Datasets:

tsharish

/

pubmed-summarization-1k

like 0

[ { "content": "You are a medical writer. Summarize the following article: dental anomalies that might affect the size , shape , or number of teeth are often detected during a routine clinical examination or incidentally . \n early detection and diagnosis of such anomalies are essential for proper management and treatment to prevent future clinical problems and complications . \n a supernumerary tooth , or hyperdontia , is one of the dental anomalies that clinicians could face , and it is defined as teeth that exceed the normal dental formula , regardless of their location or morphology . \n supernumerary teeth can be single or multiple , unilateral or bilateral , erupted or impacted , everted , or taking abnormal eruptive direction . \n in addition to occurring in isolated cases , hyperdontia can be associated with complex syndromes and developmental abnormalities such as gardner syndrome , fabry anderson syndrome , ehler danlos syndrome , facial fissures , cleidocranial dysplasia or cleft lip and palate . in such syndromes \n hyperdontia can occur in both primary and permanent dentitions although less frequently in the primary dentition . \n the etiology of hyperdontia is poorly understood although several theories have been proposed such as dichotomy of tooth germs , hyperactivity of the dental lamina and atavism . \n genetic factors have been reported in the etiology as several studies supported the theory of familial tendency to supernumerary teeth with an increased numbers of supernumerary teeth evident in relatives of those affected . the prevalence of hyperdontia has been reported in several studies with variations between different ethnic groups . according to anthonappa \n these variations could be attributed to racial differences as well as differences related to methodologies adopted , diagnostic criteria , analyses employed , and sample sizes . in the state of qatar , no study has investigated the prevalence and distribution pattern of hyperdontia . \n therefore , the aim of this study was to investigate the prevalence and distribution of hyperdontia in the permanent dentition among a group of qatari sample and to compare the present findings with other populations investigated in the literature . \n after obtaining ethical approval from the medical research center at hamad medical corporation , doha - state of qatar ( project number : 14077/14 ) , records of 1269 qatari patients who attended the pediatric dentistry and orthodontic clinics during the period ( 20092014 ) at the department of dentistry , hamad medical corporation , doha - state of qatar were examined . \n inclusion criteria were patients of qatari origin , no history of medical problem or any type of syndromes and developmental anomalies , the presence of panoramic radiograph with good quality and patients who aged between 8 and 20 years . \n four experienced dentists who have at least 5 years of clinical experience examined all the radiographs over a period of 6 months . \n supernumerary teeth were assessed for their location , morphology , number , and whether impacted or not . \n the morphology for every tooth was classified as supplemental , conical , tuberculate , and odontoma . \n supplemental teeth were further categorized into those that resemble incisors , canines , premolars , and molars . \n data obtained were recorded according to age , gender , type of supernumerary teeth , maxillary versus mandibular and impacted versus not impacted . \n descriptive and comparative analyses were performed using the statistical package for the social sciences ( version 20.0 , spss inc . , \n student 's t - test was employed to compare the chronological ages between male and female patients . to test the difference between male and female patients , maxillary versus mandibular , impacted versus nonimpacted \n , chi - square or fisher 's exact tests were employed . to test data quality , 10% of the data \n were randomly selected and reevaluated by one of the investigators 2 weeks after the initial examination so that 100% reproducibility was assured in the identification of supernumerary teeth . \n the study sample comprised of 674 ( 53% ) female and 595 ( 47% ) male patients [ table 1 ] . descriptive data of patients included in the study the prevalence of hyperdontia in the present study was 1.6% . \n there was no significant difference in the prevalence between genders although male patients demonstrated higher number of supernumerary teeth ( 60% ) . \n two patients had two supernumerary teeth ( 10% ) with the rest of patients having one supernumerary tooth ( 90% ) [ table 2 ] . \n distribution of hyperdontia by gender the supernumerary teeth identified in the present study composed of 10 supplemental teeth ( 45.5% ) , nine conical teeth ( 41% , seven mesiodens teeth , and two lateral conical teeth ) , two tuberculate teeth ( 9% ) , and one odontom ( 4.5% ) [ table 3 ] . \n the most common supplemental tooth was the mandibular incisor ( 60% ) followed by the premolar ( 20% ) . \n only one supplemental maxillary lateral incisor ( 10% ) and one supplemental maxillary permanent canine ( 10% ) were found [ table 4 ] . \n distribution of hyperdontia by type frequency of supplemental teeth of the 22 supernumerary teeth , 12 teeth were impacted ( 54.5% ) and 10 teeth were not impacted ( 45.5% ) . \n twelve teeth were in the maxilla ( 54.5% ) and 10 teeth in the mandible ( 45.5% ) . \n there was no significant difference in the prevalence with respect to impacted versus nonimpacted or maxillary versus mandibular supernumerary teeth ( p < 0.280 ; table 5 ) . \n while hyperdontia is not a common dental anomaly , early diagnosis , and timely management are highly recommended to prevent future clinical complications . \n several studies reported on the prevalence of hyperdontia across different ethnic backgrounds , however , there is no data specific to the state of qatar . therefore , the aim of this study was to investigate the prevalence and distribution of hyperdontia in the permanent teeth among a group of qatari sample and to compare the present data with others from the literature . in the present study , \n this finding was close to another study which was conducted in a saudi sample which shares similar racial , environmental , and genetic characteristics . \n when compared to other caucasian populations in the same region , this finding lies within the range of reported values ( 0.53% ) . \n furthermore , the present finding is within the normal range of overall populations investigated in the literature . \n such variations between populations could be attributed to racial factors , sampling strategies , differences in sample sizes , the age of investigated cases , diagnostic tools , and recruiting patients from different setting whether clinical or from the general population . \n although not significant , higher number of hyperdontia cases was found in male patients ( 60% ) when compared to female patients ( 40% ) . \n a possible explanation for not being statistically significant in males might relate to higher number of female patients in the present study when compared to male patients . \n furthermore , esthetic concerns due to supernumerary teeth or other dental anomalies might lead to an overestimation in females as opposed to males because esthetics is of more importance to girls and their parents when compared to boys . as a result , \n morphologically , the most common supernumerary teeth found in the present study were the supplemental teeth ( 45.5% ) followed by conical teeth ( 40% ) . \n this finding contradicts the majority of studies which found that conical teeth were the most prevalent . \n this finding might be due to our sample makeup which included , in addition to patients seeking orthodontic treatment , patients from the pediatric clinic . \n several studies recruited patients from orthodontic clinics only , and due to esthetic and clinical problems that conical teeth would cause , it is expected to have higher cases of conical teeth compared to other types of supernumerary teeth . \n contrary to majority of studies , the lower incisor was the most common supplemental supernumerary tooth ( 60% ) followed by the lower supplemental premolar ( 20% ) . in the literature , \n this difference in the prevalence might be due to the age group of the present study which recruited younger patients compared to other studies . \n there are few reports which showed supernumerary premolars and molars developing at later stage during adulthood . \n another explanation could relate to differences in the source of samples whether clinical or from the general public . \n reported that supernumerary teeth of the molar group could are the most prevalent type in the general population . in this study , \n the fact that the majority of supernumerary teeth were of supplemental and conical types necessitates careful identification and monitoring of such teeth as they could pose serious complications to the developing permanent dentition . in most cases , \n it is recommended to remove them as early as possible to prevent future clinical complications . in this study , there was no significant difference in the prevalence of supernumerary between the maxilla and the mandible . \n this finding contradicts the majority of studies in the literature which found that hyperdontia was more prevalent in the maxilla compared to the mandible . \n only one patient had a supernumerary tooth in each jaw with no bilateral involvement within any jaw . \n more than half of supernumerary teeth ( 54.5% ) identified were impacted which is concurrent with the majority of studies which reported that great deal of supernumerary teeth are impacted . \n this finding necessitates careful detection and diagnosis of supernumerary as some cases might be unnoticed without the aid of radiographs . \n with respect to limitations of the present study , generalizability of the results could be questioned as investigating the prevalence from the general population would yield more reliable results . \n . a further limitation might relate to the age of patients recruited in the present study ( 820 years ) . \n several reports found that supernumerary teeth may develop at later stages of life during the third and fourth decades . \n for example , cochrane et al . , reported on two adult patients in which late supernumerary molars and premolars erupted . \n this in turn , might have affected the overall results as younger adults were included with no older adult patients . \n the prevalence of hyperdontia in a group of qatari sample was within the normal range of reported values in the literature . \n morphologically , the most common type of supernumerary teeth was supplemental with accessory lower incisors being the most prevalent . \n more than half of supernumerary teeth identified were impacted , and this finding necessities careful detection , diagnosis , and monitoring of the developing dentition as supernumerary teeth might be unnoticed unless found incidentally . \n \n ", "role": "user" }, { "content": "objective : there is no data specific to the qatari population on the prevalence and distribution of hyperdontia . \n the aim of this study was to investigate the prevalence and distribution of hyperdontia in the permanent teeth among a group of qatari sample and to compare the present results with findings from other populations.materials and methods : records of 1269 qatari patients ( 674 females ; mean age 11.8 2.3 and 595 males ; mean age 11.4 2.2 years ) which included panoramic radiographs were examined to identify hyperdontia in the permanent dentition . \n supernumerary teeth were assessed for their location , morphology , number , and whether impacted or not.results:the prevalence of hyperdontia was 1.6% ( females 0.7% and males 0.9% ; p \n < 0169 ) . \n the most common type of supernumerary teeth was the supplemental ( 45.5% ) , followed by the conical ( 40% ) . \n of the supplemental teeth , the mandibular incisor was the most prevalent ( 60% ) , followed by the premolar ( 20% ) . \n no significant difference in the prevalence was found between the maxilla and mandible . \n more than half of supernumerary teeth identified were impacted ( 54.5%).conclusions : the prevalence of hyperdontia in a group of qatari population was within the normal range of the majority of published studies in the literature . although not significant , hyperdontia cases were more prevalent in male patients .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: two distinct frontoparietal attention networks underlie attentional relevance and salience ( petersen and posner , 2012 ) . \n the executive control network is predominantly responsible for cognitively driven attention functions including conflict resolution and attentional control . \n this network involves dorsolateral frontal and superior parietal cortices , and connections with the thalamus and anterior cingulate cortex ( posner , 2012 ) . \n abnormalities of the brain structures subserving the executive control network have been linked to response control deficits in developmental disorders such as attention deficit hyperactivity disorder ( adhd ; dennis et al . , 2008 ) . \n the orienting network , responsible for engaging , disengaging , and shifting attention ( posner , 1980 ) , is subserved by the frontal eye fields , superior parietal lobule , and intraparietal sulcus , and the superior colliculus of the midbrain tectum ( posner and petersen , 1990 ) . \n covert orienting is associated with unobservable , internal shifts of attention without engaging eye , head , or body movements ( klein , 2004 ) . \n tectal and posterior cortical abnormalities have been linked to covert orienting deficits in a variety of adult neurological disorders ( rafal et al . , 1988 ) . \n this neurodevelopmental disorder is of particular interest because in addition to covert orienting deficits , developmental dysmorphologies in sbm commonly include congenital abnormalities of the tectum and reduced volume and atypical cortical thickness of the parietal lobes due to hydrocephalus . \n however , the relation of these attentional difficulties and brain abnormalities has not been quantitatively examined . \n because sbm has a range of both cognitive and neural variability , one can not assume specific links , and so it is important to demonstrate such links directly in a hypothesis driven manner . \n spina bifida myelomeningocele , a neural tube defect , is associated with the chiari ii malformation , which involves a small posterior fossa and associated pathology of the cerebellum and brainstem , often contributing to obstructive hydrocephalus and compression of the midbrain ( juranek and salman , 2010 ) . \n in addition , hypoplasia or partial dysgenesis of the corpus callosum ( hannay et al . , 2009 ) is common , along with , significant variations in cortical thickness : frontal regions are often enlarged and posterior regions thinned ( juranek et al . , 2008 ) . \n demonstrates frequently observed neurostructural abnormalities in sbm . as part of the spectrum of abnormalities associated with chiari ii malformation , \n the majority of individuals with sbm and chiari ii malformation have a beaked tectum that is stretched posteriorly and inferiorly ( behramn et al . , 2003 ) . \n ( 2013 ) used diffusion tensor imaging ( dti ) to investigate the frontal and parietal tectocortical attention pathways in individuals with sbm relative to typically developing ( td ) individuals . \n compared to td individuals , those with sbm had reduced tectal volume , decreased fractional anisotropy in parietal tectocortical pathways , and a greater discrepancy between frontal and parietal tectocortical diffusion metrics . \n those with sbm and tectal beaking had increased axial diffusivity across frontal and parietal tectocortical pathways compared to individuals with sbm and no tectal beaking . \n impairment of the orienting network in sbm is well - established ( dennis and barnes , 2010 ) . \n individuals with sbm and a beaked tectum have more difficulty disengaging attention from a current stimulus and redirecting it towards a new stimulus when compared to td individuals and individuals with sbm and no tectal beaking ( dennis et al . , \n similar findings have been found in infants with sbm , who require more time to disengage and shift their attention towards new stimuli relative to td infants ( taylor et al . , 2010 ) . \n although these findings suggest a relation between orienting deficits and tectum , this relation has not been quantitatively evaluated . \n individuals with sbm have demonstrated executive control difficulties on measures of top - down attention processes such as attention control and response inhibition ( ou et al . , 2013 ) . \n in contrast , on continuous performance tasks , several studies found that individuals with sbm make more commission errors relative to td individuals ( swartwout et al . , 2008 ) , implicating response inhibition difficulties , although such findings have not been unequivocal ( colvin et al . , 2003 ) . \n the objective of the present study was to investigate the relations of tectal and superior parietal cortical volume , and tectocortical diffusivity metrics , with functioning of the orienting and executive control attention networks in sbm . \n given the role of the superior colliculus in the orienting network , we hypothesized that lower tectal volume would be associated with poorer covert orienting , but not with executive control functions . because the superior parietal cortex subserves both the orienting and executive control networks \n , we hypothesized that lower volume of the superior parietal cortex would be associated with poorer performance on both covert orienting and executive control tasks . \n finally , we did not have any a priori expectations concerning the understudied relations of tectocortical pathways and attention outcomes . \n the present study is novel due to a large clinical sample , the simultaneous analysis of both the orienting and executive control attention networks , and the implementation of robust correlations and bootstrap procedures to increase the reliability of findings . \n participants included 80 individuals with sbm ( also reported in williams et al . , 2013 ) who had undergone structural mri of the brain . \n these participants were recruited through clinics in houston . of these individuals , 74 had complete neuroimaging , orienting , and conflict resolution data ( except for the superior parietal cortex , orienting , conflict resolution data where n = 73 ) , and 59 had complete neuroimaging and attentional control data . \n inclusion criteria consisted of a myelomeningocele at birth , evidence of hydrocephalus , and adequate upper limb control . \n the sample was 13.70 years in age ( sd = 4.81 , age range : 7.9029.11 years ) , 55% male , and 53% hispanic . \n the sample was representative of other samples of sbm , with most showing the chiari ii malformation ( 88% ) , thinning ( 61% ) or partial dysgenesis ( 35% ) of the corpus callosum , lower spinal lesions ( 86% ) , ambulatory difficulties ( 68% ) , no seizure history ( 64% ) , and two to four shunt revisions ( 49% ) . \n the study was approved by the human participants review boards at all institutions . parents and participants \n gave written consent unless the participant was under 13 , in which case the parent consented and the child assented . \n high - resolution t1 scans were obtained on a philips 3.0 t intera system with the following acquisition parameters : slice thickness = 1.5 mm ; tr / te = 6.5 6.7/3.043.14 ms ; flip angle = 8 ; square fov = 24 cm ; matrix = 256 256 ; in - plane pixel dimensions ( x , y ) = 0.94 , 0.94 ; nex = 2 . dti images were acquired using a single - shot spin - echo diffusion sensitized echo - planar imaging ( epi ) sequence with the balanced icosa21 encoding scheme with the following parameters : 44 slices total ; square field of view ( fov ) = 24 cm ; acquisition matrix = 256 256 ; slice thickness = 3 mm ; tr / te = 6100/84 ms ; b - value = 1000 s / mm . a single non - diffusion weighted image with a b - value = 0 s / mm was acquired concurrently as an anatomical reference volume . \n resultant cortical labels were non - linearly co - registered using fmrib 's linear image registration tool ( flirt ) and transformed into native dti space to serve as endpoint masks for tractography procedures . \n cortical labels were dilated 2 mm into adjacent white matter to facilitate fiber - tracking procedures . \n dti acquisitions were processed using tools available through freesurfer and fsl ( http://fsl.fmrib.ox.ac.uk/fsl/fslwiki/fsl ) image analyses software ( behrens et al . \n diffusion tensors were calculated for each voxel using a least - squares fit to the log of the diffusion signal . \n maps for fractional anisotropy ( fa ) , axial diffusivity [ 1 ] ( ad ) and radial diffusivity [ ( 2 + 3 ) / 2 ] ( rd ) were isolated for further fsl probabilistic tractography processing and analysis ( budde et al . , 2007 ) . \n non - diffusion weighted images ( t2 ) were skull stripped and used as a mask to remove non - brain tissue from calculated diffusion maps . \n the midbrain tectum was manually defined for each participant by a single rater blinded to diagnosis in order to determine tectal volume and to function as a seed region in subsequent probabilistic tractography procedures ( williams et al . , \n hand drawn rois were traced in fslview in the axial plane of the t2-weighted lowb ( e.g. b = 0 ) image of the dti sequence such that the tectal label directly corresponded to the intended collicular structure in native dti space ( minimizing the need for spatial transformations reliant on co - registration procedures that were found to be less reliable for smaller mid - brain regions ) . \n dice similarity coefficients ( 0.894 ) showed strong intra - rater reliability for the manual tracings ( zou et al . \n volume of the superior parietal cortex within each hemisphere was acquired using the freesurfer automatic cortical parcellation routine ( desikan et al . , 2006 ) . \n probabilistic tractography was performed per hemisphere with seeding in the left or right collicular division . \n tractography iterations were performed twice per hemisphere defining connectivity from the colliculi to separate parietal and frontal cortical endpoint regions , yielding four tracts for each participant : left hemisphere ( lh ) tectal - frontal , lh tectal - parietal , right hemisphere ( rh ) tectal - frontal , rh tectal - parietal . \n tract normalization entailed waytotal normalization , thresholding to remove voxels with fa values less than 0.2 to minimize crossing fibers and partial voluming , with resultant output binarized to create tractography - derived masks for each pathway . \n mean fa , rd , and ad was subsequently calculated for each pathway and served as dependent variables in subsequent statistical analysis . \n the child attention network test ( rueda et al . , 2004 ) was designed to measure orienting and executive control attention networks in participants as young as 4 years of age ( rueda et al . , 2004 ) . because the child version of the test is a computerized , timed test where ceiling effects are unlikely \n , it was possible to administer the same test to all participants regardless of their age . \n the four cue types include : no cue ( a fixation cross ) ; a central cue ( an asterisk in the place of the fixation cross ) ; a double cue ( asterisks above and below the fixation cross ) ; and a spatial cue ( an asterisk in the location of an upcoming target ) . \n the three flanker conditions include : congruent , incongruent , or neutral flankers . in the congruent flanker condition , \n the target and four distractors face the same direction . in the incongruent flanker condition , target and distracters \n the goal of the task is to determine in which direction the target is pointing using right or left button press . \n the primary measures for this study were composites associated with the orienting and executive control attentional networks . \n the covert orienting network was captured with the orienting measure , equal to rt - centralcuert - spatialcue . \n the executive control network was captured with the conflict resolution measure , equal to rt - incongruentrt - congruent . \n within sample reliability of orienting and conflict resolution measures was equal to r = .11 and r = .47 , respectively . \n test of everyday attention for children , the opposite worlds subtest ( manly et al . , 1999 ) , assessing attentional control , was used as an additional measure of the executive control attention network . \n the opposite worlds task involves two conditions , opposite world and same world . in the same world condition ( the control condition ) , participants read aloud a list of 1 and 2 digits presented on a card . in the opposite world condition ( the attentional control condition ) \n , participants are asked to say aloud the opposite of the digit appearing on the card ( the correct verbal response for number 1 was two , and for number 2 was one ; baron , 2001 ) . \n the order of presented cards is as follows : same world , opposite world , opposite world , same world . \n incorrect responses result in a time penalty , as participants are not permitted to proceed with the task until they correct their response . \n total time required to complete the two cards related to the opposite world condition was used as a measure of attentional control . within sample reliability of \n function relations were estimated using the pearson and percentage bend correlations , as well as the skipped correlation using the donoho gasko median ( dgm ; wilcox , 2003 ) . \n the utility of the three correlations in examining structure function relations is extensively discussed in kulesz et al . \n statistical procedures were completed in r version 3.0.2 ( r development core team , 2008 ) using the boot package version 1.3 - 9 , foreign package version 0.8 - 55 , mass package version 7.3 - 29 , and custom written functions . \n relying solely on findings from a single sample of data decreases reliability of the results as one can not be sure that the same results will be replicated in the future . \n we sampled n observations with replacement 10,000 times for each relation ( with n was equal to 74 , 73 or 59 observations depending on the investigated relation and missing data points ) to derive bootstrap samples . \n the three correlations were computed for a given relation on each of the 10,000 bootstrap samples . \n empirical distributions of the three correlations were summarized using : mean and confidence intervals based on 2.5 and 97.5 percentiles . \n the findings were evaluated in terms of their generalizability across different correlational estimates as well as