation between the fold changes obtained in the microarray and the northern blot ( fig . 1 ) . \n the expression of target genes was also analyzed by real - time pcr and the results support those obtained by northern blot . \n these data clearly demonstrated the significant increase in ctgf / ccn2 and spp1/osteopontin gene expression following lactogenic stimulation of hc11 cells.to ascertain if the genes detected in the array analysis were similarly regulated in the mouse mammary gland in vivo rna from pregnant and lactating mouse mammary glands was analyzed . \n northern blots containing rna from non pregnant , pregnant , lactating and involuting mouse mammary gland tissue were hybridized to probes encoding genes differentially expressed in dip - stimulated hc11 cells . \n 1b indicate that a number of the genes exhibit modest increases in expression during pregnancy and lactation . \n a number of the genes tested in this way , excluding -casein , were also expressed in non - pregnant mammary glands but little or no expression of the specifc rnas was detected during postlactation involution of the mammary gland.ctgf/ccn2 can be induced by dexamethasone in chondrocytes and renal epithelia . \n hence , further studies explored the steroid regulation of ctgf / ccn2 expression in hc11 cells . \n while treatment of hc11 cells with dexamethasone induced expression of ctgf , neither estrogen nor progesterone produced the same result and ctgf / ccn2 expression was not dependent on tgf in these cells ( wang et al . \n the realtime pcr results in fig . 2 demonstrate that the glucocorticoid receptor antagonist ru486 efficiently blocked ctgf / ccn2 expression in response to dexamethasone confirming the function of the steroid hormone in the hc11 cells . \n our additional studies demonstrated that ctgf / ccn2 is required for hc11 lactogenic differentiation and that ectopic expression of ctgf / ccn2 enhances differentiation in hc11 cells as well as in primary mouse mammary epithelial cell cultures ( wang et al . \n hc11 mammary epithelial cells were grown to confluence and stimulated with dexamethasone ( dex)(1 m ) in serum - containing media in the presence of insulin . \n ru486 at varying concentrations or vehicle ( ethanol ) was added to cells alone or in combination with dexamethasone . \n rna was isolated and levels of ctgf and actin rna were determined by realtime pcr . \n these dex+ru486 values represent statistically significant difference ( p - value .001 ) from the dex alone condition functional division of lactogenic differentiation - regulated genes the functional division of genes transcriptionally regulated in hc11 cells undergoing lactogenic differentiation . \n the list of genes that exhibit elevated expression in hc11 cells undergoing lactogenic differentiation are categorized in functional divisions . \n the list does not include all genes with 2-fold or greater increase and some genes are listed in more than one category ctgf / ccn2 expression is regulated by dexamethasone in hc11 cells . \n hc11 mammary epithelial cells were grown to confluence and stimulated with dexamethasone ( dex)(1 m ) in serum - containing media in the presence of insulin . \n ru486 at varying concentrations or vehicle ( ethanol ) was added to cells alone or in combination with dexamethasone . \n rna was isolated and levels of ctgf and actin rna were determined by realtime pcr . \n these dex+ru486 values represent statistically significant difference ( p - value .001 ) from the dex alone condition regulation of gene expression by egf during lactogenic differentiation in hc11 cells egf , or other potent mitogens , are required for the proliferation and development of competency of hc11 cells to differentiate ( marte et al . 1995a ; merlo et al . 1994 ; taverna et al . 1991 ) . \n however , the inclusion of egf , other mitogenic growth factors or expression of transforming oncogenes in hc11 cells blocks lactogenic differentiation ( cerrito et al . 2004 ; hynes et al . 1990 ; marte et al . 1995a \n ; merlo et al . 1996 ; peterson and haldosen 1998 ) . to examine the effect of egf on the dip - induced expression pattern of the hc11 cells \n was extracted from hc11 cells induced to differentiate with dip and from hc11 cells stimulated with dip containing 10 ng / ml egf . \n rna from dip plus egf treated cells was labeled with cyanine 5-ctp , and rna from dip - treated cells was labeled with cyanine 3-ctp . \n the analysis of gene expression revealed that in egf plus dip versus dip experiments 1129 genes are significant at the nominal 0.05 level of the paired t - test , and 128 genes met the 2-fold change criteria . \n table 4 shows the partial list of genes for which expression was regulated by egf in the presence of dip . \n many of the genes expressed at higher level in the egf plus dip - stimulated cells are known targets of egf signal transduction pathways or are associated with malignant growth , for example cyclin d1 and osteopontin . \n table 4partial list of genes transcriptionally regulated by egf ( dip + egf ) versus dipexpression elevated in dip+egfmean log ratiogb accdescription2.63nm_009263.1secreted phosphoprotein 12.54nm_016980.1ribosomal protein l52.52af378830.1prostaglandin - endoperoxide synthase 22.46nm_008972.1prothymosin alpha2.35nm_009121.1spermidine / spermine n1-acetyl transferase2.33nm_019682.1dynein , cytoplasmic , light chain 12.32bc006739.1catenin beta2.31nm_133777.2ubiquitin - conjugating enzyme e2s2.30nm_023372.1ribosomal protein l38 ( rpl38 ) , transcript variant 22.29nm_007631.1cyclin d12.28bc010581.1stathmin 12.28xm_134967.2eukaryotic translation elongation factor 1 alpha 12.27nm_031165.1heat shock protein 82.27nm_022891.1ribosomal protein l232.26nm_008305.1perlecan ( heparan sulfate proteoglycan 2)2.26nm_025592.2ribosomal protein l352.26nm_009608.1actin , alpha , cardiac2.26bc034257.1epithelial membrane protein 12.25nm_019703.1phosphofructokinase , platelet2.25xm_178595.1chromobox homolog 3 ( drosophila hp1 gamma)2.23nm_133834.1expressed sequence aa407306,2.23nm_009255.1serine ( or cysteine ) proteinase inhibitor , clade e,2.22bc010726.1phospholipase a2 , group vii ( platelet - activating factor)2.22nm_013261.1peroxisome proliferative activated receptor , gamma,2.22xm_129211.2phosphoserine aminotransferase2.21nm_010480.1heat shock protein , 12.21nm_025919.1ribosomal protein l11 ( rpl11)2.20xm_128846.2similar to 60 s ribosomal protein l17 ( l23)2.20bc012508.1set translocation2.20nm_145142.1hnk-1 sulfotransferase2.19nm_009076.1hypothetical pseudogene ribosomal protein l122.19nm_007961.1ets variant gene 6 ( tel oncogene)2.17ak021352.1riken cdna d730048j04 gene ( day10 lact mamm gland)2.17nm_028044.1calponin 3 , acidic2.16bc003308.1casein kinase 1 , delta2.15nm_011400.1solute carrier family 2 ( facilitated glucose transporter),2.14nm_008774.1poly a binding protein , cytoplasmic 12.14xm_135387.1similar to 40 s ribosomal protein s192.14bc002046.1ephrin a12.13nm_011218.1protein tyrosine phosphatase , receptor type , sigma2.13xm_126364.1similar to atp synthase , h + transporting , mitochondrialexpression lower in presence of egf 0.56nm_002747mapk4 0.59l25602.1bmp-2 0.59mannose-6-phosphate receptor transporter 0.59nm_011224.1muscle glycogen phosphorylase 0.59nm_011500.1striatin 0.58nm_021454.1cdc42 effector protein 0.57nm_010086.1adam24 0.56nm_008372.2interleukin 7 receptor 0.56u44955.1connexin 3 0.55nm_020496.1t - box 20 0.50bc033410.1eukaryotic translation initiation factor 4egenes exhibiting elevated or decreased gene expression in hc11 cells undergoing lactogenic differentiation in the presence of egf compared to hc11 lactogenic controls . rna from hc11 cells undergoing lactogenic differentiation in the presence or absence of 10 ng / ml egf was analyzed for changes in gene transcription using oligonucleotide microarrays as described in materials and methods . \n the results include genes exhibiting a greater than two - fold increase or significant decrease in the presence of egfconfirmation of the array results for a number of genes was performed by northern blotting . \n rna from undifferentiated hc11 cells or cells stimulated with either dip or dip plus egf was hybridized to probes for several differentially expressed genes . \n the genes that are transcriptionally activated by dip were generally unaffected by the inclusion of egf in the differentiation media . \n however , it was clear that the expression of cyclin d1 decreased during differentiation but it increased with inclusion of egf in the differentiation media . \n this finding reflects the increase in the level of cyclin d1 in the microarray analysis . \n 3northern blot results of selected on rna from hc11 mouse mammary epithelial cells undergoing lactogenic differentiation in the presence and absence of egf . \n 1a and then incubated in differentiation media containing dexamethasone ( 10 m ) , insulin ( 5 g / ml ) and prolactin ( 5 g / ml ) with or without egf ( 10 ng / ml ) for 0 or 72 h. rnas were extracted and used for northern blot with the probes indicated . \n the blots were hybridized to -actin as a loading control partial list of genes transcriptionally regulated by egf ( dip + egf ) versus dip genes exhibiting elevated or decreased gene expression in hc11 cells undergoing lactogenic differentiation in the presence of egf compared to hc11 lactogenic controls . \n rna from hc11 cells undergoing lactogenic differentiation in the presence or absence of 10 ng / ml egf was analyzed for changes in gene transcription using oligonucleotide microarrays as described in materials and methods . \n the results include genes exhibiting a greater than two - fold increase or significant decrease in the presence of egf northern blot results of selected on rna from hc11 mouse mammary epithelial cells undergoing lactogenic differentiation in the presence and absence of egf . \n 1a and then incubated in differentiation media containing dexamethasone ( 10 m ) , insulin ( 5 g / ml ) and prolactin ( 5 g / ml ) with or without egf ( 10 ng / ml ) for 0 or 72 h. rnas were extracted and used for northern blot with the probes indicated . \n several microarray studies have examined transcriptional control in mouse mammary epithelial cells undergoing lactogenic differentiation ( kelly et al . 2002 ; clarkson and watson 2003 ; rudolph et al . \n in addition , proteomics analyses have been used to examine changes at the level of the protein expression in differentiating hc11 cells ( desrivieres et al . \n our study analyzed mammary epithelial cell lactogenic differentiation and developed a global expression profile of hc11 cells undergoing differentiation using oligonucleotide microarrays . \n in addition , the changes in gene expression that occur as a result of mitogenic stimulation of hc11 cells undergoing lactogenic differentiation were analyzed . to qualify the accuracy of the microarray data \n both northern blot and real - time pcr techniques were used , and results showed very good correspondence . while numerous genes were regulated during differentiation ( table 1 ) , the analysis of expression in different functional pathways ( table 3 ) revealed some changes not previously observed either by proteomic studies of hc11 cells or by the analysis of the lactational switch in the mouse mammary gland . a number of proteins that regulate aspects of the extracellular matrix were expressed in differentiating hc11 cells . \n two members of the small integrin binding protein family , connective tissue growth factor ( ctgf / ccn2 ) and secreted phosphoprotein ( spp1/osteopontin ) were transcriptionally activated during lactational differentiation of hc11 cells suggesting that these proteins may play a role in extracellular matrix accumulation necessary for competence to undergo differentiation . \n ctgf / ccn2 , a ccn protein , is a cysteine - rich protein that can modulate numerous cellular responses including proliferation , chemotaxis , adhesion , migration , and extracellular matrix production ( perbal 2004 ; brigstock 2002 ; brigstock 2003 ; leask and abraham 2006 ) . \n ctgf / ccn2 promotes endothelial cell growth , migration , adhesion , and survival in vitro , and ctgf action in angiogenesis is mediated at least partly through interactions with integrins ( ivkovic et al . \n the expression of integrins is regulated during lactogenesis in mouse mammary gland ( kelly et al . \n profibrotic activity of ctgf / ccn2 is related to high levels in many fibrotic lesions , and ctgf / ccn2 is induced by and acts as a co - factor for transforming growth factor in the induction of fibrogenesis ( perbal 2004 ) . in our study , \n ctgf / ccn2 is highly up - regulated in differentiated hc11 cells , suggesting that it might play an important role in matrix signals required for differentiation . \n however , expression of ctgf / ccn2 in hc11 cells does not require tgf , its expression is induced by dexamethasone ( wang et al . \n moreover , ectopic expression of ctgf / ccn2 enhances hc11 lactogenic differentiation and depletion of ctgf inhibits differentiation ( wang et al . \n secreted phosphoprotein1(spp1)/ osteopontin is a secreted glycoprotein that is rich in aspartate and sialic acid residues ( craig et al . \n 1988 ) and contains functional domains for calcium - binding , phosphorylation , glycosylation , and extra - cellular matrix adhesion ( kazanecki et al . 2007 ) . \n osteopontin is associated with cartiledge and bone but has multiple molecular functions that mediate cell adhesion , chemotaxis , macrophage - directed interleukin-10 suppression , stress - dependent angiogenesis , prevention of apoptosis , and anchorage - independent growth of tumor cells ( mi et al . \n a substantial body of data has recently linked osteopontin with the regulation of metastatic spread by tumor cells ( hayashi et al . \n a number of genes that are transcriptionally activated in hc11 cells undergoing lactogenic differentiation are also regulated during skeletogenesis . \n a recent study identified a number of proteins that are elevated in hc11 lactogenic differentiation as runx2-regulated in developing skeleton including osteopontin , ctgf / ccn2 , and cccl9 ( hecht et al . 2007 ) . \n like ctgf expression , osteopontin levels are high in breast tumors that metastasize to the bone ( kang et al . \n if there is a connection between the expression of these small secreted proteins and the ability of metastatic breast tumors to target the bone environment remains to be conclusively determined , but they are readily transcriptionally activated in hc11 cells . \n the secreted osteopontin protein is also widely detected in plasma , urine and bile , and a recent study demonstrated that it is present in human milk ( nagatomo et al . \n 2004 ) . a variety of stimuli , including phorbol 12-myristate 13-acetate , 1,25-dihydroxyvitamin d , basic fibroblast growth factor , tumor necrosis factor- , interleukin-1 , interferon and lipopolysaccharide , elevated osteopontin expression \n however , whether osteopontin expression in hc11 cells is due to dexamethasone , prolactin , or insulin is not established , but osteopontin expression was enhanced by the addition of egf to the lactogenic hormone mix . \n other extracellular matrix proteins and proteins involved in tissue reorganization are induced during lactogenic differentiation of hc11 cells ( table 3 ) . \n in addition , an increase in expression of rac1 and rock were observed , relevant because a role for rac1 has been proposed in mammary epithelial cell differentiation ( akhtar and streuli 2006 ) . \n the regulation of key growth and cell cycle regulators plays an important role in the hc11 differentiation progression . \n hc11 cells undergo growth arrest during differentiation in part regulated by the decrease in cyclin d1 . \n there is a concurrent increase in p21 suggesting it is the potent cdk inhibitor contributing to control of growth arrest in hc11 cells in this system . \n while cyclin g2 increased following dip - stimulation it is likely that this is the result of glucocorticoid - mediated event ( vedoy and sogayar 2002 ) . \n our analysis detected alterations in the regulation of igfbp2 and igfbp5 in hc11 cells undergoing lactogenic differentiation in agreement with a previously reported finding ( phillips et al . \n lactogenic differentiation induced multiple gene transcription events , while egf blocked a number of these processes . \n for example , during lactogenic differentiation , the transcription element binding proteins ( klf4 , klf9 ) were induced , but were inhibited by egf . \n klf9 has been implicated as a transactivator of progesterone and estrogen - dependent transcription in endometrial epithelium , another hormonal responsive tissue . \n this provided , in part , an explanation of the large scale gene expression changes during lactogenic differentiation that were blocked by egf . \n numerous ribosomal protein transcripts were induced in both differentiation and egf blockage process , suggesting that these genes are not a target of the mitogen - induced inhibition . in conclusion , \n our data provide further insight into the signal transduction pathways and gene interactions in the hc11 mouse mammary epithelial cell line during lactogenic differentiation . \n below is the link to the electronic supplementary material . \n supplemental file ( docx 11 kb )", "role": "user" }, { "content": "mammary epithelial cells go through a series of developmental changes during pregnancy and lactation including proliferation , differentiation , secretion and apoptosis . \n hc11 mouse mammary epithelial cells , which undergo lactogen - induced differentiation in cell culture , were used to follow the changes in gene expression during this process . \n the expression profiles of over 20,000 genes were compared in hc11 cells undergoing lactogenic differentiation to non - differentiated cells using dna microarray analysis . \n greater than two fold changes were detected in 998 genes in the differentiated cells versus growth controls . \n several genes including ctgf / ccn2 exhibited greater than five - fold increase . \n validation of the gene expression pattern for more than twenty genes was performed . \n the results indicate the involvement of numerous genes and pathways in the differentiation of mouse mammary epithelial cells in culture and they identify genetic pathways associated with specific transcriptional regulation . \n in addition , the expression of a subset of genes regulated by lactogenic differentiation in hc11 cells , including ctgf / ccn2 and osteopontin , was examined in mouse mammary glands revealing expression during pregnancy and lactation that declined during involution of the glands . to probe the mechanism by which epidermal growth factor ( egf ) , a known inhibitor of lactogenic differentiation in hc11 cells , blocks lactogenesis , the hc11 cells stimulated with lactogenic hormone in the presence of egf were profiled . \n this data revealed egf regulation of a specific subset of genes including important cell cycle regulators . \n the studies confirm the value of expression profiling in defining gene transcription associated with differentiation of mammary epithelial cells.electronic supplementary materialthe online version of this article ( doi:10.1007/s12079 - 009 - 0047 - 5 ) contains supplementary material , which is available to authorized users .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the vision system is one of the first body parts exhibiting microcomplications and dysfunction , which is an important issue in modern diabetology . over 90% of patients with type 1 diabetes ( t1 dm ) of 15 years ' and longer duration show features of retinopathy , whereas in type 2 diabetes ( t2 dm ) approximately 5% are affected at the time of diagnosis [ 1 , 2 ] . \n the scale of the problem is extremely large , as among the 2.5 million of the polish diabetic population , the number of cases with diabetic retinopathy is estimated at 600,000 . thanks to the dynamic progress in the development of diagnostic methods and the use of modern appliances , diabetes is known to affect all the anatomical structures of the eyeball . \n apart from vascular changes , diabetes may also cause neurophysiological lesions [ 5 , 6 ] \n . functional changes of retinal neurons are detected by electro physiological tests , being a noninvasive and highly objectivediagnostic tool . \n quick detection of retinopathy and immediate implementation of appropriate treatment reduce individual and social expenses and improve life quality [ 79 ] . \n while preparing the project , we were aware of the necessity to distinguish risk groups at an early stage undetectable by standard methods . color vision disorders experienced by diabetic patients were already described in the 1980s and as shown by the study , they have been found to affect 8.6% of diabetic patients . \n disorders have been noted in the formation and transmission of s - cone signals , which may be associated with their high sensitivity to hypoxia . \n the dysfunction of the ops on the ascending arm of the b - wave in full - field erg responses has been emphasized . \n a relationship has been revealed between the reduction in the amplitude of the ops and longlasting diabetic retinopathy , especially the proliferative one [ 13 , 14 ] . however , very few studies have been concerned with functional alterations developing at an early stage , when no lesions can be seen in the fundus of the eye . \n the study objective was to find out , using the s - cone erg protocol , whether juvenile patients with t1 dm , with no visible lesions in the fundus of the eye , and with normal optic disc morphology reveal retinal dysfunction . \n we also wanted to determine if the disease duration and metabolic control affect neurophysiological conduction in the outer layers of the retina . \n in addition , we analyzed the concentration levels of adm as a protective factor , vegf as a known marker of hypoxia , and il-17 . \n reports in recent years have mainly concentrated on il-17 , emphasizing its proinflammatory nature and involvement of th17 cells that produce it in the pathogenesis of diabetes and other endocrinopathies and allergic diseases . \n apart from diabetes , elevated levels of il-17 in the serum and affected tissues have been reported by patients with rheumatoid arthritis , psoriasis , multiple sclerosis , and systemic lupus erythematosus . \n its proangiogenic activity is known from research on cancer immunology [ 15 , 16 ] . \n two subgroups were distinguished as follows : subgroup i : 22 patients with diabetes of 5 10 years ' duration . \n subgroup i : 22 patients with diabetes of 5 10 years ' duration . \n the inclusion criteria for the diabetic group were age 818 years , normal routine eye test results ( best corrected visual acuity , color vision , slit lamp examination , and fundus examination ) , and negative history of the present illness that might affect the function of the retina and optic nerve . \n the exclusion criteria included patients with chronic diseases , eye disorders that might affect the retinal function and optic nerve , and electrophysiological testing . \n the inclusion criteria for the control group were age 818 years , normal routine eye test result , and negative history of the present illness known to affect the function of the retina and optic nerve . \n thirty - two patients with t1 dm ( including 19 from subgroup i , 13 from subgroup ii ) and 8 from the control group underwent the following . \n ( 1 ) first is light adapted blue flash ( 440 nm wavelength ) erg with increasing flash intensity 0.1 , 0.2 , and 0.5 ( cd s / m ) on the constant amber background ( 300 ph cd / m , 494 nm wavelength ) . the stimulus duration was 4 ms and 10 responses were averaged and repeated twice . \n the ergs were recorded simultaneously from both eyes with the use of dtl electrodes placed in the lower fornix . \n all erg tests were performed on espion e system ( diagnosys , llc , usa ) . \n they also underwent ( 2 ) biochemical investigations : hba1c , lipid profile , il-17 , vegf , and adm , using the immunoenzymatic elisa method ( r&d and eiaab kits ) . \n laboratory tests were performed in the department of laboratory diagnostics , children 's university hospital in biaystok , during routine diagnostic procedures and in the laboratory at the department of pediatrics , endocrinology , diabetology with cardiology division , children 's university hospital . \n the parents gave a written consent , whereas the children expressed a spoken consent before examination . \n the statistical analysis was performed using the statistica 10.0 software ( cracow , statsoft ) . \n all probability values were two - tailed , and a value of p < 0.05 was considered statistically significant . \n all patients included in the study had full far and near visual acuity and clear ocular media . \n a comparison of the mean values in the study group ( all diabetic patients ) and control showed a statistically significant reduction in the amplitude of the s - cone erg b - wave in the group of 64 eyes for the 0.2 cd s / m ( 9.0 6.0 v versus 13.0 5.0 v ; p = 0.01 ) stimulus and for the 0.5 cd s / m ( 18.0 8.0 v versus 24.0 10.0 v ; p = 0.0084 ) stimulus . \n no significant deviations were noted in the wave amplitude or latency prolongation for the s - cone erg a - wave and b - wave . in subgroup \n i ( 38 eyes ) , a statistically significant decrease was observed in the amplitude of the s - cone erg b - wave for 0.2 cd s / m ( 8.0 6.0 v versus 13.0 5.0 v ; p = 0.0065 ) and 0.5 cd s / m ( 17.0 8.0 v versus 24.0 10.0 v ; p = 0.010 ) . \n i n subgroup ii ( 26 eyes ) , a significant drop in the b - wave amplitude was found only for the 0.5 cd s / m stimulus as compared to the control group ( 18.0 8.0 v versus 24.0 10.0 v ; p = 0.048 ) . a comparison between subgroup i and subgroup ii did not show any significant effect of diabetes duration on the amplitude and latency of the s - cone erg a- and b - waves . \n all diabetic patients had higher levels of tch , ldl , tg , and il-17 as compared to healthy subjects , that is ( 175.0 37.0 mg / dl versus 158.0 18.0 mg / dl ; p = ns ) ( 95.0 29.0 mg / dl versus 84.0 16.0 mg / dl ; p = ns ) ( 85.0 51.0 versus 74.0 35.0 mg / dl ; p = ns ) ( 17.0 3.0 pg / ml versus 16.0 2.0 pg / ml ; p = ns ) , respectively \n . they also showed higher levels of sbp ( 114.0 9.0 mmhg versus 110.0 11.0 mmhg ; p = ns ) as compared to healthy children . \n the mean level of vegf was significantly higher in diabetic patients , yet without statistical significance ( 362.0 237.0 versus 273.0 142.0 pg / ml ; p = ns ) . \n a statistically significant finding was that adm level in this group was lower than in the control ( 36.0 27.0 versus 58.0 32.0 pg / ml ; p < 0.05 ) . a comparison between subgroup i and control revealed significantly lower adm values ( 27.0 22.0 versus 53.0 29.0 \n we observed higher levels of tch , ldl , and tg ( 181.0 47.0 versus 158.0 18.0 mg / dl ; p = ns ) ( 97.0 34.0 versus 84.0 16.0 mg / dl ; p = ns ) ( 92.0 69.0 versus 74.0 35.0 mg / dl ; p = ns ) , respectively . \n the values of sbp were increased as compared to healthy subjects ( 114.0 10.0 versus 110.0 11.0 mmhg ; p = ns ) . \n vegf was considerably higher in the subgroup patients , yet without statistical significance ( 379.0 200.0 versus 273.0 142.0 pg / ml ; p = ns ) . \n the concentrations of il-17 were similar ( 16.0 2.0 versus 16.0 2.0 pg / ml ; p = ns ) . \n a comparison between subgroup ii and control showed significantly higher bmi values in diabetic patients ( 23.0 4.0 versus 20.0 3.0 ; p < 0.05 ) . \n previously , we noted unfavorable differences in lipid metabolism for tch , ldl , and tg ( 169.0 24.0 versus 158.0 18.0 mg / dl ; p = ns ) ( 93.0 24.0 versus 84.0 16.0 mg / dl ; p = ns ) ( 78.0 22.0 versus 74.0 35.0 mg / dl ; p = ns ) . \n also in this subgroup , adm appeared lower than in healthy subjects ( 39.0 23.0 versus 58.0 32.0 pg / ml ; p = ns ) . \n a tendency of higher il-17 and vegf levels was confirmed in diabetic patients as compared to the control group ( 18.0 4.0 versus 16.0 2.0 pg / ml ; p = ns ) ( 342.0 278.0 versus 273.0 142.0 pg / ml ; p = ns ) . in multiple regression analysis , \n b - wave amplitude for the impulse 0.2 cd s / m demonstrated a significant inverse relationship with vegf ( r = 0.38 , coefficient = 0.25 , p < 0.04 ) and ldl ( r = 0.38 , coefficient = 0.45 , p < 0.00002 ) . in multiple regression analysis , \n b - wave amplitude for the impulse 0.5 cd s / m yielded significant inverse findings with hba1c ( r = 0.43 , coefficient = 0.42 , p < 0.003 ) and ldl ( r = 0.43 , coefficient = 0.84 , p < 0.00004 ) . in multiple regression analysis , b - wave implicit time for 0.5 cd s / m demonstrated significant inverse relationship with hdl ( r = 0.31 , coefficient = 0.25 , p < 0.04 ) and positive relationship with il-17 ( r = 0.31 , coefficient = 0.33 , p < 0.008 ) . \n numerous studies have confirmed the correlation between metabolic control and the incidence of diabetes - associated visual complications . among them , wisconsin epidemiology study , berlin retinopathy study , the early treatment diabetic retinopathy study , and the united kingdom prospective diabetes study have focused on the natural course of diabetic retinopathy [ 11 , 1719 ] . in 2003 , younis et al . investigated the annual and overall prevalence of any sign of diabetic retinopathy , maculopathy , and vision - threatening diabetic retinopathy in patients with t1 dm and t2 dm , who underwent screening tests . \n there is evidence that vision - threatening diabetic retinopathy has a detectable occult stage or an early symptomatic phase . \n the collected scientific data suggest that neurophysiological alterations in the retina are already present in the initial stages of diabetes [ 6 , 21 ] . \n we confirmed the impact of the disease and poor metabolic control measured by the percentage of hba1c on the responses obtained from the s - cone erg prior to clinical symptoms of retinopathy . \n diabetic children were found to show a significant reduction in the s - cone erg b - wave amplitude with stimuli 0.2 cd s / m , as compared to healthy subjects . \n previously , it was indicated that the alterations in the electric activity of the middle layers of the retina , that is , in bipolar cells , horizontal cells , and muller 's cells , were present in the course of diabetes [ 13 , 21 ] . \n the s - cone erg applied in our study shows the activity of the s - cones ( blue - sensitive ) , which are characterized by the maximum sensitivity to the short - wavelength part of the light spectrum and account only for 10% of the whole population of cones and less than 1% of the entire population of all retinal receptors . \n data are available indicating selective damage to the transduction pathway that begins in the s - cone and leads to discrete disturbances in color recognition , called tritanopia , which has not been fully explained yet . \n it seems that the s - cones are particularly sensitive to hypoxia involved in the pathophysiology of diabetes - associated alternations . \n apart from the impaired metabolism of retinal neurotransmitters , scientists also point at the role of enhanced premature apoptosis or defective tightness in the blood - retinal barrier . \n plasma protein migration accompanying this disorder may have an impact on the degree of absorption and/or light dispersion , causing a reduction in light reception by cones . \n moreover , some of these proteins , including the non - enzymatic glycosylated ones , absorb ultraviolet light [ 4 , 6 , 2225 ] . \n the erg findings are similar to those reported by mcfarlane et al . in the assessment of the b - wave amplitude . \n in contrast to the above , we found no a- wave or b - wave delay . \n however , even the reduction of photopic negative response of s - cone amplitude itself suggests functional alterations in the inner layers of the retina that attenuates the quality of the s - cone impulse . \n the multivariate regression analysis shows a negative correlation between hba1c and the height of b - wave amplitude , which is observed for the most intense light pulse ( 0.5 cd s / m ) . as indicated in table 2 , \n the b - wave amplitude values for the stimulus differ significantly in both groups of diabetic children in comparison with the control group . \n this suggests that the highest diagnostic value , in the search for early functional changes in the retina , pulses with intensity of at least 0.5 cd s / m . \n our results are consistent with the data reported by authors who have assessed bioelectric activities of the retina by means of other electrophysiological methods [ 2631 ] . \n a direct comparison of the results is difficult due to the use of different equipment , protocols , and group sizes . \n however , the common conclusion that can be drawn from these studies is that the objective neurotransmission disorders can appear in diabetic patients who still have normal eye fundus . \n they are known to be involved both in the initial and proliferative phases of the process . \n however , no major factor has been found responsible for the stimulation of neovascularization in diabetic eye disease . \n the current study indicates the key role of vegf , whose increase is one of the exponents of endothelial dysfunction , leading to increased permeability of the blood- tissue barrier ; hence , its former name is vascular permeability factor [ 3234 ] . \n the regulation of vegf gene expression is stimulated mainly by hypoxia [ 35 , 36 ] . \n high level of vegf has been noted in the vitreous humor in retinopathy patients and in many eye disorders presenting with local hypoxia and neovascularization [ 3739 ] . \n we found a tendency to higher serum levels of vegf in diabetic patients as compared to the control , irrespective of diabetes duration . \n it can be assumed that the increased level of vegf reflects endothelial dysfunction which appears earlier than the structural changes observed by ophthalmoscopy within the vascular walls . \n this author performed a prospective observation , showing a correlation between serum vegf and the risk of nephropathy in diabetic patients . \n he proved that the maintenance of the increased serum level of vegf facilitates the identification of patients with normal arterial blood pressure and normoalbuminuria , who are predisposed to the development of permanent microalbuminuria later in life . \n an interesting hypothesis can be derived from reports on the significant increase in vegf in the immunocytochemical analysis of nonvascular eye cells in diabetic patients , even , like in our study , with no signs of retinopathy [ 41 , 42 ] . \n considering the bioelectric disorders in the s - cone erg , this would suggest that retinopathy originates in retinal neurons and glial tissue and only later affects blood vessels . \n our observations in the context of the data already collected on vegf allow a wider perspective as to the role of this protein in the pathogenesis of visual complications of diabetes . \n further studies are necessary to precisely determine the mechanisms linking vegf to retinopathy . in the last years \n , adm has been found to have a potentially beneficial effect on the hemodynamics and neurohormonal regulation of the circulatory system . \n this protein has been detected not only in the cells of the adrenal medulla , but also in other tissues including smooth muscle cells , vascular endothelium cells , and retinal pigment epithelial cells . \n the collected data indicate a link between adm and pathophysiological processes in diabetes accompanied by elevated levels of adm , especially in advanced complications [ 4345 ] . \n on the other hand , increased adm can be associated with reduced renal clearance of this protein in the development of nephropathy , even though it is metabolized in the pulmonary circulation [ 46 , 47 ] . \n this peptide is thought to be engaged in antiregulatory mechanisms , by preventing vasoconstriction , increasing natriuresis , and inhibiting platelet aggregation . \n hence , the hypothesis that the level of adm reflects endothelial activation is additionally supported by a positive correlation observed between camp and adm , a second line transmitter involved in the regulation of the circulatory system [ 48 , 49 ] . in 1999 , that is , 6 years after adm identification , taniguchi et al . \n were the first to present the effect of adm on the eye , especially ciliary body and cornea , and thus on the regulation of intraocular pressure . \n pigment epithelial cells also produce and secrete adm , which stimulates back the proliferation of these cells . \n udono et al . claimed that levels of adm in the vitreous humor of patients with vitreoretinal proliferations were significantly higher in patients with proliferative diabetic retinopathy . \n a few years later , the same author proved in vitro that hypoxia increases adm expression in the human pigment epithelial cell line and that the use of exogenous adm increases survival of the cell line exposed to hypoxia , thus confirming a beneficial effect of this protein on retinal metabolism . \n the data suggest that adm may be involved in the pathogenesis of diabetic retinopathy , especially that retinal arteries have been recognized as its uptake point . \n thus , our observation of decreased serum adm in children with diabetes of less than 10 years ' duration , especially in the context of a weaker response in the s - cone erg and higher serum levels of vegf , lipids , and higher blood pressure , seems surprising , even though a substantial increase in the level of adm has been demonstrated only in patients burdened with overt retinopathy , microalbuminuria , or renal failure . \n our study , however , does not exclude a local increase in the level of adm , for example , in eye tissues , before its rise in the serum ; in patients with diabetes > 10 years ' duration , the level of adm is already higher . taking into account the negative correlation between adm and hba1c in the 10 years ' subgroup , \n an alternative hypothesis suggests that increased adm in diabetes is a late effect associated with progressing vascular endothelial dysfunction . \n it should be emphasized that our study group consisted of children , mainly adolescents , who were in the period of intensive hormonal changes , which undoubtedly affected the circulatory system . \n the fact is that the level of adm in diabetes undergoes changes even in the pediatric population and that their direction and significance require further investigations . \n still very few studies , mainly performed on the animal models of autoimmune diabetes , indicate a disorder in il-17 , which can have a significant impact on the course of the disease . also , clinical studies based on human material indicate a serious disturbance in the cell population in t1 dm . the few available studies concerning children with t1 dm \n therefore , in further elucidation of the importance of th17 and il-17 cells in t1 dm , \n interesting may seem the studies that evaluate the role of il-17 from an early clinical stage to a later period ( after the end of remission ) and thus assess the importance of the initiation and modulation of the inflammatory response and in consequence the effect on the disease and disclosure of complications . \n it is believed that il-17 may play a major role in the cytokine network regulating immune responses , inflammatory responses , or angiogenesis . \n it is possible that il-17 is indirectly involved in these reactions through the effect on the expression of other more targeted cytokines . \n has shown that il-17 is an angiogenesis mediator , acting directly on endothelial cells and through other lymphokines with angiogenic properties . \n this can be confirmed by the common direction of changes obtained in our study in the levels of il-17 and vegf . since il-17 is involved in the pathogenesis of many diseases described above and their complications , its regulation provides new diagnostic , prognostic , and therapeutic potentials . \n since we found that the s - cone visual pathway is affected in adolescent patients with type 1 diabetes and without evidence of retinopathy , the s - cone erg test may be a useful marker of early stage of inner retinal damage . \n our results indicate that the short - wavelength abnormalities detected in t1 dm before the onset of retinopathy originate in the retina . \n the changes observed in the levels of adm , il-17 , and vegf support their possible involvement in the microvascular complications of diabetes . \n different than expected results in adm concentration in group i indicate that further in vivo studies are needed to clarify the role of adm in this process . \n we believe that our findings may help elucidate the mechanisms of retinopathy in order to protect the eyesight in young diabetic patients .", "role": "user" }, { "content": "the study objective was to assess chosen biochemical parameters of blood and bioelectric function of the retina in patients with t1 dm . \n the study group consisted of 41 patients with t1 dm with no signs of diabetic retinopathy . \n the control group included 21 pediatric patients . \n we performed ( 1 ) s - cone erg testing with retina response stimulation in both eyes at the luminance of 0.1 , 0.2 , and 0.5 ( cd s / m2 ) with the 440 nm blue flash and light application of the amber background ( 300 ph cd / m2 , 495 nm wavelength ) , ( 2 ) anthropometric measurements , ( 3 ) biochemical investigations : il-17 , vegf , and adm by the elisa method . \n a comparison of the erg results with biochemical investigations indicates a likely correlation between the worsening of retinal bioelectric function and vegf levels growing with diabetes duration . \n we showed a negative correlation between adm and hba1c and described possible causes of adm reduction observed in subgroup i. we demonstrated the presence of bioelectric retinal dysfunction already before the diagnosis of diabetic retinopathy , which provides new possibilities in the diagnosis of preclinical chronic complications of diabetes . \n the changes observed in the levels of il-17 , adm , and vegf suggest their involvement in the diabetic pathogenesis of eye diseases .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: topiramate introduced as an anti - epileptic drug is increasingly being used in the treatment of numerous psychiatric conditions \n . acute myopia and acute angle - closure glaucoma are serious but rare side - effects of the drug . \n cases have been reported to occur within two weeks of starting topiramate in the normal therapeutic range for indications such as epilepsy and migraine.[26 ] no known literature recognizes this in context of its use in psychiatric conditions.if unrecognized , cases of permanent vision loss may occur . \n we present a case of bilateral acute angle - closure glaucoma occurring within one week of initiatingtherapy with topiramate for alcohol de - addiction , which to the best of the authors knowledge is the first case to be brought to the notice of psychiatrists and when recognized shows the importance of early detection and treatment . \n a case of a 40-year - old man brought by wife for de - addiction treatment for history of alcohol consumption since 20 years has been presented . \n de - addiction program was initiated and patient was put on oral chlordiazepoxide 50 mg / day and topiramate 100 mg / day during hospital stay . \n patient was better at discharge but presented to psychiatric outpatient department one week later , reportedly compliant on treatment and abstaining from alcohol , with complaints of watering , redness , and foreign body sensation in both eyes since one week with diminution of vision and increased eye pain since one day . \n ophthalmological examination of both eyes revealed the following : conjunctival chemosis , corneal edema , anterior chamber shallow , pupil 4 mm dilated , not reacting to light , lens clear , visual acuity 6/24 and 6/18 , intraocular pressure ( iop ) 48 and 46 mm hg with hazy disc on fundoscopy and gonioscopy showing closed angles . \n topiramate was stopped and the following drugs were added : t. acetazolamide 250 mg 1 - 1 - 1 - 1 t. chlordiazepoxide 25 mg 0 - 0 - 1 t. benalgis 75 mg 1 - 0 - 1 timolol eye drops 2.5% 1 - 0 - 1 prednisolone eye drops 1 - 1 - 1 on stopping topiramate and taking antiglaucoma measures , patient 's symptoms decreased and repeat examination showed the following findings on day 2 : lid edema decreased , conjunctival chemosis decreased , cornea clear , visual acuity 6/12 and 6/12 with best corrected visual acuity 6/6 in both eyes , and iop 17 and 20 mm hg . \n patient was discharged on request and follow - up after 1 week confirmed the patient 's recovery . \n topiramate is a sulfamate - substituted monosaccharide which acts predominantly byblocking voltage - gated sodium channels . \n topiramate initially introduced as an antiepileptic drug has shown efficacy in many psychiatric conditions such as bipolar disorder , eating disorders , tourette 's disorder , and alcohol dependence . \n oral topiramate reduces the consequences of drinking and has been shown to improve the quality of life in alcohol - dependent individuals . \n serious side effects with topiramate are rare , but distressing ocular adverse events such as bilateral angle - closure glaucoma , myopia , and suprachoroidal effusions have been recorded.[1316 ] the mechanism of action of topiramatecausing bilateral angle - closure glaucoma has beenattributed to ciliochoroidal effusion which causes forward rotation of the lens iris diaphragm leading to secondary angle - closure . in a study by fraunfelder \n acute - onset glaucoma was documented in 86 patients , predominantly in females ( 80% ) . \n it occurs with doses ranging from 50 mg to more than 100 mg.[1921 ] this patient was initiated on 50 mg / day topiramate and built up to 100 mg / day during the hospital stay . \n patient whose ocular history was otherwise unremarkable , presented one week later with symptoms characteristic of angle - closure glaucoma , with examination confirming the diagnosis . also , as mentioned earlier , studies have recorded that this adverse event is likely within first two weeks of initiation of topiramate therapy . \n computed tomography scan of brain showed no relevant findings that could account for the sudden loss of vision . \n our patient improved dramatically by the second day following withdrawal of topiramate and addition of antiglaucoma medication . on follow - up , the patient had no fresh complaints and was maintaining well . \n naranjo 's and who 's assessment scales were used to assess the certainty of suspected adverse drug event . \n both the scales showed that it is probable / likely that topiramate ( drug ) induced glaucoma ( adverse event ) in this patient.modified hartwig and siegel adverse drug reaction ( adr ) severity assessment scale showed moderate ( level 3 ) severity . using modified schumock and thornton 's criteria for preventability of an adr , \n topiramate - induced bilateral angle - closure glaucoma was found to be definitely preventable on the basis of there being a known treatment for the adverse event . \n this implies that early identification along with early institution of treatment may prevent the initial symptoms from developing into a full - fledged adverse event , thus reducing the patient 's distress , hospital stay , and economic burden . \n topiramate - induced angle - closure glaucoma is an idiosyncraticreaction and can occur in otherwise normal eyes with normal anterior chamber angles . \n it is not known to be dose - dependent , with one study reporting it at a dosage of 25 mg / day . \n patients commencing topiramate should therefore beadvised to immediately report any symptoms of eye pain or blurred vision , especially in the first few weeks oftreatment . \n this case report records the serious adverse event possible on oral topiramate therapy for the indication of alcohol de - addiction . to the best of the author 's knowledge , \n this is the first reported case of adverse event of topiramate used for a psychiatric condition . \n this report brings to light the severity of the adverse event caused by topiramate and consequently the burden on the patient and family . \n review of the existing literature also makes one aware of the lack of identification of a high - risk group in whom such a severe adverse event may occur and hence it falls on the clinician to make the patient and family aware of the possible side effects and immediate hospitalization in case of warning signs and symptoms .", "role": "user" }, { "content": "to report oral topiramate - induced glaucoma and to asses its severity and preventability . a 40-year - old manpresented with watering , redness , pain , and diminution of vision of both eyes , \n one week after initiation of oral topiramate 100 mg / day for alcohol de - addiction . on examination , both eyes showed conjunctival chemosis , corneal edema , shallow anterior chamber , and intraocular pressure 48 and 46 mm hg . \n the symptoms and clinical findings resolved completely upon discontinuation of topiramate and administration of antiglaucoma drugs . \n topiramate - induced angle - closure glaucoma and other ocular side effects are reversible if the diagnosis is made early and the drug is discontinued in time . \n hence , clinician awareness is an important aspect of preventability of this adverse event .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cleaning and shaping of the root canal system is an essential part of root canal therapy . \n the primary goals of cleaning and shaping are thorough debridement of the root canal system and specific shaping of root canal preparation , while maintaining the original canal configuration and optimal canal form . \n however , this is difficult in curved canals , where there is a tendency for all instrumentation techniques to change canal curvature and result in procedural errors . \n the evolution of nickel titanium rotary instrumentation and its metallurgy has resulted in reducing the procedural errors associated with root canal instrumentation and the time required to finish the preparation . \n the mtwo endodontic instruments introduced in 2005 have two blades and feature a large groove between them . \n furthermore , the increasing pitch allows a more delicate cutting action at the apex and a more aggressive one in the coronal portion . \n twisted file ( tf ; sybronendo , amersfoort , the netherlands ) , introduced in 2008 , has three unique design features : the r - phase heat treatment , twisting of the metal , and special surface conditioning . \n these features significantly increase the instrument 's resistance to fracture and provide greater flexibility . the profile gt series x ( gtx ; dentsply , tulsa dental specialties , tulsa , ok , usa ) , introduced in 2009 , is based upon m - wire technology . \n the open blade angles , variable width lands , in gtx files are reported to minimize taper lock in the canal as well as produce larger chip space between the cutting flutes and increase the cutting efficiency without transportation . \n revo - s ( rs ) , developed by micro - mega , offers apical finishing which is closely adapted to the anatomical and ecological criteria of the canal . \n there have been no studies published till date on the use of cone - beam computed tomography ( cbct ) to assess and compare the canal transportation , centering ability of mtwo files with that of rs files , tf , and gtx files in curved extracted mesiobuccal root canals of mandibular molars . \n thus , the purpose of this study was to evaluate and compare the canal transportation , canal centering ability , and time taken for preparation of curved root canals after instrumentation with mtwo files , rs files , tf , and gtx files by using cbct . \n forty extracted human mandibular first molars with an average length of 20 - 21 mm , curved mesial roots with two separate mesial canals and apical foramina were selected . \n teeth were accessed using an endo - access bur ( dentsply , maillefer ) , and the meisobuccal canals were localized and explored with a size 10 k - file ( dentsply , maillefer ) . \n distal roots with the respective part of the crown were sectioned at the furcation level and discarded . \n the determination of the working length was performed at magnification 8 using a surgical microscope by inserting # 10 k - file to the root canal terminus and subtracting 1 mm from this measurement . \n specimens were coded and randomly divided into four equal experimental groups ( n = 10 ) according to the rotary niti file system used in canal instrumentation : the rs group , the tf group , the gtx group , and the mtwo group . for all the groups , the root canal instrumentation was performed in accordance with the manufacturer 's recommendation for all the files . \n all the files were operated by a 16:1 gear reduction handpiece powered by electric torque control motor and the final apical preparation was standardized to size 30 with 0.06 taper . \n canals were irrigated with 3 ml of 5% naocl solution after use of each file . \n glyde ( dentsply , maillefer , ballagius , switzerland ) was used as a lubricant during instrumentation . \n final irrigation was done with 1 ml of 17% ethylenediaminetetraacetic acid for 1 min followed by a final flush of 3 ml of naocl . \n the roots were positioned in a custom - made specimen holder in which they were aligned perpendicularly to the beam and scanned before and after instrumentation using i - cat cbct scanner ( imaging science international , hatfield , pa , usa ) . \n the teeth were then scanned to determine root canal shape at 3 mm , 5 mm , 7 mm , 9 mm , and 11 mm from the apex . after obtaining scans from all specimens , \n the data from cbct were stored in magnetic optical disc . the shortest distance from the canal wall to the external root surface \n the distance was measured on the reconstructed 2-dimensional image without reduction by using the measure length tool . \n measurements were recorded before and after instrumentation to calculate the following : ( 1 ) the degree of canal transportation at each level according to the following formula : ( x1 x2 ) - ( y1 y2 ) ; ( 2 ) the canal centering ratio at each level according to the following ratio : ( x1 x2)/(y1 y2 ) or ( y1 y2)/(x1 x2 ) , where x1 is the shortest distance from the mesial edge of the root to the mesial edge of the uninstrumented canal , x2 is the shortest distance from the mesial edge of the root to the mesial edge of the instrumented canal , y1 is the shortest distance from the distal edge of the root to the distal edge of the uninstrumented canal , and y2 is the shortest distance from the distal edge of the root to the distal edge of the instrumented canal ; ( 3 ) the mean working time was recorded using an electronic stopwatch . \n the mean , standard deviation , minimum and maximum values were calculated for all the groups in terms of canal transportation , canal centering ability , and time taken for preparation . \n one - way analysis of variance ( anova ) with tukey 's honestly significant difference ( hsd ) was applied to make inter- and intra - group comparison of canal transportation , canal centering ability , and also the inter - group comparison of the time taken for preparation , using spss version 15.0 . \n forty extracted human mandibular first molars with an average length of 20 - 21 mm , curved mesial roots with two separate mesial canals and apical foramina were selected . \n teeth were accessed using an endo - access bur ( dentsply , maillefer ) , and the meisobuccal canals were localized and explored with a size 10 k - file ( dentsply , maillefer ) . \n distal roots with the respective part of the crown were sectioned at the furcation level and discarded . \n the determination of the working length was performed at magnification 8 using a surgical microscope by inserting # 10 k - file to the root canal terminus and subtracting 1 mm from this measurement . \n specimens were coded and randomly divided into four equal experimental groups ( n = 10 ) according to the rotary niti file system used in canal instrumentation : the rs group , the tf group , the gtx group , and the mtwo group . for all the groups , the root canal instrumentation was performed in accordance with the manufacturer 's recommendation for all the files . \n all the files were operated by a 16:1 gear reduction handpiece powered by electric torque control motor and the final apical preparation was standardized to size 30 with 0.06 taper . \n canals were irrigated with 3 ml of 5% naocl solution after use of each file . \n glyde ( dentsply , maillefer , ballagius , switzerland ) was used as a lubricant during instrumentation . \n final irrigation was done with 1 ml of 17% ethylenediaminetetraacetic acid for 1 min followed by a final flush of 3 ml of naocl . \n the roots were positioned in a custom - made specimen holder in which they were aligned perpendicularly to the beam and scanned before and after instrumentation using i - cat cbct scanner ( imaging science international , hatfield , pa , usa ) . \n the teeth were then scanned to determine root canal shape at 3 mm , 5 mm , 7 mm , 9 mm , and 11 mm from the apex . after obtaining scans from all specimens , \n the data from cbct were stored in magnetic optical disc . the shortest distance from the canal wall to the external root surface \n the distance was measured on the reconstructed 2-dimensional image without reduction by using the measure length tool . \n measurements were recorded before and after instrumentation to calculate the following : ( 1 ) the degree of canal transportation at each level according to the following formula : ( x1 x2 ) - ( y1 y2 ) ; ( 2 ) the canal centering ratio at each level according to the following ratio : ( x1 x2)/(y1 y2 ) or ( y1 y2)/(x1 x2 ) , where x1 is the shortest distance from the mesial edge of the root to the mesial edge of the uninstrumented canal , x2 is the shortest distance from the mesial edge of the root to the mesial edge of the instrumented canal , y1 is the shortest distance from the distal edge of the root to the distal edge of the uninstrumented canal , and y2 is the shortest distance from the distal edge of the root to the distal edge of the instrumented canal ; ( 3 ) the mean working time was recorded using an electronic stopwatch . \n the mean , standard deviation , minimum and maximum values were calculated for all the groups in terms of canal transportation , canal centering ability , and time taken for preparation . \n one - way analysis of variance ( anova ) with tukey 's honestly significant difference ( hsd ) was applied to make inter- and intra - group comparison of canal transportation , canal centering ability , and also the inter - group comparison of the time taken for preparation , using spss version 15.0 . \n the mean and standard deviation values for the canal transportation and the centering ratio at the studied levels for the experimental groups are presented in tables 1 and 2 , and the time taken for preparation in table 3 . at 3 mm , \n gtx showed maximum transportation and minimum canal centering ability ( 0.13 0.02 and 0.72 0.03 ) as compared to rs ( 0.12 0.02 and 0.73 0.03 ) , tf ( 0.08 0.02 and 0.83 0.03 ) , and mtwo ( 0.11 0.02 and 0.73 0.04 ) . meansd and statistical analysis of mean canal transportation values for the tested groups meansd and statistical analysis of mean canal centering ratio values for the tested groups statistical analysis of the mean values for the time taken for preparation ( seconds ) for the tested groups at 5 mm , rs showed significantly higher mean canal transportation and lower canal centering ability ( 0.14 0.02 and 0.70 0.04 ) than gtx ( 0.11 0.02 and 0.77 0.06 ) and tf ( 0.10 0.02 and 0.77 0.05 ) , while the difference between rs ( 0.14 0.02 and 0.70 0.04 ) and mtwo ( 0.12 0.02 and 0.73 0.04 ) was not significant . at 7 mm , tf showed significantly lower mean canal transportation and higher centering ability ( 0.15 0.02 and 0.69 0.04 ) , as compared to mtwo ( 0.17 0.02 and 0.60 0.03 ) , while the differences between tf ( 0.15 0.02 and 0.69 0.04 ) , gtx ( 0.16 0.02 and 0.64 0.02 ) , and rs ( 0.17 0.02 and 0.62 0.03 ) were not statistically significant . at 9 mm , \n tf showed significantly lower mean canal transportation and higher centering ability ( 0.13 0.02 and 0.76 0.03 ) , as compared to mtwo ( 0.16 0.02 and 0.71 0.04 ) , while the differences between tf ( 0.13 0.02 and 0.76 0.03 ) , gtx ( 0.14 0.02 and 0.75 0.03 ) , and rs ( 0.15 0.02 and 0.73 0.03 ) were not statistically significant . at 11 mm , tf had significantly lower mean canal transportation and higher centering ability ( 0.08 0.02 and 0.85 0.03 ) value as compared to rs ( 0.10 0.02 and 0.78 0.04 ) , while the differences between tf ( 0.08 0.02 and 0.85 0.03 ) , mtwo file ( 0.09 0.02 and 0.80 0.03 ) , and gtx file ( 0.08 0.02 and 0.82 0.03 ) were not significant . \n tf showed significantly lower mean preparation time ( 26.70 1.34 ) as compared to all other groups , while the differences between gtx ( 57.20 6.29 ) , rs ( 54.00 3.43 ) , and mtwo ( 56.00 2.45 ) were not significant . \n with increasing mechanization in endodontics , the use of ni ti rotary instrument is widespread . \n kandaswamy et al . have reported better canal centering ability of niti instruments as compared to stainless steel . \n therefore , the majority of reports on preserving original canal curvature have focused on niti instrument composition and design . \n rs , tf , gtx , and mtwo are the recently introduced file systems that are distinctly different in their geometric design and manufacturing method . \n hence , the purpose of this study was to compare the effect of these new niti rotary instruments on canal transportation and the centering ratio using cbct scanning . \n non - invasive cbct scanning was used because it provides an accurate , reproducible , 3-dimensional evaluation without the destruction of the teeth . \n apical preparation of all canals was set to size 30 and 0.06 taper in each instrument because khademi et al . \n reported that apical instrumentation with number 30 size and 0.06 coronal taper was effective for removal of debris and smear layer from the apical portion of root canals . \n five levels ( i.e. , at 3 mm , 5 mm , 7 mm , 9 mm , and 11 mm from the root apex ) were chosen for evaluation as they represent the apical and middle thirds of root canal in which curvatures exists and are highly susceptible to iatrogenic mishaps . in the present study , tf showed lower value of canal transportation and higher degree of centering ratio as compared to rs and mtwo , which could be attributed to the new manufacturing method of tf resulting in increased phase transformation temperatures and increased exibility of tf compared with the other niti instruments manufactured by grinding . also , the single length preparation in case of mtwo as compared to crown down preparation in case of tf might also have contributed to more canal transportation and lower canal centering ability of mtwo as compared to tf . \n , gergi et al . , and batouty et al . , who found that tf resulted in more centered preparation with less canal transportation than the other files systems tested . \n gtx files showed inferior overall average mean values of canal transportation and canal centering ability as compared to tf , but the difference in canal transportation value was significant only at 3 mm , while the difference in centering ratio was significant at 3 mm , 9 mm , and 7 mm . \n the comparable value of mean canal transportation and mean centering ability of gtx with that of tf might be due to a new m - wire technology used for manufacturing gtx instrument . \n this technology , along with thermal process imparts gtx instruments greater flexibility and increased resistance to cyclic fatigue , compared with files constructed from traditional niti alloy . \n similar findings were reported by hashem et al . , who also found no statistically significant difference in mean canal transportation of gtx and tf at 5.2 mm and 7.8 mm . \n gtx showed lower value of canal transportation and higher value of canal centering ability as compared to rs . \n the comparable apical transportation and mean centering ability of rs with gtx might be due to asymmetrical cutting profile of rs which facilitates penetration by a snake - like movement and offers a root canal shaping and apical finishing that is closely adapted to the anatomical and ecological criteria of the canal . \n hashem et al . have also reported that gtx showed lower canal transportation and higher canal centering ability than rs at 5.2 mm . \n gtx showed lower value of canal transportation and better centering ability as compared to mtwo . \n but the difference in canal transportation was not significant at all levels , while the difference in canal centering ratio was significant only at 9 mm . \n the comparable values of canal transportation and canal centering ratio of gtx and mtwo might be due to the single length preparation technique used in both groups and unique design of mtwo . \n have also reported lowest value for canal transportation as compared to protaper , k3 , and race . \n gtx showed maximum transportation and minimum centering ability at 3 mm as compared to all other groups . \n this might be due to the absence of intermediate size between size 20 with 6% taper and size 30 with 6% taper in the gtx file system . \n all other systems tested in the present study had an intermediate size 25 in their sequence , which might have resulted in their lesser transportation and higher centering ability at 3 mm . \n , who found that gtx recorded significantly higher mean canal transportation than rs and tf at 2.6 mm \n . there have been no studies published till date comparing canal transportation and centering ability of mtwo produced by traditional niti grinding process with the instruments produced by using the twisting method ( tf ) , rs , and m - wire alloy ( gtx ) . \n another interesting finding of the present study was that canal transportation at 3 mm of all ni ti rotary instruments tested was in the range of 0.08 - 0.17 . \n these values were considerably less than the critical canal transportation value of 0.3 mm as proposed by wu et al . , who found that leakage occurs more frequently when apical transportation index is > 0.3 mm . \n intra - group comparison showed maximum transportation and minimum canal centering ability at 7 mm and 9 mm across all groups , which is in accordance with previous studies . \n tf showed minimum time taken for preparation than gtx , rs , and mtwo . the significantly less time taken for preparation in tf \n as compared to rs , gtx , and mtwo might be due to less number of files and high speed of rotation used during instrumentation . \n however , there was no significant difference in the mean preparation time of gtx , rs , and mtwo . \n within the parameters of this study , it could be concluded that all the tested files showed some degree of apical canal transportation , but it was well within the acceptable limit ( 0.3 mm ) of canal transportation . \n the innovative method of manufacturing the tf system resulted in superior shaping ability in curved canals , with the instruments remaining more centered and producing less canal transportation than gtx , rs , and mtwo file systems .", "role": "user" }, { "content": "aim : the aim of this study was to compare the canal transportation , canal centering ability , and time taken for preparation of curved root canals after instrumentation with profile gt series x ( gtx ) files , revo - s files , twisted files , and mtwo files by using cone - beam computed tomography ( cbct).materials and methods : forty mesiobuccal canals of mandibular molars with an angle of curvature ranging from 20 to 40 were divided according to the instrument used in canal preparation into four groups of 10 samples each : gtx ( group i ) , revo - s ( group ii ) , twisted file ( group iii ) , and mtwo ( group iv ) . \n the teeth were instrumented according to manufacturer 's guidelines , with all groups being prepared to size 30 , 0.06 taper master apical file . \n canals were scanned using an i - cat cbct scanner ( imaging science international , hatfield , pa , usa ) before and after preparation to evaluate the transportation and centering ratio at 3 mm , 5 mm , 7 mm , 9 mm , and 11 mm from the apex . \n the data collected were evaluated using one - way analysis of variance ( anova ) with tukey 's honestly significant difference ( hsd ) test.results:twisted file system showed significantly least canal transportation and highest canal centering ability values as compared to gtx , revo - s , and mtwo file systems . \n overall , gtx , revo - s , and mtwo showed comparable results with respect to canal transportation and centering ability.conclusion:the innovative method of manufacturing the tf system resulted in superior shaping ability in curved canals , with the instruments remaining more centered and producing less canal transportation than gtx , revo - s , and mtwo file systems .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: chronic obstructive pulmonary disease ( copd ) has a major and growing impact on global health burden . in 2004 , copd accounted for 5.1% of deaths worldwide , with this proportion expected to rise to 8.6% by 2030 in line with the projected increases in tobacco use making copd the third leading cause of death.1 for the individual patient , copd imposes important and far - reaching limitations on the activities of daily life . \n data derived from the behavioral risk factor surveillance system and analyzed by the us center for disease control and prevention reveal extensive activity and work limitation among adults self - reporting copd.2 copd was associated with an almost 5-fold increase in inability to work , a 3-fold increase in activity limitation due to health problems and a > 3-fold increase in difficulty walking or climbing stairs . for many patients , \n the cycle is self - perpetuating , with a lack of physical activity fostering ongoing activity limitation in other aspects of daily life.2 activity impairment in copd is particularly pertinent , given that physical activity is a strong predictor of mortality in copd patients.3 the progression of symptoms and the subsequent reduction in daily activities contribute collectively to a gradual deterioration in the patient s health - related quality of life.4 it is not surprising that from the perspective of the patient , the improvement of symptoms and enhancement of ability to engage in the normal activities of daily living ( eg , family routine and , if applicable , work ) are desirable goals of copd management.4,5 a recent update to the global initiative for chronic obstructive lung disease ( gold ) strategy document placed an increased emphasis on symptom relief in copd by allowing symptomatic assessment to inform the choice of management strategy.5 in order to achieve this , gold recommended the use of validated and reliable questionnaires such as the copd assessment test ( cat ; glaxosmithkline , brentford , uk ) in routine daily clinical practice . \n the result is a patient assessment system that takes into account both the current impact of a patient s symptoms and their likelihood of having a serious exacerbation \n indicative of disease progression in the future , thereby individualizing the treatment strategy adopted . \n a previous study conducted in the usa showed that health care resource utilization ( hcru ) and associated costs for a group of 17,382 managed care patients with chronic bronchitis were substantial , despite the use of copd maintenance medications . \n the number of baseline exacerbations was a significant predictor of all - cause and copd - related total costs in this study , but data were not stratified according to symptom severity.6 the objectives of our study were : 1 ) to examine the proportion of patients with copd who had a symptomatic burden according to cat score and 2 ) to explore the association between symptomatic burden ( cat score ) and hcru , and work productivity and activity impairment ( wpai ) . \n data were derived from the disease - specific program ( dsp ) , a survey designed to provide impartial observations of routine clinical practice from a physician and matched patient perspective , with a view to improving standards of care.7 quantitative and qualitative patient and physician data together provide an accurate snapshot of the perception of a particular disease , without preselection of patients . \n the survey can be viewed as four discrete stages : 1 ) the screening and recruitment of primary care / specialist physicians ; 2 ) individual interviews with the physicians ; 3 ) the prospective completion , by the physician , of patient record forms for the next consecutive five patients with copd and 4 ) the return of patient self - completion records that were completed independently of their physicians.7 the adelphi respiratory dsps were surveys conducted in 2010 ( china ) and 2013 ( the usa and europe ) as market research adhering to the international chamber of commerce / european society for opinion and marketing research international code on observational research ; therefore , ethics approval was not necessary to obtain and was not sought . \n the patient population comprised adults aged > 40 years with confirmed airflow obstruction and a diagnosis of copd consulting for routine care . \n these criteria included patients with emphysema and chronic bronchitis and excluded patients with a concomitant diagnosis of asthma . \n although a copd diagnosis based on spirometry measurements is desirable , it is acknowledged that this is not always possible or recorded in routine clinical practice . \n all patients agreeing to participate in the survey completed a questionnaire that included the full cat questionnaire , with no influence or input from the physician or nurse . \n physicians were eligible for participation in the study if they had qualified within the last 535 years and were responsible for the treatment of patients with asthma and patients with copd . \n outcome variables were recorded directly by the patient or physician , or were derived from the patient questionnaire . \n descriptive variables included age , gender , race , body mass index , smoking status and history , employment status , comorbidities , most recent forced expiratory volume in 1 second ( fev1 , % predicted ) , current copd medications and the number of exacerbations in the last 12 months . \n physicians also provided hcru information pertaining to the number of patient visits for copd , either at their practice or elsewhere , and the number of exacerbations requiring hospitalization , within the last 12 months . \n patient questionnaire - derived variables included mean cat score and cat score range ( 09 , 1019 , 2029 and 3040 ) and the wpai questionnaire.8 wpai data were not collected for patients in the china cohort . \n data were analyzed collectively and as three separate regions : europe ( 5eu : france , germany , italy , spain and the uk ) , china and the usa . \n all analyses were performed using stata 13.1 ( stata statistical software : release 13 ; statacorp lp , college station , tx , usa ) . \n a regression approach was used to measure the association between cat scores and wpai scores or hcru variables , allowing for the inclusion of confounding variables ( eg , age , body mass index , smoking status and history , physician - confirmed diagnosis of depression , anxiety and serious cardiovascular conditions ) as covariates . \n where the hcru variable displayed signs of overdispersion , a negative binomial regression model was used . for all other variables , \n a poisson regression model was used . for all regression models , the coefficient and p - value ( wald test ) associated with the cat variable \n were used to determine the relationship between cat and the given hcru variable or wpai score . \n wpai assessments included only patients in europe and the usa who worked full time or part time . \n consistent with validated expression of wpai scores , results were expressed as percentages for four domains : work time missed ( absenteeism ) , work time impaired ( presenteeism ) , overall work impairment ( a combination of absenteeism and presenteeism ) and total activity impairment . \n data were analyzed using an ordinary least square regression model , with the four domains as dependent variables . \n the patient population comprised adults aged > 40 years with confirmed airflow obstruction and a diagnosis of copd consulting for routine care . \n these criteria included patients with emphysema and chronic bronchitis and excluded patients with a concomitant diagnosis of asthma . \n although a copd diagnosis based on spirometry measurements is desirable , it is acknowledged that this is not always possible or recorded in routine clinical practice . \n all patients agreeing to participate in the survey completed a questionnaire that included the full cat questionnaire , with no influence or input from the physician or nurse . \n physicians were eligible for participation in the study if they had qualified within the last 535 years and were responsible for the treatment of patients with asthma and patients with copd . \n the patient population comprised adults aged > 40 years with confirmed airflow obstruction and a diagnosis of copd consulting for routine care . \n these criteria included patients with emphysema and chronic bronchitis and excluded patients with a concomitant diagnosis of asthma . \n although a copd diagnosis based on spirometry measurements is desirable , it is acknowledged that this is not always possible or recorded in routine clinical practice . \n all patients agreeing to participate in the survey completed a questionnaire that included the full cat questionnaire , with no influence or input from the physician or nurse . \n physicians were eligible for participation in the study if they had qualified within the last 535 years and were responsible for the treatment of patients with asthma and patients with copd . \n outcome variables were recorded directly by the patient or physician , or were derived from the patient questionnaire . \n descriptive variables included age , gender , race , body mass index , smoking status and history , employment status , comorbidities , most recent forced expiratory volume in 1 second ( fev1 , % predicted ) , current copd medications and the number of exacerbations in the last 12 months . \n physicians also provided hcru information pertaining to the number of patient visits for copd , either at their practice or elsewhere , and the number of exacerbations requiring hospitalization , within the last 12 months . \n patient questionnaire - derived variables included mean cat score and cat score range ( 09 , 1019 , 2029 and 3040 ) and the wpai questionnaire.8 wpai data were not collected for patients in the china cohort . \n data were analyzed collectively and as three separate regions : europe ( 5eu : france , germany , italy , spain and the uk ) , china and the usa . \n all analyses were performed using stata 13.1 ( stata statistical software : release 13 ; statacorp lp , college station , tx , usa ) . \n a regression approach was used to measure the association between cat scores and wpai scores or hcru variables , allowing for the inclusion of confounding variables ( eg , age , body mass index , smoking status and history , physician - confirmed diagnosis of depression , anxiety and serious cardiovascular conditions ) as covariates . where the hcru variable displayed signs of overdispersion , a negative binomial regression model was used . for all other variables , \n a poisson regression model was used . for all regression models , the coefficient and p - value ( wald test ) associated with the cat variable \n were used to determine the relationship between cat and the given hcru variable or wpai score . \n wpai assessments included only patients in europe and the usa who worked full time or part time . \n consistent with validated expression of wpai scores , results were expressed as percentages for four domains : work time missed ( absenteeism ) , work time impaired ( presenteeism ) , overall work impairment ( a combination of absenteeism and presenteeism ) and total activity impairment . \n data were analyzed using an ordinary least square regression model , with the four domains as dependent variables . \n of 4,143 patients with copd for whom physicians completed patient record forms within the observation period , 2,166 agreed to participate and completed the patient self - completion records ( table 1 ) . \n the largest patient cohorts were from china ( 23.6% ) , the usa ( 19.1% ) and germany ( 16.8% ) . \n the mean ( standard deviation [ sd ] ) age of the entire study population was 65.1 ( 10.7 ) years ; 45.5% of the population were aged < 65 years and the majority ( 66.6% ) were male . while the majority of the population were retired ( 59.4% ) , nearly a quarter of them were still engaged in active employment ( 24.9% ) . \n most patients were current or ex - smokers ( 29.2% and 57.2% , respectively ) . \n the overall population had a mean ( sd ) number of 30.0 ( 23.9 ) pack - years , and the majority of patients had 10 pack - years ( 80.2% ) . \n a considerable number of patients surveyed ( 27.2% ) had a serious concomitant cardiovascular condition . \n the most frequently occurring comorbidities in this patient population included hypertension ( 55.8% ) , elevated cholesterol ( 27.0% ) and diabetes ( 15.5% ; table s1 ) . \n for the entire study population , the mean most recent post - bronchodilator fev1 was 61.9% of the predicted value ( table 1 ) . among patients surveyed in europe and the usa , \n 35.7% had experienced 2 exacerbations in the last 12 months that required treatment with oral corticosteroids and/or antibiotics , emergency department ( ed ) treatment and/or admission to hospital ( table 1 ) . among the three regions studied , \n the mean ( sd ) cat score was highest for china ( 24.4 [ 6.1 ] ) and similar for europe ( 20.5 [ 8.3 ] ) and the usa ( 20.3 [ 8.7 ] ; figure 1 ) . of the entire study population , \n 90.4% had a mean cat score of 10 and 62.3% had a mean cat score of 20 . \n almost all ( 98.2% ) of the patients surveyed in china had a mean cat score of 10 ( figure 1 ) . \n treatment with single short - acting therapy ( not specified as rescue or maintenance medication ) was currently prescribed to 5.9% of patients overall ( table 2 ) . in each region , a greater proportion of patients with a cat score of 09 were prescribed single short - acting therapy , compared with higher cat score groups ( table 2 ) . \n overall , treatment with maintenance bronchodilator monotherapy ( long - acting muscarinic antagonist [ lama ] or long - acting 2-agonist [ laba ] ) was currently prescribed to 18.3% of patients , with regional variations between single lama or laba use ( table 2 ) . in europe and the usa , where lamas alone were prescribed much more widely than in china , it was more common for only a lama to be prescribed to patients with cat scores of 09 or 1019 than to those with cat scores of 2029 and 3040 ( table 2 ) . \n regional differences were also found between prescription of maintenance bronchodilator dual therapy ( laba and lama ; table 2 ) . in europe , where use of this treatment was more common than in the other regions , prescribing was similar in each of the cat score groups ( table 2 ) . \n inhaled corticosteroid ( ics)/laba dual therapy was prescribed for a quarter of patients in the usa and china cohorts and 15.7% of the europe cohort , and was the most prescribed treatment in the china cohort ( table 2 ) . in the usa cohort , similar proportions of patients in each cat score cohort received ics / laba , whereas in china , half of the patients in the cat 09 cohort were using ics / laba , although the sample size was small ( n=9 ; table 2 ) . \n higher proportions of maintenance triple combination therapy ( ics plus lama and laba ) were found in the usa and europe cohorts ( where this was the most prescribed treatment approach ) compared with the china cohort . \n trends in triple combination prescription by cat score were different between regions , with similar proportions of prescriptions in all groups in the usa and increasing prescriptions in higher groups in europe and china ( table 2 ) . \n in contrast to europe and the usa where xanthines are not used , xanthines ( used as part of a combination therapy ) represented the second and fourth highest treatment strategy in china ( table 2 ; tables s2s4 ) . over the 12 months prior to the study period , surveyed patients reported an average ( sd ) of 6.6 ( 5.5 ) visits to their physician for their copd . \n primary care physician visits were the most frequent ( mean [ sd ] : 4.5 [ 4.8 ] ) , with pulmonologist visits and ed treatment / hospitalizations for exacerbations occurring a mean ( sd ) of 1.7 ( 1.9 ) and 0.4 ( 1.3 ) times , respectively ( table 3 ) . \n multivariate negative binomial regression modeling of hcru by cat score revealed a significant association between increased visits to a physician and increasing cat score . \n for each unit increase in cat score , the rate of visits to any physician in the last 12 months increased by a factor of 1.024 ( 2.4% ; p<0.001 ; table 4 ) . within this analysis , \n the number of primary care physician visits was significantly greater with increasing cat score ( incident rate ratio [ irr ] : 1.029 ; p<0.001 ) , as were pulmonologist visits ( irr : 1.012 ; p=0.007 ) . in the past 12 months , \n the number of exacerbations requiring ed treatment or hospitalization ( unscheduled hospital visits ) was significantly greater with increasing cat score ( irr : 1.112 ; p<0.001 ) . \n overall work impairment ( absenteeism and presenteeism combined ) , as quantified by mean wpai score , was 24.921.6 ( mean [ sd ] ; table 3 ) . \n over the 7 days prior to the study period , a significant association was observed between increasing absenteeism from work and increasing cat score ( coefficient : 0.445 ; p=0.002 ; table 4 ) . for each unit increase in cat score \n thus , an increase in cat score of 10 is associated with an increase in absenteeism of 4.5% points . over the same time period , \n a higher cat score was associated with impaired work time ( presenteeism ; coefficient : 1.680 ; p<0.001 ; table 4 ) . \n thus , for each unit increase in cat score , there was an increase in presenteeism of 1.68% points . \n likewise , loss of work productivity ( overall work impairment ) was significantly associated with increasing cat score ( coefficient : 1.739 ; p<0.001 ; table 4 ) . \n total activity impairment was also significantly associated with increasing cat score ( coefficient : 2.004 ; p<0.001 ; table 4 ) , so that for each unit increase in cat score , there was an increase in activity impairment of 2% points . \n of 4,143 patients with copd for whom physicians completed patient record forms within the observation period , 2,166 agreed to participate and completed the patient self - completion records ( table 1 ) . \n the largest patient cohorts were from china ( 23.6% ) , the usa ( 19.1% ) and germany ( 16.8% ) . \n the mean ( standard deviation [ sd ] ) age of the entire study population was 65.1 ( 10.7 ) years ; 45.5% of the population were aged < 65 years and the majority ( 66.6% ) were male . while the majority of the population were retired ( 59.4% ) , nearly a quarter of them were still engaged in active employment ( 24.9% ) . \n most patients were current or ex - smokers ( 29.2% and 57.2% , respectively ) . \n the overall population had a mean ( sd ) number of 30.0 ( 23.9 ) pack - years , and the majority of patients had 10 pack - years ( 80.2% ) . \n a considerable number of patients surveyed ( 27.2% ) had a serious concomitant cardiovascular condition . \n the most frequently occurring comorbidities in this patient population included hypertension ( 55.8% ) , elevated cholesterol ( 27.0% ) and diabetes ( 15.5% ; table s1 ) . \n for the entire study population , the mean most recent post - bronchodilator fev1 was 61.9% of the predicted value ( table 1 ) . among patients surveyed in europe and the usa , \n 35.7% had experienced 2 exacerbations in the last 12 months that required treatment with oral corticosteroids and/or antibiotics , emergency department ( ed ) treatment and/or admission to hospital ( table 1 ) . \n among the three regions studied , the mean ( sd ) cat score was highest for china ( 24.4 [ 6.1 ] ) and similar for europe ( 20.5 [ 8.3 ] ) and the usa ( 20.3 [ 8.7 ] ; figure 1 ) . \n of the entire study population , 90.4% had a mean cat score of 10 and 62.3% had a mean cat score of 20 . \n almost all ( 98.2% ) of the patients surveyed in china had a mean cat score of 10 ( figure 1 ) . \n treatment with single short - acting therapy ( not specified as rescue or maintenance medication ) was currently prescribed to 5.9% of patients overall ( table 2 ) . in each region , a greater proportion of patients with a cat score of 09 were prescribed single short - acting therapy , compared with higher cat score groups ( table 2 ) . \n overall , treatment with maintenance bronchodilator monotherapy ( long - acting muscarinic antagonist [ lama ] or long - acting 2-agonist [ laba ] ) was currently prescribed to 18.3% of patients , with regional variations between single lama or laba use ( table 2 ) . in europe and the usa , where lamas alone were prescribed much more widely than in china , it was more common for only a lama to be prescribed to patients with cat scores of 09 or 1019 than to those with cat scores of 2029 and 3040 ( table 2 ) . \n regional differences were also found between prescription of maintenance bronchodilator dual therapy ( laba and lama ; table 2 ) . in europe , where use of this treatment was more common than in the other regions , prescribing was similar in each of the cat score groups ( table 2 ) . \n inhaled corticosteroid ( ics)/laba dual therapy was prescribed for a quarter of patients in the usa and china cohorts and 15.7% of the europe cohort , and was the most prescribed treatment in the china cohort ( table 2 ) . in the usa cohort , similar proportions of patients in each cat score cohort received ics / laba , whereas in china , half of the patients in the cat 09 cohort were using ics / laba , although the sample size was small ( n=9 ; table 2 ) . \n higher proportions of maintenance triple combination therapy ( ics plus lama and laba ) were found in the usa and europe cohorts ( where this was the most prescribed treatment approach ) compared with the china cohort . \n trends in triple combination prescription by cat score were different between regions , with similar proportions of prescriptions in all groups in the usa and increasing prescriptions in higher groups in europe and china ( table 2 ) . \n in contrast to europe and the usa where xanthines are not used , xanthines ( used as part of a combination therapy ) represented the second and fourth highest treatment strategy in china ( table 2 ; tables s2s4 ) . over the 12 months \n prior to the study period , surveyed patients reported an average ( sd ) of 6.6 ( 5.5 ) visits to their physician for their copd . \n primary care physician visits were the most frequent ( mean [ sd ] : 4.5 [ 4.8 ] ) , with pulmonologist visits and ed treatment / hospitalizations for exacerbations occurring a mean ( sd ) of 1.7 ( 1.9 ) and 0.4 ( 1.3 ) times , respectively ( table 3 ) . \n multivariate negative binomial regression modeling of hcru by cat score revealed a significant association between increased visits to a physician and increasing cat score . for each unit increase in cat score , the rate of visits to any physician in the last 12 months increased by a factor of 1.024 ( 2.4% ; p<0.001 ; table 4 ) . within this analysis , \n the number of primary care physician visits was significantly greater with increasing cat score ( incident rate ratio [ irr ] : 1.029 ; p<0.001 ) , as were pulmonologist visits ( irr : 1.012 ; p=0.007 ) . \n in the past 12 months , the number of exacerbations requiring ed treatment or hospitalization ( unscheduled hospital visits ) was significantly greater with increasing cat score ( irr : 1.112 ; p<0.001 ) . \n overall work impairment ( absenteeism and presenteeism combined ) , as quantified by mean wpai score , was 24.921.6 ( mean [ sd ] ; table 3 ) . over the 7 days prior to the study period , a significant association was observed between increasing absenteeism from work and increasing cat score ( coefficient : 0.445 ; p=0.002 ; table 4 ) . for each unit increase in cat score \n thus , an increase in cat score of 10 is associated with an increase in absenteeism of 4.5% points . over the same time period , \n a higher cat score was associated with impaired work time ( presenteeism ; coefficient : 1.680 ; p<0.001 ; table 4 ) . \n thus , for each unit increase in cat score , there was an increase in presenteeism of 1.68% points . \n likewise , loss of work productivity ( overall work impairment ) was significantly associated with increasing cat score ( coefficient : 1.739 ; p<0.001 ; table 4 ) . \n total activity impairment was also significantly associated with increasing cat score ( coefficient : 2.004 ; p<0.001 ; table 4 ) , so that for each unit increase in cat score , there was an increase in activity impairment of 2% points . \n treatment with single short - acting therapy ( not specified as rescue or maintenance medication ) was currently prescribed to 5.9% of patients overall ( table 2 ) . in each region , a greater proportion of patients with a cat score of 09 were prescribed single short - acting therapy , compared with higher cat score groups ( table 2 ) . \n overall , treatment with maintenance bronchodilator monotherapy ( long - acting muscarinic antagonist [ lama ] or long - acting 2-agonist [ laba ] ) was currently prescribed to 18.3% of patients , with regional variations between single lama or laba use ( table 2 ) . in europe and the usa , where lamas alone were prescribed much more widely than in china , it was more common for only a lama to be prescribed to patients with cat scores of 09 or 1019 than to those with cat scores of 2029 and 3040 ( table 2 ) . \n regional differences were also found between prescription of maintenance bronchodilator dual therapy ( laba and lama ; table 2 ) . in europe , where use of this treatment was more common than in the other regions , prescribing was similar in each of the cat score groups ( table 2 ) . \n inhaled corticosteroid ( ics)/laba dual therapy was prescribed for a quarter of patients in the usa and china cohorts and 15.7% of the europe cohort , and was the most prescribed treatment in the china cohort ( table 2 ) . in the usa cohort , similar proportions of patients in each cat score cohort received ics / laba , whereas in china , half of the patients in the cat 09 cohort were using ics / laba , although the sample size was small ( n=9 ; table 2 ) . \n higher proportions of maintenance triple combination therapy ( ics plus lama and laba ) were found in the usa and europe cohorts ( where this was the most prescribed treatment approach ) compared with the china cohort . \n trends in triple combination prescription by cat score were different between regions , with similar proportions of prescriptions in all groups in the usa and increasing prescriptions in higher groups in europe and china ( table 2 ) . \n in contrast to europe and the usa where xanthines are not used , xanthines ( used as part of a combination therapy ) represented the second and fourth highest treatment strategy in china ( table 2 ; tables s2s4 ) . \n over the 12 months prior to the study period , surveyed patients reported an average ( sd ) of 6.6 ( 5.5 ) visits to their physician for their copd . \n primary care physician visits were the most frequent ( mean [ sd ] : 4.5 [ 4.8 ] ) , with pulmonologist visits and ed treatment / hospitalizations for exacerbations occurring a mean ( sd ) of 1.7 ( 1.9 ) and 0.4 ( 1.3 ) times , respectively ( table 3 ) . \n multivariate negative binomial regression modeling of hcru by cat score revealed a significant association between increased visits to a physician and increasing cat score . \n for each unit increase in cat score , the rate of visits to any physician in the last 12 months increased by a factor of 1.024 ( 2.4% ; p<0.001 ; table 4 ) . within this analysis , \n the number of primary care physician visits was significantly greater with increasing cat score ( incident rate ratio [ irr ] : 1.029 ; p<0.001 ) , as were pulmonologist visits ( irr : 1.012 ; p=0.007 ) . in the past 12 months , \n the number of exacerbations requiring ed treatment or hospitalization ( unscheduled hospital visits ) was significantly greater with increasing cat score ( irr : 1.112 ; p<0.001 ) . \n overall work impairment ( absenteeism and presenteeism combined ) , as quantified by mean wpai score , was 24.921.6 ( mean [ sd ] ; table 3 ) . over the 7 days prior to the study period , a significant association was observed between increasing absenteeism from work and increasing cat score ( coefficient : 0.445 ; p=0.002 ; table 4 ) . for each unit increase in cat score \n thus , an increase in cat score of 10 is associated with an increase in absenteeism of 4.5% points . over the same time period , \n a higher cat score was associated with impaired work time ( presenteeism ; coefficient : 1.680 ; p<0.001 ; table 4 ) . \n thus , for each unit increase in cat score , there was an increase in presenteeism of 1.68% points . \n likewise , loss of work productivity ( overall work impairment ) was significantly associated with increasing cat score ( coefficient : 1.739 ; p<0.001 ; table 4 ) . \n total activity impairment was also significantly associated with increasing cat score ( coefficient : 2.004 ; p<0.001 ; table 4 ) , so that for each unit increase in cat score , there was an increase in activity impairment of 2% points . \n in this study , the majority of patients with copd ( > 90% of the total population ) presented with a high symptom burden , based on the established threshold value of 10 on the cat.5,9 the mean cat score in our study was 21.3 ( median 22 ; 62.3% had a cat score 20 ) . \n this trend was particularly pronounced in china , with almost all of the patients surveyed presenting with a high symptom burden , and may reflect the country s health care system , where patient consultations typically occur in hospitals and are more suggestive of emergency care than routine visits . the cat cut - point for regular treatment based on symptoms \n is a score 10 , which may be too low to accurately distinguish patients based on the presence of a clinically meaningful symptom burden.5 the cut - point does correspond to the range of severity typically observed in patients recruited to clinical trials in copd.5 the distribution of cat scores observed herein serves to underline the differences between clinical trial populations and the patient populations that physicians may encounter in routine clinical practice . \n our decision to assess cat scores as a continuous variable from 0 to 40 was intended to capture more accurate information on the impact on hcru and work / activity impairment of progressively worse symptoms , and the apparent skewing of our data toward the upper end of the scale justifies such an approach . \n allowing for differences in the study populations , our findings are broadly consistent with those from a cohort of the copdgene study , which found that more patients were grouped within high symptom groups ( gold - b , 24.8% ; gold - d , 41.0% ) than low symptom groups ( gold - a , 29.4% ; gold - c , 4.9%).10 published data have shown that choice of symptom measure can alter the group assignment of patients with copd.11 indeed , a subsequent systematic review and meta - analysis of 17 studies in patients with copd confirmed that cat 10 and modified medical research council ( mmrc ) 2 are nonequivalent criteria for assessing symptom burden.12 it has been proposed that a lower mmrc - based threshold of grade 1 is equivalent to a cat score 10 cut - off when seeking to identify patients with low - symptom copd.13 further evidence for the high symptom burden among patients with copd comes from a global study14 reporting that while the majority of patients ( 62% ) were allocated to lower symptom groups ( mmrc 1 and 2 ) , the rates of exacerbation requiring hospitalization in the 12 months prior to assessment ( 27% in mmrc groups 1 and 2 ) exceed those reported in our study ( 19.6% ) , in which the burden of symptoms was notably higher . while we acknowledge that such differences may derive , in part , from reliance on patient - defined criteria for an exacerbation , rather than physician - defined criteria for an exacerbation , this observation does suggest that a high impact of symptoms on day - to - day life is not necessarily indicative of more serious exacerbation - related events . \n the study highlighted the disparity in treatment approaches between europe , the usa and china , although an exception was the large proportion of patients in each region receiving monotherapy or short - acting therapy only , which may not be adequate to provide optimal symptom control . \n triple combination therapy of ics , laba and lama appeared more widely adopted in the usa and europe than in china . \n this is despite being widely acknowledged as the current gold standard optimal inhaled therapy for patients with copd with more symptoms and high risk of exacerbation ( d classification).5 in line with these findings , a recent retrospective database review from taiwan showed excessive use of oral bronchodilators ( predominantly xanthines and 2-agonists ) in china.15 although not a specific objective of the study , our data suggest a disconnection between physicians prescribing practices and copd treatment guidelines . \n the reasons for this disparity can not be established from our data set , although in china , one barrier to effective provision of gold - recommended treatments has been identified as the self - administration of nonprescription medicines by individuals with copd.16 a particular focus of this study was translating the impact of increments in activity impairment on hcru and work productivity . \n jones et al reported that a cat score of 5 may prevent patients from performing one or two tasks and a score of 10 means that patients get exhausted easily and usually can not play sports , whereas a score > 30 prevents them from doing most of what they want to do.9 in our survey , increasing severity of copd symptoms was directly and significantly associated with hcru . \n for each unit increase in cat score , the rate of unscheduled visits to hospital related to an exacerbation increased by 11.2% . \n although establishing a causal relationship between the cat score and serious exacerbation risk was beyond the scope of the study , this association may serve as a useful marker of exacerbation risk in patients newly diagnosed in a primary care setting and in those perceived to be at low risk of exacerbation . \n a noteworthy observation was that while a statistically significant difference was seen in physician visits , the absolute increase in visits to either a primary care physician or a pulmonologist was small . \n one possible explanation is that patients were self - restrained by their symptoms , given their diagnosis of copd , and were therefore less inclined to seek medical attention . \n this sense of low expectation was also observed in the study by barnes et al , in which many patients ( 39% ) adopted a wait and see approach to an exacerbation before seeking medical help.14 one quarter of the patients in our survey were actively employed and , therefore , their ability to manage their activity impairment in order to continue working is an important factor not only for financial reasons but also for maintaining a feeling of well - being , self - worth and a sense of contributing to society . \n previous studies , conducted in us patient populations , have shown a link between hcru and/or wpai and the frequency of exacerbations.6,17,18 our study focused on symptom severity rather than exacerbations and showed that increasing cat scores were significantly associated with a loss of productivity related to absenteeism ( missed days of work ) and presenteeism ( attending work while sick ) . in addition , if a minimally important difference is taken to be ~7% , as suggested by research conducted in patients with crohn s disease,19 then this is achieved with only a difference of ~4 on the cat score for both overall wpai score and activity impairment . \n the risk of patient selection bias was a noted limitation of the study design ; however , the likelihood was limited by the prospective consecutive sampling approach adopted . \n this approach was contingent upon the integrity of the participating physician , and adherence to this instruction could not be verified . \n furthermore , as patients were enrolled from both a primary care and a specialist setting , this could potentially limit the generalizability of the findings . \n further research would be necessary to investigate the differences in outcomes between the specialties of the managing physicians . \n wpai data were not collected in china but were assessed in the european union and the usa , which together comprised the majority of patients ( > 75% ) . \n another potential limitation is the point - in - time nature of the cat , in which patients are asked for the current impact of their copd , whereas independent variables are reported over the last 12 months or 7 days . \n however , this may have reduced the likelihood of finding an association between symptoms at the present day and events over the preceding 12 months . as an outcome measure , \n the cat score was considered to provide a comprehensive assessment of a patient s symptom severity over the previous 12 months . \n this is consistent with the gold classification , whereby patients are assigned to a group based on their current cat score ; however , exacerbation risk is determined on the basis of the last 12 months . \n given the nonspecific time period of the items of the cat and the outpatient setting ( only 4.6% of patients were consulting the physician for a reason related to an exacerbation ) , their cat score can be considered representative of symptoms that extend further than just the current day . \n this further validates conclusions drawn from the correlation observed between more symptoms and higher hcru , such as serious exacerbation events . adjusting for confounding demographic variations , smoking history and selected comorbidities helped to further strengthen the significance of the specific association of inadequate symptom control with higher hcru and impact on work . \n our study provides important data that support an association between copd symptom burden and direct / indirect hcru , including physician visits and wpai . the majority of patients with copd presented with a high level of symptoms according to their cat score . \n a substantial proportion of these patients were receiving single short - acting or maintenance bronchodilator monotherapy , which may be indicative of an undertreated symptom burden that warrants an escalated pharmacotherapeutic intervention . \n increasing symptom burden was associated with increasing hcru and an overall detrimental impact on work productivity . \n patient comorbidity profile serious cv is defined as conditions such as angina and congestive heart failure and excludes the cv risk factors hypertension and hyperlipidemia ; concomitant conditions list is not exhaustive . \n abbreviations : 5eu , france , germany , italy , spain and the uk ; aids , acquired immunodeficiency syndrome ; cv , cardiovascular ; hiv , human immunodeficiency virus . \n current treatment by cat score domain in the usa triple therapy defined as a single laba , a single lama and a single ics therapy only . \n abbreviations : cat , copd assessment test ; copd , chronic obstructive pulmonary disease ; ics , inhaled corticosteroid ; laba , long - acting 2-agonist ; lama , long - acting muscarinic antagonist ; ltra , leukotriene receptor antagonist ; saba , short - acting 2-agonist ; sama , short - acting muscarinic antagonist . \n current treatment by cat score domain in europe triple therapy defined as a single laba , a single lama and a single ics therapy only . \n abbreviations : cat , copd assessment test ; copd , chronic obstructive pulmonary disease ; ics , inhaled corticosteroid ; laba , long - acting 2-agonist ; lama , long - acting muscarinic antagonist ; ltra , leukotriene receptor antagonist ; saba , short - acting 2-agonist ; sama , short - acting muscarinic antagonist . \n current treatment by cat score domain in china triple therapy defined as a single laba , a single lama and a single ics therapy only . \n abbreviations : cat , copd assessment test ; copd , chronic obstructive pulmonary disease ; ics , inhaled corticosteroid ; laba , long - acting 2-agonist ; lama , long - acting muscarinic antagonist ; ltra , leukotriene receptor antagonist ; saba , short - acting 2-agonist ; sama , short - acting muscarinic antagonist .", "role": "user" }, { "content": "backgroundchronic obstructive pulmonary disease ( copd ) can greatly impact the quality of life by limiting patients activities . \n however , data on impact of symptomatic burden on the health care resource utilization ( hcru ) and employment in copd are lacking . \n we examined the association between copd assessment test ( cat ) score and direct / indirect costs associated with hcru and work productivity.methodsdata from > 2,100 patients with copd consulting for routine care were derived from respiratory disease - specific programs in europe , the usa and china . \n questionnaires , including cat and work productivity and activity impairment ( wpai ) , were used to collect the past and current disease status data and hcru characteristics from physicians ( general practitioners / specialists ) and patients . \n a regression approach was used to quantify the association of cat with hcru and wpai variables . \n cat score was modeled as a continuous independent variable ( range : 040).resultsninety percent of patients with copd had a cat score 10 . \n short - acting therapy and maintenance bronchodilator monotherapy , respectively , were currently prescribed to patients with cat scores of 1019 ( 5.8% and 27.6% ) , 2029 ( 5.1% and 13.1% ) and 3040 ( 2.8% and 6.6% ) . \n prescribing of maintenance bronchodilator dual therapy was low across the cat score groups ( 09 , 7.8% ; 1019 , 6.4% ; 2029 , 5.9% ; 3040 , 4.4% ) , whereas maintenance triple combination therapy was prescribed more commonly in patients with higher cat scores ( 09 , 16.1% ; 1019 , 23.2% ; 2029 , 25.9% ; 3040 , 35.5% ) . increasing cat scores \n were significantly associated with a higher frequency of primary care physician visits ( p<0.001 ) , pulmonologist visits ( p=0.007 ) , exacerbations requiring hospitalization ( p<0.001 ) and wpai scores ( p<0.001).conclusionmost patients with copd presented with high symptom levels , despite being treated for copd . \n increasing symptom burden was associated with increasing hcru and had a detrimental impact on work productivity .