single and bootstrap samples . increased reliability of findings was assumed if : ( a ) significance tests for a single sample estimate yielded statistically significant results across all correlational estimates , and ( b ) confidence intervals based on the bootstrap distributions excluded 0 across all correlational estimates . \n table 1 presents means and standard deviations for the tectum and superior parietal cortex volumes , fa , ad , and rd values for frontal and parietal tectocortical pathways , as well as measures of the orienting ( i.e. , covert orienting ) and executive control ( i.e. , conflict resolution and attentional control ) attention networks . \n average diffusivity metrics were calculated for each participant based on the output of seed - based probabilistic tractography procedures modeling tectocortical connectivity for each hemisphere . because there were no significant hemispheric differences with regard to indicators of wm tract integrity ( williams et al . , 2013 ) , left and right hemisphere measurements were averaged within participants to provide a single indicator depicting frontal and parietal tectocortical tract characteristics . \n table 2 , table 3 present single sample estimates and mean values of estimates across 10,000 bootstrap samples ( respectively ) of the three correlations . \n as hypothesized , there was a significant negative relation of tectal volume with covert orienting , but not with either measure of the executive control network ( i.e. , conflict resolution and attentional control measures ) . \n importantly , this result was statistically significant for both single and bootstrap samples across all correlational estimates , and therefore considered highly reliable . \n superior parietal cortex volume was significantly associated with conflict resolution , but not with attentional control or covert orienting , partially supporting our hypothesis . a slower pace of resolving conflicts between competing stimuli was associated with lower volume of the superior parietal cortex . \n this relation was significant for single and bootstrap samples for the pearson correlations , but not for the percentage bend correlation or the skipped correlation using the dgm , suggesting that these findings are less reliable and may reflect general properties of a pearson correlation which is less robust to violations of distributional assumptions and outliers . \n significant positive associations were found between attentional control and frontal ad , parietal ad , and parietal rd . \n these results suggest that poorer attentional control was associated with reduced indicators of white matter integrity along both frontal and parietal tectocortical attention pathways . \n relations between dti metrics and attentional control were significant for pearson correlations , but not for the percentage bend correlation or the skipped correlation using the dgm , which as above may reflect the more robust properties of the latter two estimators . \n the relation with rd was significant only for the single sample estimate , suggesting that these findings may be sample - specific . \n despite the generalized nature of the neural abnormalities characteristic of sbm , covert orienting difficulties were specifically related to the midbrain anomalies that emerge as part of the chiari ii malformation . \n in contrast , problems with the executive control network were associated with reduced superior parietal volume , as well as reduced dti indicators of wm integrity along tectocortical pathways , both potentially attributed to the pathological effects of hydrocephalus . \n these results indicate that the neural disruption associated with sbm occurs in a principled manner and can be detected with a sufficiently large sample , a quantitative , multi - modality approach to neuroimaging , and more sophisticated methods for estimating correlations . \n neuropsychological impairments in sbm have historically been assumed to result predominantly from the damaging effects of hydrocephalus on the brain . \n recent investigations into the neuropsychological correlates of tectal beaking suggest that there are specific neuropsychological impairments that can not be attributed solely to the effects of hydrocephalus ; rather , they result from the characteristic brain malformation involving the midbrain and posterior fossa ( treble - barna et al . , 2014 ) . \n as hypothesized , lower tectal volume was associated with poorer covert orienting in sbm , and not with functions of the executive control attention network . \n this finding is highly reliable given that it was statistically significant for both single and bootstrap samples across all correlational estimates . \n the specificity and reliability of this finding confirm previously speculated importance of the superior colliculus in covert orienting ( dennis et al . , 2005 ) . because superior parietal cortex subserves both the orienting and executive control networks , we hypothesized that lower volume of the superior parietal cortex would be associated with poorer performance on both covert orienting and executive control functions . in partial support of our hypothesis , \n lower volume of the superior parietal cortex was associated with poorer conflict resolution in sbm ; however , we did not find expected associations with covert orienting or attentional control . \n cortical volume is a less than optimal measure of brain morphology in sbm , possibly accounting for our only partially supported hypothesis . \n cortical volume can be more finely characterized by contributory components including surface area , thickness , and gyrification . in sbm , although the parietal lobe is lower in cortical volume relative to td individuals ( juranek et al . , 2008 ) , the superior parietal cortex is thicker but less gyrified relative to td individuals ( treble et al . , 2013 ) . \n thus , volume may be inadequately sensitive to associations between brain morphology and attention functions in sbm . when examining wm microstructural morphology , poorer attentional control was associated with increased ad along frontal and parietal tectocortical pathways , and increased rd along parietal pathways . \n ( 2013 ) , dti indicators of wm integrity in those with sbm appeared more compromised along parietal tectocortical pathways compared to controls . however , present findings demonstrated positive associations between reaction time and ad along frontal and parietal pathways , whereas parietal pathways also revealed a significant association between rd and attentional control . \n the specific dti metrics associated with reduced attention performance in each pathway suggest specific mechanisms of injury , with more significant damage in posterior regions . \n although the interpretation of dti metrics is still a topic of active investigation ( see jones and cercignani , 2010 ) , early animal studies provide some ground for interpretation . \n ad is defined as the degree of diffusivity along the primary diffusion axis , and has been related to variations of axonal integrity in animal models . \n conversely , rd is calculated as the average of the two secondary diffusion axes , and is thought to approximate the degree of flow restriction provided by membranes and myelin integrity ( song et al . , 2003 ) . \n increasing values of both axial and radial diffusivity are considered indicators of decreased tissue integrity , and typically demonstrate an inverse relation to fa values . increased ad along both frontal and parietal tectocortical pathways in association with reduced attentional control suggests widespread disruption to axonal integrity and organization along both anterior and posterior white matter pathways in sbm . \n our finding that rd is also higher in the parietal tectocortical attention pathway suggests that posterior white matter regions sustain a double dose of injury , resulting in damage to axonal organization as well as myelin integrity . \n although the hypothesized mechanisms contributing to reductions in dti indicators of white matter integrity vary between frontal and parietal pathways , the results suggest that individuals with sbm may demonstrate executive control difficulties resulting from the effects of hydrocephalus on both the anterior and posterior neural substrates underlying the executive control attention network . \n the results of the present study suggest neural correlates ( disruption of superior parietal cortex and tectocortical white matter pathways ) and pathophysiological mechanisms ( reduced cortical volume and axonal and myelin damage resulting from hydrocephalus ) that may contribute to difficulties in the executive control of attention in individuals with sbm . \n further characterization of the functioning of the executive control network in individuals with sbm relative to their td peers is needed in order to establish whether the identified differences in neural structure ( williams et al . , 2013 ) , and \n the association between that structure and function in the present study , result in significant impairment . \n although individuals with sbm are able to adequately sustain their attention , they are impaired in the ability to successfully disengage and shift it in response to the environment and may also be impaired in their ability to exert executive control over it . \n the present study was limited by a 3 mm dti slice thickness and the use of 21 directions for dti acquisition , which are below current standards . however , at the time the study began in 2005 , these decisions were consistent with current scanner technology and the need to reduce acquisition time for young children . \n the output adequately reflected the intended pathways and the presence of significant structure function associations further supports our confidence in the results . \n although we found several significant structure function associations , only those involving covert orienting were reliably significant for both single and bootstrap samples across all correlational estimates , suggesting that replication of the findings in other samples is warranted . \n it would be of interest for future studies to replicate tractography of tectocortical pathways in sbm , as well as to investigate association pathways , such as the superior longitudinal fasciculus , the integrity of which may be even more strongly related to functioning of the attention networks . \n future studies should also further characterize the functioning of the attention networks in sbm in relation to td individuals , especially that of the executive control network . \n overall , neuroanatomical disruption to the orienting attention network in sbm appears more robust and a direct consequence of characteristic midbrain dysmorphology . \n executive control attention network difficulties in sbm may alternatively emerge from parietal cortical anomalies and reduced frontal and parietal cortical subcortical connectivity related to the pathophysiological effects of congenital hydrocephalus .", "role": "user" }, { "content": "this study investigated the relations of tectal volume and superior parietal cortex , as well as alterations in tectocortical white matter connectivity , with the orienting and executive control attention networks in individuals with spina bifida myelomeningocele ( sbm ) . \n probabilistic diffusion tractography and quantification of tectal and superior parietal cortical volume were performed on 74 individuals aged 829 with sbm and a history of hydrocephalus . \n behavioral assessments measured posterior ( covert orienting ) and anterior ( conflict resolution , attentional control ) attention network functions . \n reduced tectal volume was associated with slower covert orienting ; reduced superior parietal cortical volume was associated with slower conflict resolution ; and increased axial diffusivity and radial diffusivity along both frontal and parietal tectocortical pathways were associated with reduced attentional control . \n results suggest that components of both the orienting and executive control attention networks are impaired in sbm . \n neuroanatomical disruption to the orienting network appears more robust and a direct consequence of characteristic midbrain dysmorphology ; whereas , executive control difficulties may emerge from parietal cortical anomalies and reduced frontal and parietal cortical \n subcortical white matter pathways susceptible to the pathophysiological effects of congenital hydrocephalus .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: while dermatologic practice occurs primarily in the outpatient setting , dermatologists also provide essential consultative services to the care of inpatients admitted to other medical disciplines . \n a dermatologic consult often leads to a revision to the original diagnosis made by the referring physician , ordering of skin directed investigations , and changes in treatment of the skin disease.17 previous studies have shown that the discipline of medicine make the most requests for inpatient dermatologic services.1,4,7,8 we have observed in our institution that patients from the hematology ward form a significant portion of referrals to the dermatologic unit . \n cutaneous eruptions in this cohort of acutely ill , immunocompromised patients on multiple medications can be particularly challenging to the dermatologist . \n the objective of this study was to characterize the profile of dermatological issues frequently encountered in the hematology ward . \n this was a retrospective study conducted at the largest , multidisciplinary tertiary hospital in singapore ( singapore general hospital , singapore ) . \n the hematology department in this hospital regularly receives patients from other institutions in the region and has an active bone marrow transplantation program . \n we reviewed all inpatient referrals for dermatology consultations made from the department of hematology during a 6-month period from january 2010 to june 2010 . \n medical records ( both written and electronic ) of these consultations stored in the hospital were examined . \n a total of 692 inpatient referrals were made to the dermatology unit in the study period . of these , 58 ( 8.3% ) were from the hematology department . \n there were slightly more males ( n = 34 ; 58.6% ) than females ( n = 24 ; 41.4% ) , and the mean age of patients was 55.5 years ( range : 1390 years ) . \n the racial composition included 47 chinese ( 81.0% ) , 8 malays ( 13.8% ) , 2 indians ( 3.4% ) and 1 others \n a total of 60 dermatologic conditions were diagnosed in the 58 patients ( table 2 ) . \n most patients had a primary dermatologic condition , with dermatitis ( 13.3% ) and infective disorders ( 15% ) being most common . \n different types of dermatitis were represented , ranging from asteatotic to seborrhoeic and nummular eczema . \n infections were caused by viruses ( eg , infectious mononucleosis ) , fungi ( eg , candidiasis ) and bacteria ( eg , furuncles ) . \n reactivation of latent herpes simplex giving rise to herpes labialis , was the most common infective condition in our study . \n complications of thrombocytopenia ( petechiae and purpura ) were familiar to the hematologists , and the few cases seen were referred to exclude cutaneous drug eruptions or vasculitis . unsurprisingly , there were a significant number of cases of cutaneous adverse drug reactions ( cadrs ) . \n hematology inpatients were often acutely sick and on multiple medications for treatment of the underlying disease and its complications . \n many of these drugs , such as beta - lactam and sulfa - based antibiotics and allopurinol , are frequently associated with cadrs . \n six patients were diagnosed with toxic erythema of chemotherapy ( tec ) , a term coined by bolognia et al in 2008.9 it encompasses a group of overlapping toxic reactions in the skin due to chemotherapeutic agents that are ( 1 ) not allergic in nature , ( 2 ) resolve spontaneously after chemotherapy is stopped , ( 3 ) usually require only symptomatic treatment , and ( 4 ) do not preclude the use of the same causative agent in the future . \n the major entities within the spectrum of tec include cytarabine ( ara - c ) ears , palmar - plantar erythema , neutrophilic eccrine hidradenitis ( neh ) and eccrine squamous syringometaplasia ( ess ) . \n tec often occurs at a critical period after administration of chemotherapy , when the patient is receiving multiple antibiotics for neutropenic infection , and at risk for cadr and cutaneous infections . \n differentiating tec from cadr or cutaneous infection can be difficult in our study , 4 cases were given a provisional diagnosis of tec versus drug exanthem and 2 cases were diagnosed as exanthem \n since the term tec was introduced , there had been few studies on the clinical features that may help to distinguish it from other differential diagnoses ( such as cadr ) , which often occur in the same clinical setting . \n we sought to clarify this issue by analyzing the cases of drug exanthem and tec in our study ( table 3 ) . \n patients with tec had , on average , a younger age and a shorter duration between the onset of chemotherapy to the eruption of rash . \n however , there is a wide range of values , which overlapped with those of patients who had drug exanthem . \n there was no obvious difference in the presence of neutropenia or intensity of itch amongst the groups . \n apart from two cases of palmar - plantar erythema , the remaining four cases of suspected tec had generalized pruritic , exanthematous eruptions which made them clinically similar to drug or viral induced exanthems . in one patient , \n the cutaneous eruption displayed an intertriginous distribution , which in our experience was a common and distinctive feature in tec.9 the four patients with generalized tec received the following chemotherapeutic agents prior to onset of rash : idarubicin plus cytarabine ( as induction chemotherapy ) , high - dose intermittent cytarabine ( hidac ) and fludarabine , cytarabine plus filgrastim ( flag ) . \n apart from flag , none of the regimens are unique to tec patients in our study many of the patients with cadr had received similar medications either in the current or previous admissions . amongst the patients with drug exanthem , suspected causative drugs were mostly antimicrobials , including : beta - lactam antibiotics , piperacillin \n this resulted in cessation of the suspected drug . in cases where the patient was labeled as \n tec versus drug exanthem , no culprit drugs were named , but two patients still had their antimicrobial agents changed in view of the cutaneous eruption . \n none of the four tec patients had a skin biopsy , either because a clinical diagnosis was deemed sufficient , the patient declined a biopsy or due to the primary physician s concerns about the risks of biopsy in the setting of neutropenia and thrombocytopenia . \n since the term tec was introduced , there had been few studies on the clinical features that may help to distinguish it from other differential diagnoses ( such as cadr ) , which often occur in the same clinical setting . \n we sought to clarify this issue by analyzing the cases of drug exanthem and tec in our study ( table 3 ) . \n patients with tec had , on average , a younger age and a shorter duration between the onset of chemotherapy to the eruption of rash . \n however , there is a wide range of values , which overlapped with those of patients who had drug exanthem . \n there was no obvious difference in the presence of neutropenia or intensity of itch amongst the groups . \n apart from two cases of palmar - plantar erythema , the remaining four cases of suspected tec had generalized pruritic , exanthematous eruptions which made them clinically similar to drug or viral induced exanthems . in one patient \n , the cutaneous eruption displayed an intertriginous distribution , which in our experience was a common and distinctive feature in tec.9 the four patients with generalized tec received the following chemotherapeutic agents prior to onset of rash : idarubicin plus cytarabine ( as induction chemotherapy ) , high - dose intermittent cytarabine ( hidac ) and fludarabine , cytarabine plus filgrastim ( flag ) . \n apart from flag , none of the regimens are unique to tec patients in our study many of the patients with cadr had received similar medications either in the current or previous admissions . amongst the patients with drug exanthem , suspected causative drugs were mostly antimicrobials , including : beta - lactam antibiotics , piperacillin \n this resulted in cessation of the suspected drug . in cases where the patient was labeled as \n tec versus drug exanthem , no culprit drugs were named , but two patients still had their antimicrobial agents changed in view of the cutaneous eruption . \n none of the four tec patients had a skin biopsy , either because a clinical diagnosis was deemed sufficient , the patient declined a biopsy or due to the primary physician s concerns about the risks of biopsy in the setting of neutropenia and thrombocytopenia . \n skin problems are common in inpatients with underlying hematological or oncological diseases . in a random review of patients admitted to a hematology - oncology unit , pearson et al found mucocutaneous disorders in 88% of cases seen.10 the most common findings in their study were alopecia , mucositis , palm and sole erythema associated with bone marrow transplantation and drug allergies . \n this is consistent with findings from previous studies , including one from our institution , that non - dermatologists face difficulties diagnosing common dermatoses.13,5,6,8 a dermatologic consultation resulted in changes in diagnosis and management in 60% to 77% of times.1,3,6 this underscores the importance and continuing demand for inpatient medical dermatology . \n a dermatology hospitalist model has been proposed to improve inpatient dermatologic care and further dermatologic education of students and consulting physicians.11 evaluation of cutaneous eruptions in a hematologic - oncologic cohort can be challenging . apart from common dermatologic issues , \n these patients are at risk for adverse reactions to chemotherapeutic agents , atypical infections , paraneoplastic syndromes , nutritional deficiencies , hypersensitivity reactions and cutaneous metastases from their primary neoplasm . \n a typical scenario in the setting of the hematology ward is a patient who developed a rash while on multiple antibiotics for treatment of neutropenic sepsis , which set in after chemotherapy . \n most commonly , the rash had developed fairly rapidly , is pruritic , exanthematous and generalized . \n possible diagnoses include cutaneous infections ( both primary and embolic ) , cadr , tec and graft versus host disease ( gvhd ) , if transplantation had taken place . \n cadr may progress to severe cutaneous adverse reactions ( scar ) if the offending drug ( most often an antimicrobial ) is not stopped promptly , whereas tec often requires only supportive treatment and will resolve spontaneously . \n morbilliform drug eruptions often display mild perivascular lymphocytic infiltrates and few necrotic keratinocytes within the epidermis . \n cutaneous infections may show lymphocytic and/or neutrophilic infiltrates in the dermis with the causative microorganism identifiable by appropriate stains or culture . \n the major histologic features of gvhd include basal layer vacuolization , presence of apoptotic keratinocytes sometimes adjacent to lymphocytes ( satellite cell necrosis ) , exocytosis of mononuclear cells and focal spongiosis . \n the results of a biopsy must be interpreted within the clinical context , especially when histologic features are non - specific or show significant overlap amongst possible differential diagnoses.12 this highlights the importance in developing a discriminative eye to subtle clinical differences between diseases with similar characteristics . in our study , we also looked for clinical features that may guide the clinician to differentiate tec from cadr , a common clinical problem . \n a delay in diagnosis may be deleterious to the patient , whether in terms of unnecessary stoppage of antibiotics in cases of tec , or inappropriate continuation of offending drugs in cadr . \n we were unable to find major differences in terms of patient characteristics , degree of pruritus , morphology or distribution of rash , presence of fever or neutropenia , and type of chemotherapy regimen between the two groups in our patients . \n one patient with tec was noted to have an intertriginous distribution of his rash which has been reported to be a feature of tec.9 limitations of our study include the small number of patients , and its retrospective nature where some data was not adequately recorded and incomplete . \n most of the dermatological conditions were diagnosed clinically , and a biopsy was not deemed necessary . in other situations , the patients declined biopsy out of concern for bleeding or infection . \n we did not have complete data on the presence of neutropenia in our patients , and could not examine if there was a relationship between blood anomalies and the occurrence of inflammatory or infective dermatoses . \n hematology inpatients suffer from common dermatological diseases , as well as cutaneous eruptions unique to their situation . \n larger studies of a prospective nature may shed light on the useful clinical features that may guide the dermatologist faced with this dilemma .", "role": "user" }, { "content": "backgroundskin problems are common in patients with hematological disorders . dermatologists play an important role in providing consultative service to other medical specialties . while most requests for dermatologic consultations are for common skin conditions , challenging scenarios and diagnostic dilemmas \n are frequently encountered , especially in acutely ill , immunocompromised patients.aimto characterize the profile of dermatological problems encountered in a hematology unit in a tertiary hospital , and to delineate clinical features that may help to distinguish cutaneous adverse drug reactions from toxic erythema of chemotherapy.materials and methodsa retrospective study was conducted reviewing all inpatient referrals for dermatology consultations from the hematology unit during a 6-month period from january 2010 to june 2010 , at the largest multidisciplinary tertiary hospital in singapore.resultsof the 692 referrals for dermatology consultation , 58 ( 8.3% ) came from the hematology department . \n a total of 60 dermatological diagnoses were made . \n most patients were referred for primary dermatological disorders ( 43.33% , n = 26 ) . \n the most common diagnoses within this category were cutaneous infections ( 15% , n = 9 ) and dermatitis ( 13.33% , n = 8) . \n cutaneous adverse drug reactions ( 16.67% , n = 10 ) and toxic erythema of chemotherapy ( 10% , n = 6 ) were also frequently encountered . \n we could not identify any distinctive clinical feature that may help to differentiate the two conditions.conclusionour study reinforces the importance of inpatient medical dermatology in terms of both service and education to nondermatologists , who continue to face difficulties diagnosing common skin disorders . \n cutaneous adverse drug reactions and toxic erythema of chemotherapy are clinically similar and difficult to differentiate . \n larger prospective studies are needed to examine this problem .