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: infection with dengue virus ( denv ) causes dengue and severe dengue ( formerly dengue fever and dengue haemorrhagic fever ) . \n denv is an enveloped virus , and its genome consists of a positive polarity , single - stranded rna of around 11 kb that encodes ten proteins . \n denv can replicate in several types of cells , including dendritic cells , b and t lymphocytes , endothelial cells , hepatocytes , and neuronal cells . \n however , monocytes / macrophages are the primary target during in vivo infection . viral entry into these cells enables the virus to spread to different tissues and induces the presentation hla molecule - associated viral antigens . \n the presentation of viral antigens by macrophages to memory t cells induces t cell activation and , consequently , the proliferation and production of cytokines such as tnf- , ifn , and il-2 . \n this set of cytokines and chemokines induces endothelial dysfunction and plasma leakage , both of which are characteristic of more severe manifestations of the disease . \n several studies have addressed the relationship between human genes and the susceptibility to dengue virus infection . \n for example , the hla - a*0203 allele correlated with dengue fever ( df ) in thai children , while hla - a*0207 correlated with dengue haemorrhagic fever ( dhf ) . \n moreover , the alleles hla - b44 , b62 , b76 , and b77 confer protection against dhf in secondary infections . \n other polymorphisms associated with dhf have been found in the genes for dc - sign1 , tnf- , fc- receptors , vitamin d receptors , and mannose binding lectin [ 4 , 5 ] . \n in addition to these host factors , there is evidence that denv serotypes 2 and 3 cause dhf more frequently , supporting the belief that both host and virus factors can affect the clinical outcome of patients . \n recent studies have identified the oligoadenylate synthetase 1b ( oas1b ) gene as being responsible for susceptibility / resistance to west nile virus ( wnv ) infection in mice , and it is therefore a potential candidate gene for the flv locus [ 7 , 8 ] . \n these seminal works found a non - sense mutation ( c820 t ) in the oas1b gene , exon 4 , that was linked to susceptibility to wnv infection . \n this mutation replaces an arginine with a stop codon , producing a truncated protein lacking the c - terminal domain . \n knock - in of a normal oas1b allele induced resistance to yellow fever virus infection in a susceptible mouse strain , which was comparable to the resistance observed in resistant congenic mice . \n these results led to the conclusion that the oas1b gene conferred resistance against flavivirus infection . \n however , a neuronal cell line expressing the complete form of the oas1b protein showed only a slight reduction in virus yield and was not significantly different from the same neuronal cell line expressing the truncated form . likewise , transfecting cdna from the complete oas1b gene into susceptible embryonic fibroblasts did not induce a complete reversion to the resistant phenotype . \n together , these results suggest that murine resistance to flavivirus infection is not completely understood in vitro and that other cellular and animal models should be studied . \n this work evaluated the permissiveness to denv infection and evaluated the presence of the c820 t polymorphism in the oas1b gene obtained from different rodent species , including three strains of mouse , rat , hamster , and guinea pig . \n experiments with animals were approved by the universidad el bosque 's ethics committee following the national legislation . \n different 68-week - old rodent species were used and were obtained from the colombian national institute of health 's animal facility . \n the animals used were balb / c inbred mice ( mus musculus ) , nih swiss outbred mice , cd1 ( icr ) swiss outbred mice , syrian hamsters ( mesocricetus auratus ) , wistar rats ( rattus norvegicus ) , and hartley strain guinea pigs ( cavia porcellus ) . \n two millilitres of 1.5% carboxymethylcellulose was injected intraperitoneally into two animals from each species and this was done twice in different days . after 48 hours \n , the animals were euthanized , and a peritoneal wash was made with rpmi 1640 medium plus 10% foetal bovine serum , 100 u / ml penicillin , 10 g / ml streptomycin , and 2,5 g / ml amphotericin ( complete medium - cm ) . \n the medium was collected and centrifuged , and the cell pellet was then suspended in cm . then , 200,000 cells were seeded into 12-well culture dishes and 10,000 cells were seeded in 24-well culture dishes using round glass coverslips . \n nonadherent cells were removed 48 hours later , and the culture of adherent cells continued for a further 5 days to allow for cytokine clearance . \n the virus was obtained by infecting c6/36 ht cells with a denv serotype 2 ( col-789 ) isolate donated by dr . \n jairo mndez from the colombian institute of health 's virology group and titrated on llcmk-2 cells . \n the virus was placed in contact with the macrophages for 1 hour at 37c at a multiplicity of infection ( moi ) of 1 and 0.1 ; it was then removed , fresh medium was added , and the cells were kept for 24 , 48 , and 72 hours , at which time they were processed . a capsid gene fragment amplified from denv2 rna \n was used to construct a plasmid as published previously , and a dilution having 10 copies/l was prepared . \n rna was extracted from infected and uninfected macrophage supernatants and monolayers using trizol ls and trizol reagents , respectively , ( invitrogen ) and reverse - transcribed using the m - mlv enzyme and random primers . \n the sybr green and the geneamp 5700 sequence detection system ( perkin - elmer corporation ) were used for the real - time pcr assay . \n a denv capsid gene fragment was amplified using dv2c - l and dv2c - r primers . \n samples lacking cdna were used as negative controls , and cdna obtained from viral inoculums was used as positive controls . \n the data obtained from the monolayers were analysed using the relative quantification method based on the assumption of ideal amplification efficiency with a doubling product every cycle , followed by twofold changes in fluorescence intensity ( which could be calculated using the 2 formula ) and -actin as the housekeeping gene . \n absolute quantification was used for analysing the data obtained from the supernatants by producing a six - point standard curve ( 1010 copies/l ) from the pdv2core plasmid ( 1010 molecules ) that was obtained as previously described . \n this curve was simultaneously processed with the samples and evaluated 24 , 48 , and 72 hours p.i . \n data were analysed using anova and a least significant difference post hoc test and p < 0.05 was considered significant . \n two independent experiments were done , and two animals were used from each species in each one . \n independent duplicates of cells were seeded for each animal ( n = 8) ; each sample was processed by duplicate in qpcr experiments . infected and noninfected cells were fixed with 4% paraformaldehyde for the same defined periods and then permeabilised with 0.1% triton x-100 . \n infected cells were detected by using monoclonal antiflavivirus antibody ( chemicon , mab8744 ) . biotinylated anti - mouse igg antibody was used as the secondary antibody and detected with peroxidase - coupled streptavidin , and 0.05% diaminobenzidine and 0.01% h2o2 were used as the developing reagents . \n other cultures were incubated with biotinylated dutp and the tdt enzyme for detecting dna fragmentation ( as an apoptotic indicator ) ; after being washed , samples were incubated with cy3-coupled streptavidin . \n one - way anova was done , and when the overall anova resulted in a p value less than 0.05 , least significant difference ( lsd ) test was carried out for comparing infected cell counts and values from viral rna quantification . \n brain dna was obtained from each rodent species using phenol / chloroform extraction and precipitated with sodium acetate and ethanol . \n this dna was used to amplify an oas1b gene exon 4 fragment using oas-1br : 5-ctg gga gta tgg gag tcg ag-3 and oas-1bl : 5-gct gtt ggt gca ggt att ca-3 primers , which amplify the gene region between nucleotides 771925 . \n the number of viral copies released by the macrophages into the supernatant was quantified by real - time pcr analysis of the rna obtained from the supernatant of cells infected for 24 , 48 , and 72 hours at two different mois . \n figure 1(a ) shows that the viral copy number obtained from balb / c - derived macrophage supernatants infected with denv at an moi of 0,1 in all post - infection ( p.i . ) \n times was 425 times larger than that obtained from nih- and icr - derived mouse macrophages . \n the differences in the number of viral copies were significant at 24 and 48 hours p.i . \n ( p < 0.01 ) , while the number of viral copies obtained in balb / c - derived macrophages was similar to that obtained in nih- and icr - derived mouse macrophages at 72 hours . \n similar findings were established in macrophages from taxonomically different rodent species , such as rats , hamsters , and guinea pigs , where highly significant differences were found ( p < 0.01 ) . when the macrophages were infected at an moi of 1 ( figure 1(b ) ) , \n significant differences were observed 24 hours p.i . when balb / c donors were compared to nih mice , hamsters , and guinea pigs ( p < 0.01 ) . \n no difference in the viral copy number were found in the supernatants at 48 and 72 hours p.i . a larger number of viral rna copies were found in balb / c - derived macrophage supernatants from cells infected with an moi of 0.1 than with an moi of 1 ( figure 1(a ) versus figure 1(b ) ) . there were no differences among viral copies when the infection was carried out at an moi of 0.1 or 1 in the other animals ( p > 0.05 ) . \n relative rna viral quantitation was carried out from macrophage monolayers and showed that the amount of virus found in cells was proportional to the amount of virus released to the supernatant . \n the relative viral rna quantity was significantly larger in balb / c macrophages , from 4-fold ( balb / c versus hamster ) to 5400-fold ( balb / c versus icr ) higher at an moi of 0,1 , and from 4-fold ( balb / c versus hamster ) to 8100-fold ( balb / c versus icr ) at an moi of 1 ( p < 0.05 , see figure 2 ) . \n differences in relative expression levels were much more marked than the differences found in the absolute quantification of the supernatants . \n the data obtained from the other rodent species did not reveal any significant differences when comparing different mois , nor when comparing the three p.i times . with the exception of the lower relative viral rna levels found in nih mouse macrophages , the levels of viral rna tended to decrease as the p.i . \n immunocytochemistry was used to detect viral antigens in macrophages from the six different rodent species studied . \n as previously described , specific immunoreactivity was observed that corresponded to viral antigens in the infected cell cytoplasm ( having punctiform characteristics ) in the perinuclear region \n . a significantly larger number of infected macrophages was found in balb / c - derived macrophages compared with other rodent macrophage cultures ( figure 3(c ) ) . \n approximately 43% of the macrophages from balb / c mice inoculated with an moi of 1 showed evidence of infection 24 hours p.i . \n ; an 81% infection of macrophages was reached at an moi of 0.1 , but only at 72 hours p.i . \n infection percentages were much lower in cells from the other animals ( see table 1 ) . \n a large number of positively stained extracellular vesicles were also observed in balb / c - derived macrophages ( figure 3(b ) ) , but they were not observed in macrophages from other species ( figure 3(c ) ) . \n macrophages inoculated with denv at an moi of 1 presented a high percentage of dna fragmentation , as demonstrated by tunel . \n other than balb / c , the percentage of tunel - positive cells was similar to that found in control cells that had not been infected with denv ( table 1 ) . \n an interesting finding was that the apoptotic percentages in macrophages from balb / c mice inoculated with denv at an moi of 0,1 did not correlate with the percentages for denv - positive cells . while 79% of the cells had become infected 48 hours after - infection , \n only 8% were apoptotic ; the same phenomena occurred at 72 hours ( 81% versus 5% ) . \n analysing the sequences from the oas1b gene exon 4 fragment obtained from balb / c mouse genomic dna revealed that they were consistent with those reported previously [ 7 , 8 ] . \n the tga stop codon mutation inserts a premature translation stop in the oas1b gene in these mice . \n interestingly , the other rodent species analysed also had the c820 t mutation , which leads to the translation of a truncated protein in all cases . the sequences from this oas1b fragment from guinea pigs , hamsters , and nih and icr mice had not been previously identified and were reported to genbank ( cavia porcellus accession number ef081023 , rattus norvegicus accession number ef081022 , mus musculus nih strain accession number ef081021 , mus musculus icr strain accession number ef081020 , mesocricetus auratus accession number ef081019 , mus musculus balb / c strain accession number ef081018 ) . \n genetic markers for host susceptibility to infection could provide answers for questions concerning why not all individuals infected by denv become ill and why they do not all have similar symptoms if they do become ill . \n the clinical manifestations of dengue virus infection range from undifferentiated fever to severe systemic compromise , encephalitis , and haemorrhagic syndrome . \n the reason why infection with denv ( and the flavivirus in general ) causes clinical manifestations in only a small percentage of infected individuals remains unknown . \n however , it has been suggested that the host 's genetic factors could be involved . \n the resistance of some mice strains to infection by some flavivirus has been described since the beginning of the twentieth century ( reviewed in ) , and it was initially found that flavivirus resistance to infection was inherited as a dominant trait . \n it is known that the monocyte / macrophage system is the primary in vivo cellular target for denv , and the peritoneal macrophage model has also been used to study flavivirus resistance and susceptibility . in this work , it was found that macrophages from balb / c mice had higher permissiveness to denv2 infection using qpcr and immunocytochemistry . \n sequence analysis of the oas1b gene demonstrated that all four rodent species studied had the c820 t mutation , leading to the supposition that the production of a truncated protein by this genotype does not affect denv susceptibility . with the exception of balb / c mice , all rodent strains and species of macrophages studied have a low capacity to support denv2 replication because infection with the virus did not cause large amounts of rna to assemble or be released as virions . \n this finding could contradict the suggestion of a protective mechanism involving viral packaging , as has been previously proposed . \n the results found in nih mouse - derived macrophages could suggest that these cells not only have a cellular mechanism that reduces permissiveness but also have a more efficient viral clearance process . \n nevertheless , it is important to clear that these results are only relevant for dengue virus serotype 2 ; it is probable that different results could be found for other dengue serotypes . like other studies \n , we did find more viral copies in supernatants in any of the cultures that had been inoculated with an moi of 0.1 relative to those with an moi of 1 . \n brinton suggested that this finding could be due to the presence of defective interfering ( di ) particles found in greater amounts at a higher moi . \n the production of di particles could be facilitated by some mechanism in resistant cells , while highly susceptible cells will mainly produce infectious virus . in turn , this higher virus production leads to greater cell death in highly susceptible cells . \n the theory is supported by the work done by espina et al . , who used human monocytes as their model . \n despite the infected cell percentage in balb / c - derived macrophages is similar with both mois , infection at an moi of 1 induced a significantly higher number of tunel - positive cells . \n it seems that the infection of cells with a high moi activates proapoptotic molecular routes as a mechanism to block viral replication and dissemination during viral infection , thereby explaining this finding . \n however , the virus could be activating anti - apoptotic routes at a low moi and improving cell survival . \n it has been previously established that denv induces apoptosis in different cell types ( e.g. , endothelial cells , hepatocytes , dendritic cells , monocytes , and neuroblastoma cells ) . \n the proapoptotic mechanisms that are related to denv infection include apoptosis activation by the extrinsic route ( via ligands such as tnf- and apo2/trail ) and the intrinsic route ( described in neuroblastoma cells having phospholipase a2 activation , superoxide anion production , cytochrome c release , followed by caspase 3 activation ) . \n a mechanism related to apoptosis has not been previously proposed in work studying resistance and susceptibility to flavivirus infection . \n the results of the present study displayed a clear relationship between lower susceptibility to infection and decreased apoptosis . \n this finding suggests that the control of apoptosis - inducing mechanisms may represent a macrophage protection strategy in addition to it control of viral replication , a phenomenon that deserves more investigation . \n it would also be necessary to consider in the study of these cells susceptibility to dengue virus infection , the recent findings of kwan et al . \n , in which monocyte - derived dermal macrophages were capable of internalizing live denv but they displayed an inherent resistance to viral growth because virus particles accumulate into poorly acidified phagosomes , which prevents release of the nucleocapsid into the cytoplasm , and therefore its later replication . \n together , these results suggest an additional level of complexity in the genetic control of flavivirus replication . \n this work can conclude that balb / c mice macrophages had higher permissiveness to denv2 infection as it showed higher viral copies when measuring by using qpcr and immunocytochemistry . besides , sequence analysis demonstrated that balb / c , nih , and icr mice as well as rat , hamster , and guinea pig had the c820 t mutation in oas1b gene . \n it is needed to carry out more studies to clarify which is the molecular pathway involved in this higher permissiveness and if it is related to some apoptotic pathway .", "role": "user" }, { "content": "infection with dengue virus presents a broad clinical spectrum , which can range from asymptomatic cases to severe cases that are characterised by haemorrhagic syndrome and/or shock . \n the reason for such variability remains unknown . \n this work evaluated the in vitro permissiveness of mouse , rat , hamster and guinea pig macrophages to infection by dengue virus 2 ( denv2 ) . \n the results established that macrophages derived from the balb / c mouse strain showed higher permissiveness to denv2 infection than macrophages from other rodent species , although all rodent species studied had the c820 t mutation in the oligoadenylate synthetase 1b gene , indicating no relationship to the different in vitro susceptibilities of mouse cells at this locus . \n other molecular mechanisms related to flavivirus susceptibility remain to be explored .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: it accounts for 0.5% of all head and neck tumors occurring in 1 of 150,000 individuals \n . adolescents and young adults between 14 and 25 years are affected , and there is a distinct male predominance . \n recent reports suggest that the tumor is more common in the indian subcontinent than in the west . \n hippocrates first described this tumor in the 5 century b.c . in 1940 , friedberg called it juvenile angiofibroma . \n however , since a vast majority of the cases do occur between 14 and 25 years of age , this term is retained . \n the prevalence in males may be explained by high androgen receptor ( ar ) expression suggesting that jna is androgen dependent . \n type i includes lesions fundamentally localized to the nasal cavity , paranasal sinus , nasopharynx , or pterygopalatine fossa . \n type ii is a jna extending into the infratemporal fossa , buccal region , or orbital cavity with anterior and/or minimal middle cranial fossa extension but intact dura mater . \n type iii is a calabash - like massive tumor lobe in the middle cranial fossa . \n the histologic origin of jna involves vascular endothelial cells or fibroblasts . whether both components proliferate and grow together or one component is responsible for the growth and other \n efforts to determine the pathogenesis of the tumor have been done by studying the expression of various growth factors and oncogenes such as c - kit and c - myc . \n significantly higher immune staining with cd34 , vascular endothelial growth factor , flt-1 and flk-1 in jnf , when compared to orbital cavernous hemangiomas , indicates its vasoproliferative nature . \n this supports the hypothesis that the vascular endothelial cells may become postembryonic undifferentiated mesenchymal cells and can be induced into other mesenchymal nonhemopoitic cell phenotypes . \n loss of expression of gstm 1 ( null genotype ) is seen in this tumor . \n jna 's sex selectivity and the relatively young age at diagnosis suggest that its development is hormone dependent . \n several authors studied ars , progesterone receptors , and estrogen receptors ( ers ) in jna with discrepancies in the results . \n these discrepancies may be due to the monoclonal antibodies which detect only alpha - er and not the beta er protein . in spite of the reports of hormonal disorders in patients with jna and the presence of ar and/or ers in tumor tissues , no apparent alterations of serum hormone levels \n a 17-year - old male patient presented with a painless , progressive swelling in the upper jaw since 2 weeks . \n intraoral swelling was diffuse , obliterating the vestibule and extending from the lateral incisor anteriorly till the pharynx posteriorly [ figure 1 ] . \n computed tomography ( ct ) scan showed the presence of a soft tissue mass involving the maxillary sinus , nasal cavity , and nasopharynx . \n the mass extended superiorly from the skull base till the maxillary tuberosity and anteroposteriorly from nasal cavity till posterior wall of maxillary sinus [ figures 2 and 3 ] . \n intraoral view showing swelling on the upper left side of the maxilla and obliteration of the vestibule sagittal section in computed tomography scans showing site and extent of the lesion axial section in computed tomography demonstrating obliteration of the nasal cavity and maxillary sinus provisional diagnosis of nasopharyngeal angiofibroma , soft tissue tumor , nasopharyngeal polyp or vascular tumor was made . \n the excised gross specimen was soft to firm in consistency , white to yellow with darker vascular areas . \n no encapsulation was noted [ figure 4 ] . gross specimen showing tumor mass with vascular areas histopathological examination revealed a proliferative connective tissue stroma interspersed with a thick vascular network . \n numerous blood vessels with irregular size and shape were seen with a single lining endothelial cell layer . \n blood vessels were seen in large number at the periphery of the lesion [ figure 5 ] . \n connective tissue was fibro - cellular with irregular pattern and plump fibroblasts [ figure 6 ] . \n photomicrograph showing fibrocellular stroma and numerous blood vessels at the periphery ( h&e stain , 40 ) photomicrograph showing a staghorn appearance of the blood vessels ( h&e stain , 100 ) distribution of mast cells in the lesion ( toluidine blue stain , 40 ) \n although benign , it is a locally aggressive tumor and invades the surrounding tissues and even bone through pressure resorption . \n this tumor originates in the lateral wall of the nasal cavity , close to the superior border of the sphenopalatine foramen . \n the growth initiates in the submucosa of the floor of the nasopharynx extend to the nasal septum and the posterior space of the nose and causes airway obstruction . continuous growth involves the sphenoidal sinus , nasal fossa and middle turbinate , pterygomaxillary fossa and the posterior wall of the maxillary sinus as seen in the present case . eventually , the tumor may invade the infratemporal fossa and the middle cranial fossa . \n isolated case reports of angiofibromas arising outside the nasopharynx are noted , most commonly in the maxillary sinus ( 32% ) and ethmoid sinus ( 10% ) . \n jna is classified as type i when the tumor is restricted to the nasal cavity and the nasopharynx without bone destruction , type ii when the tumor invades the pterygomaxillary fossa and maxillary , sphenoidal and ethmoid sinuses with bone destruction , type iii when the tumor invades the infratemporal fossa , the orbit , and the parasellar region but remains lateral to the cavernous sinus and type iv when the tumor invades the cavernous sinus , the optic chiasma and the pituitary fossa . \n as this tumor is aggressive and expansile , it invades adjacent structures causing further symptoms . \n impaired eustachian tube function , facial deformity , proptosis and changes in visual acuity may be seen . \n angiofibromas originating outside the nasopharynx may appear as an intraoral mass in the retromolar or buccal space area . \n diagnosis of jna is made by complete history , clinical examination , radiography , nasal endoscopy ; and specialized imaging techniques such as arteriography , ct , and magnetic resonance imaging ( mri ) . \n these techniques help to establish the exact site , extension and relation of the tumor to the adjacent structures such as blood vessels and nerves . \n avid enhancement is noted on contrast - enhanced ct . at the time of diagnosis , the mass classically involves the pterygopalatine fossa . in this location , it produces widening of the pterygopalatine fossa , inferior orbital and pterygomaxillary fissures and bowing of the posterior wall of the maxillary antrum . \n bony erosion of the nasal cavity , hard palate and pterygoid plates is also common . \n anterior bowing of the posterior maxillary wall , due to invasion of the pterygomaxillary space on axial ct , known as the holman - miller sign is one of the characteristic findings . \n coronal ct images show the relationship between the tumor and surrounding structures based on which the staging can be done . \n the lesion shows low signal intensity in t1-weighted images but heterogeneous intermediate signal intensity in t2-weighted images . \n these features along with the specific age and sex predilection can help in differentiating jna from other nasopharyngeal lesions . \n mri is used posttreatment to detect residual or recurrent tumor mass and to monitor the effects of radiotherapy . \n the location and size of the tumor and feeding vessels are clearly demonstrated by this technique . the vascular supply to jnas is primarily from distal internal maxillary artery branches , particularly the sphenopalatine , descending palatine and posterior superior alveolar branches . \n these lesions include inflammatory polyps , angiomatous polyps , nasopharyngeal cysts and carcinomas , soft tissue neoplasms such as papilloma , lymphoma , neurofibroma , maxillary malignancies , nasal fossa esthesioneuroblastoma , adenoid hypertrophy , cervical vertebrae cordomas and retropharyngeal ganglia tuberculosis . a careful history noting , age , sex and location of the lesion may help to differentiate jna from other lesions . \n the final diagnosis is achieved by histopathologic examination of tissue sections either on incisional or excisional biopsy . \n the color depends on the vascular component and may vary from pale white in less vascular lesions to a pink and wine colored mass in highly vascularized ones . \n histopathologically jna shows a fibrocellular stroma with spindle cells and haphazardly arranged collagen interspersed with an irregular vascular pattern . \n the blood vessels are slit - like or dilated , organized in clusters and are of different calibers . a higher density toward the periphery \n the muscular lining of the blood vessel is absent in small and incomplete in larger vessels . \n beham et al . in 1997 proved the spindle cells of jna to be fibroblasts and not myofibroblasts . \n however , myxoid areas were not present in our case , they can be seen interspersed within the tumor . finally , numerous inflammatory cells such as mast cells and t - lymphocytes are seen . \n advanced lesions with orbital and intracranial extension are difficult to treat and may recur often . when diagnosed early the patients are treated with a combination of preoperative embolization and surgical resection providing a good prognosis . \n recurrent tumors must be managed individually taking into account location , age , complications and the possibility of spontaneous resolution . \n several reports suggest that jna regresses over time . a wait and watch policy with periodic imaging \n recurrence rates depend on the clinical stage of the tumor but are generally higher in patients with anterior and/or posterior lateral extension than in patients with anterior lateral extension only . \n jna is an uncommon , highly vascular , locally invasive , unencapsulated tumor with a distinct predilection for an origin in the nasopharynx of adolescent males . \n it presents as an innocuous , painless , unilateral nasal obstruction with or without epistaxis and rhinorrhea . \n diagnosis is arrived at by clinical examination , radiography , nasal endoscopy and specialized imaging techniques such as ct scan and mri . \n the classification and clinical staging is relatively easy and helps to plan treatment and determine prognosis . \n early diagnosis , accurate staging and adequate treatment are essential in the management of this lesion . \n \n ", "role": "user" }, { "content": "juvenile nasopharyngeal angiofibroma ( jna ) is a rare benign tumor arising predominantly in the nasopharynx of adolescent males . \n it is an aggressive neoplasm and shows a propensity for destructive local spread often extending to the base of the skull and into the cranium . \n clinically , however , it is obscure with painless , progressive unilateral nasal obstruction being the common presenting symptom with or without epistaxis and rhinorrhea . \n diagnosis of jna is made by complete history , clinical examination , radiography , nasal endoscopy and by using specialized imaging techniques such as arteriography , computer tomography and magnetic resonance imaging . \n histopathology reveals a fibrocellular stroma with spindle cells and haphazard arrangement of collagen interspersed with an irregular vascular pattern . \n a case report of jna with rare intra - oral manifestation in a 17-year - old male patient is presented in the article . \n jna being an aggressive tumor may recur posttreatment . \n thus , early diagnosis , accurate staging , and adequate treatment are essential in the management of this lesion .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: rheumatoid arthritis ( ra ) is an autoimmune arthritis affecting joints mainly , chronic inflammatory , along with many other tissues and organs . \n the process produces an inflammatory response of the synovitis secondary to hyperplasia of synovial cells , excess synovial fluid , and the development of pannus in the synovium . \n the pathology of the disease process often leads to the destruction of articular cartilage and ankylosis of the joints . \n owing to the lung tissue has redundant connective tissue and the close relation with blood vessels , and also has a link - intensive cycle system , the lung is one of the primary target organs . \n interstitial lung disease ( ild ) is the most common manifestation of rheumatoid lung disease [ 13 ] . about 0.8% of the world 's population \n rheumatoid lung disease occurs in about 28% of patients , either in the beginning or during the course of their disease . \n the presence of rheumatoid lung disease is associated with severe active disease and increased mortality compared to the general population [ 4 , 5 ] . \n its pathogenesis may be related to cd4 cd25 regulatory t cells ( treg ) ( figure 2 ) and foxp3 expression in a previous study [ 6 , 7 ] . \n tripterygium glycosides tablet comprises triptolide which is a traditional medicinal plant that has been used in china for many years to treat inflammatory conditions including ra . in this study \n we will be testing tripterygium glycosides tablet that is superior to methotrexate in improving the paw swelling degree , arthritis index ( ai ) , pulmonary function , and so on . \n rats were purchased from the experimental animal center of nanjing medical university ( nanjing , china ) . \n all animals were housed under specific pathogen free ( spf ) conditions and given free access to water and standard rat chow . \n tripterygium glycosides tablet ( tpt ) , 10 mg per piece , was produced by the shanghai medical hongqi pharmaceutical factory , batch number no . \n 20110819.methotrexate ( mtx ) , 2.5 mg per piece , was produced by the shanghai traditional chinese medicine co. , ltd . \n tripterygium glycosides tablet ( tpt ) , 10 mg per piece , was produced by the shanghai medical hongqi pharmaceutical factory , batch number no . 20110819 . \n methotrexate ( mtx ) , 2.5 mg per piece , was produced by the shanghai traditional chinese medicine co. , ltd . \n 20111004 . \n elisa kit was purchased from r & d company , usa . interleukin-10 ( il-10 , lot number 341225 ) , tumor necrosis factor alpha ( tnf- , lot number no . \n endothelin-1 ( et-1 , lot number 340918).freund 's complete adjuvant ( fca , sigma , usa , lot number no . \n 098k8729).regulatory t cells kit : anti - mouse cd4-fitc ( ebioscience , usa , lot : 11 - 0040 , clone no . \n ox35 ) , anti - mouse cd25-pe ( biolegend , usa , lot number : 202105 , clone no . ox-39).anti - mouse foxp3 monoclonal antibody ( santa cruz , usa , lot : sc-130666).pcr master mix kit and m - mulv reverse kit ( fermentas , canada , lot : k0171 , k1622 ) . \n elisa kit was purchased from r & d company , usa . interleukin-10 ( il-10 , lot number 341225 ) , tumor necrosis factor alpha ( tnf- , lot number no . 341012 ) . \n freund 's complete adjuvant ( fca , sigma , usa , lot number no . 098k8729 ) . \n regulatory t cells kit : anti - mouse cd4-fitc ( ebioscience , usa , lot : 11 - 0040 , clone no . \n ox35 ) , anti - mouse cd25-pe ( biolegend , usa , lot number : 202105 , clone no . \n ox-39 ) . anti - mouse foxp3 monoclonal antibody ( santa cruz , usa , lot : sc-130666 ) . pcr master mix kit and m - mulv reverse kit ( fermentas , canada , lot : k0171 , k1622 ) . \n microplate reader was produced by bio - tek corporation , usa ( model : elx800).pcr amplification was produced by biometra inc . \n , germany ( model : t1-thermoblock , t - gradient thermoblock).anires 2003 animal lung function analysis system was produced from beijing bei lanbo technology co. , ltd . \n , china.electrophoresis was produced by amersham corporation , usa ( model : eps-301 ) . \n microplate reader was produced by bio - tek corporation , usa ( model : elx800 ) . \n anires 2003 animal lung function analysis system was produced from beijing bei lanbo technology co. , ltd . , china . \n electrophoresis was produced by amersham corporation , usa ( model : eps-301 ) . the rats were randomly divided into four groups , the norma control ( nc ) group , model control ( mc ) , methotrexate ( mtx ) , and tripterygium glycosides tablet ( tpt ) group , 12 rats in each group . except for the rats of nc group , the others were intracutaneously injected with 0.1 ml of freund 's complete adjuvant in the right hindlimb . administration from 19th after inflammation , nc group and mc group were treated with physiological saline ( 1 ml/100 g per day ) . \n mtx group and tpt group were treated with mtx , 1 ml/100 g per week , and tpt , 1 ml/100 g per day . \n 12th after inflammation , the joints were observed and recorded , once every three days . calculated ai by five scoring method . \n no swelling ( 0 point ) ; swelling from little toe joint ( 1 point ) ; swelling from toe joints and foot ( 2 points ) ; swelling from ankle and below ( 3 points ) ; swelling from all of ankle ( 4 points ) . \n we have \n ( 1)e(%)=(vtvn)vn100% ( vn , vt represent the volume before and after modeling ) . \n we have \n ( 2)lung index ( li)=lung wet weight ( mg)body weight ( g)100% . 30th after administration , remove the lungs tissue , and tissue was fixed in 4% paraformaldehyde 8 \n according to szapiel method to determine the extent of alveolitis : 0 points : without alveolitis ( ) ; 1 points : mild alveolitis ( + ) , lesions were confined to below 20% of total lung tissue ; 2 points : moderate alveolitis ( + + ) , lesions reach about 40%50% of total lung tissue ; 3 points : severe alveolitis ( + + + ) , lesions were more than 50 percent of total lung tissue . \n average expiratory flow ( fev1/fvc % ) , 25% vital capacity of the peak expiratory flow ( fef25 ) , 50% vital capacity of the peak expiratory flow ( fef50 ) , 75% vital capacity of the peak expiratory flow ( fef75 ) , maximum mid - expiratory flow ( mmf ) , peak expiratory flow ( pef ) . \n process of the operation : the rats were anesthetized with chloral hydrate ( 10% , 0.35 ml/100 g ) through intraperitoneal injection and underwent tracheotomy endotracheal intubation . \n the rats were put inside the body of description to keep head low , and the ventilator tube was connected to mechanical ventilation in order to test pulmonary function . in the determination process , use the way that external pressure to make animal deep inspiration / deep breath . \n whole blood samples were taken into k3-edta containing tubes and added to each tube with blood ( 10 cells per tube ) , anti - mouse cd4-fitc ( 0.25 ug ) , anti - mouse cd25-pe ( 1.0 ug ) successively . \n add 1 ml rbc lysate to tube and incubate for 1525 minutes in dark again . \n rna was extracted by trizol ( takara co. , japan ) from 100 mg lung tissue and quantified using a spectrophotometer ( eppendorf co. , german ) . \n three micrograms of total rna were reverse transcribed into cdna using murine moloney leukemia virus ( m - mlv ) reverse transcriptase ( promega , usa ) . \n pcr was carried out according to the manufacturer 's instructions . the house keeping gene gapdh ( genbank accession : nm-017008 ) : sense : 5-tcc acc acc ctg ttg ctg tag-3 , and antisense : \n 5-cca cag tcc atg cca tca ct-3. amplified fragment 258 bp . the foxp3 gene ( genbank accession : nm-001108250 ) : \n sense : 5-gca aac gga gtc tgc aag tg-3 , and antisense : 5-gca gga gct ctt gtc cac tga-3 , amplified fragment 450 bp . \n pcr products were analyzed using gel works software after scanning the ethidium bromide - stained 1.5% agarose gel . \n protein was lysed in gel - loading buffer containing 50 mm tris - hcl ( ph 6.8 ) , 100 mm dithiothreitol , 2% sodium dodecyl sulfate , 0.1% bromophenol blue , and 10% glycerol . \n fifty micrograms of total protein was resolved by sds polyacrylamide gel electrophoresis and electrically blotted onto a nitrocellulose membrane . \n the filters were blocked with phosphate buffered saline ( pbs ) containing 15% nonfat milks . \n detection of foxp3 or beta actin was carried out by western blot analysis with the mouse anti - foxp3 monoclonal antibody ( 1 : 500 ) or the rabbit anti - beta actin polyclonal antibody ( 1 : 5000 ) as the primary antibody , and goat anti - mouse or goat anti - rabbit igg - conjugated horseradish peroxidase as secondary antibody . \n levels of tnf- , il-10 , and et-1 in supernatants of different groups were measured using commercially available elisa kits according to the test protocols . \n values were expressedas pg / ml . the elisa standard curve was prepared using a serial dilution of tnf- , il-10 and et-1 standard protein concentrations . \n the levels of recombinant tnf- , il-10 , and et-1 in the supernatant of the cells culture were calculated from the od450 values according to the elisa curve of the commercial tnf- , il-10 , and et-1 standards . \n lung tissue was dewaxed and rehydrated followed by antigen retrieval through microwaving in 2 mm edta ( ph 9.0 ) for foxp3 antigen . sections were blocked with 5% bovine serum albumin ( diluted in pbs ) for 30 min and then incubated with each primary antibody in a moist chamber at 4c overnight . \n parallel sections from the same tissue block were used for the staining of all molecular variables . after washing in pbs \n , hrp polymer - linked secondary antibody was added for 60 min at room temperature . \n sections for the negative control were prepared using rabbit igg1 or mouse igg1 instead of primary antibody under the same experimental conditions . \n continuous variables are the mean standard deviation . all samples were tested to ascertain if they followed a normal distribution . \n before inflammation , there was no obvious difference between paw swelling degree and arthritis index in each group . before administration , the level of paw swelling degree and arthritis index of mc group , mtx group , tpt group were significantly higher than that in the nc group ( p < 0.05 or p < 0.01 ) . after administration , \n compared to the nc group , the level of paw swelling degree and arthritis index of mc group were increased significantly ( p < 0.01 ) . compared to the mc group , the level of swelling degree and arthritis index of mtx and tpt group were reduced significantly ( p < 0.01 ) . compared to the mtx group , the level of swelling degree and arthritis index of tpt group were reduced significantly ( p < 0.01 ) . \n 30th after administration , pulmonary function parameters such as fef50 , fef25 , fvc , fef75 , mmf , and pef were significantly decreased , then fev1/fvc , li and score of alveolitis were increased in mc group . \n fvc , fef25 , fef50 , fef75 , mmf , and pef were decreased and the score of alveolitis was increased with treatment of tpt . \n 30th after administration , compared to the nc group , the concentrations of tnf- , et-1 in serum and et-1 in lung tissue were significantly increased , and il-10 in serum was decreased obviously in the mc group ( p < 0.01 ) . \n the concentrations of tnf- and et-1 in tpt group were significantly lower than those in mc group , and the concentrations of il-10 were significantly higher than those in mc group ( p < 0.01 ) . \n the differences of tnf- , et-1 between tpt group and mtx group were statistically significant ( p < 0.01 ) . \n we detected treg expression by flow cytometry in peripheral blood ( figures 1(a)1(d ) ) , and immunohistochemistry , rt - pcr , and western blot were used to detect the expression of foxp3 in lung tissue . \n flow cytometry results showed that the expression of cd4 cd25 treg was decreased significantly in mc group and increased in tpt group . \n immunohistochemistry results showed that the expression of foxp3 in lung tissue was concentrated in nucleus and cytoplasm . \n the expression of foxp3 was decreased in the mc group and increased in the tpt group . \n rt - pcr and western blot results showed that the expressions of foxp3 mrna and protein were decreased significantly in mc group ( figures 3 and 4 ) . \n we detected that paw swelling , ai , alveolitis points , tnf , and et-1 expression were significantly increased in rats experimentally developed with adjuvant arthritis , while fvc , fef25 , fef50 , fef75 , mmf , pef , il-10 , cd4 treg , cd4 cd25 treg , and foxp3 expression in lung tissue were significantly decreased . \n these studies have shown inflammatory reaction was emerged in the joints of rats developed with aa , while their pulmonary function has been changed , the level of pulmonary function declines as a result . \n pulmonary function change was further indicated by the observation of pulmonary ventilation function disorder , particularly restrictive ventilatory disorder , accompanied by small airway obstruction . \n it is worthwhile to note that an imbalance between proinflammatory and anti - inflammatory cytokine existed , suggesting that the inflammation was occurred in both joints and lung . \n the abnormal expression of regulate t cells and foxp3 shows treg was probably involved in ra pathogenesis of lung injury [ 1317 ] . \n modern pharmacological studies show that triptolide has anti - inflammatory and immunomodulatory active ingredients effects in experimental animals . \n pharmacological and clinical experiments also show that the major effective component of tripterygium is alkaloids , may directly lead to the results that reduce capillary permeability , inhibit infiltration of inflammatory exudation , inhibit or counter modulate various types of inflammatory mediators as well as the anticoagulant , antiembolism , and reduce the damage on lung tissue [ 18 , 19 ] . \n the immune modulatory effect of tripterygium ranged widely from the humoral immunity , cellular immunity , to macrophage phagocytosis . \n triptolide , its monomer , has inhibition on inflammatory joint edema was induced by carrageenan , croton oil , and freund 's complete adjuvant . \n a study also showed that triptolide has improved the role that could improve the recovery of alveolitis and fibrosis . \n triptolide can reduce the size of alveolitis and pulmonary fibrosis and increase alveolar space . in our results , compared with the aa rats , fvc , fef25 , fef50 , fef75 , mmf , pef , il-10 , and the expression of regulate t cells , foxp3 was significantly increased in the triptolide - treated group , while paw swelling , ai , tnf- , and et-1 decreased . \n there also found that the treatment effect of tripterygium was more obvious than that of triptolide . \n the levels of cd4 cd25 treg decreased in peripheral blood of the aa rats obviously . \n it may be because of that the diminished cd4 cd25 treg level is correlated to the breakdown of the autoimmune balance and the development of rheumatoid arthritis - induced lung injury , for low level of cd4 cd25 treg can not sufficiently convert cd4 cd25 t cells into regulatory cells through immune induction . \n we proposed that as a consequence , the cd4 cd25 t cells can be converted into treg that secretes il-10 in peripheral blood of the aa rats , thus promoting the expression of foxp3 in lung tissue , then making the high level expression of anti - inflammation cytokine and the low level expression of proinflammatory cytokines . \n finally the immunosuppression activity of cd4 cd25 treg is exemplified exclusively , as our data implied . \n our results showed that tripterygium can obviously improve pulmonary function in aa rats , and the mechanism may function through inhibiting the expression of tnf- , et-1 , upregulating cd4 cd25 treg level , and promoting the expression of il-10 and foxp3 [ 2026 ] . \n it is suggested that tripterygium can upregulate cd4 cd25 treg and foxp3 expression , playing the role of the immune adjustment [ 2730 ] . \n tnf- is a upstream regulatory factor of this process , which can induce accumulation of macrophages , secrete large amount of tgf- and et-1 , expand the inflammatory response , and promote the formation of synovitis inflammation and lung disease . \n tnf- not only induces the amplification of th2 cells , but also limits the immunosuppression activity of cd4 cd25 regulatory t cells , which suppress immune tolerance [ 3134 ] . in this study \n , we concluded that tripterygium plays a vital role of immune adjustment in lung injury .", "role": "user" }, { "content": "objective . to observe the effects of tripterygium glycosides tablet ( tpt ) on swelling degree , arthritis index ( ai ) , pulmonary function , cytokines , the expression of regulatory t cells ( treg ) , and foxp3 in rats of adjuvant arthritis \n . methods . \n rats were averagely divided into normal control ( nc ) group , model control ( mc ) group , methotrexate ( mtx ) group , and tripterygium glycosides tablet ( tpt ) group . except for the rats of normal group , \n the others were intracutaneously injected with 0.1 ml of freund 's complete adjuvant in the right hindlimb . \n nc group and mc group were treated with physiological saline . \n mtx group and tpt group were treated with mtx , tpt , respectively . \n results . \n the levels of swelling degree , ai , the alveolar inflammation integral , tnf alpha ( tnf- ) , and endothelium-1 ( et-1 ) in mc group were significantly increased ( p < 0.01 ) , and the levels of forced vital capacity ( fvc ) , 25% vital capacity of the peak expiratory flow ( fef25 ) , 50% vital capacity of the peak expiratory flow ( fef50 ) , 75% vital capacity of the peak expiratory flow ( fef75 ) , maximum midexpiratory flow ( mmf ) , peak expiratory flow ( pef ) , interleukin-10 ( il-10 ) , cd4 + cd25 + treg , and foxp3 were decreased ( p < 0.01 ) . \n the scores of alveolitis and et-1 were decreased with treatment of tpt . \n the levels of fvc , fef25 , fef50 , fef75 , mmf , pef , il-10 , and cd4 + cd25 + treg in peripheral blood were increased . \n the expressions of foxp3 protein and mrna in lung tissue were also increased in tpt group . \n conclusions . the paw swelling can be inhibited by tpt , and the inflammatory response in lung tissue was also decreased , which is a significant improvement in pulmonary function . \n the mechanism is probably associated with upregulating the expression of il-10 , foxp3 , and downregulating the level of tnf-.", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: we searched for mut genes variation in 139 m. tuberculosis complex strains originating from 35 different countries . \n ninety - four of these strains were selected because they were representative strains characterized with 13 different genetic markers in previous studies ( 6,22 ) . \n this set comprised 125 m. tuberculosis strains , 1 m. africanum , 8 m. bovis , 3 m. bovis bcg , and 2 m. microti . \n fifty - five strains had a w - beijing genotype ; 12 had an mdr phenotype . \n five m. tuberculosis strains of the w - beijing genotype and three strains of unrelated genotype were obtained from the national program for surveillance of mdr tuberculosis in spain . \n four m. tuberculosis w - beijing genotype strains isolated in the netherlands and one from vietnam were included because they showed spoligo patterns with fewer than nine spacers . \n five other w - beijing genotype strains showed hybridization to an additional spacer , as demonstrated by using the extended set of spacers , two of which lacked hybridization to spacer 37 . \n strain w4 is part of a drug - susceptible outbreak in new jersey ( 4 ) ; w147 is a drug - resistant isolate widely spread in russia ( 23 ) . \n eleven strains were representative of ancestral w - beijing strains , which diverged early in the evolution of the w - beijing phylogenetic lineage . finally , 29 strains of another frequently observed genotype , the haarlem genotype ( 6 ) , were investigated . the collection consisted of 55 \n w - beijing genotype isolates , 29 haarlem genotype isolates , 8 strains of the african genotype , 1 m. bovis strain , and 46 representatives of other genotypes . \n principal genetic grouping ( pgg ) , according to the polymorphism in katg and gyra , was known ( 24 ) for most of the isolates in this study . \n seventy - four strains belong to pgg 1 , 54 to pgg 2 , and 3 to pgg 3 . \n all isolates were subjected to at least is6110 rflp typing and spoligotyping ( 6 ) . \n drug susceptibility was determined for 41 of 139 strains ( table 1 and 2 ) . \n several putative mut genes were annotated as such in the released genome sequence of m. tuberculosis ( 25 ) . \n in addition , using the blast program ( 26 ) , we identified rv3908 as an orf carrying a mutt domain ( 27 ) and have since named it mutt4 . \n wt , wild - type alleles ( identical to h37rv strain ) ; nd , not determined . \n nd , not determined ; wt , wild - type alleles ( identical to h37rv strain ) . \n primers were designed to amplify putative mut genes : muty ( 5-ccggcgacgaatcgctcgtt-3 , 5-agctgggacagtcgtcgcgg-3 ) , mutm ( 5-ctggttcgatggtgatgacc-5 , 5-gtgcgctcgacccacag-3 ) , mutt2 ( 5-tccggatgatgatttacctcc-3 , 5-tccgccgggtcggggac-3 ) , mutt1 ( 5-atcgtcggcgtgccgtg-3 , 5-gtcagcgtcctgcccgg-3 ) , mutt4 ( 5-tcgaaggtgggcaaatcgtg-3 5-tggggttcgctggaagtgg3 ) , ogt ( 5-cagcgctcgctggcgcc-3 , 5-gactcagccgctcgcga-3 ) , and mut t3 ( 5-gtcacgtctgttaggacctc-3 , 5-cgcgcaacggctgccgg-3 ) . \n similar primers were designed to amplify the rpob gene ( 5-tacggtcggcgagctgatcc-3 , 5- tacggcgtttcgatgaacc-3 ) . \n dna sequencing was performed directly on the amplified fragments by using the dideoxy chain - termination method with the big dye terminator cycle sequencing kit ( perkin elmer applied biosystems , courtaboeuf , france ) on a geneamp polymerase chain reaction ( pcr ) system 9600 ( perkin elmer ) and run on a dna analysis system model 373 or 3100 ( applied biosystems ) . \n sequences of muty , mutt2 , mutt4 , rpob , mutt1 , mutt3 , and ogt of the m. tuberculosis strains h37rv , cdc1551 , and mt210 were obtained from published sequences or at the tigr web site ( available from : url : http://www.tigr.org/ ) . \n we searched for allele variation in putative genes coding for dna repair enzymes : mutt ( which hydrolyzes 8-oxo - deoxyguanosine triphosphate ) ( 28 ) , ogt ( which removes methyl groups from o6-methylguanine in dna ) ( 29 ) , mutm ( formamidopyrimidine - dna glycosylate ) ( 30 ) , and muty ( specific adenine glycosylate ) ( 31 ) in 12 mdr m. tuberculosis strains . \n subsequently , we genotyped for the observed single nucleotide polymorphism ( snp ) variation in 124 strains , members of the m. tuberculosis complex , and in the three published sequences of m. tuberculosis strains . in total , the sampling comprises 55 w - beijing genotype m. tuberculosis strains , including 11 ancestral w - beijing isolates ( unpub . \n data ) , 84 m. tuberculosis strains of other genotypes , and 1 m. bovis strain . \n several putative mut genes were annotated as such in the released genome sequence of m. tuberculosis . a blast search using the e. coli mutt sequences as template identified , in addition to mutt1 , mutt2 , mutt3 , the hypothetical orf rv3908 , which we have designated as mutt4 . \n figure 2 depicts sequence alignment of the conserved region of the different genes of the m. tuberculosis genome showing similarity with mutt of e. coli . \n the search for sequences similar to ogt , mutm , and muty identified a single orf in each case . \n mycobacterium tuberculosis rv2985(mutt1 ) , rv1160(mutt2 ) , rv0413(mutt3 ) , and rv3908(mutt4 ) were selected from the m. tuberculosis genome because of their annotation or after a blast analysis . \n these sequences were compared to escherichia coli mutt by using alignments available from : http://www.biochem.uthscsa.edu/~barnes/mutt.html . \n # , absolutely conserved residues ; * , residues that are strongly conserved and that define the mutt or nudix motif . \n we first determined the sequences of the different genes mentioned above in 12 mdr m. tuberculosis strains ( za20 , za65 , za67 , za68 , za69 , za11 , za16 , za12 , za13 , zaa14 , za17 , and za19 ) , including 5 w - beijing strains ( za20 , za65 , za67 , za78 , and za69 ) . \n for the muty , mutm , mutt1 , and mutt3 putative genes , pcr amplification was obtained in all strains tested , but sequence analysis did not indicate any nucleotide changes at these loci except for the same silent snp in mutt3 in strains with a haarlem genotype . \n we confirmed these findings by sequencing mutt1 , mutt3 , mutm , and muty in a collection of 26 mdr strains from north africa . \n all haarlem strains carried one characteristic silent mutation in mutt3 and one characteristic mutation in ogt ( ser 15 replaced by thr ) . \n however , comparative sequence analysis of h37rv , cdc1551 , and the five mdr w - beijing isolates indicated polymorphisms in mutt2 , mutt4 , and ogt . \n these mutations in mutt4 , mutt2 , and ogt were also found in the w - beijing strain 210 ( tigr ) but not in mdr strains other than those belonging to the w - beijing genotype . \n we therefore decided to extend this investigation and look for mutations in these three genes in a collection of m. tuberculosis complex isolates , including well - defined branches of the w - beijing phylogenetic lineage ( table 1 and 2 ) . in 43 of 55 strains with a w - beijing genotype , either susceptible to bacteriostat or mdr \n codon 48 ( cgg ) of the annotated orf had been changed to ggg , resulting in the amino acid substitution of arg by gly ( table 1 and 2 ) . \n all 11 w - beijing isolates known to be closely related to the ancestral w - beijing strain ( am , hi , n16 , du2 , dv , lb2 , ky , ik , 122(c11 ) , 113 , and 107(lb ) ) were found to have the wild - type genotype as all other 84 isolates with a genotype other than w - beijing . \n thirty - nine of 43 w - beijing strains with the mutation in mutt4 carried an additional mutation in mutt2 and in ogt . \n the mutt2 mutation constitutes a change in codon 58 ( gga to cga ) , resulting in an amino acid substitution of gly by arg . \n the active site of the e. coli mutt enzyme comprises amino acids 53 , 56 , 57 , and 98 . \n therefore , a mutation gly to arg at position 58 may have a important effect on enzyme activity and lead to a mutator phenotype . \n all 39 w - beijing isolates carrying the mutt2 polymorphism at codon 58 also displayed a concurrent silent mutation in codon 12 ( gly ggg to gga gly ) of the ogt gene . \n of four possible codons encoding for glycine , ggg and gga had the lowest relative synonymous codon usage ( rscu ) in genes with high expression levels ( 0.20 and 0.17 , respectively , compared to 1.32 and 2.31 for ggu and ggc ) . for genes with low expression levels , \n the rscu values are 0.92 , 0.37 , 0.65 , and 2.06 for ggg , gga , ggu , and ggc , respectively ( 32 ) . the five w - beijing isolates with a mutation in mutt4 and a wild - type mutt2 gene did not contain the ogt silent mutation on codon 12 either . \n instead , they all shared a dinucleotide substitution in codon 37 ( acc to ctc ) of ogt , resulting in amino acid substitution of arg to leu . \n these five w - beijing isolates of 43 with the mutt4 mutations , without the mutt2 ( codon 58 ) or the ogt ( codon 12 ) mutations , differed molecularly from all other w - beijing isolates in their spoligotype pattern and accompanying deletion flanking the dr locus . \n four of five were isolated from dutch patients in the netherlands ; the fifth originated from a patient in vietnam . \n 94 ) shared > 95% is6110 pattern similarity with the dutch isolate 115 when standard rflp analysis was used . \n overall , the five isolates were closely related to each other according to is6110 profiling ( > 90% similarity ) . \n spacer 37 in the dr locus of dutch isolates 114 and 139 was absent , while sample 115 was missing spacers 37 and 38 , and 111 had a deletion of spacers 38 and 39 but not spacer 37 , suggesting that these isolates may belong to a different sublineage . \n a tentative phylogeny of the w - beijing strains analyzed in this study is proposed in figure 3 . \n seven of nine mdr w - beijing strains carried missense mutations in two mut genes ( mutt2 and mutt4 ) , and two had a missense mutation in both mutt4 and ogt ( table 1 and 2 ) . \n schematic representation of a plausible pathway to explain the accumulation of mutations in mut genes . \n no mutations in mutt4 or in mutt2 were observed in any of the 84 m. tuberculosis complex strains , including 19 strains of pgg1 , 54 strains of pgg2 , and 2 strains of pgg3 ; the strains originated from 29 countries and were a genotype other than w - beijing . \n the three tested mdr w - beijing strains isolated in spain , with the mutations at the mutt2 and mutt4 loci , harbored a different mutation in the rpob gene . \n these strains were isolated from patients who had emigrated from eastern europe to spain ( za67 , za68 , and za69 ) . \n analysis of the is6110 rflp of the respective isolates showed a difference of a single band . \n the acquisition of the three different mutations in the rpob gene leading to rifampicin resistance must have occurred after the acquisition of mutations in the putative nucleotide repair enzyme genes mutt4 and mutt2 . \n our results show that m. tuberculosis strains of the w - beijing genotype acquired missense mutations in dna repair genes . \n dna repair genes have been previously shown to be associated with mutator phenotypes in other microorganisms . \n the success of this group of strains may result in part from mutations in dna repair enzymes , which might provided a true selective advantage for these bacteria to adapt and persist , including through the acquisition of resistance to anti - tb drugs . \n mutations in the dna repair genes might be the evolutionary answer of the tb bacillus to increase adaptation to hosts . \n this adaptation will lead to increasing trends in the tb epidemic in the coming decades . \n the world health organization considers mdr and resistance as a problem of local rather than of global importance ( 1 ) . if the relative contribution of w - beijing genotype strains to the current worldwide tb epidemic is increasing as suggested ( 7 ) \n , this approach should be revised . in areas with an increasing problem with mdr - tb , such as estonia and russia , \n w - beijing genotype strains are predominantly associated with mdr cases ( 33 ) . in germany , the relative proportion of w - beijing strains among isolates from resistant cases has increased from 12% in 1995 to 35% in 2000 ( unpub . \n the latter observation may indicate an increasing influence of w - beijing strains on the worldwide tb epidemic . \n we identify polymorphisms in m. tuberculosis in genes that might result in a mutator phenotype and therefore a plausibly better adaptation of the bacilli to a hostile environment ( 34 ) . \n forty - three of 55 w - beijing isolates analyzed were found to have a unique mutation on the orf rv3908 . \n thirty - nine of 43 w - beijing strains carried an additional and identical mutation in a second putative gene of the mutt family , mutt2 , and an identical silent mutation in ogt . \n the w - beijing phylogenetic lineage probably acquired the mutation on codon 48 of the mutt4 only once and before other mutations associated with the mutator genes we describe . \n this mutation clearly distinguishes ancestral w - beijing isolates from contemporary w - beijing strains . \n the 11 w - beijing isolates that did not have the characteristic mutt4 mutation on codon 48 , consist of a collection of isolates known to be ancestral within this phylogenetic lineage , as determined by various other molecular techniques ( unpub . \n nine of w - beijing strains with the wild - type mutt2 gene had a characteristic mutation on codon 37 of the ogt gene , which suggests that these isolates constitute a branch of the w - beijing family that diverged after the acquisition of the mutt4 mutation but before the development of the nucleotide substitution on mutt2 . \n one strain carries the mutation 37 in ogt but no mutation in mutt4 , a reversion that might have occurred after a transient mutator phenotype . \n a first mutation may have occurred in mutt4 and thereafter a second mutation either in mutt2 or ogt was acquired . \n as observed for other bacterial populations , mutator phenotypes may be transient in many cases to limit deleterious effects ( 35 ) . \n these mutations associated with mutator genes provide a reliable tool for the identification of w - beijing isolates and thus a useful marker for strains endowed with capacity to yield epidemics . \n the biologic consequences of these mutations and function of these dna repair genes are currently been investigated in the laboratory . \n nine mdr strains with a w - beijing genotype were among strains carrying two missense mutations in putative mutator genes . \n phylogenetically unrelated m. tuberculosis mdr isolates had no mutations within the dna repair genes investigated in this study . \n our data support the idea that m. tuberculosis strains of the w - beijing genotype may have adapted to hostile environments , including exposure to anti - tb drugs , because of a succession of alterations of dna repair enzymes . \n other genes involved in other dna repair mechanisms or in the fidelity of dna replication may also be involved and remain to be investigated . \n the acquisition of mutator alleles was described as an adaptive response of bacteria to a succession of different environments ( 18,35,36 ) . after infecting a host \n , m. tuberculosis has to adapt to different environments such as alveolar macrophages and dendritic cells and subsequently to granuloma containing inactivated macrophages or to activated macrophages after induction of the acquired immune responses . \n in addition , the bacilli have to adapt to the caseous media with low oxygen concentration in the center of tubercles and to different types of tissues during dissemination of the disease . \n such variable growth conditions might select for mutations in m. tuberculosis strains , as described in other bacterial populations exposed to different environmental challenges . \n mutations and selection might occur with an increased frequency caused by the toxic radicals produced in phagocytic cells . \n otherwise a continual accumulation of mutations would lead to deleterious effects and loss of fitness . \n no difference in the frequency of spontaneous mutations , resulting in a rifampin resistance phenotype , was observed for w - beijing strains ( 37 ) . \n we suggest that a transient mutator phenotype allowed a better adaptation of w - beijing strains . \n an alternative hypothesis would be the existence of a higher mutation rate in specific conditions ( i.e. , in mutagenic radicals inside phagocytes ) . \n the accumulation of mutations leading to antibiotic resistance in w - beijing strains may be a consequence of the appearance of strains with a better adaptation to the hosts . \n mdr strains would be easily selected when patients with strains that have adapted better received inadequate anti - tb regimens .", "role": "user" }, { "content": "alterations in genes involved in the repair of dna mutations ( mut genes ) result in an increased mutation frequency and better adaptability of the bacterium to stressful conditions . \n w - beijing genotype strains displayed unique missense alterations in three putative mut genes , including two of the mutt type ( rv3908 and mutt2 ) and ogt . \n these polymorphisms were found to be characteristic and unique to w - beijing phylogenetic lineage . \n analysis of the mut genes in 55 representative w - beijing isolates suggests a sequential acquisition of the mutations , elucidating a plausible pathway of the molecular evolution of this clonal family . \n the acquisition of mut genes may explain in part the ability of the isolates of w - beijing type to rapidly adapt to their environment .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: leydig cell tumor is a testicular tumor with a low incidence accounting for 13% of testicular neoplasms . \n it is a non - germ cell tumor of the testis and is included in the group of specialized gonadal stromal neoplasms . \n the frequent clinical presentation is that of a testicular nodule with or without endocrine manifestations . \n we report a case of leydig cell tumor of testis in a patient presenting with painless long standing slowly growing left scrotal mass . \n imaging showed a left testicular mass with multiple enlarged retroperitoneal lymph nodes and right single subcentimetric intrapulmonary nodule . \n lymph nodes and pulmonary nodule were observed radiologically over 2 months with no interval changes . \n the case could not be labeled as benign or malignant and patient is on follow - up . \n a 63-year - old noninsulin - dependent diabetes mellitus ( niddm ) patient presented with a painless swelling in the left testis first noticed by the patient 10 years ago was slowly progressive painless , and started to grow rapidly in last year . \n he had a history of left testicular trauma at 2 years of age in a form of laceration injury to the left hemiscrotum with tunica albuginea rupture that was open repaired then . on physical examination \n the left testis was 9 7 5 cm in size and the right testis was normal . \n scrotal ultrasonography revealed that the left testis was replaced completely by a lobulated heterogeneous mass with multiple foci of calcification measured 8.5 6.5 5 cm with significantly increased vascularity and a thickened left spermatic cord with grade 3 left varicocele . \n pelvic mri with contrast showed ill - defined left side lesion distorting the left testis that showed intense heterogeneous enhancement measuring 8.5 6 4 cm and thickened left spermatic cord ( fig . 1 , fig \n spiral computerized tomography ( ct ) of the chest , abdomen , pelvis and scrotum showed a 0.7 cm right intrapulmonary nodule and a well - defined soft tissue density lesion 8.5 6.5 5 cm seen in left hemi - scrotum with prominent left spermatic cord and normal right testis with multiple enlarged paraaortic , interaortocaval and pericaval lymph nodes the largest was 1.2 cm in maximum short axis diameter ( fig . \n so radiologist impression at that time was a malignant infiltrative highly vascular tumor with possible spermatic cord involvement . \n his routine investigations on admission such as hemogram , renal function tests , liver function tests and urinalysis were normal . \n serum germ cell tumor - markers ( ldh , alpha - fetoprotein and -hcg ) were normal and hormonal investigations were normal ( table 1 ) . \n pathology revealed a well circumscribed tumor mass weighing 211gm and measuring 6.5 5.5 3 cm , limited to the testis and epididymis without lymphovascular invasion , tumor invading tunica albuginea at some areas but not tunica vaginalis , no normal testicular tissue was identified . \n spermatic cord was 8 2 cm and uninvolved by the tumor ( fig . \n one week after orchiectomy testosterone steeply dropped to 36 ng / dl and luteinizing hormone ( lh ) started to rise from its lower limit of normal , then after 2 months testosterone raised to 105 ng / dl alongside with lh and follicle stimulating hormone ( fsh ) rise to 25.2 and 22.7 \n the ct scan performed 2 months after orchiectomy showed no significant interval changes regarding lymph nodes or lung nodule ( fig . \n germ cell neoplasms of the testis , accounting for 13% of testicular tumors in adults and 4% in prepubertal children \n . only about 10% of them show malignant behavior in the form of metastatic disease , particularly to the lymph nodes , lung and liver . \n malignant tumors occur exclusively in adults and are unaccompanied by endocrine changes , , , . \n these tumors are most common in the third to sixth decade in adults , another peak incidence is seen in children aged between 3 and 9 years . \n the histopathological findings for malignant leydig cell tumors include cytological atypia , increased mitotic activity , large size ( > 5 cm ) , older age , vascular invasion , increased mib-1 expression , necrosis , infiltrative margins , extension beyond the testicular parenchyma and dna aneuploidy , . \n while differentiating between benign and malignant leydig cell tumors , the presence of metastasis is the most accepted criterion for malignancy . \n patients either present with a painless enlarged testis or the tumor is found incidentally on us . in up to 80% of cases , hormonal disorders with high oestrogen and oestradiol levels , low testosterone , and increased levels of lh and fsh are reported , , while negative results are always obtained for the testicular germ cell tumor - markers afp , hcg , ldh and plap . up to 10% of adult patients present with gynaecomastia , . \n the low testosterone level observed post op could be interpreted as the lh was suppressed by the tumor expression of testosterone to keep testosterone within normal range and so the right testis is suppressed and after orchiectomy it is recovering its function . \n some morphological features like larger tumor size ( 6.5 cm ) , extension beyond the testicular parenchyma into tunica albuginea favored a diagnosis of malignancy in addition to older age and the equivocal finding of regional lymph node metastasis and right lung nodule on the c.t scan . on the other hand increased mitotic activity was not identified and there was no lymphovascular invasion , necrosis , cytological atypia or extension beyond the capsule of the testis in addition 2 months after surgery the images showed no significant interval changes regarding lymph nodes or lung nodule and patient was doing well . \n orchiectomy is the accepted mode of treatment but follow - up every 36 months with physical examination , hormone assays , scrotal and abdominal ultrasonography , chest radiography , and ct scans is essential in such a case with a potential for malignant behavior . \n when diagnosed and treated early , long - term favorable outcomes are seen even with its potential metastatic behavior . in stromal tumors with histological signs of malignancy , especially in older patients , orchiectomy and early retroperitoneal lymphadenectomy may be an option to prevent metastases or to achieve long - term cure in stage iia cases . \n prophylactic retroperitoneal lymph node dissection ( rplnd ) is unjustified for patients with clinical stage i disease without high - risk features . \n tumors that have metastasized to lymph nodes , lung , liver or bone respond poorly to chemotherapy or radiation and survival is poor . \n there is no standard of therapy for management of metastatic leydig cell tumors and no recommendations are available for the treatment of these patients . without clinical signs of malignancy , \n an individualized surveillance strategy after orchiectomy is recommended in patients with one , or more , pathological features of malignancy . \n follow - up is recommended in all high risk patients ; every 36 months with physical examination , hormone assays , scrotal and abdominal ultrasonography , chest radiography , and ct scans . \n patient plan , is to follow him up every 3 months with physical examination , hormone assays , scrotal and abdominal ultrasonography for 3 years then yearly and 6 monthly with chest radiography and ct scans for the first 2 years then yearly for up to 5 years as no interval changes were noted on the ct scan performed 2 months after orchiectomy and to avoid radiation risk with recurrent images over the follow up period as metastases have been reported as long as 8 and 17 years later . if subsequent images showed size increase rplnd would be considered . \n no recommendations are available for the size criteria in interval change to be considered significant for growth of the known lung lesion and para - aortic lymphadenopathy , as with other germ cell tumors . \n knowledge of this certain but rare tumor entity is important as endocrine manifestations could be the only sign for the presence of these tumors and if diagnosed and treated early , long - term favorable outcomes are seen even with its potential metastatic behavior . \n inguinal orchiectomy is the therapeutic decision of choice and long - term follow - up is necessary to exclude recurrence or metastasis . \n cases which fall in the grey zone like ours need to be followed up carefully for metastasis instead of rushing into an early rplnd with its potential risks and complications . \n \n \n this is a report of a case ; no research was conducted on patients that needed ethical approval . \n written informed consent was obtained from the patient for publication of this case report and any accompanying images . \n muheilan muheilan : literature review , case presentation , surgical first assistant , submitting , corresponding and main author . \n mujalli murshidi : main surgeon , performed inguinal orchiectomy of the testicular mass and main attending for the patient . \n ", "role": "user" }, { "content": "highlightsleydig cell tumor is a testicular tumor with a low incidence accounting for 13% of testicular neoplasms.only about 10% of them show malignant behavior in the form of metastatic disease.when diagnosed and treated early , long - term favorable outcomes are seen even with its potential metastatic behavior .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: lumbar disc herniation , also called \" vertebral limbus fracture \" , \" posterior extramarginal disc herniation \" , and \" vertebral endplate separation \" , combined with posterior apophyseal ring separation is an uncommon diagnosis12 ) . \n this combined condition is typically encountered in adolescents or young adults , before complete fusion of the limbus . \n trauma resulting from strenuous sports activity has been reported to be an important cause or predisposing factor of this injury . here , we report a rare case of lumbar disc herniation combined with posterior apophyseal ring separation in a non - athletic boy without history of evident trauma . the clinical features , radiological findings , and differential diagnosis of this case are discussed with a review of the relevant literature . \n a 10-year - old boy presented with severe back pain and leg pain radiating to the both buttocks and lateral thighs with an onset 10 days prior to presentation . \n the boy and his parents did not recall any precipitating event and he had enjoyed good health before this episode . on examination , he was noted to exhibit slight pelvic tilting , with truncal shift on forward bending , and flattened lumbar lordosis . \n there was an apparent muscular spasm and the straight leg - raising test was positive when both legs were lifted 45 degrees from a bed . \n simple radiographs showed a reduced lumbar lordotic curve , but preserved intervertebral disc spaces and no detectable fracture fragment ( fig . \n 1 ) . magnetic resonance imaging ( mri ) demonstrated severe l5-s1 disc protrusion , and although no fracture fragment was apparent , the supero - posterior corner of the s1 vertebral end plate was truncated ( fig . \n 2 ) . computed tomography ( ct ) scan at the l5-s1 disc level , revealed a huge central curvilinear bony fragment arising from the s1 superior end plate ( fig . \n the boy was initially treated conservatively with anti - inflammatory medication , muscle relaxants , and bed rest . \n however , his symptoms progressively worsened despite 3 weeks of aggressive conservative treatment . at 3 weeks after aggressive conservative treatment , decompressive laminectomy of l5 and discectomy of l5-s1 were performed . during surgery \n , the bone fragment , which was attached to the posterior vertebral ligament , was excised . \n symptoms resolved immediately after surgery and the postoperative course was uneventful . at 6 months after surgery , \n posterior ring apophysis separation occurs mainly in adolescents and adults , because of the process of apophyseal ring separation3 ) . \n slightly more than a quarter of cases involve adolescents and the remainders are adults aged up to 44 years10 ) . \n the osteocartilaginous ring apophysis represents a weak point in immature vertebrae and this makes it prone to fracture . on the other hand , in adults fracture is explained by delayed fusion of the apophysis to the adjacent vertebral body5 ) . \n apophysis ossification occurs at 6 - 9 years and apophysis and vertebral body fusion commences at about 17 years and concludes at about 20 years47 ) . \n typically , posterior ring apophysis separation occurs before complete fusion of the limbus between 17 and 20 years , and it is more frequently observed in males9 ) . \n the association between vertebral apophyseal ring fracture and posterior disc protrusion is caused by the relative weakness of the osteocartilaginous junction of the ring apophysis and its firm attachment to the annulus fibrosis by sharpey 's fibers . \n posterior ring apophysis separation has been classified into four types , and this categorization has been reported to be helpful when planning surgical excision of lesions6 ) . the diagnosis of posterior ring apophysis separation can not be readily made by simple radiographs . \n however , a fracture fragment may be visualized as a wedge - shaped bony density , which is usually located posterior to the vertebral body just cranial to the level of the intervertebral disc . \n ct reveals a bony ridge protruding into the spinal canal , a degree of spinal narrowing , and the presence of an accompanying prolapsed disc . \n diagnosis and classification of posterior lumbar vertebral ring fracture according to epstein are based only on ct signs6 ) . \n the mr appearances of lumbar apophyseal ring fractures were first described by rothfus et al.8 ) in 1990 . \n they suggested that features such as discontinuity and truncation of the postero - inferior vertebral body , displacement of a low - signal avulsed fragment , and disc protrusion subjacent to the fragmen t are characteristic , and hence eliminate the need for other diagnostic studies8 ) . \n however , mri findings are less specific than ct signs ; mri depicts the avulsed ring ( type i ) as a small arcuate low signal intensity fragment displaced posteriorly from the cranial or caudal rim of the vertebral body . \n moreover , because the ct resolution of osseous tissue is greater than that of mri , ct should not be replaced by mri . \n treatment should be started with nonsteroidal anti - inflammatory drugs , activity restriction , and corsets . \n surgical treatment is required in patients suffering symptoms of radiculopathy or myelopathy , and in rare cases with neurologic deficits , prompt surgical treatment is indicated . \n the possibility of lumbar disc herniation combined with posterior apophyseal ring separation should be kept in mind in even young child . \n careful review of radiographs , supplemented by targeted ct and mri is necessary for the correct diagnosis and management of this entity .", "role": "user" }, { "content": "lumbar disc herniation in children aged 10 years or less is extremely uncommon and posterior apophyseal ring separation is not a common injury that usually occurs in adolescents or young adults after a sports - related microtraumatism . \n the authors report an unique case of 10-year - old boy who presented with low back pain and radiating pain on both legs . \n the boy received conservative treatment , which included anti - inflammatory medication , muscle relaxants , and physical therapy , but symptoms were not improved . computed tomography and magnetic resonance imaging revealed a huge central disc herniation combined with posterior apophyseal ring separation . \n microscopic lumbar discectomy with the removal of apophyseal ring separation was performed due to the intractable pain . at six months after surgery , \n the child was symptom free .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: liver metastases are found in approximately 50% of patients with breast cancer during their lifetime . in general \n , such liver involvement indicates a disseminated disease and portends a poor prognosis with median survival of approximately 4 months [ 24 ] . \n however , the liver is the only site of metastasis in 5 to 25% of breast cancer patients [ 3 , 5 ] . \n liver - directed therapy may delay progression of hepatic disease and minimally impact a patient 's quality of life . until recently , \n treatment of liver metastases has been limited to systemic agents such as chemotherapy , hormonal therapy , and biological therapy . in carefully selected patients , \n however , locoregional therapy to control hepatic tumor burden has also been attempted by means of resection , radio frequency ablation or hepatic artery therapy [ 613 ] . \n transcatheter arterial chemoembolization ( tace ) is a regional therapy that can be offered to patients with unresectable liver metastases . \n it delivers a high dose of chemotherapy directly to the liver metastasis in an attempt to minimize systemic side effects . \n the chemotherapeutic effect of tace on tumor cells is augmented by the embolization - induced tumor ischemia of the therapy . \n it has a proven beneficial role in the treatment of hepatocellular carcinoma as well as hepatic metastases from colorectal cancer and neuroendocrine tumors [ 1517 ] . however , there is currently a paucity of data regarding its role in the management of metastatic breast cancer . \n we sought to evaluate efficacy and morbidity of tace in selected patients with unresectable liver metastases from breast cancer . \n approval from the institutional review board was obtained for a retrospective review of patients treated between january 1998 and january 2008 . \n ten patients with a diagnosis of breast cancer and unresectable liver metastases who were treated with tace were identified during this period . \n the main inclusion criteria for tace were liver - dominant tumor burden from breast cancer as seen on ct scan , progression on systemic chemotherapy , and good performance status . \n patient with limited and indolent extrahepatic disease , which represented less than 10% of the disease burden and with the disease not progressing , was included in the study . \n patients with evidence of hepatic failure such as total bilirubin greater than 3.0 mg / dl , ascites , or encephalopathy were excluded from tace . \n patient demographics , radiological and pathologic data on the primary and metastatic tumors , details regarding use of systemic chemotherapy , use of hormonal and biological treatments , and choice of tace agents were sought . \n clinical notes and electronic patient records were used to obtain follow - up and survival information . \n prior to the start of the first cycle of tace , a ct scan of the chest , abdomen and pelvis was performed to assess baseline tumor burden . \n a tissue biopsy of the hepatic lesions was obtained to confirm the origin of breast cancer , and basic laboratory values such as total bilirubin , albumin , and prothrombin time were obtained to assess baseline liver function . \n all the procedures were performed under a well - established protocol . in the interventional radiology suite under local anesthesia and intravenous sedation , \n the right common femoral artery was accessed . using a standard 5 french curved catheter , \n an angiogram was performed to assess hepatic vascular anatomy and to examine tumor - associated vascularity ( figure 1 ) . \n routine use of triphasic intravenous contrast ct scan of liver and angiography was performed to define any anatomic vascular variants such as accessory or replaced hepatic vessels ; and these variants were included in the treatment plan on diagnosis . \n selective catheterization of hepatic artery branches was then performed in a coaxial manner using a 3 french microcatheter to identify tumor blush . after confirming appropriate microcatheter position , infusion of chemotherapy ( adriamycin in 6 patients , cisplatin and gemcitabine in 2 patients , cisplatin in one patient , and oxaliplatin in one patient ) was completed . for each tace cycle , the dose of adriamycin ranged from 40 to 80 mg / m , cisplatin 125 to 165 mg / m , gemcitabine 1250 to 1500 mg / m , and oxaliplatin 85 mg / m . the choice of the chemotherapeutic agent depended on prior chemotherapy regimens . \n chemotherapy was first administered to the hepatic lobe that contained the dominant tumor burden . in cases of bilobar involvement , \n each hepatic lobe was treated separately in different tace cycles . following arterial chemoinfusion , embolization of the selected arterial branch \n embolization was achieved using biospheres ( biosphere medical , ma , usa ) , gelfoam ( pfizer inc , ny , usa ) , or contour ( boston scientific , ma , usa ) . \n all patients were observed overnight following the procedure , and laboratory tests were performed to assess side effects such as bone marrow suppression or liver dysfunction . \n six to eight weeks following each tace cycle , a contrast - enhanced ct scan of the chest , abdomen and pelvis was obtained to assess intrahepatic tumor response to previous tace and extrahepatic disease . \n ct scans detailing the size and the number of liver metastases were used to define radiological tumor response to the previous tace session . \n recist criteria were used to grade the ct scan findings as progressive disease , stable disease , partial response , or complete response . \n assessment of radiological tumor response was carried out retrospectively for each patient at two time points , after the third tace and after the last tace . \n data were entered and verified in spss ( version 14 , chicago , il ) . \n descriptive statistics were performed to provide information on demographic and disease specific variables . kaplan - meier survival analysis was carried out to test the differences in survival after the start of tace therapy between tace responders ( stable disease , partial or complete response ) and nonresponders ( progression of disease ) . \n all patients were female , and the median age at the time of diagnosis of liver metastasis was 46.5 ( range 29 to 60 ) ( table 1 ) . \n median time interval between diagnosis of primary breast cancer and of liver metastasis was 20 months ( range 0 to 95 ) . \n primary tumor was treated with either lumpectomy with radiation ( n = 4 ) or modified radical mastectomy ( n = 5 ) . \n one patient underwent an axillary lymph node dissection only for stage iv disease at presentation . \n axillary lymph nodes were positive in all patients , and either estrogen or progesterone receptors were positive in six patients . \n multiple bilobar hepatic metastases were found in nine patients and one large right lobe lesion was found in one patient . \n the range of the largest hepatic metastasis in each patient was 2.9 to 13.4 cm in largest dimension . \n the liver was site of metastasis in only five patients , and the remaining five patients also had isolated bone metastasis . \n all patients received systemic chemotherapy before the beginning of tace therapy , and six patients underwent hormonal therapy ( tamoxifen or aromatase inhibitors ) . \n systemic chemotherapy used for primary breast cancer included cyclophosphamide , methotrexate , 5-fluorouracil , adriamycin , cisplatin , taxol , and/or gemcitabine . \n the remaining seven patients received second - line systemic chemotherapy such as taxol , navelbine , adriamycin , gemcitabine , and/or capecitabine for the liver metastases discovered subsequent to the diagnosis of primary breast cancer . \n two patients also received autologous bone marrow transplantation after undergoing systemic chemotherapy for liver metastasis . \n median number of tace cycles administered was 4 ( range 1 to 6 ) . according to the recist criteria \n , surveillance ct scans showed that after the third cycle of the tace , liver metastases progressed in 5 patients , stabilized in 3 patients , and partially responded in 1 patient . \n after the last cycle of the tace , the disease progressed in 6 patients , stabilized in 2 patients , and partially responded in 2 patients ( figures 2(a ) and 2(b ) ) . \n tumor markers ( ca15.3 , ca125 or cea ) decreased in 5 patients during tace therapy . of note , tumor markers decreased in all four patients who responded by radiological criteria following tace . \n in contrast , five out of six patients who progressed on ct scan during tace treatment also exhibited an increase in tumor markers . \n the most common side effect was postembolization syndrome ( transient abdominal pain , nausea and/or vomiting ) ( n = 7 ) . \n three patients had transient elevation of liver enzymes ( alt or ast ) that did not require specific treatment . \n median time intervals from the diagnosis of liver metastasis to death ( n = 8) or last followup ( n = 2 ) was 26 months ( range 1 to 65 ) . \n six patients developed new or progressive extrahepatic metastasis during tace therapy . using kaplan meier survival analysis , \n median time interval from the first tace therapy to death or last followup was 12 months ( range 1 to 26 , 95% confidence interval = 4.919.1 months ) ( figure 3 ) . using radiological assessment of tumor response to tace , a statistically significant increase in median survival \n was observed for four patients who responded to treatment ( 24 months ) ( partial response or stable disease ) when compared to those six patients who did not respond to treatment ( 7 months ) ( progression of disease ) ( p = .02 ) ( figure 4 ) . \n in addition , using kaplan meier survival analysis , comparing the three different types of chemoembolization , a statistically significant increase in median survival ( 16 months ) was observed for six patients who received adriamycin when compared to four patients who received cisplatin and/or gemcitabine ( 12 months ) or oxaliplatin ( 1 month ) ( p = .01 ) . \n for patients with unresectable breast cancer liver metastases , the goal of treatment is to palliate symptoms and prolong survival without compromising the quality of remaining life . \n recent advances in systemic therapies such as taxanes , aromatase inhibitors , and trastuzumab have helped to contain tumor progression in patients with advanced disease . \n regional therapies such as hepatic resection have a role in selected patients , and retrospective case series have reported 5-year survival rates of 21% to 61% after resection of breast cancer liver metastases [ 69 , 11 , 12 ] . \n however , only a small number of patients are eligible for such a therapy , and there is therefore a need for an effective therapy that delays progression of unresectable but isolated liver metastases . \n the length of hospital stay for all the tace sessions in our study was only one day , and side effects observed after each cycle of tace were transient and minor . despite the ease of application and theoretical advantage of locoregional therapy in patients with isolated liver metastases , \n there have been only few reports of tace in the setting of metastatic breast cancer . \n our study reports ten patients treated with tace after they had exhausted all the systemic therapeutic options available . \n we observed that by radiological and tumor marker criteria , 40% of hepatic metastases responded to tace . \n similarly , li et al . reported that 35.7% of 28 breast cancer patients with liver metastases treated with tace using fluorouracil , cisplatin , and doxorubicin responded on follow - up ct scans . in another study , \n giroux et al . showed that five out of eight metastatic breast cancer patients had a radiological response of hepatic metastases to cisplatin , doxorubicin , and mitomycin - based tace . \n our series and previous published data therefore suggest that tace may have a palliative role in delaying progression of isolated hepatic metastases . of note \n , unlike two previous studies using triple chemotherapeutic agents , we observed that single - agent tace in 8 patients and two agents in two patients stabilized or reduced the size of liver metastasis in 40% of patients , and adriamycin - based tace conferred a statistically significant survival advantage ( p = .01 ) when compared to cisplatin / gemcitabine or oxaliplatin - based tace . \n this raises questions regarding the benefit of using multiple chemotherapeutic drugs for tace . in support , vogl et al . \n studied mitomycin - based single - agent tace for 25 patients with liver metastases from breast cancer as a neoadjuvant therapy prior to laser - induced thermotherapy ( litt ) , and they observed a radiological response rate of 56% following tace before litt . \n in addition , all four patients in our study who have responded to tace had radiological evidence of response by the third tace , and patients who did not show signs of response by the third cycle did not respond radiographically to further tace . \n this suggests that patients who may benefit from continuing tace therapy can be identified by measuring response during early cycles of tace therapy . \n in addition , in our study , responses by radiological and tumor marker criteria were closely correlated , suggesting therapeutic efficacy of tace on tumor burden in the liver . in this small series \n , such data should be considered pilot data , and thus a larger series investigation is needed . in our study , tace following systemic therapy for liver metastases was associated with median survival of 26 months from the time of diagnosis of liver metastasis , and at least 20% of patients survived 5 years . \n this finding is superior to that of the reported case series in which systemic therapy alone was used for liver metastases , which was associated with median survival of 4 to 10 months [ 3 , 4 ] . \n therefore , there may be a survival advantage for patients who also receive tace in addition to systemic therapy for their hepatic metastases . in support , schneebaum et al . also found that the median survival was 27 months for those patients who were treated with regional therapy ( either resection or regional chemotherapy ) , which was significantly longer than the medial survival of five months for those patients who received systemic chemotherapy alone for liver metastases . \n however , the median survival of 12 months from the start of tace in our study indicates that tace is clearly palliative and not a curative treatment . \n six patients developed new extrahepatic metastases during tace cycles , and four of them were bone metastasis . \n radiation is an effective palliative treatment for symptomatic bone metastases , and studies have shown that bone metastases are not an influential factor on overall survival of patients with metastatic disease . \n interestingly , median survival from the start of tace to death or last followup for the responders ( n = 4 ) was 24 months compared to 7 months observed in non - responders ( n = 6 ) . due to the small number of patients in our study , no firm conclusion can be drawn from this observation , but a statistically significant survival advantage was found for responders ( p = .02 ) . \n our paper therefore provides preliminary data that locoregionally directed therapy to isolated liver metastases associated with radiological response can lead to prolonged survival . \n this finding warrants further investigations to validate the efficacy of tace in this setting in a larger cohort of patients . \n here , we report a series of breast cancer patients with unresectable liver metastases who were treated with tace . tace was used in a patient population who had failed the first- and second- line systemic therapy , and it was associated with a median survival of 26 months from the diagnosis of liver metastases . \n this novel approach for breast cancer patients with liver metastases is an adjunct to existing systemic therapy , and it offers a well - tolerated palliative therapy in patients with historically dismal prognosis . in view of encouraging results from our study , further prospective randomized studies are warranted to assess tace as a regional treatment for isolated hepatic metastases from breast cancer .", "role": "user" }, { "content": "background . \n liver metastases are common in advanced breast cancer . \n we sought to evaluate the role of transcatheter arterial chemoembolization ( tace ) in breast cancer patients with hepatic metastases . \n methods . a retrospective review of ten patients with breast cancer who were treated with tace for unresectable liver metastases ( 19982008 ) . \n results . \n all patients , median age 46.5 , had received prior systemic chemotherapies . \n adriamycin was administered for 6 , cisplatin / gemcitabine for 2 , cisplatin for one and oxaliplatin for one patient . \n median number of tace cycles was 4 . \n kaplan meier survival analysis showed an increase in median survival for patients who responded to treatment when compared to those who did not respond ( 24 vs 7 months , p = .02 ) . \n conclusions . \n this is one of the largest series of breast cancer patients with liver metastases treated with tace . \n it suggests that tace is a feasible palliative option and warrants further investigations .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: professional musicians have been used over the last 15 years as a model for brain plasticity . why are musicians so interesting for plasticity research ? \n first of all , they are experts in playing musical instruments . to play the demanding two three - second segments of the 11th variation from the sixth paganini etude by franz liszt , for example , requires the production of 30 notes per second . \n ericsson and colleagues were among the first to show how much professional musicians do in fact practice . \n the authors showed that professional pianists and violinists practice for 7,500 hours before reaching the age of 18 years , whereas music teachers can look back on a total practice time of approximately 3,500 hours . \n this difference was unaffected by the quality of musical education since all musicians in this study had graduated from the prestigious berlin academy of music . \n thus , the amount of practice is one of the most important factors influencing musical expertise , at least in terms of the skill required to play a musical instrument . \n if musicians practice that much , it is hypothesised , they should show some kind of neuroanatomical and neurophysiological adaptations . \n professional , semi - professional , and non - professional musicians have now been studied extensively in terms of the neuroanatomical and neurophysiological underpinnings of their expertise . in principle , three different approaches to studying plastic processes in musicians are possible : ( a ) the first approach is cross - sectional in nature and mostly employs quasi - experimental designs ( post - test - only designs with non - equivalent groups in the terminology of cook and campbell ) . with this design , \n musicians and non - musicians are studied at the same point in time in terms of anatomical or functional brain measures . \n this approach has been widely used because it is relatively easy to collect the data . \n differences between both groups are attributed mostly to the different learning histories of musicians and non - musicians . however , the interpretation of these data is limited since this approach does not allow the inference of strong causation because it can not be ruled out that selection differences between the two groups or the different treatments ( here , music lessons ) are responsible for the results . to enhance the interpretability of such designs , several research groups have employed pretest measures related to musical expertise to control for pretest between - group differences \n this design , which is called the untreated control group design with proxy pretest measures , allows stronger causation about the influence of musical training . \n ( b ) the second approach used in this research context consists of short - term longitudinal studies in which subjects have undergone a specific training intervention . \n these studies are typically designed according to a pre - post design , and the subjects are enrolled in training programs lasting from several hours to several months . \n ( c ) finally , long - term longitudinal studies in which subjects have undergone a longer ( at least a period of years ) training are also used . \n longitudinal studies are more complicated in terms of organisation of the experiments , they take longer , and they are more expensive . \n in addition , longitudinal studies are repeated measurements studies , implying some methodological problems ( for example , unwanted practice effects ) . to understand the influence of music practice on brain plasticity \n a general finding of the studies published thus far is that nearly all of those brain areas involved in the control of musical expertise ( motor cortex , auditory cortex , cerebellum , and other areas ) show specific anatomical and functional features in professional and semi - professional musicians . in the following , \n i will review most of the recent papers ( after 2002 ) supporting the idea of brain plasticity driven by musical expertise and musical training . \n recently , hyde and colleagues published a paper strongly supporting the idea of use - dependent brain plasticity driven by musical training . in summary \n , this study demonstrates that 6-year - old children receiving instrumental musical training for 15 months ( compared with children receiving non - musical training ) not only learned to play their musical instrument but also showed changed anatomical features in brain areas known to be involved in the control of playing a musical instrument . \n most of these brain areas are part of the cortical motor system , but there were also structural changes in the auditory system and in the corpus callosum . \n this is the first longitudinal study demonstrating brain plasticity in children in the context of learning a musical instrument . \n although longitudinal studies are the gold standard in plasticity research , several cross - sectional studies demonstrating specific anatomical features in musicians have recently been published . \n omega sign ( indicative of a larger hand motor area ) on both hemispheres , whereas violinists showed the omega sign on only the right hemisphere controlling the left hand . \n this specific anatomical feature is possibly related to the fact that pianists practice a lot with both hands , whereas violinists practice a lot with their left hand ( manipulating the strings ) and their right arm ( manipulating the bow ) . \n thus , violinists might drive only the right - sided hand motor area , whereas pianists drive the hand motor areas on both hemispheres . \n this interesting finding is in strong concordance with older studies reporting specific anatomical features in the hand motor area in pianists and violinists . using a voxel - based morphometry approach , gaser and schlaug identified grey matter volume differences in motor , auditory , and visual - spatial brain regions when comparing professional musicians ( keyboard players in this study ) with a matched group of amateur musicians and non - musicians . \n most interestingly , they found a strong association between structural differences ( grey matter density ) , musician status , and practice intensity , supporting the view that practice ( in this case , practicing to play a musical instrument ) has an impact on brain anatomy . \n increased grey matter density ( and volume ) is currently taken as evidence of an increase in capillary density as well as smaller changes in synapse and glial cell density . \n thus , these changes might reflect neuroanatomical adaptations in order to improve the cognitive and motor functions controlled by these particular brain areas . \n most recently , a swedish group used diffusion tensor imaging ( dti ) to measure the integrity of fiber tracts ( association fibers and commissures ) in eight professional pianists and found a strong positive correlation between the measure of fractional anisotropy ( fa ) ( indicating the integrity of the fiber system ) and time spent practicing the piano . \n thus , the pianists who practiced more often showed higher fa values ( indicating a higher integrity of the fiber system ) . \n this finding is of outstanding importance because it brings to light morphometric differences even within a highly specialised group of skilled pianists and indicates that these differences are due to practice time ( specialisation of the specialised ) . \n in 2002 , schneider and colleagues , of heidelberg , germany , reported a remarkable anatomical finding in musicians . \n using magnetoencephalography ( meg ) and sophisticated anatomical analyses , the authors found neurophysiological and anatomical differences between musicians and non - musicians . \n first , the neurophysiological activity in the primary auditory cortex 19 - 30 ms after tone onset was more than 100% larger . in addition , the grey matter volume of the anteromedial part of heschl s gyrus ( which covers most of the primary auditory cortex ) was 130% larger in musicians . \n this study is one of the first to indicate that both the morphology and neurophysiology of heschl s gyrus have an essential influence on musical aptitude . \n , they found a strong relationship between the strategy used in processing complex tones and anatomical features in the primary auditory cortex . \n professional musicians who preferentially analyse the fundamental pitch ( the fundamental tone , abbreviated f0 or f0 , is the lowest frequency in a harmonic series ) of complex tones were found to have a leftward asymmetry of grey matter volume in heschl s gyrus , whereas those who prefer to analyse the spectral pitch of complex tones show a rightward asymmetry of grey matter volume of heschl s gyrus . \n thus , a marked anatomical feature of the auditory system correlated with a particular tone - processing strategy within a group of professional musicians . \n patricia sluming and colleagues , of liverpool , uk , published a paper in which they reported anatomical differences in broca s area between musicians and non - musicians . \n in particular , the authors reported increased grey matter in broca s area in the left inferior frontal gyrus in musicians . \n in addition , they observed significant age - related volume reductions in cerebral hemispheres , dorsolateral prefrontal cortex bilaterally , and grey matter density in the left inferior frontal gyrus in controls but not in musicians ! in other words , musicians showed no or a smaller decrease in grey matter density in the frontal cortex compared with non - musicians with increasing age . \n ( this is very important for aging research since the volume of the frontal cortex has been shown to correlate negatively with age . ) \n this anatomical study suggests that orchestral musical performance might promote use - dependent retention , and possibly expansion , of grey matter within broca s area ( a brain area that is responsible for speech production , language processing , and language comprehension as well as controlling facial neurons ; it is named after pierre paul broca , who discovered the area after studying the postmortem brain of a patient with a speech impairment ) . \n in addition , this study emphasises the significant point that shared neural networks ( within broca s area ) are involved in the control of language and music . in a more recent study , \n the same group showed that broca s area is also involved in the control of mental rotation , but only in musicians . \n they relate this extraordinary finding to the sight - reading skills of musicians . in sight reading \n broca s area might be involved in the control of this specific inter - relationship . \n the most recent study to use dti techniques was published by imfeld et al . . \n these authors measured the training effects on fa in the corticospinal tract ( cst ) of professional musicians and control non - musicians and found significantly lower fa values in both the left and the right cst in the musician group . \n diffusivity , a parameter indicating the amount of water that diffuses along and across the axon , was negatively correlated with the onset of musical training in childhood in the musician group . \n a subsequently performed median split into an early- and a late - onset musician group ( median of 7 years ) revealed increased diffusivity in the cst of the early - onset group as compared with both the late - onset group and the controls . in conclusion \n , dti was successfully applied in revealing plastic changes in white matter architecture of the cst in professional musicians . \n the present results challenge the notion that increased myelination induced by sensorimotor practice leads to an increase in fa , as has been suggested previously . instead , training - induced changes in diffusion characteristics of the axonal membrane may lead to increased radial diffusivity reflected in decreased fa values . \n however , this issue deserves more intensive discussion about the methodological aspects associated with fa and diffusivity measurements . besides the above - mentioned specific anatomical features in musicians \n recently , lappe et al . demonstrated particular changes with respect to the neurophysiological responses of the auditory cortex in non - musicians who trained for 2 weeks to play the piano . \n these authors randomly assigned subjects to one of two groups : one group learned to play a musical sequence on the piano , whereas the control group listened to the music that had been played by the other group . \n the authors demonstrated training - induced cortical plasticity using the musically elicited mismatch negativity ( mmnm ) from meg measurements before and after training . \n the mmnm is a neurophysiological response reflecting the pre - attentive processing of auditory stimuli . \n the subjects who learned to play piano showed significant enlargement of mmnm after training compared with the group who only listened to the music . \n thus , practicing to play the piano improves not only hand motor skills but also the auditory representation of the musical tones that are generated by the piano keys . \n thus , a strong crossmodal link between motor commands and the representation of auditory information is established , causing a stronger representation of musical information in the auditory cortex . \n several years ago , bangert and altenmller demonstrated a similar finding using electroencephalogaphy ( eeg ) . \n they identified changed activations in frontal brain regions of subjects who had just 20 minutes of piano training , but only in the learning conditions during which the subjects could easily associate a particular piano key with a note . in situations during which this association was random \n effects of training have also been shown to be instrument - specific [ 23 - 25 ] , and the eeg responses of children taking music lessons have been shown to change differently over the course of a year compared with those of children not studying music . \n thus , in summary , musicians or musically experienced subjects respond differently to musical stimuli even if top - down factors like attention are controlled for . \n there is also ample evidence of change in the auditory system due to musical practice and in the entire sensorimotor system [ 28 - 32 ] . \n interestingly , most of the recent findings indicate that even neurophysiological responses at the level of the brainstem are dependent on experience - dependent influences . \n neural activity generated from the brainstem can be measured using frequency following responses ( ffrs ) . \n the ffr is an electrophysiological scalp - recorded electrical response that reflects processing stages of auditory information at the level of the brainstem . \n specifically , wong et al . first showed music - related plasticity in ffrs elicited by speech . \n later , musacchia et al . found that musicians had more robust ffrs to auditory and audiovisual speech and music sounds . \n the latter study also strengthened the notion that musical experience shapes not only auditory processing but multisensory mechanisms as well . \n however , both studies indicate that playing music enhances the fidelity of the earliest stage of auditory response , not only to musical stimuli but also to speech and multisensory cues . \n more recently , krishnan et al . analysed the ffrs from chinese and english subjects in response to four mandarin tonal contours presented in a non - speech context . \n the ffr analysis revealed that the chinese group exhibited stronger representation of multiple pitch - relevant harmonics relative to the english group across all four tones . \n the authors concluded that long - term experience ( here , experience with mandarin ) enhanced the sensitivity to linguistically relevant variations in pitch . \n thus , specific language experience changes the ffr in a manner similar to that of music experience . \n recently , hyde and colleagues published a paper strongly supporting the idea of use - dependent brain plasticity driven by musical training . in summary \n , this study demonstrates that 6-year - old children receiving instrumental musical training for 15 months ( compared with children receiving non - musical training ) not only learned to play their musical instrument but also showed changed anatomical features in brain areas known to be involved in the control of playing a musical instrument . \n most of these brain areas are part of the cortical motor system , but there were also structural changes in the auditory system and in the corpus callosum . \n this is the first longitudinal study demonstrating brain plasticity in children in the context of learning a musical instrument . \n although longitudinal studies are the gold standard in plasticity research , several cross - sectional studies demonstrating specific anatomical features in musicians have recently been published . \n omega sign ( indicative of a larger hand motor area ) on both hemispheres , whereas violinists showed the omega sign on only the right hemisphere controlling the left hand . \n this specific anatomical feature is possibly related to the fact that pianists practice a lot with both hands , whereas violinists practice a lot with their left hand ( manipulating the strings ) and their right arm ( manipulating the bow ) . \n thus , violinists might drive only the right - sided hand motor area , whereas pianists drive the hand motor areas on both hemispheres . \n this interesting finding is in strong concordance with older studies reporting specific anatomical features in the hand motor area in pianists and violinists . using a voxel - based morphometry approach , gaser and schlaug identified grey matter volume differences in motor , auditory , and visual - spatial brain regions when comparing professional musicians ( keyboard players in this study ) with a matched group of amateur musicians and non - musicians . \n most interestingly , they found a strong association between structural differences ( grey matter density ) , musician status , and practice intensity , supporting the view that practice ( in this case , practicing to play a musical instrument ) has an impact on brain anatomy . \n increased grey matter density ( and volume ) is currently taken as evidence of an increase in capillary density as well as smaller changes in synapse and glial cell density . \n thus , these changes might reflect neuroanatomical adaptations in order to improve the cognitive and motor functions controlled by these particular brain areas . \n most recently , a swedish group used diffusion tensor imaging ( dti ) to measure the integrity of fiber tracts ( association fibers and commissures ) in eight professional pianists and found a strong positive correlation between the measure of fractional anisotropy ( fa ) ( indicating the integrity of the fiber system ) and time spent practicing the piano . \n thus , the pianists who practiced more often showed higher fa values ( indicating a higher integrity of the fiber system ) . \n this finding is of outstanding importance because it brings to light morphometric differences even within a highly specialised group of skilled pianists and indicates that these differences are due to practice time ( specialisation of the specialised ) . \n in 2002 , schneider and colleagues , of heidelberg , germany , reported a remarkable anatomical finding in musicians . \n using magnetoencephalography ( meg ) and sophisticated anatomical analyses , the authors found neurophysiological and anatomical differences between musicians and non - musicians . \n first , the neurophysiological activity in the primary auditory cortex 19 - 30 ms after tone onset was more than 100% larger . in addition , the grey matter volume of the anteromedial part of heschl s gyrus ( which covers most of the primary auditory cortex ) was 130% larger in musicians . \n this study is one of the first to indicate that both the morphology and neurophysiology of heschl s gyrus have an essential influence on musical aptitude . \n , they found a strong relationship between the strategy used in processing complex tones and anatomical features in the primary auditory cortex . \n professional musicians who preferentially analyse the fundamental pitch ( the fundamental tone , abbreviated f0 or f0 , is the lowest frequency in a harmonic series ) of complex tones were found to have a leftward asymmetry of grey matter volume in heschl s gyrus , whereas those who prefer to analyse the spectral pitch of complex tones show a rightward asymmetry of grey matter volume of heschl s gyrus . \n thus , a marked anatomical feature of the auditory system correlated with a particular tone - processing strategy within a group of professional musicians . \n patricia sluming and colleagues , of liverpool , uk , published a paper in which they reported anatomical differences in broca s area between musicians and non - musicians . \n in particular , the authors reported increased grey matter in broca s area in the left inferior frontal gyrus in musicians . \n in addition , they observed significant age - related volume reductions in cerebral hemispheres , dorsolateral prefrontal cortex bilaterally , and grey matter density in the left inferior frontal gyrus in controls but not in musicians ! in other words , musicians showed no or a smaller decrease in grey matter density in the frontal cortex compared with non - musicians with increasing age . \n ( this is very important for aging research since the volume of the frontal cortex has been shown to correlate negatively with age . ) \n this anatomical study suggests that orchestral musical performance might promote use - dependent retention , and possibly expansion , of grey matter within broca s area ( a brain area that is responsible for speech production , language processing , and language comprehension as well as controlling facial neurons ; it is named after pierre paul broca , who discovered the area after studying the postmortem brain of a patient with a speech impairment ) . \n in addition , this study emphasises the significant point that shared neural networks ( within broca s area ) are involved in the control of language and music . in a more recent study , \n the same group showed that broca s area is also involved in the control of mental rotation , but only in musicians . \n they relate this extraordinary finding to the sight - reading skills of musicians . in sight reading \n broca s area might be involved in the control of this specific inter - relationship . \n the most recent study to use dti techniques was published by imfeld et al . . \n these authors measured the training effects on fa in the corticospinal tract ( cst ) of professional musicians and control non - musicians and found significantly lower fa values in both the left and the right cst in the musician group . \n diffusivity , a parameter indicating the amount of water that diffuses along and across the axon , was negatively correlated with the onset of musical training in childhood in the musician group . \n a subsequently performed median split into an early- and a late - onset musician group ( median of 7 years ) revealed increased diffusivity in the cst of the early - onset group as compared with both the late - onset group and the controls . in conclusion \n , dti was successfully applied in revealing plastic changes in white matter architecture of the cst in professional musicians . \n the present results challenge the notion that increased myelination induced by sensorimotor practice leads to an increase in fa , as has been suggested previously . instead , training - induced changes in diffusion characteristics of the axonal membrane may lead to increased radial diffusivity reflected in decreased fa values . \n however , this issue deserves more intensive discussion about the methodological aspects associated with fa and diffusivity measurements . \n besides the above - mentioned specific anatomical features in musicians , several recent ( and older ) studies have shown specific neurophysiological adaptations . recently , lappe et al \n . demonstrated particular changes with respect to the neurophysiological responses of the auditory cortex in non - musicians who trained for 2 weeks to play the piano . \n these authors randomly assigned subjects to one of two groups : one group learned to play a musical sequence on the piano , whereas the control group listened to the music that had been played by the other group . \n the authors demonstrated training - induced cortical plasticity using the musically elicited mismatch negativity ( mmnm ) from meg measurements before and after training . \n the mmnm is a neurophysiological response reflecting the pre - attentive processing of auditory stimuli . \n the subjects who learned to play piano showed significant enlargement of mmnm after training compared with the group who only listened to the music . \n thus , practicing to play the piano improves not only hand motor skills but also the auditory representation of the musical tones that are generated by the piano keys . \n thus , a strong crossmodal link between motor commands and the representation of auditory information is established , causing a stronger representation of musical information in the auditory cortex . \n several years ago , bangert and altenmller demonstrated a similar finding using electroencephalogaphy ( eeg ) . \n they identified changed activations in frontal brain regions of subjects who had just 20 minutes of piano training , but only in the learning conditions during which the subjects could easily associate a particular piano key with a note . in situations during which this association was random \n effects of training have also been shown to be instrument - specific [ 23 - 25 ] , and the eeg responses of children taking music lessons have been shown to change differently over the course of a year compared with those of children not studying music . \n thus , in summary , musicians or musically experienced subjects respond differently to musical stimuli even if top - down factors like attention are controlled for . \n there is also ample evidence of change in the auditory system due to musical practice and in the entire sensorimotor system [ 28 - 32 ] . \n interestingly , most of the recent findings indicate that even neurophysiological responses at the level of the brainstem are dependent on experience - dependent influences . \n neural activity generated from the brainstem can be measured using frequency following responses ( ffrs ) . \n the ffr is an electrophysiological scalp - recorded electrical response that reflects processing stages of auditory information at the level of the brainstem . \n specifically , wong et al . first showed music - related plasticity in ffrs elicited by speech . \n later , musacchia et al . found that musicians had more robust ffrs to auditory and audiovisual speech and music sounds . \n the latter study also strengthened the notion that musical experience shapes not only auditory processing but multisensory mechanisms as well . \n however , both studies indicate that playing music enhances the fidelity of the earliest stage of auditory response , not only to musical stimuli but also to speech and multisensory cues \n analysed the ffrs from chinese and english subjects in response to four mandarin tonal contours presented in a non - speech context . \n the ffr analysis revealed that the chinese group exhibited stronger representation of multiple pitch - relevant harmonics relative to the english group across all four tones . \n the authors concluded that long - term experience ( here , experience with mandarin ) enhanced the sensitivity to linguistically relevant variations in pitch . \n thus , specific language experience changes the ffr in a manner similar to that of music experience . \n the preceding findings give rise to the question of whether there is transfer from musical to non - musical skills . \n a well - trained auditory system might support the perception of auditory speech information and thus auditory speech information might be processed more efficiently . \n in addition , when learning to play a musical instrument , the trainee also practices attention , planning functions , memory , and self - discipline . \n it is thus hypothesised that musical experience would positively influence executive functions , language functions , or even intelligence in general . \n , one paper demonstrates that extended musical experience enhances executive control on a non - verbal spatial task and auditory tasks . \n glenn schellenberg uncovered a greater iq increase in children enrolled in music classes compared with well - matched children who received no musical lessons , and ho et al . uncovered an enhancement of verbal memory skills ( but not visual memory skills ) in children enrolled in musical lessons . \n there is therefore mounting evidence on the behavioural level of positive transfer from musical expertise to non - musical domains . \n recently , moreno et al . established that musical training ( not longer than 6 months ) improves non - musical functions such as reading and linguistic perception . \n this study is one of the very few longitudinal studies to have been conducted in the context of musical training . \n if music has such a strong influence on brain plasticity , this raises the question of whether this effect can be used to enhance brain plasticity and cognitive performance in general and clinical settings . in a recent single - blind randomised \n examined whether daily music listening enhances the recovery of cognitive functions and mood after stroke . \n this study demonstrates that recovery of verbal memory and focused attention improved significantly and substantially in the group of patients who listened to their favourite music on a daily basis compared with patients who listened to audio books or received no listening material . \n besides the cognitive improvement in the context of listening to music , there was a substantial mood improvement in the patients who listened to music . \n thus , music could be used as a non - invasive tool for neuropsychological and neurological therapies . \n in addition , musical elements could be used to improve specific cognitive functions for which positive transfer effects have been demonstrated . \n for example , reading and writing skills as well as memory functions are possible candidates for functions that might benefit from musical training elements . \n evidence shows that writing and reading can be improved when dyslexic children learn to associate graphemes and phonemes with musical notes and that many memory elements are linked to music . \n hopefully , the current trend in the use of musicians as a model for brain plasticity will continue in future experiments and extend to the field of neuropsychological rehabilitation . \n ", "role": "user" }, { "content": "music is becoming more and more of an issue in the cognitive neurosciences . a major finding in this research area \n is that musical practice is associated with structural and functional plasticity of the brain . in this brief review \n , i will give an overview of the most recent findings of this research area .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: invasive fungal infections ( ifd ) are increasingly recognized and represent a primary cause of morbidity and mortality in critically ill patients [ 1 - 4 ] . a variety of factors , including immunosuppressive agents , broad - spectrum antibiotics , and antineoplastic agents influence the incidence and severity of ifds . \n transplant and haematopoietic stem cell transplant recipients , intensive care unit and surgical patients display the population at risk [ 1,4 - 7 ] . \n the introduction of voriconazole , posaconazole and echinocandins ( caspofungin , micafungin and anidulafungin ) improved the therapeutic option for treatment of invasive aspergillosis ( ia ) . \n although the outcome of ia is largely influenced by the state of immunosuppression , factors related to the fungus also play a role . until recently , \n species identification was sufficient to guide antifungal therapy , but the emergence of acquired resistance limits the use of species identification for predicting activity of antifungal agents . \n aspergilli , less susceptible to antifungals emerged and acquired resistance to azoles have been found mainly in aspergillus fumigatus ; this has launched a new era in handling aspergillosis . \n this article reviews the epidemiology and antifungal resistance against azoles and candins with particular emphasis on aspergillus species . \n in a 4-year - study pagano et al . showed that 64% of ifds in patients with haematological malignancies were caused by moulds and among them 90% were due to aspergillus species . \n overall , the incidence of ia varies according to underlying diseases , pathogen [ lf ] and geographic location ; rates of up to 7% are reported in europe . \n mortality rates for ia are high and vary according to patient population , ranging from 38% in patients with acute myelogenous leukaemia , from 50 - 60% in patients with organ transplantation and from 70 - 85% in other immunosuppressed patients [ 11 - 16 ] . \n although a. fumigatus still represents the leading cause of ia , species like aspergillus terreus and aspergillus flavus become more frequent . these non - a . \n fumigatus may be intrinsically resistant to antifungal agents ( eg a. ustus ) and the clinical presentation and evolution of ia may differ from commonly observed a. fumigatus infections [ 18 - 23 ] . maximizing the efforts \n the mic represents the lowest drug concentration that results in a notably reduction or complete lack of fungal growth . in vitro resistance \n secondary resistance is generated following exposure to an antifungal and may be associated with an altered gene expression . \n clinical resistance is defined as the failure to eradicate an infection despite the administration of an adequate antifungal . \n such failures can be attributed to a combination of the host , the pathogen and the drug . using the european committee for antibiotic susceptibility testingg ( eucast ) methodology breakpoints \n were recently proposed for a .fumigatus and itraconazole , voriconazole and posaconazole ; for itraconazole and voriconazole , < 2 mg / l ( susceptible ) , 2 mg / l ( intermediate ) and > 2 mg / l ( resistant ) ; for posaconazole , < 0.25 , 0.5 and > 0.5 mg / l respectively . \n it is suggested to differentiate between single - azole , pan - azole and multi - azole resistance ( see table 1 ) , the majority of infections is associated with clinical failure when treated with the ascertained agent . azole resistance in a. fumigatus mics = minimal inhibitory concentrations \n yet reports from the netherlands and manchester display an alarmingg increase of azole resistance in a. fumzgatus since 1998 . \n the first published case of itraconazole - resistance in a. fumigatus appeared in 1997 ; in 2000 , a survey testing over 900 isolates showed a 2% prevalence of itc resistance in manchester . in 2007 the percentage of patients with an azole - resistant a. fumigatus increased up to 15% . in the netherlands azole resistance \n increased dramatically from 2.5% in 2000 , to 4.9% in 2002 , to 6.6% in 2004 and to 10% in 2009 . \n this represents an increasing frequency of 6% per year and is an issue due to the limited number of antifungals . \n overall , azole - resistance differs from country to country and occurred sporadically in belgium , denmark , france , sweden , spain and norway [ 33 - 39 ] . in spain , \n the prevalence is about 2% among clinical a. fumigatus and in austria about 0% . in the usa , \n species with mics of voriconazole and posaconazole > 2 mg / l remain rare , less than 1% . \n the clinical presentation and disease evolution may be related to the underlying genotypes in a. fumigatus ( table 2 ) . \n clinical overview of azole resistance in a. fumigatus abpa = allergic bronchopulmonary aspergillosis azole drug resistance in a. fumigatus has been reported both , before and after drug exposure ; acquired resistance appears to develop through treatment of patients or through exposure of isolates to azole fungicides in the environment . \n these findings have major implications for clinical practice especially as fungal drug resistance is an acute issue due to the limited number of antifungal compounds . \n experts expect that triazole resistance in this haploid , sparingly sexual worldwide airborne fungus will increase . \n key elements in the management of patients will be an accurate speciation of aspergillus species and the performance of in vitro susceptibility testing for an approbiate antifungal treatment . \n presently we do not have exact data on the prevalence of azole - resistance aspergilli in germany , but seems to be rather low than high . \n where invasive candidiasis was once the predominant type of invasive fungal infections , invasive mould infections have become increasingly important , including those caused by unusual pathogens . \n aspergillus species are the most frequent mould pathogens , but the number of infections caused by previously rare pathogens , such as the zygomycetes and fusarium species , is increasing . \n the reasons for the shift in the epidemiology are multifactorial , but are a result , at least in part , of the increased use of extensive voriconazole and echinocandins as prophylaxis / treatment . as a result of growing numbers of immune - suppressed patients with risk factors , the patient populations for ia will expand and will include patients with haematological malignancy , icu intervention , pulmonary disease [ e.g.chronic obstructive pulmonary disease ( copd ) and asthma ] , sot recipients and patients with solid tumours . \n much less is currently known about echinocandin resistance in aspergillus , in part because susceptibility testing is not routinely performed and because the methods suffer from technical difficulties and suboptimal reproducibility ; breakthrough infections with a. fumigatus showing high minimum effective concentrations have been reported sporadically . \n so far , the selection pressure of candins has risen and the development of resistance is presumed to be inevitable . \n these antifungals bind to lanosterol 14--demethylase ( 14--dm , or cyp51p ) which is encoded by the erg11 genes . \n such step leads to depletion of ergosterol and an accumulation of lanosterol and other toxic 14--methylated sterols . \n several pathomechanisms account for azole resistance in a. fumigatus ; these include a modification of target enzymes , an increased expression of drug efflux mechanisms , an overexpression of target enzymes , an incorporation of exogenous cholesterol , an overexpression of hsp90 and of a sterole - regulatory element binding protein . \n the resistance phenotype depends on the amino - acid substitution and more than one azole can be affected . \n azole - resistant isolates have been reported as multidrug resistant , multiazole resistant , azole cross - resistant and multiple - triazole resistant isolates . in most cases \n azole resistance has been associated with point mutations in cyp51a , which represents the target enzyme of the azoles ; hot spots at codons 54 , 98 and 220 are most frequently characterized [ 26,33,35,48 - 50 ] . \n interestingly , other mutations have been found in azole susceptible strains and so are unlikely to be associated with resistance . \n the resistance mechanisms differ between the dutch and british azole - resistant isolates ; in the netherlands , the presence of a single resistance mechanism ( denoted by tr / l98h , a point mutation at codon 98 accompanied by a tandem repeat in the promoter region ) , was found in over 90% of clinical a. fumigatus isolates . \n by contrast , several cyp51a mutations are present in the uk strains and no prevalence of any one alteration \n . the reasons for this might be due to differences in the patient population from which the isolates originate . \n azole - resistance may develop due to exposure of a. fumigatus to azole fungicides for plant protection . \n howard et al . suggest that the reasons of the widespread increase of azole - resistance in the uk may be part of long - term azole drug exposures in patients . \n echinocandins are a unique class which block the -(1,3)-d - glucan synthesis by inhibiting - ( 1,3)-d - glucan synthase . \n much less is currently known about echinocandin resistance in aspergillus and only few clinical isolates associated with treatment failures have been investigated . in such isolate mutation in the fks1 target gene \n was not detected , but expression of the fks1 gene was found to be upregulated . manipulated or laboratory - selected strains with various degrees of caspofungin resistance have been described . \n some of these strains have been found to have mutations in the ecm33 gene ( afuecm33 ) , encoding cell wall proteins . \n strains with mutations in the fks1 gene encoding a subunit of the -1,3-d - glucan synthase enzyme have been generated . \n in other resistant aspergillus mutants the glucan synthase exhibited a wild - type affks1 gene sequence , where the function , level , and the enzyme itself were susceptible to caspofungin . \n for example , aspergillus niger is much more susceptible to echinocandins than other species probably in charge of its different cell - wall composition . \n aspergillus lentulus isolates are less susceptible to caspofungin , although they maintain susceptibility to anidulafungin and micafungin . \n the analysis of the a. lentulus fks sequence did not reveal a polymorphism at any of the known hot - spot regions of the gene . \n cross - resistance patterns are closely linked with the position of the mutation in the cyp51a gene . \n isolates with mutations at codon 54 remain voriconazole susceptible although cross - resistant to posaconazole . \n cross - resistance patterns in isolates with m220 alterations appear to be unpredictable , particularly with respect to voriconazole . \n the risk of cross - resistance between the azole compounds is high , in one report 74% and 65% of itraconazole resistant isolates were cross - resistant to posaconazole and voriconazole respectively . between itraconazole , voriconazole and ravuconazole cross - resistance \n was demonstrated in 10 clinical isolates of a. fumigatus obtained from patients with long - term exposure to itraconazole or voriconazole . \n also , broad - spectrum cross - resistance among all the azoles has been shown in a. fumigatus in a patient receiving prolonged itraconazole prophylaxis . \n overall , there is a limited number of reported cases that help us to understand the clinical impact of azole resistance on clinical outcome . \n for example , in a small case series of patients with ia and no respond to voriconazole , treatment with posaconazole was successful in 50% of infections . on the other hand in animal model of ia caused by an itraconazole - resistant a. fumigatus strain , \n the potential frequency of cross - resistance amongst echinocandins in aspergillus species is still unclear and has not been investigated in detail . at present , there is no evidence that the activity and efficacy of other antifungal compounds , such as the polyenes and echinocandins , is attenuated in azole - resistant isolates .", "role": "user" }, { "content": "aspergilli , less susceptible to antifungals emerge and resistance to azoles have been found mainly in aspergillus fumigatus ; this has launched a new phase in handling aspergillosis . \n resistant strains have currently been reported from belgium , canada , china , denmark , france , norway , spain , sweden , the netherlands , uk and the usa . \n centres in the uk ( manchester ) and the netherlands ( nijmegen ) have described particularly high frequencies ( 15 and 10% respectively ) , and a significant increase in azole resistance in recent years . \n the reason of this high incidence may be due to long term azole therapy in patients with chronic aspergillosis in manchester , and due to high use of agricultural azoles in nijmegen . \n the primary underlying mechanism of resistance is as a result of alterations in the cyp51a target gene , with a variety of mutations found in clinical isolates and one genotype identified in the environmental ( lh98 ) . \n reports on well documented in vitro and in vivo resistance to echinocandins are rare for aspergillus species and resistance may be under - diagnosed as susceptibility testing is less frequently performed due to technical reasons .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: mr . a is 73-year - old gentleman who had left upper lobectomy for adenocarcinoma of left lung 4 years back . \n subsequently he was treated with tyrosine kinase inhibitor erlotinib ; in view of positive egfr mutation status . \n he developed worsening of respiratory symptoms and imaging showed further progress of the interstitial shadows . \n he subsequently recovered . on account of poor lung function and low pao2 , he required long - term oxygen therapy . \n sequentially a trial of treatment with steroids and pirfenidone did not help the lung function or the oxygenation status . however , there was no recurrence of malignancy for a 4-year period after the surgery . \n he had other co - morbidities including atrial fibrillation and subclavian vein thrombosis which were treated medically . in view of his poor quality of life , \n written informed consent was obtained after extensive repeated discussion with the patient and his family . \n the case was discussed in the institutional clinical ethics committee and approval was obtained for this experimental therapy . \n mesenchymal stromal cells ( msc ) were prepared in- house from a cohort of voluntary donors who are not hla matched [ figure 1 ] . \n we planned to give four ; monthly intravenous infusions each containing 100 10 cells of mscs . \n the patient tolerated the first infusion of msc , which was given in the intensive care unit with continuous hemodynamic and respiratory monitoring , without any problem . \n immediately after the infusion , the patient developed hypotension with systolic blood pressure falling to 70 mmhg and he developed a skin rash . \n he was resuscitated with intravenous fluids and further doses of hydrocortisone , following which he quickly recovered . \n the serial serum tryptase levels were 48.5 and 83.7 ug / l ( normal < 11.4 \n he was reviewed after 1 , 3 and 6 months and there were no changes in arterial blood gas parameters , pulmonary function parameters or 6-minute walk distance . \n mesenchymal stromal cells ( msc ) are characterized post ex - vivo expansion by the characteristic ( a ) morphology ( spindle shaped ) and flowcytometry pattern of the expanded cells which are ( b ) negative for cd45 and cd34 ( excludes hematopoietic elements ) and ( c ) positive for cd73 , cd90 and cd103 ( classical positive in msc ) \n more recently pirfenidone treatment has shown some promise . but none of the agents have been proven to be effective in majority of patients with advanced interstitial fibrosis . in relatively young patients with limited comorbities , lung transplantation is an option . in the majority of patients , supportive measures , oxygen therapy and pulmonary rehabilitation \n mesenchymal stromal stem cells are pluri - potent cells ; which can differentiate in various cell lines and have anti - proliferative and local immune - modulatory properties . \n mesenchymal stem cells are known to home to site of cell injury , inhibit inflammation and hasten cell repair . \n hence msc are being considered for treatment of advanced lung diseases like copd and ild . \n another advantage is that msc lack hla expression and hence hla matching is not required . \n there are human trials using msc in conditions like myocardial infarction , graft - vs - host disease and refractory lupus erythematosis . \n weiss et al . did a randomized control trail with msc in 62 patients with advanced copd . \n there were no immediate serious adverse events attributable to msc administration . in the 2-year follow - up period \n , there were no significant differences in the adverse events , frequency of copd exacerbations , pulmonary function parameters or quality of life indicators . \n our patient needs a longer follow - up to see whether there are any long - term benefits . \n tzouvelekis et al . , studied three endobronchial infusions of autologous adipose derived stromal cells in 14 patients with ild . \n no clinically significant adverse effects were noted and functional parameters were stable for 12 months . \n although our patient tolerated the first infusion well , the second infusion was complicated by anaphylaxis . \n this could be due to foreign proteins / peptides in the infusate or the dmso ; which was used as a preservative . \n he may have developed sensitization to the reagent during the first infusion and subsequently reacted to the second infusion . \n dmso is the most favorable cryoprotectant ; however , it is associated with significant side effects . \n nausea , vomiting , and abdominal cramps occur in about half of all the cases . \n once the results are available we will have more definite information regarding the hope of successful treatment of this debilitating and fatal disease . in conclusion , our attempt to use msc treatment for extensive lung fibrosis has so far not produced positive results , but has resulted in serious side effects . \n therefore , any human trial should be offered with knowledge of this and only done in an intensive care unit set up .", "role": "user" }, { "content": "there are limited treatment options for advanced interstitial lung disease ( ild ) . \n we describe a patient of ild treated with mesenchymal stromal stem cell infusion . \n the index patient had end - stage ild due to a combination of insults including treatment with radiotherapy and a tyrosine kinase inhibitor erlotinib . \n he was oxygen - dependent and this was hampering his quality of life . \n he tolerated the first infusion stem cells without any problem . during the second infusion he developed anaphylactic shock , which was appropriately managed . at 6-months \n follow - up he had no improvement in oxygenation , pulmonary function or ct scan parameters . in view of anaphylaxis , further infusions of msc \n were withheld . \n a longer follow - up may reveal long - term benefits or side effects , if any . \n however the occurrence of anaphylaxis is of concern suggesting that further trials should be conducted with intensive monitoring .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a handheld dynamometer ( hhd ) is a device used to measure muscular strength using a ratio \n scale of measurement . in the conventional measuring method using an hhd \n , the measurer holds \n the hhd in a hand and then measures muscle strength . \n however , this method has a limitation \n regarding fixation of the hhd1 , 2 . as a countermeasure for this problem , \n measurement methods \n in combination with a stick3 , steel \n support4 , or belt5 , 6 have been reported \n to date . \n katoh et al.7 measured lower limb muscle \n strength using a method for fixing an hhd with a belt and examined its validity by comparing \n the measured values with those of an isokinetic dynamometer ( ikd ) . \n their results \n demonstrated that the pearson s correlation coefficients between the measurement methods \n were as follows hip flexion , r=0.52 ; hip extension , r=0.84 ; hip abduction ( abd ) , r=0.34 \n ( < 450 n ; r=0.65 ) ; hip adduction , r=0.52 ; hip external rotation ( er ) , r=0.86 ; hip internal \n rotation , r=0.77 ; knee flexion , r=0.88 ; and knee extension , r=0.75 . from these results , \n use \n of an hhd fixed with a belt was concluded to be a valid strength measurement method , except \n in subjects who have a high level of hip abductor strength . \n however , as the correlation \n coefficient for hip abd was the lowest , it was also considered to be necessary to revise the \n measurement method . \n abd with hip er in the hook - lying position is called the bent knee fall out ( bkfo)8 . moreover , abd with er in hip and knee \n flexion positions on side - lying is called the clamshell ( clam ) exercise9,10,11,12 . \n the bkfo and \n clam are used as hip joint exercises in a non - load environment . \n electromyography activities \n of the gluteus medius during performance of the clam are lower than those during crotch abd \n exercises conducted in the hip and knee extension positions9 , 10 . \n moreover , the authors \n reported that the activity of the gluteus medius during the clam is lower than that during \n hip abd exercises conducted in the hip and knee extension positions . \n thus , these findings \n suggest that the activity of the gluteus medius is changed by the hip flexion angle9 , 10 \n . \n however , the activities of the tensor fascia latae , gluteus maximus , and anterior hip \n flexors are not significantly different even if the flexion angle of the hip joint is \n changed11 . \n therefore , the clam is used \n as a movement to lower the load of the gluteus medius . when the clam and bkfo are used as hip - strengthening exercises \n , it is necessary to measure \n the muscle strength to set the amount of load and to achieve the appropriate effects . \n however , a search in pubmed on december 20 , 2015 , using the key words muscle strength , \n clamshell , muscle strength , and bent knee fall out did not find any reports . \n clarifying the reliability and validity of muscle strength measurements in the clam and bkfo \n positions would contribute to design of effective exercises . \n therefore , this study aimed to examine the reliability and validity of muscular strength \n measurements in clam , bkfo , and revised abd muscular strength measurement . \n in addition , this \n study aimed to examine the correlation among the muscular strength measurements . \n the subjects comprised 20 young healthy volunteers ( nine females ) with no history of \n orthopedic disease in the limbs or trunk of the body or cardiac disease . \n the mean age was \n 21.5 0.6 years , mean height was 164.3 9.4 cm , and mean weight was 59.3 14.0 kg . \n the \n study aim and details were explained to the subjects , and measurements were performed after \n obtaining informed written consent . \n approval from the human ethics committee of ryotokuji \n university ( approval number 2537 ) was obtained for this study , and it adhered to the tenets \n of the declaration of helsinki . \n the isometric hip joint and muscular strengths of the right leg were measured using an hhd \n and ikd , respectively . \n the assessor was a male physiotherapist ( height , 167.0 cm ; weight , \n 69.0 kg ; and 18 years of experience ) . for blinding of assessors and subjects , \n muscle strength was measured under two conditions : 1 ) abd and er with hip flexion and 2 ) \n abd . \n the abd and er muscle strengths in the hip joint were measured using an hhd in the \n supine position ( hhd - bkfo ) , using an hhd in the side - lying position ( hhd - clam ) , and using an \n ikd in the side - lying position ( ikd - clam ) . \n abd and er with hip flexion were performed with \n hip flexion of 45 and knee flexion of 90 ( fig \n a , handheld dynamometer , bent \n knee fall out ; b , handheld dynamometer , clamshell ; c , isokinetic dynamometer , \n clamshell ) . \n abd was measured using an hhd in the supine position ( hhd - abd ) , using an hhd in the \n side - lying position ( hhd - sl abd ) , and using an ikd in the side - lying position ( ikd - sl abd ) . \n in the case of measurement in the side - lying position , \n the strength of the upper side of the \n lower limb was measured ( fig . \n 2.hip abduction . a , handheld dynamometer , hip abduction ; b , handheld dynamometer , \n side - lying hip abduction ; c , isokinetic dynamometer , side - lying hip abduction ) . \n the subjects inserted a cushion between both the lower limbs to achieve measurement \n in a neutral adduction position /abd in the hip joint . \n a , handheld dynamometer , bent \n knee fall out ; b , handheld dynamometer , clamshell ; c , isokinetic dynamometer , \n clamshell hip abduction . a , handheld dynamometer , hip abduction ; b , handheld dynamometer , \n side - lying hip abduction ; c , isokinetic dynamometer , side - lying hip abduction a tas f-1 ( anima corp , tokyo , japan ) was used as the hhd for measuring muscle strength . \n an \n hhd sensor was fixed in place using a belt , and the isometric muscular strength was \n measured . the location for applying the hhd sensor ( the location of the distal part of the \n sensor ) , belt location , joint angles , and fixed location at the time of measurement \n are \n shown in table 1table 1.measurement methodsabbreviationexerciseposturehipknee jointhhd - abdhip abductionsupinemiddleextensionhhd - sl abdhip abductionside - lyingmiddleextensionikd - sl abdhip abductionside - lyingmiddleextensionhhd - bkfohip abduction and external rotationsupine45 flexion90 flexionhhd - clamhip abduction and external rotationside - lying45 flexion90 flexionikd - clamhip abduction and external rotationside - lying45 flexion90 flexionabbreviationsensor pad location belt locationfixed locationhhd - abdupper lateral thigh boneboth thighsthigh ( non - measurement side)hhd - sl abdupper lateral thigh boneboth thighspelvis ( measurement side)ikd - sl abdstraight on the lateral thigh bone thigh / trunk ( measurement side)hhd - bkfoupper lateral thigh boneboth thighsthigh / leg ( measurement side)hhd - clamupper lateral thigh boneboth thighspelvis / leg ( measurement side)ikd - clamstraight on the lateral thigh bone thigh / trunk / ankles ( measurement side)hhd : handheld dynamometer ; abd : hip abduction ; sl : side - lying ; ikd : isokinetic \n dynamometer ; bkfo : bent knee fall out ; clam : clamshell . \n lower extremity \n supported on same plain , cushion placed between legs , c ) \n sensor held in correct orientation . \n following a single practice trial , the subjects performed isometric contraction at their \n maximum exertion for approximately 5 s , and the maximum muscle strength during this task was \n recorded . a second measurement was performed after at least 30 s of rest . \n hhd : handheld dynamometer ; abd : hip abduction ; sl : side - lying ; ikd : isokinetic \n dynamometer ; bkfo : bent knee fall out ; clam : clamshell . \n lower extremity \n supported on same plain , cushion placed between legs , c ) \n sensor held in correct orientation a biodex system 3 ( biodex medical systems , shirley , ny , usa ) was used as the ikd equipment . \n the ikd pad position ( the position of the distal part of the pad ) was the same as the hhd \n sensor position ( table 1 ) . in the ikd - clam \n measurement , \n the seat was rotated 45 , and a stand , which was the same height as the seat , \n was set to prevent falling of the leg . moreover , both legs were fixed with a strap to \n prevent deviation in the external hip rotation axis ( fig . \n 1 ) . following a single practice trial , the subjects performed three trials of \n isometric maximum voluntary contraction for approximately 5 s with rests of at least 30 s \n between each , and \n the orders of the four \n measurements using the hhd and the two measurements using the ikd were also counterbalanced . \n therefore , nm ( kg , m / s ) was \n calculated based on the acceleration of gravity ( 9.8 m / s ) and the lever arm \n length ( distance from the greater trochanter to the sensor center , m ) to perform the \n comparison with the ikd measurement values . \n the intra - class correlation coefficient ( icc ) was used to evaluate the intra - rater \n reliability of the measurement values using the hhd . \n the validity of the measurement values \n using the hhd was investigated using pearson s product moment correlation coefficient with \n respect to the standard rated validity and by setting the ikd measurement values as the \n external standard . \n the differences in measurement values were assessed using two - way repeated measures \n analysis of variance ( anova ) with the measurement device [ hhd ( supine ) , hhd ( sl ) , and ikd \n ( sl ) ] and measurement posture ( abd and er in hip flexion , abd ) as the two factors ; the two \n highest measurement values were used for this . moreover , the ratio of the hhd measurement \n value to the ikd measurement value ( hhd / ikd ; the hhd / ikd ratio ) was obtained . \n all statistical analyses were performed using the r2.8.1 statistical software , and p values \n of < 0.05 were deemed significant . \n the icc ( 1 , 1 ) for the values of two consecutive measurements using the hhd was 0.940.98 \n ( table 2table 2.hhd measurement test - retest reliabilityicc ( 1,1)95% ciabd0.980.940.99sl abd0.940.860.98bkfo0.980.950.99clam0.970.940.99hhd : handheld dynamometer ; abd : hip abduction ; sl : side - lying ; bkfo : bent knee fall \n out ; clam : clamshell ; icc : intraclass correlation coefficient ; ci : confidence \n interval ) . for each movement item , \n the pearson s correlation coefficient between the \n hhd in the supine position and ikd and between the hhd in the side - lying position and ikd \n were r=0.820.86 ; significantly positive correlations were found in both cases . in all \n measurement methods , \n the pearson s correlation coefficient between the two types of movement \n were r=0.860.88 , and significantly positive correlations were found for all . \n also , there \n were significant positive correlations between the other measurement values ( table 3table 3.correlations among measurementshhd - abdhhd - sl abdikd - sl abdhhd - bkfohhd - clamikd - clamhhd - abd10.85**0.82**0.88**0.82**0.73**hhd - sl abd10.82**0.92**0.86**0.77**ikd - sl abd10.89**0.78**0.87**hhd - bkfo10.93**0.86**hhd - clam10.84**ikd - clam1hhd : handheld dynamometer ; abd : hip abduction ; sl : side - lying ; ikd : isokinetic \n dynamometer ; bkfo : bent knee fall out , clam : clamshell . * * p<0.01 ) . \n hhd : handheld dynamometer ; abd : hip abduction ; sl : side - lying ; bkfo : bent knee fall \n out ; clam : clamshell ; icc : intraclass correlation coefficient ; ci : confidence \n interval hhd : handheld dynamometer ; abd : hip abduction ; sl : side - lying ; ikd : isokinetic \n dynamometer ; bkfo : bent knee fall out , clam : clamshell . * \n * p<0.01 the values obtained from measurements using the hhd and ikd are presented in table 4table 4.average values of strength measurementshhdsupinehhdside - lyingikdside - lyinghhd / ikd ratiosupine side - lyinghip abduction99.898.1103.20.970.95(sd=29.4)(sd=33.2)(sd=34.1)hip abduction and external rotation with hip \n flexion91.990.0103.90.880.87(sd=31.4)(sd=36.8)(sd=41.5)mean ( sd ) nm . \n hhd : handheld dynamometer ; ikd : isokinetic dynamometer . a ) \n bkfo , bent knee \n the results of two - way repeated measures anova did not determine main effects \n for the measurement device , measurement posture , movement type , or interaction between \n factors . \n hhd : handheld dynamometer ; ikd : isokinetic dynamometer . a ) \n bkfo , bent knee \n the results showed that the icc ( 1 , 1 ) for the values obtained from measurements using the \n hhd was 0.9 , and the reliability was considered to be high . \n previously , katoh et al.13 reported reliability amongst assessors in \n hip abd muscle strength measurement using an hhd and a belt . their results from performing \n three measurement sessions , one in the morning , afternoon of the same day , and 1 week later , \n showed that the icc ( 1 , 1 ) for two consecutive measurements of hip abd ranged between 0.93 \n and 0.95 . in previous studies , \n the hhd / ikd ratio was 0.34 for hip abd , and a significantly \n lower measurement value was obtained with an hhd compared with an ikd7 . \n the results of the present study revealed that the icc ( 1 , \n 1 ) was 0.940.98 , which was similar to the high values obtained in previous studies \n . \n however , the results of this study did not reveal significant differences in the mean \n values , and the hhd / ikd ratio was close to 1 . \n moreover , because there was significant \n correlation between the hhd and ikd measurement values , it was considered that the abd \n measurement method utilized a superior fixation method compared with the methods used in \n proceeding studies and thus provided higher validity . because the lower limbs on the \n non - measurement side were used for belt fixation in this measurement method , it was expected \n that the muscular strength value on the measurement side decreased when there was hip \n extension muscle weakness on the non - measurement side . \n it was considered that examination of \n the method for measurement of that case is necessary . there was no significant difference between the mean values for clam muscle strength using \n the hhd and ikd , and high correlation was found . \n therefore , it can be considered that the \n validity of clam muscle strength measurement using the hhd was high . \n there was no significant difference between clam muscle strength using the hhd or ikd and \n the bkfo muscle strength , and high correlation was demonstrated . \n this suggests that the bkfo \n can be used as a method that is interchangeable with the clam in patients who have \n difficulty in side - lying . \n significant positive correlations between the other measurement values were also found , \n which was acceptable because the same agonist muscle was used for these movements . \n therefore , it was considered that clam measurement values should be used in place of hip abd \n muscle strength measurement values in patients who have difficulty with hip or knee \n extension . \n the limitation of this study was that the subjects were healthy young people , and it was \n unclear whether similar results would be obtained in elderly people who are frail or \n suffering from muscle- or bone - related diseases . \n therefore , it is desirable to perform \n further investigations on different subjects . in conclusion , it was considered that abd and er ( clam , bkfo ) muscle strength measurement \n and the revised abd muscle strength measurement in a bent - hip position using an hhd together \n with belt fixation , have high reliability and validity . \n furthermore , there was a significant \n correlation between each muscular strength measurement , and it was considered that clam \n measurement values should be used in place of hip abd muscle strength measurement values in \n patients who have difficulty with hip or knee extension .", "role": "user" }, { "content": "[ purpose ] this study aimed to investigate the relatedness , reliability , and validity of \n isometric muscle strength measurements of hip abduction and abduction with an external hip \n rotation in a bent - hip position using a handheld dynamometer with a belt . \n [ subjects and \n methods ] twenty healthy young adults , with a mean age of 21.5 0.6 years were included . \n isometric hip muscle strength in the subjects right legs was measured under two posture \n positions using two devices : a handheld dynamometer with a belt and an isokinetic \n dynamometer . \n reliability was evaluated using an intra - class correlation coefficient ( icc ) ; \n relatedness and validity were evaluated using pearson s product moment correlation \n coefficient . \n differences in measurements of devices were assessed by two - way anova . \n [ results ] \n icc ( 1 , 1 ) was 0.9 ; significant positive correlations in measurements were \n found between the two devices under both conditions . \n no main effect was found between the \n measurement values . \n [ conclusion ] our findings revealed that there was relatedness , \n reliability , and validity of this method for isometric muscle strength measurements using \n a handheld dynamometer with a belt .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the therapeutic instrument music performance ( timp ) technique uses instruments to reinforce \n functional motor patterns ; the instruments are usually percussive instruments , which do not \n require any previous music skills1 . \n instrumental piano training entails the repetition of fine finger movements as well as \n finger and hand coordination . \n furthermore , those performing the movement receive immediate \n auditory feedback regarding performance and can therefore try to correct their own \n performance2 . for fine motor skill \n training , timp usually uses the keyboard as its main rehabilitative intervention instrument . \n therapeutic keyboard music playing ( tkmp ) \n uses familiar melodies of famous music pieces to \n explore a new type of timp . according to past research , tkmp not only provides pleasure from making audible music but \n also motivates individuals to participate in rehabilitation by using their affected and \n intact hand functions1 . \n although there has \n been some research supporting the application of timp for brain injury , cerebral palsy , and \n neuro - rehabilitation , less research supports tkmp used for physical therapy ( pt ) . \n actually , \n timp , especially the tkmp method , is very suitable for patients with hand dysfunctions . \n rehabilitation of finger movement function during pt for patients with spinal cord injuries \n is based on more precise controlling exercises . \n patients were asked to perform to the best of their ability , but the \n patients always felt tired . \n however , tkmp is a new way to facilitate functional non - musical \n outcomes by training and retraining the hand and fingers to achieve motor control and hand \n muscle recovery . \n this experiment was used to observe the immediate effects of tkmp on variations in the \n joint position error ( jpe ) test , surface electromyography ( semg ) , probe reaction time \n ( p - rt ) , and writing time after intervention . \n in addition , it was also performed to explore a \n more effective method that includes physical hand exercises and tkmp techniques to help in \n the recovery of patients with hand dysfunction . \n the subjects had a mean age of \n 26.4 3.1 years , an average height of 170.0 5.6 cm , and a mean body weight of 64.5 \n 7.2 kg . \n they were selected at random from the medical school interns who were able to \n independently perform activities of daily living . \n they participated in the experimental \n group and in the control group on different days . \n the same subjects were also used as the control group and performed grip \n training , but not on the same days as when tkmp therapy was performed . \n all subject \n characteristics are detailed in table \n 1table 1.subject characteristicsmean sdn=10age ( yrs)26.4 3.1height ( cm)170.0 5.6weight ( kg)64.5 7.2 . before the experiment , all subjects were tested using the following : jpe test , semg , p - rt , \n and writing time . \n after all interventions were accomplished , subjects were evaluated by \n using the tests again to observe the intervention effects . \n the purpose and contents were \n explained to the subjects before the experiment , and they gave their informed consent to \n participate . \n all experimental procedures in this study were explained to them and were \n approved by the research ethics committee of the china rehabilitation research center ( irb \n no . \n the subjects sat on low chairs with their shoulders and backs straight , and they placed \n their right hand naturally on the keyboard . in the experimental group , \n the subjects were \n trained to play musical pieces for approximately 20 minutes under the guidance of the music \n therapist . the music piece \n ode to joy , which was written by the famous german classical \n composer beethoven , was familiar to all the experimental group participants . \n the melody used \n in this experiment was only eight bars with 42 beats in c major . in the control group , \n the \n subjects were trained with grip training under the guidance of the physical therapist . \n it is also considered the primary measure of upper limb \n proprioception and has been widely used as an outcome measure for patients with cervical \n spinal cord injury4 . \n although there are \n few reports to support its use for measuring other joints , it has been widely used as an \n effective evaluation of angle joints . during the jpe test , \n rom measurement equipment ( bioval \n 4.51 , sycomore 8.51 , rmingenierie , france ) was used . \n the fixed and mobile arms were the \n vertical axis of the radius and fifth metacarpal ; the extension angles of the wrist joints \n were recorded by the computer . \n the subjects were asked to close their eyes , and the examiner \n extended the subjects wrist joints at random angles . \n the subjects wrist joints were put \n back on tables , and they were asked to extend their wrists at approximately the same angles \n as in the initial extension . \n each \n measurement was performed five times , and the average value was used for analysis . \n semg tests the muscle function \n through the inquiry of the electrical signal that the muscle emanates5 . \n it is reported that semg evaluation data are usually \n collected by an semg system ( telemyo 2400 t ; noraxon , scottsdale , az , usa)6 . in this experiment \n the p - rt was tested using a digital audio player / recorder ( rio japan ) . \n the recorder was \n used to play the stimulus signals to the subject and the subject s vocal response was \n recorded through the microphone . \n a digital audio player / recorder was used to record the \n vocal response that the subject had in response to the stimulus signal . \n the sounds yoi and \n pi were pre - recorded on the rio player . \n yoi gave notice that the test would begin , and \n pi was the stimulus signal . \n the results were downloaded to a pc , and the time between the auditory \n stimulus of pi and the utterance of pa during p - rt was evaluated7 . during the writing time evaluation , \n the subjects were asked to write the uppercase english \n alphabet with their left hand on a4 paper . \n all the subjects in the experimental group were trained with the same musical pieces and \n the same playing method with the five fingers of their right hand . during the 20-minute \n therapeutic sessions , \n the music therapist first taught them the single melody ; when the \n subjects were accustomed to playing the melody , the music therapist began to accompany them \n with the same harmony until they were quite skilled in playing . \n the musical pieces played by \n the experimental group with their right hands are shown in fig . \n musical piece played by the experimental group with their right hands two - way repeated - measures analysis of variance ( anova ) was used to assess and evaluate \n statistically significant differences in the intervention of the two groups . \n if any \n significant interaction was found , then the paired t - test was used to compare the outcome \n indicators before and after the intervention . \n data were analyzed with spss version 17.0 for \n windows ( spss , chicago , il , usa ) . \n the data for the jpe test , semg , p - rt , and writing time for the two groups are shown in \n table 2table 2.intervention effects of tmkpa . \n 1.23.6 1.63.4 1.6b < a , c , d * ave semg ( v)951.4 914.9839.2 496.61,061.4 635.2890.3 505.2max semg ( v)4,827.7 3,951.35,347.2 3,086.55,996.7 4,357.06,061.0 3,123.4p - rt ( ms)383.2 81.5323.7 53.4399 . \n 3 112.0426.8 155.8b < a , c , d * writing time ( s)21.9 3.418.8 4.421.7 4.021.6 3.6b < a , c , d * * p<0.05 ; p<0.01 . \n there were no significant differences in average and maximum muscle strength ; however , \n there was an obvious interactive function of the jpe test and p - rt in the two groups . \n the \n paired t - test results after tmkp showed that writing time , p - rt , and jpe test score all \n significantly decreased . \n tkmp was used as an intervening variable to train the experimental group subjects to \n improve their jpe test , semg , p - rt , and writing time results . \n grip training was used to \n train the control group subjects so that the results could be compared to those of the \n experimental group trained with the tkmp method . \n there were no significant differences in the maximum semg \n between the two groups , which meant that grip training played the same role as tkmp training \n for muscle strength . \n the experimental group subjects reported feeling joyful and interested \n during the music training , but there was no obvious enhancement on semg . according to the data shown in table 2 , there \n was a significant improvement in jpe test , p - rt , and writing time . \n this meant that the tkmp \n intervention was more effective than grip training for reinforcing finger movement \n functions . \n compared to other traditional therapy methods such as grip training or other \n occupational therapy , the tkmp method provided tremendous advantages . in this experiment , \n the famous music work \n ode to joy , which was very familiar to every subject , was used . \n it \n was easy for the subjects to follow the melody and learn how to play . \n the melody , which was \n easy for the subjects to memorize , played an active role in the session . \n although the active \n psychological effects of the music were not evaluated during this experiment , they were \n evident in the writing time and p - rt results . \n music , as an acoustic expression of art , has \n unique aesthetic functions that could help improve the training efficacy . \n in addition , tkmp \n combined with a familiar melody provided an interesting way to practice hand muscle function \n and was more diverse and effective than traditional occupational therapy or pt . \n finally , for writing time , there was an obvious \n enhancement in speed after keyboard playing that was not seen after grip training . \n therefore , tkmp is an effective and novel treatment that should be widely promoted in \n clinics .", "role": "user" }, { "content": "[ purpose ] the purpose of this study was to examine the immediate effects of therapeutic \n keyboard music playing on the finger function of subjects hands through measurements of \n the joint position error test , surface electromyography , probe reaction time , and writing \n time . \n [ subjects and methods ] ten subjects were divided randomly into experimental and \n control groups . \n the experimental group used therapeutic keyboard music playing and the \n control group used grip training . \n all subjects were assessed and evaluated by the joint \n position error test , surface electromyography , probe reaction time , and writing time . \n [ results ] \n after accomplishing therapeutic keyboard music playing and grip training , \n surface electromyography of the two groups showed no significant change , but joint \n position error test , probe reaction time , and writing time obviously improved . \n [ conclusion ] \n these results suggest that therapeutic keyboard music playing is an effective \n and novel treatment for improving joint position error test scores , probe reaction time , \n and writing time , and it should be promoted widely in clinics .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in the united nations 2000 declaration of the millennium development goals , improvement of maternal health was regarded as an essential prerequisite for human development and for poverty reduction ( 1 ) . although pregnancy is a normal life - course event that most women aspire to at some point in their lives , about eight million women develop pregnancy - related complications every year , and of them , over half a million die ( 2 ) . even in the context of limited resources , \n most of these deaths could be avoided if preventive measures were taken and adequate care was available ( 1 ) . however , the right kind of information on which maternal mortality - prevention strategies are based is often missing ( 2 ) . in brazil , deaths are registered in the national mortality information system ( sim ) of the ministry of health . \n its coverage has been systematically increasing since its inception in 1976 , reaching 82% nationwide by 1999 , albeit with marked regional variation . \n of all the registered deaths , maternal deaths are particularly problematic , mainly due to inadequate assignment of causes of death in death certificates . as a strategy to improve the registration of maternal deaths , starting in 1994 \n , the ministry of health of brazil has encouraged the creation of the perinatal and maternal mortality investigation committees at both state and county health departments ( 3 ) . \n moreover , information on pregnancy , abortion , parturition , or puerperium in all women of reproductive age at death has been added to both national death certificate form and sim . \n in addition , maternal death reporting to the public - health surveillance system within 24 hours after demise has been mandated ( 4 ) . in 2002 , a nationwide study of maternal mortality was carried out in most brazilian state capitals ( 5 ) . based on household interviews and investigation of medical and hospital records and autopsies ( the reproductive age mortality study methodology ramos ) , the maternal mortality ratios ( mmrs ) were estimated , which were lower than the values reported by the world health organization ( who ) , united nations children 's fund , and united nations population fund . \n the estimated mmr adjustment factor for official data in brazil was equal to 1.4representing a 40% under - registration of maternal deaths based upon which the adjusted mmr was 54.3 maternal deaths per 100,000 livebirths . \n the authors highlighted the heterogeneous validity of data on maternal mortality across brazilian regions : quality of data was poorer in the north and northeast regions compared to the south and southeast regions where validity was higher . \n direct obstetric causes accounted for 67.1% of all maternal deaths , suggesting that both prenatal and childbirth care must be improved . as the epidemiological assessment of maternal mortality is important in revising old and developing new public - health strategies of prevention , we analyzed maternal deaths according to demographic , educational and obstetric characteristics in the city of rio de janeiro from 2000 to 2003 . \n the study was conducted in the city of rio de janeiro , the capital of rio de janeiro state , situated in the southeast region of brazil . in 2000 , the city had a population of 5,857,904 inhabitants ; the average number of livebirths per woman in reproductive ages ( 1549 years ) was 1.8 ( 6 ) , and 99% occurred in hospital settings ( 7 ) . \n data on maternal mortality were obtained from the sim and from records provided by the perinatal and maternal mortality investigation committee ( pmmic ) of the city of rio de janeiro . \n both information systems sim and sinasc have high coverage within the state of rio de janeiro ( 8) . the who defines maternal death as the death of a woman while pregnant or within 42 days of termination of pregnancy , irrespective of the duration and the site of the pregnancy , from any cause related to or aggravated by the pregnancy or its management but not from accidental or incidental causes . \n separate definitions were used for two categories of maternal deaths based on cause of death , which were termed direct obstetric deaths and indirect obstetric deaths. direct obstetric deaths included deaths resulting from obstetric complications of the pregnant state while indirect obstetric deaths were defined as \n deaths resulting from pre - existing disease or disease that developed during pregnancy , not due to direct obstetric causes , but exacerbated by the physiologic effects of pregnancy ( 9 ) . \n maternal deaths of women living in the city of rio de janeiro during 20002003 were investigated by the public - health surveillance services and further confirmed by the city 's pmmic . \n independent variables considered in analyses , as registered in the death certificates , were : age , race / colour ( reported by the doctor who submitted the death certificates ) , marital status , years of schooling , place where death occurred ( inside or outside hospital or clinic ) , reporting to the public - health surveillance system and pregnancy status ( whether death occurred during an abortion , pregnancy , or parturition yes , no , or ignored , or puerperium yes ( within 42 days after delivery or after 42 days up to one year after delivery ) , no or ignored ) , and the cause of death , according to the 10 revision of the international classification of diseases ( icd 10 ) . \n completeness of mortality data was evaluated through the proportion of missing information for each variable considered in the analyses . \n maternal deaths comprised all deaths due to obstetric causes ( icd 10 , chapter xv : direct obstetric causes , codes o00 to o92 ; unspecified obstetric causes , code o95 ; indirect obstetric causes , codes o98 to o99 , except codes o96 and o97late maternal deaths occurring more than 42 days but less than one year after delivery and death from sequelae of direct obstetric causes respectively ) and other selected causes outside chapter xv as follows : human immunodeficiency virus ( hiv ) disease , codes b20 to b24 , chapter i : neoplasms of uncertain or unknown behaviour of placenta , code d39.2 ; chapter ii : \n hypopituitarism , code e23.0 ; chapter iv : mental and behavioural disorders associated with the puerperium , not elsewhere classified , code f53 ; chapter v : \n the 95% confidence intervals ( cis ) of the mmrs were also estimated ( 10 ) . \n in total , 217 maternal deaths occurring during 20002003 in the city of rio de janeiro were identified , of which 208 ( 95.9% ) were classified as due to obstetric causes ( chapter xv , except codes o96 and o97 ) . \n the remaining nine deaths , due to hiv disease ( codes b20 to b24 , chapter i ) , were classified , after investigation , as indirect obstetric causes . \n fourteen additional deaths were also identified , of which nine had their causes coded as o96 ( late maternal deaths ) and five as o97 ( death from sequelae of direct obstetric causes ) . \n since all these additional 14 maternal deaths occurred 42 or more days after delivery , they were excluded from the present analyses . \n of the 217 maternal deaths , 58.1% were not reported to the public surveillance system . \n less than 1.0% of the maternal deaths occurred at health clinics , and in 5% , information on place where death occurred was missing . \n the demographic , educational and obstetric characteristics of the maternal deaths are presented in table 1 . \n demographic , educational and obstetric characteristics of maternal deaths , city of rio de janeiro , brazil , 20002003 age varied from 14 to 44 years ( median : 30.0 years ; meanstandard deviation ( sd ) : 29.67.3 years ) . \n approximately one ( 14.7% ) in seven women was adolescent ( aged 1019 years ) , with one death occurring under the age of 15 years . in the other extreme of the age distribution , \n almost three - quarters of the maternal deaths occurred between age 20 years and 39 years . \n the deceased women were predominantly non - white ( 48.9% ) , single ( 57.1% ) , and had 411 years of schooling ( 52.1% ) . \n however , data on years of schooling were missing in 22.6% of the death certificates . among all variables considered in the analysis , \n the variable for which most data were missing ( 43.8% ) was pregnancy status at the time of death . in 26.7% of the death certificates , \n doctors who provided care reported that they ignored whether death had occurred during an abortion , pregnancy , delivery , or puerperium ; in 17.1% , data on pregnancy status were either conflicting ( death was reported to have happened during abortion , pregnancy , or delivery and during puerperium in 9.2% ) , or insufficient ( data were missing on death prior to or during puerperium in 7.9% ) . considering only death certificates with adequate information ( 56.2% ) , for each maternal death that occurred during pregnancy or at parturition , about two women died during puerperium . \n more than three ( 77.4% ) in four maternal deaths of women living in the city of rio de janeiro from 2000 to 2003 were due to direct obstetric causes ( table 2 ) . \n hypertensive disorders ( codes o10 to o16 ) were the most common cause of death , accounting for 26.3% of all maternal deaths and for 33.9% of all direct obstetric causes . \n pre - eclampsia ( code o14 ) and eclampsia ( code o15 ) accounted for , respectively , 12 ( 7.1% ) and 19 ( 11.3% ) deaths due to hypertensive disorders . abortion ( codes o00 to o08 ) was the third main cause of death , accounting for almost one ( 14.3% ) in seven of the total deaths and the third cause among deaths due to direct obstetric causes ( 18.5% ) . \n ( code o99 ) were the most frequent indirect obstetric causes of death ( 73.7% ) mainly due to diseases of the circulatory system ( code o99.4 ) . \n the only cause of maternal death coded outside chapter xv of icd10 ( pregnancy , childbirth , and the puerperium ) was human immunodeficiency virus ( hiv ) disease ( codes b20 to b24 ) , accounting for about 4% of the total maternal deaths and 23.7% of all deaths due to indirect obstetric causes . in only one ( 5.1% ) in 20 maternal deaths , the obstetric cause was not specified ( code o95 ) . \n distribution of maternal deaths according to categories of cause of death ( icd-10 ) * , city of rio de janeiro , brazil , 20002003 * international classification of diseases . \n the distributions of demographic and educational characteristics of women who died due to direct obstetric causes were similar to those observed for all maternal deaths shown in table 1 . \n such pattern differed from that observed for maternal deaths due to unspecified or indirect obstetric causes , except for marital status ( mainly single women across all categories of cause of maternal death ) . \n ( code o95 ) were predominantly brown / coloured or of mixed races ( 45.5% ) and had a lower educational level [ 36.4% had 13 year(s ) of schooling ] . those who died from indirect causes were younger ( about 55% were aged 2029 years ) and had a higher educational level ( about 29% had 811 years of schooling ) ( data not shown ) . both maternal deaths and livebirths registered in the city of rio de janeiro each year decreased from 2000 to 2003 . \n during these four years , there was a slightly declining trend in the mmr , although it was irregular and not statistically significant ( data not shown ) . \n overall , approximately 60 maternal deaths occurred for each 100,000 livebirths ( mmr=59.5 ; 95% ci 51.668.4 per 100,000 livebirths ) in the city of rio de janeiro during 20002003 . \n the mmr varied according to maternal age : its lowest value39.7 per 100,000 livebirths ( 95% ci 30.651.6)corresponded to the age - group of 2029 years ( fig . ) , thus taken as a reference category for comparison purposes . \n among the adolescents ( n=68,392 livebirths ) , the mmr was 18% higher than the estimate for the age - group of 2029 years , i.e. 46.8 per 100,000 livebirths ( 95% ci 36.060.8 ) . \n the risk of dying due to maternal causes , as estimated by the mmr , increased in older ages , reaching 86.7 ( 95% ci 64.3114.4 ) and 283.3 ( 95% ci 206.5379.6 ) per 100,000 livebirths , respectively , for women aged 3039 and 4049 years . \n compared to the age - group of 2029 years , the mmr found for the age - groups of 3039 years and 4049 years was 2.2 and 7.1 times higher respectively . \n number of maternal deaths by categories of obstetric cause of death ( icd-10 ) and maternal mortality ratio per 100,000 livebirths , according to maternal age at death , city of rio de janeiro , brazil , 20002003 mmr = maternal mortality ratio mmr = maternal mortality ratio the contribution of the number of deaths due to indirect obstetric causes was superior in the age - groups of 2029 years and 3039 years when compared with older ages , mainly because of hiv disease ( codes b20 to b24 ) and other maternal diseases classifiable elsewhere but complicating pregnancy , childbirth , and the puerperium ( code o99 ) ( fig . ) . \n in total , 217 maternal deaths occurring in the city of rio de janeiro during 20002003 were confirmed by the city 's pmmic . \n such deaths were derived from a larger subset eligible for investigation by the public - health surveillance services , which comprises only deaths whose cause , as registered in the death certificate was primarily due to an obstetric cause or classified as a presumable cause of maternal death , according to the routine surveillance procedures . \n therefore , there is a potential for under - reporting of maternal deaths , since not all deaths of women of childbearing age were investigated . \n although possible , additional under - reporting due to lack of registration of maternal deaths was unlikely , since , as previously highlighted , the sim has a high coverage within the state of rio de janeiro ( 8) . \n it should , however , be emphasized that , if maternal deaths were under - reported , the corres - ponding risks of dying from maternal causes were also underestimated . \n even if underestimated , the overall mmr found in our study59.5 per 100,000 livebirths still exceeded by about 36 times the range of values for the mmr regarded as acceptable by the who between 10 and 20 per 100,000 livebirths ( 11 ) , revealing , thus , a high risk of dying due to maternal causes in the city of rio de janeiro during 20002003 . following the recommendation of the who for international comparisons ( 9 ) , both late maternal deaths ( code o96 , chapter xv ) and deaths from sequelae of direct obstetric causes ( code o97 , chapter xv ) \n their inclusion would have obviously increased maternal mortality beyond our estimates , as they totalled 231 deaths during 20002003 . of these , 217 \n were confirmed maternal deaths ( 208 classified as due to obstetric causes chapter xv , except codes o96 and o97 and nine deaths , due to hiv disease codes b20 to b24 , chapter i ) plus nine late maternal deaths and five deaths from sequelae of direct obstetric causes . \n the proportion of late maternal deaths ( 4.0% ) is considered low when compared with those of developed countries ( 520% of all maternal deaths ) . \n such finding is somewhat expected since access to treatments and technology to prolong life may still be restricted in developing countries ( 2 ) . the socioeconomic profile of the study women who died from maternal causes reflects a vulnerable social situation . in the city of rio \n de janeiro , from 2000 to 2003 , 60% of deaths of women for whom race / colour was known were non - white ( black or brown / mixed - raced ) , which exceeds by about 50% the proportion of non - white women in the female population aged 1049 years living in the city in 2000 ( 6 ) . notwithstanding \n the difficulty to properly assess race / colour in brazil , such a high proportion of non - white maternal deaths is a very likely reflection of social inequality ( 12 ) . \n considering only deaths for which data on educational level were available in the death certificate ( 168 ) , only about 62% had completed seven years of schooling \n a proportion that was much higher than that in women aged 15 years or more living in the city of rio de janeiro in 2000 ( 39% ) , further underscoring the strong association of socioeconomic status with maternal mortality ( 6 ) . \n the finding that as many as 57% of the deceased women were single at the moment of death also emphasizes the importance of social vulnerability in the causation of maternal mortality ( 13 ) . \n global policies are important to promote equity in health and , particularly , to reduce maternal mortality . \n factors relating to the quality and organization of healthcare services strongly influence the survival of women with pregnancy - related complications ( 13,14 ) . \n a survey of 47 maternity hospitals in the city of rio de janeiro during 19992001 showed that 71.8% of postpartum women began their prenatal care during the first three months of pregnancy , with 61.5% reporting seven or more prenatal visits . \n the overall maternal health conditions during pregnancy and delivery and the quality of healthcare at delivery were better in public than in private hospitals ( 15 ) . \n although the coverage of public maternity services is high , the public - health system ( sus ) fails to assure a place for delivery for all women on a timely basis ( 16 ) . \n in addition , there may be problems with the quality of healthcare during the prenatal phase and delivery , which can result in health complications to both mothers and babies ( 1,14 ) . in our study , women who died from maternal causes were predominately aged 3039 years ( 39.2% ) , similar to the results reported by horon et al . in maryland , \n usa ( 46.5% ) from 1993 to 2000 ( 17 ) and unlike the studies conducted in ankara , turkey , during 19822001 ( 14 ) and in bangladesh during 19961997 ( 18 ) , in which maternal deaths occurred mainly at the age of 2029 years ( 48.2% and 33.6% respectively ) . on the other hand , in the city of rio \n de janeiro , the highest risk of maternal death was seen at the age of 4049 years ( mmr=248.9 per 100,000 livebirths ) . \n conversely , more than one - third of deaths occurred at the age of 2029 years , although at these ages the risk of maternal death was the lowest . \n such findings illustrate one of the most fundamental axioms in preventive medicine : a large number of people exposed to a small risk may generate many more cases than a small number exposed to a high risk ( 19 ) . \n thus , appropriate interventions aimed at reducing maternal mortality must not be based solely on a high - risk strategy but need to encompass all women at childbearing ages regardless of the magnitude of the age - related risk of maternal death . \n the distribution of causes of maternal deaths in the city of rio de janeiro was closer to the patterns observed in ankara ( 14 ) and bangladesh ( 18 ) than to what was found in a study done in maryland , usa ( 17 ) . \n direct obstetric causes of death played a major role in our study mainly due to eclampsia / pre - eclampsia ( hypertensive disorders ) . \n abortion was also an important cause of death in the city of rio de janeiro , accounting for 19.0% of all maternal deaths . in the province of santa \n fe , argentina , hypertensive disorders were the main cause of maternal deaths in the periods before , and for a few years after the inclusion of the pregnancy status check - box in death certificate in 1994 ; however , in 2001 , abortion became the most frequent cause ( 20 ) . in st . \n petersburg , russia , abortion was the main cause of maternal deaths ( 35.0% ) from 1992 to 2003 ( 21 ) . \n in 2006 , a systematic review was undertaken to determine the distribution of causes of maternal deaths worldwide : in africa and asia , haemorrhage was the leading cause of death , and , in latin america and the caribean , hypertensive disorders ranked first ( 22 ) . in locations where the mmrs were low , such as bavaria , the usa , sweden , and the united kingdom , the leading cause of maternal deaths was thromboembolism which is difficult to prevent ( 21 ) . \n hiv infection caused 4% of the total maternal deaths in the city of rio de janeiro . \n thus , providing support for helping women who need to use antiretroviral drugs before and during pregnancy is also an important strategy for prevention of maternal and also childhood deaths ( 1 ) . \n more efforts are needed to increase the effectiveness of the strategies aimed at improving maternal death report in brazil . \n first , in the present study , maternal deaths were poorly reported by the surveillance system ( coverage of about 42% ) . \n also , the inclusion in the death certificate of information about abortion , pregnancy , delivery , and puerperium at or during the 12 months that preceded deaths of women of reproductive age , if correctly filled , would also help improve the ascertainment of maternal deaths . \n both physicians and medical students should be better trained on how to complete a death certificate adequately . in our study , \n the addition of the maternal condition at the time of death in the death certificate was followed by a decrease of under - reporting of maternal deaths in the province of santa fe , argentina ( 18 ) . \n moreover , completeness of reporting of deaths relating to pregnancy , delivery , and puerperium could also be improved by linking death records of women of reproductive ages to birth and foetal death records ( 16 ) . \n such strategy has already been used at the state health department of rio de janeiro , although not in a systematic way . \n finally , more sensitive criteria to select the death certificate for field investigation should be adopted by the pmmic of the city of rio de janeiro and should encompass the investigation of all pregnancy - related deaths . in conclusion , \n more efforts are needed to achieve the 2000 millennium development goals of a 75% reduction of maternal mortality by 2015 in the city of rio de janeiro ( 1 ) . at present , \n efforts are being developed by the sim and ccmmp towards improving the quality of data on maternal deaths in brazil , an important step to provide programme - oriented strategies aimed at reducing maternal mortality . \n both health sector - specific and intersectoral intervention policies are important to promote the survival and well - being of mothers and their babies . \n this study was supported by the research support foundation , rio de janeiro state ( faperj ) . \n the authors thank janaina v. costa ( public - health student of iesc / ufrj ) and fernando d.s . \n motta ( undergraduate student at the medical school / ufrj ) for their cooperation during data collection and processing and mariza miranda theme - filha ( health department of the city of rio de janeiro ) for providing the mortality database . \n an earlier version this paper was presented at the 2006 population studies brazilian association ( abep ) meeting held in , caxambu , minas gerais , brazil , on 1822 september 2006 .", "role": "user" }, { "content": "the study describes the characteristics of maternal deaths in the city of rio de janeiro , brazil , during 20002003 . \n after investigation by public - health services , 217 maternal deaths were identified among predominantly non - white ( 48.9% ) , single ( 57.1% ) women aged 29.67.3 years on average . \n direct obstetric causes corresponded to 77.4% of the maternal deaths , mainly due to hypertensive disorders . \n hiv - related diseases accounted for 4% of the maternal deaths . \n almost three - fourths of the mothers who died were aged 2039 years , although the highest risk of maternal death corresponded to the age - group of 4049 years ( 248.9 per 100,000 livebirths ) . \n the socioeconomic and demographic profiles of maternal deaths in the city of rio de janeiro reflected a vulnerable social situation . \n appropriate interventions aimed at reducing maternal mortality need to encompass all women of childbearing age , irrespective of the magnitude of the risk of maternal death .