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: dermatophytes comprise a highly specialized group of pathogenic fungi that infect keratinized tissues ( skin , hair , and nails ) of humans and animals , resulting in dermatophytoses , also referred to as tinea infections . \n taxonomically , dermatophytes are classified into three genera : epidermophyton , microsporum , and trichophyton , with the latter being the most complex , containing more than 15 species and several different variants within the species t. mentagrophytes . the most frequently observed dermatophyte species worldwide is t. rubrum , whose infections usually manifest as tinea pedis and tinea unguium ( onychomycosis ) . \n the prevalence of t. rubrum as a causative agent of onychomycosis is particularly high and exceeds 90% in europe . \n the identification of t. rubrum by means of conventional laboratory methods may not always be easy or straightforward , since t. rubrum exhibits substantial phenotypic variability . \n contrastingly , a high degree of homogeneity of the t. rubrum genome , as revealed by using several anonymous molecular markers , significantly impedes discrimination at the strain level [ 3 , 4 ] . yet , as new molecular typing methods are becoming increasingly available , species determination and strain typing are still being improved . \n the aim of this study was to apply some of the recently devised dna fingerprinting methods to the identification and strain differentiation of t. rubrum . \n the study included 57 isolates of t. rubrum recovered from as many dermatological patients from lower silesia , poland ( 40 ) , krakw , poland ( 8) , and tbingen , germany ( 9 ) . \n clinically , onychomycosis showed the highest number of cases ( 40 patients ; 70.2% of all patients ) , followed by tinea pedis ( 12 ; 21% ) , tinea corporis ( 2 ; 3.5% ) , tinea cruris ( 2 ; 3.5% ) , and tinea manuum ( 1 ; 1.8% ) . \n the isolates were primarily identified as t. rubrum on the basis of their phenotypic characteristics , such as colony surface texture , reverse pigmentation , the ability of micro- and macroconidia formation , and urease activity , assessed by standard mycological procedures . \n the identification of t. rubrum was achieved by restriction fragment length polymorphism ( rflp ) analysis of the internal transcribed spacer ( its ) region of rdna , as previously described . \n the amplified products were digested with mvni , hinfi , and , where necessary , with mvai restriction endonucleases ( roche ) , at a 2-h incubation at 37c . \n the resulting restriction fragments were separated electrophoretically on 8% polyacrylamide gels and visualized under uv light after ethidium bromide ( et - br ) staining . \n two primers , designated 1 and 6 , as devised by baeza and mendes - giannini , were used in two separate randomly amplified polymorphic dna ( rapd ) assays . \n amplification products were resolved by electrophoresis using 1.5% agarose gels and were photographed under uv light after et - br staining . \n the gel images were analyzed by the gel doc system and quantity one ( bio - rad , usa ) software . \n a dendrogram of the rapd profiles obtained with primer 1 was constructed using dice s coefficient of similarity and the unweighted pair - group arithmetic averaging ( upgma ) clustering method . \n of the 57 clinical isolates assessed in this study and recognized as t. rubrum by conventional identification methods , 55 ( 96.5% ) were further confirmed as t. rubrum by means of pcr - rflp analysis . \n using mvni , all of the isolates except for one ( 841/05 ) yielded restriction patterns consistent with that of trichophyton taxon . using hinfi , 55 ( 96.5% ) \n one isolate ( 841/05 ) could not be assigned to any of the dermatophyte species , distinguishable by their unique rflp profiles obtained with mvni , hinfi , or mvai enzymes . among the 55 \n t. rubrum isolates , a total of 40 distinct patterns ( a an ) were obtained by rapd with primer 1 . \n the four most prevalent patterns , designated as t , aj , ae , and an , contained five , four , three , and three isolates , respectively . \n four patterns ( c , af , ag , and al ) contained two isolates each , and the remaining 34 patterns were represented by single isolates . \n the rapd with primer 6 generated five different profiles in t. rubrum isolates ( a e ) and two additional profiles in non - t . \n rubrum isolates ( designated as f and g for isolate nos . \n b , found in 23 isolates , followed by profiles designated as a and c , represented by 19 and 11 isolates , respectively . \n patterns designated as d and e were each identified for one isolate . \n the combination of the profiles obtained with both primers resulted in 47 different genotypes for the t. rubrum isolates . \n six of those genotypes were common to three ( type t - a and type aj - a ) or two ( types c - a , ae - b , af - b , and an - a ) isolates , whereas the remaining 41 genotypes were unique , which are represented by single isolates only . \n the distribution of the genotypes varied among the three geographical regions from which the isolates originated . of the 40 rapd genotypes produced with primer 1 , each \n twenty - six genotypes occurred in isolates from lower silesia , eight genotypes were observed in isolates from krakw , and six in isolates from tbingen , germany . regarding the genotypes obtained by rapd with primer 6 , genotypes \n b and c were found in isolates from all three regions studied , and genotype a was observed in the lower silesia and tbingen isolates , but not in the krakw isolates . \n c were the most prevalent in single regions , i.e. , in lower silesia ( 44.7% of isolates ) , krakw ( 62.5% ) , and tbingen ( 44.4% ) , respectively . \n a dendrogram based on the rapd profiles with primer 1 allowed the separation of the t. rubrum isolates into genetic similarity groups ( clusters ) . \n a total of 48 isolates could be allocated into six main clusters ( i vi ) , with the similarity index between the isolates within the cluster being 80% or higher ( fig . 1 ) . \n the largest cluster ( vi ) comprised 21 isolates , for which 11 different patterns were obtained . \n clusters iv and v consisted of eight isolates each , being representative of either four ( cluster iv ) or eight ( cluster v ) distinct patterns . \n the numbers of isolates ( and corresponding patterns ) belonging to the remaining clusters were 3 ( 2 patterns ) for cluster i , 5 ( 5 ) for cluster ii , and 3 ( 3 ) for cluster iii . \n 1dendrogram showing genetic relationships among 55 trichophyton rubrum strains inferred from the randomly amplified polymorphic dna ( rapd ) patterns generated by using primer 1 dendrogram showing genetic relationships among 55 trichophyton rubrum strains inferred from the randomly amplified polymorphic dna ( rapd ) patterns generated by using primer 1 \n the traditional , culture - based methods of identifying dermatophytes are cumbersome , laborious , and often inconclusive , due to fungal phenotypic variability and pleomorphism [ 1 , 8 ] . \n however , the advent of molecular biology tools has enabled the development of new molecular approaches to the diagnosis of dermatophyte infections . \n , relies upon rflp analysis of pcr - amplified its regions of the rdna gene complex . \n the only modification to the original procedure was the use of mvni and hinfi instead of mvai . whereas digestion with mvni allows discrimination between the three main dermatophyte genera ( trichophyton , microsporum , and epidermophyton ) , the hinfi digestion results in species - specific restriction profiles . by using those two restriction enzymes , we wanted to verify their usefulness in the molecular identification of dermatophyte species , and t. rubrum in particular . \n the results from this study showed high concordance between conventional and molecular techniques for identifying t. rubrum . \n rubrum isolates : one was identified as t. tonsurans ( upon restriction analysis with mvai ) and the other was concluded to be a non - dermatophyte fungus . a possible explanation for the latter may relate to the laboratory contamination of the specimen and/or culture . \n it is also noteworthy that the application of the pcr - rflp analysis , as in this study , does not allow to distinguish between t. rubrum and t. soudanense . \n the distinction between the two species is only possible with methods that target single nucleotide polymorphisms ( snps ) within the its regions of rdna . \n given , however , that t. rubrum differs substantially from t. soudanense in terms of phenotypic properties and geographical distribution ( the former is cosmopolitan , while the latter is restricted mainly to the sub - saharan part of africa ) , the assignment to the t. rubrum species provided by pcr - rflp seems unambiguous . \n differentiation of t. rubrum at the strain level has been attempted using a number of genotyping methods , though with unsatisfactory results [ 3 , 13 , 14 ] . \n have recently reported on intraspecific variability within t. rubrum by pcr - amplifying two tandemly repetitive subelements ( trss ) , located in the non - transcribed spacer ( nts ) region of the rrna gene cluster . \n more recently , the rapd analysis performed by baeza et al . with two decameric primers , designated 1 and 6 , has been shown to produce a high degree of interstrain polymorphism [ 7 , 16 ] . \n the rapd analysis with primers 1 and 6 was also applied in the present study , and this choice was motivated by a high discriminatory potential of the method , higher than that of the trs typing system . \n based on the combined rapd profiles , a total of 47 distinct genotypes were obtained . \n hence , the overall genetic diversity rate ( gdr ) , calculated as the number of different genotypes divided by the number of isolates , was 85.4% . \n it is noteworthy that most of the polymorphism was generated by rapd with primer 1 . \n it yielded 40 profiles , whereas rapd with primer 6 resulted in only five profiles ( gdrs of 72.7% and 9.1% , respectively ) . in the first study that used primers 1 and 6 , among ten clinical isolates of t. rubrum , \n five molecular patterns were observed for each primer . in a subsequent study including 67 t. rubrum isolates , a total of 12 and 11 individual patterns were obtained by rapd with primers 1 and 6 , respectively ( gdrs of 17.9% and 16.4% , respectively ) . \n another study that investigated the intraspecific diversity of t. rubrum isolates originating from japan and china revealed a considerable tightness of the population structure . \n all 150 isolates tested were split into only 19 fingerprinting genotypes , based on the combined rapd analyses with primers 1 and 6 ( gdr of 12.7% ) . \n much higher genotypic variability with the same primers was shown in a recent study of santos et al . . \n nineteen different molecular profiles were configured for 52 t. rubrum isolates when each of the primers was used independently , resulting in a gdr of 36.5% . \n it was speculated by the authors that the greater genetic diversity revealed in their study might result from having used strains exclusively from patients with onychomycosis . \n this condition , with its frequent chronicity , has been associated with mixed infections by multiple t. rubrum genotypes . \n collectively , the results of the studies cited above differ in terms of genetic polymorphism achieved by rapd with both of the primers . \n the polymorphism obtained in our study was exceptionally high , and this may relate to the specific , genetic structure of polish ( and german ) isolates , which is different from that of the so - far - analyzed t. rubrum populations . \n the polymorphism obtained by rapd with primer 1 was further investigated by a dendrogram analysis derived from the similarity coefficients between the rapd patterns . \n although the similarity coefficient value for the entire t. rubrum population studied was calculated to be 52% , a vast majority of isolates ( 87.3% ) were distributed into six clusters , within which all of the isolates shared at least 80% similarity . \n this finding , considering that the similarity coefficient value of 0.80.99 is assumed to represent genetically related isolates , indicates that the clustered isolates might have originated from the same strain that had undergone microevolutionary changes . \n thus , the high polymorphism resolved by rapd may relate to the reproducibility of the rapd technique itself . \n indeed , rapd assays often suffer from poor reproducibility and variations in the amplification patterns between isolates may be caused by even the slightest changes in the pcr reaction conditions . \n this explains the reluctance on the part of researchers to use the rapd method and their search for newer molecular tools with a better diagnostic performance . \n one such promising alternative method is multilocus microsatellite typing ( mlmt ) , which has recently been developed by grser et al . . \n finally , the fact that every genetic cluster identified in rapd with primer 1 was restricted to a single geographical locale , together with marked differences in the frequencies of the three most prevalent genotypes produced from rapd with primer 6 , may suggest that certain genotypes exhibit regional and/or geographical affinities . \n however , since this study was carried out on a relatively small sample of isolates , the geographical specificity of the genotypes would need to be confirmed by further research involving a larger population . interestingly , the geographical differentiation of t. rubrum populations has , so far , been revealed only by using the mlmt methodology [ 4 , 21 ] . in conclusion , the results from this study demonstrated the usefulness of pcr - rflp in the rapid identification of t. rubrum , yet the insufficient suitability of the rapd analysis for t. rubrum strain differentiation , due to its poor reproducibility .", "role": "user" }, { "content": "trichophyton rubrum represents the most frequently isolated causative agent of superficial dermatophyte infections . \n several genotyping methods have recently been introduced to improve the delineation between pathogenic fungi at both the species and the strain levels . \n the purpose of this study was to apply selected dna fingerprinting methods to the identification and strain discrimination of t. rubrum clinical isolates . \n fifty - seven isolates from as many tinea patients were subjected to species identification by polymerase chain reaction restriction fragment length polymorphism ( pcr - rflp ) analysis and strain differentiation using a randomly amplified polymorphic dna ( rapd ) method , with two primers designated 1 and 6 . using pcr - rflp , 55 of the isolates studied were confirmed to be t. rubrum . among those , \n a total of 40 and five distinct profiles were obtained by rapd with primers 1 and 6 , respectively . \n the combination of profiles from both rapd assays resulted in 47 genotypes and an overall genotypic diversity rate of 85.4% . a dendrogram analysis performed on the profiles generated by rapd with primer 1 showed most of the isolates ( 87.3% ) to be genetically related . \n pcr - rflp serves as a rapid and reliable method for the identification of t. rubrum species , while the rapd analysis is rather a disadvantageous tool for t. rubrum strain typing .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: nowadays , ultraviolet ( uv ) photodetectors play very important roles in many fields such as missile tracking , ozone monitoring , flame detection , imaging techniques and lightwave communications [ 1 - 3 ] . \n one - dimensional nanostructures of high - performance oxides have attracted considerable attention as a class of potential optoelectronic materials . \n so far , uv nano - photodetectors based on zno nanowires , sno2 nanowires and ga2o3 nanowires have been investigated , and some remarkable characteristics such as wavelength selectivity and photoresponse have been revealed [ 4 - 7 ] . as a kind of important transition metal oxides , \n tungsten oxides have been extensively researched for their distinctive properties including electrochromism , photochromism , gaschromism and photosensitivity [ 8 - 13 ] . among the sub - stoichiometric phases of wox , \n monoclinic w18o49 has attracted much attention for their photoluminescence , gas sensing and field emission properties [ 14 - 19 ] . however , to our knowledge , the photoconductivity characteristics of the w18o49 nanostructures have not been reported until now . in this paper , we report a systematic study on uv photoconductivity characteristics of single w18o49 nanowires . \n the conductivity of w18o49 nanowires is extremely sensitive to uv light exposure , allowing us to reversibly switch the photoconductors between off and on states with ilight / idark ratios of two orders of magnitude , excellent stability and reproducibility . \n the results indicate that the w18o49 nanowires are a potential candidate for applications in high sensitivity nano - photodetector and nano - photoelectronic switch . \n the w18o49 nanowires were synthesized on ito glass substrates by thermal evaporation of tungsten trioxide powders without catalysts or additives . to fabricate single - nanowire detectors , seven parallel ti / au ( 10 nm/150 nm ) electrodes spaced about 2 m apart were fabricated with photolithography on a p - type si substrate with a 500 nm sio2 layer . \n the as - prepared w18o49 nanowires were dispersed in deionized water by ultrasonic . an ac voltage with a frequency of 1 mhz and a peak to peak voltage vp \n p = 16 v was applied between the two electrodes when a droplet of the w18o49 nanowires suspension was dropped to cover the electrodes area using a micropipette . \n a fast thermal annealing at 300c was carried out in n2 atmosphere for 2 min to form the ohmic contacts between the electrodes and nanowire . \n the as - prepared nanowires were characterized by x - ray powder diffraction ( xrd ) on a rigaku rint 2400 x - ray diffractometer with cu k radiation . \n all the characteristic peaks can be indexed to monoclinic w18o49 phase with the lattice constants a = 18.280 , b = 3.775 , c = 13.980 and = 115.20 , which is in good agreement with the jcpds , no . \n the lines mark the expected position for w18o49 phase ( jcpds 05 - 0392 ) figure 2a , 2b respectively , show a schematic illustration and a sem image of the nanowire photoconductor in a configuration of field effect transistor ( fet ) . under dark condition , \n the current voltage ( isd vsd ) characteristics of the fet at different gate voltages ( from + 20 to 20 v with a 10 v step ) are shown in fig . \n the conductivity of w18o49 nanowire increases with increasing the gate voltage , which indicates that the nanowire is an n - type semiconductor . \n the n - type conduct behavior in nominally undoped tungsten oxide can be attributed to the presence of oxygen vacancies . \n b sem image of a single - w18o49 nanowire device . cids vds characteristics of a typical w18o49 nanowire fet optoelectronic characteristics of the device were investigated under 312 nm uv illumination with an intensity of 1.0 mw / cm . as shown in fig . \n the conductivity of the nanowire increases from 2 ns in the dark to 37 ns under the uv light illumination , which shows its potential application as uv photodetector . \n the current flowing between au electrodes without the nanowires connecting has been measured to exclude the possible contribution of the electrodes and the substrate . \n a photocurrent as a function of bias voltage for a single w18o49 nanowire under 312 nm uv light with an intensity of 1.0 mw / cm and dark state , respectively . \n the bias voltage is 0.5 v the photoconductance of the w18o49 nanowire is dependent on light intensity . \n figure 3b shows the photocurrent as a function of the light intensity for a single nanowire irradiated with the 312 nm uv light . \n the photocurrent ( ip ) can be expressed by a simple power law : where p is the intensity of uv illumination . \n the non - unity exponent is a result of the complex process of electron hole generation , trapping and recombination within the material . to change the power of illumination , the conductance can increase by 10 times without damaging the nanowire . because the uv light intensity is relatively low , \n it suggests that the hole - traps present on the surface of the nanowire havent absolutely been released at low light intensity , leading to unsaturation of the photocurrent . as a critical parameter for photoconductors , \n the gain g was defined as the number of electrons collected by electrodes due to the excitation by one photon . \n g can be expressed as where ne is the number of electrons collected in unit time , np is the number of absorbed photons in unit time , is carrier lifetime , and ttran is the transit time between the electrodes . \n take the obtained photocurrent value under 312 nm uv light with an intensity of 1.0 mw / cm and the exposal area about 4 10 cm of the nanowire into eq . \n figure 4a shows the response of the device to 312 nm light at a bias of 0.5 v. the real - time by on / off switching was measured with an intensity of 1.6 mw / cm . \n the measured photocurrent shows a rapidly increase to 60 na upon exposure to uv light with 1.6 mw / cm and decreases back to the initial value when the uv light was turned off . \n the enhanced conductivity under uv light illumination is attributed to the photogenerated carriers in the semiconducting nanowire . as shown in fig . \n 4b , detailed data analysis reveals a rise time ( tr ) and fall time ( tf ) of 35 and 100 s , respectively . \n it is worth mentioning that the time constant for the rise time is always faster than the fall time , which is believed that traps and other defect states were involved in the process . \n a photoresponse of a single w18o49 nanowire upon pulsed illumination by a 312 nm wavelength uv light with an intensity of 1.6 mw / cm . \n the arrows indicate the points of 10 and 90% peak value used for calculating the rise time tr and fall time tf for their large surface - to - volume ratio , chemisorption on the surface of nanowires may play an important role on the conductivity \n . to study the adsorption effect , we investigated the response of the w18o49 nanowires in air and vacuum under dark condition . due to the presence of oxygen vacancies , as - synthesized nanowires are usually n - type semiconductors as demonstrated in fig . \n these vacancies serve as active sites for adsorption of ambient oxygen , which can create a depletion layer in the near - surface region of the nanowires by capturing free electrons , and result in a decrease of conductivity of the nanowires . \n the conductivity of the w18o49 nanowire device increases obviously in vacuum compared to that measured in air under the same bias voltage , as shown in fig . \n , some oxygen molecules could be desorbed from the surface of the nanowire , and some captured free electrons can be released from the near - surface depletion region , leading to an increase of the conductivity . \n therefore , the ambient would be an important factor to the photodetector of the w18o49 nanowires . \n the photocurrent response of a single - w18o49 nanowire device in vacuum and atmosphere under dark condition \n the photoelectrical properties have been characterized systematically and shown the highest light sensitivity at uv light . \n a simple power - law dependence on uv light intensity was observed at room temperature . \n absorption of oxygen on the surface of the w18o49 nanowires can significantly influence their conductivity . \n the results will open up some new possibilities of using w18o49 nanowires for fabricating nanodevices such as high - performance uv detectors , optical keys and optical memory . \n this work was supported by the national natural science foundation of china and the teaching and research award program for outstanding young teachers in high education institutions of moe , china . \n this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited . \n this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited .", "role": "user" }, { "content": "photodetectors in a configuration of field effect transistor were fabricated based on individual w18o49 nanowires . \n evaluation of electrical transport behavior indicates that the w18o49 nanowires are n - type semiconductors . \n the photodetectors show high sensitivity , stability and reversibility to ultraviolet ( uv ) light . \n a high photoconductive gain of 104 was obtained , and the photoconductivity is up to 60 ns upon exposure to 312 nm uv light with an intensity of 1.6 mw / cm2 . \n absorption of oxygen on the surface of w18o49 nanowires has a significant influence on the dark conductivity , and the ambient gas can remarkably change the conductivity of w18o49 nanowire . \n the results imply that w18o49 nanowires will be promising candidates for fabricating uv photodetectors .