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: ab is an 84-year - old caucasian female with a history of hypertension , osteoporosis , type 2 diabetes , dyslipidemia , osteoarthritis , and persistent depression who presents to the office as a new patient with worsening ambulation : \n the patient lives in a small house above the family farm , on the side of a mountain . \n she describes her difficulty as an unsteadiness , and stiffness , in her knees and hips . \n she has moderate pain in her right hip and in her left knee , especially late in the day . on clinical examination \n , ab has reduced internal and external rotation of the hips , right side more affected than the left , with some pain to the maneuvers , and widened knees with some tenderness . \n a mini - mental status exam ( mmse ) is consistent with mild cognitive impairment , with a score of 24 . \n ( generally , scores of 27 - 30 are normal , 24 - 26 suggest mild cognitive impairment , 19 - 23 mild dementia , 10 - 18 moderate dementia , and < 10 severe dementia . ) \n ab has a son , fred , who lives in the main farmhouse below her house , but ab does not get along with him well : he has a diagnosis of bipolar , and they argue frequently . \n her other son , rod , lives in texas , and has recently been diagnosed with leukemia . \n rod helps her with medical decisions for example , he helped her pick her current medicare part d plan . \n ab also has one surviving brother , 89 years old , but he is rather debilitated . \n he lives close by her house , but is unable to assist her ; in fact , she assists him \n based on the evaluation so far , ab is at risk of requiring institutionalization from both her worsening ambulation and her mild cognitive impairment . \n physical therapy may benefit her ambulation . both the mental status and the mobility are likely to be adversely effected by her polypharmacy . taking multiple medications \n some research suggests four or more , some seven or more increases the risk of falls and other adverse effects , as well as significant drug drug interactions ( hajjar , cafiero , & hanlon , 2007 ) . \n looking over her medication list , there are serious potential interactions between diltiazem xr and simvastatin , and between amitriptyline and paroxetine ( and potentially st . \n there is no benefit from celecoxib for her ( celecoxib does not reduce gi bleeding , if co - administered with aspirin ) , or from metformin greater than 2000 mg per day , or from daily alendronate versus the weekly form . \n furthermore , she has been on alendronate for 14 years , with stable dual xray absorption ( dxa ) results . given her age and debility , amitriptyline , glyburide xr , pioglitazone , and hydroxyzine palmoate are probably ill - advised . \n it is unclear if chromium , cinnamon , glucosamine , niacin , hydroxyzine palmoate , or vitamin c offer any real benefit for her . \n the box also lists some of the medication recommendations made at that first visit ; amitriptyline and st . \n john s wort were both weaned off over 3 months , alendronate 70 weekly was used , and metformin was changed to 1,000 mg twice daily with meals . \n medications replaced included atorvastatin 20 for simvastatin , naproxen 250 twice daily with food for celecoxib , and glimepiride 4 for glyburide . \n medications can contribute to cognitive impairment , and stopping medications may help improve cognitive impairment ( ancelin et al . \n , 2006 ) . accordingly , medication review is a reasonable first step to keeping patients at home . \n in addition to the medication changes , the physician recommends home health to assist with her home medications , to monitor glucose levels and blood pressures , and to provide physical therapy . \n ab , like many elderly patients , is resistant to changing medications , but may be most open to making multiple changes at the first visit to a geriatric medicine expert . at the follow - up visit one month later , ab reports , my legs hurt a little more , but i feel better ! she is able to ambulate more effectively , even in her steep driveway . \n although she does not report any mental status change , her mmse result has improved to 29perhaps due to the medication changes . \n she is brought by her son rod ; he reports that she s having more memory lapses , and more difficulty getting around . \n rod also has had deterioration of his medical status : his acute myelogenous leukemia has relapsed , and he is moving back with ab while he gets chemotherapy . \n i feel fine ! rod describes a pattern of short - term memory loss , difficulty naming common objects , and uncertainty with long - established skills such as knitting . \n ron notes that between his retirement and ab s annuity , ab can afford assisted - living ( al ) . \n as he is unable to care for ab during his chemotherapy , he persuades his mother to try a local al facility . \n ab really likes not having to cook , but she complains that the meals are too predictable . \n rod is worried that he may die soon ; he strongly encourages ab to stay in the al facility . \n the al facility is in contact with ab s physician , reporting that she is very distraught . \n , ab seems to be grieving appropriately , and is comforted by all her new friends at the al facility . \n she and her doctor agree that she will try to manage her grief without additional medications , and she will participate in some social activities at the assisted living facility each week . \n ( ab s al facility does offer frequent activities . ) on the physical exam , ab has a somewhat worsened memory \n ab is still driving , and because she now has definite dementia , she agrees to be retested by the state highway department . \n her ambulation is slowed from her baseline , and she has more tenderness in her knees and hips , consistent with worsening osteoarthritis . her physician does not change any of her medications and agrees to see her as often as needed . \n ab does well at the assisted living facility for another year . by that time , \n her dementia is moderate not only has she improved from her grief , but usually she no longer remembers that rod has died : when is rod coming to see me ? \n after that year , however , ab is noticeably worse : she has trouble recognizing her other son fred , and her two granddaughters , who now share power of attorney authority . \n she has begun to wander in the al facility , and has walked off the grounds , toward a major street , once in the past week . \n ab knows many of the staff in the locked unit , as they also work on the al side ; she does not become agitated after her move . \n urinary incontinence is less of an issue now , as the staff is assisting her with diaper changes . after about a year in the locked unit , \n her doctor plans to evaluate her at his next visit , but ab needs a visit to the er first : she chokes on her dinner , and subsequently develops fever , cough , and shortness of breath : \n the speech therapist orders a modified barium swallow , which confirms mild aspiration of thin liquids , then recommends a mechanical soft diet with honey - thick liquids . \n the pneumonia responds to antibiotics , but ab is not able to return to her al locked alzheimer s unit : she needs more intensive physical therapy and st than she could obtain via home health at the al facility . \n she has some difficulty cooperating with pt and st at the nh , but overall makes slow progress . \n ( mmi)after 4 weeks , at which time her swallowing and ambulatory capacity are no longer improving . \n once mmi is reached , ab no longer qualifies for snf , and her family must decide on disposition . \n her granddaughters , familiar with the locked dementia unit at the al , decide to transfer her back . \n however , upon her return to the locked dementia unit , after a month away , ab no longer recognizes the staff . \n she is less cooperative with staff s attempt to change her diapers , bathe her , and to assist her with feeding and walking . she is agitated much more often . despite walking better after rehab than she had before her pneumonia admission , her refusal to walk with staff and reluctance to walk on her own causes her to quickly lose strength : she can not walk on her own within 2 months . the al administration notifies her niece that ab no longer meets criteria for the locked unit \n ab is not yet felt to be an appropriate hospice candidate , so her granddaughters arrange for her admission to a nearby nursing home . for long - term placement at the nh \n , ab must spend down . her granddaughters cash in her annuity for us$50,000 , and \n because the family farm has been in her son s name since her husband s death 12 years ago , the farm is not considered one of ab s assets but if she had co - owned the farm less than 5 years before , it would also have to be sold in the \n the annuity and social security payments will cover more than 8 months in the nh . \n even though ab returns to the nh in which she had had rehab , she does not remember anyone there . \n even though the nurses put a mattress on the floor next to ab s bed , she gets up at night and falls frequently . \n one week after nh admission , she is found on the floor near the bathroom , apparently in great pain . \n her right leg is shorter than her left , and is externally rotated at the hip . \n the physician is called , and authorizes transfer to the er . in the er , a right intertrochanteric hip fracture is confirmed ; ab is hospitalized ( pearson & coburn , 2013 ) . \n the surgical repair goes smoothly the next morning , but ab is extremely agitated in the evening . \n risk factors for delirium include hospital admission , recent surgery , opioids , and the foley catheter . \n there is no apparent bleeding , ab is not impacted , and there are no unnecessary meds . \n a 2-mg haloperidol i m is given for the agitation , with a repeat dose ordered as needed every 4 hr , and the opioids are changed to a pca pump with a low basal rate . \n after 3 days , she returns to her nh on snf , for rehab . of note , \n a meta - analysis published in 2016 concluded that antipsychotics , the standard treatment for delirium with agitation , are ineffective in preventing or treating delirium in hospitalized patients ( neufeld , yue , robinson , inouye , & needham , 2016 ) . \n similar to agitation due to dementia , use of antipsychotics must now be limited to an emergent need for sedation , when the subsequent harms are considered less severe than the benefit from the sedation . \n when ab was in rehab 2 months earlier , she used 30 of her 100 medicare rehab days , including all 20 of the days covered 100% . \n these days are restored over a 2-year period ; after 2 months , she has 1 day covered at 100% , and 71 days at 80% payment . \n once again , ab is somewhat cooperative with rehab staff , but given her hip fracture and poor baseline ambulation , recovery of meaningful ambulation is not felt to be feasible . \n physical therapy instead works to improve her ability to assist with transfer between bed and wheelchair . \n after 3 weeks , she is no longer progressing in rehab , so she is transferred back to her icf bed . this time , \n her agitation has improved a little bit ; she seems more comfortable with the nh staff . \n after rehab , ab helps with transfer significantly , but requires feeding assistance and a pureed diet . \n she experiences slow incremental decline over 2 years , until she requires total care \n hospice is consulted . as ab has declined , but has shown less agitation , her son and granddaughters resume their occasional visits . \n after enrollment in hospice , they come more regularly , with occasional appointments with the hospice chaplain . \n four months after starting hospice , ab dies , with apparent good control of pain and other symptoms . \n the counseling continues for the family after ab s death , for several months ( up to 1 year is covered ) . \n she is brought by her son rod ; he reports that she s having more memory lapses , and more difficulty getting around . \n rod also has had deterioration of his medical status : his acute myelogenous leukemia has relapsed , and he is moving back with ab while he gets chemotherapy . \n i feel fine ! rod describes a pattern of short - term memory loss , difficulty naming common objects , and uncertainty with long - established skills such as knitting . \n ron notes that between his retirement and ab s annuity , ab can afford assisted - living ( al ) . \n as he is unable to care for ab during his chemotherapy , he persuades his mother to try a local al facility . \n ab really likes not having to cook , but she complains that the meals are too predictable . \n rod is worried that he may die soon ; he strongly encourages ab to stay in the al facility . \n the al facility is in contact with ab s physician , reporting that she is very distraught . \n , ab seems to be grieving appropriately , and is comforted by all her new friends at the al facility . \n she and her doctor agree that she will try to manage her grief without additional medications , and she will participate in some social activities at the assisted living facility each week . \n ( ab s al facility does offer frequent activities . ) on the physical exam , ab has a somewhat worsened memory \n ab is still driving , and because she now has definite dementia , she agrees to be retested by the state highway department . \n her ambulation is slowed from her baseline , and she has more tenderness in her knees and hips , consistent with worsening osteoarthritis . her physician does not change any of her medications and agrees to see her as often as needed . \n ab does well at the assisted living facility for another year . by that time , \n her dementia is moderate not only has she improved from her grief , but usually she no longer remembers that rod has died : \n after that year , however , ab is noticeably worse : she has trouble recognizing her other son fred , and her two granddaughters , who now share power of attorney authority . \n she has begun to wander in the al facility , and has walked off the grounds , toward a major street , once in the past week . \n ab knows many of the staff in the locked unit , as they also work on the al side ; she does not become agitated after her move . \n urinary incontinence is less of an issue now , as the staff is assisting her with diaper changes . after about a year in the locked unit , \n her doctor plans to evaluate her at his next visit , but ab needs a visit to the er first : she chokes on her dinner , and subsequently develops fever , cough , and shortness of breath : \n the speech therapist orders a modified barium swallow , which confirms mild aspiration of thin liquids , then recommends a mechanical soft diet with honey - thick liquids . \n the pneumonia responds to antibiotics , but ab is not able to return to her al locked alzheimer s unit : she needs more intensive physical therapy and st than she could obtain via home health at the al facility . \n she has some difficulty cooperating with pt and st at the nh , but overall makes slow progress . \n she reaches her endpoint the point of maximal medical improvement ( mmi)after 4 weeks , at which time her swallowing and ambulatory capacity are no longer improving . \n once mmi is reached , ab no longer qualifies for snf , and her family must decide on disposition . \n her granddaughters , familiar with the locked dementia unit at the al , decide to transfer her back . \n however , upon her return to the locked dementia unit , after a month away , ab no longer recognizes the staff . \n she is less cooperative with staff s attempt to change her diapers , bathe her , and to assist her with feeding and walking . she is agitated much more often . despite walking better after rehab than she had before her pneumonia admission , her refusal to walk with staff and reluctance to walk on her own causes her to quickly lose strength : she can not walk on her own within 2 months . \n the al administration notifies her niece that ab no longer meets criteria for the locked unit . \n ab is not yet felt to be an appropriate hospice candidate , so her granddaughters arrange for her admission to a nearby nursing home . \n for long - term placement at the nh , ab must spend down . her granddaughters cash in her annuity for us$50,000 , and \n because the family farm has been in her son s name since her husband s death 12 years ago , the farm is not considered one of ab s assets but if she had co - owned the farm less than 5 years before , it would also have to be sold in the \n the annuity and social security payments will cover more than 8 months in the nh . \n even though ab returns to the nh in which she had had rehab , she does not remember anyone there . \n even though the nurses put a mattress on the floor next to ab s bed , she gets up at night and falls frequently . \n one week after nh admission , she is found on the floor near the bathroom , apparently in great pain . \n her right leg is shorter than her left , and is externally rotated at the hip . \n the physician is called , and authorizes transfer to the er . in the er , a right intertrochanteric hip fracture is confirmed ; ab is hospitalized ( pearson & coburn , 2013 ) . \n the surgical repair goes smoothly the next morning , but ab is extremely agitated in the evening . \n risk factors for delirium include hospital admission , recent surgery , opioids , and the foley catheter . \n there is no apparent bleeding , ab is not impacted , and there are no unnecessary meds . \n a 2-mg haloperidol i m is given for the agitation , with a repeat dose ordered as needed every 4 hr , and the opioids are changed to a pca pump with a low basal rate . \n after 3 days , she returns to her nh on snf , for rehab . of note , \n a meta - analysis published in 2016 concluded that antipsychotics , the standard treatment for delirium with agitation , are ineffective in preventing or treating delirium in hospitalized patients ( neufeld , yue , robinson , inouye , & needham , 2016 ) . similar to agitation due to dementia , use of antipsychotics must now be limited to an emergent need for sedation , when the subsequent harms are considered less severe than the benefit from the sedation . when ab was in rehab 2 months earlier , she used 30 of her 100 medicare rehab days , including all 20 of the days covered 100% . \n these days are restored over a 2-year period ; after 2 months , she has 1 day covered at 100% , and 71 days at 80% payment . \n once again , ab is somewhat cooperative with rehab staff , but given her hip fracture and poor baseline ambulation , recovery of meaningful ambulation is not felt to be feasible . \n physical therapy instead works to improve her ability to assist with transfer between bed and wheelchair . \n after 3 weeks , she is no longer progressing in rehab , so she is transferred back to her icf bed . this time , \n her agitation has improved a little bit ; she seems more comfortable with the nh staff . \n after rehab , ab helps with transfer significantly , but requires feeding assistance and a pureed diet . \n she experiences slow incremental decline over 2 years , until she requires total care \n as ab has declined , but has shown less agitation , her son and granddaughters resume their occasional visits . \n after enrollment in hospice , they come more regularly , with occasional appointments with the hospice chaplain . \n four months after starting hospice , ab dies , with apparent good control of pain and other symptoms . \n the counseling continues for the family after ab s death , for several months ( up to 1 year is covered ) .", "role": "user" }, { "content": "americans over age 65 constitute a larger percentage of the population each year : from 14% in 2010 ( 40 million elderly ) to possibly 20% in 2030 ( 70 million elderly ) . in 2015 , \n an estimated 66 million people provided care to the ill , disabled , and elderly in the united states . in 2000 , according to the centers for disease control and prevention ( cdc ) , 15 million americans used some form of long - term care : adult day care , home health , nursing home , or hospice . in all , 13% of people over 85 years old , compared with 1% of those ages 65 to 74 , live in nursing homes in the united states . \n transitions of care , among these various levels of care , are common : nursing home to hospital transfer , one of the best - studied transitions , occurs in more than 25% of nursing home residents per year . \n this article follows one patient through several levels of care .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: colon cancer is the second most common cancer in europe and the third most common in uk.13 the incidence of colon cancer has not changed a lot in recent time , but age - standardized mortality has improved in the last 30 years.3 this improvement is more pronounced in early colon cancer , where management usually consists of surgery followed by adjuvant treatment.4 adjuvant treatment is fluoropyrimidine based , and it has now become a standard of care in the management of colon cancer . \n the most important prognostic factors at primary diagnoses are tnm ( tumor , nodes , and metastases ) staging of disease and the ability to perform complete resection of all macroscopic disease . \n after surgery , the next question always is the need for adjuvant treatment and also the choice of chemotherapeutic agent . \n the goal of postoperative ( adjuvant ) therapy is to eradicate occult micrometastases present at time of surgery thereby increasing the cure rate . \n poor prognosis is associated with lymphovascular space invasion , perineural invasion , perforation / ulceration of tumor , signet ring / mucinous histology , and number of lymph nodes involved.57 evidence at the moment favors use of adjuvant treatment in stage iii colon cancer ( lymph node positive disease ) . \n however , with stage ii colon cancer , adjuvant treatment is a question of debate , as data only show modest 3% 5-year survival benefit with adjuvant chemotherapy compared with observation alone.8 many molecular markers have been speculated to affect outcome , and examples are microsatellite instability ( msi - h ) , tumor - dna ploidy , chromosomal deletions , and mutated p53 . \n the influence of microsatellite instability to predict response to adjuvant 5-fluorouracil ( 5-fu)-based chemotherapy is controversial , and so far the evidence is retrospective and conflicting , with some studies showing no effect on overall survival but others showing a trend toward lower or improved survival . \n ribic et al demonstrated survival advantage with adjuvant chemotherapy in microsatellite stable colon cancer and no benefit for patients with microsatellite instability positive tumor.28 in contrast to above , kim et al found no relationship between msi and chemotherapy in terms of overall survival.29 similarly , allelic loss on chromosome 18q and p53 mutation are also considered as poor prognostic signs , but incorporation of these molecular markers into clinical evidence is difficult at present on grounds of lack of robust evidence . \n colon cancer was considered to be refractory to any cytotoxic treatment until 5-fu was designed , synthesized , and patented by charles heidelberger in 1957.9 5-fu is a pyrimidine antagonist , and it functions to inhibit dna synthesis by blocking the formation of normal pyrimidine nucleotides via thymidylate synthase inhibition . \n fluorouracil has been the established treatment for locally advanced and metastatic colorectal cancer for nearly four decades . \n meta - analysis in the early 1990s showed that single - agent 5-fu has a reasonable efficacy in patients with metastatic colon cancer , providing a tumor response rate of 10%15% . the addition and modulation of fluorouracil by leucovorin ( lv , folinic acid ) lead to doubling of the response rate.10 moving from metastatic settings to adjuvant , the study by moertel et al11 was the first breakthrough trial which showed survival advantage in patients with stage iii colon cancer with fluorouracil plus levamisole . \n it demonstrated a reduction in the recurrence rate by 40% ( p < 0.0001 ) and the death rate by 33% ( p = 0.0007 ) . in the same trial , levamisole on its own reduced the recurrence rate by only 2% and the death rate by only 6%.11 also , a meta - analysis in 1988 showed similar results , with a small survival benefit for patients receiving adjuvant 5-fu after surgery compared with surgery alone ( odds ratio of death : 0.83 , 95% confidence interval : 0.700.98).10 in the same era , efforts were made to increase the antineoplastic activity of fluorouracil by adding a cytostatic agent which can modulate its mechanism of action . \n lv was the first success story , and impact ( the international multicenter pooled analysis of colon cancer trials ) , a meta - analysis , showed that treatment with 5-fu / lv after surgery was associated with a 22% reduction in death rate compared with surgery alone in stage iii colon cancer.10,12 as treatment of colon cancer evolved more , research questions were raised about the method of infusion ( continuous infusion vs bolus infusion ) of 5-fu along with dosage of lv . \n pan - european trials in adjuvant colon cancer ( petacc-2 trial ) had examined the above question and failed to show any difference in outcome between continuous infusional regimens ( mayo regimen ) vs bolus infusion regimen . \n however the toxicity profile favored the infusional regimen with lesser incidence of grade iii / iv diarrhea , neutropenia , and mucositis.13 similarly , trials did not show any survival benefit of high dose lv compared with low dose lv in combination with 5-fu.8 at the same time , oxaliplatin and irinotecan were showing activity and potential roles in management of colon cancer . \n oxaliplatin shows synergy to 5-fu by downregulation of thymidylate synthase , and its role was established in multicenter international study of oxaliplatin / fluorouracil / leucovorin in the adjuvant treatment of colon cancer ( mosaic ) , where 2246 patients with stage ii ( 40% ) or stage iii ( 60% ) colon cancer were randomized to receive 6 months of infusional fluorouracil and lv with or without oxaliplatin.1416 after a median follow - up of 49 months , the 4-year disease - free survival was statistically superior in those patients who received oxaliplatin and 5-fu / lv , compared with those who received 5-fu / lv ( 72.9% vs 68.3% ) ( see table 1 and figure 1 ) . \n in contrast to the promising infusional 5-fu / oxaliplatin regimen , an irinotecan / bolus 5-fu combination never lived up to the expectations in adjuvant settings . the petacc-3 trial was a randomized phase iii trial which compared use of biweekly infusional fluorouracil / lv alone or in combination with irinotecan in the adjuvant treatment of stage iii colon cancer . \n a total of 3278 patients ( 945 with stage ii disease ; 2333 with stage iii disease ) were randomized to receive fortnightly infusional 5-fu / lv alone or with the addition of irinotecan . at a median follow - up of 32 months , \n the 3-year disease - free survival was 62.9% for the irinotecan combination and 59.9% for those receiving 5-fu / lv , a difference which was not statistically significant ( hazard ratio : 0.89 [ 95% confidence intervals : 0.771.03 ] , p = 0.107).30 \n an oral preparation of 5-fu would have obvious benefits in terms of convenience for patients . unfortunately , 5-fu is not suitable for oral administration because of variable bioavailability and unpredictable degradation in the gastrointestinal tract . \n inter- and intra - individual variation in dihydropyrimidine dehydrogenase activity ( the main catabolic enzyme for 5-fu ) , particularly in gastric mucosa , was also a reason for unsuitability of oral 5-fu.17 capecitabine ( xeloda , roche , basel , switzerland ) was designed as a pro - drug of fluorouracil , which will deliver 5-fu selectively to the tumor minimizing systemic toxicities . after gastrointestinal absorption \n , capecitabine is hydrolyzed in the liver by carboxyl esterase to produce 5-deoxy-5-fluorocytidine , and this moiety is then deaminated on its pyrimidine ring to produce 5-deoxy-5-fluorouridine by cytidine deaminase , an enzyme located principally in hepatic and neoplastic tissue . \n the last enzymatic step of conversion of 5-deoxy-5-fluorouridine to 5-fu in the cancer cell is catalyzed by thymidine phosphorylase , thus minimizing systemic exposure to 5-fu . \n thymidine phosphorylase occurs at higher levels in most solid tumors than in the corresponding normal tissue . \n human pharmacokinetic studies have demonstrated that capecitabine is well absorbed and rapidly converted to noncytotoxic intermediates and that intra - tumoral concentrations of 5-fu are significantly higher than plasma and normal tissue levels.1820 again , capecitabine completed the same cycle as was done with 5-fu , and it was tested in metastatic settings first where it showed good equivalent efficacy and better tolerability compared with 5-fu , and subsequently also in the adjuvant setting . in early trials in the metastatic setting , \n capecitabine demonstrated response rate superior to those achieved with the mayo clinic regimen of 5-fu / lv ( 26% vs 17% ) , with equivalent progression- free survival and overall survival.21,22 capecitabine was also better tolerated than 5-fu / lv , and its administration was associated with a reduced consumption of medical resources.27 as a result , capecitabine was considered as a good first - line treatment for metastatic colorectal cancer and became an established alternative to the combination of fluorouracil and lv . \n the next challenge was to establish the role of capecitabine in adjuvant settings in colon cancer . \n the xeloda in adjuvant chemotherapy trial ( x - act ) investigated the efficacy and safety of capecitabine treatment vs 5-fu / lv treatment ( mayo clinic regimen ) in the postoperative adjuvant setting in 1987 patients with stage iii ( dukes c ) colon cancer . \n this trial demonstrated that capecitabine was at least as effective as bolus 5-fu / lv in terms of disease - free and overall survival , with trends towards superiority for both . \n moreover , there was less toxicity associated with capecitabine , apart from hand foot syndrome , which was significantly more prevalent ( figures 2 and 3 ) . \n on the basis of the x - act trial , capecitabine was approved by the united states food and drug administration , the national institute for clinical excellence , and the scottish medicines consortium as monotherapy for the adjuvant treatment of stage iii colon cancer . \n the next question was : does oxaliplatin also show synergy with capecitabine in a similar way as with 5-fu ( mosaic trial ) . \n it recruited 1886 patients with stage iii colon cancer at 226 study sites across 29 countries . \n they were randomly allocated to treatment with xelox ( oxaliplatin / capecitabine ) or 5-fu / lv . \n this trial showed 5-year disease - free survival was 66% for xelox vs 60% for 5-fu / lv . \n the incidence of grade 3/4 toxicities in the 5-fu / lv arm ( n = 924 ) and xelox arm ( n = 937 ) were comparable ( figure 4).23 unfortunately , so far none of the targeted agents have shown efficacy in the adjuvant setting in colon cancer . \n a north central cancer treatment group randomized phase iii trial investigated the addition of cetuximab to mfolfox6 ( modified lv , 5-fu , and oxaliplatin ) , and it showed no benefit for patients with resected stage iii wild - type kras colon cancer.24 recent trials with bevacizumab in combination with xelox have failed to show any improvement in disease - free survival and overall survival in adjuvant therapy of colon cancer.25,26 \n in conclusion , both the single agent use of capecitabine as well as in combination with oxaliplatin can be considered as part of the standard of care in management of early colon cancer in appropriately selected patient groups . \n any role of targeted treatments in combination with capecitabine is a research question , and such an approach can not be recommended outside the context of clinical trials . \n we also have to wait for robust data regarding predictive / prognostic molecular markers in colon cancer and their role in defining need and choice of adjuvant treatment in colon cancer .", "role": "user" }, { "content": "capecitabine ( xeloda , roche , basel , switzerland ) is a pro - drug of 5-fluorouracil ( 5-fu ) , and it is converted to 5-fu in the cancer cell by enzymatic degradation . \n the role of capecitabine in colorectal cancer has evolved in the last 15 years . in early trials in the metastatic setting , \n capecitabine has shown superior response rates compared with those achieved with 5-fu ( mayo clinic regimen ) ( 26% vs 17% ) , with equivalent progression - free survival and overall survival . in the adjuvant \n setting , the xeloda in adjuvant colon cancer therapy ( x - act ) trial demonstrated that capecitabine as a single agent led to improvement in relapse - free survival ( hazard ratio : 0.86 , 95% confidence interval : 0.740.99 , p = 0.04 ) and was associated with significantly fewer adverse events than 5-fu plus leucovorin ( lv , folinic acid ) . \n on the basis of the x - act trial , capecitabine was approved by the united states food and drug administration , the national institute for clinical excellence , and the scottish medicines consortium as monotherapy for the adjuvant treatment of stage iii colon cancer . \n the next step was to incorporate capecitabine into combination therapy . \n the xeloxa trial studied the combination of capecitabine and oxaliplatin ( xelox ) vs 5-fu / lv and demonstrated 5-year disease - free survival of 66% for xelox , compared with 60% for 5-fu / lv . \n the toxicity profile was also quite comparable in the two arms . \n so both the single agent use of capecitabine as well as in combination with oxaliplatin can be considered as part of the standard of care in management of early colon cancer in appropriately selected patient groups .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in particular , power plants produce both electricity and co2 by combusting fossil fuels , which is one of the major sources \n of total man made co2 emissions worldwide . \n future forecasts for the economic growth in asia pacific and industrial \n development in africa indicate that the total world energy demand \n will increase from 462 quadrillion british thermal units ( btu ) in \n 2005 to over 695 quadrillion btu by 2030 . \n the exponential rise in emissions of co2 from fossil \n fuel utilization to around 30 gt per year will lead to significant \n climate change unless the emissions are captured and stored . \n developing clean and affordable energy with abundant supply is \n an issue of international concern . until recently , \n the prime focus \n of the research on power generation was on improving energy efficiency \n and switching from fossil fuels toward less carbon intensive ( renewable ) \n energy sources . \n the renewable energy technologies can reduce co2 emissions but are still costly . even if they are made cost - competitive \n in the next few years \n , they will still need time to penetrate the \n market . some researchers consider coal as the primary source of energy \n at least for the next 56 decades since its supply will last \n over 150 years compared with 5060 years for oil and natural \n gas . \n thus , there is a large international \n research effort toward developing technologies to use coal in an environmentally \n sustainable manner . in the recent years \n , carbon capture and storage ( ccs ) has been \n considered to offer end - of - pipe technologies that \n can allow continuous use of fossil fuels with low or almost negligible \n emissions . a review by boot - handford et al . \n has comprehensively discussed the recent developments , challenges , \n and potential future improvements in different types of ccs technologies . \n table 1 shows a summary of a number of studies \n on selection of a promising ccs technology that can produce electricity \n and , in some cases , h2 from fossil fuels . \n for instance , \n chiesa et al . compared different scenarios \n considering co2 venting and co2 capture using \n integrated gasification combined cycle ( igcc ) technology for the production \n of h2 and electricity from coal . \n physical absorption and \n adsorption processes were assumed for co2 and h2 separation , respectively . \n they concluded \n that , with an emissions constraint , there are very small thermodynamic \n benefits of coproduction relative to stand - alone electricity and h2 production \n reviewed \n various concepts including oxyfuel combustion , membrane separation , \n physical absorption , and chemical absorption processes for electricity \n and h2 production from coal and natural gas with ccs . \n a \n number of critical factors were identified and compared , including \n efficiency , cost of energy ( coe ) , cost of h2 ( coh ) , and \n co2 avoidance costs . \n also assessed were the impact of fuel \n prices on electricity and h2 production costs for pulverized \n coal ( pc ) , natural gas combined combustion ( ngcc ) , and igcc plants . \n the analysis showed that with co2 capture , the net electrical \n efficiencies are 3035% for pc , 3240% for igcc , and \n 4350% for ngcc power plants . also , both the chemical and physical \n absorption processes can achieve 8590% co2 capture \n efficiency with the precapture technologies being more suitable for \n igcc plants . \n cormos describes the methodology \n to evaluate the performance of a coproduction ( electricity and h2 ) igcc power plant with physical absorption ( selexol)-based \n co2 capture technology . \n the study examined the effect of \n using different feed stocks such as coal , sawdust , municipal solid \n waste , and food waste ( meat and bone ) on the power output . \n later , \n cormos compared different types of gasifiers \n using only coal as fuel and investigated the energy integration aspects \n in detail to optimize the overall plant efficiency of a coproduction \n igcc plant with ccs . \n the study concludes that an entrained flow gasifier \n with dry feed and syngas heat recovery is a more promising concept \n than slurry feed and water quench design . \n further work by cormos presented a detailed methodology to assess the \n performance of an iron - based clc system using critical design factors \n such as gasifier selection , gasifier feeding system , and overall energy \n efficiency . \n this work suggested that a clc - based system has a low \n energy penalty compared to liquid absorption process for co2 capture . \n li and fan addressed the energy conversion \n efficiencies for the chemical looping based coal conversion process . \n their study shows that efficiencies of syngas chemical looping process \n is comparable with the current coal conversion processes for electricity \n and h2 generation and could be considered as a retrofit \n technology in the downstream of the present gasification processes . \n on the other hand , they found that coal direct chemical looping combustion \n ( cdclc ) process is more energy efficient than coal gasification based \n clc process . \n in addition to the investigations on energy efficiency , there are \n a few studies on the exergetic efficiency of various co2 capture technologies with combined electricity and h2 production . \n exergy analysis combines the first and second laws of \n thermodynamics to identify the irreversibility and losses related \n to each unit or process of a system . \n for instance , kunze , et al . presented the exergy analysis of an igcc process \n by dividing the plant into three sections , the gasifier , gas treatment , \n and combined cycle . \n the analysis shows that 60% of the exergy is lost \n in the overall process ; out of which , 31.1% is lost only in the combined \n cycle section , making it the most inefficient part of the process , \n followed by 17.1% in gas treating and 11.3% in the gasifier . \n further , anheden and svedberg showed the exergy analysis of clc system with \n different fuels and oxygen carriers ( ocs ) . \n their results indicate \n that efficiency of a clc system is similar or higher than that of \n a conventional combustion process . \n while the existing studies have provided useful evaluation of a \n range of power ( and in some cases h2 ) generation schemes \n with or without ccs , their assumptions and considerations vary with \n respect to factors such as feedstock , power generation technology , \n ccs technology , production scale , and modeling approaches adopted , \n making it difficult to compare their results . to address this deficiency , \n our work uses a single basis of analysis in terms of the feedstock \n type , production scale , and modeling assumptions . \n this makes it easier \n and more straightforward to compare various gasification - coupled coal \n power plants with and without the ccs producing electricity and possibly \n h2 . \n this work provides a methodology to assess different \n co2 capture technologies based on mainly energy , exergy , \n and co2 capture efficiencies . \n the processes evaluated here \n include ( i ) igcc for power generation without ccs , ( ii ) igcc for power \n ( and h2 ) generation with two different precombustion ccs \n options based on physical absorption and adsorption , and ( iii ) power \n ( and h2 ) generation with clc . \n comparison is also made on \n the basis of the effect of asu and gt unit integration for each of \n the three capture technologies . \n the effect of different operating \n conditions such as air reactor temperature and water cooling of the \n air reactor in the clc process on the net electrical efficiency is \n another distinct feature of the present work . \n the findings of this \n work evaluate the suitability of physical absorption , physical adsorption , \n and clc based co2 capture technologies for coal power plants \n by indicating the differences in overall plant performance with each \n type of capture technology . \n this article also predicts the behavior \n of the clc process at different operating conditions ( as stated above ) , \n which can be useful in pilot scale experimental studies . \n a literature review of advanced ccs technologies has been first \n carried out to gather information on technical inputs and parameters \n such as the component flow rates , temperature , pressure , and efficiencies \n for various units , required for process modeling . \n the chemical process \n simulation tool aspen plus , was used to develop the flowsheet models \n for seven different coal gasification based power plant configurations \n at a nominal power output of up to 467 mw . the electricity generation , \n h2 production , \n co2 emission and other performance \n indicators such as energy and exergy efficiencies are subsequently \n analyzed . \n seven different \n types of coal gasification based power plant configurations , with \n and without co2 capture , at a power output between 141 \n and 467 mw have been considered . \n the chemical process simulation \n tool aspen plus was used to develop and simulate a process flowsheet \n for each case . the base case ( case 0 ) considered in this work \n the flowsheets for cases 14 are conventional igcc process \n with precombustion based co2 capture and cases 56 \n are gasification - coupled clc process for co2 capture . \n cases \n 1 , 2 , and 5 generate electricity only while the cases 3 , 4 , and 6 \n produce both electricity and h2 . \n a stand - alone asu generating \n 95% pure o2 has been used in all seven cases , followed \n by an o2-blown entrained flow shell gasifier operating \n at 30 atm , and fuel conversion ratio of 99.9% . the power consumption by the asu is assumed to be 225 kwh / tonne \n of o2 produced . \n the dry pulverized \n coal ( 100 m in size ) is pressurized in a lock hopper and fed \n to the gasifier vessel along with o2 from the top . \n the \n coal is partially oxidized by o2 in the gasifier to produce \n syngas , which mainly consists of co and h2 . \n the exothermic \n nature of the partial oxidation reaction of coal inside the gasifier \n provides the heat to achieve and maintain the desired temperature \n of 1300 c which is above the melting point of ash . \n the excess heat generated in the gasifier is \n removed by the generation of high pressure ( hp ) steam . \n the slag in \n liquid form flows down the walls and comes out at the bottom with \n syngas . \n the syngas can be either quenched with water or cooled in \n radiative and convective heat exchanger . \n water quenching degrades the thermal energy of the hot syngas stream . \n therefore , in our study , the syngas from the gasifier is cooled in \n a heat exchanger , which allows production of hp steam . \n this section describes the configuration of cases \n 1 to 4 , which use psa and selexol technologies for co2 capture . \n first , an igcc process producing only electricity with psa technology \n for co2 capture ( case 1 ) , shown in figure 1a , was developed . \n the detailed process flow diagram of case \n 1 can be seen in supporting information ( si ) figure s.1 . in this process , \n the hot syngas stream at 1300 \n c from the gasifier is cooled to 350 c in a convective \n heat exchanger in the heat recovery steam generation ( hrsg ) unit where \n hp water used for cooling is converted into a hp steam . \n the cooled \n syngas at 350 c is sent to two water gas shift reactors \n ( wgs-1 and wgs-2 ) aligned in series operating at temperatures 350 \n and 178 c , respectively . \n the wgs-1 reactor is \n supplied with steam at 30 atm and 350 c generated in the hrsg . \n the co in the syngas stream is partially converted to co2 by the steam in wgs-1 reactor generating more h2 in the \n syngas . \n the syngas and steam exiting the wgs-1 reactor at 350 c \n are cooled to 178 c before both are fed to the wgs-2 reactor \n where up to 98% of the remaining co is converted to co2 . \n the heat released by the cooling of \n syngas from 350 to 178 c is used for preheating the boiler feedwater \n in the hrsg . \n the conversion of co into co2 in the wgs reactors \n is an exothermic process which needs continuous removal of the excess \n heat to maintain the required reaction temperatures . \n the syngas \n exiting the wgs-2 reactor at 178 c is further cooled to 35 c \n in the hrsg which condenses the steam and removes it before the syngas \n is sent to an acid gas removal ( agr ) unit or a selexol unit to remove \n sulfur ; here nearly 99.9% of the hydrogen sulphide ( h2s ) \n is stripped from the syngas using selexol ( dimethyl ether of polyethylene \n glycol ) . the sulfur removed from the \n syngas in the form of h2s could be converted into elementary \n sulfur in a claus plant . \n the selexol \n in the sulfur removal unit is regenerated by heating which removes \n the dissolved sulfur and co2 . after removing sulfur , \n the \n syngas stream is passed through the psa - co2 unit where \n co2 is adsorbed by the adsorbent material ( activated carbon ) \n and the remaining gases ( tail gas1 ; see figure 1a ) exits with a pressure drop of 0.49 atm . \n the co2 separation efficiency of the psa unit is assumed \n to be between 90% and 95% . \n the adsorbent \n material in the psa - co2 chamber is regenerated by lowering \n the pressure to nearly atmospheric pressure level to release co2 . \n case 1 does not produce any h2 , and therefore h2-rich tail gas-1 follows route ii ( as seen in figure 1a ) , which is then supplied to the combustor of the gt unit \n after reheated to 350 c . \n the high temperature exhaust gases \n from the gt are cooled in the hrsg unit before it is finally released \n to the atmosphere . \n the syngas and flue gas stream temperatures for \n case 1 are noted in si table s.1 . \n the hp \n steam generated at 600 c in the overall process ( gasifier , heat \n exchangers , hrsg ) is expanded through the hp , intermediate pressure \n ( ip ) and low pressure ( lp ) steam turbines . \n the exhaust steam from \n the hp and ip steam turbines are reheated to 600 c before further \n expansion through the ip and lp turbines . \n the details of water and \n steam cycle as well as the temperature and mass flow rate of steam \n and water for case 1 are provided in the si section s.1 and table s.2 , respectively . \n simplified block flow diagrams of coal gasification - based power \n plant : ( a ) igcc with psa based co2 capture technology ( cases \n 1 and 3 ) ; ( b ) igcc with selexol based co2 capture ( cases \n 2 and 4 ) ; ( c ) gasification - coupled clc based co2 capture \n producing electricity only ( case 5 ) ; ( d ) gasification - coupled clc \n based co2 capture producing combined electricity and h2 ( case 6 ) . \n case 2 , which uses a selexol - based physical absorption co2 capture unit ( also known as acid gas removal or agr unit ) instead \n of a psa - co2 unit after sulfur removal , is shown in figure 1b . in this process \n , the outgoing gas stream from \n the sulfur removal unit , containing mainly co2 and h2 , is passed through the agr - co2 unit which separates \n co2 from rest of the gases . \n the selexol is regenerated \n by reducing the pressure to atmospheric level which releases the absorbed \n co2 . \n the co2 is \n then compressed to up to 150 atm after condensing any vapor present \n in the stream . \n after co2 removal , the remaining gases ( tail \n gas-1 ) are used in the gt unit as in case 1 , following route ii . \n case 3 , which is shown in figure 1a , is \n a variant of case 1 , with combined electricity and h2 production . \n the stream from psa - co2 enters psa - h2 installed \n for h2 separation , following route i instead of route ii . \n a 99.99% pure stream of h2 exits the psa - h2 unit \n after 0.49 atm of pressure drop . the separation \n efficiency for h2 in the psa - h2 unit is assumed \n to be 85% . \n the output h2 stream is compressed \n to 60 atm for transportation and storage . the leftover gas ( tail gas-2 ) after h2 separation leaves \n psa - h2 at nearly atmospheric pressure ; hence , it needs \n to be compressed to the gt combustor pressure ( 21 atm ) . \n if more electrical \n energy is required , some amount of separated pure h2 can \n be purged to the gt combustor according to the requirement . \n the \n high temperature gt exhaust is passed through the hrsg to produce \n hp steam and for steam reheating . \n case 4 , shown in figure 1b , has an agr - co2 unit for co2 removal instead of a psa - co2 unit used in case 3 . \n apart \n from this difference , the rest of the downstream path after co2 removal is same as described above for case 3 , which is following \n route i instead of route ii . \n a clc process \n is based on transferring oxygen to the fuel from air or steam by means \n of a oc . \n an oc could be made of metal or synthetic material that is \n capable of carrying oxygen and has excellent mechanical properties \n to withstand attrition , agglomeration and physical stress of recycling \n at high temperatures . \n this work assumes hematite ( fe2o3 ) as the oc , supported with 15% aluminum oxide ( al2o3 ) and 15% silicon carbide ( sic ) to enhance its mechanical \n and physical properties . \n parts c and \n d of figure 1 show the block diagram of cases \n 5 and 6 , respectively . in cases 5 and 6 , \n the syngas from the coal \n gasifier is cooled to 35 c in hrsg and supplied to a selexol \n based sulfur removal unit . \n the syngas is then sent to a fluidized \n bed fuel reactor of the clc process ( after reheated to 350 c ) \n represented by two fuel reactors , fr 1 and fr 2 ( see figure 1c , d ) . in the fuel \n reactors , h2 and co \n the fe2o3 is first partially reduced to magnetite \n ( fe3o4 ) in fr 1 and then completely reduced \n to wustite ( fe0.947o ) in fr 2 , as shown in figure 1c and d. a cyclone separator \n removes the reduced oc particles from the hot gases coming out of \n the fr 2 . \n these hot gases are cooled in a hrsg unit to condense the \n water vapor and produce a pure stream of co2 , which is \n compressed to 150 atm for storage . the sensible heat lost by the hot \n gases from the clc fuel reactor \n is used to generate hp steam and for \n steam reheating . in case 5 , \n the reduced oc particles ( fe0.947o ) are fully regenerated to fe2o3 in the air \n reactor where they are oxidized by pressurized air , which also helps \n in circulation of oc in the system . \n the air reactor is maintained \n at 1300 c by supplying excess air than usually required for \n oc regeneration . \n the hot pressurized \n air exiting the air reactor is separated from the oc particles in \n a cyclone separator and expanded in an air turbine . \n the air turbine exhaust \n has a high temperature and , therefore , is sent to the hrsg unit for \n heat recovery before released to the atmosphere . \n the steam generated \n in the whole process ( i.e. , gasifier , clc reactors , hrsg and other \n heat exchangers ) is used to drive the hp , ip , and lp steam turbines . \n as in cases without clc , the exhaust steam from the hp and ip steam \n turbines is reheated in the hrsg unit to 600 c before expanding \n through ip and lp steam turbines . in case 6 , \n the reduced oc \n from the fuel reactors is partially oxidized to fe3o4 in the steam reactor using steam at 30 atm and 350 c \n generated in the hrsg unit . \n this oxidation reaction of the oc is an \n exothermic process that generates h2 , which with some steam \n and oc particles comes out from the exhaust of the steam reactor maintained \n at 550 c through hp water / steam cooling . \n the oc particles are \n separated from the steam and h2 in a cyclone separator \n and sent for complete oxidation to fe2o3 by \n compressed air ( which is again an exothermic reaction ) in an air reactor \n ( see figure 1d ) . the hot mixture of h2 and steam after oc separation is cooled in hrsg unit that causes \n the steam to condense , generating a pure stream of pressurized h2 for further compression to 60 atm and storage . \n the hot pressurized \n air from the air reactor is expanded in an air turbine and then supplied \n to the hrsg unit before it is finally released to the atmosphere . \n equations 1 to 7 represent \n the reactions taking place inside the reactors of a clc process using \n an iron based oc . the key modeling information and choices used in the simulations \n are shown in tables 3 and 4 . \n table 3 shows the physical and chemical \n properties of illinois # 6 type coal used as fuel in all the cases . \n the \n databanks selected for aspen plus simulations are combust , inorganic , \n solids , and pure22 . \n coal \n and ash used in the simulation models are considered as nonconventional \n components ; therefore , information about their physical and chemical \n properties is needed . \n the property methods used for coal and ash are \n hcoalgen and dcoaligt , respectively . \n the \n oc and support materials are entered as solid in the component input \n data in aspen plus . \n the barin equation is used to calculate the physical \n properties of the solid compounds . \n the \n model retrieves the cpsxp ( a h ) coefficients from the inorganic \n databank of aspen . the key conditions and input parameters of each process unit such \n as gasifier , asu , turbines , and reactors are presented in table 4 . in all the seven processes studied in this work , \n the raw syngas is produced in a conventional gasification process \n represented by a ryiled decomposer and a rgibbs gasifier unit . \n four - stage adiabatic compressors represented by the mcompr \n model in aspen plus , are used for gas compression . \n these compressors \n need the discharge pressure from the final stage and isentropic efficiency \n as the input to the aspen plus model . \n the aspen plus pump models with \n an isentropic efficiency of 90% have been used to simulate pressurization \n of the water needed for steam generation . for heat recovery steam \n generation ( hrsg ) , mheatx type counter current heat exchangers are \n used . \n the built - in aspen plus reactor models ryield and rgibbs are used \n to design different reactive processes including ( i ) gasification , \n ( ii ) wgs reaction , ( iii ) oxidation of fuel in fuel reactor , and ( iv ) \n oc regeneration in steam and air reactor . \n a dry feed type entrained \n flow shell gasifier is considered in this work due to its dominance \n in the commercial igcc plant designs . \n an ryield reactor block is used \n to decompose the pulverized coal powder into its conventional constituent \n elements and also calculates the heat required for it . \n the conventional \n elements provided after decomposition of coal are fed to the rgibbs \n reactor block , which determines the possible products and their composition \n at equilibrium conditions . \n the rgibbs reactor is an equilibrium based \n reactor , which restricts individual equations to equilibrium and does \n not take account of the reaction kinetics . \n this type of reactor considers \n all the components as possible products , which is useful when there \n are many reactions between several components and the reaction kinetics \n is unknown . \n the operating temperature , pressure and o2 to \n coal ratio are the key parameters required as input to the rgibbs \n reactor . \n these reactors are supplied \n with hot syngas and steam at 30 atm at 350 and 178 c , respectively . \n a wgs reactor is modeled by using a requil block , which is an equilibrium \n based reactor in aspen plus . \n this block is useful when there are few \n reactions and the reaction kinetics is unknown . \n the temperature , \n pressure , and the chemical reaction equations are the key parameters \n required as input to a requil reactor . \n the reactants \n and products of the clc fuel reactors are assumed to be well - mixed . \n simple rgibbs reactor blocks of aspen plus are used for the simulation \n of the clc fuel oxidization process under equilibrium conditions . \n the operating temperature , pressure , and molar flow of oc particles \n and syngas are the key input parameters required for this model . \n the reactions \n taking place inside the fuel reactors are endothermic and require \n heat , which is provided by high temperature oc particles ( fe2o3 ) supplied from the air reactor . \n the steam \n reactor of a clc system uses steam to partially oxidize the reduced \n oc particles to fe3o4 while generating h2 as a product at thermodynamic equilibrium . \n the h2 yield of the steam reactor is directly proportional to the oc conversion . \n the steam reactor was modeled in aspen plus by using a single rgibbs \n reactor block . \n the key operating parameters used for modeling the \n steam reactor are operating temperature , pressure and molar flow ratio \n between steam and oc . \n the air reactor effected complete oxidization \n of the reduced oc particles to fe2o3 and was \n modeled as an entrained bed reactor with air and oc particles flowing \n cocurrently through the vessel . \n the combustor model , operating at \n a constant temperature and pressure , was used to predict the excess \n heat produced and the possible products . \n all of the combustion reactions \n are assumed to be fully completed in the combustor and this was sufficiently \n modeled using a rgibbs model . \n the ratio between oc and air supplied \n and the operating temperature are the key variables for the air reactor \n model . \n all \n cases were evaluated from both the energy and exergy point of view . \n the assessment of the overall performance of all the processes was \n performed using streamflow data , for example , mass flow of the components , \n pressure , temperature , power , and energy output provided by the simulation \n of each process configuration . \n gross electrical efficiency ( gross ) indicates the overall electricity produced by the steam \n and gas turbines used in the process . \n it does not consider the energy \n consumed by the auxiliary elements needed to run the plant and can \n be calculated using eq 8.8 net electrical efficiency ( net ) shows the actual electrical power produced by the system . \n this \n is calculated by deducting all the auxiliary energy consumed from \n the gross electricity produced , as shown in eq 9.9 h2 energy efficiency ( h2 ) applies to cases 3 , 4 , and 6 which produce both h2 and \n electricity . \n the term indicates the efficiency of the system in producing \n h2 from the coal feed . \n the thermal energy of h2 is used to calculate h2 efficiency , as shown by eq 10.10 overall energy efficiency ( overall ) for cases \n 1 , 2 , and 5 producing only electricity is the same as the net electrical \n efficiency shown by eq 9 . for the cases 3 , 4 , \n and 6 , \n overall is calculated by adding both electrical \n and h2 energy efficiency as shown by eq 11.11 specific co2 emission ( seco2 ) \n gives the amount of co2 released to the atmosphere by the \n system for per mw of energy generated , which is equal to the net electrical \n energy output for cases producing only net electricity , and electrical \n plus thermal energy of h2 for cases with coproduction . \n seco2 is calculated by eq 12.12 exergy is the maximum \n work that can be extracted from a system interacting with a reference \n environment , which is taken as 1 atm and 25 c for this study . for a process stream , its exergy can be divided \n into two parts ( physical and chemical ) . \n physical exergy ( exph ) equals to the maximum reversible amount of work \n obtainable when a stream of substance is brought from its actual state \n to the environmental state . \n the physical processes involve only thermal \n and mechanical interaction with the environment which is defined by \n pressure p0 and temperature t0 , respectively . \n assuming that potential and kinetic energy can \n be neglected , the physical exergy is expressed by eq 13:13where h and s are specific molar enthalpy ( kj / kmol ) and specific molar entropy \n ( kj / kmol k ) , respectively ; h0 and s0 are the values of h and s at standard conditions ( t0 , p0 ) . chemical exergy ( exch ) of a substance is the maximum \n amount of work obtainable by bringing it from the environmental state \n ( t0 , p0 ) to \n a full equilibrium with the chosen environment . \n the molar chemical \n exergy of an ideal mixture is expressed by eq 14 as14where xi and exchi are molar fraction and molar chemical exergy \n ( kj / kmol ) , respectively , of each component in the mixture , and r is the universal gas constant . \n exergy loss ( exloss ) of each individual unit can be \n calculated by finding the difference between the exergy of input and \n output streams of this unit:15 total exergy ( extotal ) of stream is \n taken as the sum of its physical and chemical exergy:16 chemical exergy of coal ( excoal ) : in calculation of \n the total exergy of coal , its physical exergy is considered to be \n zero , because the input coal feed is in the physical equilibrium with \n the environment . \n these equations \n are only applicable when the oxygen to carbon ratio in the given coal \n feed is less than 0.667.17 cv is the net calorific value of illinois # 6 type coal in kj / kg , w is the percentage of moisture content in the coal , hfg is the latent heat of water in kj / kg at temperature , to , and s denotes the mass fraction \n of sulfur in the fuel . \n the term dry is be calculated \n by using the eq 18.18where c , h , o , and n represents the mass \n fractions of carbon , hydrogen , oxygen , and nitrogen in the coal feed , \n respectively . \n h2 exergy efficiency ( exh2 ) is taken as the ratio of the total exergy content in h2 product to the chemical exergy of the coal feed:19 exergy efficiency ( ex ) of a system is the ratio \n of total exergy output to the total exergy given to the system . \n for \n the cases considered in this study , the total exergy output is the \n sum of electrical work output and chemical exergy of h2 stream produced in the process whereas the chemical exergy of the \n coal feed is taken as the exergy input to the system , as shown in \n eqs 20 and 21:2021 \n the net electrical efficiency and co2 captured shown in \n tables 5 and 6 are the \n two main investigated parameters , which are discussed in this section \n to compare clc , psa , and selexol based capture technologies . \n the simulation \n results of the clc process that produces only electricity ( case 5 ) \n give an overall electrical efficiency of 38.7% , which is close to \n what is observed by a previous study . \n the psa ( case 1 ) and selexol ( case 2 ) based processes showed an \n overall electrical efficiency of 37.4 and 36.4% , respectively , which \n is lower than case 5 . the electrical efficiency achieved for case \n 5 \n is also found to be substantially higher as compared with amine - based \n postcombustion capture technology , which has efficiency between 26.7 \n and 35.3% . \n the overall co2 capture efficiency of the clc process is 99.9% compared with 89.9% \n for psa and 93.5% for selexol processes . \n this lower overall capture \n efficiency of psa and selexol process is mainly due to the following \n reasons : ( i ) the 98% co conversion efficiency of wgs reactors compared \n to 99.99% conversion in the clc fuel reactor and ( ii ) 90.3% co2 capture efficiency for the psa and 95.0% for selexol units , \n compared to the assumed complete capture by clc . \n the unconverted co \n from the wgs reactor is oxidized in a combustor after the co2 removal step in the presence of air to produce co2 . \n this \n co2 along with the uncaptured co2 from the co2 removal unit is expanded in a gt before it is finally vented \n to the atmosphere with the other flue gases . \n figure 2a shows the variation in electricity \n production and carbon emissions for all the three different co2 capture cases with electricity production only . \n compared \n with the clc process ( case 5 ) that emits 0.0006 t / mwh of co2 at an emission rate of 0.28 t / h , the psa ( case 1 ) and selexol ( case \n 2 ) technologies emit 0.079 and 0.051 t / mwh of co2 at an \n emission rate of 33.6 and 21.1 t / h , respectively . \n figure 2b shows a comparison between cases 0 , 1 , 2 , and \n 5 for gross power output , power consumption , and net power produced . \n clc process ( case 5 ) produces less power from the gt unit , but it \n generates more power from the steam turbines , which results in more \n net electricity production ( 436.9 mw ) compared with case 1 ( 421.1 \n mw ) and case 2 ( 409.6 mw ) . \n ( a ) relation between electricity production and co2 emissions \n for cases 0 , 1 , 2 , and 5 and ( b ) relation between power production , \n power consumption and net power output for cases 0 , 1 , 2 , and 5 . \n table 5 shows the results \n of case 0 , which is taken as a base case that produces only electricity \n without any co2 capture . in case 0 , \n the syngas stream from \n the wgs reactors is supplied to the combustor unit eliminating the \n co2 scrubbing step . \n the unconverted co , and h2 from the wgs reactor unit are oxidized in the combustor in the presence \n of air . \n the product stream from the combustor is expanded through \n the gt and sent to hrsg before it is finally vented to the atmosphere . \n the base case has a higher net electrical efficiency of 41.4% compared \n to the other cases ( cases 1 , 2 , and 5 ) , which produce only electricity \n with co2 capture . \n figure 3 shows \n that case 2 using the selexol process suffers the highest net energy \n penalty of 57.2 mw versus case 0 compared to 29.9 mw for clc and 45.7 \n mw for psa - based processes . \n the results from table 6 indicate that per mw decrease in energy production compared \n to the base case , the clc process captures significantly higher co2 ( 9.3 t / h ) compared to psa ( 5.3t / h ) and selexol ( 4.5 t / h ) \n process . \n the relative decrease in the net electrical efficiency in \n comparison to base case ( case 0 ) for precombustion based capture processes \n ( case 1 and 2 ) is lower than the energy penalty of 2029% for \n the amine based postcombustion capture methods described in a report \n of the iea . \n energy and efficiency penalty in cases 1 , 2 , and 5 with reference \n to the case 0 . \n table 7 shows \n the energy consumption in co2 compression work for psa , \n selexol and clc processes . \n it can be seen that the clc process ( case \n 5 ) requires only 10.2 mw for compressing 278 t / h of co2 whereas the igcc with psa ( case1 ) and igcc with selexol ( case 2 ) \n processes require 26.3 mw and 29.9 mw , respectively , even though they \n compress less co2 compared to the clc . \n this is due to the \n fact that the co2 stream available for compression in this \n clc process is already at elevated pressure levels of approximately \n 30 atm , and therefore , less energy is required for compressing co2 to 150 atm . on the other hand , \n the co2 streams \n available for compression in the cases of the psa and selexol processes \n are very close to atmospheric pressure , which explains the higher \n compression energy requirement for these two technologies . \n further \n analysis can be made to consider the co2 stream being produced \n from the system at a pressure of 1 atm . for cases 1 and 2 \n , this would \n mean that the co2 compression step is eliminated . in case \n 5 \n , this analysis assumes that the pressurized ( 30 atm ) co2 stream from the fuel reactor is expanded in an expander , which will \n produce an extra 5.11 mw of power . as shown in table 7 , the clc process will still be more energy efficient than \n the selexol and psa processes and attain a net electrical efficiency \n of 40.0% . \n some consider that this analysis could be useful if the \n co2 captured from the power plant were to be used in other \n industries , instead of sequestration . \n for example , the food and chemical \n sectors may have no need for compressed co2 . \n however , very \n few processes other than enhanced oil recovery ( eor ) and potentially \n the production of urea are likely to be able to utilize a significant \n fraction of the co2 produced by a gasifier producing 467 \n mwe . \n one of the main objectives of this work was to investigate the suitability \n of the gasification - coupled clc process ( case 6 ) compared to igcc \n with psa ( case 3 ) and selexol ( case 4 ) technologies for combined electricity \n and h2 generating plants . \n table 8 summaries the results of these cases for identical h2 production rates ( 524 mw ) from each process . \n case 6 with clc yields \n an overall energy efficiency ( 59.4% ) , which is marginally higher than \n case 4 selexol ( 59.1% ) . \n case 6 has a lower overall efficiency compared \n to the case 3 psa ( 60.0% ) process owing to two main reasons : ( i ) lower \n gt inlet temperature of 727 c compared to 1185 c for case \n 3 and ( ii ) higher power consumption by the air compressor in air reactor . \n figure 4 shows the trade - off between the \n electrical , h2 and overall efficiencies for case 6 . \n the \n overall efficiency increases with the h2 production rate \n whereas the electrical efficiency shows an opposite trend . \n the decrease \n in electrical power is the result of less h2 being available \n for combustion in the gt combustor unit . \n the h2 produced \n in the steam reactor of the clc system can be used for electricity \n generation during periods of high electricity demand by simply burning \n it in a separate combustor and expanding through the gt along with \n the hot air reactor exhaust . \n variation of electrical , h2 , and overall efficiency \n versus the h2 output for case 6 . \n tables 5 and 8 show \n the results of exergy analysis for all the seven cases . \n the study \n indicates an overall exergetic efficiency of 53.6% for case 3 with \n the psa process producing combined electricity and h2 , \n which is the highest among all the seven cases analyzed here . \n the \n other two cases for electricity and h2 production using \n selexol ( case 4 ) and clc ( case 6 ) process have exergetic efficiencies \n of 52.7 and 53.0% , respectively . \n the exergetic efficiency of clc process \n is higher compared to selexol and psa processes in cases with electricity \n production only . \n it is also seen that the captured co2 stream \n contains 7.510.2% of the total chemical exergy of the coal \n used as the fuel to the system . \n if this exergy of the captured co2 stream is considered to recognize the effort dedicated to \n co2 capture , it would make the clc process more exergetically \n efficient among the cases with combined h2 and electricity \n production . \n all the configurations with co2 capture , represented by cases 16 , assumed that n2 from the asu is added to the feed to the gt unit to enhance \n its power output . \n the n2 stream produced in the asu is \n compressed ( 22 atm for the cases without clc process and 32 atm for \n clc ) and supplied to the combustors ( in cases without clc ) and to \n the air reactors ( in cases with clc ) eventually for expansion through \n the gt / air turbine . \n figure 5 shows that all \n the processes benefit , in terms of their power output , from the integration \n of asu with the gt unit . the gasification - coupled clc process ( cases \n 5 and 6 ) is least effected by asu integration . \n in contrast , case 1 \n experiences 4.7% increase in the net electrical efficiency which is \n the highest among all six cases . \n the results show that integrating \n n2 stream with the gt cycle can improve the overall electrical \n efficiency of the process despite the extra work required for n2 compression . \n potentially , further integration can be done to use the air from \n the more efficient compressor of the gt power cycle to supply compressed \n air to the asu . \n the main limitation of \n such integration is that the asu can not start unless the gt starts \n running . \n this problem can be resolved by using a separate air compressor \n for the asu to start up the process . with the model of gasification - coupled \n clc ( case 5 ) , the effect of change in air reactor temperature on the \n net electric power produced has been analyzed . \n figure 6a shows that the net power production increases with the air \n reactor temperature . \n the power is produced in the gt unit , which is \n supplied with hot exhaust from the air reactor , and in the steam turbine \n unit . \n steam is generated by the hrsg unit which recovers heat from \n the hot exhaust of the fuel reactor and that of the gas turbine . \n the \n air reactor regulates its temperature via the amount of excess air \n supplied to the reactor beyond what is required by complete combustion . \n figure 6a shows that as the temperature of \n the air reactor increases , both the power from the stream turbine \n unit and that from the gt unit increase . \n effect of ( a ) air reactor temperature and ( b ) water - cooling of \n the air reactor on the power output for clc process . \n the exhaust gases from the air reactor are expanded through the \n gt , which gives a higher yield when operated at a higher temperature \n range . \n this provides the explanation behind the increase in gt power \n output with air reactor temperature . when the air reactor is maintained \n at higher temperature , the temperature of oc supplied to the fuel \n reactor from the air reactor is also high and hence is higher the \n fuel reactor temperature . \n this means a high temperature fuel reactor \n exhaust is available in the hrsg for steam generation , explaining \n the reason behind the gain in steam turbine power output with increase \n in air reactor temperature . \n the clc system ( case 5 ) was examined \n for the effects of using water - cooling of the air reactor instead \n of excess air supply as an alternative to maintain the required temperature \n of 1300 c throughout the study . \n the hp water after absorbing \n heat from the air reactor is converted into hp steam , which is used \n for power generation . \n it has been found from the sensitivity analysis \n that an excess air supply of 81.14% can maintain the desired air reactor \n temperature without requiring any cooling by water . \n figure 6b indicates that the use of water - cooling results \n in decrease in the feed to the gt , gross , and net power output of \n the system , whereas the steam turbine output power increase due to \n more steam available for the steam turbines . completely using water / steam \n cooling for \n however , this can help in reducing the size of the air reactor , compressor , \n gas solid separator , and gt , and hence , the capital cost of \n the plant . \n this article investigates the performance characteristics of seven \n different types of gasification based coal power plants with and without \n the co2 capture using psa , selexol and clc processes . \n cases \n 0 , 1 , 2 , and 5 produced only electricity while cases 3 , 4 , and 6 produced \n combined electricity and h2 . \n the results generated from the flowsheet simulation \n models were compared based on the electrical efficiency , h2 production , and co2 emissions . \n the effect of asu and \n gt integration on the performance of all co2 capture cases \n was estimated . \n sensitivity analysis was performed for the clc process \n to study the plant behavior with respect to air reactor temperature \n and water cooling of the air reactor . among the systems producing only electricity with co2 capture \n , the clc based process achieves the highest electrical efficiency \n ( 38.7% ) compared with psa ( 37.4% ) and selexol ( 36.4% ) based processes . \n in electricity and h2 cogeneration cases , \n the clc - based \n process has marginally lower ( by 0.6% ) and higher ( by 0.3% ) net electrical \n efficiencies than the psa and selexol based process , respectively \n . \n however , clc process can capture 99.9% of co2 produced , \n which is potentially higher in comparison to 89.9% for psa and 93.5% \n for selexol based processes . \n further comparison among the three capture \n processes could also be made , based on the cost and life cycle analysis \n in order to assess the combined techno - economic viability , but such \n a comparison is beyond the scope of our present study . \n the asu and \n gt integration results in higher power output for all the cases ; however , \n the cases with clc process have the least effect . \n the sensitivity \n analyses performed on clc process shows that it is favorable to operate \n the air reactor at higher temperatures for more net power output . \n also it has been concluded that cooling of air reactor ( while maintaining \n 1300 c ) by using excess air supply instead of pressurized water \n tends to increase the net power output of the clc system . \n in addition to the factors considered in the current work , a number \n of potential improvements will be studied in future investigations . \n these include extracting and utilizing the heat released by the intercooled \n compressors , and replacing the cryogenic asu with membrane - based technology , \n which can possibly be more efficient when integrated with the gt unit . \n a detailed sensitivity analysis of the three capture technologies \n at all different possible operating conditions will be considered \n in future work to further study and understand the plant behavior \n in order to assist the optimization of power plants . \n the clc process \n has comparatively more scope of efficiency improvement in future by \n directly using the solid coal fuel into the fuel reactor , eliminating \n a separate gasification and asu , which are responsible for high exergy \n losses in the system .", "role": "user" }, { "content": "seven different types of gasification - based coal conversion processes \n for producing mainly electricity and in some cases hydrogen ( h2 ) , with and without carbon dioxide ( co2 ) capture , \n were compared on a consistent basis through simulation studies . \n the \n flowsheet for each process was developed in a chemical process simulation \n tool aspen plus . \n the pressure swing adsorption ( psa ) , \n physical absorption ( selexol ) , and chemical looping combustion ( clc ) \n technologies were separately analyzed for processes with co2 capture . \n the performances of the above three capture technologies \n were compared with respect to energetic and exergetic efficiencies , \n and the level of co2 emission . the effect of air separation \n unit ( asu ) and gas turbine ( gt ) integration on the power output of \n all the co2 capture cases is assessed . \n sensitivity analysis \n was carried out for the clc process ( electricity - only case ) to examine \n the effect of temperature and water - cooling of the air reactor on \n the overall efficiency of the process . \n the results show that , when \n only electricity production in considered , the case using clc technology \n has an electrical efficiency 1.3% and 2.3% higher than the psa and \n selexol based cases , respectively . \n the clc based process achieves \n an overall co2 capture efficiency of 99.9% in contrast \n to 89.9% for psa and 93.5% for selexol based processes . \n the overall \n efficiency of the clc case for combined electricity and h2 production is marginally higher ( by 0.3% ) than selexol and lower \n ( by 0.6% ) than psa cases . \n the integration between the asu and gt units \n benefits all three technologies in terms of electrical efficiency . \n furthermore , our results suggest that it is favorable to operate the \n air reactor of the clc process at higher temperatures with excess \n air supply in order to achieve higher power efficiency .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: deep sternal wound infection ( dswi ) is a rare but serious and potentially fatal complication after median sternotomy for cardiac surgery , with an incidence rate 0.5% to 4% and an associated mortality rate between 14% and 47% . presently , management of this problem is still controversial . \n some reports emphasize that more efforts should be taken to prevent it rather than to treat it , especially for those patients who have high risk factors such as obesity , comorbidities of diabetes mellitus , or chronic obstructive pulmonary disease . \n however , the introduction of various flaps has led to a significant decrease in morbidity and mortality over the past 30 years . according to the severity and dimensions of the dswi , the therapeutic methods range from conservative treatment to radical surgical debridement followed by negative pressure wound therapy or 1-stage flap coverage . \n current sternal wound management involves debridement of any devitalized infected soft tissues and bones , administration of culture - specific antibiotics , and the use of a vascularized flap to fill the wound cavity . at present , the pectoralis major muscle or myocutaneous flap remains the most common method for closing the majority of the infected median sternotomy wound . \n however , this flap does not have the capacity to resurface the entire length of the sternal defect when the thoracic defects are larger than half of the sternum . \n the greater omentum has the ability to cover the entire wound and control the sternal infection , but perhaps , leads to the spread of the infection to the abdomen . \n the rectus abdominis myocutaneous flap ( ramf ) has the major advantages of easy dissection , proximity to the infected sternal wound , and provision of ample skin island to repair the extensive thoracic skin deficit . \n however , several authors reported that this flap may not be considered as a viable option for sternal defects reconstruction when the ipsilateral or bilateral internal mammary artery ( i m a ) had been harvested for coronary artery bypass grafting ( cabg ) . \n when the ramf is rotated by 180 into the thoracic defects , the inferior epigastric artery ( iea ) can be anastomosed to the intercostal artery or the i m a perforator . \n thus , this flap possesses a double blood supply . in this study , we aimed to describe our experience with the ramf for large sternal wound management , especially in the absence of 1 or 2 internal mammary arteries . to our knowledge , this is the first introduction of the particular ramf with a double blood supply . \n between october 2010 and january 2016 , 9 consecutive patients who had received sternal reconstruction with the ramf after radical surgical debridement were referred . \n the general data ( table 1 ) was collected by reviewing the medical records of the patients . according to the american center of disease control norm \n , dswi was defined as clinical infection requiring surgical debridement up to and including the sternum , with or without positive microbiology . \n the 9 patients in this study included 7 males and 2 females , with a mean age of 59 years ( range : 4865 years ) . \n patients weights ranged from 43 to 95 kg , with a mean weight of 78 kg . \n all selected patients were received at least 2 debridements ( range : 24 times ) before sternal defect closure , and did not undergo any other flap procedures to repair the defects before the ramf procedure which was performed by the same surgeon ( zhao zheng ) . \n the second intercostal artery or the second i m a perforator was identified with the handheld doppler probe preoperatively and marked ( to decide which artery was anastomosed to the iea ) . \n next , the superior epigastric artery ( sea ) and the iea were marked , then the sea iea axis \n after microbiological specimens were collected , all infected necrotic tissues and bones were removed until healthy solid bone with bleeding margins was found . \n we carefully protected the internal mammary vessels during resection of the infected bones and cartilaginous structures . \n the dimensions of the thoracic defects were templated made and marked on the abdominal skin and off the midline . \n , the inferior epigastric vessels were viewed as a pedicle left at the inferior axis of the flap and the pedicle length was about 8 to 10 cm . \n then , the flap was rotated by 180 and filled into the sternal defects over suction drains . \n the abdominal donor defects were repaired by suturing the margin of the remaining anterior rectus sheath to its lateral component and then the skin was closed by relaxation suture . \n the iea was anastomosed to the second intercostal artery or the second i m a perforator . at the same time , the inferior epigastric vein was anastomosed to the concomitant vein . \n therefore , the ramf had a double blood supply ( the anastomotic artery and the sea ) . \n the iea anastomosis was selected according to the following indication : the ipsilateral or bilateral i m a had been harvested previously or the contralateral i m a was ligated during previous cabg and the wound almost encompassed the full length of the sternum . after the operation , \n between october 2010 and january 2016 , 9 consecutive patients who had received sternal reconstruction with the ramf after radical surgical debridement were referred . \n the general data ( table 1 ) was collected by reviewing the medical records of the patients . according to the american center of disease control norm \n , dswi was defined as clinical infection requiring surgical debridement up to and including the sternum , with or without positive microbiology . \n the 9 patients in this study included 7 males and 2 females , with a mean age of 59 years ( range : 4865 years ) . \n patients weights ranged from 43 to 95 kg , with a mean weight of 78 kg . \n all selected patients were received at least 2 debridements ( range : 24 times ) before sternal defect closure , and did not undergo any other flap procedures to repair the defects before the ramf procedure which was performed by the same surgeon ( zhao zheng ) . \n all procedures were performed under general anesthesia . the second intercostal artery or the second i m \n a perforator was identified with the handheld doppler probe preoperatively and marked ( to decide which artery was anastomosed to the iea ) . \n next , the superior epigastric artery ( sea ) and the iea were marked , then the sea \n after microbiological specimens were collected , all infected necrotic tissues and bones were removed until healthy solid bone with bleeding margins was found . \n we carefully protected the internal mammary vessels during resection of the infected bones and cartilaginous structures . \n the dimensions of the thoracic defects were templated made and marked on the abdominal skin and off the midline . \n , the inferior epigastric vessels were viewed as a pedicle left at the inferior axis of the flap and the pedicle length was about 8 to 10 cm . \n then , the flap was rotated by 180 and filled into the sternal defects over suction drains . \n the abdominal donor defects were repaired by suturing the margin of the remaining anterior rectus sheath to its lateral component and then the skin was closed by relaxation suture . \n the iea was anastomosed to the second intercostal artery or the second i m a perforator . at the same time , the inferior epigastric vein was anastomosed to the concomitant vein . therefore \n , the ramf had a double blood supply ( the anastomotic artery and the sea ) . \n the iea anastomosis was selected according to the following indication : the ipsilateral or bilateral i m a had been harvested previously or the contralateral i m a was ligated during previous cabg and the wound almost encompassed the full length of the sternum . after the operation , \n nine patients who had the extensive thoracic defects were treated by the plastic surgery team during the study period . overall preoperative status \n six patients were in asa grade 3 and 3 patients in asa grade 4 ( table 1 ) . \n of the 8 patients who received the cabg , 7 patients had been harvested of 1 or 2 internal mammary arteries and 1 patient had aorto - coronary arterial saphenous vein bypass grafting ( table 1 ) . \n the mean operation time was 176 minutes ( range : 155228 minutes ) including the vascular anastomosis and the debridement . \n there was no recurrent infection after the thoracic defects were covered with the ramf combined with antibiotic therapy . \n one patient who did not have the double blood supply flap suffered from a distal part necrosis of the flap 7 days later and was taken back to the operation room . \n then , the distal 10% of the flap was debrided and reconstructed with a split - skin graft . \n the other patient had a seroma at the abdomen donor site and was managed conservatively . \n the mean overall hospitalization time was 32 days ( range : 2356 days ) after referral to the plastic surgery department . \n the mean follow - up time was 6 months ( range : 312 months ) . \n the schematic diagram of the double blood supply ramf for coverage of the entire sternum is shown in fig . \n a 60-year - old man received coronary artery bypass grafting and his bilateral internal mammary artery had been harvested . \n after this operation , deep sternal wound infection occurred and 2 debridements were performed by cardiac surgeons . because of the large defect area ( 25 cm10 cm ) , the patient was recommended into our department . \n defect reconstruction was achieved by rectus abdominis myocutaneous flap combined with the inferior epigastric artery anastomosed to the second intercostal artery perforator . \n ( a ) large sternal defect after 2 debridements by the cardiac surgeon . ( b ) \n mediastinal organs were exposed after radical surgical debridement ( c ) defect reconstruction with a double blood supply rectus abdominis myocutaneous flap ( the inferior epigastric artery was anastomosed to the second intercostal artery perforator ) . \n ( d ) at a 6-month follow - up , no wound infection was found and the patient was satisfied with his own state . \n the schematic diagram shows the double blood supply rectus abdominis myocutaneous flap for coverage of the entire sternum . \n ( a ) the red arrow indicates the inferior epigastric vessels , which were left at the inferior axis of the rectus abdominis myocutaneous flap . \n ( b ) when the rectus abdominis myocutaneous flap was rotated by 180 into the sternal defects , the inferior epigastric artery ( the red arrow ) was anastomosed to the second intercostal artery . at the same time , the inferior epigastric vein was anastomosed to the concomitant vein . \n treatment of the dswi has improved significantly over the past half century . during the 1960s , \n the infected sternal wound was managed by local debridement with closed catheter antibiotic irrigation , which led to mortality rate up to 20% . in 1976 , \n the greater omentum was first reported to cover the extensive thoracic defects after extensive bone and cartilage debridement . \n later , various muscle or myocutaneous flaps became the primary treatment for reconstruction of the sternal defects . in the 1990s , vacuum - assisted closure dressings occurred and was readily viewed as an adjunct to facilitate sternal wound healing , even as the sole method for definitive treatment in specific cases . today , repairing the wound with well - vascularized muscle or myocutaneous flap after the early radical surgical debridement becomes an effective method . \n in this study , we used the ramf to repair the extensive thoracic defects containing almost the entire sternum , especially in those patients whose ipsilateral or bilateral i m a had been divided for reasons such as cabg . \n the rectus abdominis received dual - dominant blood supply from the superior and inferior epigastric arteries , which consisted of a complex perfusion pattern . \n the sea is a continuation of the i m a and the iea comes from the external iliac artery . with the superior epigastric vessels as the sole blood supply \n , the rectus abdominis with or without the overlying skin can be raised as a local flap to repair the sternal wound from the manubrium sterni to the xiphoid . \n the most common complication is the distal part necrosis of the flap because the distal flap can not receive enough blood supply from the pedicle . \n however , this complication did not occur when the iea was anastomosed to the second intercostal artery or the second i m a perforator in our case series . \n several studies reported that prior harvesting of ipsilateral or bilateral i m a may preclude the use of the ramf . \n indeed , we can speculate that the collateral circulation will be strengthened from the anterior intercostal arteries when the i m a has been ligated previously . \n furthermore , the i m a divides distally behind the sixth or seventh interspace into the sea and the musculophrenic artery . \n if the i m a is ligated on the distal bifurcation point , the musculophrenic artery will provide a rich supply of collateral circulation to the sea . based on this \n , some previous studies reported that the rectus abdominis muscle or the myocutaneous flap was used successfully for median sternotomy wounds after ipsilateral i m a ligation . \n however , this flap is limited to repair the lower half of small sternal wound , which requires a pectoralis major muscle flap for the superior part of the wound . in our study , the entire sternal wound was repaired successfully when we took advantage of the iea to provide additional blood supply to the ramf . \n there are also other alternative methods to reconstruct the extensive thoracic defects which comprise almost the entire sternum and the significant skin defect after radical surgical debridement . \n for example , pectoralis major muscle advancement for upper sternum with rectus abdominis muscle turn - over for the coverage of lower sternum is another choice for the entire sternal wound reconstruction . \n however , we rarely consider the combined use of 2 or more local flaps in our study when a single local flap is sufficient to repair the defect . \n the greater omentum flap is also a useful reconstructive option because it contains rich vascular supply and large amount of available soft tissues which can reach the entire sternal defects and fill irregular defects sufficiently . \n the emergence of laparoscopic omental harvest has gained great attention on omental flap use in extensive thoracic defects after dswi . \n in addition , several previous literatures suggested that the use of omentum may be associated with lower mortality and fewer complications when compared with the pectoralis muscle flap . \n . moreover , omentum may not be available in those patients with intra - abdominal adhesion after previous surgery . \n lastly , secondary split - thickness skin graft is necessary when compared with the ramf . \n more recently , the free myocutaneous flap has been described for sternal wound closure and viewed as a new choice to repair the extensive thoracic defects after dswi . in our case \n the complication rate of 22% ( 2/9 ) is comparable to that found in previous studies of 25% to 30% . \n the tip necrosis is the major complication associated with the ramf , which has been reported in a lot of literatures . but \n this complication did not occur in our patients whose iea had been anastomosed to the second intercostal artery or the i m a perforator . \n furthermore , even when the ipsilateral or bilateral i m a has been harvested , the particular ramf also has enough blood supply and heals well . despite the satisfactory results that all patients were healed and did not have recurrent infection \n first , because of the small number of patients included in the study , we can not have enough data for further analysis and make a stronger conclusion . \n in fact , the small number of eligible patients is largely due to the rare prevalence of the extensive thoracic defects after dswi . \n in addition , when the bilateral i m a and 1-sided iea are harvested , it may decrease the abdominal wall perfusion and increase the risk of abdominal wall herniation . in conclusion \n , our study suggests that the ramf may be suitable to repair the large sternal wound up to the entire sternum . \n when one or both internal mammary arteries have been ligated for cabg or other reasons , the iea can be anastomosed to the second intercostal artery or the i m a perforator to provide the flap with a double blood supply .", "role": "user" }, { "content": "abstractdeep sternal wound infection is a severe complication after open heart surgery . according to the different severity and dimensions of the deep sternal wound infection \n , the treatment method is different . in this study \n , we aimed to describe our experience with the rectus abdominis myocutaneous flap for large sternal wound management , especially when 1 or 2 internal mammary arteries were absent.between october 2010 and january 2016 , a retrospective review of 9 patients who suffered from the extensive thoracic defects after deep sternal wound infection was conducted . \n all of these sternal defects encompassed almost the full length of the sternum after debridement . \n defect reconstruction was achieved by covering with a rectus abdominis myocutaneous flap . when the ipsilateral or bilateral internal mammary artery had been harvested previously , we took advantage of the inferior epigastric artery to provide additional blood supply to the rectus abdominis myocutaneous flap . \n thus , this flap had a double blood supply.there was no recurrent infection in all 9 patients . \n three patients received the rectus abdominis myocutaneous flap with a double blood supply . \n flap complications occurred in 2 patients ( 22% ) . \n one patient who did not have the double blood supply flap suffered from necrosis on the distal part of the flap , which was then debrided and reconstructed with a split - skin graft . \n the other patient had a seroma at the abdomen donor site and was managed conservatively . \n none of the patients died during the hospital stay.this study suggests that the rectus abdominis myocutaneous flap may be a good choice to repair the entire length of sternal wound . \n when 1 or 2 internal mammary arteries have been harvested , the inferior epigastric artery can be anastomosed to the second intercostal artery or the internal mammary artery perforator to provide the rectus abdominis myocutaneous flap with a double blood supply .