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: superior mesenteric artery syndrome ( smas ) is a rare gastrovascular disorder resulting in proximal intestinal obstruction . \n affected patients are characterized by a decreased angle between the overlaying superior mesenteric artery and underlying abdominal aorta , resulting in compression of the third portion of the duodenum.1 this rare syndrome typically occurs secondary to rapid weight loss.2 significant weight loss decreases the amount of retroperitoneal fat between the superior mesenteric artery and aorta , thus removing a major source of cushioning for the duodenum and allowing duodenal compression . \n weight loss can be attributed to a number of causes , including dietary disorders such as : anorexia nervosa or malabsorption ; severe wasting states such as burns , cachexia , and endocrine disorders ; spinal deformity due to scoliosis or severe trauma ; mechanical compression due to retroperitoneal tumors ; and even bariatric surgery.112 early diagnosis of smas is vital as any delay can result in severe complications , including electrolyte abnormalities , fatal catabolysis , peritonitis , and gastric perforation.2,13 despite the numerous etiologies known , systemic chemotherapy has rarely been reported as a cause of smas . here \n we present a case of a patient with mesothelioma undergoing treatment with carboplatin - based chemotherapy whose course was complicated by the development of smas . \n a previously asymptomatic 81-year - old caucasian male presented to the emergency room complaining of multiple episodes of bilious , projectile , non - bloody vomiting accompanied by severe nausea and continuous , colicky epigastric pain of 2 days duration . \n his past medical history was significant for hypertension and mesothelioma , for which the patient was being treated with a combination of carboplatin and pemetrexed over the past year . \n the patient denied any similar gastrointestinal symptoms during the course of his chemotherapy ; however , he did report an unintentional 18 kg weight loss over the past 6 months . additionally , the patient reported no weight loss or gastrointestinal symptoms prior to initiation of his chemotherapy . on arrival , \n he was afebrile , with pulse of 62 beats per minute and blood pressure of 135/69 mmhg . \n physical examination was notable for abdominal tenderness in all quadrants with guarding , along with epigastric bulging . \n the patient s symptoms were initially thought to be a side effect from his chemotherapy and he was thus treated conservatively with intravenous fluids , with no resolution of his symptoms . \n subsequently , the patient underwent computed tomography of the abdomen ( figures 1 and 2 ) , which revealed considerable gastric and duodenal distention extending to the level of the third / fourth duodenal segment , suggestive of small bowel obstruction , and narrowing of the angle between the superior mesenteric artery and abdominal aorta ( less than 20 , reference angle is 4565 ) . \n an esophagogram with upper gastrointestinal series confirmed gastric and proximal duodenal dilatation ( megaduodenum ) until the third duodenal portion near the midline , where there was short segment narrowing giving way to more caliber at the distal duodenum and proximal small bowel at the ligament of treitz with a delayed passage of contrast ( figure 3 ) . \n the surgeons and gastroenterologists were consulted and conservative management was agreed upon due to the patient s age and state of malnutrition . \n the patient was kept nil per os on total parenteral nutrition and intravenous fluids for 2 days , upon which diet was advanced with no further complications . prior to discharge , the patient was extensively counseled on diet modification to small frequent meals and how to maintain knee - to - chest position after eating . \n he was discharged home and told to follow up as an outpatient in the following months . \n the patient gained approximately 5 kg over a period of 3 months and his symptoms resolved . \n smas , also known as wilkie s syndrome or cast syndrome , is an extremely rare form of upper gastrointestinal obstruction thought to be caused by intermittent obstruction of the third , or transverse , part of the duodenum between the superior mesenteric artery and abdominal aorta.1,3 vascular compression has been noted at all ages , but this syndrome is seen primarily in adolescents or young adults , with females more frequently affected than males.3,4 von rokitansky first documented the existence of this syndrome in 1861,5 but it was wilkie who formally characterized smas in 1927.6 despite prior reports and radiological evidence to support the diagnosis , there has been continued skepticism on the existence of smas . \n responses have varied from whether smas is a real entity7 to suggestions that smas is overdiagnosed.8 nevertheless , smas is a well recognized but uncommon clinical entity , with previous studies reporting the incidence of smas in the general population to be as low as 0.1%0.3%.4 precipitating factors for smas include profound weight loss due to , but not limited to , eating disorders , prolonged immobilization , or spinal disease , including scoliosis and exaggerated lumbar lordosis . \n additionally , constitutional factors such as a tall , thin , body build , and anatomic anomalies including an abnormally high and fixed position of the ligament of treitz with an upward displacing duodenum or a low origin of the superior mesenteric artery have also been implicated.2,3,14 our patient presented with several risk factors for smas , most significantly a recent history of considerable weight loss following chemotherapy . \n neoplasms and systemic chemotherapy are well known risk factors for weight loss , but a pubmed literature search revealed only one previously reported case of smas in a cancer patient being treated with chemotherapy.15 moreover , cases involving smas in cancer patients were caused by mechanical compression of the duodenum by the tumor rather than weight loss itself . in the case reported by ushiki et al , the patient was being treated with cisplatin , a drug strongly associated with severe emesis.15 carboplatin , similar to its parent compound cisplatin , is a platinum - based antineoplastic drug used in the treatment of lung cancers . unlike its predecessor , carboplatin is known for its greatly reduced side effect profile and is thus preferred in patients unable to tolerate toxicities , along with the elderly . \n the most common complications associated with carboplatin are myelosuppression , anemia , and mild nausea and vomiting soon after initial use.16 however , this scenario was not the case in our patient . \n he did not have any episodes of emesis prior to his acute presentation . nevertheless , systemic side effects such as weight loss with carboplatin are noteworthy . \n our patient developed weight loss as a result of receiving carboplatin - based chemotherapy , which subsequently led to smas . \n it is likewise notable that our patient did not report any weight loss prior to initiation of his chemotherapy . \n nevertheless , it is likely that the combination of carboplatin - based chemotherapy and the primary malignancy led to our patient s weight loss . \n when a search for smas in patients with mesothelioma is performed , the results do not show any reported cases . \n what is unique about our case is the fact that the patient presented with smas due to weight loss and not mechanical obstruction . \n there was no evidence of tumor or metastasis in the area of the superior mesenteric artery . \n the weight loss induced in this patient , whether by the cancer or the subsequent chemotherapy , is thought to have been the cause of the smas . \n further evidence of weight loss being the inducing factor of the smas is the fact that our patient presented in follow - up with weight gain and no further episodes . in conclusion \n , smas is a rare but treatable complication in patients receiving carboplatin - based chemotherapy . \n practitioners should be aware of this potential complication and educate patients to report any significant weight loss to their physician . \n smas should be considered a differential diagnosis in patients who present with severe abdominal pain , especially after weight loss , regardless of the etiology . \n we also encourage clinicians to keep a high index of suspicion for this condition as delays in diagnosis can lead to a recurrence of symptoms , leading to increased weight loss and the formation of a vicious cycle , along with potentially fatal complications . once symptom - free , patients should undergo extensive dietary and postural counseling in order to gain weight and prevent further exacerbations .", "role": "user" }, { "content": "superior mesenteric artery syndrome ( smas ) is an uncommon condition , attributable to vascular compression of the third part of the duodenum between the superior mesenteric artery and the abdominal aorta . \n it can present in patients due to mechanical compression or severe weight loss . \n we present a unique case of smas in a patient undergoing carboplatin - based chemotherapy for mesothelioma . \n an 81-year - old male with mesothelioma was treated with carboplatin - based chemotherapy . \n he subsequently suffered a progressive , unintentional 18 kg weight loss and presented acutely with intense epigastric pain , severe nausea , and vomiting . \n diagnosis was confirmed by abdominal computed tomography and esophagogram with upper gastrointestinal series , which revealed gastric and duodenal distention and a narrow angle between the superior mesenteric artery and aorta , causing compression of the duodenum . \n prompt recognition of this syndrome allowed us to treat our patient successfully and avoid the risks of operative interventions . to our knowledge , this is the first reported case of smas in patients receiving carboplatin . \n furthermore , this case of smas was unique in that it was due to weight loss as compared with mechanical obstruction . \n our experience illustrates the importance of considering smas in chemotherapy patients , especially those with substantial weight loss . \n a high index of suspicion for this potential complication coupled with appropriate radiographic studies are necessary for early diagnosis and can prevent severe consequences .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: amliorer la scurit des patients grce des normes contemporaines et dtailles pour une pratique scuritaire de lanesthsie qui augmentent , amliorent et appuient les normes semblables dj publies par divers pays et procurent une ressource aux pays qui doivent encore laborer de telles normes . \n linitiative mondiale une chirurgie plus sre pour sauver des vies du groupe de travail pour la scurit en anesthsie de lorganisation mondiale de la sant a mis jour les normes internationales pour une pratique scuritaire de lanesthsie de 1992 ( 1992 international standards for the safe practice of anaesthesia ) par un processus itratif de revue de la littrature , de consultation , de dbat , de rcriture et de perfectionnement . \n ces normes abordent de faon dtaille les questions dorganisation , de soutien , de pratique et dinfrastructure lies aux soins en anesthsie . \n elles se fondent sur le principe fondamental de la scurit en anesthsie , soit la prsence ininterrompue dun professionnel de lanesthsie vigilant et adquatement form . \n dans les faits , lutilisation de loxymtrie de pouls pendant lanesthsie est dsormais considre comme obligatoire , tout en reconnaissant que , dans les cas durgence , un compromis peut tre invitable . \n lors du congrs mondial des anesthsiologistes de 2008 , plusieurs avant - projets ont t prsents afin dtre discuts , certains points ont t perfectionns , et les normes rvises ont t adoptes par la fdration mondiale des socits danesthsiologistes ( fmsa ) . \n ces normes rvises ont t publies sur le site internet de la fmsa avec un appel aux commentaires , et quelques rvisions mineures y ont encore t apportes . \n les normes internationales pour une pratique scuritaire de lanesthsie de 2010 ont t avalises par le conseil de direction de la fmsa en mars 2010 . \n tout en tant applicables universellement , les normes de 2010 sadressent principalement aux rgions du monde disposant de ressources limites . \n elles sont particulirement conues lintention des rgions qui doivent encore formuler ou adopter leurs propres normes afin de favoriser des devenirs de patients optimaux partout o lanesthsie est pratique dans le monde . \n anesthesiology as a profession was the pioneer and persists as the leader in improving quality of care and , hence , patient outcome through the development and application of published standards of practice , guidelines , and protocols . as a precursor to contributing the anesthesia care component to the second global challenge of the world health organization ( who ) , safe surgery saves lives,1 a who working group updated the 1992 international standards for the safe practice of anaesthesia of the world federation of societies of anaesthesiologists ( wfsa).2 that update \n is presented in the journal owing to a cooperative developmental process that can serve both as a quality improvement template within and beyond anesthesiology and as a resource for all anesthesia professionals in all types of anesthetizing settings throughout the world . \n the importance of surgery to worldwide public health has become increasingly apparent in recent years.3 that importance has increased with the advent of an epidemiological shift ; longstanding leading causes of the global burden of disease , such as malnutrition and infectious diseases are still important , but conditions amenable to surgical treatment , such as childbirth complications , cancer , and trauma ( notably road traffic accidents ) have become relatively more prominent . this trend is likely to increase . over 230 million surgical procedures are carried out annually around the world , which is twice the number of births . \n surgical procedures are unevenly distributed , and the standard of care associated with them is inconsistent . \n safe surgery is dependent on safe anesthesia , and variation in the standard of anesthesia care is particularly marked.4,5 in most high - income countries , anesthesia has become extremely safe . \n rates of mortality attributable to anesthesia are typically less than 1 in 50,000 procedures.6 unfortunately , the rate is often at least ten times higher in other parts of the world 79 improvements in anesthesia safety in high - income countries can be attributed to a number of contributing factors . \n one obvious factor in many such countries has been the adoption of standards for intraoperative \n safety monitoring10 based on the original precedent - setting harvard standards for minimal monitoring11 from the mid 1980 s. improved monitoring provides early warning of adverse events or developments and thus time for remediation and prevention of patient harm . \n monitoring standards are useful , not only in establishing best practices but also in adding authoritative support to political arguments over the proportion of limited healthcare resources that ought to be directed towards anesthesia . to retain their value and authority , \n standards should be revised on a regular basis . at the beginning of the 1990 s , \n an independent group of anesthesiologists ( the international taskforce on anaesthesia safety ) set itself a mission : to enhance the safety of anaesthesia by promotion of international standards for anaesthesia practice . \n the intent was not to supersede safety standards already published by various countries ; rather , the goal was to augment , enhance , and support published standards while providing a model and resource for countries that had yet to formulate or adopt such standards . \n the resulting document included two sections , general standards and perianesthetic care and monitoring standards . \n the former section covered , in detail , certain essential characteristics , such as professional status , organization , and training ; it also dealt with general matters , such as records , peer review , personnel requirements , and appropriate workloads . \n the latter section was notable for its novel formulation of different levels of resource availability , which acknowledged the wide variability of available medical resources around the world . \n these standards were endorsed and adopted as the world standards by the wfsa at its world congress of anaesthesiologists at the hague in 1992.2 in 2002 , the world health assembly adopted a resolution urging countries to strengthen the safety of healthcare and monitoring systems , and in 2004 , the world alliance for patient safety was established within who . \n a number of developments have followed , including the global initiative for emergency and essential surgical care in 2005 and two global patient safety challenges . \n the second of these challenges , safe surgery saves lives , which was initiated in 2007 , addressed safety in surgical care.1 this program is perhaps best known for the who surgical safety checklist that is the widely publicized leading component of the comprehensive parent document , the who guidelines for safe surgery.12 four of the who safe surgery saves lives working groups were given the task of addressing ten objectives . \n as members of the safe anesthesia working group , the authors of this paper were asked to focus on those objectives related to safer anesthesia . in effect , we realized that what was required were comprehensive guidelines for safe anesthesia . \n we further recognized the value of the foundational work undertaken by the international taskforce nearly 20 years earlier , and we appreciated the advantages of building on this work rather than simply trying to repeat it . \n it became clear that there was still a substantial need for such standards and that revision of the 1992 international standards was overdue . \n therefore , we have revised and updated the international standards for a safe practice of anaesthesia ( standards ) in parallel with contributing to the who guidelines for safe surgery , and the revised version is published in this issue . \n the formulation of the 1992 standards has been fully described.13 in brief , following inception by drs . \n gravenstein and the securing of funding , membership on the international taskforce on anesthesia safety was offered , by invitation , to a group of ten independent individuals with strong credentials in their national anesthesia patient safety movements who were from countries that had or were formulating anesthesia safety standards . \n the members collected copies of all of the available anesthesia standards documents from around the world . extensive debate on the scope and content of the standards ( taking into account the applicability of the standards to a wide range of settings and resources ) was carried on via correspondence and facsimile transmission and at twice yearly face - to - face meetings . \n the standards were written on the basis of all of this input through a long iterative process of drafting and refinement . at the hague in june 1992 , \n they were presented to the tenth world congress of anaesthesiologists in two plenary sessions dedicated to this purpose . at this congress , the general assembly of the wfsa adopted the standards document as their official world standards and commended it to its member societies . the document and a series of supporting background articles \n were published subsequently in the european journal of anaesthesiology.14 on the basis of their credentials in relation to patient safety , the authors of this current paper were invited to the safe surgery saves lives international consultation led by dr . \n the purpose of this meeting was to address the following two questions : what are the minimum standards of surgical care that can be applied universally across countries of different economic standards and different healthcare settings that will have the greatest impact on improving the safety of surgical care?what measurement systems can be implemented to monitor the progress and improvement of surgical safety resulting from these standards ? \n what are the minimum standards of surgical care that can be applied universally across countries of different economic standards and different healthcare settings that will have the greatest impact on improving the safety of surgical care ? \n what measurement systems can be implemented to monitor the progress and improvement of surgical safety resulting from these standards ? \n discussion of these objectives occurred through a series of moderated panels , each focused on a particular element of the wider issue . at the end of this consultation meeting , \n four working groups were established , including the safe anesthesia working group ( the group ) . \n subsequent work was done by the individual members of the group , communicating through email , telephone , and face - to - face meetings as opportunities arose . \n three further formal face - to - face meetings of the wider group took place . in relation to the standards , evidence on individual aspects of anesthesia care ( notably pulse oximetry ) was sought from a number of sources with the aim of identifying all relevant publications and data sources . \n we carried out systematic searches of the literature using medline and pubmed ; we checked the references of retrieved publications , and we used personal communication . \n we consulted with colleagues in our own and other countries , particularly seeking to obtain the views of those from areas not represented within the group . as part of the overall process of developing the checklist , key issues were debated extensively with a broader group of international experts that convened in geneva at who headquarters in january 2008 . \n the revised standards were drafted iteratively on the basis of the information that emerged from this process . \n the overall structure of the original 1992 standards was retained , but the terminology was aligned with that of the who . the who guidelines for safe surgery have been validated through the pilot study of the checklist.15 the recommendations in the revised standards are aligned with those in the guidelines , although the exact phrasing differs . \n importantly , while both documents are intended primarily as stimuli , models , and resources for quality improvement efforts in resource - constrained areas of the world , the principles and practices outlined are universally applicable and relevant in every surgical and anesthetizing setting anywhere , even the most technologically advanced ultra - sophisticated operating theatres in teaching hospitals of major world capitals . \n these revised standards were presented and discussed at a plenary session of the world congress of anaesthesiologists in cape town in march 2008 and at two general assemblies of the wfsa held at this congress . \n further refinements were made on the basis of feedback from these presentations , and a final revision was endorsed by the wfsa at its third general assembly held in cape town on march 7 , 2008 . \n the 2008 international standards for a safe practice of anaesthesia were posted on the website of the wfsa . \n this further revised edition was presented to the executive committee of the wfsa in london in march 2010 . \n the executive committee endorsed the edition and further accepted the necessity of an ongoing process of revision . \n it was agreed that the 2010 revised standards with an accompanying description of their development should be submitted for open access publication in a peer - reviewed journal with the view to facilitating the dissemination of the standards and promoting feedback though the journal s correspondence columns . \n it was further agreed that the endorsement ( or otherwise ) of future revisions should be made by the executive committee of wfsa . since this committee meets every two years , the next clear opportunity for revision of the standards will be in 2012 at the world congress of anaesthesiologists in buenos aeries . \n the international standards for a safe practice of anesthesia 2010 are divided into two sections , general standards and perianesthetic care and monitoring standards . in keeping with the particularly effective approach of the original standards , there are three graduated levels of practice recommendations , and these levels are aligned with three increasing levels of applicable infrastructure . \n the 2010 standards specify the practices and resources required as a minimum for the provision of anesthesia for an elective surgical procedure , and they explicitly acknowledge that compromise may be unavoidable in an emergency . they are grounded in the most fundamental principle of safety in anesthesia , i.e. , the continuous presence of a vigilant anesthesia professional during anesthesia . \n this requirement may seem obvious to many in 2010 , but it was actually controversial when first introduced , and we have anecdotal observational evidence that the point still needs to be made . \n the 2010 standards specify further that providers of anesthesia care should be appropriately trained and accredited \n . the wfsa views anesthesia as a medical practice but recognizes the reality that many anesthetics are provided by non - medical personnel ( even in a number of high - income countries ) . \n nonetheless , leadership , training , direction , and supervision by medical personnel are specified . \n this parallels the situation found in other specialties , such as radiology , pathology , and cardiology . for example \n , a trained technician may well be capable of obtaining radiographs or echocardiographic views , and even of interpreting these . \n yet , the need for broadly based medical expertise to direct radiological services or to deal with the implications of echocardiographic findings to patient management is not controversial . in the same way \n , there are clearly many aspects of anesthesia care that can be provided safely by appropriately trained non - medical health personnel . however , the prescription of optimum anesthesia , the complexity and variety of patients co - morbidities , the management of crises ( which can develop quickly and without warning ) , and the broader issues of the appropriateness of the overall surgical management of certain patients are all areas for which formal medical training is required . \n working together as a team , politically and perioperatively , allows the optimum configuration to be developed by medical and non - medical providers in different hospitals . \n perhaps the most controversial aspect of the 2010 standards is the elevation of pulse oximetry to the highest level of recommendation , making its use , in effect , a mandatory standard of care . \n this was a carefully considered decision , and the rationale for it has been explained previously.16 we have surveyed wfsa member societies , and we have yet to find a national society that has minimal standards for anesthesia that does not specify pulse oximetry as mandatory . however , there is a discrepancy between the standards of some national societies and the actual availability of pulse oximetry in their regions . \n the extent of this substantial oximetry gap has recently been estimated.17 after proof of the concept through pilot studies in four countries,18 a major project is underway to address this gap through the provision of a package that includes appropriately designed and relatively affordable oximeters and training for the personnel who will use the oximeters . in combination with this initiative , the 2010 standards have the potential to stimulate a major step forward in the care of anesthetized patients in some of the least - resourced areas of the world . \n there are obvious limitations in the process that was used to develop the 2010 standards . \n however , elements of the 2010 standards are a reflection of expert consensus based on many years of collective clinical experience \n . there have been epidemiologic trends and , from the usa , observed decreases in the frequency and severity of malpractice lawsuits for anesthesia injury accidents , which suggests improved anesthesia outcome associated with observing safety standards.19 there are no randomized trials to support the contention that the continuous presence of a trained anesthesiologist is essential for safe anesthesia . \n neither is there a need for such trials.20,21 there is limited evidence from randomized trials regarding the value of pulse oximetry in anesthesia , but while this evidence is inconclusive , there can be few aspects of medical practice about which expert consensus is more unified or more supported in actual clinical practice.22 there has been little if any criticism of the original 1992 standards since their publication , and the publication of the 2010 standards in a widely accessible indexed medical journal provides a clear mechanism for discussion of any points thought to be contentious . \n the international standards for a safe practice of anesthesia 2010 have been developed through an extensive process of literature review and international consultation . \n they were built on the thorough and carefully planned groundwork by the 1990 s task force . \n the first edition of the standards stood the test of over 15 years of use . \n the establishment of a process for revision and iterative endorsement is an important step forward to ensure the ongoing relevance of the standards to anesthesia practice throughout the world and to maintain a continuous stimulus for quality improvement in anesthesia care . while they are universally applicable , these standards primarily target lesser - resourced areas . \n they are designed particularly for regions that have yet to formulate or adopt their own standards so as to promote optimum patient outcomes in every anesthetizing location in the world .", "role": "user" }, { "content": "purpose to enhance patient safety through contemporaneous and comprehensive standards for a safe practice of anesthesia that augment , enhance , and support similar standards already published by various countries and that provide a resource for countries that have yet to formulate such standards.standards development the safe anesthesia working group of the world health organization s safe surgery saves lives global initiative updated the 1992 international standards for the safe practice of anaesthesia ( standards ) through an iterative process of literature review , consultation , debate , drafting , and refinement . \n these standards address , in detail , the organization , support , practices , and infrastructure for anesthesia care . \n the standards are grounded in the fundamental principle of safety in anesthesia , i.e. , the continuous presence of an appropriately trained , vigilant anesthesia professional . in effect , the use of pulse oximetry during anesthesia is now considered mandatory , with acknowledgement that compromise may be unavoidable in emergencies . at the world congress of anaesthesiologists in 2008 , drafts were presented for comment , further refinements were made , and the revised standards were adopted by the world federation of societies of anaesthesiologists ( wfsa ) . \n these revised standards were posted on the wfsa website for further feedback , and minor revisions followed . \n the international standards for a safe practice of anesthesia 2010 were endorsed by the executive committee of the wfsa in march 2010 . \n ongoing periodic revision is planned.conclusion while they are universally applicable , the 2010 standards primarily target lesser - resourced areas . \n they are designed particularly for regions that have yet to formulate or adopt their own standards so as to promote optimum patient outcomes in every anesthetizing location in the world .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: peritonitis is a common complication in patients on continuous ambulatory peritoneal dialysis ( capd ) . in certain cases , \n a 62-year - old lady , a known case of diabetes mellitus , hypertension , dyslipidemia , and chronic kidney disease ( ckd ) , was admitted with abdominal pain , vomiting and loose stools of 7 days duration . \n for the last 6 years , she has been on capd , and her dialysis has been largely uneventful . \n she had similar symptoms about 4 weeks ago which was diagnosed as peritonitis and was treated with ip cephalosporin , aminoglycoside , and vancomycin . \n she was restarted on intravenous ( iv ) antibiotics ( meropenem and amikacin ) . as she did not show any improvement , she was referred to us , and she was subsequently admitted in our hospital . at admission \n her systemic examination revealed a soft abdomen with no evidence of exit site or tunnel infection . \n acid fast bacilli ( afb ) were not seen on zn stain , and a mycobacterial culture was asked for . \n a relapse of capd - associated peritonitis was diagnosed , and iv vancomycin was added . \n laboratory investigations of patients early next day , she showed hemodynamic deterioration and her peritoneal dialysis catheter was removed on the same day . \n a computed tomography ( ct ) scan of the abdomen was done which revealed dilated , thin and fuzzy appearing wall of a segment of the jejunal loop with air in the parietal wall . \n an exploratory laparotomy revealed extensive infarction of the gut extending from jejunum to transverse colon [ figure 1 ] . \n no vascular occlusive lesion was found and arterial pulsations were appreciated by the operating surgeon . \n exploratory laparatomy showing extensive infarction of the gut a 70-year - old male , known case of diabetes mellitus , hypertension , ckd stage 5 on capd for last 5 years , was admitted with low - grade fever , vomiting , and drowsiness . on evaluation , he was febrile and icteric . \n a diagnosis of capd peritonitis with sepsis was made , and he was started on antibiotics . \n a ct scan of the abdomen was done , which showed diffuse thickening of small bowel loop predominantly in the jejunum with thumb printing appearance [ figure 2 ] . \n there was no enhancement of the jejunal loops on contrast administration suggestive of ischemic bowel disease . \n celiac and superior mesenteric arteries appeared small in caliber along with diffuse atherosclerotic changes in ct angiography . \n he was managed conservatively keeping in view of his poor general condition and advanced comorbidities , and he expired after 2 days . computed tomography scan of the abdomen showing thumbprinting suggestive of mesenteric ischemia \n a 62-year - old lady , a known case of diabetes mellitus , hypertension , dyslipidemia , and chronic kidney disease ( ckd ) , was admitted with abdominal pain , vomiting and loose stools of 7 days duration . \n for the last 6 years , she has been on capd , and her dialysis has been largely uneventful . \n she had similar symptoms about 4 weeks ago which was diagnosed as peritonitis and was treated with ip cephalosporin , aminoglycoside , and vancomycin . \n she was restarted on intravenous ( iv ) antibiotics ( meropenem and amikacin ) . as she did not show any improvement , she was referred to us , and she was subsequently admitted in our hospital . at admission \n her systemic examination revealed a soft abdomen with no evidence of exit site or tunnel infection . \n acid fast bacilli ( afb ) were not seen on zn stain , and a mycobacterial culture was asked for . \n a relapse of capd - associated peritonitis was diagnosed , and iv vancomycin was added . \n laboratory investigations of patients early next day , she showed hemodynamic deterioration and her peritoneal dialysis catheter was removed on the same day . \n a computed tomography ( ct ) scan of the abdomen was done which revealed dilated , thin and fuzzy appearing wall of a segment of the jejunal loop with air in the parietal wall . \n an exploratory laparotomy revealed extensive infarction of the gut extending from jejunum to transverse colon [ figure 1 ] . \n no vascular occlusive lesion was found and arterial pulsations were appreciated by the operating surgeon . \n a 70-year - old male , known case of diabetes mellitus , hypertension , ckd stage 5 on capd for last 5 years , was admitted with low - grade fever , vomiting , and drowsiness . on evaluation \n a diagnosis of capd peritonitis with sepsis was made , and he was started on antibiotics . \n a ct scan of the abdomen was done , which showed diffuse thickening of small bowel loop predominantly in the jejunum with thumb printing appearance [ figure 2 ] . \n there was no enhancement of the jejunal loops on contrast administration suggestive of ischemic bowel disease . \n celiac and superior mesenteric arteries appeared small in caliber along with diffuse atherosclerotic changes in ct angiography . \n he was managed conservatively keeping in view of his poor general condition and advanced comorbidities , and he expired after 2 days . computed tomography scan of the abdomen showing thumbprinting suggestive of mesenteric ischemia \n the two cases illustrate the presence of bowel ischemia in patients on long - term capd . \n these patients presented to the hospital with episodes of peritonitis that were difficult to treat . \n they had nonocclusive mesenteric ischemia as the underlying cause of peritonitis which was missed on initial evaluation . \n nonocclusive mesenteric ischemia ( nomi ) was described 1958 as one of the diseases that affect the vasculature of the intestine . \n it may be called as intestinal gangrene in the presence of a patent arterial tree . \n the dialysis population , and in particular hemodialysis patients , are especially prone to mesenteric ischemia . besides the traditional risk factors , ckd patients are more prone for vascular calcification and increasing risk of ischemia because of the use of erythropoietin . \n erythropoietin has also direct vasopressor effect on mesenteric blood vessels . despite its definite association in hemodialysis \n the higher incidence of diabetes mellitus in pd patients with vascular disease actually predisposes this group of patients to underlying chronic mesenteric ischemia . \n this ischemic compromise becomes critical during a peritonitis episode when there is an increased metabolic demand . \n it is also worthwhile to note that there is an increased incidence of transmigration of gut bacteria across the ischemic intestinal wall which again predisposes these patients to an increased risk of peritonitis . \n hypotension is the leading precipitating cause and the mechanisms being the inappropriate use of dialysate resulting in excessive fluid removal , diuretics , and very low salt intake . \n the clinical presentation in such patients remain similar to that of peritonitis and thus pose a difficult challenge needing a high index of suspicion for diagnosis . \n there have been a few case reports in the past where the presence of peritonitis masked the underlying pathology . \n reported one such case where the patient was thought to suffer from an episode of peritonitis and mesenteric ischemia was suspected only when the ct scan showed pneumatosis coli of the right colon . \n thus , nomi can masquerade as refractory peritonitis as in above cases and needs a high index of clinical suspicion . \n the mortality remains high in view of the presence of underlying comorbidities , delayed diagnosis and subsequent delay in treatment .", "role": "user" }, { "content": "we report two cases of mesenteric ischemia in patients on long term peritoneal dialysis both of which were associated with poor outcomes . both were diabetic and on peritoneal dialysis for a long time . \n on evaluation of refractory peritonitis we found evidence of non occlusive mesenteric ischemia . despite adequate treatment both succumbed to their illness . \n abdominal pathology , especially mesenteric ischemia leading to gut infarction , should be considered in patients with refractory peritonitis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a new pathological entity with distinct clinicopathological features has been recently described and termed as juvenile spongiotic gingivitis . \n histopathological associated features are unique and characterized by prominent intercellular edema ( spongiosis ) and neutrophil infiltrate . \n the aims of this paper were to : introduce juvenile spongiotic gingivitis to the dental and pediatric communities , to report three cases based on clinical and histopathological findings , and to discuss the most common clinical differential diagnoses . \n the clinical appearance of the lesions described in this paper correspond to the pattern described by the literature : 1 ) localized lesions as bright red slightly raised overgrowths , most often with a subtle papillary or finely granular surface ; or 2 ) multifocal masses or raised papular lesions with a pebbly texture . \n because of the lack of a good clinical response to conventional therapy , excisional biopsies were performed , which helped establish the diagnosis . \n a real improvement in the local gingival conditions was recorded for all the patients . however , because of the persistence of some bright reddish gingival masses in one of the patients these lesions were treated by surgical excision . \n the presented cases might raise awareness of this condition among orthodontic specialists because orthodontic treatment could not be applied until the gingival gum disease was resolved . \n a new pathological entity with distinct clinicopathological features has been recently described and termed as juvenile spongiotic gingivitis ( jsg ) . \n the term includes small , bright red , easily bleeding , localized or generalized gingival overgrowth , with a papillary or velvety texture . \n usually the lesions are painless , and around 20% are associated with bleeding when brushing teeth . \n the size of the lesions range from 2 mm to 10 mm in diameter ( median 6 mm ) . \n one year later an alternative designation for this disease was suggested : localized juvenile spongiotic gingival hyperplasia . \n this new denomination was proposed as almost all the monitored lesions ( 94% ) displayed gingival overgrowth as determined by clinical and histopathological features rather than a pure inflammatory process with minimal to no tissue swelling . \n histopathological features are unique and characterized by prominent intercellular edema ( spongiosis ) and neutrophilic infiltrate . \n these lesions have a striking predilection for the gingiva and do not appear to be related to plaque . \n the disease mostly affects the anterior facial gingiva , with 84% occurrence on the maxillary gingiva and 16% on the mandibular gingiva . \n the condition occurs with a 2.3:1 female predominance in patients who are approximately 12 years old , on average . \n this new pathological entity was retrospectively diagnosed in a series of patients from different archives as juvenile spongiotic gingivitis / hyperplasia ; this entity had been most frequently misdiagnosed as puberty plaque - induced gingivitis because of its predilection to occur in juveniles . \n several reports have indicated a significant increase in gingivitis as children enter puberty and during the pubertal period . \n this increase is believed to be related to an alteration in the subgingival microflora due to the exuberant hormonal supply . \n the severity of puberty plaque - induced gingivitis was related more closely to plaque buildup than to hormones . however , even if there are common clinical signs that could drive to misdiagnosis , the resemblance between jsg and puberty gingivitis ends at this point . \n while the removal of local factors by oral hygiene techniques was the key to manage hormone - related gingivitis , a lack of response to conventional plaque control was remarked for jsg . \n moreover , microscopically , plaque induced gingivitis is associated with chronic inflammatory modifications : increase of the number of vessels , dilatations of the vessels , chronic inflammatory infiltrate . \n typically , this condition lacks significant epithelial spongiosis , so it may be ruled out from the differential diagnosis on a microscopical basis . \n however , the limited age range of the patients under study by darling et al . \n ( 2008 ) suggests the possibility that puberty might play an etiologic role in this new diseased gingival entity . the hormonal change itself \n other hormone - related gingival alterations with an associated histological inflammatory pattern have been described in association with menstrual cycles , pregnancy , and taking contraceptive medication . \n the aims of this paper were to : introduce jsg to the dental and pediatric communities , to report three cases based on clinical and histopathological findings and to discuss the most common clinical differential diagnoses . \n three patients with gingival lesions corresponding to the features described for jsg were addressed to our department in the last 3 years . \n the medical history of the patients was reviewed using the current questionnaire and verbal confirmation from the parents . \n however , for the third patient presenting unusual gingival modifications , a hematological evaluation was recommended ; normal values were recorded . \n the cases were clinically documented at baseline : full mouth periodontal examination , oral hygiene evaluation , bleeding on probing , orthopantomography , and photographs . \n follow - up photographs were taken and periodontal monitoring of the clinical parameters was recorded . for each jsg case \n the clinical diagnosis was based on the following characteristics : 1 ) bright red , painless , singular or multifocal , thickened patches of the attached gingiva , marginal gingiva and/or interdental papillae ; 2 ) the inconsistency between the quantity of plaque at the level of gingival margin and the development of the lesions ; 3 ) the pubertal period of diagnosis ; 4 ) the lack of an appropriate response to conventional therapy . \n the individual general and specific characteristics of the patients are available in table i. for all the patients the lesions were localized only on the buccal aspect of the gingiva and interdental papillae were touched ( figures 13 ) . \n patient no 3 revealed multiple , reddish , highly prominent lesions at the level of the attached gingiva , with irregular outline and a feathery change of the gingiva ; these particular lesions alternating with gingival modifications are characteristic for a common chronic gingival inflammation ( figure 3 ) . \n the first treatment approach was personal and professional plaque control . because of the lack of a good clinical response to conventional therapy , excisional biopsies were performed and submitted for histopathological examination . \n biopsy specimens were examined by light microscopy using hematoxylin and eosin stained 5-mm tissue sections . in all patients , \n the microscopic examination showed long epithelial rete pegs , marked edema in the epithelial layer and lamina propria ( spongiosis ) , loss of keratinization , and intense intraepithelial hemorrhage . only for two of the specimens was neutrophil infiltrate present . for patient no 3 the same histopathological picture \n plaque control was reinforced including the professional mechanical debridement and additional antiseptic local treatment was administered to the patients ( corsodyl glaxo smithkline , gb ) . \n however , in patient no 3 some elevated , bright reddish tissue masses persisted on the attached gingiva corresponding to the maxillary canines . \n the lesions were treated by surgical excision associated with a good clinical outcome ( figure 5 ) . \n this paper presented three cases that could be described as gingival disease which was initially named jsg and after that reconsidered as a spongiotic gingival hyperplasia . \n the clinical appearance of the lesions described in this paper correspond to the pattern described in literature : 1 ) often localized lesions presented clinically as bright red raised overgrowths , most often with a subtle papillary or finely granular surface ; or 2 ) sometimes multifocal masses or raised papular lesions with a pebbly texture . \n the clinical localization of the lesions for the presented cases was slightly different from that described by darling et al . \n ( 2008 ) as they mentioned the localization of the gingival modifications mostly at the level of attached and marginal gingiva . in our patients \n the gingival mucosa of the anterior maxilla is the most common location but , in some cases , the mandibular buccal gingiva was reported to be affected as we recorded . as two of our patients \n we remarked that even in the presence of minor gingival modifications , the lesions corresponding to jsg had characteristic clinical features : the vivid reddish color and the pebbly / granular aspect of the surface . \n the incidence of jsg is unknown and can not be estimated from the records of a biopsy service . \n jsg is a newly described pathological entity that is not included in the actual accepted classification of periodontal diseases and probably it was one of the reasons of the misdiagnosis . \n jsg had been reported as misdiagnosed after a reevaluation of 52 patients files was performed . \n hematoxylin and eosin stained slides were reviewed and the diagnosis of jsg was confirmed independently by 3 oral pathologists . \n the first subject of confusion was puberty plaque - induced gingivitis , which is a chronic gingival inflammation induced by dental plaque and characterized clinically by the onset of an exuberant inflammation of the marginal and attached gingiva , with increased gingival bleeding . \n the confusion is not surprising as pubertal plaque - induced gingivitis is frequently present in adolescents . \n based on the new evaluation which corrected the former diagnosis , other pathological entities proved to be wrongly described : inflammatory papillary hyperplasia , chronic mucositis / gingivitis , or inflammatory fibrous hyperplasia . \n however , jsg could be clinically a subject of diagnostic confusion and thus clinical differential diagnosis must consider some similar diseased entities . \n the fact that the cause of jsg is not well - elucidated complicates furthermore the clinical identification of the disease . \n pyogenic granuloma is another common clinical entity which could be taken into consideration for a differential diagnosis . \n clinically , these lesions are most commonly described as a mass lesion rather than a pure inflammatory one . \n sometimes , enlargement of the gingiva may occur as a hormone - related gingival disease , known also as a pregnancy tumor . \n microscopically , the gingival enlargements show a mixture of variable amounts of vascular proliferation , inflammation , and fibrotic changes . \n the localized and apparently inflammatory nature of jsg lesions leads to speculation about a hypersensitivity reaction to environmental agents or a foreign body reaction . \n most of the jsg lesions are too localized to be diagnosed as hypersensitivity reactions ; moreover , no foreign material was observed microscopically to sustain a foreign body reaction . \n some authors ruled out the plaque - induced etiology as the jsg lesions on the attached gingiva were observed to be often separated from marginal gingiva and dental plaque by a strip of normal gingiva . \n moreover , the lack of response to oral hygiene procedures in these patients was reported . \n the same authors stated that the primary cause of jsg could be an alteration in the epithelium with a loss of keratinization and increased porosity , as seen in junctional epithelium , causing a decreased defense against oral antigens and a subsequently local inflammation . \n for the patients monitored by the present study , oral hygiene conventional procedures led to certain clinical improvements of the gingival appearance . on the other hand , \n the lack of the inflammatory infiltrate in the biopsy specimen of the third patient is somewhat surprising because of the inflammatory nature of the clinical aspect . \n inflammatory papillary hyperplasia could be easily microscopically diagnosed because of the histologic evidence of inflammation and papillary hyperplasia . \n however , the clinical features differentiate it from jsg ( frequent palatal localization , older age of development ) . \n the presence of strong staining for cytokeratin ck19 throughout all levels of the epithelium in jsg could reflect its odontogenic origin raising the possibility that the disease could represent an ectopic junctional epithelium at the level of the attached gingiva in association with a secondary inflammatory response . \n the fact that jsg is benign and sometimes characterized by epithelial hyperplasia raises the possibility of an hpv etiology . the hpv - associated lesions , such as papilloma , verruca vulgaris , condyloma accuminatum , and focal epithelial hyperplasia , can become inflamed but most lesions are not inflamed and rarely show prominent spongiosis . \n moreover , jsg does not show koilocytosis or cells in mitosis suggestive for an hpv etiology . \n the gingival lesions described by the present study could be obviously reduced by the reinforcement of oral hygiene and short - term use of topical antimicrobial agents . \n the diagnosis of jsg requires clinical pathological correlations ; the biopsy is an appropriate approach to establish the diagnosis and to rule out other periodontal pathologies . \n the presented cases might raise awareness of this condition among orthodontic specialists , as an orthodontic treatment could not be applied until the resolution of the gingival pathology .", "role": "user" }, { "content": "background and aims.a new pathological entity with distinct clinicopathological features has been recently described and termed as juvenile spongiotic gingivitis . \n histopathological associated features are unique and characterized by prominent intercellular edema ( spongiosis ) and neutrophil infiltrate . \n the aims of this paper were to : introduce juvenile spongiotic gingivitis to the dental and pediatric communities , to report three cases based on clinical and histopathological findings , and to discuss the most common clinical differential diagnoses . \n the cases were documented at baseline and follow - ups . \n the clinical appearance of the lesions described in this paper correspond to the pattern described by the literature : 1 ) localized lesions as bright red slightly raised overgrowths , most often with a subtle papillary or finely granular surface ; or 2 ) multifocal masses or raised papular lesions with a pebbly texture . \n the first intention treatment approach was personal and professional plaque control . because of the lack of a good clinical response to conventional therapy \n , excisional biopsies were performed , which helped establish the diagnosis . \n the plaque control was reinforced and additional antiseptic local treatment was administered . \n a real improvement in the local gingival conditions was recorded for all the patients . however , because of the persistence of some bright reddish gingival masses in one of the patients these lesions were treated by surgical excision . \n the overall clinical outcome was good and stable after one year.conclusions.the presented cases might raise awareness of this condition among orthodontic specialists because orthodontic treatment could not be applied until the gingival gum disease was resolved .