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: mir-506 belongs to a chrxq27.3 mirna cluster that is associated with early relapse in advanced stage ovarian cancer . in our previous study \n , we demonstrated that mir-506 is a potent inhibitor of the mesenchymal phenotype and transforming growth factor ( tgf-)-induced emt by directly targeting snail family zinc finger 2 ( snai2 ) , a transcriptional repressor of the epithelial protein e - cadherin . \n subsequently , we further illustrated a broader role of mir-506 in the suppression of emt via its direct regulation of 2 well - known mesenchymal proteins , vimentin and n - cadherin , in all epithelial ovarian carcinoma subtypes . \n therefore , mir-506 represents a novel class of mirna that regulates both e - cadherin and vimentin / n - cadherin to suppress emt . \n the expression of e - cadherin and vimentin / n - cadherin represents 2 spectrums of emt and met . \n accumulating evidence suggests that these pathways crosstalk closely and regulate one another . in our study , we found that the knockdown of vimentin up - regulated e - cadherin expression . \n rodriguez et al . reported that vimentin inhibited e - cadherin and induced emt via glycogen synthase kinase 3 ( gsk-3 ) , an upstream regulator of snai1 . \n our recent study showed that mir-506 inhibited the expression of forkhead box protein m1 ( foxm1 ) by directly down - regulating cyclin - dependent kinase 4 ( cdk4)/cdk6 . \n foxm1 is a transcriptional activator of snai1 , another major e - cadherin repressor , . \n mir-506 also targets nuclear factor kappa b ( nfb ) p65 , which was implicated in the regulation of emt . \n identified the nfb - binding site in the n - cadherin promoter and reported that the loss of e - cadherin activated nfb and induced n - cadherin expression during the emt of melanoma cells . \n therefore , mir-506 has emerged as a key network gatekeeper for epithelial and mesenchymal lineage switches by simultaneously regulating multiple nodes in the sophisticated regulatory network ( figure 2 ) . because mir-506 functions as a potent suppressor of emt , it may be useful as a small - molecule therapeutic agent for cancer . \n we tested this possibility in a preclinical study in which nanoparticle delivery of mir-506 effectively suppressed tumor growth and spread in 2 orthotopic ovarian cancer models , . \n in addition to its effect on emt , this tumor suppression function of mir-506 may also be partly caused by its recently recognized role in the inhibition of cell proliferation and the promotion of senescence by directly targeting its binding sites on the 3- untranslated regions ( 3-utrs ) of cdk4 and cdk6 . \n the cdk4/6 inhibitor pd-0332991 is currently undergoing clinical testing in several cancer types. the transcription factor network cdk4/6-foxm1 is activated in more than 80% of high - grade serous ovarian cancer cases . collectively , these data suggest that mir-506 is a potential therapeutic agent for ovarian cancer , and further studies are needed to validate the clinical value of mir-506 in the treatment of ovarian cancer . \n the mirna - gene network shows the relationships between 8 key mirnas and epithelial - to - mesenchymal transition ( emt ) signature genes they are predicted to regulate . \n the size of each gene node indicates the number of predicted key mirnas regulators ; the colors indicate the annotated function of the gene . only genes with gene ontology ( go ) and kyoto encyclopedia of genes and genomes ( kegg ) annotations \n the role of mir-506 in emt inhibition , cell senescence , and differentiation has also been demonstrated in several other cancer types , including breast cancer , lung cancer , cervical cancer , and neuroblastoma , , , , indicating that mir-506 functions as a tumor suppressor in a wide spectrum of cancers . \n this is consistent with the result of a recent large - scale screening of epigenetically regulated mirnas in ovarian cancer , which showed the xq27.3 mirna cluster ( including mir-506 ) was regulated by epigenetic mechanisms . \n further studies using larger sample sizes are needed to reveal the relationship between mir-506 methylation and mir-506 expression . \n mir-506 directly targets snai2 , vimentin , n - cad , nfb and cdk4/cdk6 . mir-506 \n down - regulates snai2 which increases e - cad expression and subsequently promotes cell - cell adherence . \n mir-506 directly down - regulates vimentin and n - cadherin , which reduces cell mobility and cell - matrix adherence . mir-506 \n also targets nfb p65 which transactivates n - cad and vimentin and is implicated in the regulation of emt , . \n mir-506 inhibits the expression of foxm1 by directly down - regulating cdk4/cdk6 , which not only promotes cellular senescence but also inhibits emt via suppressing the expression of snai1 and zeb1/2 . \n therefore , mir-506 inhibits cancer progression through suppressing emt and promoting cellular senescence . decreased expression of mir-506 partially results from promoter methylation . \n emt , epithelial - to - mesenchymal transition ; e - cad , e - cadherin ; snai2 , snail family zinc finger 2 ; n - cad , n - cadherin ; nfb , nuclear factor kappa b ; cdk4 , cyclin - dependent kinase 4 ; cdk6 , cyclin - dependent kinase 6 ; foxm1 , forkhead box protein m1 ; snai1 , snail family zinc finger 1 ; zeb1 , zinc finger e - box binding homeobox 1 ; zeb2 , zinc finger e - box binding homeobox 2 ; ilk , integrin - linked kinase ; gsk-3 , glycogen synthase kinase 3. \n there are 2 separate copies of the mir-101 gene , located on 1p31.3 and 9p24 . \n both regions have been identified as fragile regions of the genome that are associated with abnormal deletion or amplification in cancer . \n down - regulation of mir-101 has been observed in bladder cancer , intraductal papillary mucinous neoplasms of the pancreas , and ovarian carcinoma , suggesting that mir-101 plays a role in tumor progression . \n recent reports showed that mir-101 is methylated in several cancer types , explaining its decreased expression . \n abnormal expression of mir-101 may lead to a more malignant phenotype and promote cancer progression . \n a recent study found that low mir-101 expression in several subtypes of ovarian cancer tissues is significantly associated with poor cell differentiation , advanced international federation of gynecology and obstetrics ( figo ) stages , and resistance to cisplatin . \n by contrast , mir-101 overexpression reduced the proliferation and migration of ovarian cancer cells and re - sensitized drug - resistant cancer cells to cisplatin - induced cytotoxicity . \n mir-101 may suppress tumor proliferation and migration and induce apoptosis by targeting enhancer of zeste homolog 2 ( ezh2 ) , and janus kinase 2 ( jak2 ) . \n mir-101 may also induce senescence in breast cancer cells by targeting ubiquitin - conjugating enzyme e2n ( ube2n)- and swi / snf - related , matrix - associated , actin - dependent regulator of chromatin , subfamily a , member 4 ( smarca4 ) and inhibit the g1-to - s phase transition of cervical cancer cells by targeting fbj murine osteosarcoma viral oncogene homolog ( fos ) . like most mirnas , mir-101 acts as a tumor suppressor in cancers by targeting the 3-utr of multiple genes , including ezh2 , ube2n and smarca4 , mitogen - activated protein kinase 1 ( mapk1 ) and fos , kruppel - like factor 6 ( klf6 ) , dna ( cytosine-5-)-methyltransferase 3 alpha ( dnmt3a ) , and cyclooxygenase-2 ( cox-2 ) . \n several recent publications have demonstrated that mir-101 can suppress emt in cancers , including colon cancer . \n our investigations of the mirna network that regulates the emt of ovarian carcinoma have identified mir-101 as a key regulator . \n recent studies have shown that mir-101 regulates emt through its effects on ezh2 , and the wnt signaling pathway . \n our group has provided evidence that mir-101 suppresses emt in ovarian cancer by directly targeting the e - cadherin suppressor genes zinc finger e - box binding homeobox 1 ( zeb1 ) and zeb2 via specific binding sites on their 3-utrs . \n therefore , the literature consistently supports that mir-101 is a tumor suppressing mirna and that one of the key cellular processes mir-101 regulates is emt ( figure 3 ) . \n mir-200 is a family of tumor suppressor mirnas that consists of 5 members ( mir-200a , mir-200b , mir-200c , mir-141 , and mir-429 ) , which are significantly involved in the inhibition of emt . \n the mir-200 family is often down - regulated in human cancer cells and tumors as a result of aberrant epigenetic gene silencing , . \n recent studies reported that the mir-200 family plays a critical role in suppressing emt as well as cancer invasion and metastasis by targeting transcriptional repressors of zeb1 and zeb2 . \n furthermore , zeb1 and zeb2 repress the expression of mir-200a and mir-141 by binding to a conserved pair of zeb - type e - box elements proximal to the transcription start site in the promoter region . \n therefore , zeb1 and zeb2 and mir-200 family members repress the expression of one another in a reciprocal feedback loop , which may lead to an amplification of emt . \n both p300 and pcaf act as cofactors for zeb1 , forming a p300/pcaf / zeb1 complex on the mir200c/141 promoter . \n this results in lysine acetylation of zeb1 and abrogates zeb1 's suppression of mir-200c/141 transcription . \n p53 has been reported to transactivate mir-200 family members by directly binding to the promoters of mir-200c and repress the expression of zeb1 and zeb2 , leading to an inhibition of emt , . moreover , \n npv - lde-225 ( erismodegib ) suppressed emt by increasing the expression of mir-200a , mir-200b , and mir-200c . by contrast , the overexpression of signal transducer and activator of transcription 3 ( stat3 ) , platelet - derived growth factor d ( pdgf - d ) , notch1 , and doublecortin - like kinase 1 ( dclk1 ) in cancer cells led to a significant down - regulation of mir-200 family members , resulting in the up - regulation of zeb1 , zeb2 , and snai2 expression and acquisition of the emt phenotype . \n several mirnas , such as mir-103 and mir-107 , can induce emt by down - regulating mir-200 via dicer . \n moreover , mir-130b silencing can restore dicer 1 to a threshold level that allows mir-200 family members to repress emt in endometrial cancer . \n together , these findings suggest that targeting these molecules may suppress emt by increasing expression of the mir-200 family . \n mir-101 down - regulates zeb1/zeb2 and ezh2 , which increases e - cadherin expression and subsequently promotes emt . \n emt , epithelial - to - mesenchymal transition ; zeb1 , zinc finger e - box binding homeobox 1 ; zeb2 , zinc finger e - box binding homeobox 2 ; ezh2 , enhancer of zeste homolog 2 . \n mir-25 is a member of the mir-106b-25 cluster , which is a part of the mir-92a family . \n recent studies found that mir-25 is located on the 13th intron of the minichromosome maintenance protein 7 ( mcm7 ) gene of human chromosome 7q22.1 . \n liu et al . reported that a single nucleotide polymorphism ( snp ) , rs999885 , in the promoter region of the mir-106b-25 cluster influences the expression of mir-25 . \n showed that the expression of mir-25 was regulated epigenetically in gastric cancer . up - regulation of c - myc induced the expression of a variety of mirnas , including the mir-17 - 92 cluster , mir-106a-363 cluster , and mir-106b-25 cluster. the transcription factor homeoprotein sine oculis homeobox homolog 1 ( six1 ) , a regulator of emt , was shown to up - regulate the expression of the mir-106b-25 cluster . \n it is known that tgf- has suppressive effects on normal epithelial cells and during the early stages of carcinogenesis . as cancer progresses \n , tumor cells become resistant to tgf-mediated growth inhibition , and tgf- promotes tumor invasion and metastasis , partly via its promotion of emt . \n it was reported that mir-25 targets the cell cycle inhibitor p21 and the pro - apoptotic factor bim ( also known as bcl2-like 11 ) in the tgf- signaling pathway , thus inhibiting the tgf-mediated growth suppression of tumor cells , . \n furthermore , it was shown that the mir-106b-25 cluster could also target the inhibitory smad7 directly , resulting in increased levels of the tgf- type i receptor and downstream activation of tgf- signaling , . \n mir-25 was also reported to directly target the cdh1 gene , which is closely associated with the lymphatic metastasis and invasion of esophageal squamous cell carcinoma ( escc ) , . \n fang et al . demonstrated that mir-25 could target desmocollin 2 ( dsc2 ) , a member of the desmocollin subfamily of the cadherin superfamily , which is involved in cell - cell adhesion and plays a critical role in maintaining normal tissue architecture in the epithelium . \n down - regulated dsc2 promoted the aggressiveness of escc cells by redistributing the adherens junctions and inducing the transposition of -catenin from the cytoplasm to the nucleus , thus further activating the -catenin / t - cell factor ( tcf ) transactivation axis . in our network analysis of integrated mesenchymal serous ovarian cancer , \n however , the current data on whether mir-25 acts as an oncogene or a tumor suppressor gene are inconsistent . \n mir-25 is more highly expressed in a variety of tumor tissues , including gastric cancer , prostate cancer , esophageal cancer , and colorectal cancer ( crc ) tissues , than in normal tissue controls,. however , li et al . \n reported that mir-25 functions as a potential tumor suppressor by targeting smad family member 7 ( smad7 ) in colon cancer . \n they showed that the introduction of mir-25 inhibited the proliferation and migration of colon cancer cells . \n mir-25 was also suggested to act as a tumor suppressor in anaplastic thyroid carcinoma by targeting the polycomb protein ezh2 . using an integrated analysis of tcga cases \n , we found that mir-25 expression was decreased in our integrated mesenchymal subtype of high - grade serous ovarian cancer , suggesting that mir-25 is inversely associated with emt . \n mir-25 was highly expressed in both clinical ovarian cancer samples and cell lines , , and the mir-25 expression level was significantly positively associated with tumor stage , regional lymph node status , and poor survival in epithelial ovarian cancer . \n zhang et al . demonstrated that mir-25 directly regulated apoptosis by targeting bim in ovarian cancer . in ovarian cancer cells , the down - regulation of \n however , the above results were from a single bioinformatics analysis , in vitro studies without in vivo validation , , or a small - scale clinical analysis ( 86 cases ) . therefore , further studies should be performed , such as measuring the expression of mir-25 in serous and other subtypes of ovarian cancer cases in a large - scale , multiple - center study and demonstrating the function of mir-25 in emt , met , and metastasis both in vitro and in vivo . \n the mir-29 family consists of mir-29a , mir-29b , and mir-29c ; mir-29b includes 2 members , mir-29b-1 and mir-29b-2 . \n dysregulation of the mir-29 family is reported in many aspects of tumorigenesis and cancer progression , including cell proliferation , cell cycle , cell differentiation , apoptosis , and metastasis . \n however , the mechanism responsible for the deregulation of mir-29 family members in tumors remains unclear . \n zhang et al . reported that mir-29 members were suppressed by c - myc in b - cell lymphoma . \n although not explicitly stated , the mir-29 family is involved in the regulation of emt . \n mir-29 expression is induced by the tgf-smad signaling pathway , , which is a key signaling pathway for emt . \n furthermore , tp53-induced mir-200 expression provides critical evidence for the role of tp53 in emt regulation . \n the reported functions of mir-29 family members consistently support their roles as tumor suppressing mirnas in many systems , including melanoma , peripheral nerve sheath tumors , glioma , and nasopharyngeal , colorectal , gastric , hepatocellular , breast and lung cancers . \n zhang et al . reported that mir-29c dramatically suppressed crc cell migration , invasion , and metastasis in vivo . \n these authors further demonstrated that mir-29c mediates emt in crc by directly targeting guanine nucleotide - binding protein alpha 13 ( gna13 ) and protein tyrosine phosphatase type iv a ( ptp4a ) . \n these 2 proteins are known to be involved in the erk / gsk3/-catenin and akt / gsk3/-catenin signaling pathways , respectively . \n showed that ectopic treatment with mir-29c mimics in gastric cancer cell lines resulted in reduced proliferation , adhesion , invasion , and migration and that high mir-29c expression suppressed xenograft tumor growth in nude mice by directly targeting integrin beta 1 ( itgb1 ) . in hepatocellular carcinoma \n ( hcc ) , mir-29c directly targeted and suppressed sirtuin 1(sirt1 ) expression and blocked hcc cell growth and proliferation , thus suggesting a tumor suppressive role . \n in addition , mir-29c expression was down - regulated in a large cohort of hcc patients , and low expression of mir-29c was significantly associated with poor prognosis of hcc . \n currently , besides our report of the association between decreased mir-29c expression and the mesenchymal subtype of high - grade serous ovarian cancer , there are no other reports on mir-29c dysregulation in ovarian cancer . \n further studies are needed to determine whether mir-29c is a strong tumor suppressor in ovarian cancer and the cause of its dysregulation . \n the mir-183 family is highly conserved and consists of mir-96 , mir-182 , and mir-183 . \n several studies have demonstrated that the mir-183 family is abnormally expressed in various tumors and is directly involved in human cancer processes , such as cellular differentiation , proliferation , apoptosis , and metabolism. zhang et al . performed a meta - analysis of the expression of the mir-183 family in human cancers and found that mir-182 expression was consistently up - regulated in 15 cancer types , including ovarian cancer , but inconsistently expressed in gastric cancer tissues and adjacent noncancerous tissues . \n however , li et al . observed that mir-182 was down - regulated in gastric adenocarcinoma tissues and may function as a tumor suppressor via down - regulation of camp responsive element - binding protein 1 ( creb1 ) . \n mir-182 has been consistently reported to be significantly up - regulated in ovarian cancer tissue. liu et al . \n reported that mir-182 expression was significantly higher in serous tubal intraepithelial carcinoma , which is recognized as a precursor lesion of high - grade serous ovarian cancer , than in matched normal fallopian tube . \n furthermore , mir-182 was significantly overexpressed in most high - grade serous ovarian cancer cases . \n overexpressing mir-182 in immortalized ovarian surface cells , fallopian tube secretory cells and malignant ovarian cell lines resulted in increased tumor transformation in vitro , enhanced tumor invasiveness in vitro , and metastasis in vivo . \n mir-182 plays an ontogenic role in ovarian cancer partly via its effects on repairing dna double - strand breaks , its negative regulation of breast cancer 1 ( brca1 ) and metastasis suppressor 1 ( mtss1 ) , and its positive regulation of the oncogene high - mobility group at - hook 2 ( hmga2 ) . \n wang et al . measured 1,722 mirnas from 15 normal ovarian tissue samples and 48 ovarian cancer samples using a quantificational real - time polymerase chain reaction ( qrt - pcr ) assay and identified a 10-mirna signature that distinguished ovarian cancer tissues from normal tissues . \n wang et al . demonstrated that mir-182 promotes cell growth , invasion , and chemoresistance by targeting programmed cell death 4 ( pdcd4 ) in human ovarian cancer . \n interestingly , inactivation of brca1 , although less potent than that of brca2 , has been shown to confer beneficial effects on ovarian cancer survival . among the 8 mirnas in our network , \n the expression of mir-506 and mir-182 is associated with increased survival in the tcga cohort . in prostate cancer , mir-182 was reported to suppress emt via its repression of snai2 . \n however , mir-182 was shown to increase the invasiveness of breast cancer by targeting reversion - inducing - cysteine - rich protein with kazal motifs ( reck ) , a matrix metalloproteinase inhibitor . \n mir-182 also promoted gallbladder cancer metastasis partly by targeting cell adhesion molecule 1 ( cadm1 ) . \n furthermore , mir-182 was shown to stimulate angiogenesis and promote non small cell lung cancer ( nsclc ) progression partly by directly targeting fibroblast growth factor receptor substrate 2 ( frs2 ) . \n in addition , mir-182 drove metastasis of primary sarcomas by targeting mtss1 and ras suppressor protein-1 ( rsu1 ) . \n therefore , mir-182 may play different roles in the development and progression of various cancers depending on their target downstream genes . \n it is mainly expressed in neurons rather than astrocytes , and it is abundantly represented in the hippocampal region of brains of fetus , adults , and the patients with alzheimer 's disease . mir-128 consists of 2 distinct genes , mir-128 - 1 and mir-128 - 2 , which are embedded in the introns of the r3h domain containing 1 ( r3hdm1 ) that is located on human chromosome 2q21.3 and in the introns of the cyclic amp - regulated phosphoprotein , 21 kda ( arpp21 ) that is located on 3p22.3 , respectively . \n mir-128 - 1 and mir-128 - 2 are processed to generate the same mature mirna with an identical sequence , mir-128 . \n it is also known that the majority of intronic mirnas transcriptionally depend on the expression of their host gene . \n however , researchers have found that approximately 26% of the mammalian intronic mirnas may be transcribed using their own promoters . \n monteys et al . demonstrated that mir-128 - 2 has a pol iii promoter in its 5-flanking region , which may permit an independent expression from its host gene , arpp21 . \n also found that there were 3 snps located in the genomic region that corresponds to hsa - mir-128 - 1-r3hdm1 and that there was a strong geographical genetic variation among different populations from hapmap . \n examined the dna methylation status of cpg islands located in the mir-128b promoters of 10 acute lymphoblastic leukemia ( all ) , 14 acute myeloid leukemia ( aml ) , and 3 normal samples , and they found that the average methylation rate of the all group was 2.7% , lower than that of the aml group ( 17.1% ) . \n their results suggested that the up - regulation of mir-128b in all patients may be due to a lower degree of cpg island methylation in its promoter regions . \n snail can down - regulate the expression of mir-128 by directly binding to its promoter regions of both e - box 1 and 2 . \n the mutant tp53 can bind to the putative promoter of the mir128 - 2 host gene arpp21 and increase the expression of both mir-128 and arpp21 mrna , . \n aberrant expression of mir-128 has been observed in many malignant tumors . under - expression of mir-128 \n was observed in glioma compared with tumor - adjacent brain tissue , particularly in the more aggressive subtypes , glioblastoma multiforme ( gbm ) and medulloblastoma , based on mirna array , northern blot , and qrt - pcr analyses , , . \n however , the levels of mir-128 expression in other solid tumor tissues were highly variable . using a large - scale mirnome analysis , volinia et al \n . measured 540 different malignant tumor samples and found that the expression of mir-128b was significantly up - regulated in tumor tissues of the colon , lung , and pancreas . by contrast , katada et al . \n measured the expression levels of mir-128 in 42 undifferentiated gastric cancer tissues and paired controls . \n their findings showed that mir-128a was up - regulated , whereas mir-128b was down - regulated , in undifferentiated gastric cancer tissues . \n khan et al . measured 21 independent prostate specimens and found a significant reduction in the levels of mir-128 in a progressive fashion from benign prostatic hyperplasia to prostate cancer and then to metastatic prostate cancer . \n the level of mir-128 was also lower in more invasive ovarian cancer cells than in less invasive cancer cells . \n examining the role of mir-128 in emt and tumor cell invasion and motility , qian et al . demonstrated that overexpression of mir-128 suppressed the morphologic transformation associated with emt , retarded wound closing , and reduced cell migration and invasion in mda - mb-231 cells . \n found that ectopic overexpression of mir-128 down - regulated glioblastoma cell invasion by directly targeting reelin and doublecortin ( dcx ) . \n woo et al . reported that overexpression of mir-128 in ovarian cancer cells resulted in reduced cell motility and adhesion by directly targeting colony - stimulating factor-1 ( csf-1 ) . because reducing cell motility and adhesion adversely affects cell migration , the function of mir-128 in ovarian cancer metastasis via its effects on csf-1 needs to be studied in vivo . \n in addition , the regulation of mir-128 on multiple targets related to emt should be further studied . \n most studies have shown that as post - transcriptional regulators , mirnas play important roles in emt and are important markers and tools in cancer diagnosis , prognosis , and therapeutics . using an integrated analysis , we identified a core regulatory network , including 8 key node mirnas and 214 protein - coding genes , related to an integrated mesenchymal subtype of serous ovarian cancer , suggesting that these 8 mirnas can regulate emt and met in ovarian cancer . however , in various tumors , including ovarian cancer , the functions of some of the 8 mirnas in emt and met are contradictory , possibly because mirnas play different roles by targeting different targets in specific conditions . \n in addition , the function of a single mirna in emt and met may be limited , thus the combination of several mirnas may generate an entirely different cellular phenotype and therapeutic outcome . \n monitored the consequent changes in the global patterns of gene expression using microarray and qrt - pcr after transfecting 2 mirnas , mir-7 and mir-128 , and found that the changes in gene expression induced by the individual mirnas was functionally coordinated but distinct . \n mir-7 transfection into ovarian cancer cells induces changes in cell adhesion and other developmental networks previously associated with emt and other processes linked with metastasis . by contrast , mir-128 transfection induces changes in cell cycle control and other processes commonly linked with cellular replication . \n therefore , the function of an individual mirna in emt and met may be influenced by other mirnas . \n preclinical mouse model studies have already provided evidence that mirnas , such as mir-506 , can exhibit strong tumor suppressive effects , . with the development and perfection of mirna delivery techniques such as nanoparticles and mesenchymal stem cells", "role": "user" }, { "content": "metastasis is the main cause of cancer mortality . \n one of the initiating events of cancer metastasis of epithelial tumors is epithelial - to - mesenchymal transition ( emt ) , during which cells dedifferentiate from a relatively rigid cell structure / morphology to a flexible and changeable structure / morphology often associated with mesenchymal cells . \n the presence of emt in human epithelial tumors is reflected by the increased expression of genes and levels of proteins that are preferentially present in mesenchymal cells . \n the combined presence of these genes forms the basis of mesenchymal gene signatures , which are the foundation for classifying a mesenchymal subtype of tumors . \n indeed , tumor classification schemes that use clustering analysis of large genomic characterizations , like the cancer genome atlas ( tcga ) , have defined mesenchymal subtype in a number of cancer types , such as high - grade serous ovarian cancer and glioblastoma . \n however , recent analyses have shown that gene expression - based classifications of mesenchymal subtypes often do not associate with poor survival . \n this paradox can be ameliorated using integrated analysis that combines multiple data types . \n we recently found that integrating mrna and microrna ( mirna ) data revealed an integrated mesenchymal subtype that is consistently associated with poor survival in multiple cohorts of patients with serous ovarian cancer . \n this network consists of 8 major mirnas and 214 mrnas . among the 8 mirnas , \n 4 are known to be regulators of emt . \n this review provides a summary of these 8 mirnas , which were associated with the integrated mesenchymal subtype of serous ovarian cancer .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: gestational diabetes mellitus ( gdm ) is defined as any stage of hyperglycemia which is first expressed or diagnosed during pregnancy . \n gdm is the most prevalent disorder during pregnancy , resulting in disability and perinatal complications as well as neonatal problems ( 1 - 3 ) . \n the occurrence of gdm is also expected to increase in upcoming years ; its prevalence in the usa and turkey is calculated to be 7% and 4.48% , respectively ( 5 - 7 ) . in iran \n , the numbers vary between provinces from 1.3% to 8.9% ( 8) . in 2011 , mexico reported the prevalence of gdm to be 10.3% according to the ada index ( 30.1% using the iadpsg criteria ) ( 9 ) . \n as well as being highly prevalent , gdm can be considered a predisposing factor for type 2 diabetes . \n thus , any attempt to diagnose gdm earlier seems critical ( 10,11 ) . \n \n in 1997 , the american diabetes association ( ada ) proposed indexes for the diagnosis of gdm in the 24 week of pregnancy ( 1 ) . \n the comprehensive research known as hapo ( hyperglycemia and adverse pregnancy outcome ) conducted in 2008 in 9 countries showed that even in mothers with normal plasma glucose values ( according to the ada index ) , there is still a strong correlation between diabetes complications and plasma glucose levels . \n the findings of this research were interpreted , and in 2011 the international association of diabetes and pregnancy study groups ( iadpsg ) introduced new criteria for the diagnosis of gdm which seem to be more sensitive ( 12 ) . although the ada supports and recommends its use , the new criteria are not yet widely used by doctors ( 13 ) . \n the hapo project results showed that for every 6.9 mg / dl increase in the blood glucose , the chance of complications from gdm , such as macrosomia , cord - blood serum c - peptide levels and primary cesarean delivery , multiplies by 1.38 , 1.55 , and 1.1 times , respectively . \n this research also concluded that the existing criteria do not predict the complications of diabetes sufficiently ( 7,12 ) . \n taking into the account the high prevalence of gdm in iran , this survey was designed to calculate the frequency of this disease among urban populations according to the ada and iadpsg criteria . \n we included all pregnant women who were admitted to the gynecology wards of rafsanjan hospitals from september 2012 until march 2013 . \n after their first gynecological examination , the participants signed written informed consent forms for participation in the study . \n this study was approved by the ethics committee of tehran university of medical sciences . \n those having fbs 126 mg / dl were assumed to have apparent diabetes mellitus and were excluded from the study . \n other exclusion criteria were a history of gestational diabetes , thyroid , liver , heart or renal dysfunction and a history of consuming any kind of corticosteroids . \n standard oral glucose tolerance test ( ogtt ) was done by ingesting 75 g of glucose in the 24 to 32 week of pregnancy . if the patient was admitted to the ward after her 24 week of pregnancy , her fbs level was read from her hospital document and then ogtt was performed . \n data were analyzed using spss 20 and were reported as average , standard deviation and percentages . \n logistic regression tests were done to evaluate the correlation between different variables with the diagnosis of gdm . \n two hundred ninety pregnant women with the average age of 27.725.091 years in age 1.911.02 gravidity ( from 1 to 6 , with a median of 2 ) , and 0.730.84 parity ( from 0 to 4 with a median of 1 ) were included in the study . \n the meansd of bmi at the time of enrolment was 27.624.58 and the meansd of systolic and diastolic pressures were 109.1112.27 and 63.656.57 mmhg , respectively . \n family history of diabetes type2 was present in 31% of the participants ( n= 90 ) . from the patients with at least one delivery ( n= 155 ) , 1.9% and 2.5% had a history of gdm and delivery of macrosomic infant respectively . \n the meansd fbs , blood glucose one hour , and two hours after ingesting 75 g of glucose were 82.489.41 , 146.8634.22 , and 114.2127.79mg / dl , respectively . \n based on the criteria of the ada , 9.3% ( n = 27 ) of the admitted patients suffered from gdm . for the iadpsg and the who , those numbers were 31% ( n= 90 ) and 15.2% ( n= 44 ) , respectively . \n tables 1 and 2 demonstrate the correlation between gdm and known pregnancy risk factors . \n \n in the regression analysis , according to the new criteria , blood sugar did not regress with either gravidity ( p= 0.99 ) , parity ( p= 0.27 ) , or age of pregnancy ( p= 0.87 ) . \n however , in the logistic regression , the only significant variable was the patient s history of type 2 diabetes ( p= 0.009 , or= 2.02 ( 95% ci : 1.19 - 3.44 ) ) . \n this study compared ada and iadpsg criterion in a sample of pregnant women from rafsanjan in 2012 and 2013 . \n we calculated the prevalence of gdm to be 9.3% , 15.2% , and 31% , respectively based on the ada , iadpsg and who criteria . as reported in other studies , lowering gdm s diagnosis cut - off resulted in a higher prevalence ( the ada had the highest cut - off and thus the least prevalence ) . \n the prevalence of gdm was 1.5 times and 3 times higher based on the iadpsg criteria than based on the who and ada criterion . \n it is quite obvious that having a less expensive and more sensitive screening test would produce the best desired result . as in iadpsg and ada , 3 and 4 blood sugar assessments \n although their diagnostic cut - offs are different , all patients reported to have gdm by iadpsg criteria had the same results as ada ; therefore , it seems that using iadpsg is more reasonable . whether this triple increase in gdm prevalence is in line with any change in mother and neonatal complications after pregnancy , needs to be determined in future studies . \n for example , in japan , the prevalence of gdm was reported to be 2.4% and 6.6% , using previous and new criteria , respectively . \n the prevalence of macrosomia was found to be significantly different in normal patients based on the ada criteria compared to a similar group using iadpsg indexes . \n the researchers concluded that using the new method would increase the cases of gdm at least 2.7 times ( 14 ) . \n \n in another study done in ireland , \n the prevalence of gdm changed from 9.4% to 12.4% using the iadpsg instead of the who criteria ( 15 ) . in a similar study conducted in the uae , \n the prevalence of gdm was reported to be 12.9% according to the ada and 37.7% according to the iadpsg . \n it was concluded that lowering the cut - off of two - hour glucose blood according to the iadpsg was the reason for the increase in gdm prevalence , making it the most important index ( 16).in contrast with the results of previous studies , our work showed that the number of positive cases of the fbs test , 1h ogtt , and 2h ogtt were 52 , 48 , and 24 , respectively . \n moreover , 43 patients had an fbs value of more than 92 mg / dl prior to ogtt , which is half the number of gdm cases . \n these findings show that the sensitivity of the fbs test seems to be high . on the other hand , in our study , the correlation between diabetes and a woman s bmi , a history of diabetes in the family and age were significant . based on these findings and the fact that the treatment of choice for gdm is a modified diet , the cost effectiveness of gdm screening is more reasonable . \n one of our limitations in this study was the absence of bmi score documentation before pregnancy . \n we considered the bmi of the patients during pregnancy anindependent variable ; thus , our interpretations could be false . \n this study was designed to compare the prevalence of gdm with respect to different criteria . according to the ada , the who , and the iadpsg , the prevalence of gdm was calculated to be 8% , 15.1% and 21% , respectively . \n the prevalence of gdm was 1.5-times and 3 times higher when the iadpsg based data was compared with those of the who or the ada . \n as a final point , we suggest that gdm screening be done using iadpsg criteria .", "role": "user" }, { "content": "background : gestational diabetes mellitus ( gdm ) is common during pregnancy . \n this survey was \n designed based on the frequency of gdm among an urban population according to the american \n diabetes association ( ada ) and the international association of diabetes and pregnancy study \n groups ( iadpsg ) criteria . \n methods : we included all pregnant women who were admitted to a gynecology clinic from september \n 2012 until may 2013 . the fasting blood sugar ( fbs ) was measured . \n those having fbs 126 \n mg / dl were excluded from the study . \n all women underwent a standard ogtt ( oral glucose tolerance \n test ) by ingesting 75 g of glucose in the 24th to 32nd week of their pregnancy . \n results : two hundred ninety pregnant women with a meansd age of 27.725.091 years were \n included in the study . \n the meansd fbs , blood glucose one hour and two hours after ingesting 75 g \n of glucose were 82.489.41 , 146.8634.22 and 114.2127.79 mg/ dl , respectively . based on the criteria \n of the ada , 9.3% ( n= 27 ) of the admitted patients suffered from gdm . for the iadpsg and \n the who , those numbers were 31% ( n= 90 ) and 15.2% ( n= 44 ) , respectively . \n conclusion : the prevalence of gdm was 1.5-times and 3 times higher when the iadpsg based \n data were compared to those of the who or the ada .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a prerecorded message instructed callers to contact their state or local health department if they had not done so . \n calls that could be answered with frequently asked questions documents or guidelines published in the morbidity and mortality weekly report ( mmwr ) were handled directly by public health advisors , epidemiologists , and junior staff ( 58 ) . \n callers were referred to the slt for follow - up if they reported symptoms consistent with anthrax or other bioterrorism agents , noted exposure to a suspicious package or substance , or required detailed medical expertise . \n slt staff included a team of public health advisors to obtain initial case information , and at least two physicians , epidemiologists , or veterinarians . \n the slt had an average of nine staff members ( range 215 ) that was reduced in evenings and on weekends depending on the volume of calls being received . \n whenever appropriate , calls were also referred from the slt to state epidemiologists for more detailed follow - up . \n two access databases ( microsoft corp . , redmond , wa ) were created to assist in documenting and tracking all incoming calls . \n a general database was intended to document every incoming call to the eoc telephone bank . for all incoming calls call volume permitting central telephone bank staff were instructed to record information on the date , topic , and type of caller on call response forms . \n reports of call volume , call type , and call topic by day were then shared with eoc management and communications personnel to assist them with staffing decisions , publication of mmwr reports , and determination of educational needs . \n calls referred from the central telephone bank to the slt were manually entered into a second , more detailed slt tracking database . \n information collected in this tracking database included demographic background of the patient , reporter information , and any reported symptoms or exposures . \n slt staff were also asked to assign each referred call to a risk category to prioritize follow - up within the large volume of calls . \n telephone call data were exported from access databases into statistical analysis software ( sas institute , inc . , cary , nc ) . \n distributions of call volume by date of call , type of caller , and topic of call were produced from the central eoc telephone bank data . \n descriptive analyses of slt tracking data were undertaken by type of caller , state of reported occurrence , triage classification ( level of urgency ) , reported signs and symptoms , and nature of reported exposure . \n data were analyzed during the peak period of call volume during the anthrax investigations ( october 8 to november 11 , 2001 ) . \n from october 8 to november 11 , 2001 , a total of 11,063 telephone calls were documented and responded to by eoc telephone bank staff . a topic of call \n the most frequently mentioned topic was questions about the availability of an anthrax vaccine \n ( 2,438 [ 58.4% ] of 4,178 calls ) , followed by request for general bioterrorism information \n ( 617 calls [ 14.8% ] ) , request for information about personal protective equipment ( 501 calls [ 12.0% ] ) , general concerns about bioterrorism ( 491 calls [ 11.8% ] ) , and request for information about smallpox ( 400 calls [ 9.6%]).1 the type of caller was indicated on 6,845 ( 61.9% ) of the 11,063 call forms . \n the most frequent types of callers included private citizens ( 3,712 [ 54.2% ] of 6,845 calls ) , followed by physicians ( 1,846 calls [ 27.0% ] ) , other federal or state employees ( 714 calls [ 10.4% ] ) , and nonphysician health - care professionals ( 672 calls [ 9.8% ] ) . \n a greater percentage of calls from private citizens ( 42.5% ) than from health professionals ( 32.1% ) mentioned concerns about smallpox , bioterrorism , or requests for bioterrorism information . \n health professionals ( 2.7% ) were more likely than private citizens ( 0.7% ) to ask questions about sample handling and processing . \n call volume increased to a peak of 858 calls received on october 16 , 2001 , shortly after the public announcement that a letter containing anthrax had been opened in senator tom daschle s office ( figure 2 ) . \n while the highly publicized nature of the bioterrorism - related events contributed to the large number of calls received by the eoc , day of the week was also an important determinant of call volume . \n fewer calls were received on the weekends of october 1314 , 2021 , and 2728 and november 34 and 1011 . during the period of data collection , \n the mean call volume to the eoc was 80 incoming calls per day on weekends and 411 incoming calls per day on weekdays . during weekdays , a lower call volume was also consistently observed on mondays and fridays . \n an average of 350 incoming calls per day were received on mondays and fridays and 450 incoming calls per day during tuesday through thursday . the proportion of calls received by topic of call and type of caller did not change in any meaningful way during this time ( data not shown ) . \n telephone calls documented by staff of the emergency operations center telephone bank , october 8 to november 11 , 2001 ( n = 11,063 call forms ) of the 11,063 calls received by the eoc telephone bank , 882 ( 8.0% ) were referred to the slt for follow - up . \n calls referred to the slt came most commonly from physicians ( 256 calls [ 29.0% ] ) , followed by private citizens ( 178 calls [ 20.1% ] ) ; state health department employees ( 99 calls [ 11.2% ] ) ; local government , law enforcement , or emergency personnel ( 99 calls [ 11.2% ] ) ; and nonphysician health - care workers ( 82 calls [ 9.3% ] ) . \n the type of caller was not documented for 168 ( 19.0% ) of the calls referred to the slt . \n the slt staff provided follow - up on calls from 48 states , the district of columbia , puerto rico , and guam . \n while the distribution of calls by state was generally population based , a larger proportion of calls were received from states with increased press coverage of confirmed cases of anthrax and from georgia , where cdc headquarters is located . \n forty - six percent of slt follow - up activities pertained to reported occurrences in washington , d.c . , \n georgia , new york , california , maryland , and pennsylvania ( figure 3 ) . \n the proportion of calls received from private citizens or physicians did not vary by region of the country ( data not shown ) . \n distribution of telephone calls referred to the state liaison team , by state of occurrence , october 8 to november 11 , 2001 ( n = 882 calls ) because slt staff was limited to an average of nine members , a triage protocol to classify calls referred to the slt by level of urgency was developed ( table 1 ) . in 10.4% of the calls referred to the slt for follow - up , a physician or health - care professional reported symptoms clinically compatible with anthrax in a person from a known high - risk group ( postal workers , u.s . \n government officials , national press from contaminated facilities , or person with known contact with a contaminated facility ) or in a person who reported exposure to a suspicious substance . \n an additional 15.2% of calls referred to the slt included a report by a health - care professional of a person with clinically compatible symptoms but no reported high - risk status or possible source of exposure . \n forty - four percent of all calls referred to the slt mentioned exposure to a suspicious package or substance but did not include any report of clinically confirmed signs or symptoms . an additional 30.4% of the calls referred to the slt included no mention of any reported exposures , signs , or symptoms ( table 1 ) . \n clinically compatible refers to physician or health professional report of any symptom thought to be related to inhalational , cutaneous , or gastrointestinal anthrax . \n cases of anthrax confirmed during this time period were identified through active surveillance by cdc field epidemiology teams and not the emergency operations center telephone bank . \n of the 181 calls referred to slt that mentioned signs or symptoms clinically compatible with anthrax ( classified as level a , b , c , or e in table 1 ) , fever or influenzalike symptoms were most commonly reported ( 57 calls [ 31% ] ) . \n other commonly reported signs and symptoms included skin lesions or eschars ( 48 calls [ 26.5% ] ) , upper respiratory symptoms ( 47 calls [ 26.0% ] ) , and skin rashes ( 19 calls [ 10.5% ] ) . \n fewer calls included mention of sore throats ( 15 calls [ 8.3% ] ) , myalgia ( 15 calls [ 8.3% ] ) , gastrointestinal problems ( 8 calls [ 4.4% ] ) , lymphadenopathy ( 6 calls [ 3.3% ] ) , chest pain ( 6 calls [ 3.3% ] ) , and shortness of breath ( 4 calls [ 2.2% ] ) . \n four hundred eighty calls ( 54.4% ) referred to the slt included mention of exposure to a suspicious substance or package or direct contact with an environment known to be contaminated with b. anthracis ( classified as level b , c , d , or f in table 1 ) . \n over half of reported exposures included mention of contact with a suspicious powder or package ( table 2 ) . \n however , < 10% of reported exposures ( 47/480 ) included mention of any clinically confirmed signs or symptoms compatible with anthrax . \n as a result , standardized response protocols to address the handling of suspicious packages and powders and the receipt of mail through contaminated facilities were developed ( 5,7 ) . \n this measure allowed second - tier triage staff to devote more time to calls involving clinically compatible cases from high - risk groups and slt medical staff to remain on - call at off - site locations during evenings and weekends . \n none of the calls referred to the slt were confirmed to be reports of cases of anthrax . \n the confirmed cases of anthrax were identified by the cdc field specialty teams or through calls made to the cdc director . \n from october 8 to november 11 , 2001 , a total of 11,063 telephone calls were documented and responded to by eoc telephone bank staff . a topic of call \n the most frequently mentioned topic was questions about the availability of an anthrax vaccine \n ( 2,438 [ 58.4% ] of 4,178 calls ) , followed by request for general bioterrorism information \n ( 617 calls [ 14.8% ] ) , request for information about personal protective equipment ( 501 calls [ 12.0% ] ) , general concerns about bioterrorism ( 491 calls [ 11.8% ] ) , and request for information about smallpox ( 400 calls [ 9.6%]).1 the type of caller was indicated on 6,845 ( 61.9% ) of the 11,063 call forms . \n the most frequent types of callers included private citizens ( 3,712 [ 54.2% ] of 6,845 calls ) , followed by physicians ( 1,846 calls [ 27.0% ] ) , other federal or state employees ( 714 calls [ 10.4% ] ) , and nonphysician health - care professionals ( 672 calls [ 9.8% ] ) . \n a greater percentage of calls from private citizens ( 42.5% ) than from health professionals ( 32.1% ) mentioned concerns about smallpox , bioterrorism , or requests for bioterrorism information . \n health professionals ( 2.7% ) were more likely than private citizens ( 0.7% ) to ask questions about sample handling and processing . \n call volume increased to a peak of 858 calls received on october 16 , 2001 , shortly after the public announcement that a letter containing anthrax had been opened in senator tom daschle s office ( figure 2 ) . \n while the highly publicized nature of the bioterrorism - related events contributed to the large number of calls received by the eoc , day of the week was also an important determinant of call volume . \n fewer calls were received on the weekends of october 1314 , 2021 , and 2728 and november 34 and 1011 . during the period of data collection , \n the mean call volume to the eoc was 80 incoming calls per day on weekends and 411 incoming calls per day on weekdays . during weekdays , a lower call volume was also consistently observed on mondays and fridays . \n an average of 350 incoming calls per day were received on mondays and fridays and 450 incoming calls per day during tuesday through thursday . the proportion of calls received by topic of call and type of caller did not change in any meaningful way during this time ( data not shown ) . \n telephone calls documented by staff of the emergency operations center telephone bank , october 8 to november 11 , 2001 ( n = 11,063 call forms ) \n of the 11,063 calls received by the eoc telephone bank , 882 ( 8.0% ) were referred to the slt for follow - up . \n calls referred to the slt came most commonly from physicians ( 256 calls [ 29.0% ] ) , followed by private citizens ( 178 calls [ 20.1% ] ) ; state health department employees ( 99 calls [ 11.2% ] ) ; local government , law enforcement , or emergency personnel ( 99 calls [ 11.2% ] ) ; and nonphysician health - care workers ( 82 calls [ 9.3% ] ) . \n the type of caller was not documented for 168 ( 19.0% ) of the calls referred to the slt . \n the slt staff provided follow - up on calls from 48 states , the district of columbia , puerto rico , and guam . \n while the distribution of calls by state was generally population based , a larger proportion of calls were received from states with increased press coverage of confirmed cases of anthrax and from georgia , where cdc headquarters is located . \n forty - six percent of slt follow - up activities pertained to reported occurrences in washington , d.c . , \n georgia , new york , california , maryland , and pennsylvania ( figure 3 ) . \n the proportion of calls received from private citizens or physicians did not vary by region of the country ( data not shown ) . \n distribution of telephone calls referred to the state liaison team , by state of occurrence , october 8 to november 11 , 2001 ( n = 882 calls ) because slt staff was limited to an average of nine members , a triage protocol to classify calls referred to the slt by level of urgency was developed ( table 1 ) . in 10.4% of the calls referred to the slt for follow - up , a physician or health - care professional reported symptoms clinically compatible with anthrax in a person from a known high - risk group ( postal workers , u.s . \n government officials , national press from contaminated facilities , or person with known contact with a contaminated facility ) or in a person who reported exposure to a suspicious substance . \n an additional 15.2% of calls referred to the slt included a report by a health - care professional of a person with clinically compatible symptoms but no reported high - risk status or possible source of exposure . \n forty - four percent of all calls referred to the slt mentioned exposure to a suspicious package or substance but did not include any report of clinically confirmed signs or symptoms . \n an additional 30.4% of the calls referred to the slt included no mention of any reported exposures , signs , or symptoms ( table 1 ) . \n clinically compatible refers to physician or health professional report of any symptom thought to be related to inhalational , cutaneous , or gastrointestinal anthrax . \n cases of anthrax confirmed during this time period were identified through active surveillance by cdc field epidemiology teams and not the emergency operations center telephone bank . \n of the 181 calls referred to slt that mentioned signs or symptoms clinically compatible with anthrax ( classified as level a , b , c , or e in table 1 ) , fever or influenzalike symptoms were most commonly reported ( 57 calls [ 31% ] ) . \n other commonly reported signs and symptoms included skin lesions or eschars ( 48 calls [ 26.5% ] ) , upper respiratory symptoms ( 47 calls [ 26.0% ] ) , and skin rashes ( 19 calls [ 10.5% ] ) . \n fewer calls included mention of sore throats ( 15 calls [ 8.3% ] ) , myalgia ( 15 calls [ 8.3% ] ) , gastrointestinal problems ( 8 calls [ 4.4% ] ) , lymphadenopathy ( 6 calls [ 3.3% ] ) , chest pain ( 6 calls [ 3.3% ] ) , and shortness of breath ( 4 calls [ 2.2% ] ) . \n four hundred eighty calls ( 54.4% ) referred to the slt included mention of exposure to a suspicious substance or package or direct contact with an environment known to be contaminated with b. anthracis ( classified as level b , c , d , or f in table 1 ) . over half of reported exposures included mention of contact with a \n suspicious powder or package ( table 2 ) . however , < 10% of reported exposures ( 47/480 ) included mention of any clinically confirmed signs or symptoms compatible with anthrax . \n as a result , standardized response protocols to address the handling of suspicious packages and powders and the receipt of mail through contaminated facilities were developed ( 5,7 ) . \n this measure allowed second - tier triage staff to devote more time to calls involving clinically compatible cases from high - risk groups and slt medical staff to remain on - call at off - site locations during evenings and weekends . \n none of the calls referred to the slt were confirmed to be reports of cases of anthrax . \n the confirmed cases of anthrax were identified by the cdc field specialty teams or through calls made to the cdc director . \n from october 8 to november 11 , 2001 , the eoc received 11,063 telephone calls pertaining to bioterrorism and referred 882 of these calls to the slt for diagnostic evaluation , consultation , and coordination of follow - up activities . \n the volume of calls received during this time period demonstrated a considerable public need for guidance during this emergency . \n daschle s office were likely catalysts for the observed increases in call volume . however , day - to - day patterns in the call volume to the eoc telephone bank suggest that at predictable times during the week emergency staff resources can be relaxed . during the data collection period , \n the mean call volume to the eoc was 80% lower on weekends than on weekdays . within the working week , mean call volumes were 23% lower on mondays and fridays than during the rest of the work week . \n as many staff worked 1220 hour days during the height of this emergency , allowing staff to remain on - call at off - site locations on days of predictably lower call volume may help maintain staff morale and stamina through long periods of emergency center operations . \n the eoc implemented a tiered telephone call triage system designed to allow highly suspicious cases and exposures to be tracked more closely by field epidemiology and specialty teams ( figure 1 ) . using scripted responses to frequently asked questions , \n this system effectively screened out many calls involving general queries about anthrax vaccines , requests for bioterrorism information , and the use of personal protective equipment . \n this approach allowed the slt at the second tier of the triage system to spend more time interpreting clinically confirmed symptoms and laboratory results , and monitoring possible exposures for further referral to appropriate specialized teams . \n these findings , however , also indicate that many calls received by the slt did not pertain to known high - risk situations . during the data collection period \n , nearly 75% of calls referred to the slt did not include a report of any clinically confirmed signs or symptoms or any direct contact with an environment known to be contaminated with b. anthracis . \n of these calls , nearly 60% mentioned contact with a suspicious powder or package , but included no report of illness . \n as a result , to maintain specificity in tracking high - risk cases , scripted responses were developed to questions regarding 1 ) contact with unknown substances , 2 ) the receipt of mail through a facility that had been contaminated with b. anthracis , and 3 ) the report of clinically unconfirmed signs or symptoms ( 5,7 ) . \n we recommend further refinement of these response protocols for inclusion in the first tier of the triage system , along with additional training of telephone bank staff in the overall objectives and methods of triage during bioterrorism emergencies . \n these measures would substantially reduce the call volume burden on second - tier staff and decrease the chance that a high - risk situation would be overlooked during a similar bioterrorism event . \n state health departments typically expect that cdc will direct local calls back to them unless they have previously been referred to cdc ( 9 ) . as more than half \n the calls to the eoc were from private citizens , a larger number of calls should also have been redirected from the eoc to appropriate contact persons at the state level ( with minimal data entry and analysis by cdc ) . \n such referrals would have allowed the eoc staff more time to respond to questions from physicians or health departments . the extent to which \n state and local health departments were satisfied with the assistance received from the eoc also remains unknown . \n a survey of state and local personnel who contacted the eoc system would assist cdc staff with quality improvement of the triage system and provide additional insight into the state perspective of appropriate respective roles during periods of emergency response . \n an unknown number of calls to the eoc telephone bank were undocumented as first - tier staff were unable to complete all telephone call response forms during peak periods of call intensity . \n these high call volumes periodically resulted in delays in information transfer between tiers of the telephone call triaging system . \n in addition , the manual completion of telephone response forms resulted in a substantial amount of missing data , as first and second - tier eoc staff often overlooked key data elements in their efforts to provide timely responses to public demands . \n for example , we were unable retrospectively to determine the number of law enforcement or emergency medical service personnel who called the central phone bank or whether callers from state health departments were medical or public relations personnel . \n telephone - based hotlines underestimate the true number of cases of a disease and are dependent on media reports and general public interest ( 10 ) . \n however , a telephone bank at cdc during an outbreak of hantavirus pulmonary syndrome identified 38% of confirmed cases ( 10 ) . \n computerization of the eoc triage system , including required fields for date and topic of call and type of caller would allow for timely transfer and analysis of complete and accurate telephone call data and perhaps provide a similar layer of passive surveillance for emerging bioterrorism events . \n however , the maintenance of such a system would require additional technical expertise in database development , management , and analysis ( 11 ) . \n medical expertise in first - tier telephone bank staff will continue to be needed to assure the accurate entry of data into any automated system . \n our findings suggest that available on - site staff resources can be adjusted to predictable daily patterns of call volume to increase long - term effectiveness and stamina during emergency periods . while the first tier of the eoc telephone call triage system effectively addressed a substantial portion of all incoming public inquiries during this emergency , standardized health communication protocols that address contact with suspicious substances , handling of suspicious mail , and the clinical evaluation of suspected cases in the absence and presence of confirmed exposure \n should also be added to first - tier response activities in a computerized triage system . \n this standardization would allow for a more effective triage system for inquiries and more efficient focus for follow - up investigations by specialized epidemiologic teams .", "role": "user" }, { "content": "after public notification of confirmed cases of bioterrorism - related anthrax , the centers for disease control and prevention s emergency operations center responded to 11,063 bioterrorism - related telephone calls from october 8 to november 11 , 2001 . \n most calls were inquiries from the public about anthrax vaccines ( 58.4% ) , requests for general information on bioterrorism prevention ( 14.8% ) , and use of personal protective equipment ( 12.0% ) ; 882 telephone calls ( 8.0% ) were referred to the state liaison team for follow - up investigation . \n of these , 226 ( 25.6% ) included reports of either illness clinically confirmed to be compatible with anthrax or direct exposure to an environment known to be contaminated with bacillus anthracis . \n the remaining 656 ( 74.4% ) included no confirmed illness but reported exposures to suspicious packages or substances or the receipt of mail through a contaminated facility . \n emergency response staff must handle high call volumes following suspected or actual bioterrorist attacks . \n standardized health communication protocols that address contact with unknown substances , handling of suspicious mail , and clinical evaluation of suspected cases would allow more efficient follow - up investigations of clinically compatible cases in high - risk groups .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: adequate clearance of airway secretions is an essential component of the defense mechanism \n of the respiratory tract against infection . \n coughing and huffing are expiratory maneuvers \n that use high expiratory pressure and flow rates to aid secretion clearance . \n physiotherapists encourage patients to cough and huff as part of a strategy to clear these \n secretions in order to minimize complications . forced expiration maneuvers ( huffs ) \n because maximal intrapleural pressures are \n lower during huff than either a voluntary or induced cough2 , the improved effectiveness of forced expiration vs. coughs may be \n due to lesser airway collapse in the former maneuver . increased airway collapse , especially \n in those with obstructive disease , \n may transiently cause complete obstruction of some \n airways , making removal of mucus by cough difficult2 . on the other hand , \n the peak flows of forced expirations tend to be \n less than those of voluntary coughing , presumably because of the lesser airway compression \n and the absence of glottal closure , which are important components for producing \n supramaximal flows . with age , \n physical functions decline , influencing respiratory \n performance3 , and physiotherapists need \n data regarding the expiratory muscles producing the high - force expiratory airflow velocity \n during huffs . \n the abdominal muscles with significant expiratory activity are those in the ventrolateral \n wall of the abdomen . \n these include the rectus abdominis ( ra ) , ventrally , and the external \n oblique ( eo ) , internal oblique ( io ) , and transverse abdominis ( tra ) , laterally . as \n respiratory muscles , they have two principle actions . \n first , as they contract , they pull the \n abdominal wall inward and produce an increase in intra - abdominal pressure ( iap ) . \n because the \n abdominal contents are virtually incompressible , this causes the diaphragm to move cranially \n into the thoracic cavity4 . \n this \n displacement , in turn , results in an increase in pleural pressure and a decrease in lung \n volume4 . \n the \n other function of the abdominal muscles in relation to breathing is to displace the rib \n cage . \n isolated stimulation of the ra produces a caudal displacement of the sternum and a \n decrease in the rib cage anteroposterior diameter8 . \n the eo causes a caudal displacement and a decrease in the rib cage \n transverse diameter8 . as described above \n , \n the abdominals are major muscles of expiration and play important roles in activities such \n as forced expiration . \n however , little is known about the contribution of each abdominal \n muscle to forced expiration . \n though previous studies have shown the activity levels of the \n abdominal muscles normalized to maximal voluntary contraction during forced expiration as \n measured by surface electromyography ( emg)9 , the relative emg values can not be used to determine the \n force - generating level of each individual abdominal muscle . \n it is not possible to make \n direct force measurements to compare the strength of the individual abdominal muscles , but \n size may provide an indirect measurement of force - generating capacity , as has been \n demonstrated for various muscles10,11,12,13,14,15,16,17,18 . \n the abdominal muscles are too large to allow measurement of their cross - sectional area using \n ultrasound imaging , and thus , muscle thickness is measured19 . \n ultrasound imaging measurements correlate well with those made \n using magnetic resonance imaging20 . \n therefore , we used ultrasound muscle - thickness measurements to estimate muscle size . \n the \n diaphragm is the principal muscle of the inspiration , and the descent of the diaphragmatic \n dome during inspiration expands the thoracic cavity . because there is a positive association \n between the strength of inspiratory muscles and diaphragmatic thickness14 , 18 \n , we \n hypothesized that there are associations between huff strength and the thicknesses of the \n abdominal muscles at rest . \n in general , programs of expiration muscle strength training use a \n pressure threshold device and respiratory maneuvers3 , \n 21 . \n if there are different degrees of \n association of individual abdominal muscles with forced expiration , nonrespiratory exercises \n to strengthen the muscle that associates most strongly with forced expiration could be \n selected . \n peak expiratory flow ( pef ) has been used as a measure of huff strength22 . \n this study was conducted using a healthy \n young population to determine whether pef is correlated with abdominal muscle thickness at \n rest before further investigations of elderly subjects . \n twenty - three healthy male volunteers participated in this study . their age , height , and \n weight ( mean sd ) were 21.1 3.0 years , 172.2 7.2 cm , and 65.7 10.9 kg , respectively . \n the protocol for this study was approved by the ethics committee of the kawasaki university \n of medical welfare . \n pef was measured using a peak flow meter ( assess , full range ; philips respironics g.k . \n subjects were allowed to practice until they could perform the \n task consistently , then measurements were taken three times . \n the maximum value of the three \n trials was used in the analysis . a b - mode ultrasound imaging system ( aloka , ssd-3500sx ; \n tokyo , japan ) with a \n 10-mhz transducer was used to perform ultrasound imaging of the thicknesses of ra , eo , io , \n and tra . to perform ultrasound imaging of the abdominal muscles at rest , the subjects were \n positioned in the supine position . \n the ra was measured four centimeters lateral to the \n umbilicus on the right side of the body23 . \n the eo , io , and tra were measured 2.5 cm anterior to the midaxillary \n line and at the midpoint between the inferior rib and iliac crest24 . \n a recent study indicated that inward pressures of the \n transducer during ultrasound imaging resulted in measured vales of thicknesses of the \n abdominal muscles being lower than their actual values25 . \n therefore a large quantity of gel was applied between the \n transducer and the skin , and care was taken to avoid contact between the transducer and skin \n when imaging26 . because the activity of \n abdominal muscles is modulated by ventilation , the thickness of the abdominal muscles \n increases during expiration27 . \n measurement of abdominal muscle thicknesses was performed at the end of a relaxed \n expiration . \n the correlations between pef \n and the abdominal muscle thickness were determined using pearson s correlation coefficient . \n the abdominal muscle thicknesses and their \n correlations with pef are listed in table \n 1table 1.abdominal muscle thicknesses and their correlations with pef valuesmusclesmuscle thickness ( mm)correlation coefficientrectus abdominis13.1 \n 2.60.348external oblique10.8 1.90.530 * * internal oblique9.0 2.20.362transverse abdominis3.3 0.80.278values are expressed as mean sd . * * p < 0.01 . \n there was a significant positive correlation between pef and the thickness of \n the eo muscle . \n we investigated the relationships between pef and the thicknesses of the abdominal muscles . \n among the abdominal muscles , only the eo muscle displayed a significant correlation with \n pef . \n this result might indicate that , among the abdominal muscles , the thickness of the eo \n at the end of relaxed expiration most strongly associates with pef during forced expiration . \n previous studies have indicated that the activity of the eo mildly exhibited some correlates \n with iap , albeit not as much as tra7 , and \n eo acts to contract the rib cage along its transverse dimension8 . \n the action of the eo on the rib cage might have a greater \n association with forced expiration than with the increase in iap . \n the action of the ra \n produces a decrease in the anteroposterior diameter of the rib cage , and the action of the \n eo causes a decrease in the transverse diameter of the rib cage8 . \n mccool et al.28 reported that during forced expiration , rib - cage deformation \n consisted of a rounding of the lower rib cage with the transverse dimension decreasing more \n rapidly than the lower anteroposterior dimension . \n the results of this study , the action of \n the eo on the rib cage is associated with pef . \n previous research demonstrated that sit - ups \n can strengthen the expiratory muscles in healthy individuals29 . \n sit - ups provide a good challenge for the ra , but not for the \n eo30 . \n asymmetrical exercises such as \n the isometric side bridge strengthen oblique activity , with little effect on ra30 . \n increases in the activities of the \n abdominal muscles ( ra , eo , and io ) occurred with maximum expiration when compared with \n resting expiration during side bridge exercise31 . \n these results indicate that training with nonrespiratory maneuvers \n such as side bridge exercise with maximum expiration might more effectively strengthen pef \n than sit - ups . \n one limitation of this study was the measurement of muscle thickness for determining the \n size of trunk muscles . \n in general , muscle size is believed to accurately reflect \n force - generating capacity . \n however , little is known about correlations between abdominal \n muscle size and their strength in iap . \n therefore , the causes of the lack of correlation \n between the thicknesses of the tra and io muscles and pef are unclear , even though the \n activities of these two muscles are related to changes in iap5,6,7 . \n another limitation of this study is the fact that only males were \n included in the analysis . \n regardless of the state of the muscle ( rest or contracted ) , \n healthy males have both thicker tra and total lateral abdominal muscles than females32 . \n however , the tra forms a greater \n proportion of the lateral abdominal muscles at rest and while contracted in females32 . \n the influence of gender on the extent to \n which abdominal muscle thickness associates with pef remains unknown . as part of the normal aging process \n this decline has also been documented for the muscles of respiration33 . this age - related change in the \n respiratory muscles \n inactivity due to lack of \n physical exercise may accelerate reductions in respiratory muscle force generating \n capacity34 . \n a previous study reported \n that the eo muscle was significantly thinner in a walking independent elderly group than in \n a young group , and the thickness of the eo in a walking dependent elderly group was \n significantly smaller than that in the walking independent elderly group35 . \n further study is necessary to determine \n whether forced expiration and abdominal muscle thickness are correlated in elderly \n people .", "role": "user" }, { "content": "[ purpose ] the purpose of this study was to determine whether forced expiration is \n correlated with abdominal muscle thickness . \n [ subjects ] twenty - three healthy male \n volunteers participated in this study . [ methods ] \n the peak expiratory flow ( pef ) was \n obtained using a peak flow meter with subjects in the sitting position . \n the thicknesses of \n the right rectus abdominis , external oblique , internal oblique , and transverse abdominis \n muscles were measured using b - mode ultrasonography at the end of a relaxed expiration in \n the supine position \n . [ results ] among the abdominal muscles , only the thickness of the \n external oblique muscle displayed a significant correlation with pef . \n [ conclusion ] it \n appears that the thickness of the external oblique muscle might be associated with pef \n during forced expiration .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: genomic dna was extracted from cultured single bacterial colonies . for genome sequencing of stb - d , -j , -k and -l \n , sanger reads from 10-kb fragment shotgun libraries at 4- 4.9 fold coverages were assembled with contigs obtained from newbler assemblies of 454/roche reads at 13 - 18.1 fold coverages , using arachne . \n the assembled consensus sequences were validated using illumina reads at 45 - 105 fold coverages and consed functionalities , and by mapping of termini - sequences from bacterial artificial chromosome libraries . high quality , contiguous genome sequences of 4420 kb ( stb - l , 9 contigs ) , 4432 kb ( stb - d , 12 contigs ) , 4524 kb ( stb - j , 11 contigs ) , and 4525 kb ( stb - k , 9 contigs ) were generated . \n remaining gaps estimated not to exceed 2 kb correspond to gc - rich and repetitive regions coding for pe_pgrs proteins , and/or the pks5 region ( stb - j ) . \n for stb - a , a fully finished , contiguous sequence of 4,482,059 bp was obtained by using ~ 80,000 shotgun sanger reads , illumina - generated reads and finishing . \n wgs data from stb strains e , g , h , and i were generated using illumina hisseq technology and single lanes . resulting reads that covered the genomes of these stb up to 900x were assembled using the velvet software and contigs were ordered using m. canettii cipt 140010059 ( stb - a ) and m. tuberculosis h37rv as reference genomes . \n annotation and genome comparisons were performed with the microscope platform , artemis and artemis comparison tool ( act ) . \n when applicable , annotations were transferred from those of m. tuberculosis orthologs in the tuberculist / mycobrowser database , using blast matches of > 90% protein sequence identity , an alignable region of > 80% of the shortest protein length in pairwise comparisons and visual inspection of the gene synteny . \n sniper pipeline ( genoscope ) based on the ssaha2 package was used to map illumina reads and detect snps and indels of stb strains against a corrected version of the m. tuberculosis h37rv reference sequence ( nc_000962 ) . \n after exclusion of ambiguous maps on repeat regions , an average of 4.7 million split paired - end reads of 36 bp ( stb - a , -d , -l , - j ) or trimmed at 50 bp ( stb - k ) were mapped at a resulting genome coverage > 40x . \n snps with base coverage < 10 , base quality < 25 , or heterozygosity > 0.2 were removed . \n act comparison files were created by using mummer and nucmer softwares to visualize the snp distribution in local genome regions . \n dn / ds ratios were calculated on orthologs conserved in all stb and m. tuberculosis h37rv , as identified by bidirectional best hits , alignable region of > 80% and sequence identity > \n pairwise , concatenated codon alignments between m. tuberculosis h37rv and each stb strain were generated using pal2nal , after respective protein alignments obtained with muscle . \n synonymous and non - synonymous substitutions were defined using nei - gojobori method - based snap or maximum likelihood - based paml . \n stb t - cell antigen , essential and non - essential gene categories , as well as t - cell epitope codon concatenates were constructed as described . \n the genomes of m. tuberculosis h37rv , m. bovis af2122/97 and the five stb strains were aligned using progressive mauve . given a pair ij of aligned genomes , the number of snps xij observed between i and j within a region of length l follows a binomial distribution b(l , pij ) , where pij is the expected proportion of recombination - free nucleotide differences between taxa i and j. regions containing at least one pair of sequences ij with an unexpectedly large or low number xij of snps , i.e. min [ pr ( x xij ) , pr ( x xij ) ] < 0.05 where x ~ b(l , pij ) , were identified by using a 200 character - long sliding window along the conserved ( core ) portions of the multiple genome alignment . \n the value pij inside each window was estimated as the proportion of snps between i and j within the 10000 aligned characters flanking the sliding window on both sides . to obtain a reference phylogeny , \n all regions of length 500 characters ( excluding gaps ) that did not contain an unexpected number of snps were concatenated . \n the derived supermatrix was used to infer a phylogenetic tree by using the neighbor - joining algorithm on the pairwise nucleotide p - distances . \n all regions of length 500 characters with a significantly high or low number of snps were inspected visually for detection of concentration of homoplasic characters using act , leading to similarities between strains incongruent with the phylogenetic tree . \n the proportion of protein coding sequences within the core genome likely affected by inter - strain recombination was assessed with the pairwise homoplasy index , the maximum x test , and the neighbour similarity score . \n growth rates of stb and reference mtbc strains in liquid media were measured by using a bactec 460 system ( beckton - dickinson ) as recommended by the manufacturer . \n mice were maintained according to the institut pasteur de lille and paris guidelines for laboratory animal husbandry . \n animal experiments were approved by the nord - pas - de - calais ethical committee ( ceea 15/2009 ) and the institut pasteur hygiene committee ( authorization number 75 - 1469 ) , in accordance with european and french guidelines ( directive 86/609/cee and decree 87848 ) . \n eight - week - old female balb / c mice were infected by the intranasal route with 10 cfus of either stb or m. tuberculosis h37rv strains , respectively . at indicated times , 4 mice per group were sacrificed , and colony counting was performed from homogenized individual lungs and spleens as described . for histopathological evaluation , \n whole lungs were harvested from 3 balb / c mice per group 128 days post - infection , fixed in 4% formalin , and embedded in paraffin . \n virulence and cell - analysis - based immunological assays using c57bl/6 and/or scid mice were performed as described . \n adaptive immune cells from infected mice were prepared , incubated with conjugated mabs ( beckton - dickinson ) , fixed , and analyzed using a cyan system and summit ( beckman coulter ) and flowjo ( treestar ) softwares . \n \n genomic dna was extracted from cultured single bacterial colonies . for genome sequencing of stb - d , -j , -k and -l \n , sanger reads from 10-kb fragment shotgun libraries at 4- 4.9 fold coverages were assembled with contigs obtained from newbler assemblies of 454/roche reads at 13 - 18.1 fold coverages , using arachne . \n the assembled consensus sequences were validated using illumina reads at 45 - 105 fold coverages and consed functionalities , and by mapping of termini - sequences from bacterial artificial chromosome libraries . \n high quality , contiguous genome sequences of 4420 kb ( stb - l , 9 contigs ) , 4432 kb ( stb - d , 12 contigs ) , 4524 kb ( stb - j , 11 contigs ) , and 4525 kb ( stb - k , 9 contigs ) were generated . \n remaining gaps estimated not to exceed 2 kb correspond to gc - rich and repetitive regions coding for pe_pgrs proteins , and/or the pks5 region ( stb - j ) . \n for stb - a , a fully finished , contiguous sequence of 4,482,059 bp was obtained by using ~ 80,000 shotgun sanger reads , illumina - generated reads and finishing . \n wgs data from stb strains e , g , h , and i were generated using illumina hisseq technology and single lanes . \n resulting reads that covered the genomes of these stb up to 900x were assembled using the velvet software and contigs were ordered using m. canettii cipt 140010059 ( stb - a ) and m. tuberculosis h37rv as reference genomes . \n annotation and genome comparisons were performed with the microscope platform , artemis and artemis comparison tool ( act ) . \n when applicable , annotations were transferred from those of m. tuberculosis orthologs in the tuberculist / mycobrowser database , using blast matches of > 90% protein sequence identity , an alignable region of > 80% of the shortest protein length in pairwise comparisons and visual inspection of the gene synteny . \n sniper pipeline ( genoscope ) based on the ssaha2 package was used to map illumina reads and detect snps and indels of stb strains against a corrected version of the m. tuberculosis h37rv reference sequence ( nc_000962 ) . \n after exclusion of ambiguous maps on repeat regions , an average of 4.7 million split paired - end reads of 36 bp ( stb - a , -d , -l , - j ) or trimmed at 50 bp ( stb - k ) were mapped at a resulting genome coverage > 40x . \n snps with base coverage < 10 , base quality < 25 , or heterozygosity > 0.2 were removed . \n act comparison files were created by using mummer and nucmer softwares to visualize the snp distribution in local genome regions . \n dn / ds ratios were calculated on orthologs conserved in all stb and m. tuberculosis h37rv , as identified by bidirectional best hits , alignable region of > 80% and sequence identity > \n pairwise , concatenated codon alignments between m. tuberculosis h37rv and each stb strain were generated using pal2nal , after respective protein alignments obtained with muscle . \n synonymous and non - synonymous substitutions were defined using nei - gojobori method - based snap or maximum likelihood - based paml . \n stb t - cell antigen , essential and non - essential gene categories , as well as t - cell epitope codon concatenates were constructed as described . \n the genomes of m. tuberculosis h37rv , m. bovis af2122/97 and the five stb strains were aligned using progressive mauve . given a pair ij of aligned genomes , the number of snps xij observed between i and j within a region of length l follows a binomial distribution b(l , pij ) , where pij is the expected proportion of recombination - free nucleotide differences between taxa i and j. regions containing at least one pair of sequences ij with an unexpectedly large or low number xij of snps , i.e. min [ pr ( x xij ) , pr ( x xij ) ] < 0.05 where x ~ b(l , pij ) , were identified by using a 200 character - long sliding window along the conserved ( core ) portions of the multiple genome alignment . \n the value pij inside each window was estimated as the proportion of snps between i and j within the 10000 aligned characters flanking the sliding window on both sides . to obtain a reference phylogeny , \n all regions of length 500 characters ( excluding gaps ) that did not contain an unexpected number of snps were concatenated . \n the derived supermatrix was used to infer a phylogenetic tree by using the neighbor - joining algorithm on the pairwise nucleotide p - distances . \n all regions of length 500 characters with a significantly high or low number of snps were inspected visually for detection of concentration of homoplasic characters using act , leading to similarities between strains incongruent with the phylogenetic tree . \n the proportion of protein coding sequences within the core genome likely affected by inter - strain recombination was assessed with the pairwise homoplasy index , the maximum x test , and the neighbour similarity score . \n growth rates of stb and reference mtbc strains in liquid media were measured by using a bactec 460 system ( beckton - dickinson ) as recommended by the manufacturer . \n mice were maintained according to the institut pasteur de lille and paris guidelines for laboratory animal husbandry . \n animal experiments were approved by the nord - pas - de - calais ethical committee ( ceea 15/2009 ) and the institut pasteur hygiene committee ( authorization number 75 - 1469 ) , in accordance with european and french guidelines ( directive 86/609/cee and decree 87848 ) . \n eight - week - old female balb / c mice were infected by the intranasal route with 10 cfus of either stb or m. tuberculosis h37rv strains , respectively . at indicated times , 4 mice per group were sacrificed , and colony counting was performed from homogenized individual lungs and spleens as described . for histopathological evaluation , \n whole lungs were harvested from 3 balb / c mice per group 128 days post - infection , fixed in 4% formalin , and embedded in paraffin . \n virulence and cell - analysis - based immunological assays using c57bl/6 and/or scid mice were performed as described . \n adaptive immune cells from infected mice were prepared , incubated with conjugated mabs ( beckton - dickinson ) , fixed , and analyzed using a cyan system and summit ( beckman coulter ) and flowjo ( treestar ) softwares . \n ", "role": "user" }, { "content": "global spread and genetic monomorphism are hallmarks of mycobacterium tuberculosis , the agent of human tuberculosis . in contrast , \n mycobacterium canettii , and related tubercle bacilli that also cause human tuberculosis and exhibit unusual smooth colony morphology , are restricted to east - africa . here , we sequenced and analyzed the genomes of five representative strains of smooth tubercle bacilli ( stb ) using sanger ( 4 - 5x coverage ) , 454/roche ( 13 - 18x coverage ) and/or illumina dna sequencing ( 45 - 105x coverage ) . \n we show that stb are highly recombinogenic and evolutionary early - branching , with larger genome sizes , 25-fold more snps , fewer molecular scars and distinct crispr - cas systems relative to m. tuberculosis . despite the differences , all tuberculosis - causing mycobacteria share a highly conserved core genome . \n mouse - infection experiments revealed that stb are less persistent and virulent than m. tuberculosis . \n we conclude that m. tuberculosis emerged from an ancestral , stb - like pool of mycobacteria by gain of persistence and virulence mechanisms and we provide genome - wide insights into the molecular events involved .