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in a prospective double - blind randomized controlled trial , we tried to find out whether coblation technique decreases the postoperative morbidity compared to traditional dissection tonsillectomy . \n operation time , intraoperative blood loss , postoperative pain , number of days needed to return to work and normal diet and postoperative hemorrhage were compared between two groups . \n the study design was approved by the local ethics committee of sadi hospital in isfahan . \n 94 candidates for tonsillectomy were recruited between june 2007 and december 2008 , 47 of which in control ( traditional tonsillectomy ) group and 47 in intervention ( coblation ) group ( figure 1 ) . informed and \n consent was obtained from each subjects allowing randomization , using random number table , prior to surgery . \n participants retention vs. attrition indications for tonsillectomy in our study were chronic recurrent tonsillitis ( without any history of tonsillitis within 4 weeks prior to surgery ) and snoring with sleep apnea . \n patients with a history of a peritonsillar abscess , ongoing analgesic use for medical conditions and bleeding disorders were excluded . \n no antibiotics , topical or local anesthesia , or other medications were administered before surgery . \n the anesthetic approach was the same for all patients as follows : induction was performed using intravenous fentanyl , propofol 2 mg / kg , and atracurium 0.5 mg / kg following intubation . \n maintenance of anesthesia was achieved by a mixture of nitrous oxide , oxygen , and propofol . \n fentanyl boluses of 25 mcg were given when blood pressure and heart rate increased by 20% or more during surgery , following reversal and in recovery status . \n after beginning of anesthesia , the patient was allocated in each group by surgeon based on a randomly generated number sequence . \n the operation was performed in the standard way using either the arthrocare 2 assisted evac-70 coblator wand or steel cold dissection instruments . \n the coblation device was made by arthrocare company , sunnyvale , ca , usa . all procedures were done by first author to lower any probable skill related bias . \n our surgeon had performed more than a hundred coblation assisted tonsillectomies prior to trial to eliminate a learning curve related disturbance . \n operation time , from insertion till removal of crow - davis blade , was recorded for each case . \n operation scrub evaluated and recorded intraoperative blood loss by checking volume of blood in suction bottle after the operation . \n data including age , volume of blood loss , operation time , postoperative pain score , postoperative hemorrhage , days needed to return to work and normal diet were gathered in both groups . \n patients were examined for the following postoperative complications during post surgical visits : primary hemorrhage , secondary hemorrhage , and readmission due to postoperative pain . on discharge , \n the patients were advised to call the medical group for any complications especially bleeding . follow up of all patients \n was performed by a second colleague to make the surgeon blind . on the other hand , \n the primary hemorrhage was defined as bleeding occurring within 24 hours after surgery and secondary hemorrhage as bleeding after 24 hours postoperatively . \n visual analog scale was used for the pain severity , ranging from 0 to 10 . \n data were entered into a database and analyzed using spss software ( spss , windows , version 16 ) . \n data of day of return to work and normal diet were analyzed using student 's t - test . \n there was no significant difference between the mean age of two groups ( p > 0.05 ) , being 11.2 years in coblation and 11.8 years in traditional group . \n intraoperative blood loss turned out to be 103.4 28.7 ml for the coblation and 161.5 46.4 for the traditional group ( p < 0.001 ) . \n mean operation time was 27.3 4.8 minutes ( ranging from 18 to 42 ) in coblation group and 31.0 5.4 minutes ( ranging from 20 to 45 minutes ) in traditional group . \n the mean operation time was thus significantly less for coblation group ( p < 0.001 ) . \n postoperative pain scores were evaluated for both groups and compared using chi - square test . \n a lower postoperative pain score in coblation group was statistically significant ( p < 0.000 ) . \n diet recovery period was significantly shorter in the coblation group ( 6.2 vs. 9.2 days p < 0.001 ) . \n otherwise , return to normal general condition was significantly earlier in the coblation group ( 7.6 vs. 11.0 days p < 0.001 ) . \n postoperative diet intake and regaining the normal general condition of patients furthermore , it was revealed that postoperative primary and secondary hemorrhage rate was slightly higher in traditional group . \n however , there was no statistically significant difference ( p > 0.05 ) ( table 2 ) . during follow up period , \n tonsillectomy is one of the most common operations performed in otolaryngology worldwide.1920 tonsillectomy with steel forceps ( as traditional ) consumes longer time than coblation tonsillectomy does as a slower dissection.21 coblation ( cold ablation ) is a newly introduced technique of surgery . \n the use of this new technique has received remarkable research attention.22 results in small study groups have been encouraging ; however , they have requested for evaluation with larger numbers and evidences from other centers.1823 one large - scale trial performed to date , found a 1% hemorrhagerate24 using the coblation technique . in our study , we found 4.3 % which is rather close to mentioned trial . \n coblation assisted tonsillectomy can result in less blood loss and tissue damage , which may minimize the postoperative recovery period and earlier return to normal activity . \n first studies on coblation tonsillectomy have shown a significant decrease in postoperative pain scores comparing with traditional method with no more complications410 that is compatible with our results . \n these promising results based up different studies revealed similar outcomes when comparing coblation and electrosurgery or ultrasonic tonsillectomy.2526 on the other hand , there are some studies which reported no significant reductions in pain with coblation surgery comparing with cold dissection or electrosurgery.1715 noon , et al . demonstrated a significantly higher hemorrhage rate in the coblation group comparing with diathermy ( 22.2% versus 3.4% ) from a study arranged for 64 patients.13 our data opposed this study as we found only 4.3% hemorrhage rate . \n our study showed significant difference in post - operative morbidities in favor of coblation assisted method . \n need for analgesics , perhaps due to a significantly longer operating time , was significantly higher in the control group . \n removal of the tonsils and achievement of good homeostasis was more difficult in traditional group . \n the incidence of postoperative hemorrhage matched favorably with the published rates of 0 - 20 percent for other series,2730 which confirmed our findings . \n we found that the postoperative hemorrhage including primary and secondary hemorrhages was generally more frequent in the control group ; the difference was not statistically significant though . in order to evaluate the return to normal activities , \n the patients were asked the postoperative day they would be able to return to work . \n the reduction of intraoperative blood loss and operation time in coblation tonsillectomy was obvious and reduction of the postoperative pain and early return to normal diet and activities without increasing the postoperative complications were clinically and statistically significant . \n therefore , we believe that the coblation tonsillectomy is an effective and cost - effective method . \n our study showed a significant difference in postoperative morbidity and complications between patients undergoing coblation tonsillectomy and those undergoing traditional technique . \n coblation tonsillectomy significantly reduced the operation time , intraoperative blood loss and postoperative pain , and was associated with early recovery of dietary routine . \n ", "role": "user" }, { "content": "background : coblation tonsillectomy is a new surgical technique and demands further research to be proven as a suitable and standard method of tonsillectomy . \n this study compares coblation and traditional tonsillectomy techniques in view of their advantages and complications.methods:in a prospective double - blind randomized controlled trial information on operation time , intraoperative blood loss , postoperative pain , time needed to regain the normal diet and activity and postoperative hemorrhage were gathered and compared between two groups containing 47 patients in each group.results:we found statistically significant differences in operation time ( p < 0.05 ) , intraoperative blood loss ( p < 0.05 ) , postoperative pain ( p < 0.001 ) , time needed to find back the normal diet ( p < 0.001 ) and normal activity ( p < 0.001 ) . however , post operation hemorrhage ( p > 0.5 ) was not significantly different between two groups.conclusions:this study revealed a significantly less intraoperative or postoperative complications and morbidity in coblation tonsillectomy in comparison with traditional method . \n coblation was associated with less pain and quick return to normal diet and daily activity . \n these findings addressed coblation tonsillectomy as an advanced method .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: asymptomatic inflammation ( ai ) ( also known as silent , low - grade , or painless inflammation ) is a concept that describes a scenario in which an etiologic agent is present without clinical evidence of harm or pain . \n it can be found in different types of cancer , genital tract diseases , cerebral infarction , or diabetic conditions . \n the oral environment is also vulnerable to suffer ai under certain pathologies , including chronic apical periodontitis and periodontal disease . \n dental treatments such as deep restorations or orthodontic movements can cause incessant injury to dental tissues that are not identified as noxious . \n irreversible pulpitis can also occur asymptomatically [ 7 , 8 ] , which may progress to dental pulp necrosis without treatment . vascular , neural , cellular , and biochemical changes from inflammation can be present in the absence of pain . \n neuropeptides released from primary afferent neurons ( pan ) are crucial factors in provoking inflammation of neural origin or neurogenic inflammation . \n substance p ( sp ) and calcitonin gene - related peptide ( cgrp ) are capable of inducing vasodilation , plasma extravasation , immune cell chemotaxis , and pain [ 11 , 12 ] . \n peripherally , opioid - containing immune cells ( ocic ) play the main role due to -endorphins ( -end ) and methionine - enkephalin ( met - enk ) release . \n these substances induce the activation of opioid receptors ( or ) located in pan , thus causing electrical changes that modulate pain partially via the inhibition of neuropeptide release [ 15 , 16 ] . \n considering both sides , it is interesting to analyze these two families of peptides within dental pulp , using controlled orthodontic forces that may allow nerve response without causing clinical symptomatology . \n the aim of this study was to determine the expression levels of sp , cgrp , -end , and met - enk in human dental pulp following orthodontic intrusion . \n eight patients of both sexes who were between 12 and 16 years old were selected . \n inclusion criteria were as follows : being systemically healthy and indicated for the extraction of the four first premolars for orthodontic reasons ; teeth without caries , fractures , or periodontal disease ; and teeth with radiographically evident complete radicular formation . \n exclusion criteria were as follows : patients receiving recent anti - inflammatory , analgesic , or antibiotic treatment ; those who had root resorption ( from any cause ) , permanent or provisional restorations in the first premolars or radicular dilacerations ; smokers ; pregnant patients ; and those who have occlusal disorders . \n a descriptive comparative pilot study was conducted with the approval of the institutional ethics committee ( approval code number ceife-002 - 010 ) , according to the declaration of helsinki . \n written informed consent was explained and obtained from parents / legal guardians of each patient . \n intrusive orthodontic appliances were designed using standard 0.018 orthodontic brackets and double tubes ( sybron / ormco , orange , ca , usa ) , selected for the first premolars and permanent first molars , respectively . \n both brackets were bonded to each tooth using the adhesive system prime & bond ( 3 m unitek , monrovia , ca , usa ) and composite filtek 350 ( 3 m unitek ) , standardizing their positions with an anderson calibrator ( dentaurum gmbh , ispringen , germany ) . using number 139 orthodontic pliers ( dentaurum gmbh ) , a 1 mm loop was formed with a retentive fold on the opposite side of a stainless steel wire ( 0.018 0.025 ) . the customized wire was placed in the tube slot and adjusted to allow the loop to be bent until an acute angle was achieved . using a dynamometer ( corex , haag - streit , kowniz , switzerland ) , \n the angulation was standardized at 40 to allow for a 150200 g intrusive force . \n two premolars from each patient were randomly selected and assigned to two different groups : the asymptomatic inflammation group referred to as experimental group , which would undergo controlled intrusive force for seven days ( expg ) , and the control group ( ctrg ) , used to determine the basal levels of each substance . \n each patient was scheduled to obtain the samples from the control tooth before any clinical intervention took place . \n each control tooth was anesthetized with 4% prilocaine ( pricanest , ropsohn therapeutics , bogot , colombia ) . from that moment , the entire sampling procedure was performed within a 10-minute period . \n after extraction , a second assistant created a 1 mm longitudinal groove over the vestibular tooth surface using a high - speed diamond bur with copious irrigation to facilitate the mechanical fracture of the tooth and the intact acquisition of pulpal tissue , which was immediately stored in a tagged cryovial containing 1.8 ml of 4% paraformaldehyde . \n after its activation , each patient received instructions to call if any problem or severe discomfort was experienced and , if necessary , to take 400 mg of ibuprofen as a rescue analgesic . \n for the following six days , the patients were contacted by telephone to evaluate their progress along the experimental period . \n information on their symptoms , analgesic usage , or orthodontic device displacement was recorded . at day seven , patients were scheduled to obtain the dental pulp sample from expg , as described above . \n a radioimmunoassay ( ria ) was performed to quantify the amount of each substance obtained from each sample , according to previous investigations reported . \n sp , cgrp , -end , and met - enk release were determined by competition ria binding assays using a human sp ria - kit ( reference rk-061 - 05 ) , a human cgrp ria - kit ( reference rk-015 - 02 ) , a human -end ria - kit ( reference rk-022 - 14 ) ( phoenix peptide pharmaceuticals , burlingame , ca , usa ) , and a human met - enk ria - kit ( reference s-2119 ) ( peninsula laboratories llc , bachem group , san carlos , ca , usa ) . for each kit , \n 100 l of antiserum and 100 l of various neuropeptide / opioid concentrations ( 1128 pg l ) or 100 l of dental pulp tissue extracts were incubated in polypropylene tubes at room temperature for 20 hours . \n then , 100 l of radioactive 125i tracer was added and left to incubate for another 24 hours . \n bound fractions were precipitated by the addition of 100 l of a secondary antibody ( goat anti - rabbit immunoglobulin g serum ) , 100 l normal rabbit serum , and 500 l ria buffer containing 1% polyethylene glycol 4,000 . \n after 2 hours of incubation at room temperature , the suspensions were spun at 3,500 rpm ( 4,000 g ) for 40 minutes at 4c to precipitate the bound fractions . \n the supernatants were carefully aspirated , and pellet radioactivity was read on a gamma counter ( model b5002 , packard instrument international , zurich , switzerland ) . \n all samples were assayed in duplicate , and the mean values were calculated . finally , scatchard analysis of the binding data was used to assess the amount of neuropeptide / opioid present in each sample . \n the results were analyzed by the mann - whitney u test to compare the differences among groups for continuous variables . \n a difference was considered to be significant if the probability of its occurring by chance alone was < 5% ( p < 0.05 ) in a two - tailed test . \n basal levels of both neuropeptides and endogenous opioids were observed . in the expg , sp and cgrp exhibited statistically significant different levels ( p < 0.05 ) . \n although none of the endogenous opioids showed statistically significant differences ( p > 0.05 ) , they all expressed increasing trends in the expg . \n none of the patients enrolled were eliminated from the study because no one reported severe pain episodes or the need to take the rescue analgesic treatment . \n all patients reported tolerable discomfort localized in the tooth assigned to expg , for the two or three days after orthodontic activation . by day seven , \n all of the symptoms were absent , and all of the orthodontic devices were still active . \n mechanisms related to neurogenic inflammation and pain modulation in ai are not fully understood . in this study , \n the expression of two somatosensory neuropeptides and two ops in dental pulp ai caused by orthodontic intrusion was determined . \n this clinical model allowed us to obtain a biphasic inflammatory transition , which began with discomfort during the acute phase and finally achieved an asymptomatic state . \n since the intrusion period of the experiment was seven days , it was considered not objective to make a clinical measurement of the distance . in this experiment , \n although the majority of available evidence is focused on the biochemistry of painful conditions , the study of ai is a promising field that may help explain how important diseases appear after the development of anonymous inflammation . in this study \n , the presence of an initial inflammatory tenderness was required to assess the beginning of the asymptomatic phase ; it was a requirement for this study that all patients report no presence of pain when the samples were obtained . \n previous studies have demonstrated , within dental pulp , the expression of markers of neurogenic inflammation ( substance p and cgrp ) using the model of inflammation employed in this study ; this controlled orthodontic movement was selected as a well - standardized available model for human clinical trials focused on inflammation [ 6 , 1921 ] . \n chemotaxis of the macrophage population induced by neuropeptides in late orthodontic inflammation is crucial to establish the neuropeptidergic and op relationship . \n furthermore , nerve fiber sprouting and neurogenic inflammation are common during pulpal insult , including early force application during orthodontic tooth movement . \n macrophages express nk1 and cgrp1/2 receptors , which are activated by sp and cgrp , respectively , favoring their activation [ 15 , 24 ] . \n these cells are the main secretors of op , including -end and met - enk . \n interestingly , under inflammatory conditions , pan , the main source of local sp and cgrp release , exhibits an upregulation expression of or [ 13 , 27 ] , which can be targeted by macrophage analgesic products ( figure 1 ) . \n controversy surrounds the fact that macrophages are also capable of secreting somatostatin ( a substance able to cause analgesia ) ; thus , pain control may not be exclusively caused by op . \n these results demonstrate an important increase of sp and cgrp levels in expg ( p < 0.05 ) . \n the release of sensory neuropeptides occurs almost immediately , in a manner described as an axonal reflex . \n such a response supports the role of neurogenic inflammation of the dental pulp after low - grade orthodontic continuous movement [ 20 , 22 , 28 ] . \n both neuropeptides are frequently associated with pain from pulpal origin [ 2931 ] ; however , they have also been identified in asymptomatic irreversible pulpitis . \n the importance of the role of neuropeptides in inflammation was previously studied by determining their absence , not their presence . \n different denervation experiments showed how the deprivation of the sensory nerve supply can attenuate the local inflammatory response . \n both ops are postulated to play the leading role in endogenous antinociception due to their action as negative regulators of neurogenic inflammation by the inhibition of sp and cgrp release [ 14 , 15 ] . \n however , this study shows that , after orthodontic intrusion , low levels of op were not enough to attenuate neuropeptide expression . \n it is important to consider why late neurogenic inflammation can develop in the absence of pain . \n first , dental pulp is able to adjust slowly to low - grade inflammation , assimilating higher levels of proalgesic mediators in the absence of pain . \n second , experimental tooth movement is capable of activating central trigeminal pain modulation mechanisms , causing a reduction in the local recruitment of ocic to peripheral injured tissues ; thus , the net effect will be the control of pain and lower peripheral opioid peptide concentration [ 15 , 25 , 3537 ] . \n third , new evidence explores the dual effects of neuropeptides in relation to pain experience . \n sp enhances opioid release , and it is possible that its n - terminal fragment may act as a miu - opioid receptor ( mor ) agonist once its expression is upregulated during inflammation . \n for cgrp , the antinociceptive effect is related to the upregulation of mor when it is applied centrally and peripherally by the local suppression of interleukin-2 production , causing an anti - inflammatory effect . \n finally , though both neuropeptides are strong vasodilators , this effect may be masked by low blood flow after orthodontic intrusion , thus avoiding the increase of inner pressure in a low compliance pulpal environment [ 3941 ] . \n all of these hypotheses must be evaluated in further studies , including more patients in order to confirm these findings , as well as new complementary experiments including pulp tissue immunostaining to evaluate neurons , peptides activity , and immune and inflammatory cells participation . \n also , it is necessary to include peptides measurement at different time points in order to elucidate the possible mechanism of asymptomatic inflammation . \n in this preliminary report , sp and cgrp were identified in dental pulp after seven days of controlled orthodontic intrusion movement , even in the absence of pain . at the same time , endogenous opioids exhibited no statistical differences compared with control levels ; however , an increase tendency was appreciable for both .", "role": "user" }, { "content": "purpose . \n this study quantified the expression of substance p ( sp ) , calcitonin gene - related peptide ( cgrp ) , -endorphins ( -end ) , and methionine - enkephalin ( met - enk ) in human dental pulp following orthodontic intrusion . methods . \n eight patients were selected according to preestablished inclusion criteria . from each patient , two premolars ( indicated for extraction due to orthodontic reasons ) \n were randomly assigned to two different groups : the asymptomatic inflammation group ( expg ) , which would undergo controlled intrusive force for seven days , and the control group ( ctrg ) , which was used to determine the basal levels of each substance . \n once extracted , dental pulp tissue was prepared to determine the expression levels of both neuropeptides and endogenous opioids by radioimmunoassay ( ria ) . \n results . \n all samples from the ctrg exhibited basal levels of both neuropeptides and endogenous opioids . by day seven , all patients were asymptomatic , even when all orthodontic - intrusive devices were still active . in the expg , \n the sp and cgrp exhibited statistically significant different levels . \n although none of the endogenous opioids showed statistically significant differences , they all expressed increasing trends in the expg . \n conclusions . \n sp and cgrp were identified in dental pulp after seven days of controlled orthodontic intrusion movement , even in the absence of pain .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: total shoulder arthroplasty is considered a good option for treatment of the rheumatoid shoulder when the rotator cuff is intact and the glenoid bone stock is preserved . in rheumatoid shoulders with loss of glenoid bone stock , rupture of the rotator cuff , and/or rheumatoid destruction of the ac joint [ 1 , 3 , 6 ] , the clinical outcome of arthroplasty is often less predictable [ 13 , 15 ] . \n several factors have been implicated in affecting the prognosis following shoulder arthroplasty for patients with rheumatoid involvement . \n these include the degree of glenohumeral destruction , proximal and medial migration of the humeral head , preoperative status of the rotator cuff , successful repair of the cuff , involvement of the ac joint , age at the time of surgery , and sex . \n however , in most clinical follow - up studies , the mean postoperative result is based on only one postoperative measurement with a different follow - up period for most of the patients \n . however , the postoperative status of the patient often changes over time and as a result the postoperative score will gradually increase in some patients or decrease in others in the years after surgery . therefore , at least two measurements are necessary in the years after surgery to assess the effect of prognostic factors on the trend of the score over time of an individual patient . \n more measurements will add to the accuracy by which a trend of the score over time of an individual patient can be estimated . \n therefore , in this prospective study , we analyzed the effect of various prognostic factors on the outcome of shoulder arthroplasty in patients with rheumatoid arthritis by using multiple functional measurements at different time points . \n specifically , we studied the effect of the following preoperative and peroperative prognostic factors : ac joint destruction , age , glenoid bone loss , and status of the rotator cuff [ 9 , 16 ] on the hospital for special surgery clinical score ( hss ) comparing the preoperative score to that obtained at 2 years of follow - up . \n additionally , we studied the trend of the score over time in relation to the above - mentioned factors , to determine the change in hss score over time . \n all rheumatoid patients in whom an arthroplasty of the shoulder was performed between 1985 and 2005 were prospectively studied . \n thirty - two patients ( 42 shoulders ) had died from unrelated causes in the years following surgery . \n seven of these were not included in the follow - up study because they died within 2 years after surgery . \n thirty - five of these patients were regularly seen in the clinic for their follow - up and were included in the study . \n one patient with bilateral shoulder prosthesis refused to come for follow - up because she had no complaints . \n three shoulders were considered as lost to follow - up because they could not be traced and of three shoulders the follow - up data were incomplete . \n hence , 141 shoulders in 110 patients were included in this study ( table 1 ) . \n the operation was performed in 68 right shoulders and 73 left shoulders , and in 64 cases , it concerned the dominant extremity . \n the average age was 60 years ( range , 24 to 81 years ) . \n the follow - up period ranged from 2 to 20 years with a mean duration of follow - up of 6.5 years ( sd 4 years ) . \n all patients were examined by the first author and scored clinically and radiographically before the operation , at 1-year and 2-year follow - up examinations and afterward for a 5- and 10-year follow - up . \n the frequency of the scoring during follow - up was on average four times . in this way \n , the change of the score in the years after surgery could be evaluated for every individual patient . the hospital for special surgery ( hss score ) 100 \n this 100-point scoring system allocates 30 points to pain , 25 points to power , 25 points to motion , and 20 points to function . \n a handheld goniometer was used to assess the range of motion and strength was measured with a hand held dynamometer and by manual muscle testing . \n table 1patient characteristicstype of arthroplastytotal shoulder arthroplastyhemiarthroplastynumber of casesnumber of casesnumber of operations6675 mean age sd(years)56.9 12.8562.2 10.35 mean follow - up sd(years)7.8 3.685.5 3.96radiol . grading \n larsen344 larsen45235 larsen51036ac joint destruction normal2419 cysts1813 erosions1315 acro - osteolysis919 missing29med . \n migration ( coracoid line ) none / mild ( 0)2414 moderate ( 1/5)2522 severe ( < 5)1737 missing2sup . migration ( ah interval ) none / mild ( > 6 mm)1916 moderate ( 46 mm)2718 severe ( <3 mm)1937 missing14pre - op . \n cuff intact3117 attenuated / intact1010 small tear1011 large tear1534 missing3gender male1828 female4847age 502613 5160815 61702331 > 70916 patient characteristics a standardized system of both performing and assessing the radiographs was used . \n all radiographs were assessed by two individuals ( pmr , jn ) and , in case of a discrepancy , were reevaluated until consensus was reached . \n it included a true antero - posterior view of the shoulder with the patient in an upright position ( with the back in 45 to the roentgen film ) and an axillary view . \n the radiographic destruction of the shoulder joint was scored according to the criteria of larsen et al . \n ( larsen 0 : normal shoulder ; larsen 1 : soft tissue swelling and osteoporosis ; larsen 2 : marginal erosions ; larsen 3 : obvious narrowing of the joint space ; larsen 4 : deep erosions through the subchondral plate and joint space reduced to a joint line ; and larsen 5 : total disorganizations of joint and major bone destruction . \n eight shoulders were graded as larsen 3 , 87 shoulders as larsen 4 , and 46 shoulders as larsen 5 . \n superior migration of the humeral head was measured by the width of the acromio - humeral interval . in five shoulders \n , the proximal migration could not be measured due to the inferior quality of the digitized radiographs . the change in proximal migration during follow - up \n was estimated by comparing the follow - up radiographs with the preoperative radiographs and measuring the width of the subacromial space and the position of the center of the humeral head opposite the glenoid . \n three categories were distinguished : progression , no change , and improvement of proximal migration . \n the medialization or medial migration of the humeral head is caused by loss of the subchondral bone mass of the glenoid due to the rheumatoid process . \n the position of the joint surface can be measured relative to the projection of the basis of the coracoid process [ 2 , 10 ] . \n a vertical line is drawn tangential to the lateral margin of the coracoid process , and the distance between this line and the medial contour of the humeral head is measured . \n it gets a positive sign when the head is lateral to this line and a negative sign if the head is medial to this line . \n also , a descriptive evaluation of glenoid bone loss was used in terms of the severity of the medial migration . \n there was no medial migration when there was no glenoid bone loss , mild medial migration when the joint line was lateral to the coracoid line , moderate medial migration when the joint line was 05 mm medial to the coracoid line , and severe medial migration when the joint line was more than 5 mm medial to this line . in 38 shoulders , the joint line was lateral to this coracoid line ( no or mild medial migration ) ; in 47 shoulders , the joint line was medialized between 0 and 5 mm ( moderate medial migration ) , and in 54 shoulders , the medialization was more than 5 mm to this line ( severe medial migration ) . \n in two shoulders , the medialization could not be measured accurately because the radiograph was not a true antero - posterior view . \n the ac joint was evaluated on standard radiographs of the shoulder for para - articular cysts , erosions , or acro - osteolysis of the clavicle , which respectively represent progressive stages of rheumatoid destruction . \n three items were evaluated : para - articular cysts in 31 joints , erosions in 28 joints , acro - osteolysis of the clavicula in 28 joints , and a normal ac joint in 43 shoulders . on 11 shoulder radiographs , \n the width of the joint space and the degree of subluxation of the ac - joint was not measured in this study . \n all surgery was performed by the first author or by a resident under his supervision . \n nevertheless , in 66 shoulders , a total shoulder arthroplasty was performed and , in 75 shoulders , a hemiarthroplasty . \n hemiarthroplasty was performed when the bone loss of the glenoid did not allow secure fixation of the glenoid component or when a large irreparable cuff tear was present . \n sometimes , the surgical plan was changed at the time of surgery in favor of a hemiarthroplasty when the surgical exposure of the glenoid was so insufficient risking compromise of insertion of the glenoid component . for replacement of the humeral head , two uncemented types of prosthesis were used . \n a biomodular humeral prosthesis was used in 83 shoulders ( biomodular prosthesis , biomet , warsaw , in ) and an eska prosthesis with a short intramedullary stem in 58 shoulders ( eska implants gmbh , lbeck ) . \n most of the components were used uncemented , and , in only eight shoulders ( four biomodular , four eska ) , the humeral stem was cemented because the initial fixation at the time of surgery was considered insufficient for bony ingrowth . \n when a total shoulder prosthesis was inserted , a biomodular glenoid component was used , an uncemented metal backed version in 18 shoulders , and a cemented polyethylene keeled design in 48 shoulders . \n the status of the rotator cuff was known preoperatively from the ct ( arthro- ) or mri , and the cuff was also inspected at the time of surgery . in 48 shoulders , \n the cuff had a normal aspect ; in 20 shoulders , the cuff was thin and attenuated but still intact , and , in 21 shoulders , it was combined with a small tear ( diameter <3 cm ) . in 49 shoulders , \n a large tear was present ( diameter > 3 cm ) . in three shoulders , \n the quality of the rotator cuff after repair was subjectively graded as moderate if the cuff could not be closed completely , and a small defect remained or the thin and attenuated rotator cuff was closed under tension . \n the repair was graded as good if the cuff was closed without tension with strong tendon tissue , and intact if no tear in the cuff had to be closed . \n when no repair of the tear was performed , the quality of the cuff was graded as bad . in 49 shoulders with a large cuff tear , \n the repair was considered moderate in 14 shoulders and good in ten shoulders , and the tear was not repaired in 25 cases . in 21 shoulders with a small tear , the quality of the cuff after repair was graded as moderate in ten shoulders , good in four , and bad in seven . \n the data of all patients were collected prospectively with mrdm software ( medical research data management ( www.clinicalresearch.nl ) and converted into spss ( spss , chicago , illinois ) for data analysis . \n the difference between the preoperative and postoperative hss score and its sub - items was tested using the student 's t test . \n correlation analysis was used for measuring the degree of association between the preoperative and postoperative clinical score with the spearman 's rank correlation coefficient . the relationship between improvement of the clinical score after operation and prognostic factors was analyzed with the one - way analysis of variance with the preoperative score as covariate for categorical data and linear regression for numerical data . the pearson chi - square test for independence \n was used for the relationship of the preoperative , peroperative , and postoperative categorical data to one another . \n comparison of the clinical score after tsa and hemiarthroplasty ( hhr ) in patients with bilateral shoulder prosthesis was done with the paired t test . \n the change of the clinical score during follow - up in relation with the prognostic factors like type of arthroplasty , superior and medial migration , cuff status , radiographic destruction , sex , and age were analyzed by means of a generalized linear mixed model with the presurgery status as a covariate . in this way , \n the trend of the score or the change of the score with the passage of time was studied within the different groups and subgroups of the variables as well as between the different groups . \n there was no significant difference in the pre - op hss score and the sub - items , pain , motion , function , and strength comparing hhr and tsa in the whole group of patients ( table 2 ) . \n the hss score and its sub - items pain , motion , function and strength , and the change of the preoperative scores were significantly improved at the 2 years follow - up compared with the preoperative scores ( student 's t - test : p < 0.001 ) . \n after this initial improvement , there was a gradual decrease of the hss score ( p = 0.045 ) and the function score ( p = 0.041 ) over time in patients with tsa . in shoulders with hhr , there was no significant change of the score over time ( table 2 ) . in the group of patients with bilateral shoulder prosthesis \n , there were 11 patients with a tsa in one shoulder and a hhr in the other shoulder . \n in these 11 patients , no significant difference was found between both shoulders regarding the hss score and the score of the sub - items both preoperatively and at the 2 years follow - up ( paired t - test hss score : preoperative , p = 0.751 ; postoperative , p = 0.772 ) . \n the importance of the prognostic values was studied in shoulders with tsa and hhr . in tsa \n , the improvement of the score was positively correlated with the status of the rotator cuff after insertion of the prosthesis ( p = 0.006 ) as well as younger age at the time of surgery ( p < 0.001 ) . in hhr , \n the postoperative improvement varied significantly with respect to the preoperative medial migration ( p = 0.019 ) and the status of the ac joint ( p = 0.022 ) . \n table 2comparison of the average hss score after total shoulder arthroplasty and humeral head replacementarthroplasty typehss clinical scorehss scorepreoperative2 years5 years10 yearsp for trendhhr ( n = 75)total ( 0100)42.369.571.873.00.534pain ( 030)10.125.625.126.90.259motion ( 025)9.112.614.1 * 13.3**0.412function ( 020)7.313.613.513.30.764strength ( 025)11.712.613.613.00.202tsa ( n = 66)total ( 0100)40.970.069.266.00.045pain ( 030)9.025.624.323.80.068motion ( 025)8.911.512.1 * 11.1**0.555function ( 020)7.413.614.313.10.041strength ( 025)12.413.012.912.30.089data are presented as mean hss score with standard error of the mean . difference in motion between tsa and hhr , * p = 0.005 * * p = 0.013 comparison of the average hss score after total shoulder arthroplasty and humeral head replacement data are presented as mean hss score with standard error of the mean . \n difference in motion between tsa and hhr , * p = 0.005 * * p = 0.013 the preoperative status of the ac joint was significantly related to the clinical outcome after arthroplasty ( p = 0.034 ) . in patients with hhr \n , the presence of erosions or cysts in the ac joint on the preoperative radiographs was associated with less improvement of the hss score in comparison with those with an intact ac joint ( p = 0.005 ) and was associated with a lower hss score during the whole follow - up ( p = 0.004 ) . in patients with tsa , the improvement of the score at the 2-year follow - up did not vary with the status of the ac joint at the time of surgery ( p = 0.509 ) , but there was a gradual decrease of the score with the passage of time in shoulders with degenerative changes in the ac joint at the time of surgery ( p = 0.030 ) . \n age at the time of surgery influenced the improvement of the score after surgery significantly in tsa ( p < 0.001 ) and hhr ( p = 0.036 ; fig . 1 ) . in patients with tsa and younger than 50 years , the improvement of the hss score was 34.6 ( sd , 13.60 ) at the 2 years follow - up and in patients older than 70 years 22.9 ( sd , 18.03 ) . \n although the improvement of the score after surgery differed with age at the time of surgery , age was not a factor in deterioration of the score with the passage of time after tsa or hhr . \n ( white bar : preoperative hss score ; transverse striated bar : postoperative improvement ; oblique striated bar : hss score at 2 years follow - up ) . \n data are presented as mean hss score with standard error of the mean the relationship between age and clinical outcome after shoulder replacement is shown . \n ( white bar : preoperative hss score ; transverse striated bar : postoperative improvement ; oblique striated bar : hss score at 2 years follow - up ) . \n data are presented as mean hss score with standard error of the mean outcome of tsa was related to the integrity of the rotator cuff . \n patients with tsa showed significantly less improvement of the score at the 2 years follow - up in shoulders with a moderate repair of the cuff than in shoulders with a good repair or an intact cuff ( p = 0.006 ) . \n shoulders with a good repair had a good improvement of the clinical score at the 2 years follow - up comparable with shoulders with an intact cuff ( table 3 ) . \n after this initial improvement , the hss score decreased over time in shoulders with a good repair with an average of 1.3 point / year ( p = 0.003 ) . in patients with an intact cuff , \n the decrease of the score ( on average 0.4 point / year ) was not significant ( p = 0.122 ) . in patients with hhr , \n the improvement of the score did not vary with the quality of the repair ( p = 0.704 ) , and there was no significant change of the score over time in the different groups during follow - up ( table 3 ) . \n table 3cuff repair versus pre- and postoperative hss score for tsa and hhrarthroplasty typecuff repairhss score standard deviationpreoperative2 years5 years10 yearsp for trendhhr ( n = 32)bad43.5 14.4972.3 14.56 * 76.0 \n 11.6470.5 13.00.753hhr ( n = 12)moderate42.8 12.5570.3 13.73 * 68.1 19.2871.3 20.10.647hhr ( n = 2)good57.5 6.3684.5 3.53 * 78.50.607hhr ( n = 26)intact39.9 12.9666.7 13.25 * \n 69.6 11.1778.2 9.850.520tsa ( n = 0)badtsa ( n = 13)moderate38.4 14.8357.0 14.79**54.5 19.356.2 33.390.859tsa ( n = 12)good40.0 9.6373.8 9.33**76.2 9.1759.5 14.500.003tsa \n ( n = 41)intact41.9 9.4773.6 13.96**72.0 14.4470.1 14.810.122relationship between cuff status after repair and improvement of hss score in patients with tsa ( * * p = 0.006 ) and patients with hhr ( * p = 0.704 ) . \n significant decrease of the score over time for patients with tsa and a good repair of the rotator cuff ( p = 0.003 ) . \n missing three shoulders with hhr cuff repair versus pre- and postoperative hss score for tsa and hhr relationship between cuff status after repair and improvement of hss score in patients with tsa ( * * p = 0.006 ) and patients with hhr ( * p = 0.704 ) . \n significant decrease of the score over time for patients with tsa and a good repair of the rotator cuff ( p = 0.003 ) . missing three shoulders with hhr \n the intention at the time of surgery was always to replace the glenoid unless the repair of the cuff or the glenoid bone stock was considered insufficient for a reliable functioning of a tsa . \n shoulders with a moderate repair of the cuff and tsa formed a positive selected group of patients in whom the authors expected a better outcome than in patients with hhr . \n nevertheless , comparing the two groups with reasonable repair and with or without a glenoid component , patients with hhr had a higher hss score during the whole follow - up ( p = 0.031 ; table 3 ) . in patients with tsa or hhr and an intact cuff at surgery , the degree of preoperative proximal migration was not significantly related with the improvement of the overall clinical hss score or the height of the score at the 2 years follow - up . regarding the sub - items of the score , in patients with tsa , \n the improvement of motion varied by the degree of preoperative proximal migration ( p = 0.037 ) , and shoulders with preoperative proximal migration had less flexion ( p = 0.009 ) and less abduction ( p = 0.021 ) at the 2 years follow - up . if the acromio - humeral distance was less than 6 mm , flexion was 81 32 ( mean standard deviation ) , and abduction 65 20 , and if this distance was more than 6 mm , flexion was 100 36 and abduction 86 31. in shoulders with hhr , the improvement of function was significantly better in shoulders with less preoperative proximal migration ( p = 0.021 ) . \n proximal migration at follow - up was significantly related with the degree of proximal migration preoperatively ( p < 0.001 ) and older age at the time of surgery ( p < 0.001 ) ) . in 39 shoulders , \n the proximal migration of the humeral head had progressed in the years after surgery , and in 38 shoulders , the proximal migration had improved in comparison with the preoperative proximal migration . \n improvement occurred more frequently after a good repair of the cuff than after a moderate repair ( p = 0.027 ) . in patients with tsa , progression of proximal migration \n was accompanied with a decrease of the clinical score over time ( p = 0.047 ) , and the score was significantly lower in comparison with the score in patients with an improvement of proximal migration ( p = 0.034 ; fig . 2 ) . in patients with hhr , \n the clinical score was not affected by an improvement or worsening of the proximal migration . \n 2the relationship between change of proximal migration and hss score , preoperatively and at 2 , 5 , and 10 years follow - up in shoulders with tsa is demonstrated . \n number of shoulders for different postoperative intervals are : for 0 years , 27 improved/16 progression ; 2 years , 23/17 ; 5 years , 23/16 ; and 10 years , 13/11 the relationship between change of proximal migration and hss score , preoperatively and at 2 , 5 , and 10 years follow - up in shoulders with tsa is demonstrated . \n number of shoulders for different postoperative intervals are : for 0 years , 27 improved/16 progression ; 2 years , 23/17 ; 5 years , 23/16 ; and 10 years , 13/11 in patients with tsa , the improvement of the score did not vary with the degree of the preoperative medial migration ( p = 0.564 ) , and there was no significant difference in the trend of the scores during follow - up between shoulders with the glenoid surface lateral to the coracoid line ( no or mild medial migration ) and shoulders with bone loss medial to coracoid line [ moderate or severe medial migration ( p = 0.367 ) ] . in patients with hhr , the clinical score after surgery varied with the degree of medial migration by glenoid bone loss .the hss score was higher and improved more after surgery in shoulders with moderate or severe medial migration than in shoulders with no or mild medial migration ( p = 0.020 ) . this finding could not be explained by a difference in distribution of frequency of age , cuff destruction , or cuff repair . \n the average hss score during follow - up remained significantly lower in patients with preoperatively no or only mild glenoid bone loss ( p = 0.041 ) . the medial migration measured at follow - up \n there was an increase of medialization at follow - up in 28 of 72 shoulders with a hemiarthroplasty ( three missing ) , and the average progression measured in this group was 4.8 mm ( sd , 3.4 mm . ) . in 14 shoulders , it progressed to severe . a progression of the medial migration did not result in a decrease of the hss score ( fig . \n 3 ) or the score of the sub - items pain , motion , function , or strength over time , and there was no significant difference in the trend of the clinical score and the score of sub - items between the shoulders that migrated medially and those shoulders that did not in the years after surgery hss , p = 0.90 ; pain , p = 0.98 ; motion , p = 0.19 ; function , p = 0.32 ; and strength , p = 0.86 . \n 3the relationship between change of medial migration and hss score preoperatively and at 2.5 and 10 years follow - up in shoulders with hhr . \n the numbers of shoulders for different postoperative intervals are : for 0 years , 72 shoulders ( 44 unchanged/28 progression ) ; 2 years , 64 ( 39/25 ) ; 5 years , 38 ( 19/19 ) ; 10 years , 16 ( 7/9 ) the relationship between change of medial migration and hss score preoperatively and at 2.5 and 10 years follow - up in shoulders with hhr . \n the numbers of shoulders for different postoperative intervals are : for 0 years , 72 shoulders ( 44 unchanged/28 progression ) ; 2 years , 64 ( 39/25 ) ; 5 years , 38 ( 19/19 ) ; 10 years , 16 ( 7/9 ) in the group with an uncemented glenoid component ( n = 18 of 66 tsa 's ) with a follow - up of 7.9 years ( sd , 3.97 ) , there were no complications regarding the glenoid and no radiographic signs of loosening except in one patient in which there was a non - progressive resorption of bone under the metal backing . in patients with a cemented glenoid component ( n = 48 ) with a follow - up of 7.1 years ( sd 3.24 years ) , 17 of the cemented glenoid components had no radiolucency at the cement bone interface , and ten components a partial radiolucency . in 21 shoulders , \n the glenoid component was considered loose based upon a complete radiolucency , combined with a shift of the component in a superior tilt in 13 shoulders and additionally with major bone loss in nine shoulders . \n the presence of partial or complete radiolucency and loosening in cemented glenoid components was significantly related with the preoperative status of the rotator cuff . in shoulders with a preoperatively attenuated cuff ( degenerated , small tear , or large tear ) \n , there was more often a loosening or radiolucency at follow - up ( p = 0.002 ) . \n this negative effect was not undone by a good repair of the rotator cuff and even in shoulders with a good repair of the cuff there was more often radiolucency or loosening at follow - up than in shoulders with an intact cuff ( p = 0.004 ) . \n the importance of the status of the rotator cuff is also expressed by the increased occurrence of glenoid loosening in shoulders with postoperatively a proximal migration ( p < 0.001 ) . \n the presence of medial migration of the humeral head preoperatively caused by bone loss of the glenoid was significantly related with radiolucency and loosening of the glenoid component at follow - up ( p = 0.042 ) . \n loosening of a cemented glenoid component occurred in shoulders with the joint line preoperatively lateral to the coracoid line in four out of 17 shoulders ( relative risk = 0.31 ) and in shoulders with the joint line medial to the coracoid line in 17 of 31 shoulders ( relative risk = 1.21 ) . of the 18 shoulders with an uncemented glenoid component , \n 11 shoulders had preoperatively a migration medial to the coracoid line but no loosening occurred . \n patients with loosening of the glenoid component developed a lower hss score over time ( p = 0.022 ) and had a loss of function ( p = 0.001 ) in comparison with patients with a well - fixed glenoid . in 11 shoulders , a revision operation was performed . \n three revisions of a symptomatic loose glenoid component , one painful medial migration , one painful proximal migration , three cases with an acute rupture of the cuff , one release of an internal rotation contracture , and two cases with a painful ac joint . \n in this study , we aimed to investigate the prognostic value of various parameters in the clinical course after shoulder arthroplasty in rheumatoid patients . by using multiple postoperative functional measurements at different time points , we found that age at the time of surgery , the condition of the ac joint , the status of the rotator cuff , and the presence of a good glenoid bone stock were important predictors for the outcome during follow - up . \n moreover , in patients with hemiarthroplasty , no deterioration of the clinical score over time was observed . \n a possible limitation of this study is the low number of patients in certain subgroups and the non - randomization of the type of glenoid component used . \n because this study was performed in a referral center for rheumatoid patients , more severely affected patients were included . \n the age at the time of surgery is important for the improvement of the score after shoulder replacement , but it does not influence the trend of the score in the years after surgery . the pathology of the ac joint in the rheumatoid shoulder has been reported by several authors [ 1 , 3 , 6 ] , but