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: there are 20 class i genes and in transplantation hla - a , b , and c are the classic genes referenced to when typing the recipient . \n class i major histocompatibility complex ( mhc ) molecule processing and loading of peptides occurs in all nucleated cells , where class ii mhc molecule involves primarily b cells , macrophages , and dendritic cells by method of endocytosis and phagocytosis . \n class ii mhc molecule nomenclature is designated by class ( d ) , family ( m , o , p , q , r ) , and chain ( a or b ) \n . late antibody - mediated rejection ( amr ) is a major cause of late kidney transplant failure and several developments in understanding of pathogenesis allow for improvement of diagnosis , treatment , and prevention . \n this review will concentrate on reviewing the pathogenesis , diagnosis , and treatment of amr . \n not only can antibodies form against hla molecules , but to endothelial - cell antigens and across abo blood group . \n blood transfusions can induce humoral immunity by formation of hla alloantibodies and are more likely to occur in individuals who have been previously pregnant . \n our understanding of how blood transfusions cause sensitization is incomplete , but it is not inevitable and can be attenuated by immunosuppression . in a study performed by eikmans et al . \n it was found two weeks after blood transfusion in both nonsensitized and sensitized recipients , increased numbers of ifn--producing cells were produced stimulating cd4 + and nk cells . with de novo hla production , \n endothelium of donor graft peritubular and glomerular capillaries display mhc molecules which are the target for antibody production . \n once the endothelium is damaged by antibody , von willebrand factor and p - selectin are released as an inflammatory response . \n leukocytes adhere to glomeruli or to dilated peritubular capillaries via cytokines ( il-1 , il-8 , and chemokine ligand 2 ) allowing complement activation . in antibody rejection \n , c4d is a useful marker of complement activation and is seen commonly in peritubular capillaries with proper immunohistochemical staining technique . \n chemoattractants c3a and c5a are a part of the compliment cascade which activate c5b allowing for assembly of membrane attack complex ( mac ) which is composed of c5b - c9 . \n the mac complex once activated will cause local necrosis allowing detachment of endothelial cells from the basement membrane , which is also a characteristic finding upon biopsy indicative of amr . if not treated properly in a timely manner , sequelae can include thrombotic microangiopathy ( tma ) causing hemorrhage with arterial wall necrosis , and ultimately graft loss . also potentially playing a role in amr pathogenesis \n are polymorphic mhc - class - i - related chain a ( mica ) antigens . \n it has been found that not all patients with amr have anti - hla antibodies , which suggests other possible mechanisms involved in acute or chronic graft damage . in a study conducted by worthington et al . \n , only five out of 14 patients with renal graft dysfunction and pathology showing c4d deposition in peritubular capillaries were found to have anti - hla antibodies . \n mica antigens are structurally similar to mhc class i proteins , closely linked to hla - b and c loci . \n mica antigens can be found on fibroblasts , endothelial cells , dendritic cells , and many tumors which unfortunately makes detection difficult by standard donor and recipient crossmatching . \n mica eplet repertoire has become the basis for developing hlamatchmaker program which analyzes antibody patterns with single mica alleles on luminex platform . \n it has been determined so far ( duquesnoy et al . ) that there are 38 potentially immunogenic mica eplets associated with mica - reactive serum . \n mica and hla class i chains are similar in configuration however none of the polymorphic residues are shared . \n hlamatchmaker program is therefore used to determine the specificity of anti - mica antibodies in sensitized patients since mica is considered as a separate alloantigenic system . in a study by zhang et al . \n , 52 patients transplanted who were crossmatch negative were placed on triple therapy ( cyclosporine / tacrolimus , mycophenolate , and prednisone ) . once graft dysfunction was diagnosed with positive c4d , both anti - hla and anti - mica antibodies were collected from serum and reviewed via luminex . of the 15 patients found to have anti - mica antibodies , 9 patients were positive for class i and/or class ii anti - hla antibodies . \n nine out of 15 patients were found to have c4d deposition , and after reviewing patients for the follow - up period ( 1 year ) , it was found that egfr decreased in anti - mica and anti - hla antibody positive group . \n this study suggested that patients with mica antibodies have a more rapid deterioration of graft function versus patients with just anti - hla antibodies . \n there are several proposed mechanisms for anti - mica antibody activation involving complement or natural killer cells and studies are continuing to determine the pathogenesis . a more thorough understanding of hla typing as well as continuing studies to determine anti - mica and antibody rejection pathogenesis may allow for novel treatment strategies . \n amr occurs in up to 33% of cases undergoing abo incompatible kidney transplantation . among cases in which amr is triggered in the early post - op period , \n this is opposed to the case in which gloor found patients who received desensitization to hla antibodies showed more glomerular changes versus abo incompatible transplant grafts not having clinical amr , suggesting subclinical amr may exist . \n the resistance of the graft to amr in spite of the presence of antibodies against donor endothelium is called accommodation . \n this is explained either by difference in antigen expression , change in repertoire / level of antibodies in recipient , or decreased susceptibility of injury to endothelium secondary to continual stimulation of antibody and complement components . \n it is proposed that continued stimulation of endothelial cells by endotoxin or il-1 over time diminishes cellular responses to restimulation . \n another proposed mechanism explaining accommodation could be a decrease in the recipient 's type blood - type antigen on the endothelium of the graft . \n koestner et al . reported histo - blood type change of a blood type b graft after abo - mismatched heart transplantation , where the recipient 's blood - type o antigen was replaced by the donor 's type b antigen after amr graft loss . \n the mechanism of replacement of the recipient 's antigens remains unclear , and several studies have been attempted to explain occurrence of blood - type chimerism . \n one explanation is replacement of the recipient type antigens by stem cells derived from injured vessel walls after graft rejection . \n it is speculated that during amr some blood - type antigens could be shaved off from endothelial surface from immunological reaction , resulting in loss of blood - type antigens on the transplanted mismatched organ . \n in addition the presence of diffuse c4d without capillary damage or inflammation infers that accommodation may include resistance to the terminal complement cascade . \n there are some noted differences between hla - sensitized and abo - incompatible renal transplantation in terms of pattern of cell injury after c4d deposition . \n it has been found that there is more graft loss with positive c4d amr in hla - sensitized patients which may be due to differences in biological responses between non - self - carbohydrate antigens ( blood type antigens ) and non - self - peptide antigens ( hla antigens ) . \n crossmatching not only improves long - term graft survival by identifying the presence of antidonor antibody in the recipient , but is used as a predictor of amr . \n the donor cells are incubated with the recipient serum , and antihuman globulin which is fluorescent dye tagged is placed in the flow cytometer . \n hla - specific antibody detects antibodies binding to individual hla antigens and allowing determination of antigens to avoid in a donor , coined unacceptable antigens thus avoiding rejection . of patients who are highly sensitized \n hla - specific antibody detection prior to transplantation and surveillance after transplantation during a rejection episode allows for avoidance of rejection and determination of course of treatment for amr , respectively . \n the 1997 banff classification was used to classify rejection prior to the meeting in 2001 , which further defined pathological classification of amr . \n gorer determined the role of antibody after much debate in the early days of transplantation , and unfortunately after his death in 1961 the concept of amr was lost . in 1991 - 1992 , \n feucht and halloran described c4d as a marker for amr however this was not uniformly utilized until the report from solez et al . in 19982000 . \n after international transplant meetings in 1997 , amr was an entity recognized by most of the participants and c4d staining raised hope that morphological classification of amr can be further defined . \n incidence of amr has been reported as 08% in renal transplant recipients in larger centers largely due to increased recognition , detection of dsa , retransplanted patients , as well as increase in positive crossmatch and abo incompatible transplantation for highly sensitized patients . \n colvin had reviewed studies from massachusetts general hospital which for the first time indicated a clear correlation of peritubular capillary c4d staining pathological features with dsa in amr . \n a few studies have indicated c4d staining is around 9396% specific , but 3195% sensitive . \n this raises a concern that additional evidence is needed to diagnose amr such as quantification of dsa or other morphologic feature consistent with amr on pathology . \n however it should be noted that regele and colleagues presented data from 1 year after amr that kidney transplant patients with positive c4d had higher incidence of graft loss and elevation of serum creatinine . after the banff meeting in 2001 \n acute tubular injury ; neutrophils and/or mononuclear cells in peritubular capillaries and/or glomeruli , and/or capillary thrombosis ; or arteritis / fibrinoid necrosis in the intima along with intramural / transmural arterial inflammation . \n c4d evidence for antibody action and/or immunoglobulin in peritubular capillaries , immunoglobulin and complement in arterial fibrinoid necrosis . \n anti - hla antibody ( dsa ) circulation in serum or other antidonor endothelial antigens . after the banff meeting in 2009 , \n positive c4d deposition without evidence of rejection was added to criteria suggesting antibody - mediated changes . \n several studies had reported this finding including mark haas ( los angeles ) who had seen c4d deposition in biopsies without evidence of rejection . in protocol biopsies from abo incompatible grafts , \n 21/37 had c4d deposition without evidence of amr lesions or t - cell - mediated rejection which can suggest accommodation . \n another addition to banff criteria indicating antibody - mediated changes was determined to be positive c4d with presence of circulating antidonor antibodies ( no signs of acute or chronic t - cell - mediated rejection or amr / no atn - like minimal inflammation ) . in normal kidneys , specifically in the glomerular mesangium as well as arterioles at the vascular pole , turnover of immune complexes occurs ( c4d ) . \n transplanted kidneys in addition show deposition of c4d in peritubular capillaries and can follow a dynamic course . \n c4d can be in a transitional state and show staining of only a few capillaries indicating either an ongoing humoral attack or resolving previous attack . \n there is sometimes diffuse staining in every capillary or focal staining in only a few capillaries , but c4d is always attached to endothelial cells and basement membranes . \n there has also been evidence for c4d negative amr in a couple studies , which in the past few years has brought to the forefront the limitations of c4d as a marker for amr . \n in one such study by sis et al . , overexpression of 12-individual endothelial - associated transcripts genes ( endats ) upon transplant biopsies with graft dysfunction was correlated with an increased risk of graft loss . \n high endat expression and endothelial activation with dsa was found to be strongly associated with the presence of transplant glomerulopathy . \n interestingly , fewer than 50% of the biopsies performed ( n = 173 ) with dsa and endats had diffuse c4d staining in peritubular capillaries . \n investigators also have found that c4d negative form of amr is less severe than c4d positive amr but is associated with chronic changes within the graft , such as transplant glomerulopathy . \n it has been postulated that dsa binding to endothelial cells triggers natural - killer cells to release interferon- resulting in granule - associated toxicity . \n dsa has been found to play a role in diagnosis of amr and can be an independent predictor of allograft loss . \n it was found when patients had dsa at time of clinical rejection diagnosed by luminex , 50% reduction in dsa within 14 days of diagnosis had higher allograft survival . in a study performed by everly et al . \n , acute rejection was defined as an increase in serum creatinine by 20% above the baseline upon rejection ; dsa was identified by antigen bead panels by luminex assay . \n 650 patients were analyzed for acute rejection , 94 of which were identified with biopsy - proven acute rejection by banff criteria . \n analysis of predictors of allograft loss revealed dsa to be an independent predictor of allograft loss , with a sixfold increase in allograft loss rates . \n however , it is noted in this study that dsa was present in the absence of c4d staining on biopsy . \n further studies need to be conducted to determine if complete elimination of dsa is necessary . \n however , from this study it should be deduced that dsa reduction should receive consideration as a potential therapeutic goal for rejection therapy . \n suppression of dsa with antihumoral therapies may provide a means for improving long - term renal allograft survival . \n bortezomib , a new anti - b - cell agent that targets antibody producing cells ( plasma cells ) has shown promise as an effective means for reducing dsa as well . \n it has also been postulated that surveillance of dsa can be a means of preventing rejection , especially for highly sensitized patients . \n it has been discussed that high - risk patients ( presensitized and retransplants ) may benefit from more dsa surveillance in the first 3 months after transplant to detect an early immune response ; however this is not rigorously proven to improve outcomes . \n plasmapheresis ( pp ) removes alloantibodies from the circulation and is the fastest and most effective method for elimination of dsa . \n usually 1.01.5 full - volume exchanges are performed using albumin solution daily or alternate days , continued until serum creatinine decreases 30% from the baseline value . \n although pp is effective in removing alloantibodies ( dsa ) from the circulation , rebound synthesis of de novo alloantibodies can occur . \n ivig is used in combination with pp to neutralize antibodies and potentially block complement activity as well as agents used for suppression of antibody ( cacineurin inhibitors , mycophenolate , or rituximab ) . \n immunoadsorption ( ia ) is a substance derived from the cowan strain of staphylococcus aureus . \n the protein a coating the column beads has a strong affinity for the fc portion of immunoglobulin and immune complexes . \n for the past decade , protein a ia was found to remove harmful antibodies and immune complexes efficiently and has been used as treatment of amr of highly sensitized patients . \n it was found in a study by qing et al . that classes i and ii panel - reactive antibody ( pra ) as well as immunoglobulin and complement ( c3 and c4 ) were reduced significantly . \n however , it was found that within 6 to 8 hours rebound of antibodies was seen . \n it has been postulated that ia may cause a conformation change of the structure of the antibodies and immune complexes making them more immunogenic , and immunostimulating to regulatory anti - idiotype antibodies . \n these antibodies play a role in the control of autoimmune mechanisms and reverse the continuing cycle of abnormal immune balance . \n the long lasting response of ia therapy may be explained by phagocytosis of the reticuloendothelial system and activation of complement . \n ivig is prepared by human plasma from approximately 50,000100,000 of healthy donors , composed of 90% intact igg , a few dimers , fabs ( fragment antigen - binding ) and traces of igm and iga . \n the fc region in igg allows it to interact and signal through fc - gamma receptors on phagocytes , b cells , and other cells as well as with fc - binding plasma proteins , such as components of the complement system . \n immune globulin also prevents damage mediated by immune complexes containing c3b into an inactive form ic3b as well as neutralization of some cytokines . \n ivig can neutralize autoantibodies and down regulate synthesis of antibodies by b cells expressing the relevant idiotype . \n there are some studies with usage of ivig alone or in combination with pp , and when ivig is used alone a high dose is given ( 1 - 2 g / kg ) . \n it was found ivig was effective in reversing rejection within 25 days of infusion with no recurrence in kidney transplant recipients . \n the usual recommended dose is 100 mg / kg of ivig after each pp session and 300400 mg / kg for 1 - 2 days after the last pp with a cumulative dose of 1000 mg / kg . \n a benefit of ivig is its ability to replenish gammaglobulin lost during pp , decreasing infection risk . \n adverse effects of ivig which are common are headache , fever , chills , myalgias , and hypotension / hypertension which can be reduced by slowing the infusion rate . \n serious adverse effects are rare and can include aseptic meningitis , acute renal failure , thrombotic events , and anaphylaxis . \n jin et al . had used thymoglobulin ( atg ) 0.75 mg / kg / day for 510 days in combination with plasma exchange in 7 patients with amr and showed 85% reversal in amr . \n atg eliminates cd4 + t - cell and b - cell interaction causing b - cell toxicity / apoptosis and modulation of alloantibody production . \n if both cellular and humoral features are seen on biopsy , atg is often used along with steroids for treatment of amr . \n atg can be given in 3 - 4 doses to a cumulative dose of 6 mg / kg , and it is noted that leukopenia is a side effect which should be monitored to guide specific treatment for each patient . \n the spleen is the largest lymphoid organ in the body and has been found to play a role in alloantibody generation . \n splenectomy is used in desensitization protocols for abo incompatible transplants as well as positive crossmatches , however it has been found to surprisingly treat amr refractory to treatment . \n there are a few case studies , one in particular where abundant clusters of cd138 + plasma cells were found upon review of pathology of the spleen . usually in traumatic splenectomy controls , cd138 + cells \n she had been treated with pp / ivig and then underwent emergent splenectomy . immediately afterward \n the mechanism of action is not entirely clear as to why splenectomy treats amr , but several case reports have indicated that it could be a potential treatment for refractory amr to pp / ivig . \n it is not certain whether the cd138 + cells found in the spleen had produced anti - dr51 antibodies in this particular case , but provides a novel insight for further studies in the role of the spleen with amr . \n of course , splenectomy has risks associated with it which include increased risk of infections and the risks associated with surgery . \n therefore these risks must be discussed with the patient before proceeding , as this is not a conventional treatment for amr . \n there is lifelong risk with encapsulated microorganisms ; therefore patients must receive haemophilus influenza vaccine , pneumococcal , and meningococcal vaccines . \n most episodes of amr are associated by evidence of early complement activation by the presence of c4d+ staining of the peritubular capillaries . \n eculizumab is a humanized monoclonal antibody with high affinity for c5 and blocks the activation of terminal complement and is fda approved for the treatment of paroxysmal nocturnal hemoglobinuria . \n serious adverse effects of this medication are an increased risk of infections , particularly to encapsulated bacteria . \n it is recommended to immunize patients at least two weeks before the administration of eculizumab to meningococcus and pneumococcus . \n the transplant community is looking towards the use of this medication because of its highly selective mechanism of action . \n there are several case reports using eculizumab for desensitization before transplant and to treat amr after transplant . \n stegall and colleges reported using eculizumab in sensitized renal transplant recipients with high levels of dsa to determine if the incidence of amr in the first 3 months after transplant was decreased compared to historical controls . \n these patients were immunized one month prior to transplant , received plasmapheresis treatments before and after transplant based on the crossmatch channel shifts , and received the same induction and maintenance immunosuppression . \n the eculizumab dosing regimen included 600 mg on postoperative day 1 , and 600 mg weekly thereafter for 4 weeks . at week 4 , assessment of dsa levels was performed to determine if patients would continue treatment based on dsa levels . \n the study found the incidence of amr was statistically significanty lower in the eculizumab group compared to the control group and reduced the need for splenectomy , reducing transplant glomerulopathy . \n considering the cost of this medication , this dosing regimen and prophylactic use might be unrealistic for smaller transplant centers . \n a few case reports used eculizumab in treating renal thrombotic microangiopathy ( tma ) and reversal of complement activation after abo - incompatible transplantation [ 2628 ] . \n the use for tma involved a patient who underwent a living related kidney transplant with a history of lupus developed severe tma , glomerular scarring , and diffuse tubulointerstitial fibrosis with positive apl antibodies . the patient received dialysis and plasmapheresis sessions with no improvement in kidney function . \n the patient received weekly infusions of eculizumab without complication and renal function improved with subsequent biopsy revealed complete resolution of tma . \n the transplant community has recognized the potential use of an agent that can directly target plasma cells . \n traditional treatments have been successful in removing antibodies , inhibiting antibody activity or lowering production but no treatments have been effective in targeting mature antibody production in plasma cells . \n amr involves the production of high levels of dsa by plasma cells either newly made from memory or nave b cells or from those that existed prior to transplant . \n bortezomib is a proteasome inhibitor which is fda approved for the treatment of multiple myeloma . \n this medication has been shown to cause apoptosis of normal plasma cells which in turn decreases alloantibody production in sensitized patients . \n the university of cincinnati reported the first study on the use of bortezomib in amr . \n everly and colleagues treated six kidney transplant recipients with refractory amr and concomitant acr with bortezomib and found fast rejection reversal , reductions in dsa levels , improved renal allograft function , and suppression of recurrent rejection . \n the same group reported two patients with amr who received bortezomib and these patients experienced prompt amr reversal and dsa elimination in 14 days . \n the use of bortezomib has also been published in five patients with a combination of acr and amr . \n these patients were given four doses of bortezomib and reversal of both acr and amr occurred with reduction in dsa . \n other studies have shown positive and mixed results regarding the use of this medication in amr and dsa levels [ 31 , 32 ] . \n rituximab is a chimeric anti - cd 20 ( anti - b cell ) monoclonal antibody that is currently fda approved for the treatment of lymphoma . \n the cd 20 antigen is expressed early in b - cell cycle but is absent on mature plasma cells . \n the variable region of rituximab binds to cd 20 through three different mechanisms including antibody - dependent cell cytotoxicity , complement - dependent cell killing , and induction of apoptotic cell death . \n these mechanisms mark cells for destruction and leads to sustained depletion of circulating b cells [ 32 , 33 ] . \n genberg and colleagues reviewed the pharmacodynamics after a single dose of rituximab given to renal transplant patients and showed b - cell elimination was rapid and occurred in the peripheral blood over 1 - 2 days . \n the effect on the b - cell population was prolonged and did not reemerge for 1 year and remained suppressed for 2 years . \n the first report of using rituximab in amr evaluated 27 patients with refractory rejection and received a single dose of rituximab . \n three grafts were lost and the remaining grafts had good function at the time of discharge . \n kaposztas and colleagues published a retrospective study involving 54 patients with amr and were split into two groups . \n group a ( n = 26 ) received plasmapheresis and rituximab and group b ( n = 28 ) received plasmapheresis alone . \n the two year graft survival was significantly better in the rituximab group . since these two large case reports \n , there have been many case series , and so forth published on using rituximab with any of the studies for desensitization and for amr [ 3740 ] . with many of studies \n the patient population is small , with incomplete criteria for amr diagnosis , and other treatments used in conjunction with rituximab including ivig , plasmapheresis , and steroids . however it should be noted in other studies particularly by pescovitz , a small number of patients failed to show a decrease in pra with rituximab alone .", "role": "user" }, { "content": "antibody - mediated rejection ( amr ) is a major cause of late kidney transplant failure . \n it is important to have an understanding of human - leukocyte antigen ( hla ) typing including well - designed studies to determine anti - mhc - class - i - related chain a ( mica ) and antibody rejection pathogenesis . \n this can allow for more specific diagnosis and treatment which may improve long - term graft function . \n hla - specific antibody detection prior to transplantation allows one to help determine the risk for amr while detection of dsa along with a biopsy confirms it . \n it is now appreciated that biopsy for amr does not have to include diffuse c4d , but does require a closer look at peritubular capillary microvasculature . although plasmapheresis ( pp ) is effective in removing alloantibodies ( dsas ) from the circulation , rebound synthesis of alloantibodies can occur . \n splenectomy is used in desensitization protocols for abo incompatible transplants as well as being found to treat amr refractory to conventional treatment . \n also used are agents targeted for plasma cells , b cells , and the complement cascade which are bortezomib rituximab and eculizumab , respectively .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: this is a normal protective mechanism associated with any \n lesion anywhere in the body . \n usually the patients complain of a localized pain in the ocular \n area of the affected cornea . \n this is due to the ciliary spasm \n secondary to the corneal neuronal reflex arc . \n ciliary spasm \n can be effectively relieved by use of cycloplegics such as \n homatropine eye drops . \n in addition , the pain is usually well \n controlled once the topical medication brings the corneal \n infiltrates under control . however \n , if a patient complains of a sudden or severe increase \n in pain , one needs to consider secondary glaucoma . \n they include hypopyon and exudates on the endothelial \n surfaces causing a block of the trabecular meshwork or \n secondary trabeculitis in some cases of viral keratitis . \n secondary glaucoma needs aggressive medical management \n in the form of topical beta blockers and carbonic anhydrase \n inhibitors ( dorzolamide ) with or without systemic carbonic \n anhydrase inhibitors ( acetazolamide ) . \n we prefer systemic \n carbonic anhydrase inhibitors due to the potential toxicity of \n topical inhibitors to the damaged corneal endothelium.1 sudden reduction of pain in a patient with an active \n uncontrolled keratitis should be looked upon with suspicion \n rather than relief . \n many a times due to the extensive exudation \n and/or accumulation of the medications ( especially antifungal ) , \n the underlying wound is hidden . \n this can lead to a false sense \n of security and the underlying thinning may be missed . \n a \n micro - perforation in the area of the corneal ulcer can lead to \n natural drainage of the aqueous and relieve the intraocular \n pressure . \n however , the collapse of the anterior chamber \n will lead to the formation of an adherent leukoma as well as \n closure of the angle of the anterior chamber \n . this will lead \n to irreversible secondary angle closure glaucoma with poor \n chances of visual rehabilitation . \n however , if a patient complains of a sudden or severe increase \n in pain , one needs to consider secondary glaucoma . \n they include hypopyon and exudates on the endothelial \n surfaces causing a block of the trabecular meshwork or \n secondary trabeculitis in some cases of viral keratitis . \n secondary glaucoma needs aggressive medical management \n in the form of topical beta blockers and carbonic anhydrase \n inhibitors ( dorzolamide ) with or without systemic carbonic \n anhydrase inhibitors ( acetazolamide ) . \n we prefer systemic \n carbonic anhydrase inhibitors due to the potential toxicity of \n topical inhibitors to the damaged corneal endothelium.1 \n sudden reduction of pain in a patient with an active \n uncontrolled keratitis should be looked upon with suspicion \n rather than relief . \n many a times due to the extensive exudation \n and/or accumulation of the medications ( especially antifungal ) , \n the underlying wound is hidden . \n this can lead to a false sense \n of security and the underlying thinning may be missed . \n a \n micro - perforation in the area of the corneal ulcer can lead to \n natural drainage of the aqueous and relieve the intraocular \n pressure . \n however , the collapse of the anterior chamber \n will lead to the formation of an adherent leukoma as well as \n closure of the angle of the anterior chamber . \n this will lead \n to irreversible secondary angle closure glaucoma with poor \n chances of visual rehabilitation . \n the most common effect of a microbial infection of the cornea \n is the necrotic changes of the stromal fibers . \n . it can be the direct action of the \n microbe in breakdown of the stromal fibers . \n it can be indirect \n action due to the endotoxins released due to the destruction of \n the microbial cell wall by the antibiotics or the body defense \n mechanisms . \n it can also be due to autolysis induced by various \n human enzymes like matrix metalloproteinases ( mmps ) that \n are released due to an uncontrolled activation of the tissue \n destruction mechanisms.3,4 the end result of all these mechanisms is the necrosis of the \n tissue in the infected area . \n if this is seen only due to the direct \n action of the microbes , then the control of the infection will \n limit the thinning . \n thus , a regular watch on the corneal ulcer \n ( we usually recommend a follow - up visit at least 48 h apart in \n ulcers < 3 mm and every 24 h in larger ulcers ) is necessary to \n prevent such mishaps ( v agrawal , unpublished data ) . in infections due to gram - negative bacteria such as \n pseudomonas , the risk of rapid corneal melt is unusually high . \n these patients need to be seen as frequently as twice a day till \n the ulcer begins to heal . \n the reason to watch for a corneal melt is that an early melt \n may respond to treatment and advanced melt is unlikely to \n respond well ( v agrawal , unpublished data ) . in case of early melt , \n use of topical and systemic tetracycline \n is believed to help.5,6 in addition , the use of tissue \n glue and bandage contact lens can also be useful . \n if the perforation is \n larger than 2 mm , then the use of tissue glue is unlikely to \n be adequate . \n we have successfully used preserved amniotic \n membrane as a multilayered application with tissue glue at \n the wound edges to close such wounds . \n this is a modification \n of the method of hick et al.7 amniotic membrane also has \n anti - collagenolytic properties and may help in stabilizing the \n ocular surface . \n perforations larger than 4 mm and up to 6 mm may need a \n corneal patch graft to close the fistula . \n total corneal melts have been managed with sclerokeratoplasty with \n guarded results.8 in summary , corneal melts are best avoided by rigorous \n observation and aggressive medical management . \n in severe fungal infection , the descemets membrane can fail \n to limit the infection to the corneal stroma . \n alternatively , the \n severe anterior chamber reaction secondary to the toxic effects \n of the microbe can lead to a complete organized hypopyon \n formation in the anterior chamber . \n the use of cycloplegics has \n been advocated but in our experience it may not be adequate . \n in such cases , \n we have used the concept of anterior chamber \n lavage to debulk the chamber and also reduce the infectious \n load to help the medications act better . along with the lavage \n with ringers lactate , there may be a need to remove the \n organized fibrinoid material from the chamber . \n the use of a \n suitable antibiotic or antifungal agent in the lavage fluid is \n acceptable.9 \n many a times one sees that the corneal ulcer is responding \n to the medications for first 24 - 48 h. after this period , the \n eye becomes significantly redder , there is lid edema and the \n conjunctival surface too starts to stain with fluorescein . \n however , it is more likely \n to either be an allergic reaction to one of the medications being \n used or the occurrence due to keratitis medicamentosa . \n this \n is differentiated from spreading infection by the fact that the \n primary lesion size remains constant or shows improvement \n despite all the adnexal changes .", "role": "user" }, { "content": "infectious keratitis is a fairly common entity in india . \n however while paying attention to the primary entity , \n the associated events may be overlooked . \n enhanced pain usually suggests a worsening of the condition or \n development of associated problems like secondary glaucoma . \n however , contrary to logic , a sudden decrease \n in pain is also liley to suggest a worsening , e.g. perforation of the corneal ulcer . \n various such problems with \n their management are outlined .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: for free radicals , \n the singly occupied molecular orbital ( somo ) \n is usually expected to be the highest occupied ( half - filled ) mo in \n accordance with the aufbau principle . \n violations \n of the aufbau principle are rare but have been reported in a few studies \n in which the somo is found to be energetically lower in energy than \n the highest - occupied molecular orbital ( homo ) . using theory and experiment [ photoelectron spectroscopy in the gas - phase \n and condensed - phase epr ( electron paramagnetic resonance ) ] , westcott \n et al . showed the non - aufbau behavior \n in metalloporphyrins . \n homo level inversion was also reported \n in 2,2,6,6-tetramethylpiperidine - l - oxy radical ( tempo)-dithiolate \n complexed with pt(ii ) . \n studied the triradical with an open - shell \n doublet ground state of 5-dehydro - m - xylylene . \n sugawara \n et al . reported that the nitronyl nitroxide \n radical ( nn ) bonded to ttf ( tetrathiafulvalene ) \n had the somo on the nn portion that lay lower in energy than the homo , \n which was on the ttf portion . \n thus , one electron oxidation of this \n radical nn - ttf removed an electron from the homo \n on the ttf portion and produced a triplet cation biradical , nn - ttf . \n this was confirmed \n from the measured oxidation potential of nn - ttf , \n which was similar to that of ttf and not of nn . \n using ab initio and dft calculations and experiment , coote and co - workers recently showed ph - induced somo \n homo energy level conversion \n in deprotonated dna / rna base radicals were also proposed by these \n authors . \n one - electron oxidized \n dna bases [ adenine ( a ) , guanine ( g ) , thymine \n ( t ) , and cytosine ( c ) ] and base pairs ( a - t and g - c ) produced by ionizing \n radiation have been extensively investigated by electron spin resonance \n ( esr ) and pulse radiolysis experiments and theory . both theory and experiment predicted that g and a have lower ionization \n potentials ( ip ) than thymine and cytosine and are therefore the most \n easily oxidized sites in dna . on one - electron oxidation , all molecules , including dna bases , become \n far more acidic in nature than their neutral state . the guanine radical cation ( g ) \n deprotonates \n to solvent from its n1h site in nucleosides ( pka = 3.9 ) as well \n as in single - stranded dna . \n but in the g - c base \n pair , g partially transfers its n1h \n proton to the n3 site of cytosine , forming proton transferred \n g(-h)-c(h ) ( see scheme 1 ) . \n similarly , a deprotonates from its n6h site to solvent , and \n in an a - t base pair , it can transfer its n6 proton to o4 of thymine forming a(-h)-t(h ) ( see scheme 1 ) . these proton transfer ( pt ) reactions in one - electron \n oxidized dna \n bases and base pairs control their electronic configuration and thus \n play an important role in determining their radical stability and \n reactivity . in this work , \n we provide the first report of the proton - induced \n switching of the somo and homo energy levels in one - electron oxidized \n a - t and g - c base pairs ( a - t and g - c ) , using three different density functional methods . \n pink circle shows the location \n of the proton ( h ) in the base pair . \n the ground state structures \n of a - t and g - c base pairs in their \n neutral , one - electron oxidized , and proton - transferred state are fully \n optimized using the b97x , b3lyp , and m06 - 2x density \n functionals and the 6 - 31++g(d ) basis set as implemented in gaussian \n 09 . to mimic the effect of deoxyribose \n ( sugar ) , \n a methyl ( ch3 ) group was attached at n9 of g and a and at n1 of c and t. in addition , a full \n sugar deoxyribose diphosphate was also considered . \n the present study \n clearly demonstrates that the electronic configuration of the one - electron \n oxidized a - t and g - c base pairs do not follow the aufbau principle \n ( see figures 13 and figures s1s29 in the supporting \n information ) . \n the somo of an a - t base pair \n localized on a lies below the doubly occupied homo which localizes \n on t ( see scheme 1a ) . in the case of g - c \n , somo is localized on g and lies below the doubly \n occupied homo which localizes on c ( see scheme 1b ) . \n these dft - based observations were further supported by the ab \n initio mp2/6 - 31++g(d ) calculations of a - t and \n g - c base pairs and casscf(11,11 ) calculations \n for a - t ( see the supporting \n information ) . \n b97x/6 - 31++g(d ) calculated spin \n density \n distribution and electronic configuration ( and mos \n distribution ) of a - t and proton transferred a(-h)-t(h ) . \n see the supporting information for details and b3lyp , \n m06 - 2x , and mp2 results . \n proton transfer from a to t and g to c restores the expected orbital ordering in which \n the somo lies \n highest in energy . \n this proton transfer induced reordering of the \n somo is important to redox processes in dna as it directs the second \n electron loss from a base pair away from t and c and to the deprotonated \n g or a radicals . \n the effect of full solvation on the electronic configuration \n of a - t and g - c was also considered \n using pcm-b97x/6 - 31++g(d ) method and show \n the same homo \n the theoretical ips of bases and base pairs \n are well - studied and \n have been reviewed in several recent reviews . in this work , \n we assess the reliability of three density functionals used in the \n present study of base pairs by calculating the vertical and adiabatic \n ionization potentials ( ip and ip ) of \n a , t , g , and c for which the gas - phase experimental ips are available \n in the literature . \n the calculated ips along with \n the experimental values are presented in table 1 . from table 1 \n , it is evident that b97x \n and m06 - 2x calculated ip values of bases are very close to the experimental \n values having a maximum difference of ca . 0.1 ev , while b3lyp - calculated \n ip values have a maximum difference of ca . \n we note that ch3 substitution at n9 of a and g and at n1 of c and t lowers the ips of the dna bases ( see table 1 ) . also , in comparison to the b3lyp which severely suffers \n from self - interaction errors ( sie ) , b97x and m06 - 2x mitigate \n sie and provide improved orbital descriptions of ionized states . \n we present b97x/6 - 31++g(d ) results here \n and b3lyp and m06 - 2x results in the supporting \n information . \n ip calculated with \n respect to neutral g - c and a - t base pairs . \n ip ( a ) = 8.35 ev . ( 5-g-3)(3-c-5 ) \n and ( 5-a-3)(3-t-5 ) . see figures \n s23s28 in the supporting information . the electronic configuration \n ( orbital distribution ) of neutral \n a - t base pair calculated by the b97x , b3lyp , and \n m06 - 2x methods \n are shown in figures s1s3 , and a pcm ( polarized continuum \n model ) using b97x is shown in figure s22 in the supporting information . \n as expected , all the \n methods predict homo as in nature and localizing on a in the \n a - t base pair . \n this preliminary inspection of the electronic configuration \n of the a - t base pair clearly shows that the initial oxidation will \n take place from the homo localizing on a. this is also supported by \n the experiment as a has a lower reduction potential than t. the calculated ip of the a - t \n base pair by b97x , b3lyp , and m06 - 2x methods are 7.99 , 7.58 , \n and 8.08 ev , while the corresponding ip are 7.62 , 7.43 , \n and 7.72 ev , respectively ( see table 1 ) . \n the \n b97x/6 - 31++g(d ) calculated ip ( 7.99 ev ) is in excellent agreement ( 8.01 ev ) with those calculated \n by krylov and co - workers using the eom - ip - ccsd/6 - 311+g(d , p ) \n method ( see table 1 ) . \n the spin density distribution \n and electronic configuration of a - t and proton \n transferred a(-h)-t(h ) is shown in \n figure 1 and in figures s1s3 in the supporting information . \n the methods b97x , \n b3lyp , and m06 - 2x predict that a - t is more stable \n than a(-h)-t(h ) by 4.15 , 4.44 , and \n 1.98 kcal / mol , respectively ( see figure s7 in the supporting information ) . from the electronic configuration \n , \n we see that the somo which is localized on a in a - t lies below the homo localizing on t , in violation of the aufbau \n principle , see figure 1 and figures s1s3 \n and mp2 calculated electronic configuration in figure s29 in the supporting information . \n the electronic \n configuration of a - t clearly \n predicts that further ionization will take place from t not from a , \n and this is confirmed from the calculated ip of a ( figure s11 in the supporting information ) . \n the calculated ip of a by b97x , \n b3lyp , and m06 - 2x are 13.51 , 13.39 , and 13.50 ev , respectively , and \n the corresponding ip of a are 13.08 , \n 13.06 , and 13.10 ev , respectively , which are much larger than the \n ip of thymine , ca . 9 ev ( see table 1 and figure \n s11 in the supporting information ) . as \n mentioned above , the ionized a - t ( a - t ) \n becomes \n far more acidic in nature and the pka of \n a was predicted to be ca . \n thus , a in \n the base pair can transfer its n6 proton to o4 of thymine . \n although it is energetically uphill in our work , a recent \n qm / mm simulation by conwell and co - workers suggests proton transfer is likely . \n the electronic configuration \n of a(-h)-t(h ) ( figure 1 ) shows that upon proton transfer the somo which is localized \n on a(-h ) is highest in energy and lying above the \n highest doubly occupied molecular orbital ( hdmo ) localized on o4-protonated t [ t(h ) ] . \n the electronic configuration \n of a(-h)-t(h ) thus shows that further \n ionization will occur from a(-h ) . \n the calculated \n ip(ip ) of a(-h ) by \n b97x , b3lyp , and m06 - 2x are 8.81(8.39 ) , 8.54(8.27 ) , and 8.73(8.32 ) \n ev , respectively , and the calculated ip and ip of t(h ) by b97x , b3lyp , and m06 - 2x \n lie in the range of 13.2813.71 ev , respectively ( see figures \n s10 and s13 in the supporting information ) . \n the electronic configuration of the neutral g - c base pair \n is shown \n in the supporting information in figures \n s4s6 and in figure s21 using pcm ( b97x ) . in the g - c \n base pair \n , the homo is localized on guanine , while the lowest unoccupied \n molecular orbital ( lumo ) localizes on cytosine ; these are \n in nature . \n thus , the electronic configuration of the g - c base pair \n depicts that ionization will take place on guanine . \n the b97x , \n b3lyp , and m06 - 2x calculated ip of the g - c base pair \n are 7.24 , 7.06 , and 7.33 ev , respectively , and the corresponding ip are 6.81 , 6.72 , and 6.91 ev , respectively . the ip of the \n g - c base pair is lower than the a - t base pair , and it is well - known \n that guanine is the prime site for hole localization in dna . from the electronic configuration of g - c , shown \n in figure 2 , we see that somo localized on \n guanine is no longer the highest energy orbital and lies below the \n doubly occupied homo localized on cytosine . \n this is also supported \n by mp2 calculations presented in figure s29 in the supporting information . \n thus , in g - c , \n cytosine is available for the oxidation . the calculated ip and ip of g ( figure s18 in the supporting information ) lie in the range of 12.6213.11 \n ev , which is larger than the ip ( ca . \n steenken estimated \n the pka of one - electron oxidized deoxyguanosine \n ( dg ) as 3.9 and proposed that a facile pt can \n take place from n1 of g to n3 of c in a g - c base pair , which has been confirmed by esr experiments \n and dft calculations . \n from the present calculation , g - c was found \n to be more stable than the proton transferred g(-h)-c(h ) by 1.06 , 0.91 , and 1.23 kcal / mol using the b97x , \n b3lyp , and m06 - 2x calculations ( see figure s14 in the supporting information ) . \n we note that surrounding \n solvation plays an important role in the stability of g - c and g(-h)-c(h ) , and other work \n shows that the inclusion of the first hydration layer around these \n structures make g(-h)-c(h ) more stable \n ( ca . \n b97x/6 - 31++g(d ) calculated spin density \n distribution and electronic configuration ( and mos \n distribution ) of g - c and proton transferred g(-h)-c(h ) . \n see the supporting information for details and b3lyp , m06 - 2x , and \n mp2 results . from the electronic configuration \n of proton \n transferred g(-h)-c(h ) ( shown \n in figure 2 ) , it is evident that the somo localizing \n on g(-h ) is highest in energy and the hdmo localized \n on cytosine lies below \n the somo . \n thus , in g(-h)-c(h ) , the \n oxidation takes place from g(-h ) , which is confirmed \n from the calculated ip of g(-h ) ( figure s17 in \n the supporting information ) . the calculated \n ips of g(-h ) \n are in the range of 8.118.56 \n ev , while the ips of c(h ) lie in the range of 13.3613.74 \n ev ( see figures s17 and s20 in the supporting \n information ) . \n the electronic configuration of species \n formed by one - electron \n oxidation of a - t , a(-h)-t(h ) , g - c , and g(-h)-c(h ) , based on b97x/6 - 31++g(d ) calculations , \n are shown in figure 3 . \n one - electron oxidation of a - t yields a - t , which is found to be the most \n stable in the triplet state . \n thus , in \n the triplet state , both a and t are oxidized to the diradical dication \n form ( a - t ) with one electron \n spin localized on each base ( figure 3 ) . \n the \n calculated ip of a - t by b97x , \n b3lyp , and m06 - 2x methods are 11.12 , 10.91 , and 11.23 ev , respectively , \n and the corresponding ip are 10.72 , 10.69 , and 10.81 \n ev , respectively ( see table 1).figure 3b97x/6 - 31++g(d ) based electronic configuration \n of one - electron oxidized a - t , a(-h)-t(h ) , \n spin - density distributions are shown for radicals , \n and mo plots are shown for the singlet state . \n b97x/6 - 31++g(d ) based electronic configuration \n of one - electron oxidized a - t , a(-h)-t(h ) , \n spin - density distributions are shown for radicals , \n and mo plots are shown for the singlet state . \n our calculation predicts that one - electron oxidation \n of proton - transferred \n a(-h)-t(h ) removes an electron from \n a and yields , a(-h)-t(h ) . \n the singlet state \n of this species [ a(-h)-t(h ) ] is found to be \n more stable than its triplet form . \n the homo in the singlet state lies \n on t(h ) ( see figure 3 ) . \n the calculated \n ip of a(-h)-t(h ) by \n b97x and m06 - 2x are 11.50 and 11.41 ev , respectively . \n most \n importantly , we note that the a - t ( triplet state ) is more stable than the a(-h)-t(h ) ( singlet state ) by ca . \n also , the ip of a - t in the triplet state is lower \n than a(-h)-t(h ) in the singlet state , thus , \n the present calculations show that on double oxidation both a and \n t will be oxidized in the a - t base pair . \n recently , peluso and co - workers measured the oxidation potential of a single \n strand 5-ttaatt-3 sequence and measured two \n peaks centered at 0.97 and 1.35 v. the first anodic peak ( 0.97 v ) \n was assigned to the oxidation of two stacked adenines , and the second \n peak ( 1.35 v ) was assigned to the two stacked thymines . \n one - electron \n oxidation of g - c produces the \n triplet diradical ( g - c ) , and \n one - electron oxidation of proton transferred g(-h)-c(h ) produces singlet g(-h)-c(h ) , the latter species is the most stable structure overall ( see figure 3 and figure s15 in the supporting \n information ) . \n the somo in triplet g - c places an unpaired electron on both g and c ( figure 3 ) . \n calculations using b97x/6 - 31++g(d ) predict singlet g(-h)-c(h ) to \n be more stable than the triplet diradical g - c by ca . \n 11 kcal / mol ( figure s15 in the supporting information ) . the b97x/6 - 31++g(d ) \n calculated ip of g - c in \n the triplet state is 11.67 ev ( ip ) and 11.26 ev ( ip ) , and the ip of g(-h)-c(h ) in the singlet state is 11.26 ev ( ip ) and 10.76 \n ev ( ip ) . \n thus , in a g - c base pair , the sequential two - electron \n oxidation will occur only on guanine . \n the second ionization \n of a - t and g - c base pairs lies in the range \n of 10.7212.67 ev ( table 1 ) , which is \n close to the ionization potential of phosphate ( ca . , 1112 \n ev ) , thus in dna , phosphate may be the \n prime site for a second oxidation . to test this possibility , we calculated \n the first and second ionization potentials ( table 1 last column ) and electronic configurations of double stranded \n ( 5-g-3)(3-c-5 ) and ( 5-a-3)(3-t-5 ) \n using the b97x/6 - 31g(d ) method . \n the calculations \n clearly show that the second oxidation occurs only on the bases and \n not on the phosphate in dna ( see mos in figures s23s28 in \n the supporting information ) . \n also , from \n table 1 , it is evident that the ips of bases \n in the dna decrease substantially in comparison to the ips of isolated \n bases and base pairs . \n the energy differences \n between the protonated and anionic system with counterions in an aqueous \n media is relatively small . \n thus , only \n a modest change in base ionization potential is expected on phosphate \n protonation , but protonation will have a greater effect on the phosphate \n ips . \n in conclusion , we find that pt in one - electron \n oxidized dna base \n pairs plays an important role in altering the ips of individual bases \n in the base pair , induces homo somo level switching , and thus \n directs multiple ionizations to a single base g or a. for the a \n t \n base pair , we find pt is not favored within a - t \n and the homo lies on t so that the second ionization oxidizes both \n a and t forming triplet a - t , which is more stable than the singlet a(-h)-t(h ) . for the g - c base pair , pt is favored within g - c forming g(-h)-(h)c , thus g(-h ) becomes available for further oxidation resulting \n in doubly oxidized g. pt reactions in one - electron oxidized dna base \n pairs are an expected phenomenon . \n since one electron - oxidation of \n a base makes it more acidic , oxidation induces a shift in the prototropic \n equilibrium between the two bases as proposed by steenken . \n homo \n level inversion in the one - electron oxidized a - t and g - c base pair \n as observed for distonic anion radicals after protonation from the \n solvent . \n high - energy radiation often produces two \n one electron ionizations within a short - range . \n two - electron oxidation at sites within dna were proposed earlier \n by bernhard to account for products formed in nonradical processes . \n the present work shows that the a - t base pair and g - c base pair \n would respond differently to double oxidation . in a doubly oxidized \n g - c \n , the double oxidation would reside only on g ( in the singlet state ) , \n whereas in a doubly oxidized a - t , the oxidations would be shared between \n a and t in the triplet state . \n subsequent rapid hole transfers and \n deprotonation processes in dna then lead to the most stable double - oxidized \n g. finally , we note that since spectroscopic studies of gas phase \n base pairs are now well - established , tests \n of predictions made in this work are quite feasible .", "role": "user" }, { "content": "in the present study , \n we show that for one - electron oxidized a - t \n or g - c base pairs the singly occupied molecular orbital ( somo ) is \n located on a or g and is lower in energy than the doubly occupied \n highest - occupied molecular orbital ( homo ) localized to the pyrimidines , \n t or c. this directs second ionizations to the pyrimidine bases resulting \n in triplet state diradical dications , ( a+-t+ ) and ( g+-c+ ) . on interbase proton transfer , \n the somo and homo levels switch \n and the second oxidation is redirected to g and a. for g - c , the doubly \n oxidized singlet g(-h)+-c(h+ ) is more stable \n than its triplet ( g+-c+ ) ; however , \n for a - t , the triplet ( a+-t+ ) \n lies lowest in energy . \n the study demonstrates that double ionization \n of the a - t base pair results in a triplet dication diradical , which \n is more stable than the proton - transferred triplet or singlet species ; \n whereas , double ionization of the g - c base pair , the proton transferred \n doubly oxidized singlet , g(-h)+-c(h+ ) , is more \n stable and has both oxidations on guanine . in dna , with both a - t and g - c , multiple oxidations would transfer \n to the guanine base alone .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cervical cancer is considered preventable , as the premalignant stages can be detected by exfoliative cytology like a papanicolaou ( pap ) smear examination . nowadays , \n cytology along with human papilloma virus ( hpv ) testing is being assessed as a screening test for cervical cancer in the developed countries . \n similar to other dna viruses ( e.g. , adenovirus , hepatitis b virus , etc . ) , hpv is detected by dna testing with polymerase chain reaction ( pcr ) or hybrid capture ( hc ) . \n however , in the setting of a developing country the pap test is useful as a screening modality , which is ultimately geared toward the reduction of cervical cancer related mortality by the earlier detection of premalignant lesions . \n cervical epithelial cell abnormalities in the pap smear represent a spectrum of intraepithelial lesions that lie along the pathway , from mild - to - severe dyskaryosis to invasive cancer . \n the significance as well as consequence of cervical cytology with atypia or dyskaryosis has been extensively studied . according to the 2001 bethesda system for reporting cervical cytological diagnoses , epithelial cell abnormalities \n the category of atypical squamous cells ( asc ) includes asc - us ( asc of undetermined significance ) and asc - h ( asc , can not exclude high grade squamous intraepithelial lesions ) . \n the positive predictive value for hsil ( high - grade squamous intraepithelial lesion ) in asc - h is higher than in asc - us , but not as high as in the category of hsil . \n the generic term squamous intraepithelial lesion ( sil ) is subdivided into lesions showing perinuclear halo and mild dyskaryosis , termed as low - grade squamous intraepithelial lesion ( lsil ) and lesions showing moderate - to - severe dyskaryosis and carcinoma in situ , termed as hsil . \n smears showing no epithelial abnormalities are depicted under the category of negative for intraepithelial lesion or malignancy ( nilm ) , in the revised bethesda system . \n screening with pap smear has been seen to be accompanied by a dramatic reduction in the incidence of invasive cervical cancer in different countries of the world . to date two types of pap tests \n are in use : conventional and liquid - based cytology . even as the liquid - based test is popular in the developed countries , in low resource settings , a conventional pap test is the mainstay screening system . \n various studies reveal that a majority of the cervical cancer mortality of the world comes from developing countries.[79 ] this may be attributed to the absence of an efficient cervical cancer screening system . \n therefore , it is important to know the overall scenario of epithelial cell abnormality in the pap smear , in a developing country like bangladesh . \n again , in order to counsel women and to organize a public health system for cervical cancer screening by pap smear examination , it is imperative to know the pattern of premalignant and malignant lesions . standardization of the pap smear reporting by the use of the revised bethesda system has unified various overlapping terminologies and has included specific statements regarding specimen adequacy , general categorization , interpretation , and results . \n hence , we have undertaken the present study using the revised bethesda system , with the intention of finding out the prevalence of epithelial cell abnormality in the pap smear of women visiting the gynae outpatient department ( gopd ) of a tertiary hospital in bangladesh , and to carry out a clinicopathological and demographical analysis , to establish the pattern of epithelial cell abnormality in the pap smear among the women visiting the hospital . \n a cross - sectional descriptive study was carried out in the department of pathology , chittagong medical college , chittagong , bangladesh , from the months of february to september , 2010 . after taking a history ( regarding parity , menstrual history , and duration of married life ) and recording the findings ( healthy or unhealthy ) of per vaginal examination of the patients , the pap smear was collected with the help of a wooden ayer spatula . \n specimen adequacy as well as reporting was assessed according to the revised 2001 bethesda system . \n all patients with epithelial cell abnormalities were referred for colposcopy according to the standard procedure and recommendations . \n among the 1699 pap smears submitted , 139 ( 8.18% ) revealed cervical epithelial cell abnormality [ table 1 ] . \n the age of the patients with an abnormal pap smear was between 21 and 70 years , with the mean age being 41.97 years . \n altogether 26 pap smears revealed high grade lesions and malignancy , most of which were found to be in women who belonged to the 30 39 and 45 year age group . \n a total of 75 ( 53.96% ) women were in the 20 44 year age group and 64 ( 46.04% ) were in the 45 year age group [ table 2 ] . \n the mean parity was 4.34 and the parity of a majority ( 45.32% ) of patients was 5 [ table 3 ] . \n percentage of different categories of cervical cytological diagnoses in pap smear pattern of cervical epithelial cell abnormalities in a total of 139 positive pap smears ( february september , 2010 ) : lsil 108(77.7% ) ; hsil 20(14.39% ) ; asc - us 3(2.15% ) ; agc 2(1.44% ) number of patients with epithelial cell abnormality in pap smear in different age groups number of parity among the patients with abnormal pap smear in the per vaginal examination , the cervix was taken as unhealthy when it revealed the presence of any of the following features , alone or in any combination : broadening of cervix , hypertrophy , ulceration , erosion , growth , nabothian cyst , tear , and increased vascularity . \n a cervix that was smooth , pink , tubular , with a centrally placed external os was considered healthy . \n approximately one - third of the patients with an abnormal pap smear result had a healthy cervix . in the context of a country like bangladesh where premarital sex is forbidden , age at first marriage \n the present study demonstrated that the average age at first marriage was around 16 [ table 4 ] . \n to date there are no published data from bangladesh concerning the pattern of epithelial cell abnormality in pap smear . in this study , we have applied the revised bethesda system , which will obviously , to some extent , provide an idea about the overall picture of the epithelial cell abnormality in the pap smear cytology of a developing country . \n various studies on the prevalence of cervical epithelial cell abnormality in the pap smear revealed 4.3% in a tertiary hospital in kuwait , 5% in a large referral hospital in saudi arabia , 0.95% in jewish israeli women , 1.66% in the western region of saudi arabia , and 7.9% in south - western saudi arabia . \n however , unlike the previous studies , our study showed a raised prevalence ( 8.18% ) . this may be explained by the fact that these patients did not visit the tertiary health institute for cancer screening purpose , but rather with specific gynecological complaints , such as , something coming down per vaginum , mass descending per vaginum , lower abdominal pain , and abnormal vaginal bleeding or discharge . \n it is notable that they had come to visit the hospital when the dyskaryotic changes in the cervical epithelium had already occurred . \n all these patients were married and most of them were multipara , the mean parity being 4.34 . \n edelman et al , studied pap smears from 29295 females over a period of one year and the pap smear abnormalities were as follows : 9.9% asc - us , 2.5% lsil , 0.6% hsil , and 0.2% invasive cancer . \n they also showed that adolescents with an age range of 13 22 years had a significantly higher rate of lsil . \n another study in brazil , where 1822 441 pap smears were examined over a period of five years , showed that low - grade lesions were common among women in the age group of 15 30 years , while high - grade lesions were frequently encountered among women in the age group of 25 45 years . \n patients older than 40 years had the greatest incidence of invasive cancer . in comparison to the previous studies our study revealed the following scenario : 0.18% asc - us , 0.12% atypical glandular cells ( agc ) , 6.36% lsil , 1.18% hsil , and 0.35% malignancy . the most frequent finding in our study was lsil . \n age incidence for low - grade lesions was in the reproductive age , with a peak in the 35 39 year age range . \n one of the significant discrepancies between our study and the previously published data from other countries is the lower rate of asc - us and higher rate of lsil . \n we assume that as the women included in our study were never routinely screened and / or re - screened , they presented with an advanced / definitive form of cytological interpretation in the cervical smear , and thus , lsil rate was higher . following the revised bethesda system we designated those smears as asc - us , which showed borderline changes that fell short of a definitive sil interpretation , that is , the smears that were only suggestive of lsil or sil of indeterminate grade , were diagnosed as asc - us . the overall insubstantial pap smear screening scenario along with a drop out of some cases to private clinics could be a possible explanation for the significant variation in the percentage of asc - us and lsil from other studies of the world . \n again , it was speculated that many of the asc - us cases remained unattended , and if there was a regular , well - organized pap smear screening system it was not unlikely that the asc - us rate would have been higher . \n in addition , the criteria for asc - us might differ subtly among laboratories due to technical differences in the slide preparation , as described in the revised bethesda system . \n high - grade lesions were more common in women of 45 and 35 39 year age groups . \n briefly , a bimodal age distribution was detected in the epithelial cell abnormality with the bulk being diagnosed in the 45 year age group . \n the present study also showed a wide age range ( 21 70 years ) . \n previous studies indicate that the most common age to develop carcinoma cervix is between 40 and 50 years and the precursor lesions occur 5 10 years prior to developing invasive cancer . \n it is interesting to note that 46.04% of the patients included in our study are in the 45 year age group , and are in the peri-/postmenopausal age . \n both low- and high - grade lesions of the cervix were more commonly seen in these patients than in any other age group . \n this finding can be explained by the fact derived from previous studies that older age groups are among the under users of pap screening . in the perspective of a developing country like bangladesh \n , the reasons may be illiteracy , lack of awareness about cancer screening , and expenditure of the test . besides , unavailability of cytological screening in the rural and suburban areas adds to the problem . \n the average life expectancy of people has increased and therefore if the low - grade cervical lesions persist and progress , then there is every chance that these women are at risk of developing higher grade lesions in the future . \n again it is documented that the rate of progression of most lesions destined to become invasive cancer is generally considered to be slow , and one might therefore anticipate that a negative history before the age of 50 would considerably reduce the risk of positive cytology or histology in women of age 50 64 years , which is considered the upper age range in developed countries . \n our findings call attention to the need for cytological screening in this older age group of patients and the need to create awareness about cervical cancer for motivating them to attend screening \n . a total of 45 patients with abnormal pap results had a healthy - looking cervix . \n it is interesting to note that while 39 of these patients showed lsil , four showed hsil , and two showed malignancies in the pap smear . \n this signifies that cervical cancer screening , based only on clinical impression and visual examination , is quite unpredictable in relation to cytological screening . \n this also connotes the value of universal cervical cancer screening , irrespective of an unhealthy or healthy looking cervix . in a large randomized controlled trial in india , visual inspection with acetic acid ( via ) \n via may be the only screening approach applicable in many low - resource settings like ours . \n nevertheless , the poor performance of this test due to non - visualization of the squamocoloumnar junction in the older age group indicates that it should be used in screening of women before they are of an age when the retreat of the transformation zone into the endocervix renders it invisible to the visual method . \n it is to be noted that all the patients included in our study had never undergone pap smear screening for cervical cancer . \n this shows that ever - increasing participation in the screening program must be given priority , to decrease the incidence of cervical premalignant and malignant lesions . \n routine screening in bangladesh is not well - developed and there are no clear cut national health policies for a cervical cancer screening program by pap smear cytology . \n there is little awareness among the general population , healthcare professionals , and policy makers about cervical cancer prevention by pap smear cytology . \n environmental disasters such as floods , hurricanes , along with other causes of death such as diarrheal diseases , respiratory tract infections , and high maternal mortality concern national policy makers more than the deaths caused by cervical cancer . therefore , failure of pap test - based cervical cancer screening in preventing otherwise preventable deaths may be attributed to lack of proper national healthcare policy , limited access to healthcare centers by a major subset of the population , failure of the eligible women to come for screening with follow - up , and last but not the least lack of patient compliance . \n most of the patients included in our study were married when they were in their teens . \n these patients had increased risk of hpv as there was a biological predisposition of the immature cervix of the adolescent to persistent hpv infection , which augmented the risk of cancer development . therefore , family planning , sexual education , and hpv vaccination should be targeted toward this early age group . \n however , information provided in this study will in addition encourage further utilization of pap smear as a screening method for cervical cancer in peri- / postmenopausal women . \n from this study it is evident that unlike in the developed countries , pap smear cytology - based screening is not well - organized enough in bangladesh . \n the pap test is done as a part of investigations related to the management of these patients . \n therefore , facilities for cytological screening should be extended up to the primary health care level . if possible hpv testing should be included too . \n all the women who were reported as lsil / hsil in our study were counseled and advised for colposcopic biopsy and histopathology . \n regrettably , so far , only a very small percentage ( 34.5% ) has undergone biopsy and histopathology . \n ours is a hospital - based study and an advanced study under a well - organized screening system , with a large number of cases , is in demand , to reveal the exact statistics of premalignant and malignant cervical lesions , in bangladesh . \n the present study highlights that women of age 45 years or above harbor the bulk of premalignant and malignant lesions in pap smears . \n \n all authors of this article declare that we qualify for authorship as defined by icmje http://www.icmje.org/#author each author has participated sufficiently in the work and take public responsibility for appropriate portions of the content of this article . \n this study was conducted with approval from institutional review board ( irb ) ( or its equivalent ) of all the institutions associated with this study as applicable . \n to ensure integrity and highest quality of cytojournal publications , the review process of this manuscript was conducted under a double blind model(authors are blinded for reviewers and reviewers are blinded for authors)through automatic online system .", "role": "user" }, { "content": "background : in the low resource settings of a developing country , a conventional papanicolaou ( pap ) test is the mainstay screening system for cervical cancer . in order to counsel women and to organize a public health system for cervical cancer screening by pap smear examination , it is imperative to know the pattern of premalignant and malignant lesions . this study was undertaken to find out the prevalence of an abnormal pap smear , in a tertiary hospital of a developing country , and to carry out a clinicopathological and demographical analysis for establishing the pattern of epithelial cell abnormality in a pap smear.materials and methods : a cross - sectional descriptive study was carried out in a total of 1699 patients who underwent pap smear examination . \n the prevalence of epithelial cell abnormality in the pap smear was calculated in proportions / percentages . \n specimen adequacy and reporting was assessed according to the revised bethesda system.results:among the total of 1699 patients who had their pap smear done , 139 ( 8.18% ) revealed epithelial cell abnormality . altogether \n 26 smears revealed high - grade lesions and malignancy , most of which were found to be in women belonging to the 30 39 and 45 age group . \n a total of 75 ( 53.96% ) women were in the 20 44 age group and 64 ( 46.04% ) were in the 45 age group . \n a bimodal age distribution was detected in the epithelial cell abnormality , with the bulk being diagnosed in patients aged 45 or above . \n overall one - third of the patients with an abnormal pap smear result showed healthy cervix in per vaginal examination.conclusions:a raised prevalence of epithelial cell abnormality reflects the lack of awareness about cervical cancer screening . \n women aged 45 or above harbor the bulk of premalignant and malignant lesions in the pap smear , signifying that these women are among the under users of cytological screening .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: rufinamide ( 1-[(2,6-difluorophenyl)methyl]-1hydro-1,2,3-triazole-4 carboxamide ) is a novel antiepileptic drug ( aed ) that is structurally distinct from other aeds available on the market ( levy et al 2002a ) . \n an application was filed by eisai ltd in 2005 for european approval of this agent as an adjunctive treatment for seizures associated with lennox - gastaut syndrome ( lgs ) in children and adults ( eisai co ltd 2005 ) . \n lennox - gastaut syndrome is a catastrophic epileptic encephalopathy of childhood onset ( typically at age 35 years ) , for which effective treatment options are limited . \n this syndrome is associated with multiple types of generalized seizures , especially drop attacks and tonic seizures , delayed psychomotor development , behavioral and personality disorders , and a characteristic electroencephalogram pattern containing both generalized slow spike wave activity and paroxysms of generalized fast rhythmic activity during sleep which reflect excessive neocortical excitability ( markand 2003 ; nabbout and dulac 2003 ; guerrini 2006 ) . \n the long - term prognosis is very poor , with persistence of seizures in more than 75% of patients and severe mental retardation in more than 50% of patients ( markand 2003 ; dulac and engel 2003 ; schmidt and bourgeois 2000 ) . \n consequently , lgs is viewed as one of the most difficult epilepsies to treat . currently available treatment options for the epileptic encephalopathies in europe center around the use of valproate , with adjunctive benzodiazepines , topiramate , lamotrigine , or felbamate ( guerrini 2006 ) . however \n , a cochrane review has concluded that no single aed could be considered highly efficacious for lgs ( hancock and cross 2003 ) . \n indeed , the efficacy of valproate as a first - line treatment has been described as unimpressive , and its use in young children should be accompanied by great caution due to the risk of life - threatening hepatic toxicity ( schmidt and bourgeois 2000 ) . \n other first - generation aeds ( carbamazepine , phenytoin , and phenobarbital ) are not recommended for the treatment of lgs , due to the potential for aggravation of absence and myoclonic seizures by carbamazepine and phenytoin , and exacerbation of the behavioral problems seen in patients with lgs by barbiturates . among the benzodiazepines \n , clobazam may be viewed as the best tolerated , although there is no head - to - head comparison to confirm this . however , for this class of drugs , development of tolerance is well documented in the literature ( levy et al 2002b ) . \n the only aeds which have been evaluated in a randomized , controlled trial in lgs are lamotrigine , topiramate , and felbamate , the outcomes of which are discussed later in this paper . \n although felbamate is licenced for the treatment of lgs in the usa and some other countries ( eg , germany ) , its use has been limited following reports of serious toxicity ( borowicz et al 2004 ) . \n this has led to the recommendation that , in lgs , it should be used only in patients aged over 4 years who can not be treated satisfactorily with other aeds ( schmidt and bourgeois 2000 ) . \n thus , there is a clear need for new options in the management of this intractable condition . \n rufinamide was granted orphan drug status by the european medicines agency ( emea ) and the us food and drug administration ( fda ) in 2005 . \n this review will evaluate the relevant pharmacologic and clinical data for rufinamide , and explore its potential role in the future management of this severe form of epilepsy in the context of other products currently available for lgs . \n an extensive preclinical evaluation has suggested that the principal mechanism involved in the antiepileptic activity of rufinamide is its ability to modulate the activity of sodium channels , limiting high - frequency firing of neuronal action potentials over a broad range of concentrations , as demonstrated in vitro ( mclean et al 2005 ) . in radioligand \n binding studies , rufinamide does not interact with other neurotransmitter systems , including monoamine , adenosine , acetylcholine , histamine , glycine , -amino-3-hydroxy-5-methyl-4-isoxazole propionate ( ampa)/kainite , n - methyl - d - aspartate ( nmda ) , and -amino butyric acid ( gaba ) systems ( bialer et al 1996 ) . \n rufinamide has demonstrated broad spectrum anticonvulsant activity in animal models of epilepsy , elevating both electrically and chemically induced seizure thresholds and preventing seizure spread following oral and intraperitoneal administration in mice and rats ( white et al 2005 ) . \n furthermore , the protective index for rufinamide ( ratio of the concentration required for 50% anticonvulsant efficacy to that for neurotoxicity ) was superior to that of each of the comparator aeds examined ( phenytoin , phenobarbital , ethosuximide , and valproate ) . \n the pharmacokinetic properties of rufinamide have been established both in healthy volunteers and in patients with epilepsy . in a study of 3 healthy volunteers , \n an oral dose of 600 mg rufinamide demonstrated high absorption , and monoexponential elimination with a mean half - life ( t ) of 9 hours ( waldmeier et al 1996 ) . \n excretion was largely renal ( 85% ) and complete ( 98% ) within 7 days . \n following administration of 400 mg rufinamide as two 200-mg tablets or 400-mg oral suspension after a standard meal , mean maximum plasma concentrations ( cmax ) of 3.03 and 3.32 g / ml were reached after 6.6 and 7.2 hours , respectively , leading to elimination with a terminal t of 8.8 and 9.1 hours , respectively ( cheung et al 1995 ) . in a further study , \n the absorption of a single dose of 400 mg rufinamide was accelerated in fed subjects compared with fasting conditions , resulting in a 43% increase in exposure ( 96-hour exposure ) , without affecting the t ( cardot et al 1998 ) . \n however , no effect of food was observed with repeat dosing ( eisai , data on file ) , and no difference in rufinamide pharmacokinetics has been found between older ( aged 6677 years ) and younger ( 1840 years ) healthy subjects in either single- or multiple - dosing conditions ( chang et al 1998 ) . \n rufinamide pharmacokinetics in a study of 16 children aged between 2 and 17 years treated with 10 or 30 mg / kg daily rufinamide for 2 weeks were also comparable to those reported elsewhere for adult patients ( sachdeo et al 1998 ) . \n overall , evaluation of these data suggests that no age - related dose adjustments are likely to be required for either pediatric or elderly populations ( bialer et al 2001 ) . \n the pharmacokinetic parameters of single ascending doses of rufinamide ( 0 , 400 , 800 , 1200 mg ) have also been compared between 3 healthy subjects and 16 patients with epilepsy receiving enzyme - inducing aeds ( brunner et al 1994 ) . \n absorption rates were comparable , and both groups showed dose - related increases in cmax and exposure . \n rufinamide elimination was accelerated in aed - treated patients compared with healthy subjects , but t was independent of the dose administered in both groups . \n the pharmacokinetics of rufinamide have also been evaluated in 129 pediatric and adult patients with lgs ( critchley et al 2005 ) . \n rufinamide clearance was not affected by concomitant lamotrigine or topiramate , and was also unaffected by liver or kidney function . \n however , rufinamide concentrations were increased by concomitant valproate : 40% in children and 11% in adults . \n therefore , the rufinamide dosage may require adjustment during the addition or withdrawal of concomitant valproate therapy . \n rufinimade is extensively metabolized ( 2% excreted unchanged in urine and 2% in feces ) , predominantly via hydrolysis of the carboxylamide group to yield an inactive metabolite ( cgp-27292 ) , and is largely excreted in urine ( 84.7% of dose ) ( bialer et al 1999 ) . \n thus , rufinamide has a low propensity for drug drug interactions , based on its low protein binding ( approximately 34% ) and absence of metabolism via hepatic cytochrome p450 or inhibition of the major enzyme subclasses ( bialer et al 1996 ; kapeghian et al 1996 ) . \n this is supported by the absence of clinically relevant alterations of concomitant aed levels observed in a population pharmacokinetic drug \n this analysis was conducted using data from 5 double - blind studies involving pediatric and adult patients with inadequately controlled seizures despite previous treatment with up to 3 aeds . in total \n , 903 patients were receiving carbamazepine , 588 valproate , 200 lamotrigine , 299 phenytoin , 149 phenobarbital , and 69 topiramate . \n rufinamide co - administration did not affect the clearance of topiramate or valproate , but increased the clearance of carbamazepine and lamotrigine and decreased clearance of phenobarbital and phenytoin . \n however , all produced effects were small , were considered unlikely to be of clinical significance , and were independent of age . at a rufinamide plasma concentration of 15 g / ml , representing steady - state concentrations following doses of 45 mg / kg daily in children or 3200 mg / day in adults , changes in clearance \n conversely , in a similar study involving 471 patients , valproate co - administration decreased rufinamide clearance by approximately 22% , while any combination of phenytoin , phenobarbital , or primidone increased rufinamide clearance by approximately 25% , compared with patients not receiving these aeds ( bialer et al 2001 ) . \n rufinamide also resulted in a small increase in clearance of the oral contraceptive ortho - novum ( ortho - mcneil pharmaceutical , inc . \n raritan , nj , usa ) 1/35 in healthy female volunteers , though the clinical relevance of this effect is not known ( svendsen et al 1998 ) . \n the efficacy of rufinamide as an adjunctive therapy for treatment - resistant lgs has been evaluated in a multicenter , randomized , 12-week , double - blind , placebo - controlled , parallel - group study in 138 patients aged 437 years ( mean age 14.1 years ) , followed by an open - label extension phase ( glauser et al 2005a , 2005b ) . \n patients diagnosed with lgs , experiencing 90 seizures in the month prior to study entry , and receiving stable treatment with 13 concomitant aeds , were evaluated . \n after a 28-day baseline , patients randomized to twice - daily oral treatment with rufinamide ( n=74 ) or placebo ( n=64 ) entered a 14-day titration period ( rufinamide target dose 45 mg / kg daily ) , followed by 70 days of double - blind maintenance treatment . \n the reduction from baseline in the frequency of tonic - atonic seizures ( drop attacks ) per 28 days was significantly greater with rufinamide than placebo ( median change 42.5% vs + 1.4% , respectively , p<0.0001 ) . \n similarly , the reduction from baseline in total seizure frequency per 28 days was significantly greater with rufinamide than placebo treatment ( median change 32.7% vs 11.7% , respectively , p=0.0015 ) . \n these improvements were associated with significantly greater proportions of responders ( patients achieving 50% reduction in seizures per 28 days ) with rufinamide than placebo treatment , both for tonic - atonic seizures ( 42.5% vs 16.7% , \n p=0.0020 ) ( glauser et al 2005a ) and total seizure frequency ( 31.1% vs 10.9% , p=0.0045 ) ( kluger et al 2006 ) . \n following completion of the double - blind study , 123 patients continued to receive open - label treatment in the extension phase , at a median dose of 1800 mg / day ( range 1034865 mg / day ) for a median duration of 432 days ( range 101149 days ) ( glauser et al 2005b ) . \n the reduction in median total seizure frequency observed at 12 weeks was maintained , with some further improvement noted with continued treatment for up to 3 years ( see figure 1 ) . \n similarly , the responder rate for total seizures was maintained , with 36.9% of patients achieving a reduction in total seizures of at least 50% overall during the extension study . \n furthermore , 21.3% of patients achieved a 75% reduction in total seizures overall during the extension study . \n during the double - blind study of rufinamide in patients with lgs , the most common adverse events ( reported by 10% patients in either treatment group ) were : somnolence ( 24.3% rufinamide , 12.5% placebo ) , vomiting ( 21.6% rufinamide , 6.3% placebo ) , pyrexia ( 13.5% rufinamide , 17.2% placebo ) , and diarrhea ( 5.4% rufinamide , 10.9% placebo ) ( glauser et al 2005a ) . \n notably , rufinamide treatment was associated with a lower incidence of cognitive / psychiatric adverse events ( such as psychomotor hyperactivity and lethargy ) than placebo treatment ( 17.6% vs 23.4% , respectively ) . \n there was no clinically significant change in clinical laboratory tests , physical examinations or vital signs . during the subsequent open - label extension study , \n the most commonly reported all - causality adverse events were vomiting ( 30.6% ) , pyrexia ( 25.8% ) , upper respiratory tract infection ( 21.8% ) , and somnolence ( 21.0% ) ( glauser et al 2005b ) . \n there were two deaths , which were not considered to be related to rufinamide treatment . \n thus , long - term treatment of patients with lgs does not appear to be associated with any increase in central nervous system ( cns ) adverse events , with somnolence noted with somewhat lower frequency than during the double - blind phase . \n these tolerability and safety data in patients with lgs are further supported by a pooled analysis of rufinamide tolerability and safety in a large population of epilepsy patients , in which the data were evaluated separately for patients receiving short - term or long - term treatment ( krauss et al 2005 ) . \n the short - term safety population comprised 1240 patients treated with rufinamide ( mean age 31.7 years ; mean rufinamide dose 1373 mg / day ; mean duration of treatment 2.8 months ) and 635 placebo recipients ( mean age 28.6 years , mean duration of treatment 3.0 months ) . \n somnolence was reported somewhat less frequently in this population than in the lgs study , with an incidence of 11.8% for rufinamide and 9.1% among placebo recipients . \n the timing of events in this pooled analysis indicated a pattern of early onset and rapid resolution , and a tolerability profile not substantially different from placebo ; the incidence of the most frequently reported adverse events with rufinamide vs placebo were headache ( 22.9% vs 18.9% ) , dizziness ( 15.5% vs 9.4% ) , fatigue ( 13.6% vs 9.0% ) , somnolence ( 11.8% vs 9.1% ) , and nausea ( 11.4% vs 7.6% ) . \n the pooled tolerability and safety analysis included 1978 patients assessed for long - term tolerability and safety ( mean age 31.3 years , mean rufinamide dose 1700 mg / day , maximum dose 7200 mg / day ) , 47% of whom were treated with rufinamide for at least 12 months ; the most frequently reported adverse events in this population were headache ( 29.5% ) , dizziness ( 22.5% ) , and fatigue ( 17.7% ) ( krauss et al 2005 ) . \n few randomized , controlled clinical trials have been conducted in patients with lgs , none of which is a head - to - head comparison . \n consequently , the available treatments for lgs can not be compared directly , and only limited conclusions may be drawn from indirect comparisons . the most robust approaches for indirect comparisons include systematic reviews and meta - analyses , such as those conducted by the cochrane group . a systematic ( cochrane ) review of randomized , controlled trials in lgs ( hancock and cross 2003 ) retrieved only 5 evaluable studies : one each conducted with topiramate , lamotrigine , felbamate , cinromide , and a thyrotropin releasing hormone ( trh ) derivative , respectively ( anonymous 1989 , 1993 ; inanaga et al 1989 ; motte et al 1997 ; sachdeo et al 1999 ) . \n this review concluded that no single agent was found to be highly efficacious in lgs , and that of those evaluated only lamotrigine , topiramate and felbamate were considered potentially efficacious as add - on therapy ( hancock and cross 2003 ) . \n data derived from this cochrane analysis for each of the clinical trials are summarized in table 1 , together with data from the more recently reported rufinamide study ( glauser et al 2005a ) . \n although this provides an indirect comparison , it is of interest to note that rufinamide produced a particularly marked effect in the reduction in drop attacks ( tonic - atonic seizures ) , since this is also the parameter viewed as the primary outcome variable for lgs according to guidelines from the american academy of neurology ( french et al 2004 ) . \n the median reduction in tonic - atonic seizures was 42.5% with rufinamide , which compares well with rates observed in the separate studies with topiramate ( 14.8% reduction ) or lamotrigine ( 34% reduction ) ; the effect of felbamate on drop attacks was not reported . when corrected for the magnitude of placebo response , \n the median effect size for rufinamide on drop attacks was 41.1% , compared with 19.9% for topiramate and 14.8% for lamotrigine . \n similarly , the proportion of patients who could be considered responders to therapy ( achieving at least a 50% decrease in drop attacks ) was 42.5% with rufinamide , 45.6% with topiramate , and 37.3% with lamotrigine , or 25.8% , 25.6% , and 14.8% , respectively , when corrected for placebo response . \n as with drop attacks , the effects of these agents on total seizure frequency produced some interesting findings . \n the rufinamide , topiramate , and lamotrigine studies demonstrated 32.7% , 20.6% , and 32.0% median reductions in total seizures , and treatment effect sizes ( adjusted for placebo ) of 20.0% , 12.6% , and 17.6% , respectively . \n in the felbamate study , outcomes were reported as mean rather than median values , resulting in a 19% mean reduction in total seizures , and a 23% mean effect size . \n the number of patients achieving complete cessation of seizures has only been reported with felbamate , and although these results are favorable , can not be compared with the other aeds in the studies available to date . of course , the overall benefit of treatment comprises a balance between reduction in ( or cessation of ) seizures and tolerability / safety . \n the reported tolerability of treatment was broadly comparable among the studies described in table 1 , with relatively small differences in rates of discontinuations due to adverse events . \n few randomized , controlled clinical trials have been conducted in patients with lgs , none of which is a head - to - head comparison . \n consequently , the available treatments for lgs can not be compared directly , and only limited conclusions may be drawn from indirect comparisons . the most robust approaches for indirect comparisons include systematic reviews and meta - analyses , such as those conducted by the cochrane group . a systematic ( cochrane ) review of randomized , controlled trials in lgs ( hancock and cross 2003 ) retrieved only 5 evaluable studies : one each conducted with topiramate , lamotrigine , felbamate , cinromide , and a thyrotropin releasing hormone ( trh ) derivative , respectively ( anonymous 1989 , 1993 ; inanaga et al 1989 ; motte et al 1997 ; sachdeo et al 1999 ) . \n this review concluded that no single agent was found to be highly efficacious in lgs , and that of those evaluated only lamotrigine , topiramate and felbamate were considered potentially efficacious as add - on therapy ( hancock and cross 2003 ) . \n data derived from this cochrane analysis for each of the clinical trials are summarized in table 1 , together with data from the more recently reported rufinamide study ( glauser et al 2005a ) . \n although this provides an indirect comparison , it is of interest to note that rufinamide produced a particularly marked effect in the reduction in drop attacks ( tonic - atonic seizures ) , since this is also the parameter viewed as the primary outcome variable for lgs according to guidelines from the american academy of neurology ( french et al 2004 ) . \n the median reduction in tonic - atonic seizures was 42.5% with rufinamide , which compares well with rates observed in the separate studies with topiramate ( 14.8% reduction ) or lamotrigine ( 34% reduction ) ; the effect of felbamate on drop attacks was not reported . when corrected for the magnitude of placebo response , \n the median effect size for rufinamide on drop attacks was 41.1% , compared with 19.9% for topiramate and 14.8% for lamotrigine . \n similarly , the proportion of patients who could be considered responders to therapy ( achieving at least a 50% decrease in drop attacks ) was 42.5% with rufinamide , 45.6% with topiramate , and 37.3% with lamotrigine , or 25.8% , 25.6% , and 14.8% , respectively , when corrected for placebo response . \n as with drop attacks , the effects of these agents on total seizure frequency produced some interesting findings . \n the rufinamide , topiramate , and lamotrigine studies demonstrated 32.7% , 20.6% , and 32.0% median reductions in total seizures , and treatment effect sizes ( adjusted for placebo ) of 20.0% , 12.6% , and 17.6% , respectively . \n in the felbamate study , outcomes were reported as mean rather than median values , resulting in a 19% mean reduction in total seizures , and a 23% mean effect size . \n the number of patients achieving complete cessation of seizures has only been reported with felbamate , and although these results are favorable , can not be compared with the other aeds in the studies available to date . of course , the overall benefit of treatment comprises a balance between reduction in ( or cessation of ) seizures and tolerability / safety . \n the reported tolerability of treatment was broadly comparable among the studies described in table 1 , with relatively small differences in rates of discontinuations due to adverse events . \n each of these currently available agents has been associated with warnings relating to severe adverse events . \n the use of felbamate has been restricted in many countries following reports of idiosyncratic aplastic anemia and hepatic failure , which led to its initial withdrawal in the usa , although limited use was granted subsequently ( fda 1994 ) . \n similarly , the efficacy of lamotrigine must be balanced against the risk of serious skin reactions in susceptible individuals , for which boxed warnings or safety alerts have been issued ( committee on safety of medicines 1996 ; fda 1997 ) , while the use of topiramate is associated with warnings relating to oligohydrosis and hyperthermia in children , and also metabolic acidosis and glaucoma ( fda 2003 ; janssen - cilag 2006 ) . \n in addition , factors such as cognitive slowing and weight loss may be issues with the use of topiramate ( levy et al 2002c ) . \n the timing of these warnings , some time after the initial marketing of these aeds , illustrates the difficulties in identifying such events during clinical trials , and that further evaluation is required to confirm the long - term safety of rufinamide in comparison with the marketed drugs . \n indeed , increased qt interval dispersion has been demonstrated in children with epilepsy , potentially predisposing them to serious cardiac events ( akalin et al 2003 ) . \n rufinamide has demonstrated excellent cardiovascular tolerability , with no increase in qt intervals in a cardiac safety study conducted in 15 healthy volunteers treated with placebo or ascending doses of rufinamide ( from 800 to 7200 mg / day ) over 18 days ( marchand et al 2005 ) . on the contrary , \n lgs is a catastrophic and debilitating age - specific epileptic disorder , for which a substantial unmet need exists for highly effective treatment options . \n the data reviewed here indicate that adjunctive therapy with rufinamide , a new aed that is structurally unrelated to other currently available aeds , significantly reduces seizure frequency in patients with lgs , accompanied by good tolerability , both of which are maintained during long - term use . \n in particular , the reduction in drop attacks adds substantially to patient quality of life . \n the efficacy of rufinamide is most likely derived from its ability to block sodium channels , thereby limiting high - frequency action potential firing , a mechanism shared by some other aeds including phenytoin , carbamazepine , lamotrigine , and oxcarbazepine ( mclean et al 2005 ) . \n however , it is commonplace for patients with lgs to remain symptomatic despite optimal therapy , and it is notable that , in the studies reviewed , adjunctive rufinamide treatment was able to exert significant improvement in a treatment - resistant population receiving 13 other aeds at baseline . in an indirect comparison with randomized controlled trials examining other aeds , the results with rufinamide appear impressive : a median reduction in drop attacks of 42.5% with rufinamide , compared with 14.8% with topiramate and 34% for lamotrigine , representing treatment effect sizes , after adjustment for placebo response , of 41.1% , 19.9% , and 14.8% , respectively . \n this was associated with a median reduction in total seizures of 32.7% with rufinamide , compared with 20.6% in the topiramate study and 32% in the lamotrigine study . \n although the full safety data for the rufinamide study in lgs have yet to be reported , data from a pooled safety database suggest a good tolerability profile for both short- and long - term use of rufinamide , with a pattern of early onset and early resolution of events . \n cardiac safety profile , based on a dose - ranging study in healthy volunteers which included qt analysis . \n however , the full spectrum of efficacy as well as the safety profile of rufinamide will become clear with accumulation of long - term clinical experience and usage . \n overall , these findings suggest that rufinamide may be a valuable option for the adjunctive treatment of lgs .", "role": "user" }, { "content": "rufinamide , a triazole derivative that is structurally distinct from currently marketed antiepileptic drugs ( aeds ) , is in development for the adjunctive treatment of lennox - gastaut syndrome ( lgs ) in children and adults . \n rufinamide is well absorbed after oral administration , demonstrates low protein binding , and is metabolized by enzymatic hydrolysis without involvement of cytochrome p450 enzymes , conferring a low drug interaction potential . in a randomized , double - blind trial involving 138 adult and pediatric patients with lgs , compared with placebo , rufinamide 45 mg / kg / day resulted in significantly superior reductions in drop attacks ( median change 42.5% vs + 1.4% with placebo ) and total seizures ( 32.1% vs 11.7% with placebo ) , accompanied by significantly higher responder rates . \n these results are comparable with findings reported for other aeds in randomized , controlled clinical trials in patients with lgs . \n rufinamide produced statistically significant seizure reduction which was maintained during long - term therapy and accompanied by good tolerability . the most frequently reported adverse events from a pooled safety database evaluating short- and long - term therapy were headache ( 22.9% and 29.5% ) , dizziness ( 15.5% and 22.5% ) and fatigue ( 13.6% and 17.7% ) . \n rufinamide therefore presents a favorable efficacy and tolerability profile and is a promising candidate for the adjunctive therapy of lgs .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the superior mesenteric artery syndrome ( smas ) is an uncommon condition in children resulting from vascular compression of the third part of the duodenum between the superior mesenteric artery ( sma ) and the aorta . \n we describe a case of a 7-year - old boy with smas that occurred 3 years after a deloyers procedure for subtotal colonic hirschsprung . \n a 7-year - old boy who had been treated at 3 years of age for a subtotal colonic hirschsprung disease with a deloyers procedure was admitted for persistent bilious vomit associated with recurrent episodes of postprandial abdominal pain and diarrhea . \n the parents reported a progressive weight loss of 3.5 kg during the last 3 years . \n the patient was emaciated with severe chronic malnutrition ; the weight and the length were 15.19 kg and 113 cm [ body mass index ( bmi ) : 11.9 kg / m ] , both between the third and the fifth percentile , respectively . \n a plain abdominal x - ray showed a distended stomach with paucity of gas in the distal bowel . \n an abdominal ultrasound confirmed a dilated duodenum without signs of mechanical obstruction of the small bowel and a normal relationship between the superior mesenteric vessels . \n an upper gastrointestinal contrast study confirmed dilatation of the first and second portions of the duodenum with little progression of contrast medium across the third portion released in left lateral position ( fig . 1 ) . \n an smas was confirmed by a computed tomography ( ct ) scan that showed a reduction in retroperitoneal preduodenal and mesenteric fat and compression of the third duodenum by the superior mesenteric artery with an acute 13 angle and a 7.5 mm distance from the aorta ( fig . 2 ) . \n a gastrointestinal endoscopy confirmed the dilatation of the duodenum with an inflammatory mucosa and a normal jejunum . \n gastric and duodenal biopsies were performed and a nasojejunal tube was guided through the duodenum to the treitz to start enteral feeding ( fig . 3 ) . \n figure 1:the upper gastrointestinal contrast study shows poor progression of contrast medium across duodenal obstruction . \n the duodenal biopsies showed a villous atrophy , crypt hyperplasia and increased intraepithelial lymphocytosis compatible with a celiac disease that was confirmed by an increased serum level of immunoglobulin ( ig)a anti - tissue transglutaminase ( tg2 ; 270 u / ml ; normal value < 4 u / ml ) , and the human leucocyte antigen ( hla)-dq2 genotype at the analysis of hla class ii region . \n after 3 weeks , the patient gained 2 kg tolerating a gluten - free diet in addition to his tube feeding , and he was discharged to go home . at the scheduled 4-week outpatient control , \n he had gained 1.6 kg , the enteral feeding tube was removed and he was allowed to eat a full gluten - free diet . at the 1-year follow - up , the nutritional status had improved significantly with a bmi gain from 11.9 kg / m ( < 5th percentile ) to 16 kg / m ( 56th percentile ) . \n the smas results from vascular compression of the third part of the duodenum due to the reduction in the acute angle and distance between the superior mesenteric artery and the abdominal aorta . several predisposing conditions for smas have been identified , including abdominal surgical procedures and dietary disorders with a significant weight loss [ 13 ] . in our patient \n , the etiology of smas may be related to two causes : the deloyers ' procedure employed for the treatment of total hirschsprung disease , and undiagnosed celiac disease with associated malabsorption and weight loss . \n after a left colectomy extended to the transverse colon and rectum , the right colon is rotated in a craniocaudal and a counter clockwise direction to avoid compression of the terminal ileum , and it is pulled down into the pelvis . similar to surgical procedures of the ileoanal pouch performed in adult patients , the deloyers ' maneuver may cause traction in small bowel mesentery changing the relationship between the vascular structures forming the aortomesenteric angle . \n this anatomical modification may have reduced the aortomesenteric angle making our patient susceptible to smas [ 5 , 6 ] . \n the progressive weight loss related to malabsorption associated with celiac disease may have led to depletion of the retroperitoneal preduodenal and mesenteric fat with a further decrease of the aortomesenteric angle and distance , worsening the duodenal obstruction . \n smas diagnosis was derived from the upper gastrointestinal radiography associated with the ct scan that demonstrated the location of the duodenal obstruction between the aorta and the superior mesenteric artery with an acute aortomesenteric angle and a reduced aortomesenteric distance measuring 13 and 7.5 mm , respectively . in the adult population , the aortomesenteric angle and distance range from 20 to 70 and from 10 to 34 mm , respectively . \n upper gastrointestinal endoscopy , as used in this patient , may be a useful diagnostic and therapeutic tool to rule out associated pathologies that may create a predisposition for the development of smas , and the placement of a jejunal tube to bypass the obstruction is useful to administer hypercaloric enteral feeding avoiding parenteral nutrition . in conclusion , as reported in adults after ileoanal pouch anastomosis , smas should be considered as the cause of upper gastrointestinal obstruction in children treated by a deloyers ' procedure or ileoanal anastomosis . \n close attention must be given during preparation of the mesentery avoiding any possible source of traction and employing , if necessary , the ruses for mesenteric lengthening in adult patients . \n it is always important to follow the clinical course of operated children for they can present symptoms and signs not related to surgery as in this reported case . \n according to the most recent guidelines by espghan on celiac disease , our patient was able to meet the criteria outlined to avoid duodenal biopsy with serum levels of iga anti - tg2 > 10 falling within the normal value with a strong suspected clinical picture originally interpreted as a sequela of the previous surgery . in this patient , we were forced to take a journey back from duodenal biopsies to serology iga anti - tg2 when the clinical findings already led to diagnosis . \n this process that led to severe malnutrition with worsening of smas , to several radiological and invasive procedures and to several hospitalizations could have been avoided . \n only a close medical and surgical follow - up can avoid an underestimation of early clinical signs unrelated to surgery . \n ", "role": "user" }, { "content": "the superior mesenteric artery syndrome ( smas ) is an uncommon condition in children . \n we describe a case of a 7-year - old boy with smas that occurred 3 years after a deloyers ' procedure for subtotal colonic hirschsprung who was admitted for bilious vomit , abdominal pain and diarrhea due to unrecognized celiac disease . \n this case emphasize that smas in children needs a close medical and surgical follow - up to avoid an underestimation of early clinical signs unrelated to surgery .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: gitelman syndrome ( gs ) is characterized by hypokalemic metabolic alkalosis and increased \n plasma aldosterone level and renin activity in combination with hypomagnesemia and low \n urinary calcium excretion , caused by defective tubular reabsorption of magnesium and \n potassium ( 1 , 2 ) . symptoms of gs patients range from asymptomatic , to mild symptoms of cramps and \n fatigue , to severe manifestations such as tetany and paralysis . \n salt craving , polydipsia , \n polyuria , and nocturnal enuresis are also prominent symptoms ( 1,2,3,4 ) . \n gs is usually diagnosed in early \n adulthood during routine laboratory examinations , however there are some reports of children \n with gs ( 4,5,6 ) . \n cramps in a febrile illness , abdominal discomfort or constipation often lead to \n medical attention . \n it is then evident from past history that diffuse muscle pain , muscle \n weakness , and occasional carpopedal spasms are present . \n however , manifestations during \n childhood and adolescence are sometimes underestimated ( 3 , 4 ) . \n gs is caused by genetic mutations of slc12a3 , which encodes the thiazide - sensitive na - cl \n cotransporter ( ncct ) ( 7 ) . \n ncct is selectively \n expressed in the distal convoluted tubule of the renal nephron where it represents the main \n ion cotransporter system . \n human slc12a3 is located on q13 of chromosome 16 and it consists \n of 26 exons . to date , more than 100 mutations of the slc12a3 gene have been reported , and \n these mutations are present throughout the entire gene ( 5,6,7,8,9,10,11,12 ) . in japanese patients with gs , \n several mutations have been identified and one missense mutation ( l623p ) is particularly \n frequent , presumably due to a founder effect ( 5 , 9 , 11 , 12 ) . here , we report the two cases of gs patients . \n clinically , it was noted that these two patients had a past history of \n easy fatigue , occasional muscle pain , weakness , and nocturnal enuresis , however gs had not \n been suspected . \n a 10-yr - old japanese boy was referred to our hospital because of headache and easy \n fatigue . \n he had also suffered from nocturnal enuresis from early \n childhood and had been treated with desmopessin acetate ( ddavp ) at another clinic . at the \n time of the earlier treatment his serum levels of potassium and magnesium were not \n evaluated . on admission , \n his height was 130 cm ( 1.7 sd for normal japanese boy ) and body \n weight was 26 kg . \n laboratory findings are shown in the table \n 1table 1 laboratory findings of patients 1 and 2 . \n the boy was diagnosed as having gs . \n treatment with potassium ( 2.3 mmol / kg / day ) and magnesium ( 0.4 mmol / kg / day ) supplementation \n was begun . \n after this treatment , serum levels of potassium and magnesium remained in the \n subnormal or lower normal range , however the symptoms of muscle weakness , easy fatigue and \n polydipsia have improved considerably . \n nocturnal enuresis was observed four to five times a week , but after \n treatment the frequency was reduced to once or twice a week . \n a 10-yr - old japanese boy was admitted to our hospital because of periodic paralysis of \n the limbs and muscular weakness . \n the boy had a past \n history of occasional muscle cramps during acute febrile illness , polydipsia and nocturnal \n enuresis from early childhood . \n his height was 128 cm ( 1.6 sd ) \n and weight , 26 kg ( 0.7 sd ) . \n hypokalemia and hypomagnesemia , hyperaldostermonism and \n hyperreninemia were accompanied by elevated levels of bicarbonate and a positive base \n excess . \n potassium ( 2 mmol / kg / day ) and magnesium ( 0.4 \n mmol / kg / day ) substitution failed to fully correct hypokalemia and hypomagnesemia . \n however , \n the patient s urine volume decreased to approximately 1000 ml / day and the frequency of his \n nocturnal enuresis is now once a week . \n a 10-yr - old japanese boy was referred to our hospital because of headache and easy \n fatigue . \n he had also suffered from nocturnal enuresis from early \n childhood and had been treated with desmopessin acetate ( ddavp ) at another clinic . at the \n time of the earlier treatment his serum levels of potassium and magnesium were not \n evaluated . on admission , \n his height was 130 cm ( 1.7 sd for normal japanese boy ) and body \n weight was 26 kg . \n laboratory findings are shown in the table \n 1table 1 laboratory findings of patients 1 and 2 . \n the boy was diagnosed as having gs . \n treatment with potassium ( 2.3 mmol / kg / day ) and magnesium ( 0.4 mmol / kg / day ) supplementation \n was begun . \n after this treatment , serum levels of potassium and magnesium remained in the \n subnormal or lower normal range , however the symptoms of muscle weakness , easy fatigue and \n polydipsia have improved considerably . \n nocturnal enuresis was observed four to five times a week , but after \n treatment the frequency was reduced to once or twice a week . \n a 10-yr - old japanese boy was admitted to our hospital because of periodic paralysis of \n the limbs and muscular weakness . \n the boy had a past \n history of occasional muscle cramps during acute febrile illness , polydipsia and nocturnal \n enuresis from early childhood . \n his height was 128 cm ( 1.6 sd ) \n and weight , 26 kg ( 0.7 sd ) . \n hypokalemia and hypomagnesemia , hyperaldostermonism and \n hyperreninemia were accompanied by elevated levels of bicarbonate and a positive base \n excess . \n potassium ( 2 mmol / kg / day ) and magnesium ( 0.4 \n mmol / kg / day ) substitution failed to fully correct hypokalemia and hypomagnesemia . \n however , \n the patient s urine volume decreased to approximately 1000 ml / day and the frequency of his \n nocturnal enuresis is now once a week . \n this study was approved by the institutional review board , and informed consent for dna \n analysis was obtained from both patients parents . \n twenty - six exons of the slc12a3 gene were \n amplified by polymerase - chain - reaction ( pcr ) and these amplified products were subjected to \n direct sequencing by specific primers according to previous reports ( 5 , 8) . \n amplitaq - gold ( perkin - elmer , \n ca , usa ) and its standard buffer were used in all reactions . \n all exons were amplified by pcr \n under the following conditions : initial denaturation at 95c for 7 min , followed by 30 \n cycles at 94c for 1 min , 6265c for 1 min , and 72c for 1 min . \n the amplified products were \n electrophoresed , purified by low melting agarose gel and subsequently sequenced according to \n the manufacturer s protocol on an automated sequencer ( applied biosystems model 373a dna \n sequencer , ca , usa ) . \n ( b ) a heterozygous two \n base ( tt ) deletion ( nucleotide 2543 and 2544 ) was found . \n note that after the deletion \n site , double peaks were shown ( underline ) . ) ; the other mutation was a heterozygous two t base deletion of nucleotides 2543 and \n 2544 in exon 21(2543 - 2544del tt ) ( fig . \n c and t \n nucleotides ( arrows ) were present in the sequence of patient 2 . ) . \n ( b ) a heterozygous two \n base ( tt ) deletion ( nucleotide 2543 and 2544 ) was found . note that after the deletion \n site , double peaks were shown ( underline ) . \n c and t \n nucleotides ( arrows ) were present in the sequence of patient 2 . \n in our two patients , we identified four mutations previously reported in the slc12a3 gene . \n both mutations have been previously \n reported in japanese patients with gs ( 5 , 9 , 11 , 12 ) . \n the 2543 - 2544deltt mutation leads to a premature \n stop codon in exon 21 , thus eliminating the c - terminus of ncct protein . in the second \n patient , g493s and s555l mutations \n both mutations have also been reported in gs \n patients ( 3 , 8) . \n as dna samples from the parents of these two patients were not available , we could not \n determine whether they were compound heterozygotes . \n as mentioned above , patients with gs are usually diagnosed in early adulthood . however , \n there are some reports of children with gs . \n . however , cruz et al . ( 3 ) have described that symptoms of gs , especially fatigue and difficulty to perform \n are often underestimated . \n although our patients had past histories of muscle weakness and \n easy fatigue from early childhood , they had not sought medical attention . \n it has been reported that salt craving is observed in \n approximately 70% of gs patients ( 3 ) . \n accordingly , we \n need to have a better understanding of the variable symptoms that are common to gs to aid \n diagnosis of this disease . another important point of our patients cases was nocturnal enuresis . \n it has been reported that gs patients rate \n polyuria and nocturia as particularly problematic ( 3 ) . \n our two patients had suffered from nocturnal enuresis and one patient was treated with \n ddavp . \n nocturnal enuresis is common in pediatric practice ; thus , the differential diagnosis \n of nocturnal enuresis should include gs . in conclusion , \n variable clinical \n manifestations , which should lead to suspicion of gs , are already present in early \n childhood .", "role": "user" }, { "content": "gitelman syndrome ( gs ) is a renal tubular disorder characterized by hypokalemia , \n hypomagnesemia , metabolic alkalosis and hypocalciuria due to defective tubular \n reabsorption of magnesium and potassium . \n this disease is caused by mutations of the \n thiazide - sensitive na - cl cotransporter ( ncct ) gene , slc12a3 . \n manifestations of gs are \n heterogeneous , from asymptomatic to mild symptoms of cramps and easy fatigue , to tetany \n and paralysis . \n polydipsia , polyuria , and nocturia are also frequent in gs patients . here \n we describe two japanese patients with gs followed as nocturnal enuresis . in the first \n patient , \n occasional muscle cramps , easy fatigue and headache led to the diagnosis of gs . \n the parents of this patient reported that he had been affected by polydipsia and polyuria , \n especially nocturnal enuresis from early childhood . \n the second patient was referred to our \n clinic because of muscular weakness and cramps . \n he had a past history of transient muscle \n weakness and muscle cramps . \n he had also suffered from nocturnal enuresis since 3 yr of \n age . \n laboratory findings of these patients were consistent with those of gs . \n sequencing \n analysis of the slc12a3 gene from two patients showed four mutations , which were \n previously reported . in our two patients , \n their manifestations had been underestimated and \n the correct diagnosis was delayed . \n gs is generally likely to be benign , however signs of \n gs are found in early childhood . \n especially , we must recognize that nocturnal enuresis is \n frequent in symptoms of gs .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the current dialytic therapy has brought brilliant success in prolonging patient survival in end - stage renal disease ( esrd ) . \n in addition to the control of uremia , it can prevent patients from extracellular volume ( ecv ) excess , dilutional hyponatremia , severe hyperkalemia and metabolic acidosis \n . however , it can not keep patients in a steady state all the time because of its incomplete therapeutic efficacy . \n the concept of stability of the ' milieu interieur ( internal environment ) ' was created by claude bernard in the middle of the 19 century , and it was developed to the concept of homeostasis by walter cannon and popularized in his book the wisdom of the body , published in 1932 . whereas normal kidneys contribute to maintaining milieu interieur in a steady state , the current routine dialytic treatment hardly offers esrd patients homeostasis . \n sodium is accumulated over the interdialytic period , and sodium removal by dialysis may be insufficient because of the brief and discontinuous nature of routine dialytic therapy . \n besides , supraphysiologic dialysate sodium concentrations which are frequently used in current practice may hamper normalizing sodium balance in hemodialysis patients . \n carl kjellstrand and his associates for the first time drew attention to the issue of possible negative effects of the unphysiology of intermittent dialysis treatment1 ) . \n they formulated the \" unphysiology hypothesis \" which stated that side effects seemed particularly common in patients who experience great swings in body weight , urea ( osmolality ) , and potassium ( k ) , and who had - as a consequence of their large fluid load - severe hypertension . \n in other words , the more \" unphysiologic \" dialysis is , and the more abnormal blood chemistries and fluid levels are before dialysis , the more violently they will change during dialysis and the more ill - effects those patients will experience . \n the best way which they contemplated to get rid of \" unphysiology \" was to dialyze often - i.e. , dialyze daily . \n keeping blood chemistries within normal limits may be impossible with three dialyses per week . before each dialysis the patient would be fluid - overloaded , hyperkalemic , and acidotic . \n thus the patient 's body is never in a normal state ; it is in an abnormal state , both before and after dialysis2 ) . \n lopot and vlek proposed two parameters for quantification of dialysis unphysiology : plasma urea time - averaged concentration ( tac ) and time average deviation ( tad)3 ) . \n the less frequent and thus less physiological the dialysis schedule , the higher will be the fluctuation of the plasma urea concentration and the higher the resulting tad . \n treatment outcome of a specific treatment schedule can be represented by a point on the tac / tad plot . \n 1 shows the tac / tad plot representing currently used renal replacement therapies and health . \n it was derived from an average patient with total body water of 42 l , negligible residual renal function and a protein catabolic rate ( pcr ) of 1 g / kg / day dialyzed with a urea clearance of 160 ml / min for the same total weekly time ( and thus , equal to weekly cleared volume)3 ) . \n in hemodialysis patients without residual renal function , intradialytic sodium removal should be matched with interdialytic sodium accumulation . \n sodium removal during hemodialysis is carried out by convection and to a lesser degree by diffusion . however , with supraphysiologic dialysate sodium concentrations , diffusive influx from dialysate may occur , especially in patients with low predialytic plasma sodium concentrations5 ) . over the interdialytic period \n the ecv changes occurring in the usual thrice weekly hemodialysis treatment are shown in fig . \n owing to the intermittent nature of hemodialysis , the patient oscillates between a high - weight \" wet \" state just before the session , and a low weight \" dry \" state just at the end of the session6 ) . \n thus , we can say that the intermittent hemodialysis is \" unphysiologic \" in terms of sodium balance as well . \n the discontinuous nature of hemodialysis causes saw - tooth volume fluctuations , and the ecv expansion during the interdialytic period may lead to hypertension and adverse cardiovascular consequences . \n sodium ions ( na ) may be divided into osmotically active and osmotically inactive fractions7 ) . \n the traditional view is that na and its accompanying anions are the principal extracellular osmoles and act to hold water in the extracellular space ; conversely , k salts account for almost all the intracellular osmoles and act to hold water within the cells . \n although the cell membrane is permeable to both na and k , these ions are able to act as effective osmoles because they are restricted to their respective compartments by the activity of the na , k - atpase pump in the cell membrane8 ) . \n thus , this fraction of na is osmotically active because na accumulation inevitably leads to water retention in the extracellular space ( fig . \n as shown originally by short - term isotope dilution studies done by edelman et al.9 ) , changes in the serum na concentration reflect short - term changes in the exchangeable fraction of total body na and k relative to total body water . \n more recent data have suggested that large amounts of na can be accumulated without accompanying water retention10 , 11 ) . \n thus , plasma and extracellular water can not be the only sites of na and water metabolism , and tissues such as bone , cartilage and connective tissue may account for > 50% of the total body na content . \n some osmotically inactive na in the crystalline phase of bone was postulated in the 1960s12 ) . \n this localization may be interpreted as \" an internal na escape into extracellular matrix components \" to maintain the ecv despite a positive na balance7 ) . \n if this na was bound in a \" third \" sodium space to negatively charged interstitial matrix components with polyanionic character or to the bone mineral , this bound na would not readily equilibrate with the ecv ( water - free na accumulation ) and thus would be osmotically inactive ( fig . \n however , this osmotically inactive na can be mobilized and made available for exchange13 ) . \n recently , osmotically inactive sodium storage has been documented in humans11 ) and rats consuming a high - salt diet14 ) . \n in patients with chronic renal failure , the blood pressure ( bp ) , when related to urinary sodium excretion , rises exponentially with the decrease of creatinine clearance15 ) . \n intravascular volume - to - extracellular volume ratio increases more in patients with advanced renal insufficiency , and bp increases more in relation to the increase of ecv in these patients . \n the following guyton 's 2 examples show how , in the long run , small volume increases are associated with high bp increases16 ) . \n the first relates to changes in fluid volume and bp caused by hyperaldosteronism in humans . in one study , after hypertension was completely controlled by spironolactone , the drug was withheld for several weeks . during the next 2 weeks , extracellular fluid volume and bp increased by 20% to 40% . during the following 2 weeks , the ecv decreased toward normal , but bp remained elevated . \n yet no other cause for the elevated bp was found in these patients , except for the small increase in fluid volume . \n another example was a study on circulatory system variables , after acute volume loading in dogs with reduced kidney mass to 30% . \n the study showed , within 2 days , an increased extracellular fluid and blood volume , increased cardiac output , slight decrease in total peripheral resistance , and a rise in bp . within the following few days , extracellular and blood volumes and cardiac output decreased ; however , total peripheral resistance increased and bp remained elevated ( fig . \n guyton postulated that the bp remained elevated by increased total peripheral resistance due to autoregulation of blood flow at the tissue level16 ) . \n recently , however , the mechanisms leading to vasoconstriction in salt - dependent hypertension are being understood more clearly . \n either excessive sodium intake or sodium retention by the kidneys and the consequent tendency toward plasma volume expansion lead to release of endogenous ouabain ( eo ) probably from the hypothalamus18 ) . \n the na , k - atpase pumps in the vascular smooth muscle cells ( vsmcs ) are inhibited by the increase in plasma eo , resulting in the elevation of local na on the submembrane area . \n this produces electrogenic depolarization of vsmcs and facilitates ca entry through the na / ca exchanger . the resulting rise in the cytosolic ca \n previous clinical observations revealed that the bp response to ecv reduction was delayed by some weeks . \n this represents the lag phenomenon , i.e. , the delay of bp decrease after normalization of extracellular fluid volume17 ) . \n it was first described in the middle of the twentieth century after introduction of the \" rice diet\"20 , 21 ) and during treatment with thiazide diuretics22 ) . in 1967 , scribner commented that \" in many patients a time lag exists between reduction of ecv and adequate control of bp . \n several days or weeks may be required for adequate control , even though striking weight loss and , presumably , reduction of ecv occurred immediately.\"23 ) the time - dependent relationship between the ecv control by hemodialysis and the normalization of bp can be illustrated by the first year of dialysis of 712 patients started on hemodialysis in tassin , france24 ) . during the first month , ecv expressed by the postdialysis weight declined sharply by 2 to 3 kg . \n predialysis mean arterial pressure also decreased rapidly . at 2 months , the postdialysis weight was stable , but bp continued to decrease . at that stage , \n antihypertensive medication was already stopped in almost all patients . between 3 and 12 months , the curves crossed over , bp continued to decrease gently , but weight increased by several kilograms ( fig . 5 ) . this gain in weight after 2 months was not related with an ecv increase but with the anabolic gain in lean and fat body mass following the start of dialysis25 ) . \n first , vascular remodeling26 ) , followed by a progressive reduction of peripheral resistances , is conceivable . \n secondly , vasoactive middle molecular substances such as asymmetric dimethylarginine may be very slowly removed27 ) . \n thirdly , water - free sodium storage in the vsmcs may be very slowly relieved because of the restored na , k - atpase activity . \n specifically , the liberalization of diet and short dialysis with a high sodium concentration in the dialysate are the main causes of positive sodium balance28 ) . according to the national survey performed in 2005 , \n the average dietary sodium intake in koreans was estimated to be 5.2 grams per day . educating patients to restrict sodium intake < 2 grams per day \n thus , reducing dietary sodium intake remains the most important tool in improving bp control in dialysis patients5 ) , and a low - salt diet is more than ever a necessity in conventional hemodialysis29 ) . \n sodium removal can be increased both by applying higher ultrafiltration volumes and by lowering dialysate sodium concentration5 ) . however , the former may be difficult because of improper tolerance , and the latter may hamper the hemodynamic stability during the dialysis . \n the ultrafiltration rate is a major limiting factor because intravascular compartment refilling from the interstitium needs more time than is available with now - standard short sessions29 ) . \n thus , prolonging session length ( long hemodialysis ) will be desirable to improve hemodialysis tolerance while maintaining a high rate of ultrafiltration . \n current hemodialysis practices adopt a standard dialysate sodium prescription that is typically higher than the plasma sodium concentration of most patients . however , hypertonic dialysate sodium prescriptions , including sodium modeling , predispose to positive sodium balance and lead to higher bp and increased interdialytic weight gain6 ) . \n conversely , lowering or individualizing dialysate sodium reduces thirst , interdialytic weight gain , and bp in non - hypotension prone dialysis patients30 ) . \n a random reduction of 3 meq / l in dialysate sodium was well tolerated even by patients with preexisting hypotension31 ) , and the sodium concentration in the dialysate may be reduced to < 138 meq / l28 ) . \n it has become possible to individualize dialysate sodium concentration by means of online measurements of plasma conductivity and adjustment of dialysate conductivity by feedback technologies . \n sodium , which is accumulated over the interdialytic period in esrd patients , may be divided into two fractions . \n the one is the fraction of osmotically active sodium which is mainly confined to the extracellular space , and the other is that of water - free ( osmotically inactive ) sodium which diffuses into the intracellular space . \n both contribute to the pathogenesis of hypertension because the former may act to expand extracellular fluid volume and the latter may cause vasoconstriction in the long run by increasing cytosolic concentration of calcium in the vascular smooth muscle cells ( fig . \n , it may take several weeks to months for water - free sodium storage in the vascular smooth muscle cells to be relieved . \n this may be an explanation for the lag phenomenon , i.e. , the delay of blood pressure decrease after normalization of extracellular fluid volume shown in the tassin experience . \n modest restriction of dietary sodium intake , the dialytic session length long enough to maintain a high ultrafiltration volume , and the reasonably low dialysate sodium concentration are required to avoid unphysiology of positive sodium balance in current hemodialysis practice .", "role": "user" }, { "content": "dialysis unphysiology was first discussed by carl kjellstrand in 1975 for the possible negative effects of the unphysiology of intermittent dialysis treatment . \n current hemodialysis practices are still unphysiologic because they can not keep blood chemistries within normal limits , both before and after dialysis . \n in addition , the discontinuous nature of hemodialysis causes saw - tooth volume fluctuations , and the extracellular fluid volume expansion during the interdialytic period may lead to hypertension and adverse cardiovascular consequences . sodium , which is accumulated over the interdialytic period , may be divided into two fractions . \n the one is the fraction of osmotically active sodium which is mainly confined to the extracellular space , and the other is that of water - free ( osmotically inactive ) sodium which diffuses into the intracellular space . \n both contribute to the pathogenesis of hypertension because the former may act to expand extracellular fluid volume and the latter may cause vasoconstriction in the long run by increasing cytosolic concentration of calcium in the vascular smooth muscle cells . even in intensive hemodialysis , it may take several weeks to months for water - free sodium storage in the vascular smooth muscle cells to be relieved . \n this may be an explanation for the lag phenomenon , i.e. , the delay of blood pressure decrease after normalization of extracellular fluid volume shown in the tassin experience . \n modest restriction of dietary sodium intake , the dialytic session length long enough to maintain a high ultrafiltration volume , and the reasonably low dialysate sodium concentration are required to avoid unphysiology of positive sodium balance in current hemodialysis practice .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 71-year - old woman presented with a complaint of sudden decrease in vision in the right eye , 7 days after tkra . \n the patient 's history was unremarkable except a severe pain of more than the visual analog scale of 8 points for about 2 days , because the analgesic dose given was not adequate for the pain after the surgical operation . on examination \n the best corrected visual acuity ( bcva ) was 20/100 in the right eye and 20/20 in the left eye . \n retinal examination showed a well differentiated serous detachment that was about 3.5 disc diameter in size and located on the macular area in the right eye . \n no disc edema , retinal cotton wool spots , hemorrhages , or vascular abnormalities were noted in both eyes ( fig . \n 1 ) . a fluorescein angiography ( fa ) of right eye performed at the first visit revealed choroidal hypoperfusion and a serous detachment without any leakage points in the early phase of the angiogram ( fig . \n 2a ) . in the mid and late phases , the area of non - perfusion showed pooling of the dye in the subretinal space without a leakage point ( fig . \n indocyanine green ( icg ) angiography was also performed on the same day and showed delayed perfusion of the choriocapillaris without a leakage point in the early phase followed by slow filling of neurosensory detachment without a focal source of leakage in the late phase ( fig . \n after 2 months , the symptoms and clinical findings began to improve gradually and at the follow - up examination 6 months after the first clinic visit , there was a complete resolution of the serous detachment of macula . \n the bcva had improved to 20/20 in the right eye and the fluorescein angiogram showed minor disturbances in the rpe only ( fig . \n serous detachment of the neurosensory retina can occur due to any process that disrupts the outer blood - ocular barrier controlled by the rpe.3 diagnosis of a serous detachment is made clinically , although optical coherence tomography has recently been used for the detection of clinically occult serous elevations of the retina \n . the underlying mechanisms of subretinal exudation are thought to include choroidal vascular perfusion and permeability changes , which result in increased choroidal interstitial fluid with further extension into the subretinal space.3 in our case , this 71-year - old woman presented with a unilateral choroidal ischemia with serous macular detachment detected by fa and icg angiography . \n the most common cause of this finding is the neovascular form of age related macular degeneration.3,4 however , the patient did not have subretinal hemorrhages , exudates or fibrosis at any time.5 other signs of choroidal neovascualr membrane including a gray - green membrane and pigment epithelial detachment were also absent . \n subretinal leakage , due to altered choroidal vascular perfusion and permeability , occurs in systemic inflammatory and infectious diseases with fluid extension into the subretinal space.3 systemic malignant hypertension , toxemia of pregnancy , and hypercoagulable states may result in choriocapillaris occlusion and choroidal ischemia with subsequent breakdown of the outer blood ocular barrier and serous detachment.3,6 however , the patient had no significant ophthalmic history and her medical history and review of systems were unremarkable . \n other causes of serous macular detachment include acute and chronic central serous chorioretinopathy ( csc ) . however , fa failed to show focal rpe leaks , rpe stippling , or gravitational fluid tracts consistent with csc.7,8 the icg angiography showed a slow pooling of icg in the subneurosensory space but failed to demonstrate focal leaks or frank choroidal leakage as seen in csc . \n idiopathic csc in a resolving phase with early resolution of fluorescein leakage and persistence of subretinal fluid , might present with serous macular detachment . \n however , the acute onset of visual loss in a close temporal relationship to severe postoperative pain that interfered with sleep for 2 days after surgery ( visual analog scale : 8 points ) and the constant pain ( visual analog scale : 2~4 points ) despite narcotic analgesics suggest a different etiology . \n a search of the medline database ( search words used : choroidal ischemia , pain , serous retinal detachment ) showed no studies on choroidal hypoperfusion and serous detachment related to severe pain . \n generally , pain reacts to nociceptive stimulation , and primarily secretes histamine or substance p , and serotonin ; secondary stimulation of the sympathetic nervous system follows.9 it is possible that the sympathetic innervation produced vasoconstriction and alteration of blood flow in the choroidal vascular beds leading to choroidal hypoperfusion . \n compromised function of the retinal pigment epithelium and/or choroid would lead to accumulation of subretinal fluid as is observed in our patient with a serous detachment . \n a recent survey investigation of the severity of pain , following ambulatory surgery in 5,703 patients , indicated that 30%(1,712 ) of the patients experienced moderate - to - severe pain postoperatively . \n however , because individual tolerance to pain varies , patients who have pain do not always present with ocular symptoms.10 therefore , we propose that severe postoperative pain influences sympathetic activity that can result in ischemic injury with focal choroidal vascular compromise and secondary dysfunction of the overlying rep cells ; this may occur in some patients and lead to leakage across the rpe and accumulation of subretinal fluid . \n further investigation of the potential impact of pain on the delicate balance of fluid homeostasis , at the outer blood - ocular barrier , may be warranted .", "role": "user" }, { "content": "to report the association of a unilateral serous macular detachment with severe postoperative pain . a 71-year - old woman presented with a sudden decrease in vision in the right eye , seven days after a total knee replacement arthroplasty . \n the patient 's history was unremarkable except for a severe pain greater than the visual analog scale of 8 points for about 2 days after surgery . \n retinal examination showed a well differentiated serous detachment that was about 3.5 disc diameter in size and located in the macular area . \n fluorecein angiography and indocyanine green angiography showed delayed perfusion of the choriocapillaris without leakage points in the early phase and persistent hypofluorescence with pooling of dye in the subretinal space in the late phase . \n there was a spontaneous resolution of the serous detachment and the choroidal changes with residual pigment epithelial changes . \n severe postoperative pain may influence the sympathetic activity and introduce an ischemic injury with a focal , choroidal vascular compromise and secondary dysfunction of overlying rpe cells in select patients .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: we used the odh website ( www.odh.state.oh.us ) to obtain rates ( cases/10,000 patient - days ) of initial c. difficile infections during january december 2006 for the 22 hospitals in cuyahoga county . \n all healthcare facilities in ohio were required to submit c. difficile infection rates by using a standardized method of reporting . \n an initial case was defined as a first positive laboratory diagnostic test for c. difficile , pseudomembranes on endoscopy , or confirmatory histologic features from surgical or autopsy specimen . \n an infection that occurred > 6 months after a previous infection was classified as an initial infection . for a subset of 5 hospitals , up \n to 20 consecutive stool samples from individual patients with c. difficile infection were cultured for c. difficile ( 11 ) . c. \n difficile isolates were tested for in vitro cytotoxin production and moxifloxacin susceptibility and analyzed for binary toxin gene cdtb and partial deletions of the tcdc gene ( 1113 ) . \n the 5 hospitals were 1 community hospital , 3 tertiary care facilities , and 1 veterans affairs hospital . \n three of the hospitals had experienced large outbreaks of c. difficile infection in 20022003 ( i.e. , their c. difficile incidence doubled and their peak incidence was > 20 cases per 1,000 discharges ) ; the other 2 reported an increase in the proportion of cases that were fulminant . \n the infection control departments of each institution provided information about c. difficile infection rates , fluoroquinolones on formulary , and infection control measures for c. difficile during january 2000december 2006 . \n rates of c. difficile infection for 2006 were compared among hospitals with moxifloxacin or gatifloxacin versus those with levofloxacin on formulary as primarily fluoroquinolones used to treat respiratory infections . \n in addition , for 2 hospitals in the molecular typing analysis that had a formulary change from 1 respiratory fluoroquinolone to another , we used poisson analysis to compare rates of c. difficile infection during the 12 months before and after the formulary change , with a lag of 1 month after the change . \n chicago , il , usa ) and stata 9.1 ( statacorp , college station , tx , usa ) . \n for the 18 adult acute - care hospitals and 4 long - term acute - care ( ltac ) facilities in cuyahoga county , the median c. difficile infection rate in 2006 was 7.3 ( range 4.263.1 cases/10,000 patient - days ) . \n six facilities ( 3 acute care hospitals and 3 ltacs ) had higher c. difficile infection rates than did each of the 5 hospitals in the molecular typing analysis . \n a total of 64 toxigenic c. difficile isolates were cultured from feces samples obtained from 5 hospitals . \n features of 42 ( 66% ) isolates were consistent with epidemic bi / nap1 strains ( range 55%83% for each facility ) , including amplification of the binary toxin gene cdtb and partial deletions in tcdc and resistance to moxifloxacin ( mics > 32 g / ml ) . by pcr ribotyping \n , we observed a characteristic banding pattern for isolates with features of the epidemic strain ; 6 isolates with this banding pattern were confirmed as bi strains in the laboratory of d.g . \n of the 22 facilities , 8 used moxifloxacin as the primary respiratory fluoroquinolone , 13 used levofloxacin , and 1 did not have a respiratory fluoroquinolone on formulary . \n the c. difficile infection rate did not differ between facilities with levofloxacin ( 8.5 cases/10,000 patient - days , 95% confidence interval [ ci ] 7.89.3 ) and moxifloxacin ( 8.5 cases/10,000 patient - days , 95% ci 7.89.2 ) on formulary ( p = 1 ) ( table ) . \n the facility that did not have a respiratory fluoroquinolone on formulary had a lower rate of c. difficile infection than the median rates for facilities that used levofloxacin or moxifloxacin . however , 8 facilities had lower c. difficile infection rates than did this institution . \n two of the 5 hospitals in the molecular typing analysis changed their formulary fluoroquinolones during the study period ( figure ) . \n both hospitals made formulary changes from levofloxacin to gatifloxacin ; however , the increase in c. difficile infection rates preceded the formulary change in each hospital . c. difficile infection rates did not differ significantly in the 12 months before and after the change from levofloxacin to gatifloxacin ( relative risk [ rr ] 1.0 , 95% ci 0.970.86 ; p = 0.973 ) . for hospital 2 ( figure , panel b ) , \n a subsequent formulary change from gatifloxacin to levofloxacin was associated with a reduction in c. difficile infection ( rr 0.59 , 95% ci 0.510.70 ; p<0.001 ) ; an intervention to improve environmental cleaning with a 10% bleach solution occurred at the time of the formulary change \n . rates of clostridium difficile infection for hospital 1 ( a ) and hospital 2 ( b ) . \n our findings provide further evidence that emergence of epidemic nap1/bi strains in a geographic region may be associated with large multihospital outbreaks of c. difficile infection . before the odh decision to require mandatory reporting , \n many area hospitals were either not collecting surveillance data about c. difficile infection or were reluctant to share their rates . \n therefore , we believe that mandatory public reporting of c. difficile infection rates provided a valuable tool to examine the full magnitude of the outbreaks and an incentive for hospitals with high rates to increase efforts to control infection . one area hospital recently reported that the odh database underestimated the incidence of c. difficile infection ( 14 ) , but this observation does not affect our conclusions because all facilities used the same surveillance definitions . \n our findings do not support the hypothesis that use of moxifloxacin or gatifloxacin is associated with higher rates of c. difficile infection than is use of levofloxacin or ciprofloxacin . \n first , data on the amount of the fluoroquinolones used in the hospitals were not available . \n second , analysis of hospital formularies does not account for the effects of fluoroquinolones used in long - term care facilities and among outpatients . \n third , we did not assess confounding factors , such as use of other classes of antimicrobial drugs and differing patient populations . \n finally , studies that evaluate group - level effects may not reflect the biological effects at the individual - patient level . \n additional studies are needed to evaluate the risk for c. difficile infection associated with different fluoroquinolones .", "role": "user" }, { "content": "to determine whether a multihospital clostridium difficile outbreak was associated with epidemic strains and whether use of particular fluoroquinolones was associated with increased infection rates , we cultured feces from c. difficile infected patients . \n use of fluoroquionolones with enhanced antianaerobic activity was not associated with increased infection rates .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: although metastasis of intracranial meningioma has been reported , there are few reports on the metastasis of intraspinal meningioma . \n this report aimed to describe the clinical features and pathological findings of the case of malignant transformation and distant metastasis of intraspinal meningioma , with a review of the literature . \n a 44 year - old man with a bilateral lower limb paresis was diagnosed with an intradural extramedullary tumor at the thoracic spine . a t2 - 4 laminectomy with tumor resection and coagulation of the dural attachment \n were performed , and the histological findings revealed an atypical meningioma classified as who grade 2 ( fig . \n postoperatively , the lower limb paresis completely resolved , but at age 46 , deteriorated again . \n tumor resection was performed a second time , but complete removal was abandoned because of a fall in motor evoked potential during the surgery . at age 48 , lower limb weakness occurred again . \n mri revealed a t2 - 4 intradural tumor surrounding the spinal cord and enhanced by gadolinium ( fig . \n 2 ) . the tumor was adherent to the spinal cord making it difficult to distinguish the spinal cord from the tumor microscopically . \n subtotal tumor resection , resection of the dural attachment as possible , and a t1 - 6 posterolateral fusion were performed as a third surgery . \n the tumor increased , therefore , stereotactic irradiation was performed but not effective . at age 60 , the patient suffered from thoracic pain and was diagnosed with metastatic tumors of the rib , lumbar vertebra , and sacrum . \n whole - body ct scan could not detect the primary tumor except the thoracic meningioma . \n biopsy of the rib metastatic tumor was performed , and the histological finding revealed anaplastic meningioma classified as who grade 3 ( fig . \n , the patient was diagnosed with malignant transformation and distant metastasis of an intraspinal meningioma . \n histological examination on the spinal cord tumor , showing sheet like growth , and cells with prominent nuclei diagnosed as atypical meningioma ( who grade 2 ) . \n intradural - extramedullary tumor surrounded the spinal cord enhanced by gadolinium with no calcification and no invasion . \n histological examination on the spinal cord tumor diagnosed as atypical meningioma ( who grade 2 ) . \n tumor invaded and surrounded the thoracic spine and metastasized to the rib and the lumbar spine . \n histological examination on the metastatic rib tumor , showing round cells with eccentric nuclei , eosinophilic cytoplasm , and focal necrosis diagnosed as anaplastic meningioma ( who grade 3 ) . \n to the best of our knowledge , this is the first report of a case of intraspinal meningioma with malignant transformation and distant metastasis . the meningioma transformed from atypical to anaplastic meningioma over a span of 14 years . in this case , the thoracic intraspinal meningioma transformed into a malignancy and invaded directly around the thoracic spine . \n thoroughly reviewed distant metastases of intracranial meningioma , including 115 cases with 165 metastatic lesions in their analysis . \n they found that the primary tumor of metastasized meningioma was , 33.9% for who grade 1 , 20.9% for who grade 2 , and 40% for who grade 3 . \n the metastatic lesions included 37.2% in the lung , 16.5% in the bones , 15.2% intraspinal , and 9.2% in the liver . \n in contrast , there has only been a single case report of distant metastases of intraspinal meningioma , and that case was originally graded as who grade 3 , which was different from our case originally graded as who grade 2 . \n malignant transfomation of intracranial meningioma are rare , occurring in only 0.162.0% of cases , and the time to malignant transformation ranging from 8 months to 26 years . \n factors that induce malignant transformation in intracranial meningioma include high - dose radiation , surgical stress , viral infection , growth factors such as vegf , and numerous progression - associated alternations of chromosomes 1p , 6q , 9q , 10q , 14q , 17q , and 22q . in our case \n however , it can not conclude that these factors change the atypical intraspinal meningioma into malignant transformation . \n to avoid recurrence , a macroscopically complete removal of tumor , with excision of its dural attachment or a macroscopically complete removal , with coagulation of its dural attachment \n reports have shown that the recurrence rate of subtotal resection is significantly higher than that of total resection . however , when evaluating recurrence , these reports have intermixed the tumor who grade . \n the recurrence rate for intracranial atypical meningioma is eightfold higher than it is for who grade 1 meningioma . \n the mean recurrence - free survivals time was 66 months , and the recurrence - free rate was 92% at one year and 53% at five years . \n when meningioma involves and adheres to the spinal cord , as in our case , it is extremely difficult to achieve total gross resection of the meningioma without damage to the spinal cord . \n however , based on the aforementioned studies and the course of our case , total resection is recommended to avoid recurrence of atypical meningioma . \n this report is the extremely rare case of intraspinal meningioma that transformed from who grade 2 to 3 with distant hematogenous metastasis . to avoid recurrence and malignant transformation of meningioma , gross total resection is likely required . \n thoroughly reviewed distant metastases of intracranial meningioma , including 115 cases with 165 metastatic lesions in their analysis . \n they found that the primary tumor of metastasized meningioma was , 33.9% for who grade 1 , 20.9% for who grade 2 , and 40% for who grade 3 . \n the metastatic lesions included 37.2% in the lung , 16.5% in the bones , 15.2% intraspinal , and 9.2% in the liver . \n in contrast , there has only been a single case report of distant metastases of intraspinal meningioma , and that case was originally graded as who grade 3 , which was different from our case originally graded as who grade 2 . \n malignant transfomation of intracranial meningioma are rare , occurring in only 0.162.0% of cases , and the time to malignant transformation ranging from 8 months to 26 years . \n factors that induce malignant transformation in intracranial meningioma include high - dose radiation , surgical stress , viral infection , growth factors such as vegf , and numerous progression - associated alternations of chromosomes 1p , 6q , 9q , 10q , 14q , 17q , and 22q . in our case , \n however , it can not conclude that these factors change the atypical intraspinal meningioma into malignant transformation . \n to avoid recurrence , a macroscopically complete removal of tumor , with excision of its dural attachment or a macroscopically complete removal , with coagulation of its dural attachment are recommended . \n reports have shown that the recurrence rate of subtotal resection is significantly higher than that of total resection . however , when evaluating recurrence , these reports have intermixed the tumor who grade . \n the recurrence rate for intracranial atypical meningioma is eightfold higher than it is for who grade 1 meningioma . \n the mean recurrence - free survivals time was 66 months , and the recurrence - free rate was 92% at one year and 53% at five years . \n when meningioma involves and adheres to the spinal cord , as in our case , it is extremely difficult to achieve total gross resection of the meningioma without damage to the spinal cord . \n however , based on the aforementioned studies and the course of our case , total resection is recommended to avoid recurrence of atypical meningioma . \n this report is the extremely rare case of intraspinal meningioma that transformed from who grade 2 to 3 with distant hematogenous metastasis . to avoid recurrence and malignant transformation of meningioma \n the authors report no conflict of interest concerning the materials or methods used in this study or the findings specified in this paper .", "role": "user" }, { "content": "abstractmeningioma is typically considered to be a benign tumor . \n malignant transformation and metastasis of meningiomas are rare \n . moreover , most meningiomas are intracranial , and there are few reports on intraspinal meningiomas . \n this report aimed to describe the clinical features and pathological findings of a case of malignant transformation and distant metastasis of intraspinal meningioma , with a review of the literature . \n a 44-year - old man with a bilateral lower limb paresis was diagnosed with an intradural extramedullary tumor of the thoracic spine . \n primary tumor resection was performed , and the histological findings revealed atypical meningioma . \n the meningioma recurred 2 years after the primary surgery , and a second resection was performed , but only partial resection was possible because of decreased motor evoked potential . at age 48 , the patient s lower limb weakness returned , and a third resection was performed , and the histological finding remained atypical meningioma . at age 54 , \n the tumor increased and stereotactic irradiation was performed . at age 60 , \n the patient was diagnosed with metastatic tumors of the rib , lumbar vertebra , cervical spine , and sacrum . \n biopsy of the rib metastatic tumor was performed , and the histological findings revealed anaplastic meningioma . \n this case is the first report of an intraspinal meningioma that transformed from atypical to anaplastic meningioma with distant hematogenous metastasis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: management of infected total knee arthroplasty ( tka ) is a challenge to patient and surgeon alike . \n various spacer devices are available for the first stage surgery for local delivery of antibiotics . here \n , we report our experience with management of infected tka patients with our indigenously designed and produced knee spacer . \n between 2012 and 2013 , 28 patients with infected total knee replacement ( tkr ) have been managed by our indigenous knee spacer . \n minimal spacer - related complications and a stable knee joint with range of motion up to 100 were noted in these patients . after a mean period of 6 - 8 weeks , the spacer was removed and definitive tkr fixation done . at a mean follow - up of 4-months post second stage definitive surgery , patients were infection free with no evidence of recurrence of infection . \n our new innovative customized articulating knee spacer , which has intramedullary stem extension , has potential to significantly reduce spacer - related complications along with providing improved knee function . \n with the increasing incidence of total knee arthroplasty ( tka ) , the incidence of infected tka is also on the rise . \n the infection rate after primary tka ranges from 0.5% to 2% and is a serious problem despite modern technology and rigorous prophylaxis . \n however , considering the increasing number of patients with tka , infection is still a complication of major concern . \n a variety of techniques and devices have been developed to improve the management of the infected tka . \n antibiotic - loaded bone cement spacers in the two - stage reimplantation technique are the gold standard as they allow early joint and patient mobilization , a shorter hospital stay and potentially a reduced rate of reinfection . \n many off the shelf readymade spacers are available , but these are not very cost - effective and are associated with a variety of spacer - related complications . \n we describe our experience of managing infected total knee replacement ( tkr ) patients with our indigenous customized knee spacer in the initial stage of two - stage reimplantation complications . \n in the year 2012 - 2013 , 28 patients of infected tkr were managed by our new innovated customized articulating cement spacer in the first stage of two - stage exchange arthroplasty . \n the average age of the patients was 70 years ( range : 56 - 79 years ) . \n 20 were knees with advanced osteoarthritis , whereas the other 8 were post rheumatoid knees , all of these had been managed by primary tkr . after first stage implant removal and debridement and our indigenous spacer implantation , \n no evidence of spacer dislocation , mediolateral tilting , or spacer subluxation was noted while only 2 patients had spacer fracture . \n features such as pain , warmth , redness , severe restriction of movement with or without frank discharging sinuses are noted . \n neutrophilia persistently elevated erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp ) and radiographic loosening of implants are considered criteria of diagnosis of infected tkr . after epidural anesthesia in first stage surgery , \n total knee components are removed , cement and loose bodies being curetted out along with thorough cleaning of femoral and tibial canals with pulse lavage . during surgery itself , \n indigenous knee spacer is prepared on a clean trolley with 20 g ( two pacs ) and 40 g ( four pacs ) of high viscosity gentamicin - loaded bone cement . \n depending on preoperatively determined femoral or tibial canal size , 5 cc or 10 cc disposable syringes are selected . \n after thorough debridement and lavage , these stems are inserted in the femoral and tibial canals with 1 cm of their ends projecting into the joint . \n cement in doughy form is layered on femoral and tibial side to make femoral and tibial spacer components . for spacer construction 40 g ( four packets ) of gentamicin - loaded polymethylmethacrylate ( pmma ) , \n cement prepared for femoral side is layered on the femoral surface and the projected stem to shape it like femoral condyles of desired thickness . \n a groove on the anterior surface of the spacer is made with the femoral component for better alignment of the patella . \n for tibial tray , cement is placed on tibial surface in a doughy state and shaped into a spacer of desired thickness as determined preoperatively ( fig . \n flexion - extension matching is done to confirm an optimum spacer thickness and provide a smooth knee range of motion . \n 2 ) physiotherapy is started by knee range of motion and quadriceps strengthening exercises as soon as the pain permits and walker ambulation by second post - operative day . \n post - operative antibiotics are started as per culture , and sensitivity report of the fluid and tissue sent for culture preoperatively and continued for 6 weeks followed by 2 weeks antibiotic free period . \n normal skin condition over the operative site without any redness or sinuses and normal range of serial esr and crp markers make the patient eligible for the second stage of surgery which involves spacer removal and definitive tkr implant fixation . in our series , no evidence of dislocation , mediolateral tilting , or knee subluxation was noted except for two patients who had spacer fracture and were operated by spacer reimplantation \n . the mean range of knee motion with spacer in our series has been 100 flexion with complete eradication of infection and definitive surgery 6 - 8 weeks after spacer implantation . \n the cost of manufacturing these on table spacers is nominal when compared to off the shelf available articulating spacers , thus providing economic advantage to the patient ( table 1 ) . \n ( a ) infected total knee replacement , exposure and component removal , ( b ) intramedullary femoral and tibial stems , ( c ) our innovative knee spacer ( in situ ) . \n post - operative x - rays of the patient with knee spacer ( in situ ) . \n two - stage exchange arthroplasty with an antibiotic - impregnated cement spacer remains the standard treatment for patients with an infected tka . \n spacers not only help in maintaining knee joint space but also act as a source of local antibiotic delivery . \n nonarticulating block spacers can be easily made peroperatively by antibiotic - impregnated pmma and are fashioned to fit the existing bone defect . \n although useful in infected knees with the substantial bone loss , they present several disadvantages such as knee immobility and subsequent stiffness , spacer dislodgement , and bone erosion . \n scar formation , tissue adherence , and quadriceps shortening make subsequent surgery a difficult one . \n temporary prosthesis , prefabricated articulating spacers , and on table articulating spacers are some of the various options used to overcome problems faced with static block spacers . \n use of temporary prosthesis technique involves autoclaving removed femoral component and using a new tibial poly and fixing both these components with antibiotic cement to the parent bone , medullary canals being packed with antibiotic laden beads . however , there is possibility of bacterial adhesion to the surface of these components and increased the cost of management of patients with infected tka . commercially available \n prefabricated cemented articulating spacers have various disadvantages in the form of size mismatch , lack of modularity , unsatisfactory antibiotic impregnation , fixed antibiotic type , and dose , often allowing delivery of a single antibiotic . \n all these spacers have had their set of spacer - related complications which are largely due to their nonconformity to articulating surfaces , inadequate size and thickness and no or poor fixation to underlying bone . \n spacer fixation to bone and its stability in the joint is largely compromised because of lack of intramedullary purchase in femur and tibia . \n this problem has been successfully addressed by our innovation where we have used intramedullary antibiotic bone cement stems along with on table custom made spacers . stems not only provide sound anchorage to the overlying spacers but also act as a channel to deliver antibiotics deep inside the intramedullary canals . \n other factors like range of motion , patient satisfaction , and infection healing have been comparable to readymade contemporary devices available , but the cost - effectiveness of our spacers is an advantage to the patient . commercially available \n articulating knee spacers are very costly and most of the times out of reach of the patient already burdened by challenges of infection , multiple surgeries , and loss of livelihood . \n we have been able to achieve eradication of infection in all our patients of infected tkr with our indigenous cost - effective device . \n ours is a dynamic spacer , hence with knee flexion femoral component is removed first followed by tibial spacer removal . \n moreover , cement spacer is made in later setting stage of cement while stems are inserted in medullary canal only after cement has cured completely ; hence , there is no incorporation of cement in bone , making spacer removal into quite easy . \n our innovation provides specific advantage in the form of spacer stability inside the knee and capability of intramedullary local antibiotic delivery . \n however , a multicenter study and a long - term follow - up is required to confirm potential usefulness of this spacer device . \n the articulating antibiotic knee spacer as designed by us for the management of infected tkr is cost - effective , customized , easy to manufacture on the operation table and is associated with negligible spacer - related complications . \n our innovative knee spacer as a management option in the first stage of a two - stage exchange for infected tkr is easy to make on table in a customized fashion . \n moreover , it is biomechanically more stable and associated with negligible spacer - related complications . \n this spacer device can give a better outcome in patients with infected knee arthroplasty as compared to conventionally available spacers .", "role": "user" }, { "content": "introduction : management of infected total knee arthroplasty ( tka ) is a challenge to patient and surgeon alike . \n two - stage exchange is the universally acclaimed method to tackle this problem . \n various spacer devices are available for the first stage surgery for local delivery of antibiotics . here \n , we report our experience with management of infected tka patients with our indigenously designed and produced knee spacer.case report : between 2012 and 2013 , 28 patients with infected total knee replacement ( tkr ) have been managed by our indigenous knee spacer . \n minimal spacer - related complications and a stable knee joint with range of motion up to 100 were noted in these patients . \n after a mean period of 6 - 8 weeks , the spacer was removed and definitive tkr fixation done . at a mean follow - up of 4-months post second stage definitive surgery , patients were infection free with no evidence of recurrence of infection.conclusion:our new innovative customized articulating knee spacer , which has intramedullary stem extension , has potential to significantly reduce spacer - related complications along with providing improved knee function .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the innate immune system or the nonspecific immune system is the first and the oldest line of defense in organisms [ 1 , 2 ] . \n it was the most dominant form of immunity before the evolution of the more sophisticated adaptive immunity . \n it is comprised of various mechanisms which are responsible for rapid defense of the host organism against invasion by other factors in a nonspecific manner . \n the innate immune system differs from the adaptive immune system in a way that while it is able to defend the body against pathogens , it is not able to impart long - lasting immunity to the host , unlike the latter . despite the evolution of the more complex and specific adaptive immunity \n , innate immunity still continues to function as the primary line of defense for most organisms . \n the antimicrobial action in the innate immunity is mediated by various antimicrobial proteins and peptides , which have been evolutionary conserved . \n antimicrobial peptides are small peptides which demonstrate broad - spectrum antibiotic activity against various gram - positive and gram - negative bacteria , fungi , protozoa , and viruses [ 58 ] . \n while the most common mechanism of action deployed by these peptides is perturbation of microbial cell membrane [ 911 ] , there are other mechanisms which are also prevalent [ 1216 ] . due to increasing resistance to antibiotics \n use of antimicrobial peptides is one of the promising approaches which may lead to potential antimicrobial drugs [ 16 , 2024 ] . \n it has been observed that peptides which are predominantly cationic and hydrophobic in nature show potent antimicrobial activity [ 5 , 2529 ] . \n many of these peptides including indolicidin from bovine neutrophiles , tripticin from porcine neutrophil granules , puroindoline from wheat seeds , combi-1 , a synthesized antimicrobial peptide , and lys h and lys c from lysozyme have been extensively studied . \n although these peptides adopt various conformations the alpha - helical conformation with polar and nonpolar groups on opposite sides of the helix tends to be the most abundant [ 3537 ] . \n the antimicrobial property of these amphipathic alpha - helical peptides increases sequentially with increase in net charge . \n lactoferrin is an iron - binding glycoprotein which is found in most of the exocrine secretions such as milk , tears , nasal secretions , saliva , urine , uterine secretions , and amniotic fluids [ 3941 ] as well as in secondary granules of neutrophils . \n it exerts a wide antimicrobial activity against a number of bacterial , viral , and fungal pathogens in vitro [ 4348 ] . \n lactoferrin exerts its antimicrobial action not just in the form of the intact molecule but the monoferric lobes and active peptides of lactoferrin also have a role in the host defense against microbial disease [ 4952 ] . \n lactoferrin is a rich source of cationic and hydrophobic antimicrobial peptides , which may be used against microbes [ 53 , 54 ] . \n these antibacterial peptides which are a part of the polypeptide chain of lactoferrin and are released upon the proteolysis of this molecule by various proteolytic enzymes can be developed into clinically useful lead molecules for antimicrobial therapeutics [ 55 , 56 ] . \n although it has been shown that native lactoferrin exerts its antimicrobial action through sequestration of iron [ 5759 ] , it is still unclear how the antimicrobial lactoferrin peptides act against the microbes . \n though a number of studies have implicated these peptides in the binding to the outer membrane proteins of various bacteria or binding to microbial proteases [ 6062 ] , the structure - function interrelationships of these peptides have not yet been established . \n a number of functional peptides are produced from lactoferrin by the action of proteolytic enzymes . \n it is expected that these enzymes are present in the gastrointestinal tract as well as the site of microbial infection , and hence , they may contribute in the natural function of lactoferrin in the human body . \n this paper reports the comparison of these peptides with other antimicrobial peptides found in nature as well as cross - species comparison of the sequences of these antimicrobial peptides from the native sequences of lactoferrin with the intent to draw evolutionary inferences of their function . \n although many antimicrobial peptides from lactoferrin have been isolated and characterized , only three of them have been studied in detail . \n these are lf1 - 11 , lactoferrampin , and lactoferricin . the sequences of these peptides indicate that these peptides belong to the n - terminal half of lactoferrin ( figure 1 ) . \n hydrophobicity , cationicity , and helical conformation of these antimicrobial peptides are the important characteristics that determine their antimicrobial potency [ 9 , 63 , 64 ] . \n all these peptides have high pi values ( > 9 ) and is expected to interact with negatively charged elements . \n all three have different sequences , structural elements , and modes of action ( table 1 ) . \n an attempt to analyze and decipher the structural and functional characteristics of three peptides is made in this paper . \n lf1 - 11 , as its name suggests , is the n - terminal peptide of lactoferrin , comprised of the first eleven residues of the molecule . \n this peptide has been shown to be highly effective against five multidrug - resistant acinetobacter baumannii strains and methicillin - resistant staphylococcus aureus and various candida species [ 67 , 68 ] . \n the potent antimicrobial effect of lf1 - 11 was attributed to the first two arginines at the n - terminus of human lactoferrin . \n this conclusion was based on the fact that when the second or third arginines were replaced by alanine , the candidacidal activity of the lf1 - 11 was observed . additionally , while lf1 - 11 , lf2 - 11 , and lf3 - 11 showed comparable candidacidal activities , the same was found compromised in the case of lf4 - 11 . \n the importance of the three arginines ( r2r4 ) for the potent antimicrobial activity of this peptide was established when synthetic peptides lacking the first three n - terminal residues were found to be less effective in the killing of bacteria . \n also , mutant lactoferrin lacking the first five n - terminal residues displayed decreased binding to bacterial lipopolysaccharide . in yet another study , \n stallmann et al . studied the efficacy of local prophylactic treatment with human lf1 - 11 in a rabbit model of femur infection and observed that hlf1 - 11 effectively reduced the development of osteomyelitis in a rabbit model . \n it was speculated that the mechanism of antimicrobial action of lf1 - 11 is mitochondrial damage , with the extracellular atp being essential but not sufficient for lf1 - 11 to exert its candidacidal activity . in later studies \n , it was found that uptake of calcium by mitochondria is vital for killing of candida albicans by the lf1 - 11 . in another study , it was found that lf1 - 11 is responsible for directing the gm - csf - driven monocyte differentiation toward macrophages that produces both pro- and anti - inflammatory cytokines . it was speculated that the peptide could be used as agent to empower the innate immune response of the host for infections . \n these results demonstrated the importance of the further development of lf1 - 11 as a promising drug against microbial infections in patients who may have compromised immune systems . \n the cellular target for the immunomodulatory activity of lf1 - 11 was found to be myeloperoxidase , to which lf1 - 11 binds and inhibits after entering the monocytes . \n a molecular modeling study by the same group demonstrated that lf1 - 11 bound at the active site of the enzyme . \n the importance of the first two arginines and the cysteine at the tenth position was further substantiated by the fact that peptides which did not possess these necessary residues were not as effective in binding with myeloperoxidase . \n the sequence comparison of lf1 - 11 among the six species ( table 2 ) shows that unlike human lf1 - 11 , which contains three arginines in the positions 25 ( r2r4 ) , the peptide from other species contains only one arginine ( r3 ) . \n yet , it is noteworthy that the r4 has been replaced by lysine , which is also a basic residue in all the other species , thereby maintaining the highly cationic nature of the peptide throughout the species . also , in all the cases except human , arginine occurs at the seventh position also . \n the most significant change is seen in the second residue which is proline in all cases except in human and camel . \n notably , the hydrophobic residues , v6 , and w8 are conserved in all the cases . \n lactoferrampin , comprised of residues 268284 in the n1 domain of lactoferrin , has been identified as an antimicrobial peptide and plays a key role in membrane - mediated activities of lactoferrin [ 76 , 77 ] . \n it exhibits broad antimicrobial action against several gram - positive and gram - negative bacteria , notably , bacillus subtilis , escherichia coli , pseudomonas aeruginosa , and staphylococcus aureus , as well as candidacidal activity . \n the antimicrobial action of this peptide was also found to be more potent than the native lactoferrin . \n the structure of lactoferrampin revealed an amphipathic alpha - helix which begins with the n - terminus and ends at the 11th residue , followed by a c - terminus tail . \n it is reported that the cleavage of this peptide at both the termini resulted in considerable decrease of the candidacidal activity . \n the c - terminal residues of lactoferrampin are most critical for its antimicrobial action , possibly because the c - terminus consists of several residues with positive charges which are clustered together . \n but truncation of c - terminal side did not alter the ability of this peptide to adopt helical conformations . \n also , substitution of the basic residues at the c - terminus led to decrease in potency of this peptide [ 77 , 79 ] . \n the n - terminal residues , truncated up to the sequence 270284 , are essential for maintaining the structure of this peptide in a helical conformation . \n the helical conformation of this peptide was found to be critical for the potency against gram - positive bacteria as established when the bactericidal activities of two lactoferrampin peptides , lactoferrampin 265284 and lactoferrampin 268284 , were compared . \n lactoferrampin 265284 , which consists of additional three residues , asp - leu - ile , showed a broader specificity since the asp - leu - ile sequence increases the tendency of this peptide to assume an alpha - helical conformation . \n both the peptides possessed bactericidal activity against certain species of gram - positive and gram - negative bacteria . \n compared to lactoferrampin 268284 , higher concentrations of lactoferrampin 265284 were required to kill the gram - negative bacteria , e. coli and p. aeruginosa . \n the killing activity expressed as lc50 value ( the concentration that produced 50% reduction in viable counts of the microorganisms ) was found to be about 5.8 mol / l for lactoferrampin 268284 which is about 4 times higher than lactoferrampin 265284 . \n the mode of action of this peptide on bacteria is by bacterial membrane binding and membrane disruption . \n it is established that lactoferrampin is internalized within few minutes with the bacterial membrane permeabilization followed by cellular damage [ 81 , 82 ] . \n distinct vesicle - like structures by the lactoferrampin peptide were also observed by freeze - fracture transmission electron microscopy in the membrane of c. albicans . it is speculated that this peptide exerted detergent - like activity , disturbing the hydrophobic interphase of the lipid bilayer . \n several studies have revealed that the determinants for antimicrobial action are the orientation and structure of bovine lactoferrampin in bacterial membranes [ 78 , 8385 ] . \n the solution structure of bovine lactoferrampin suggests that it adopts an amphipathic alpha - helical conformation across the first 11 residues of the peptide but remains comparatively random at the c - terminus [ 78 , 85 ] . \n the interaction between the n - terminal tryptophan residue and model membranes of varying composition was evaluated suggesting that w1 is inserted into the membrane at the lipid / water interface . \n along with this , the orientation of the phenyl side chain of f11 found to be in same direction as the indole ring of w1 also suggested that the amphipathic n - terminal helix anchors the peptide to membrane with these two residues that facilitates peptide folding [ 78 , 86 ] . \n the same group has suggested that the hydrophobic patch in between the two residues as well as leu , ile , and ala side chains are responsible for interaction between the peptide and the hydrophobic core of a phospholipid bilayer . \n in addition , the helix capping residues asp - leu - ile in the n - terminus of the peptide has been found to mediate the depth of membrane insertion by enhancing the affinity for negatively charged vesicles . \n bovine lactoferrampin had been shown to have greater affinity to acidic phospholipids than that to neutral phospholipids . \n haney et al . have speculated a two - step model of antimicrobial action by this peptide where the c - terminus positive charge cluster helps in the primary attraction of lactoferrampin to the membrane followed by the helix formation at the n - terminus that interacts to the surface of the bacterial lipid bilayer . \n the sequence comparison of lactoferrampin from six different species shows uniform preponderance of cationic amino acid residues among hydrophobic residues ( table 3 ) . \n the hydrophobic domain contains w1 in all the species that is involved in membrane insertion . \n bovine lactoferrampin 268284 has a net positive charge of 5 + at neutral ph with hydrophobic domain . \n the hydrophobic moment ( ) of the peptide which is a measure of lipophilicity was found to be 5.42 . \n in contrast , the human lactoferrampin has a net charge of 2 + resulting in reduced antimicrobial activity . \n however , by increasing the net positive charge near the c - terminal end of human lactoferrampin , a significant increase in its antibacterial and candidacidal activity was obtained . \n the basic amino acid residues crucial for the antimicrobial action were found to be conserved among all the six species . \n lactoferricin is a multifunctional , 25-residue peptide that is generated upon cleavage of native lactoferrin by pepsin and represents amino acid residues number 1741 in lactoferrin . \n the lactoferricin peptide is different from the other peptides described so far as it contains a disulfide bond between residues cys 20 and cys 37 in human lactoferrin and cys 19 and cys 36 in bovine lactoferrin . \n the peptide has an abundance of basic amino acids like lysine and arginine as well as hydrophobic residues like tryptophan and phenylalanine . \n the first report on lactoferricin in 1992 described this peptide to be more potent as an antibacterial agent in comparison with the intact lactoferrin and it was demonstrated to cause a rapid loss of colony - forming capacity in most of its targets . \n however , some strains like pseudomonas fluorescens , enterococcus faecalis , and bifidobacterium bifidum strains were found to be resistant to lactoferricin . \n the antibacterial activity of this peptide was attributed to its action of releasing lipopolysaccharide from bacterial strains and , hence , disruption of cytoplasmic membrane permeability after cell binding [ 8991 ] . \n apart from having a broad antibacterial spectrum , lactoferricin was found to be highly potent against candida albicans [ 89 , 92 , 93 ] . \n recently , it has also been shown to have antiviral [ 94 , 95 ] and antiprotozoal activities . \n it also displayed other activities like inhibition of tumor metastasis and induction of apoptosis in human leukemic cells . \n the mechanism of action of lactoferricin was attributed to 11-amino - acid amphipathic alpha - helical region which is positioned on the outer surface of the n - lobe of lactoferrin . \n the proline at the 26th position ( p26 ) was found to be essential for the antibacterial activity , and it was speculated to be responsible for disruption of the helical region , and hence the helicity of the peptide was predicted to be an essential aspect of the antibacterial action of this peptide . \n lactoferricin was found to be produced in the human stomach , indicating that this peptide is definitely generated in vivo for host defense . \n the comparison of the antimicrobial activities of lactoferricin from human , bovine , murine , and caprine showed that bovine lactoferricin was the most potent . \n the minimal inhibitory concentration ( mic ) of lactoferricin b differs according to their source . \n a comparison of the mic values of lactoferricin shows that bovine lactoferricin is the most potent . \n the mic of bovine lactoferricin against certain e. coli strains has been found to be around 30 g / ml while that derived from human is more than 100 g / ml . the efficiency of antibacterial activity of bovine lactoferricin is due to the presence of high amount of net positive charge ( + 8 ) and hydrophobic residues ( primarily w6 , w8 , and m10 ) [ 51 , 88 ] . \n the action of this peptide is also dependent on the ph [ 89 , 103 ] . \n it was shown that only six central residues ( 49 ) among the twenty five residues of the peptide are required for its antimicrobial activity . \n it may be noted that the tetrapeptide krds is present only in human lactoferrin while it shows variations in the sequence of others . \n it has been reported that krds inhibits platelet aggregation [ 105 , 106 ] . \n the bovine lactoferricin has been demonstrated to interact with the negatively charged elements in the membrane of susceptible bacteria and disrupt the cell membrane . \n a synthetic peptide derived from human lactoferricin has been found to be effective in depolarizing the bacterial cytoplasmic membrane with a loss of ph gradient . \n the permeabilizing effect of bovine lactoferricin causes membrane disruption resulting in inhibition of macromolecular biosynthesis and ultimately cell death . \n the mode of action is however different in gram - positive and gram - negative bacteria . in gram - negative bacteria \n antimicrobial peptides act on lipopolysaccharides and in gram - positive bacteria they act on lipoteichoic and teichoic acids . \n in addition to antimicrobial properties , lactoferricin derived from human and bovine origin has also been found to be effective in inhibiting the classical complement pathway . \n this implicates a role of these peptides in suppression of inflammatory effects caused by bacteria . \n the sequence analysis of the lactoferricin from various species indicates that unlike bovine lactoferricin there is only one tryptophan at position 6 ( table 4 ) . \n a further exception to this is equine which has no tryptophan residue in either of the positions . \n this shows that the two tryptophans in lactoferricin are important for its optimal activity against microbes . \n the solution structures of lactoferricin have been determined from bovine and human sources . \n the bovine lactoferricin adopted a distorted antiparallel beta sheet , in complete contrast with its conformation in the intact lactoferrin , as observed in the structures obtained by x - ray crystallography . \n however , the solution structure of human lactoferricin was closer to its structure in native lactoferrin since the amphipathic helix was preserved from gln14 to lys29 . however , the beta - sheet character was not observed in the solution structure of human lactoferricin either . \n lipopolysaccharide ( lps ) , the outer membrane component of gram - negative bacteria , is one of the major causes of endotoxin - induced production of inflammatory cytokines and septic shock . \n lactoferrin has been shown to neutralize the effect of lps - induced toxicity by binding to lps [ 115 , 116 ] . \n the cationic peptide derived from lactoferrin which is responsible for this interaction and release of lps is first identified to be lactoferricin . \n the residues from 28 to 34 of lactoferrin corresponding to the region in human lactoferricin have been identified to have a high affinity for binding to lps . \n the initial binding of the peptide with e. coli has been found to be due to interaction with bacterial lps . \n further studies have shown that bovine lactoferricin can arrest the lps - induced cytokine release by suppressing the il-6 response in human monocytic cells stimulated by lps . \n a synthetic peptide corresponding to the antibacterial region of human lactoferricin was also found to facilitate depolarization of the bacterial cytoplasmic membrane , loss of the ph gradient , and a bactericidal effect in e. coli . \n modelling studies using synthetic peptides derived from human and bovine lactoferricin have shown that these cationic peptides with their positively charged residues first interact with lps carrying negative charges . \n this is followed by hydrophobic interactions between the tryptophan residues of the peptides and the lipid a molecule of lps to promote structural disorganization . \n similarly , a synthetic peptide corresponding to 11 residues of human lactoferricin near its n - terminus has been found to bind to lps and neutralize the lps - induced adverse effects in vitro and in monocytes [ 121 , 122 ] . in yet another study using nmr , it has been observed that this peptide folds into a \n conformation formed by its hydrophobic core and the two clusters of hydrophilic residues of the peptide targets the two phosphate moieties of lipid a in lps . \n the antimicrobial peptides found in nature are classified into four groups according to a combination of their sequence homologies , functional similarities , and common three - dimensional structures . \n the four groups include group 1 , which consists of linear , cationic , and amphipathic - helical peptides , for example , cecropins , magainins , bombinins , and temporins ; group 2 , which consists of -strands connected by intramolecular disulfide bridges , for example , human -defensin-2 , tachyplesins , and protegrins ; group 3 , which consists of linear peptides with an extended structure , characterized by overrepresentation of one or more amino acids , for example , tritrpticin and indolicidin ; and group 4 , which consists of peptides containing a looped structure , for example , bactenecin , brevinins , and esculentin . in the light of the above classification , human lf1 - 11 ( grrrsvqwcav ) \n consists of a highly variable loop region and a short -strand and is arginine rich , and hence can be classified in group 4 . \n however , the same can not be said about lf1 - 11 from other species , since their conformation may be similar to the human lf1 - 11 in the structure , but they are not rich in arginines . \n the arginine - rich fragment of this peptide is similar to other cationic arginine - rich peptides found in nature which have cell - penetrating activity and hence can traverse the plasma membrane of eukaryotic cells . \n a significant example of arginine - rich peptide that has cell - penetrating property is arginine - rich hiv tat peptide ( grkkrrqrrrppq ) . on the other hand \n , lactoferrampin belongs to group 1 which consists of linear , cationic , and amphipathic - helical peptides . \n the alpha - helical amphipathic character of lactoferrampin has been compared with other group i peptides like magainins , bombinins , cecropin a , and temporins and are depicted by the helical wheel representation of the peptides in which the charged and polar residues are found aligned along one side and most of the amino acids with nonpolar side chains occupy the opposite side of the helical cylinder ( figure 3 ) . \n the spatial segregation of the hydrophobic and hydrophilic residues designates the amphipathic nature of the peptides [ 127 , 128 ] . \n these peptides upon interaction with target membranes fold into an amphipathic -helix with one face of the helix predominantly containing the hydrophobic amino acids and the opposite face the charged amino acids . \n the presence of a prominent hydrophobic face is observed in the helical wheel representations of magainin 2 , bombinin , and temporin ( figures 3(a ) , 3(b ) , and 3(c ) ) whereas a pronounced cationic domain is present on the hydrophilic surface of the helical wheel diagram of bovine lactoferrampin like that in cecropin a ( figures 3(d ) and 3(e ) ) . \n the positively charged domain is more distinct in bovine than human lactoferrampin ( data not shown ) . \n the analysis suggests that there is very little similarity in the amino acid sequence within the group ; however there is a distinct trend in the distribution of different types of residue , that is , hydrophobic and charged , polar , and so forth , within the secondary structure of the helix . \n sequence similarities between lactoferricin and dermaseptin and magainins suggest that lactoferricin may act as an amphipathic alpha - helix . \n the active hexapeptide fragment within bovine lactoferricin peptide showed distinct similarities with lf1 - 11 and other amphipathic tryptophan and arginine - rich antimicrobial peptides found in other sources apart from lactoferrin ( table 5 ) . \n bovine lactoferricin contains two tryptophan residues at positions 6 and 8 and two arginines at positions 4 and 5 . \n these two amino acids have chemical properties which are one of the critical components of antimicrobial peptides . \n enzymatic digestion of lactoferrin results in the generation of antimicrobial peptides which display antimicrobial properties , in some cases , with greater potency than the native lactoferrin , possibly for the protection of neonates against the invading pathogens . \n these peptides , all from the n - lobe of lactoferrin , show a remarkable similarity to cationic antimicrobial peptides found in other invertebrate and vertebrate species . \n though there may be minor variations in the sequence and the conformational features among these lactoferrin peptides from various species , the basic framework tends to be similar and conserved . \n this indicates that these peptides play a significant role in the antimicrobial function of this protein . \n the antimicrobial effect of cationic peptides of different origins is due to cytoplasmic membrane disruption of the target cell as well as immunomodulation . \n the difference in their functional properties is due to the difference in their amino acid composition inspite of sharing amphipathic and cationic characteristics . \n the presence of all these antimicrobial peptides in a single domain of lactoferrin suggests that the protein acts on the membrane interface and disturbs the membrane integrity resulting in its antimicrobial activity . \n since lactoferrin is found in the milk and is ingested throughout the life of all neonates and most adults , it may be an excellent agent for administration to humans . in the future ,", "role": "user" }, { "content": "lactoferrin is a multifunctional , iron - binding glycoprotein which displays a wide array of modes of action to execute its primary antimicrobial function . \n it contains various antimicrobial peptides which are released upon its hydrolysis by proteases . \n these peptides display a similarity with the antimicrobial cationic peptides found in nature . in the current scenario of increasing resistance to antibiotics , \n there is a need for the discovery of novel antimicrobial drugs . in this context , the structural and functional perspectives on some of the antimicrobial peptides found in n - lobe of lactoferrin have been reviewed . \n this paper provides the comparison of lactoferrin peptides with other antimicrobial peptides found in nature as well as interspecies comparison of the structural properties of these peptides within the native lactoferrin .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: sinomenine ( 7,8-didehydro-4-hydroxyl-3,7-dimethoxy-17-methylmorphinan-6-one , chemical structure is shown in figure 1 ) is an alkaloid isolated from the stem and root of chinese medical plant sinomenium acutum rehd . \n because of its analgesic and anti - inflammatory effects , sinomenine has been utilized clinically to treat rheumatoid arthritis and neuralgia [ 1 , 2 ] . in order to prevent the negative gastrointestinal adverse reactions and low bioavailability of sinomenine oral preparations , \n for example , microemulsion based gel , liposome , and ethosomes had been documented in the literature . \n we concerned the development of sinomenine preparations for a long time and found cubosome , a novel kind of transdermal drug delivery system , could be very well suitable to the sinomenine . \n cubosome and liposome both had the bilipids membrane , but cubosome showed better storing stability compared to liposomes . \n cubosome could also enhance the drug deposition in the skin and showed excellent skin - targeted characteristics . \n our previous experiment has proved cubosome could enhance sinomenine skin permeation ( 7-fold compared to gel ) and a patent was applied in china ( zl 201310087778.6 ) . here \n glycerol monooleate ( dimodan mo / d kosher , material number 116703 ) was kindly provided by danisco cultor ( brabrand , denmark ) . \n poloxamer 407 ( peo98pop67peo98 ) was a gift from basf ( ludwigshafen , germany ) . \n ( guangdong , china ) . methanol ( chromatographic grade ) was purchased from tianjin fuyu chemical co. , ltd . \n water purified through a flow water purification system ( qingdao , china ) was used throughout this study . \n pbs ( ph 6.8 ) was made according to the chinese pharmacopoeia ( 2010 ) . \n analyses were performed on uv-6000s spectrophotometer ( shanghai metash instruments co. , ltd . ) and lc-20at high performance liquid chromatograph with spd-20a uv - detector ( shimadzu ( suzhou ) instruments co. , ltd ) . \n firstly , glycerol monooleate ( 2.7 g ) and poloxamer 407 ( 0.3 g ) were first melted at 60c in a hot water bath until they were homogeneous , after which sinomenine ( 0.3 g ) was added to blend under continuous stirring . \n water ( 6.7 ml ) was then added gradually and the mixture was vortex - mixed to achieve a homogeneous state . \n after equilibration for at least 48 hours at room temperature , the cubic phase gel was formed . by adding 20 ml of water , the cubic gel was disrupted by mechanical stirring . \n subsequently , the crude dispersion was fragmented for 10 min by intermittent probe sonication . \n the analytical column was an hichrom c18 column ( 4.6 250 mm , 5 m , inner diameter , 5 m ) . \n the mobile phase was methanol - pbs(ph6.8)-triethylamine ( 50 : 50 : 0.1% ) with a flow rate of 1 ml / min , and the detection wavelength was at 265 nm . \n sinomenine stock solution was prepared in 50% methanol solution and sonicated for 5 min to obtain stock solution concentrations of 320 g / ml . this solution was further diluted with 50% methanol solution to yield solutions containing 160.0 , 80.0 , 40.0 , 20.0 , 10.0 , 5.0 , 2.5 , and 1.25 g / ml . \n 0.2 ml ( approximately 200 mg ) of cubosome nanoparticles was accurately transferred into a 10 ml volumetric flask , dissolved , and made up to volume with methanol . \n then , the sample solutions were filtered using a 0.45 m filter membrane and 10 l aliquot was injected into the hplc system . \n the milky coarse dispersions of phytantriol - based sinomenine cubosomes were obtained ( figure 2 ) . \n the cubosomal particle size was determined by photon correlation spectroscopy using a zetasizernano zs90 ( malvern instruments malvern , uk ) at 25c . the mean z - average diameter and polydispersity indices ( pdi ) \n the mean diameter of different cubosome dispersions was in an approximate range of 177.8 nm with the polydispersity indices ( pdi ) value of 0.158 ( figure 3 ) . \n uv spectrum of sinomenine showed maximum absorbance at 265 nm wavelength ( figure 4 ) . \n therefore , 265 nm was selected as the detection wavelength . in selected spectrometry conditions , \n the response was high and the retention time was less than 10 min with good reproducibility . \n blank cubosome sample was prepared according to section 2.3 ( no sinomenine ) , and the chromatogram was shown in figure 5(a ) . \n a certain concentration of sinomenine standard solution and sinomenine cubosome sample solution were injected into the hplc system with the same operation , and the chromatogram was shown in figures 5(b ) and 5(c ) . \n obviously , the peaks of the sinomenine were well separated and were not affected by the excipients . \n the calibration curves for sinomenine were found to be linear within the range of 1.25 to 320.0 g / ml . the regression equation was a = 10835c + 1058 ( r = 1.0 ) , where a is peak area and c is the concentration ( g / ml ) of sinomenine standard solution . \n the correlation coefficient indicated a good linear relationship between peak area and concentration over a wide range . \n mean recovery for sinomenine at different concentration levels was found to be 100.3 2.2% ( rsd = 2.19% , n = 3 ) , 103.1 2.2% ( rsd = 2.2% , n = 3 ) , and 103.3 1.7% ( rsd = 1.6% , n \n the low values of rsd revealed the present method was accurate , reliable , and reproducible . \n the lod ( signal / noise ratio of 3 : 1 ) and loq ( signal / noise ratio of 10 : 1 ) were determined as 7.8 10 g / ml and 2.6 10 g / ml , respectively . \n the mean concentration was 8.0 mg / ml ( rsd = 1.9% , n = 3 ) . \n the stress testing showed the cubosome was physically stable under high temperature ( 60c ) within 10 days ( figure 6 ) . \n it was similar to the literatures in which cubosomes showed better storing stability at room temperature and could endure heat treatment compared to liposome [ 911 ] . that also provided the base for the practicability and scientificalness of the formulations and process parameters . \n in this work , we used hplc method to separate and determine the sinomenine in cubosome nanoparticles . \n calculated by samples , the intra- and interassay precision ( rsd ) were less than 2% . \n the separation time was 8.53 min and the excipients did not interfere with the detection of sinomenine .", "role": "user" }, { "content": "we applied hplc technique to quantitatively analyze sinomenine in cubosome nanoparticles . \n the chromatographic method was performed by using an isocratic system . \n the mobile phase was composed of methanol - pbs(ph6.8)-triethylamine ( 50 : 50 : 0.1% ) with a flow rate of 1 ml / min ; the detection wavelength was at 265 nm . \n sinomenine can be successfully separated with good linearity ( the regression equation is a = 10835c + 1058 ; r2 = 1.0 ) and perfect recovery ( 102.2% ) . \n the chromatograph technique was proper for quality control of sinomenine in cubosome nanoparticles .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: hydatid disease , although rare , is still endemic in many countries , representing an important public health problem . \n reviews show that the most frequently involved organs are the liver ( 55% ) and lungs ( 40% ) . \n rarely , hydatid disease may be found in the spleen ( 1.8% ) , kidneys ( 1.4% ) bones ( 0.1% ) or other sites ( 1.7% ) . \n a common complication of hepatic hydatid disease is the rupture of the cyst caused by the increased pressure within it ( 2 ) . \n cysts may rupture into the biliary tree , the peritoneal or pleural cavity , the pericardium , the gastrointestinal tract , or even into blood vessels . \n the aim of this study was to present an unusual case of hydatid cyst coexisting with choledocholithiasis and obstructive jaundice , in which the increased intraluminal pressure in the right hepatic duct led to the decompression of the biliary tree in to the cystic cavity . \n a 60-yr - old female , coming from a rural area , was referred in march 2009 to the emergency department complaining for right upper quadrant pain and jaundice . \n the laboratory examinations on admission were : white blood cell count ( wbc ) : 10,000/l without eosinophilia ; lactate dehydrogenase ( ldh ) 1,209 /l ; serum glutamic oxaloacetic transaminase ( sgot ) 256 /l ; serum glutamic pyruvic transaminase ( sgpt ) 401 /l ; total bilirubin 5.5 mg / dl with direct bilirubin 3.6 mg / dl . \n abdominal ultrasound revealed multiple echinococcal cystic lesions in the right lobe of the liver . additionally , the gallbladder was distended , containing multiple small stones and mud , while the intrahepatic biliary tree and the common bile duct were dilated . \n the subsequent computed tomography ( ct ) showed a huge multisegmented hydatid cyst of the right lobe occupying the segments v , vi , and vii , the intra- and extra - hepatic biliary trees were dilated ( fig . \n she was treated conservatively , her transaminasemia and hyperbilirubinemia subsided and the patient was discharged seven days later . \n her biochemical and hematological tests revealed severe transaminasemia and hyperbilirubinemia ( sgot 358 /l ; sgpt 491 /l ; ldh 754 /l ; bilirubin 12.7 mg / dl with direct bilirubin 8.3 mg / dl ) . \n surprisingly , an acute fall in her bilirubin levels was noticed two days later ( ldh 400 /l ; sgot 175 /l ; sgpt 335 /l ; gamma - glutamyltransferase ( -gt ) 786 /l ; alkaline phosphatase ( alp ) 461 /l ; bilirubin 5.4 mg / dl with direct bilirubin 3,2 mg / dl ) . magnetic resonance cholangiopancreatography ( mrcp ) was performed showing a communication between the echinococcal cyst and the right hepatic duct , while the common hepatic duct and the common bile duct were full with material of unknown origin ( fig . \n multiple gallstones were removed from the common bile duct . additionally , partial cystectomy was performed . surprisingly , pigmented gallstones with daughter cysts were found and removed from the echinococcal cystic cavity ( fig . \n 3 ) . the intra - operative cholangiogram revealed communication between the echinococcal cyst and the right hepatic duct . \n the cystic cavity and the subhepatic space were drained , and a t - tube was placed into the common bile duct . \n after discharge , albenazole was administered for 3 month cycles , with 14 day intervals . \n her follow - up included ultrasonography and ct scan 3 months and 12 months after the operation . \n they may stabilize , or become calcified , while others may collapse or even completely resolve ( 4 ) . becoming symptomatic may be due to pressure exertion of the cyst on the liver parenchyma , or rupture into surrounding tissues ( 3 ) . when referring to biliary tract , the rupture is common in the right and left hepatic duct and rarely may occur into the hepatic duct junction , common bile duct or cystic duct ( 5 ) . \n hydatid cyst rupture has been classified into three types : i ) contained when only the endocyst ruptures and the cyst contents are confined within the pericyst ; ii ) communicating when the cyst contents escape via biliary radicles and iii ) direct when both the endocyst and the pericyst tear , allowing cyst contents to spill into the pleural or peritoneal spaces ( 6 , 7 ) . in the present case \n a communicating rupture of the echinococcal cyst occurred causing a fistula between the echinococcal cyst and the right hepatic duct . as a result , \n the biliary tree was decompressed , serum bilirubin levels were decreased and the patient improved . \n the communicating type of rupture is the most frequent complication , representing approximately 50% of cases on admission ( 6 ) . \n the mechanism of intrabiliary rupture seems to be that of entrapment of small bile duct radicles in the pericyst , which due to increased intracystic pressure undergo atrophy resulting in rupture ( 8) . following cyst enlargement , communication with larger ducts \n most hydatid cysts of the liver eventually leak into small bile ducts or perforate into larger ones . \n in large surgical series , some sort of communication was found in 40%-90% of cysts ( 9 ) . in our case , \n the progressive growth of the cyst led its wall to be adjacent to the right hepatic duct , while choledocholithiasis and subsequent obstruction increased the pressure inside the biliary tree . \n this combination resulted in the rupture of the right hepatic duct into the hydatid cyst to decompress the biliary tree and as a result a biliocystic fistula was established . \n intrabiliary rupture can occur with two different clinical settings which are followed by certain symptoms . \n these are occult communication ( 10%-37% ) and frank intrabiliary rupture ( 3%-17% ) ( 10 ) . \n the occult rupture is usually silent and may be accompanied by suppuration or can evolve towards a frank rupture ( 9 ) . in the frank rupture daughter vesicles and fragmented membranes \n the present case was probably an occult communication , which evolved towards a frank rupture . \n echogenic material , without posterior acoustic shadowing in the extrahepatic ducts , is a finding implying the presence of intracystic material ( 12 ) . \n abdominal ct scan may reveal the dilated common bile duct with low attenuation intraluminal material , suggesting the presence of hydatid sand and cysts ( 13 ) . \n recently , magnetic resonance imaging ( mri - mrcp ) has proven to be a useful noninvasive diagnostic modality in cases of intrabiliary rupture , whereas ct scan and ultrasound results are inconclusive ( 13 ) . \n endoscopy is a modality serving both diagnostic and therapeutic aims . during preoperative endoscopic retrograde cholangiopancreatography ( ercp ) , daughter cysts \n may be seen in the duodenum , impacted in the ampulla of vater or obstructing any part of the biliary tree ( 14 , 15 ) . \n moreover , postoperative ercp may resolve obstruction or cholangitis due to residual material in biliary ducts , while providing management of postoperative external biliary fistulae ( 15 ) . \n additionally , endoscopic sphincterotomy has proved to be an alternative treatment for patients with biliary hydatid disease ( 12 ) . in case of cystobiliary communication \n various types of procedures have been proposed such as : partial cystectomy with primary closure , partial cystectomy with drainage , cystotomy with drainage , hepatic resection ( atypic , segmentary or lobar ) and omentoplasty ( 9 ) . \n suturing of the cystobiliary fistula , and if feasible common bile duct exploration using intraoperative cholangiography are also required ( 11 ) . if the biliary tract is cleaned of all cystic content , a t - tube drain is usually sufficient . in conclusion , \n rupture of a hepatic hydatid cyst into the biliary tree is the most common complication of hydatid disease . \n however , it is possible that the rupture is being done conversely , relieving the patient from the obstructive symptoms . \n further surgical treatment may be required if an obvious communication between the biliary tree and the hydatid cyst is displayed .", "role": "user" }, { "content": "echinococcal disease can develop anywhere in the human body . \n the liver represents its most frequent location . \n hepatic hydatid cysts may rupture into the biliary tract , thorax , peritoneum , viscera , digestive tract or skin . \n we report a rare case with rupture of the right hepatic duct into a hydatid cyst in a woman with known hydatid disease and choledocholithiasis . \n the increased intra - luminal pressure in the biliary tree caused the rupture into the adjacent hydatid cyst . \n the creation of the fistula between the right hepatic duct and the hydatid cyst decompressed the biliary tree , decreased the bilirubin levels and offered a temporary resolution of the obstructive jaundice . \n rupture of a hydatid cyst into the biliary tree usually leads to biliary colic , cholangitis and jaundice . \n however , in case of obstructive jaundice due to choledocholithiasis , it is possible that the cyst may rupture by other way around while offering the patient a temporary relief from his symptoms .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: mechanical stimulation regulates growth , differentiation , motility , and apoptosis in many cell types . \n therefore , understanding the mechanisms by which mechanical stimuli are transmitted within cells and are subsequently transduced into biochemical signals is a critical issue in cellular and tissue engineering . \n mechanical forces applied to cell surfaces activate a variety of mechanotransducers including mechanosensitive ion channels , cell - cell adhesion complexes , g - protein - coupled receptors , focal adhesion sites , and the nucleus . \n stimulation of these structures elicits the activation of downstream signaling pathways that ultimately regulate gene expression and protein synthesis and hence modulate cellular phenotype . \n an important feature of cellular mechanotransduction is that mechanical signals can be transmitted very rapidly to intracellular sites far away from the location of force application . \n for example , recent experiments on vascular smooth muscle cells have demonstrated mechanical activation of the tyrosine kinase src more than 50 m away from the point of force application in less than 300 msec . \n this time constant of mechanical signal transmission is orders of magnitude faster than that associated with reaction - diffusion signaling cascades which typically require more than 10 sec to travel the same distance . \n it has been suggested that rapid long - distance mechanical signal transmission occurs via the cytoskeleton , most notably the actin stress fiber network . in support of this notion , both pharmacological disruption of actin filaments and dissipation of stress fiber prestress ( i.e. , pre - existing tension provided by the actomyosin machinery ) appear to impair rapid long - distance mechanochemical conversion in smooth muscle cells . despite the experimental evidence implicating actin stress fibers in rapid long - distance mechanical signal transmission , how this transmission occurs remains unknown . \n it has been conjectured that mechanical forces applied to cell surfaces generate elastic stress waves which rapidly propagate through actin stress fibers , thus transferring the mechanical stimulus . in order to evaluate the plausibility of this conjecture \n , we recently developed a mathematical model for mechanical stimulus transmission through an actin stress fiber . \n this model accounts for the various physical factors that govern stress fiber displacement in response to an applied force including fiber inertia , prestress generated by myosin motor activity , fiber viscoelasticity , and cytosolic damping . \n as described in more detail in the next section , the predictions of this model raise doubts about the validity of the elastic stress wave conjecture . \n the editors of communicative and integrative biology invited us to submit a brief follow - up to our earlier modeling study . \n thus , in the present paper we use dimensional analysis to : 1 ) further evaluate the plausibility of the elastic stress wave conjecture , and 2 ) qualitatively describe expected mechanical signal transmission dynamics in simple stress fiber networks . \n stress fibers are viscoelastic structures that are surrounded by cytosolic fluid . if the internal ( material ) viscosity of stress fibers and the viscosity of the surrounding cytosol were both negligible , then the elastic stress wave speed within a stress fiber would be predicted to be [ where and are the density and elastic modulus of the stress fiber , respectively ] . at this speed , the time scale for a mechanical stimulus to travel a typical intracellular distance of would be : at first glance , this time scale appears to be consistent with the experimental findings on the dynamics of src activation described above . \n however , recent experiments on the dynamics of stress fiber retraction following laser severing suggest prominent viscoelastic behavior with large values of stress fiber internal ( or material ) viscosity [ ] . \n a simple dimensional analysis in the case of a viscoelastic stress fiber leads to the following time scale for mechanical stimulus transmission : this time scale is very much larger than the time scale for rapid mechanotransduction . \n ( 1 ) and ( 2 ) , the influence of stress fiber prestress does not appear , even though a number of experimental studies have reported that prestress plays a crucial role in rapid cytoskeleton - mediated mechanical stimulus transmission . \n therefore , the following question naturally arises : what is the fundamental mechanism that governs rapid mechanical stimulus transmission through actin stress fibers ? in our recently published modeling study , we considered mechanical signal transmission through an actin stress fiber . \n the model accounted for stress fiber inertia , prestress generated by myosin motor activity , fiber viscoelasticity ( elasticity , bending rigidity and material viscosity implemented using the kelvin - voigt model following recent measurements ) , and cytosolic damping ( an external damping force based on the assumption of stokes flow ) . \n thus , two types of system damping were considered : internal ( material ) damping due to the viscous portion of the viscoelastic mechanical behavior and external damping due to cytosolic drag resulting from stress fiber displacement . \n the model equations for small amplitude stress fiber displacement were solved in response to forces applied either orthogonal to or in the direction of the stress fiber axis as depicted in figure 1 . \n the results demonstrated that when the force is applied in the transverse direction ( fig . \n 1a ) , prestress in the stress fiber acts as the primary restoring ( spring - like ) force and dominates the effect of bending rigidity . \n this restoring force is balanced virtually entirely by the stress fiber 's material viscosity , whereas the roles of both stress fiber inertia and cytosolic damping are negligible . \n a dimensional analysis of this force balance leads to the following time scale for mechanical stimulus transmission for a force applied in the transverse direction : figure 1 . \n schematic diagram of the model for mechanical stimulus transmission through an actin stress fiber in hwang and barakat . \n a prestress is generated due to myosin motor activity and is assumed to be uniformly distributed throughout the stress fiber . \n forces are applied to the stress fiber at a location close to the integrin ( ) in the direction ( a ) orthogonal to the stress fiber axis and ( b ) along the stress fiber axis . where and are the prestress level and the radius of the stress fiber , respectively . \n in contrast , when the force is applied in the axial direction ( fig . \n therefore , elasticity acts as the only restoring force and is balanced primarily by the damping force due to material ( internal ) viscosity . as in the case of transverse motion , \n therefore , using dimensional analysis , the time scale for mechanical stimulus transmission for a force applied along the stress fiber axis is found to be : the dimensional scaling above implies that mechanical signal transmission via deformation of actin stress fibers is anisotropic with very different dynamics depending on the direction of force application . in practice , forces applied to the surface of a cell within which stress fibers are randomly oriented would be expected to lead to both transverse and axial loading on the stress fibers ; thus , both time scales derived in eq . \n ( 3 ) above would be observed simultaneously . the time scale for transverse motion in eq . \n ( 3a ) is consistent with the experimental observations of long - distance and rapid stress fiber - mediated src activation . \n ( 3b ) , which corresponds well to the viscoelastic time scale provided by eq . \n ( 2 ) as well as the experimental measurements on the dynamics of stress fiber retraction following severing , is found to be much larger than the time scale for transverse motion . \n these results suggest that rapid mechanical stimulus transmission in cells is only enabled via transverse stress fiber motion . \n importantly , these dynamics are not mediated by the elasticity of the stress fiber but rather by its prestress , consistent with experiments showing that dissipation of prestress inhibits rapid mechanical stimulus transmission . \n these results lead us to conclude that the elastic stress wave conjecture proposed in previous studies and whose dynamics scale according to eq . \n ( 1 ) is likely not the mechanism by which mechanical stimuli are rapidly transmitted via actin stress fibers . \n rather , stress fiber deformation whose dynamics are governed by the balance between prestress and material viscosity constitutes the likely mechanism for this transmission . \n the discussion thus far has been confined to mechanical signal transmission dynamics in a single actin stress fiber . \n the cytoskeleton , of course , is a complex network of tightly linked filaments , and network topology is expected to modulate the dynamics of mechanical stimulus transmission . \n in order to probe this issue in a qualitative manner , we will use dimensional analysis to investigate the two representative networks shown in figure 2 . \n figure 2a represents a network where stress fibers are randomly linked to one another , whereas figure 2b depicts a network of highly organized and aligned stress fibers . for both networks , \n we consider that a mechanical force is applied to a particular location on the cell surface . in the case of the network in figure 2a \n , we expect the resulting steady - state longitudinal and transverse deformations for each stress fiber to be approximately equal due to the links among the stress fibers : i.e. , , where and are the longitudinal and transverse deformations of the stress fiber . \n the longitudinal and transverse forces along the stress fiber can then be approximated as and , respectively . \n therefore , the work done on the stress fiber network by the mechanical force applied at the cell surface can be written as : figure 2 . \n schematic diagram of two representative stress fiber networks : ( a ) randomly oriented case ; ( b ) case where stress fibers are aligned nearly parallel to one another . a force is applied to an integrin on the cell surface to which an actin stress fiber is linked as shown . while the potential energy stored in the stress fiber network can be approximated as here , note that implying that some of the work done by the applied force is lost due to the material ( internal ) viscous damping force which acts as frictional work within the network . \n the lost work done due to the material damping force scales as : where is the time scale for which the damping force is active . here \n , it should be pointed out that the lost work done related to the vertical motion is proportional to because the vertical damping force of the fiber is given as ( where is the axial direction of the fiber ) . using eqs . \n ( 4a)-(4c ) , the energy balance , yields the following : this result implies that the mechanical stimulus applied to the cell surface for the network in figure 2a would be transmitted to other subcellular sites with a time scale of o(1 ) sec . \n in contrast , if the stress fiber network is highly organized as in figure 2b , the time scale for mechanical stimulus transmission , similar to the case of a single stress fiber , would be determined by the direction of the applied force relative to the orientation of the organized network . in this case \n , the fastest time scale of mechanical stimulus transmission would be obtained by setting and applying a similar scaling as that given in eq . \n ( 4 ) to the aligned stress fiber network depicted in figure 2b yields the time scale given in eq . \n the dimensional analysis based on energy balance outlined above for idealized and simple networks suggests that the topology of the cytoskeletal network plays a critical role in determining the dynamics of mechanical stimulus transmission . \n importantly , this conclusion remains robust over a wide range of stress fiber dimensions and mechanical properties . \n this is important in light of the large variations in these properties reported in the literature for different cell types , measurement techniques , and experimental conditions . \n examples of these variations include stress fiber elastic modulus in the range of 10 - 10 pa , stress fiber prestress in the range of 10 - 10 pa , and stress fiber radius in the range of 0.1 - 0.4 m . \n the finding that the topology of stress fiber networks plays an important role in regulating how rapidly forces applied to cell surfaces are transmitted within the intracellular space may have a number of important physiological implications . \n the two different network topologies analyzed in this study are broadly representative of distinct phenotypes of vascular endothelial cells . \n the network with randomly oriented stress fibers is characteristic of cuboidal ( or round ) endothelial cells found in arterial regions prone to the development of early atherosclerotic lesions . within these regions , \n in contrast , the network with highly aligned stress fibers is representative of elongated endothelial cells within arterial zones that are largely protected from the disease and within which endothelial cells exhibit an anti - inflammatory phenotype . in light of the role of blood flow - derived mechanical forces in the development of atherosclerosis , a particularly intriguing notion that merits experimental investigation is whether or not the endothelial dysfunction observed in atherosclerosis - prone endothelial cells is related to those cells ' inability to transmit force and hence \n it is of course recognized that the conclusions made in the present work are based on approximate scaling arguments and on highly simplified stress fiber network topologies . in cells , \n stress fiber networks are three - dimensional and are expected to exhibit considerably more complicated topologies . \n furthermore , other components of the cellular cytoskeleton , most notably microtubules and intermediate filaments , probably interact with stress fibers and influence the dynamics of mechanical signal transmission ; however , the nature of these interactions remains poorly understood . \n therefore , a more complete understanding of how stress fiber network topology modulates the dynamics of mechanical stimulus transmission awaits extending the current dimensional analysis to a quantitative study of mechanical signal transmission in realistic stress fiber networks that also account at some level for interactions with microtubules and intermediate filaments . \n such an analysis promises to significantly enhance our understanding of cellular mechanotransduction and its implications for health and disease . \n stress fibers are viscoelastic structures that are surrounded by cytosolic fluid . if the internal ( material ) viscosity of stress fibers and the viscosity of the surrounding cytosol were both negligible , then the elastic stress wave speed within a stress fiber would be predicted to be [ where and are the density and elastic modulus of the stress fiber , respectively ] . at this speed , the time scale for a mechanical stimulus to travel a typical intracellular distance of would be : at first glance , this time scale appears to be consistent with the experimental findings on the dynamics of src activation described above . \n however , recent experiments on the dynamics of stress fiber retraction following laser severing suggest prominent viscoelastic behavior with large values of stress fiber internal ( or material ) viscosity [ ] . \n a simple dimensional analysis in the case of a viscoelastic stress fiber leads to the following time scale for mechanical stimulus transmission : this time scale is very much larger than the time scale for rapid mechanotransduction . \n ( 1 ) and ( 2 ) , the influence of stress fiber prestress does not appear , even though a number of experimental studies have reported that prestress plays a crucial role in rapid cytoskeleton - mediated mechanical stimulus transmission . \n therefore , the following question naturally arises : what is the fundamental mechanism that governs rapid mechanical stimulus transmission through actin stress fibers ? in our recently published modeling study , we considered mechanical signal transmission through an actin stress fiber . \n the model accounted for stress fiber inertia , prestress generated by myosin motor activity , fiber viscoelasticity ( elasticity , bending rigidity and material viscosity implemented using the kelvin - voigt model following recent measurements ) , and cytosolic damping ( an external damping force based on the assumption of stokes flow ) . \n thus , two types of system damping were considered : internal ( material ) damping due to the viscous portion of the viscoelastic mechanical behavior and external damping due to cytosolic drag resulting from stress fiber displacement . \n the model equations for small amplitude stress fiber displacement were solved in response to forces applied either orthogonal to or in the direction of the stress fiber axis as depicted in figure 1 . \n the results demonstrated that when the force is applied in the transverse direction ( fig . \n 1a ) , prestress in the stress fiber acts as the primary restoring ( spring - like ) force and dominates the effect of bending rigidity . \n this restoring force is balanced virtually entirely by the stress fiber 's material viscosity , whereas the roles of both stress fiber inertia and cytosolic damping are negligible . \n a dimensional analysis of this force balance leads to the following time scale for mechanical stimulus transmission for a force applied in the transverse direction : figure 1 . \n schematic diagram of the model for mechanical stimulus transmission through an actin stress fiber in hwang and barakat . \n a prestress is generated due to myosin motor activity and is assumed to be uniformly distributed throughout the stress fiber . \n forces are applied to the stress fiber at a location close to the integrin ( ) in the direction ( a ) orthogonal to the stress fiber axis and ( b ) along the stress fiber axis . where and are the prestress level and the radius of the stress fiber , respectively . \n in contrast , when the force is applied in the axial direction ( fig . \n therefore , elasticity acts as the only restoring force and is balanced primarily by the damping force due to material ( internal ) viscosity . as in the case of transverse motion , \n therefore , using dimensional analysis , the time scale for mechanical stimulus transmission for a force applied along the stress fiber axis is found to be : the dimensional scaling above implies that mechanical signal transmission via deformation of actin stress fibers is anisotropic with very different dynamics depending on the direction of force application . in practice , forces applied to the surface of a cell within which stress fibers are randomly oriented would be expected to lead to both transverse and axial loading on the stress fibers ; thus , both time scales derived in eq . \n ( 3 ) above would be observed simultaneously . the time scale for transverse motion in eq . \n ( 3a ) is consistent with the experimental observations of long - distance and rapid stress fiber - mediated src activation . \n ( 3b ) , which corresponds well to the viscoelastic time scale provided by eq . \n ( 2 ) as well as the experimental measurements on the dynamics of stress fiber retraction following severing , is found to be much larger than the time scale for transverse motion . \n these results suggest that rapid mechanical stimulus transmission in cells is only enabled via transverse stress fiber motion . \n importantly , these dynamics are not mediated by the elasticity of the stress fiber but rather by its prestress , consistent with experiments showing that dissipation of prestress inhibits rapid mechanical stimulus transmission . \n these results lead us to conclude that the elastic stress wave conjecture proposed in previous studies and whose dynamics scale according to eq . \n ( 1 ) is likely not the mechanism by which mechanical stimuli are rapidly transmitted via actin stress fibers . \n rather , stress fiber deformation whose dynamics are governed by the balance between prestress and material viscosity constitutes the likely mechanism for this transmission . \n the discussion thus far has been confined to mechanical signal transmission dynamics in a single actin stress fiber . \n the cytoskeleton , of course , is a complex network of tightly linked filaments , and network topology is expected to modulate the dynamics of mechanical stimulus transmission . in order to probe this issue in a qualitative manner \n , we will use dimensional analysis to investigate the two representative networks shown in figure 2 . \n figure 2a represents a network where stress fibers are randomly linked to one another , whereas figure 2b depicts a network of highly organized and aligned stress fibers . for both networks , we consider that a mechanical force is applied to a particular location on the cell surface . in the case of the network in figure 2a , we expect the resulting steady - state longitudinal and transverse deformations for each stress fiber to be approximately equal due to the links among the stress fibers : i.e. , , where and are the longitudinal and transverse deformations of the stress fiber \n . the longitudinal and transverse forces along the stress fiber can then be approximated as and , respectively . \n therefore , the work done on the stress fiber network by the mechanical force applied at the cell surface can be written as : figure 2 . \n schematic diagram of two representative stress fiber networks : ( a ) randomly oriented case ; ( b ) case where stress fibers are aligned nearly parallel to one another . \n a force is applied to an integrin on the cell surface to which an actin stress fiber is linked as shown . while the potential energy stored in the stress fiber network \n can be approximated as here , note that implying that some of the work done by the applied force is lost due to the material ( internal ) viscous damping force which acts as frictional work within the network . the lost work done due to the material damping force scales as : where is the time scale for which the damping force is active . here \n , it should be pointed out that the lost work done related to the vertical motion is proportional to because the vertical damping force of the fiber is given as ( where is the axial direction of the fiber ) . using eqs . \n ( 4a)-(4c ) , the energy balance , yields the following : this result implies that the mechanical stimulus applied to the cell surface for the network in figure 2a would be transmitted to other subcellular sites with a time scale of o(1 ) sec . \n in contrast , if the stress fiber network is highly organized as in figure 2b , the time scale for mechanical stimulus transmission , similar to the case of a single stress fiber , would be determined by the direction of the applied force relative to the orientation of the organized network . in this case \n , the fastest time scale of mechanical stimulus transmission would be obtained by setting and applying a similar scaling as that given in eq . \n ( 4 ) to the aligned stress fiber network depicted in figure 2b yields the time scale given in eq . \n the dimensional analysis based on energy balance outlined above for idealized and simple networks suggests that the topology of the cytoskeletal network plays a critical role in determining the dynamics of mechanical stimulus transmission . \n importantly , this conclusion remains robust over a wide range of stress fiber dimensions and mechanical properties . \n this is important in light of the large variations in these properties reported in the literature for different cell types , measurement techniques , and experimental conditions . \n examples of these variations include stress fiber elastic modulus in the range of 10 - 10 pa , stress fiber prestress in the range of 10 - 10 pa , and stress fiber radius in the range of 0.1 - 0.4 m . \n the finding that the topology of stress fiber networks plays an important role in regulating how rapidly forces applied to cell surfaces are transmitted within the intracellular space may have a number of important physiological implications . \n the two different network topologies analyzed in this study are broadly representative of distinct phenotypes of vascular endothelial cells . \n the network with randomly oriented stress fibers is characteristic of cuboidal ( or round ) endothelial cells found in arterial regions prone to the development of early atherosclerotic lesions . within these regions , \n in contrast , the network with highly aligned stress fibers is representative of elongated endothelial cells within arterial zones that are largely protected from the disease and within which endothelial cells exhibit an anti - inflammatory phenotype . in light of the role of blood flow - derived mechanical forces in the development of atherosclerosis , a particularly intriguing notion that merits experimental investigation is whether or not the endothelial dysfunction observed in atherosclerosis - prone endothelial cells is related to those cells ' inability to transmit force and hence initiate particular intracellular signaling cascades sufficiently rapidly . \n it is of course recognized that the conclusions made in the present work are based on approximate scaling arguments and on highly simplified stress fiber network topologies . in cells , \n stress fiber networks are three - dimensional and are expected to exhibit considerably more complicated topologies . \n furthermore , other components of the cellular cytoskeleton , most notably microtubules and intermediate filaments , probably interact with stress fibers and influence the dynamics of mechanical signal transmission ; however , the nature of these interactions remains poorly understood . \n therefore , a more complete understanding of how stress fiber network topology modulates the dynamics of mechanical stimulus transmission awaits extending the current dimensional analysis to a quantitative study of mechanical signal transmission in realistic stress fiber networks that also account at some level for interactions with microtubules and intermediate filaments . \n such an analysis promises to significantly enhance our understanding of cellular mechanotransduction and its implications for health and disease .", "role": "user" }, { "content": "recent experiments have demonstrated very rapid long - distance transmission of mechanical forces within cells . because the speed of this transmission greatly exceeds that of reaction - diffusion signaling , it has been conjectured that it occurs via the propagation of elastic waves through the actin stress fiber network . to explore the plausibility of this conjecture \n , we recently developed a model of small amplitude stress fiber deformations in prestressed viscoelastic stress fibers subjected to external forces . \n the model results demonstrated that rapid mechanical signal transmission is only possible when the external force is applied orthogonal to the stress fiber axis and that the dynamics of this transmission are governed by a balance between the prestress in the stress fiber and the stress fiber 's material viscosity . \n the present study , which is a follow - up on our previous model , uses dimensional analysis to : ( 1 ) further evaluate the plausibility of the elastic wave conjecture and ( 2 ) obtain insight into mechanical signal transmission dynamics in simple stress fiber networks . \n we show that the elastic wave scenario is likely not the mechanism of rapid mechanical signal transmission in actin stress fibers due to the highly viscoelastic character of these fibers . \n our analysis also demonstrates that the time constant characterizing mechanical stimulus transmission is strongly dependent on the topology of the stress fiber network , implying that network organization plays an important role in determining the dynamics of cellular responsiveness to mechanical stimulation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: current estimates suggest that the number of persons with diabetes will reach 300 million by 2025 . fifty percent of patients who have diabetes for more than 20 years develop peripheral neuropathy ( pn ) , which affects nerve function from the periphery to more proximal regions [ 2 , 3 ] . \n because the increasing prevalence of diabetes is accompanied by gait problems and a heightened risk of falling , there is an increased need for understanding the possible gait pattern changes diabetic patients are confronted with . \n it has , furthermore , been demonstrated that patients with diabetes may also improve their gait due to specific exercise programs [ 5 , 6 ] . in this context gait analysis \n cameras , force platforms , and magnetic and ultrasound systems are thereby often used technologies for the gait analysis [ 7 , 8 ] \n . however , time expenditure and financial constraints limit their use in clinical practice . moreover , gait analyses are traditionally performed indoors , on a predefined , clean , and flat specific pathway . \n such conditions enable precise recording but are not representative of the real - life context . \n activities of daily life require us to move about in challenging environments and to walk on varied surfaces . \n irregular terrain has been shown to influence gait parameters such as speed , especially in a population at risk for falling , for example , patients with diabetes [ 11 , 12 ] . \n furthermore , the fact that falling mainly occurs in a complex environment under attention demanding conditions emphasizes the need for clinicians to objectively record gait data in a real - life context under dual task conditions . \n the recent use of body - fixed sensors suggests that they could serve as a tool for analyzing the gait of patients in more challenging walking environments [ 1618 ] . in comparison with other motion measurement devices , \n body - fixed sensors have the advantage of being lightweight and portable , which enables subjects to move relatively freely . \n they permit data collection in a challenging environment ; they are easy to use , provide a good ratio in terms of cost and amount of information retrieved , and can capture data from many gait cycles . \n thus they seem ideal for extending our understanding of gait changes in specific populations by performing measures in real - life conditions , for example , in diabetic patients . \n an objective evaluation in real - life conditions might help understand the causes of diabetic gait problems and ultimately facilitate the choice or the development of appropriate physical treatment . \n therefore , the potential of body - fixed sensor approaches should be investigated in the diabetic population in order to ensure the validity and the reliability of data recorded during gait analysis under single and dual task conditions on changing types of surfaces . to be clinically useful \n , an assessment procedure must have a small measurement error to detect a real change and must be able to distinguish between subpopulations for example , diabetic patients with and without various stages of peripheral neuropathy . a test - retest difference in a patient with a value smaller than the standard error of the measurement ( sem ) is likely to be the result of measurement noise and is unlikely to be detected reliably in practice ; a difference greater than the smallest real difference is highly likely ( with 95% confidence ) to be a real difference . \n the dynaport minimod body - fixed sensor has previously been shown to be reliable , valid , and valuable in elderly for the analysis of gait performed on challenging surfaces [ 2225 ] . to date , little \n is known about the variability in gait measures within the diabetic population and the reliable use of accelerometers in these patients . with this in mind , we conducted this study to ( a ) investigate the validity and reliability of gait parameters measured with dynaport minimod in diabetic patients walking under single and dual task conditions on a challenging walking course , ( b ) identify the measurement error ( precision ) , and ( c ) identify the smallest clinical detectable difference . \n we hypothesized that walking quality in patients with diabetes can be reliably measured with accelerometers , that the walking quality is different in patient subgroups ( we expect diabetic neuropathy to change gait quality compared to the group with no neuropathy ) , and we believe that severe neuropathy effects walking quality more than mild neuropathy . \n all participants received written and oral information and were requested to sign an informed consent statement . a convenience sample of 31 patients with diabetes type 2 ( with and without neuropathy ) was recruited from the patients consulting the division of endocrinology , diabetes and clinical nutrition , university hospital of zurich ( table 1 ) . patients were included if they were medically diagnosed with diabetes type 2 , were between 50 and 70 years of age , and had the ability to walk without assistive devices . \n patients were excluded if they had concomitant foot ulcer , orthopaedic or surgical problems influencing gait parameters , a nondiabetic neuropathy ( due to charcot - marie - tooth disease , alcohol , or thyroid dysfunction ) , or neurological pathology influencing gait parameters . before gait analysis started , \n a neurometer cpt electrodiagnostic device was used for sensory nerve conduction threshold ( snct ) evaluations at the great toe by determining current perception threshold ( cpt ) levels . \n the used rapid screening cpt ( r - cpt ) resulted in a value between 1 and 25 , where the higher numbers indicate worse nerve conduction . \n the value was used to grade neuropathy : no neuropathy = 613 , moderate neuropathy = 1419 , severe neuropathy = 2025 . \n the rydel - seiffer tuning fork test was used to assess the vibratory threshold perception at the base of the great toe as a good predictor for impairment of the vibratory senses and , therefore , also usable to diagnose neuropathy [ 2729 ] . \n the rydel - seiffer tuning fork test acquires values between 0 and 8 , where the higher values indicate better vibratory senses . \n patients were grouped by the test in one of the three categories with application of an age - related correction . \n the third test used was the semmes - weinstein monofilament test , a good test to diagnose but not to quantify neuropathy . \n if the subjects did not notice five of seven stimuli , a neuropathy was diagnosed . \n testing and group assignment was performed by an md unfamiliar with the study design and the patients . \n based on the results of all three tests the md categorized the patients in one of three categories . \n the md principally considered the results from the neurometer cpt / c tests where three values for every frequency were obtained for the right and the left great toe . \n if at least two frequencies of the worse foot had a value over 14 , the subject was allocated to the moderate neuropathy group . \n if at least two frequencies of the worse foot had a value over 19 , the subject was allocated to the severe neuropathy group . if there were any uncertainties in the group allocation according to r - cpt values , the rydel - seiffer tuning fork test was the next criteria considered . \n the loading of the group arrangement 's criteria was neurometer cpt / c > rydel - seiffer tuning fork > semmes - weinstein monofilament test . \n a triaxial accelerometer ( dynaport minimod , mcroberts bv , the hague , the netherlands ) was used to measure pelvic accelerations \n . the accelerometer was placed at the lower back of the subject with the center of the device at the level of the second sacral vertebrae . \n each subject was assessed during usual walking at preferred velocity under two different conditions over an outdoor gait therapy walkway with different surfaces : ( 1 ) silent walking on the walkway and ( 2 ) walking on the walkway with a counting task . \n the walkway contained a paved trajectory , cobble stones , and gravel rocks ( figure 1(a ) ) . \n the complete walkway was 31 meter long and 1.5 meter wide . to measure steady state- walking , the 16.6 meters ( with the three different surfaces ) of the walking course \n the remaining parts of the walkway were used for acceleration and deceleration . at the end of the first 31 meters the subjects had to stop for two seconds , \n then turn around , and walk the walkway back to the starting point . at the beginning the measurement \n was started ( s ) , and , at the end , the measurement was stopped ( s + m5 ; figure 1(b)).test run with subject 's preferred walking speed : the subject received the most important information : no speaking , hold arms out of the pocket , and try not to stop walking during the measurement.first trial with preferred walking speed : the subject was briefed to walk like you would bring a letter to the mailbox \n ( single task).second trial with preferred walking speed and an additional cognitive task ( count backwards aloud in steps of three ) : the subject had to walk and count aloud in steps of three . \n the subject was briefed to try to walk and count at the same time . \n do not favour one task over the other but try to perform these concurrently ( dual task ) . \n test run with subject 's preferred walking speed : the subject received the most important information : no speaking , hold arms out of the pocket , and try not to stop walking during the measurement . first trial with preferred walking speed : the subject was briefed to walk like you would bring a letter to the mailbox ( single task ) . \n second trial with preferred walking speed and an additional cognitive task ( count backwards aloud in steps of three ) : the subject had to walk and count aloud in steps of three . \n the subject was briefed to try to walk and count at the same time . \n do not favour one task over the other but try to perform these concurrently ( dual task ) . \n the dual task was subtracting repeatedly the number three starting from 200 down and was practiced before gait testing while sitting on a chair . \n subjects were told to try and perform both tasks at the same time without prioritizing either the walking or counting . \n a small receiver was mounted on the accelerometer and the researcher placed a marker in the data through triggering by the use of a remote control when the subjects passed distance lines ( figure 1(b ) ) . \n the researcher walked alongside the subjects to ensure their safety . at the end of the last trial the sd card \n was removed from the accelerometer , and the measurements were checked for completeness on a laptop . \n the subject was asked to come again for the retest one week later at the same time and to wear the same shoes as during the first trial . per trial , all measured data between the two trigger signals ( m1-m2/m3-m4 ) were used for analysis . walking speed ( v ) , cadence , mean values ( x- ) of step duration ( sdu ) and step length ( sl ) , and corresponding standard deviations ( sd ) \n we used the intraclass correlation ( icc(2,1 ) ) with 95% confidence intervals to calculate intervisit reliability between visit 1 and visit 2 . \n icc(2,1 ) was used because individual ratings constitute the unit of analysis , and raters and subjects were conceived as being a random selection . \n there was one week between visit 1 and 2 . to interpret icc(2,1 ) values we used benchmarks suggested by shrout and fleiss ( > 0.75 excellent reliability , 0.40.75 fair to good reliability , and < 0.4 poor reliability ) . \n to evaluate precision the 95% limits of agreement statistics ( bland and altman ) were used . \n it expresses the degree of error proportional to the mean , and was calculated as d-2sddiff [ 33 , 34 ] , where d- is the mean of the difference and sddiff the standard deviation of the difference . \n the measurement error ( standard error of the mean difference ( sem ) ) was reported , and the smallest detectable difference ( sdd ) for each parameter was calculated as described by de vet et al . . \n the smallest detectable change was calculated with the formula 1.96sem2 . to identify differences between groups we used an analysis with planned contrasts . \n all statistical analyses were performed using spss 17 for windows ( spss inc . ) . \n this resulted in complete data for 29 patients ( 21 male and 8 female ) at baseline , mean age : 61.9 ( 5.5 ) years ; body mass index : 28.2 ( 3.5 ) ) kg / m ; leg length 0.84 ( 0.06 ) m ( table 1 ) . \n twelve patients were categorized as diabetic , eleven as mild neuropathy , and six as severe neuropathy . \n post hoc anova revealed that the groups did not differ in age f(2 , 26 ) = 0.949 , p = .40 ; height f(2 , 26 ) = 1.26 , p = .302 ; sdu f(2 , 26 ) = 1.99 , p = .157 ; vf(2 , 26 ) = 3.01 , p = .067 ; cadence f(2 , 26 ) = 1.98 , p = .159 and showed to be different for weight f(2 , 26 ) = 4.729 , p = .018 ; bmi f(2 , 26 ) = 4.28 , p = .025 ; sl f(2 , 26 ) = 3.14 , p = .048 . \n four patients were unable or refused to perform the retest due to time limitations or lack of motivation . for the reliability testing we had twenty - five patients performing retesting ( 17 male and 8 female ) ; mean age : 61 ( 5.7 ) years ; body mass index : 28.7 ( 3.5 ) kg / m , leg length 0.83 ( 0.06 ) m. eleven patients were diabetic , eight mild neuropathy and six severe neuropathy . \n significant differences between the two test conditions at baseline , single versus dual task walking , were identified for all gait parameters ( walking speed : t(28 ) = 3.616 , p = .001 , cadence : t(28 ) = 3.221 , p = .003 , step duration : t(28 ) = 3.112 , p = .004 , and step length : t(28 ) = 2.308 , p = .029 . walking speed , step length , and cadence \n were significantly decreased under dual tasking , and step duration was significantly increased compared to normal walking . \n the results of the repeated measurements for the different gait parameters sdu , sl , v , and cadence are presented in table 2 . except for cadence under dual task condition \n all gait parameters on the walking trajectory under single and dual task walking with regard to test retest reliability are illustrated in figure 2 by bland - altman plots . \n the reliability of single task walking speed , cadence , step duration , and step length was excellent \n ( iccs between 0.8240.898 and sems between 0.035.2 ) and comparable to the reliability of dual task walking speed , cadence , step duration and step length ( iccs between 0.8260.869 and sems between 0.15.38 ) . \n the mean values and standard deviations of the gait parameters of 29 evaluated patients at baseline are reported in table 4 for their grouping . \n planned contrasts showed that there was no significant effect on sdu , v , and cadence and a significant effect of grouping on step length performance . \n the planned contrasts revealed that having mild and severe pn did not significantly alter step length compared to diabetic patients presenting without pn , t(26 ) = 1.318 , p = .101 , and having severe pn significantly influenced step length compared to mild pn , t(26 ) = 2.469 , p = .046 ( one tailed ) . \n this study has shown that the reliability of walking speed , cadence , step duration and step length on different surfaces and under dual task conditions was high with excellent iccs , small sems and rloas in older adults with diabetes using the dynaport minimod system . \n results from discriminant validity were essentially non conclusive , with the exception of step length . \n there are , therefore , only indications that the system might also be able to distinguish between subpopulations within the population of patients with diabetes based on step length . \n the disease status of the elderly participants in our study varied from having diabetes without pn and having diabetes with mild or severe polyneuropathy . \n we thus expected our subjects to represent a heterogeneous group with regard to walking abilities . from previous studies we know that disease severity negatively influences walking velocity especially in challenging environments where patients with neuropathy walk slower when compared to patients without neuropathy . \n we think that the negative findings in our cross - sectional sample are very likely related to the limited statistical power of this analysis and might be attributed to a possible type i error . \n a post hoc power analysis revealed that power ( 1- err prob ) = 0.19 . \n our data allow for an a priori sample size calculation for a future trial with a fixed effects one - way anova design and under the assumption of a moderate effect size of 0.25 . to avoid a type i or ii error in this future trial , \n the gait changes that we observed in dual task walking relative to single task walking are consistent with other studies that demonstrate that cognitive tasks have a destabilizing effect on gait [ 4044 ] . \n this finding seems to indicate that it is important to consider additional cognitive tasks in gait assessment of diabetic patient populations in clinical practice . \n there is scarce information available about the reliability of body fixed sensor approaches to assess gait parameters in older adults with diabetes . \n the iccs for walking speed and cadence that we found were , however , similar to values reported by allet et al . who were using the physilog system in older , diabetic subjects . \n the relative reliability is the degree to which individuals maintain their test results in a sample with repeated measurements and is affected by sample heterogeneity , that means the more heterogeneous a sample is , the higher the relative reliability becomes . \n therefore , a high correlation may still mean unacceptable measurement error for some analytical goals , for example , for individualised assessments , and data about absolute reliabilities of a test are desired for clinical use . \n the determination of what constitutes an acceptable rloa depends on what size difference the researcher or clinician wants to detect when comparing groups or when assessing the effect of interventions . whether the absolute reliability reported here for the gait measures is sufficiently high to identify gait impairments or small effects of an intervention program to improve walking in populations suffering from diabetes \n in particular , the rloas for step length and gait velocity might be indicative for rather large needed changes to be detected with the system . a study that investigated gait recovery in a sample of patients with diabetes due to specific exercises , with a mean age of 63 years and that used the physilog gait analysis system for evaluation in challenging environments , showed that changes in gait velocity of around 0.149 ms , and improvements of 10% for cadence are achievable with specific rehabilitation [ 5 , 6 ] . \n whether such changes are also clinically meaningful should be determined in future studies . in the present study \n we have shown that step length measures derived from the dynaport minimod are significantly different between groups of patients . \n clinical detection of these differences potentially allows the division of diabetes patients into two groups with different mean step length : one with severe np and one without severe np . \n these results support the assertion that there is a relationship between quality of walking and the presence of pn . \n however , these are only preliminary data , and further ( cross - sectional and longitudinal ) research is needed with larger samples to substantiate this observation . to obtain the diagnostic information from a walking test in a challenging environment alone , the outcomes of the gait analysis should be compared with other diagnostic tests in use . \n therefore , bigger samples of subjects should be selected in the future , and with logistic regression analysis the contribution of the dynaport minimod gait assessment to existing diagnostic tests should be estimated more precisely . \n the results of this study demonstrate that walking speed , cadence , step duration , and step length under more challenging conditions can be reliably measured in adults with diabetes using the dynaport minimod system . \n there are first indications that the system is able to discriminate subgroups of patients with diabetes based on their step length . \n further research in diabetic populations is needed to determine the value of these parameters that are derived from this measurement system in clinical settings .", "role": "user" }, { "content": "walking on irregular terrain influences gait of diabetic patients . \n we investigate the test - retest reliability and construct validity of gait measured with the dynaport minimod under single and dual task conditions in diabetic patients walking on irregular terrain to identify the measurement error ( precision ) and minimal clinical detectable change . \n 29 patients with type 2 diabetes were measured once , and 25 repeated the measurement within 7 days . \n patients walked on a therapy garden walkway . \n differences between three groups of diabetics with various levels of lower extremity neuropathy were analyzed with planned contrasts . \n icc was excellent for intervisit measurements with icc 's > 0.824 . \n bland and altman plots , sem , and sdd showed precise values , distributed around zero for both test conditions . a significant effect of grouping on step length performance hints at possible construct validity of the device . \n good reliability of dynaport minimod measurements on a therapy garden walkway and an indication for discriminatory capability suggests that dynaport minimod could facilitate the study of gait in diabetic patients in conditions close to real - life situations . good reliability , small measurement error , and values of minimal clinical detectable change recommend the further utilization of dynaport minimod for the evaluation of gait parameters in diabetic patients .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: human respiratory syncytial virus ( rsv ) is one of the most important infectious agents causing acute lower respiratory tract illness , such as bronchiolitis and pneumonia , in infants and young children [ 1 , 2 ] . \n viral rna generated during rsv replication is recognized by host pattern recognition molecules , such as toll - like receptor 3 ( tlr3 ) and retinoic acid inducible gene - i ( rig - i ) , and it induces type i and type iii interferon [ 3 , 4 ] . \n transcriptional induction of proinflammatory cytokines , chemokines , and interferons is mediated by nf-b and interferon regulatory factors ( irfs ) [ 5 , 6 ] . \n these mediators are believed to contribute to the pathophysiology of rsv infection , such as mucous hypersecretion , swelling of submucous , and infiltration of lymphocytes , neutrophils , eosinophils , and macrophages . frequently , there are coinfections with respiratory viruses , including rsv , and bacteria that cause community - acquired respiratory diseases , such as streptococcus pneumoniae and haemophilus influenzae . \n there is evidence for a positive correlation between infections with s. pneumoniae and rsv in the pathogenesis of otitis media , pneumonia , and meningitis [ 811 ] . \n s. pneumoniae and h. influenzae colonize to the host respiratory epithelium via host cell surface receptors , such as the platelet - activating factor ( paf ) receptor [ 1214 ] . \n these bacteria interact with the paf receptor via phosphorylcholine , which is a component of the bacterial cell surface . \n both live and heat - killed s. pneumoniae cells show an increased adhesion to human epithelial cells infected with rsv . \n the upregulation of paf receptor expression that is induced by respiratory virus infections , including those caused by rsv , results in the enhanced adhesion of s. pneumoniae and h. influenzae to respiratory epithelial cells [ 1517 ] . \n paf receptor expression and s. pneumoniae cell adhesion are also upregulated by exposure to acid , which causes tissue injury and an inflammatory response . \n clarithromycin ( cam ) is 14-membered ring macrolide antibiotic that also acts as a biological reaction modifier with anti - inflammatory properties . in japan , \n cam is applied to diffuse panbronchiolitis , chronic bronchiolitis , otitis media , and chronic sinusitis as an immunomodulator [ 1921 ] . \n the anti - inflammatory mechanism of cam has not yet been completely clarified , but one of the important mechanisms for its anti - inflammatory action is considered to be the suppression of nf-b [ 2224 ] . \n recently , we reported that fosfomycin , which is an antibiotic , suppressed rsv - induced interleukin ( il)-8 , regulated on activation , normal t - cell expressed and secreted ( rantes ) , and the paf receptor by suppressing nf-b activity [ 25 , 26 ] . on the other hand , wang et al . \n report that cam suppressed rhinovirus - induced staphylococcus aureus and h. influenzae adhesions to nasal epithelial cells . \n so we anticipate that cam suppresses rsv - induced bacterial adhesion to epithelial cells , because expression of paf receptor is controlled by nf-b [ 28 , 29 ] in the present study , we examined the effect of cam on cytokine production , paf receptor expression , and rsv infection - induced s. pneumoniae adhesion to respiratory epithelial cells . \n rsv strain long , human type ii pulmonary epithelial cell line a549 and s. pneumoniae strain r6 were obtained from the american type culture collection ( atcc , manassas , va ) . \n the virus titer of rsv was determined using a plaque - forming assay with hep-2 cells as the indicator cells . \n rsv infection to a549 cells was performed at multiplicity of infection ( moi ) of 1 . \n cam was donated by abbott japan ( tokyo , japan ) . a paf receptor antagonist , 1-o - hexadecyl-2-acetyl - sn - glycero-3-phospho(n , n , n ,- \n an nf-b inhibitor , pyrrolidine dithiocarbamate ( pdtc ) , was purchased from sigma - aldrich ( st . louis , mo ) . \n after 24-hour infection , culture supernatants of rsv - infected and -uninfected cells were collected . \n the amounts of il-6 , il-8 , and rantes in the culture supernatants were determined by enzyme - linked immunosorbent assay ( elisa ) ( duoset elisa development kit , r&d systems , minneapolis , mn ) . \n semiquantitative rt - pcr was carried out as described previously [ 4 , 30 ] . \n the cell surface expression of the paf receptor was examined by flow cytometry as previously described . \n the cells were harvested from culture flasks using a cell scraper and then incubated with 2.5 g / ml of mouse anti - paf receptor monoclonal antibody ( 11a4 ( clone 21 ) ; cayman chemical , ann arbor , mi ) or mouse igg2a , isotype control antibody ( ebioscience , san diego , ca ) . \n after incubation at 4c for 30 min , cells were collected by centrifugation and washed once with dulbecco 's phosphate - buffered saline ( pbs ( ) ) . \n cell suspensions were incubated with a phycoerythrin - conjugated goat anti - mouse igg f(ab)2 fragment antibody ( 1 : 100 dilution ) ( abcam , cambridge , uk ) at 4c for 30 min , and the stained cells were assessed with facscalibur ( bd bioscience , san jose , ca ) . \n s. pneumoniae adhesion was assayed using fluorescein - isothiocyanate- ( fitc- ) labeled s. pneumoniae as previously described . \n briefly , a bacterial suspension in 0.1 m nacl-50 mm sodium carbonate buffer ( ph9.5 ) at 1 10 cfu / ml was prepared . \n fitc isomer - i ( dojindo laboratories , kumamoto , japan ) was added at a concentration of 1 mg / ml , and the mixture was incubated at 4c for 1 h. the cells were washed three times with pbs ( ) . \n cam was added to monolayers of a549 cells 1 h prior to rsv infection . \n the a549 cells infected with rsv at an moi of 1 for 24 h and uninfected a549 cells were incubated with fitc - labeled s. pneumoniae cells at moi of 10 for 30 min at 37c . for the control experiments , either 20 g / ml of the paf receptor antagonist or 10 g / ml of the mouse anti - paf receptor monoclonal antibody ( 11a4(clone 21 ) ) was added to the a549 cells 1 h prior to the addition of the fitc - labeled bacteria . \n the cell monolayer was gently washed three times with pbs ( ) and observed by fluorescence microscopy . \n alternatively , the cells were harvested with cell scraper and then assessed by flow cytometry as previously described . \n first , we examined the effect of cam on rsv replication in a549 cells . \n rsv infection to a549 cells was performed at moi of 1 . after 24 and 36 h of infection , significant alterations of the rsv titers or expression levels of g mrna \n were not observed by the addition of cam even at a concentration of 100 g / ml ( figure 1 ) . when a549 cells were infected with rsv at moi of 1 , rantes , il-8 , and il-6 \n these cytokine inductions were significantly suppressed in the presence of cam in a dose - dependent manner ( figure 2 ) . \n the degree of suppression by cam was less than that by an nf-b inhibitor , pdtc . \n paf receptor expression on the cell surface is upregulated during rsv infection in a549 cells . \n the rsv - induced upregulation of the paf receptor was significantly suppressed by cam and pdtc in a dose - dependent manner ( figure 3 ) . \n suppression of the paf receptor expression was also observed when a549 cells were posttreated with cam ( 4 or 12 h after rsv infection ) ( data not shown ) . \n we examined the adhesion of fitc - labeled s. pneumoniae cells to a549 cells by fluorescence microscopy ( figure 4 ) and flow cytometry ( figure 5 ) . \n rsv infection significantly enhanced the adhesion of s. pneumoniae to a549 cells , and this enhancement was suppressed by adding a paf receptor antagonist ( figures 4 and 5 ) or anti - paf receptor monoclonal antibody ( data not shown ) . \n this result indicated that the rsv - induced s. pneumoniae adhesion occurs via the paf receptor on a549 cells . \n these lines of evidence confirmed that the expression of the paf receptor was induced by rsv infection and indicated that this induction , and subsequent rsv - induced s. pneumoniae adhesion , can be suppressed by cam treatment . \n macrolides , with the exception of the 16-membered ring type , have both anti - inflammatory and antibacterial functions [ 20 , 21 ] . \n one of the important mechanisms of anti - inflammatory action is the suppression of nf-b activation [ 2224 ] . \n our recent studies show that rsv upregulates proinflammatory cytokines , such as il-6 , and chemokines , such as il-8 and rantes , in the respiratory epithelial cell line a549 . \n furthermore , the induction of chemokines by rsv is significantly suppressed by an antibiotic , fosfomycin , via suppression of nf-b activation . in the present study , \n cam was shown to suppress il-6 , il-8 , and rantes , which are induced by rsv infection , at concentrations of 10 and 100 g / ml . \n patel et al . reported that the concentration of cam in fluid of the bronchopulmonary epithelial lining was 34.2 5.16 g / ml at 4 h , 23.01 11.9 g / ml at 12 h in healthy adults orally administered cam 500 mg . \n we observed that cam did not affect rsv replication even at a concentration of 100 g / ml . however , it is reported that respiratory virus , such as rsv , rhinovirus [ 33 , 34 ] , and influenza virus , replication is suppressed by 14-membered ring macrolides , including cam . \n these two studies used different types of epithelial cells and different experimental conditions of rsv infection . \n used primary human tracheal epithelial cells , and in contrast we used a549 cell line . \n carry out infection at a lower titer of rsv ( 10 tcid50/cell ) and measuring virus titer at a longer period ( 35 days ) after infection . \n our results indicated that suppression of the rsv - induced cytokines by cam was not caused by the amount of replicated rsv . in other words , \n both il-8 and rantes , which are strongly upregulated during rsv infection , play important roles in pathogenesis [ 36 , 37 ] . \n rantes is secreted from respiratory epithelial cells and promotes migration of eosinophils , basophils , monocytes , and neutrophils . \n in particular , rantes is an efficient eosinophil chemoattractant involved in the pathogenesis of asthma . \n cam has been suggested to suppress the inflammatory disorders induced by rsv . in the present study \n , we also observed that cam suppressed enhanced s. pneumoniae adhesion by rsv infection in a549 cells . \n the rsv - induced s. pneumoniae adhesion was mainly mediated by host paf receptor , as indicated by that suppressed by the paf receptor antagonist and anti - paf receptor monoclonal antibody . \n the paf receptor acts as a receptor for s. pneumoniae and h. influenzae [ 1214 ] . \n transcription of the paf receptor gene is controlled by nf-b [ 28 , 29 ] . \n we confirmed it by that the rsv - induced paf receptor expression and s. pneumoniae adhesion were suppressed by an nf-b inhibitor , pdtc . \n we revealed that cam also suppressed paf receptor expression induced by rsv infection and s. pneumoniae adhesion to rsv - infected a549 cells . \n . reported that cam suppressed rhinovirus - induced s. aureus and h. influenzae adhesions to nasal epithelial cells . \n they show that the expressions of fibronectin and carcinoembryonic antigen - related cell adhesion molecule ( ceacam ) , which act as receptors for s. aureus and h. influenza , respectively , are induced by rhinovirus and suppressed by cam . \n the present study indicated that cam suppressed the paf receptor - phosphorylcholine ( host - bacteria ) interaction , which is enhanced by rsv infection , by inhibiting paf receptor expression . \n cam showed more potent suppression of rsv - induced s. pneumoniae adhesion and production of proinflammatory cytokines and chemokines than fosfomycin , as we reported previously [ 25 , 26 ] . \n notably , cam significantly suppressed rsv - induced il-6 production , whereas fosfomycin did not significantly . \n this finding may be caused by that cam is more potent than fosfomycin ; however , the actual reason for this disparity is not clear . \n the upregulation of paf receptor expression and the enhanced adhesion of pathogenic bacteria , such as s. pneumoniae , to respiratory epithelial cells are considered to be a major risk factor for secondary bacterial infections after primary respiratory viral infections . \n cam may suppress both secondary bacterial infections and immunological disorders induced by rsv , without suppressing viral replication . \n infection with other respiratory viruses , such as human parainfluenza virus 3 and rhinovirus , also upregulates known receptors for the pathogenic bacteria , including paf receptor and s. pneumoniae adhesion . on the other hand \n , influenza virus does not upregulate the known receptors for bacteria , whereas bacterial adhesion is increased by the infection . \n mccullers reported that influenza - induced bacterial adhesion to a549 cells was not inhibited by paf receptor antagonist , and the paf receptor knock - out mice did not show lower susceptibility to experimental secondary pneumonia caused by s. pneunimoae following influenza infection compared to the parent mice \n . lines of evidence suggest that adherent inducing mechanisms of s. pneumoniae to host respiratory epithelial cells are varied among viruses . \n we proposed that clarithromycin efficiently suppressed paf receptor - mediated streptococcus pneumoniae adhesion to respiratory epithelial cells as well as rsv - induced proinflammatory cytokine and chemokine production .", "role": "user" }, { "content": "human respiratory syncytial virus ( rsv ) sometimes causes acute and severe lower respiratory tract illness in infants and young children . \n rsv strongly upregulates proinflammatory cytokines and the platelet - activating factor ( paf ) receptor , which is a receptor for streptococcus pneumoniae , in the pulmonary epithelial cell line a549 . \n clarithromycin ( cam ) , which is an antimicrobial agent and is also known as an immunomodulator , significantly suppressed rsv - induced production of interleukin-6 , interleukin-8 , and regulated on activation , normal t - cell expressed and secreted ( rantes ) . \n cam also suppressed rsv - induced paf receptor expression and adhesion of fluorescein - labeled s. pneumoniae cells to a549 cells . \n the rsv - induced s. pneumoniae adhesion was thought to be mediated by the host cell 's paf receptor . \n cam , which exhibits antimicrobial and immunomodulatory activities , was found in this study to suppress the rsv - induced adhesion of respiratory disease - causing bacteria , s. pneumoniae , to host cells . \n thus , cam might suppress immunological disorders and prevent secondary bacterial infections during rsv infection .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: nuclear factor-b ( nf-b ) is a transcription factor that regulates expression of various genes including pro - inflammatory cytokines . \n tnfaip3 ( tumor necrosis factor alpha - induced protein 3 ) gene codes for a20 , a ubiquitin - modifying protein required to inhibit nf-b activation by several signaling pathways including tnf and toll - like receptors . \n nf-b induces expression of a20 ; thus , a20 plays a role in a negative feedback mechanism in nf-b pathway . \n the lupus phenotypes in fc receptor iib - deficient mice were reduced by treatment with nf-b inhibitors , suggesting a role of nf-b activation in the pathogenesis of systemic lupus erythematosus ( sle ) . \n a recent study reported that a20 negatively regulates immunostimulatory effects of dendritic cells and attenuates antigen presentation . \n thus , reduced function of a20 may induce excessive activation of dendritic cells and lead to the loss of tolerance to self - antigens . \n since a genome - wide association study ( gwas ) conducted by the wellcome trust case control consortium reported association of tnfaip3 region single nucleotide polymorphisms ( snps ) with rheumatoid arthritis ( ra ) and crohn 's disease in 2007 , association of snps in the region surrounding tnfaip3 at 6q23 has been reported in several autoimmune diseases . \n association of the tnfaip3 region has subsequently been replicated in ra [ 6 , 7 ] and was also reported in sle by two groups using gwas [ 8 , 9 ] . \n these observations implicated that tnfaip3 may be a common susceptibility gene to multiple autoimmune diseases . \n specifically , musone et al . reported independent association of three snps in the tnfaip3 region , rs13192841 , rs2230926 , and rs6922466 , with sle in a european - american population . \n the snp rs2230926 is located in the coding region of tnfaip3 and introduces amino acid substitution of phe to cys at position 127 in the ovarian tumor domain , which was suggested to participate in the inhibitory function of a20 through deubiquitination of adaptor proteins . \n cys127 allele product was modestly less effective in inhibiting nf-b activation by tnf than phe127 . \n . demonstrated that the strongest association was detected at an intron 2 snp rs5029939 , which was originally detected by graham et al . and was in tight linkage disequilibrium ( ld ) with rs2230926 . \n they also showed that the carrier of the risk allele was at higher risk of developing nephritis and hematological manifestations . \n snps rs13192841 and rs6922466 were mapped within 250 kb upstream and downstream of the tnfaip3 region , respectively . \n recently , we demonstrated that irf5 , stat4 , and blk are associated with sle not only in the caucasians , but also in the japanese . in this study , we carried out a case - control association study of the snps in the tnfaip3 region to examine whether tnfaip3 is involved in genetic predisposition to sle also in japanese . \n a case - control association study was conducted in 318 japanese patients with sle ( 19 males and 299 females , mean sd age 41.4 13.5 years ) and 444 healthy controls ( 219 males and 225 females , mean sd age 34.0 9.9 years ) , recruited at the university of tsukuba , juntendo university , and the university of tokyo . \n all patients and healthy individuals were native japanese living in the central part of the japan . \n in addition to the originally recruited controls , genotype data of 934 japanese healthy controls were retrieved from the \n this study was reviewed and approved by the research ethics committees of university of tsukuba , juntendo university , and the university of tokyo . \n genomic dna was extracted from peripheral blood leucocytes using qiaamp blood kit ( qiagen , hilden , germany ) and amplified using the genomiphi dna amplification kit ( amersham biosciences , piscataway , nj , usa ) , following the manufacturer 's instructions . \n genotyping of snps was carried out using the taqman genotyping assay ( applied biosystems , foster city , ca ) , according to the manufacturer 's instructions . \n the taqman probes used in this study were as follows : assay i d : c_1575524_10 ( rs13192841 ) , c_7701116_10 ( rs2230926 ) , and c _ 29431844_10 ( rs6922466 ) . \n amplification was performed in a 10 l reaction volume containing 5 l of taqman genotyping master mix and 0.125 l of taqman genotyping assay mix using 7300 real - time pcr system ( applied biosystems ) . \n thermal cycling conditions consisted of initial denaturation at 95c for 10 minutes , followed by 40 cycles of 95c for 15 seconds and 60c for 1 minute . \n jsnp550typed dataset was performed using the illumina humanhap550 beadchip ( illumina , inc . , san diego , ca ) , as indicated in the jsnp database . \n association of tnfaip3 rs2230926 genotype with tnfaip3 mrna expression was examined using the mrna data from lymphoblastoid cell lines derived from 44 jpt ( the japanese in tokyo , japan ) and 45 chb ( the han chinese in beijing , china ) hapmap individuals available from the database of the gene expression variation ( genevar ) project at the wellcome trust sanger institute ( http://www.sanger.ac.uk/humgen/genevar/ ) , as previously described . \n genotypes of rs2230926 in hapmap samples were available from hapmap database ( http://www.hapmap.org/index.html.en ) . because there was no subject with g / g genotype , mrna levels of tnfaip3 \n were compared between rs2230926 g / t ( n = 24 ) and t / t ( n = 65 ) subjects . \n association analyses were conducted by chi - square test using 2 2 contingency tables . \n when 1 or more of the variables in the contingency tables was 5 or less , fisher 's exact test was employed . because this study intended to examine whether the association of tnfaip3 is replicated in japanese , correction for multiple testing was not applied and the uncorrected p values are shown . \n based on the allele frequencies in japanese , the sample size of this study ( 318 patients and 444 controls ) had the power of 80% to detect association when the genotype relative risk is 1.55 ( rs13192841 ) , 1.65 ( rs2230926 ) , and 1.45 ( rs6922466 ) , respectively . to examine ld between the snps in the tnfaip3 region , ld parameters ( d and r ) were calculated using haploview version 4.0 software ( broad institute of mit and harvard , cambridge , ma ) , based on data from the 444 healthy japanese controls . \n difference in the mrna expression between the rs2230926 g / t and t / t subjects in the hapmap subjects was analyzed by unpaired student 's t - test . \n to examine whether tnfaip3 is associated with sle in a japanese population , an association study of rs13192841 , rs2230926 , and rs6922466 was conducted in 318 japanese patients with sle and 444 healthy controls . as observed in caucasians , ld was modest among the examined three snps in 444 healthy japanese controls ( r : 0.000.11 , d : 0.040.40 ) . \n on the other hand , the intron 2 snp rs5029939 , which showed the strongest association in the study of bates et al . \n , was in strong ld with rs2230926 also in japanese ( hapmap jpt : r = 0.86 , d = 1.0 ) . \n the association of rs2230926 with sle was replicated in the japanese , while evidence for association of rs13192841 and rs6922466 was not detected ( table 1 ) . to confirm our findings , the patients ' genotypes \n were also compared with the genotypes of 934 japanese controls available from jsnp database . as shown in table 1 , rs2230926 g allele frequency \n on the other hand , association of rs13192841 and rs6922466 was not detected , even when the jsnp controls were used for comparison . because the minor allele frequency of rs6920220 , previously shown to be associated both with ra and sle in european - american populations [ 6 , 7 , 9 ] , was only 0.006 in the hapmap jpt samples , association was not examined for this snp . \n frequency of rs2230926 g allele was significantly increased in sle with nephritis ( 12.2% ) as compared with healthy controls ( 7.5% , p = .010 , or 1.70 , 95%ci 1.132.56 ) , while significant difference was not observed between sle without nephritis ( 8.6% ) and healthy controls ( table 2 ) . \n this finding is in agreement with bates et al . , who demonstrated preferential association of tnfaip3 with sle patients with nephritis in caucasians . \n we did not carry out this analysis , however , because more than 90% of our patients fulfilled acr classification criteria for hematologic disorder , especially lymphopenia ( 1500/l ) . \n a previous study suggested that the product of the risk allele , rs2230926 g ( cys127 ) , may be modestly less efficient in inhibiting tnf - induced nf-b activity . to gain more insight into the functional significance of rs2230926 , association of tnfaip3 mrna levels with genotype \n data on the mrna levels in b cell lines from hapmap samples were obtained from genevar database ( http://www.sanger.ac.uk/humgen/genevar/ ) . as shown in figure 1 , \n the levels of tnfaip3 mrna were decreased in carriers of the rs2230926 g allele ( g / t subjects ) as compared with noncarriers ( t / t ) ( p = .013 ) . \n this finding is in agreement with a previous study which demonstrated that tnfaip3 intronic snp rs5029930 , which is strong ld with rs2230926 g , was associated with lower expression of tnfaip3 mrna expression in peripheral mononuclear cells . \n thus , our findings suggested that the molecular mechanisms of association of tnfaip3 haplotype containing rs2230926 g and rs5029939 g may involve both the functional change caused by the amino acid substitution at the protein level and the reduced expression level of a20 protein . \n a gwas of sle in a chinese han population was very recently reported for the first time in non - caucasian populations . in the study , association of tnfaip3 rs2230926 , but not rs13192841 and rs6922466 , with sle was demonstrated , which was consistent with our results in japanese . \n thus , taken together with previous observations , our study established tnfaip3 as a susceptibility gene to sle common to caucasian and asian populations . \n of particular interest , both the gwas in chinese and a large - scale study in caucasians identified association of tnfaip3 interacting protein 1 ( tnip1 ) , which binds to a20 and is thought to inhibit nf-b signaling . \n these findings underscore the crucial role of nf-b regulation pathway in the genetic background of sle in multiple populations . \n the association of rs2230926 in the coding region of tnfaip3 with sle was replicated in a japanese population . \n our finding demonstrated that tnfaip3 is a susceptibility gene to sle both in the asian and caucasian populations .", "role": "user" }, { "content": "recent genome - wide association studies demonstrated association of single nucleotide polymorphisms ( snps ) in the tnfaip3 region at 6q23 with systemic lupus erythematosus ( sle ) in european - american populations . in this study , we investigated whether snps in the tnfaip3 region are associated with sle also in a japanese population . \n a case - control association study was performed on the snps rs13192841 , rs2230926 , and rs6922466 in 318 japanese sle patients and 444 healthy controls . \n association of rs2230926 g allele with sle was replicated in japanese ( allelic association p = .033 , odds ratio [ or ] 1.47 , recessive model p = .023 , or 8.52 ) . \n the association was preferentially observed in the sle patients with nephritis . when the tnfaip3 mrna levels of the hapmap samples were examined using genevar database , \n the presence of tnfaip3 rs2230926 g allele was associated with lower mrna expression of tnfaip3 ( p = .013 ) . \n these results indicated that tnfaip3 is a susceptibility gene to sle both in the caucasian and asian populations .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: treatment options for hepatitis c virus ( hcv ) infection in renal transplant ( rtx ) patients are limited . \n the conventional treatment of interferon ( ifn ) injection with ribavirin carries the risk of allograft rejection . \n conversely , not treating for hcv is associated with increased morbidity and mortality due to progressive liver dysfunction , infections , malignancy , vasculitis , glomerulonephritis , and new onset diabetes . \n the availability of second generation oral anti - viral drugs has opened new avenues for hcv treatment . \n although used successfully in liver transplant situation , there is no available literature for their use in rtx patient . \n we share our early experience of a rtx patient with hcv infection treated successfully with combination pill of sofosbuvir ( sof ) and ledipasvir ( ldv ) ( harvoni ) , heralding a new era of safe , ifn - free , oral , anti - hcv therapy \n a 43-year - old male renal allograft recipient , presented at the sixth year follow up with significant weight loss of 6 kg over 3 months . prior to renal transplantation he was hypertensive , nondiabetic and hcv negative ( confirmed by standard elisa and polymerase chain reaction [ pcr ] test ) . \n induction therapy included basiliximab 2 doses ( 20 mg each ) followed by triple drug immuno - suppression ( prednisolone , tacrolimus , mycophenolate mofetil [ mmf ] ) he received two units blood transfusion in the peritransplant period . \n he was receiving prednisolone 5 mg daily , mmf500 mg thrice daily , and tacrolimus 1 mg twice daily . \n his other medications included nifedipine 20 mg thrice daily , metoprolol 50 mg once daily and calcium carbonate 500 mg twice daily . \n laboratory evaluation showed de novo new onset diabetes mellitus after transplant ( fasting blood glucose 225 mg / dl , hemoglobin a1c 11.9 ) , elevated liver enzymes ( aspartate transaminase 89 \n iu / l [ normal < 40 ] , gamma glutamyl transferase 150 iu / l , biliburin 1 mg% , serum albumin 4 g / dl ) , normal renal functions ( serum creatinine 0.9 mg% ) , normal hemogram , and chest x - ray . \n furthermore , the evaluation showed hbsag negative , anti - hcv serology positive status due to hcv genotype 1 with high viral load ( 10,800,000 iu / ml ) . \n diabetes was initially controlled with insulin and later he was switched to oral sitagliptin - metformin combination . \n his serum transaminases level remained elevated over next 9 months with persistent high hcv load ( 106,074,000 iu / ml ) . \n the patient was counseled about the risk of allograft rejection with existing anti - hcv therapy , and lack of treatment guidelines for using oral new anti - viral agents in rtx situation . however , with recent treatment success with newer oral anti - viral agents in non - rtx situation , the patient consented to take oral anti - viral therapy under closed supervision . \n he received the fixed - dose combination of ldv and sof ( harvoni ) , manufactured by gilead sciences . for next 12 weeks . at 3 weeks ( after starting treatment ) \n doppler ultrasound and radionuclide study with technetium-99m - diethylene - triamine - pentaacetate were normal . \n his serum cyclosporine trough level was in the acceptable range ( 110.2 ng / ml whole blood at 3 weeks while baseline was 95 ng / ml by liquid chromatography - tandem mass spectrometry normal range 80150 on long - term ) . \n he continues to do clinically well at four months posttreatment in addition , after completion of oral anti - viral therapy he is off anti - diabetic treatment with maintained euglycemia and normal liver functions . \n liver disease is an important cause of morbidity and mortality in rtx recipients , especially with hcv infection . \n abnormal liver functions test are reported in 724% of rtx recipients , with liver failure as the cause of death in 828% of long - term survivors . \n liver disease in rtx patient may be due to viral infections ( hepatitis b virus or hcv , epstein - barr virus , or cytomegalovirus ) , drugs ( azathioprine or cyclosporine ) , iron overload ( hemosiderosis ) or alcohol abuse . \n hcv infection in immuno - suppressed rtx recipient is associated with significant morbidity and mortality . \n patients with hcv - positive status prior to transplantation have increased risk of posttransplant liver disease with a relative risk ( rr ) of 5.0 . \n one large meta - analysis , that included 6365 hcv positive patients reported increased risk for death ( rr 1.79 ) and allograft failure ( rr 1.56 ) . \n hcv infection additionally causes heightened immuno - suppression thereby increasing the risk of sepsis in the initial years post - rtx and liver disease in later years that progresses more rapidly compared to the nontransplant situation to chronic hepatitis , cirrhosis , and liver cancer . \n hcv infection is also associated with increased risk for new onset diabetes after transplantation ( nodat ) , de novo glomerulonephritis and mixed cryoglobulinemia - related vasculitis that may lead to graft loss or recipient death . \n interestingly , the present case highlights that the patient who developed nodat associated with hcv infection may have a collateral benefit of getting cured of diabetes with control of hcv infection . \n efforts to minimize the incidence of post - rtx hcv infection must focus on viral screening of both donors and recipients using sensitive methods in the pretransplant stage . \n third generation elisa serology for the detection of hcv has high sensitivity ( > 98% ) . \n the latter is confirmed by a gold standard pcr test that detects hcv rna antigen , which should be done in all patients prior to transplant . \n the index patient was negative for hcv by elisa and pcr in pre - rtx evaluation . \n he probably acquired hcv infection from blood transfusions ( tested negative by elisa ) received in peritransplant period though a remote possibility of missed hcv infection in pretransplant evaluation exists . \n the latter may occur in patients who have intermittent viremia from the sequestered virus in the liver or peripheral mononuclear cells leading to negative serum hcv status . \n the standard care for the patients with hcv genotype 1 infection in non - rtx scenario is pegylated ifn plus ribavirin with newer direct acting anti - viral protease inhibitor ( boceprevir or telaprevir ) for 48 weeks . \n the overall sustained virological response ( svr ) rate in patients infected with hcv genotype 1 is poor ( < 50% ) compared to genotype 2 or 3 ( approximately 7580% ) more so in patients on dialysis ( nearly one - third ) . \n current treatment option approved for patients ineligible to receive inf in hcv genotype 1 infection is 24 weeks of sof and ribavirin . \n rtx is a contraindication to ifn therapy due to its limited efficacy , increased risk of acute rejection , high cost , and significant side effects . \n however , ifn mono - therapy is to be considered in kidney transplant recipients with hcv infection having fibrosing cholestatic hepatitis or life - threatening vasculitis . \n ribavirin in the post - rtx state does not produce sustained virologic response despite lowering of transaminase level . \n current clinical strategy in the post - rtx hcv infection is manipulation of immunosuppressive therapy ( minimizing corticosteroid , avoidance of anti - lymphocyte antibody , and to replace tacrolimus with cyclosporine ) . \n however , there is an urgent need for newer anti - hcv therapies with greater safety and efficacy than ifn and ribavirin in rtx patient . \n the drugs used as add - on oral therapy in hcv treatment include ribavarine , telaprevir , boceprevir , or simeprevir in different combinations . \n the advent of newer second generation anti - virals like sof -ldv , ombitasvir - paritaprevir plus dasabuvir , daclatasvir - asunaprevir , and simeprevir - sof has widened the therapeutic options with reported svr above 90% . \n the novel oral anti - viral agents are likely to cause a paradigm shift in the treatment of hcv infection in post - rtx state by simplifying current therapy of shorter duration and also eliminating the need for response guided therapeutic approach . \n the choice between these agents depends primarily on the potential for drug interactions and drug toxicity . \n the combination therapies are preferred as they provide better viral suppression than mono - therapy with less chance of viral escape based on complementary resistance profiles . \n there is no additional benefit by extension of the duration of treatment to even 24 weeks . \n addition of ribavirin to a ldv - sof combination increases toxicity without any additional efficacy . \n ldv - sof combination has favorable adverse effect profile ( common side effects rated as mild and not leading to drug discontinuation like fatigue , headache , nausea , diarrhea , and insomnia reported in 1020% ) , minimal drug interactions , and easy to administer ( single pill daily ) . \n ldv is an inhibitor of the hcv ns5a protein that is required for viral replication , postreplication assembly , and secretion . \n sof , a nucleotide pro - drug and an inhibitor of the hcv ns5b rna - dependent rna polymerase , acts as a chain terminator . \n sofosobuvir , the backbone of the new standard of care for hcv infection , offers a number of potential benefits such as high rates of sustained virologic response , high barrier to resistance , tolerability , pan - genotype efficacy ( hcv genotype 16 ) , need for shortened duration of treatment , usefulness in cirrhosis , human immunodeficiency virus co - infection and liver transplantation . \n sof ( 400 mg ) in combination with ldv ( 90 mg ) ( harvoni ) has been proven to be efficacious , tolerable and safe in series of clinical trials , both in treatment - nave and treatment - experienced patients with 1224 weeks of therapy ( depending presence or absence of cirrhosis , treatment experience , and genotype ) with high sustained viral response . \n the index rtx patient with a very high viral load without cirrhosis showed a remarkable response as early as 3 weeks after therapy . \n shorter duration for 8 weeks can be considered in treatment - nave patients without cirrhosis who have pretreatment hcv rna of < 6 million iu / ml . \n both sof and ldv are substrates of p - glycoprotein inducers ( like rifampicin ) with implication for potential drug interactions but it does not demonstrate significant drug interactions with immunosuppressant drugs . \n the development of ifn free oral anti - hcv therapy may be a major breakthrough in anti - hcv management in rtx patient . \n the dual drug combination therapy appears to be an important arrow in our quiver now for targeting hcv infection in high - risk rtx . \n such combination therapy may shorten and simplify treatment regimens even in the post - rtx scenario ushering a new era of safer , simpler and more effective therapy . \n however , the utility versus the risk of such new therapy has to be scrutinized carefully by studies involving a sizeable cohort of rtx patients having long - term follow - up for reliable assessment of such therapeutic intervention . medwin hospital , nampally , hyderabad , andhra pradesh , india . \n \n ", "role": "user" }, { "content": "liver disease due to hepatitis c infection in renal transplant recipients is difficult to treat and often associated with reduced patient survival . \n a 43-year - old male , a renal allograft recipient , presented at 6 years follow - up with significant weight loss over 3 months . \n he was detected to have new onset diabetes mellitus together with hepatitis c virus ( hcv ) infection ( genotype 1 ) . \n his hcv load remained high despite the change of immuno - suppression from tacrolimus to cyclosporine . \n a decision to treat with a new anti - viral combination of ledipasvir and sofosbuvir for 12 weeks was taken . within 3 weeks \n , his raised serum transaminases levels normalized and viral load became undetectable . at the end of 16 weeks \n , he continues to do well with normal renal function , has sustained remission from hepatitis c infection and resolution of diabetes .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: i / r ( ischaemia / reperfusion ) injury , inherent in lt ( liver transplantation ) , is the main cause of initial deficiencies and primary non - function of liver allografts . therefore minimizing the adverse effects of i / r injury could increase the number of both suitable transplantation grafts and patients who successfully recover from lt . \n the mechanisms involved in the pathophysiology of i / r injury have been the focus of previous extended reviews . \n in essence , during the ischaemic phase , blood flow and oxygen and nutrient supply to the organ are inhibited , which stops energetic metabolism , depletes atp levels and renders the organ more susceptible to blood reflow in the reperfusion phase . in this last phase , \n a ros ( reactive oxygen species ) burst , as well as activation of pro - inflammatory cells and mediators , takes place , enhancing organ injury even more . a strategy to reduce i \n / r injury is the use of ups ( ubiquitin proteasome system ) inhibitors either as additives to preservation solutions or as drugs administered to patients . \n the multicatalytic proteasome is the ubiquitous proteinase found in cells throughout the plant and animal kingdoms that is responsible for the degradation of intracellular proteins . \n the proteasome exerts multiple intracellular functions , namely the degradation of damaged proteins and the modulation of many regulatory proteins that are involved in inflammatory processes , cell cycle , metabolism , growth and differentiation among others . \n several studies have proposed that ups inhibition is protective against i / r injury in different organs . \n protein conjugate pool during cold ischaemia in a model of murine heart transplantation , and thus may prolong organ preservation . \n other studies have in fact demonstrated that proteasome inhibition can reduce injury in models of isolated perfused rat heart through a decrease in polymorphonuclear leucocyte adherence to the endothelium . on the other hand , \n for instance , a study on endothelial cells submitted to hypothermia showed that the ups pathway was activated during cold preservation of endothelial cells , but proteasome inhibition could not prevent cell damage . \n other studies have reported a decrease in proteasome activity in cerebral ischaemia . a possible explanation for this effect could be the atp depletion observed in ischaemia , since the ups is an atp - dependent system . \n interestingly , a study by divald and powell demonstrated that the ups is able to degrade oxidized proteins in an atp- and ubiquitin - independent manner in a model of myocardial ischaemia . \n this indicates that , even though proteasome activity is decreased in ischaemia and reperfusion , the remnant pool of active proteasomes is able to maintain proteolysis even if the cell is depleted from atp . \n in addition , geng et al . have also shown that a subset of 26s proteasomes is activated at low atp concentrations and that this contributed to myocardial injury during cold ischaemia . \n thus a subset of the 26s proteasomes acts as a cell - destructive protease that is activated when the cellular energy supply declines . in that study , \n the administration of a proteasome inhibitor resulted in preservation of the ultrastructural integrity of the cardiomyocyte . \n furthermore , a subsequent study by the same group revealed that proteasome inhibition during cold ischaemia of hearts prolonged myocardial viability and reduced reperfusion injury . regarding the methods used for the measurement of the activity of the proteasome in all of these studies , analysis of suc - llvy - mca \n ( succinyl - leu - leu - val - tyr-4-methylcoumaryl-7-amide)-hydrolysing activities in the presence of atp , at a similar concentration , was used . \n moreover , the latter two studies used epoxomycin to differentiate between peptidase and proteasome activities . \n in addition to all of the above , ups inhibitors have already been used in models of organ transplantation and have shown profound beneficial effects . finally , taking into account their well - established immunosuppressive effects , \n ups inhibitors seem to be very promising candidates for the preservation of organ integrity and function during transplantation . \n concerning liver injury , the ups system is still an almost unwalked path , particularly in the hepatic i / r field . \n the majority of studies have investigated the effect of proteasome inhibitors on liver injury and have shown that ups inhibitors were able to reduce injury , oxidative stress and apoptosis in different models of hepatic injury . on the other hand , \n hence there remains a controversy over whether the use of ups inhibitors is beneficial or injurious against liver injury , and the mechanisms are still not clear . \n the use of all of these inhibitors and their potential for the treatment of human diseases other than hepatic i / r injury have been considered in a previous review . \n some of these compounds are far advanced in clinical trials for their administration in humans . \n for example , synthetic analogues of the bacterial metabolite lactacystin , which inhibits proteasome activity , have been developed . among these , ps-519 ( a small analogue of lactacystin ) is under clinical evaluation for inhibiting reperfusion injury after ischaemic central nervous system injury . \n another compound that has been approved for clinical trials is bortezomib , a tripeptide consisting of pyrazinoic acid , phenylalanine and leucine with boronic acid instead of a carboxylic acid ( pyz - phe - boroleu ) . \n bortezomib has proven its therapeutic potential for intervention of the ups in cancer ( velcade ; millennium pharmaceuticals ) and was approved by the us food and drug administration in 2003 . \n from our experience and studies that have investigated the role of the ups in hepatic i / r , it is clear that ups inhibitors are a potential strategy to reduce i / r injury in lt and graft preservation . \n moreover , we hypothesize that ups inhibition may improve graft preservation due to an increase in ampk ( amp - activated protein kinase ) activity and autophagy . \n previous studies from our group have reported that the beneficial effects of ischaemic preconditioning in liver graft preservation was due to the up - regulation of ampk , among other mechanisms , and that ampk was also involved in steatotic liver preservation . \n ampk acts as a metabolic fuel gauge , which is activated in response to diverse stress factors to restore cellular and whole - body energy balance . \n ampk is allosterically regulated by the competitive binding of amp and atp , thereby sensing cellular energy status and , when activated , triggers compensatory atp - generating mechanisms while attenuating atp - consuming processes . \n knowing that ampk is basically degraded , and therefore regulated by the ups , it appears that , when administering ups inhibitors , ampk can not be degraded at the usual rate and therefore it is stabilized and its action perpetuated . in the rat , \n ampk and the mtor ( mammalian target of rapamycin ) signal transduction pathway are involved in the control of autophagic proteolysis . \n the mtor pathway is a key regulator of cell growth and proliferation , and integrates signals regarding availability of nutrients and growth factors to regulate many cellular processes , including ribosome biogenesis and metabolism . \n the lysosomal pathway , autophagy , renders complete organelles and individual proteins to be engulfed by a newly formed membrane , termed a phagophore or isolation membrane , to form a double - membrane vesicle , called the autophagosome , which is delivered to lysosomes for hydrolytic degradation . \n free fatty acids and amino acids , which can then be reused to maintain mitochondrial atp production and ribosomal protein synthesis . \n autophagy is also activated in order to remove damaged organelles and to stimulate phagocytic clearance of apoptotic cells . \n induction of autophagy by ampk may contribute to the preservation of atp content , as well as promotion of cell survival in the ischaemic heart . \n furthermore , activation of ampk also enhances atp production through other multiple mechanisms , such as increases in glucose uptake , glycolysis and fatty acid oxidation . nonetheless , \n although autophagy during energy starvation is generally protective , its induction by other stimuli can lead to autophagic cell death and thus can be detrimental . \n previous studies have reported a cross - talk between autophagy and apoptotic and necrotic cell death pathways , and activation of autophagy may favour cellular survival by decreasing ros production and suppressing er ( endoplasmic reticulum ) stress . \n it is thought that er stress induced by i / r induces autophagy in the heart as an adaptive mechanism . \n moreover , a recent study by esposti et al . has shown that the beneficial effects of ischaemic preconditioning in steatotic livers undergoing i / r were due to the activation of autophagy , which could modulate apoptosis and necrosis and may be involved in the attenuation of er stress . \n additionally , another study has reported that ischaemic preconditioning increases autophagy in human patients and this correlated with a decrease in liver cell death . \n returning to our hypothesis ( figure 1 ) , when ampk is up - regulated under ups inhibition , mtor may be inhibited and therefore can not exert its inhibitory effect on autophagy . \n this would result in the preservation of cellular atp levels and thus prevention of cell death . \n in addition , this induction of autophagy could help the cell to get rid of oxidized proteins that can damage the cell membrane and other cellular compounds . \n enhancement of ampk activity also induces enos [ endothelial nos ( no synthase ) ] activity and thus no production , which has been widely demonstrated to prevent endothelial cell damage . \n furthermore , ampk inhibits inos ( inducible nos ) activity , which is known for its injurious effects through the generation of no . \n in addition , a link between no and autophagy has been demonstrated previously , and , in endothelial cells , ampk was shown to activate enos and thus no production , which promoted vasodilation and reduced leucocyte adhesion . moreover \n , ampk activity also acts on several downstream targets that preserve the energetic state of the cell and prevent liver i / r injury ( reviewed in ) . \n mtor inhibition may also enhance the compensatory up - regulation of upstream survival kinases , such as pi3k ( phosphoinositide 3-kinase ) and akt , which will also protect the cell from apoptosis . \n all of this correlates with previous studies showing that ischaemic preconditioning can induce autophagy in the liver and thus prevent cell death . \n in addition to what has been discussed above , the induction of autophagy is also beneficial against i / r , because when autophagy is inhibited it is not possible to remove dysfunctional mitochondria . \n therefore these mitochondria laden with ros and calcium undergo the mitochondrial permeability transition , which in turn leads to the uncoupling of oxidative phosphorylation , energetic failure , atp depletion and ultimately cell death . \n therefore it is important that autophagy is induced under ischaemic conditions and its induction can be even more protective . \n this hypothesis is supported by the finding that autophagy declines in aged organisms , which correlates with the decrease in tolerance of aged patients to i / r injury . \n however , would the induction of autophagy during reperfusion also be protective against i / r injury ? \n it should be taken into account that the induction of autophagy may be protective against apoptosis and cell injury if it is not too excessive . \n as mentioned above , both protective and detrimental effects of autophagy have been reported , and excessive induction of autophagy may cause cell death . furthermore , excessive inhibition of the ups may also result in cell death as described above . however , as alternative proteolytic pathways are active in the cell , it is expected that when one of the systems for proteolysis in cells is inhibited , other systems are able to degrade abnormal proteins that may trigger cell death if present in large amounts and/or for prolonged periods of time . \n in addition , differences in the processes of ischaemia and reperfusion may account for some of the discrepancies . finally , even though proteasome activity declines in post - ischaemic reperfused organs , the remnant pool of active proteasomes is able to maintain proteolysis even if the cell is depleted of atp . \n this may explain why additional inhibition of the proteasome during reperfusion may be protective against i / r injury . \n it is also noteworthy that autophagy decreases after partial hepatectomy , suggesting that ups inhibition could also be beneficial in living donor lt , as it would enhance autophagy and thus preserve atp levels and other molecules necessary for liver regeneration . hence ups inhibition could also be beneficial in models of reduced - size lt by both increasing liver regeneration and protecting the liver against i / r injury . \n in addition to the effect on ampk activity described above , additional mechanisms may well contribute to the protective effects of ups inhibitors in lt and graft preservation . \n for instance , stangl et al . have shown that the proteasome inhibitor mg-132 protected cardiomyocytes from hypothermic injury through the induction of hsp ( heat - shock protein ) 70 and 90 , which enhanced their survival and functional recovery . \n furthermore , others have implicated nf-b ( nuclear factor b ) in the protective effect of proteasome inhibition . \n for example , pye et al . have shown that proteasome inhibition reduced reperfusion injury in myocardial i / r through a decrease in nf-b activation , which in turn affected the recruitment of inflammatory cells . \n a study of liver injury induced by intestinal i / r showed that lactacystin inhibited nf-b , and this consequently reduced liver and intestinal injury and neutrophil infiltration . alternatively \n , ups inhibitors could also be protective against i / r injury through the modulation of hif-1 ( hypoxia - inducible factor-1 ) , which is well known for its role in cell adaptation to hypoxia and its regulation by the ups . \n a study by shin et al . has reported that proteasome inhibition inactivates hif-1 , thereby suppressing the expression of genes essential for cellular adaptation to hypoxia . however , this could be considered a paradox as it is well established that ups degrades the subunit under normoxia to maintain hif-1 inactivated . \n , previous studies have found that hif-1 levels were increased after proteasome inhibition in xenografted tumours , although two genes which are usually up - regulated by hif-1 were down - regulated . \n further studies will therefore be required to determine the specific role of hif-1 in proteasome inhibition and i / r injury . \n finally , a reduction in oxidative stress could also contribute to the protective effects of ups inhibitors in the liver , as bardag - gorce et al . \n have shown that bortezomib decreases oxidative stress in a model of rat alcoholic liver disease . in that study , bortezomib increased the expression of antioxidant enzymes and decreased the oxidative burst . furthermore , mg-132 protected mouse hepatocytes from tnf- ( tumour necrosis factor-)-induced apoptosis . \n in summary , we propose that the major mechanism by which ups inhibitors reduce i / r injury in lt and graft preservation is via the up - regulation of ampk activity and the consequent down - regulation of mtor during ischaemia , which may finally influence autophagy and preserve the energy state of the cell . \n future studies will be required to determine the effects and mechanisms of action of ups inhibitors during cold ischaemia in lt . \n we thank professor sabine werner for her valuable collaboration and comments on the revision of the text . \n our work is supported by the ministerio de sanidad y consumo ( madrid , spain ) [ project grant number pio81988 ] .", "role": "user" }, { "content": "in the present hypothesis article , we summarize and present data from the literature that support our hypothesis on the potential mechanisms by which ups ( ubiquitin proteasome system ) inhibitors reduce i / r ( ischaemia / reperfusion ) injury in the liver . \n i / r is the main cause of primary liver failure and , consequently , minimizing the detrimental effects of this process could increase the number of suitable transplantation grafts and also enhance the survival rate of patients after liver transplantation . a potential strategy to reduce i / r \n injury is the use of ups inhibitors either as additives to preservation solutions or as drugs administered to patients . \n however , there is still controversy over whether the use of ups inhibitors is beneficial or deleterious with regard to liver injury . from our experience and \n the few studies that have investigated the role of ups in hepatic i / r , we believe that the use of ups inhibitors is a potential strategy to reduce i / r injury in liver transplantation and graft preservation . \n we hypothesize that one of the main mechanisms of action of ups inhibitors may be the up - regulation of ampk ( amp - activated protein kinase ) activity and the consequent down - regulation of mtor ( mammalian target of rapamycin ) , which may finally influence autophagy and preserve the energy state of the cell .", "role": "assistant" } ]