not in combination with a replacement arthroplasty of the shoulder . in these earlier studies , \n destruction of the ac joint and the glenohumeral joint do not follow the same course neither in time nor in severity of destruction . in our study , \n presence of radiological changes in the ac joint was an important prognostic factor . there might have been an indication to combine shoulder replacement surgery with a resection arthroplasty of the ac joint . \n the outcome of the hss clinical score during follow - up was affected by the degree of preoperative medial migration by glenoid bone loss . in patients with hhr , the improvement of the score after surgery was less in shoulders with preoperatively none or mild medial migration . \n progression of the medial migration during follow - up in patients with hhr did not result in a worsening of the clinical score in the years after surgery , contrary to findings in other reported series [ 13 , 15 ] . in our study , only one patient underwent a revision for this reason . \n if the preoperative medial migration is beyond the base of the coracoids process , the long - term fixation of the glenoid component might be compromised as seen in this study . \n we also found that the presence of proximal migration at follow - up is associated with glenoid loosening [ 8 , 12 ] . \n the rate of loosening of the cemented glenoid component of 44% in our study is similar as reported in the literature [ 7 , 8 , 14 , 15 ] . \n loosening had a significant influence on the outcome and caused a lower hhs score and a loss of function . \n this is contrary to previous findings suggesting that loosening did not influence pain relief , motion , function , or abduction strength . \n rheumatic involvement leading to disuse atrophy of the intact rotator cuff results in an anterior superior sublimation of the humeral head as is seen frequently in the rheumatoid shoulder . in one shoulder study , it was found that the risk of proximal migration after surgery increased with older age and more severe migration preoperatively and was stated that proximal migration could occur irrespective of the status of the rotator cuff , which findings were confirmed in our series . \n some authors reported proximal migration after arthroplasty as the most frequent complication . in the present study , \n proximal migration was present preoperatively in 75% of the shoulders in a degree of moderate or severe ( ah interval 6 mm ) , and there was postoperatively an improvement of the proximal migration compared with the preoperative status in 28% and a progression in 33% of the shoulders . \n a progression of proximal migration resulted in a lower clinical score and a falling score during follow - up in patients with tsa . in agreement with earlier studies , progression of proximal migration \n the status of the rotator cuff is predictive of the outcome of tsa . at the time of surgery , if the quality of the rotator cuff after repair is assessed as moderate , hhr should be considered the procedure of choice . \n glenoid bone loss increased the risk of glenoid loosening of cemented glenoid prosthesis in tsa , and in those cases , hhr is a good option for treatment . in hhr \n , no relation was observed between the progression of proximal or medial migration during follow - up and the clinical score over time . \n age was a predictive factor for the improvement of the hss score , and the status of the ac joint was related with the trend of the score over time .", "role": "user" }, { "content": "total shoulder arthroplasty is commonly considered a good option for treatment of the rheumatoid shoulder . however , when the rotator cuff and glenoid bone stock are not preserved , the clinical outcome of arthroplasty in the rheumatoid patients remains unclear . \n aim of the study is to explore the prognostic value of multiple preoperative and peroperative variables in total shoulder arthroplasty and shoulder hemiarthroplasty in rheumatoid patients . \n clinical hospital for special surgery shoulder score was determined at different time points over a mean period of 6.5 years in 66 rheumatoid patients with total shoulder arthroplasty and 75 rheumatoid patients with shoulder hemiarthroplasty . moreover , \n radiographic analysis was performed to assess the progression of humeral head migration and glenoid loosening . \n advanced age and erosions or cysts at the ac joint at time of surgery were associated with a lower postoperative clinical hospital for special surgery shoulder score . in total shoulder arthroplasty , status of the rotator cuff and its repair at surgery \n were predictive of postoperative improvement . \n progression of proximal migration during the period after surgery was associated with a lower clinical score over time . however , in hemiarthroplasty , no relation was observed between the progression of proximal or medial migration during follow - up and the clinical score over time . \n status of the ac joint and age at the time of surgery should be taken into account when considering shoulder arthroplasty in rheumatoid patients . \n total shoulder arthroplasty in combination with good cuff repair yields comparable clinical results as total shoulder arthroplasty when the cuff is intact .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: obesity is one of the most common disorders in industrialized countries and is fast becoming a worldwide health problem . \n metabolic disorders such as hypertension , dyslipidemia , and glucose intolerance frequently , but not incidentally , cluster in an individual with obesity , resulting in atherosclerotic cardiovascular diseases . \n syndrome x , deadly quartet , or visceral fat syndrome , which are currently recognized as metabolic syndrome . \n accumulating evidence indicates that adipose tissue secretes a variety of bioactive adipocytokines such as tumor necrosis factor ( tnf ) , plasminogen activator inhibitor type 1 , retinol binding protein-4 , monocyte chemotactic protein-1 , and adiponectin ( apn ) . of these \n , apn has been cloned and is the most abundant . in the past decade , a large number of clinical and experimental studies have uncovered a variety of biological functions for apn . \n this paper updates the protective roles of apn in cardiovascular diseases and discusses the association of apn with metabolic syndrome . \n the first clinical study of apn was conducted to observe plasma levels of apn among obese subjects . \n although plasma levels of most other adipocytokines are higher in obese individuals , arita et al . reported that plasma levels of apn are lower in obese individuals and are negatively correlated with body mass index ( bmi ) . \n subsequent studies demonstrated that plasma apn is lower ( hypoadiponectinemia ) in patients with diabetes , hypertension , and dyslipidemia than bmi - matched controls [ 35 ] , indicating that hypoadiponectinemia is associated with an increased prevalence of coronary risk factors . \n subsequently , a series of clinical studies reported an association between hypoadiponectinemia and coronary artery diseases ( cad ) . \n plasma apn is significantly lower in patients with cad than control subjects , and male patients with hypoadiponectinemia have a twofold increase in cad prevalence , independent of well - known risk factors [ 6 , 7 ] . \n another prospective study revealed that high plasma apn concentrations are associated with a lower risk for myocardial infarction in men , independent of inflammation and glycemic status . \n moreover , otsuka et al . reported that patients with acute coronary syndrome have lower apn levels than patients with stable cad and that plasma apn levels are significantly associated with coronary lesion complexity in men with cad . \n several studies of patients undergoing percutaneous coronary intervention ( pci ) indicate that hypoadiponectinemia is an independent predictor for in - stent restenosis [ 10 , 11 ] . \n recently , a multiple regression analysis revealed that levels of high molecular weight ( hmw ) apn correlate negatively with glycated hemoglobin in nondiabetic patients but positively with high - density lipoprotein cholesterol in diabetic patients with cad . \n these results indicate that total or hmw hypoadiponectinemia is an independent risk factor for cad and that apn may directly protect against abnormal vascular remodeling . \n obesity is strongly associated with pathological cardiac remodeling , and several studies have investigated the association between plasma apn levels and cardiac diseases . \n hypoadiponectinemia is associated with the progression of left ventricular hypertrophy ( lvh ) with diastolic dysfunction among patients with essential hypertension . even among healthy subjects , \n apn concentration is inversely and independently associated with lvh diagnosed by electrocardiography in japanese men . \n another study using echocardiography revealed that circulating total apn and hmw apn are related to left ventricular wall thickness and diastolic function independent of age and metabolic factors . \n these data suggest that apn may regulate hypertrophic progression of cardiomyocytes . however , the role of apn in heart failure is controversial . \n several studies have shown that plasma apn levels are high in patients with chronic heart failure ( chf ) and are associated with chf severity or mortality despite the protective effect of apn on chf in mice [ 1619 ] . \n -blocker therapy correlates with lower apn levels in patients with chf , especially in nonobese patients , suggesting that this relationship should be considered when assessing plasma apn among patients with chf . \n further careful studies may be required to clarify the relationship between apn and heart failure . increased albuminuria among patients with obesity and diabetes \n is a risk factor for cardiovascular and renal disease , and patients with ckd are at high risk for cardiovascular events . \n ckd patients show higher plasma apn levels than healthy subjects due to the low renal clearance rate of apn . \n a prospective study of patients with renal failure demonstrated that patients who experience new cardiovascular events had lower plasma apn levels than event - free patients . \n several other studies have also indicated that increases in plasma apn in patients with ckd decrease their risk for cardiovascular disease and increase survival rate [ 23 , 24 ] . \n in contrast , a high apn level is associated with mortality , independent of risk markers for chf severity among patients with ckd [ 16 , 25 ] . \n a recent report by komura et al . revealed that the loss of the vascular protective function of apn in the presence of high cystatin c levels in patients with ckd indicates that cystatin c may mask the beneficial effect of apn in patients with ckd despite high plasma apn levels . \n after initial clinical findings of the association between cad and hypoadiponectinemia were reported , several experimental studies have been conducted to elucidate the biological effect of apn in atherosclerosis . \n apn specifically binds to collagen types i , iii , and v , which are present in vascular intima and detected in the subendothelial space of rat balloon - injured arteries , implying an interaction between apn and vascular pathology . \n when atherosclerosis commences , low - density lipoprotein ( ldl ) particles in the blood become oxidized ( oxldl ) and induce the expression of adhesion molecules such as vascular cell adhesion molecule-1 ( vcam-1 ) and intercellular adhesion molecule-1 , in endothelial cells ( ecs ) . \n leukocytes in blood attach to the endothelial layer and induce proinflammatory chemokines that attract leukocytes into the subendothelial space . \n apn inhibits the expression of these adhesion molecules in tnf-activated endothelial cells by suppressing inflammatory transcriptional factors and activating nuclear factor ( nf)-b [ 6 , 28 ] . \n additionally , apn inhibits tnf-inducible interleukin ( il)-8 synthesis in ecs by inactivating nf-b and activating akt . \n an in vivo study in mice demonstrated that apn deficiency increases leukocyte - endothelium interactions with impaired endothelial nitric oxide signaling ( enos ) via upregulation of endothelial cell adhesion molecules . \n monocytes migrate to the subendothelial space in the atherosclerotic lesion and become lipid - laden macrophages . \n monocytes change into macrophages in the subendothelial space by taking up oxldl via scavenger receptors and form cells with accumulated cholesterol esters . \n apn suppresses scavenger receptor type a ( sr - a ) in macrophages and the internal cholesterol ester content . \n however , macrophages play an important role in reverse cholesterol transport ( rct ) , a protective system against atherosclerosis . \n apn increases apoa - i - mediated cholesterol efflux from macrophages through an atp - binding cassette transporter a1-dependent pathway , indicating that apn may prevent atherosclerosis by accelerating rct . \n macrophages sustain and amplify the inflammatory process by releasing several growth factors , cytokines , and chemokines that may further recruit immune cells , including monocyte / macrophages , t lymphocytes , or vascular smooth muscle cells . \n pretreatment with recombinant apn significantly suppresses the production of cytokines / chemokines , such as tnf , and cxcr3 ligand chemokines , such as ifn - inducible protein of 10 kda ( ip-10 ) , monokine induced by ifn- , and ifn - inducible t cells , which is a chemoattractant in lipopolysaccharide - stimulated macrophages [ 32 , 33 ] . \n the inflammatory process includes enzymes that can destroy the arterial extracellular matrix such as metalloproteinases ( mmps ) . \n apn treatment also induces anti - inflammatory il-10 and subsequent tissue inhibition of mmp-1 production , suggesting that apn may stabilize atherosclerotic plaques and prevent their rupture . \n aortic smooth muscle cells ( aosmcs ) are another major player in atherosclerosis , and their pathological migration and proliferation in the intima relates to restenosis of coronary arteries after pci . \n apn suppresses growth factor - stimulated aosmc proliferation and migration by inhibiting the erk signal . \n the increment of total apn or globular apn significantly attenuates the progression of atherosclerosis in apoe knockout mice [ 36 , 37 ] . in atherosclerotic lesions \n , apn accumulates to form cells in fatty streaks and inhibits the expression of vcam-1 , sr - a , and tnf . \n in addition , apn / apoe double knockout mice show advanced atherosclerotic lesions with increased t - lymphocyte accumulation and higher plasma ip-10 levels compared with apoe single knockout mice ( figure 1 ) \n . moreover , apn deficiency worsens neointimal formation after endothelial injury in mice , while apn supplements reverse the abnormal vascular remodeling . \n these data support the in vitro bioactivity of apn as an anti - inflammatory adipocytokine in the atherosclerotic process . \n apn deficiency causes severe concentric cardiac hypertrophy in mice after pressure overload with increased extracellular signal - regulated kinase , diminishes amp - activated protein kinase ( ampk ) signaling in the myocardium , and increases mortality . \n supplementing apn with an adenovirus vector attenuates the pathological cardiac hypertrophy . in an ischemia / reperfusion myocardium injury model , \n apn knockout mice exhibit increases in myocardial infarct size , apoptosis , and tnf expression compared with controls . in cultured cardiomyocytes \n a similar experiment showed that globular apn protects myocardium from ischemia / reperfusion injury by inhibiting inducible nos and nicotinamide adenine dinucleotide phosphate oxidase protein expression and resultant oxidative / nitrate stress . \n two recent reports demonstrated that apn knockout mice show enhanced cardiac fibrosis following permanent ligation of the left anterior descending artery or angiotensin ii infusion . \n apn accumulates in the injured cardiomyocytes and protects it against fibrosis by reducing apoptosis and ampk - dependent peroxisome proliferator - activated receptor ( ppar ) activation [ 19 , 42 ] . \n despite the potential association between heart failure and high plasma apn shown by several clinical studies , other experimental studies have demonstrated a beneficial , protective effect of apn on myocardium . \n elevated plasma levels of apn among patients with heart failure can be a reflection of accompanying renal dysfunction or \n pulmonary arterial hypertension ( pah ) is an idiopathic disease characterized by an increase in the thickness of pulmonary artery wall . \n apn suppresses platelet - derived growth factor bb - mediated proliferation of pulmonary artery smooth muscle cells harvested from mice , indicating that apn may play a role in the prevention of pah . in a mouse model of chronic airway inflammation , \n apn deficiency causes pathological pulmonary arterial wall thickness and elevates right ventricular systolic pressure , indicating pah . \n apn knockout mice also show thickening of pulmonary arterial wall under chronic hypoxic exposure , and apn overexpression significantly decreases the wall remodeling and right ventricular hypertrophy . \n apn serves as an angiogenic factor . in a mouse hindlimb ischemia model , apn deficiency impairs revascularization , whereas adenovirus - mediated apn administration recovers angiogenesis . \n apn stimulates blood vessel growth in the in vivo mouse matrigel plug implantation and rabbit corneal models of angiogenesis by promoting cross - talk between amp - activated protein kinase and akt signaling within endothelial cells . \n also dose dependently suppresses endothelial cell apoptosis and proliferation , migration , and premature diabetic senescence of endothelial progenitor cells [ 4850 ] . \n apn knockout mice show a significantly reduced endothelium - dependent vasodilation in response to acetylcholine compared with wild - type mice . \n another experiment demonstrated that apn knockout mice develop hypertension when maintained on a high - salt diet ( 8% nacl ) without insulin resistance . \n notably , all of these apns protective effects on endothelial function are mediated through an increase in the production of enos [ 51 , 5355 ] . \n therefore , the increment of plasma apn is important to maximize the beneficial effects of apn . \n a reduction in body weight , especially visceral fat mass , with a combination of diet therapy and exercise is a safe and effective way to increase plasma apn levels . \n another strategy to prevent cardiovascular disease using apn includes pharmacological changes in plasma apn levels . \n ppar agonists significantly increase plasma apn concentrations in insulin - resistant humans without affecting their body weight and in a mouse model of oxygen - induced retinopathy [ 56 , 57 ] . \n administering ppar ligands and angiotensin receptor blockers also increases plasma apn levels [ 53 , 5860 ] . \n furthermore , several statins are also effective for elevating plasma apn [ 61 , 62 ] . \n changes in hmw apn as well as total apn may also be an ideal target . \n the natriuretic peptides including atrial natriuretic peptide ( anp ) and brain natriuretic peptide ( bnp ) also increased the production of apn in adipocytes and plasma apn levels among patients with congestive heart failure . \n exogenous administration of adiponectin may be a therapeutic strategy as well . in a pig model , \n a single intracoronary administration of recombinant adiponectin protected myocardial ischemia / reperfusion injury by suppressing inflammation , apoptosis and oxidative stress . \n apn receptors or candidate apn - receptor - binding proteins have been reported such as adipor1-r2 , t - cadherin , and calreticulin [ 6567 ] . \n very recently , denzel et al . reported that t - cadherin ( glycosyl phosphatidylinositol - anchored cell surface glycoprotein ) is critical for adiponectin - mediated cardioprotection by showing no effect of adenovirus - mediated adiponectin supplement in t - cadherin knockout mice . \n pharmacologically enhancing the expression of or activating apn receptors may be a good strategy for cardiovascular protection . \n adipose tissue stores not only excess body energy but also a variety of adipocytokines that regulate cardiovascular homeostasis directly and indirectly . \n accumulating evidence has demonstrated that apn prevents diabetes , dyslipidemia , and hypertension , which are well - known risk factors for cardiovascular disease . \n generally , anti - inflammation is a key biological action of apn for cardiovascular protection . \n further clinical and experimental studies will clarify the precise effects and mechanisms of apn action for future clinical use .", "role": "user" }, { "content": "adipose tissue plays a central role in the pathogenesis of metabolic syndrome . \n adiponectin ( apn ) is a bioactive adipocytokine secreted from adipocytes \n . low plasma apn levels ( hypoadiponectinemia ) are observed among obese individuals and in those with related disorders such as diabetes , hypertension , and dyslipidemia . \n apn ameliorates such disorders . \n hypoadiponectinemia is also associated with major cardiovascular diseases including atherosclerosis and cardiac hypertrophy . \n accumulating evidence indicates that apn directly interacts with cardiovascular tissue and prevents cardiovascular pathology . \n increasing plasma apn or enhancing apn signal transduction may be an ideal strategy to prevent and treat the cardiovascular diseases associated with metabolic syndrome \n . however , further studies are required to uncover the precise biological actions of apn .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cervical radiculopathy ( cr ) is a neurologic disorder that usually presents with neck and arm pain , accompanied with sensory / motor function loss or reflex changes dependent on the affected nerve root . \n the reported annual incidence rate of cr is 83.2 per 100,000 populations ( male / female ratio = 1.69 ) , and in most of the patients cr presents within the fifth decade of age . \n compressive radiculopathy , mostly resulted from disc herniation or spondylosis , is the main type of cr . \n causes of noncompressive radiculopathies include infection , inflammatory , and neoplastic lesions . the underlying mechanisms of pain in cr are not clear . \n although nerve root compression is the most common cause of cr , without compression of dorsal root ganglion , it does not always lead to pain . \n some evidence indicates the role of inflammatory mediators ( prostaglandin e2 , interleukin-6 , and nitric oxide ) , released by herniated discs , in the pathophysiology of pain . \n most of the surgical and nonsurgical therapies of cr have not yet been tested in well - designed trials and current recommendations are mainly based on anecdotal reports . \n analgesic agents ( opioids and nonsteroidal anti - inflammatory drugs ( nsaids ) are often used as the first - line therapy . \n some physicians prescribe a short course ( 1 week ) of oral corticosteroid therapy with prednisone . \n surgical interventions are limited to those with severe disease and resistant to other less invasive therapies . however , epidural injection and surgery are associated with rare but serious neurologic squeals . considering the potential serious complications from injections and surgeries , and the lack of qualified data on the efficacy of oral corticosteroid therapies \n , we conducted a randomized controlled trial ( rct ) to evaluate the efficacy of a short course of prednisolone in relieving pain in patients with cr . \n this randomized , double - blinded , placebo - controlled trial was conducted on patients with cr referring to the clinic of neurology in kashani university hospital between 2011 and 2012 . \n adult patients with neck / shoulder pain for less than 1 month and neck disability index ( ndi ) score of 15 or more ( indicating moderate disability ) were enrolled into the study . \n diagnosis was confirmed by needle electromyography ( emg ) and nerve conduction study ( ncs ) tests and mr imaging of cervical spine . those with alarm symptoms of malignancy or infection ( e.g. , fever / chills , weight loss , history of malignancy ) , symptoms and signs of moderate to severe myelopathy , history of immunosuppressant or corticosteroid use , chronic liver disease , diabetes mellitus , osteoporosis , glaucoma , peptic ulcer disease , and pregnant / breastfeeding woman were excluded . \n considering type i error ( alpha ) = 0.05 , study power = 80% , and expecting at least one score difference between the two groups in the amount of change in 11-point numerical pain rating scale ( nprs ) score , sample size was calculated as 30 patients in each group . \n the study protocol was approved by the ethics committee of isfahan university of medical sciences and informed consent was obtained from the patients . \n the study has also been registered in iranian registry of clinical trials ( irct138801211804n1 ) . \n patients were randomized within two treatment group using random allocation software . neither the investigator nor the patient knew which treatment was to be administered . \n an individual without involvement in this study were asked to render medication packages ( placebo or prednisolone ) . \n patients in the prednisolone group received prednisolone ( aburaihan co. iran ) 50 mg / day for 5 days that was tapered within the following 5 days . \n all patients also received acetaminophen 325 mg three times a day as the standard treatment , and ranitidine two times a day for preventing adverse effects on gastrointestinal system . at the time of enrollment \n , the emg and ncs tests were done using medelec synergy instrument and mr imaging of cervical spine . \n two methods were used for the measurement of pain before and after the study ; the ndi and the nprs both of them recommended as appropriate outcome measures for cr treatment trials . \n the ndi is a widely used self - administered questionnaire that measures neck pain - related disability . \n it contains 10 items questioning about different daily activities ( 7 items ) , pain intensity ( 2 items ) , and concentration ( 1 item ) . \n each item is scored from 0 ( no disability ) to 5 ( full disability ) and the total ndi score ranges from 0 to 50 point ( expressed as percentage in this study ) for which a higher score indicates a greater patient 's perceived disability . \n the ndi has good psychometric characteristics specially responsiveness to change , which is important for clinical trials . \n we also used the 11-point nprs , which is a general pain rating scale with appropriate psychometric characteristics among patients with cr . in the nprs , \n patient reports the current intensity of pain by choosing a score from 0 = no pain to 10 = worst pain imaginable . \n the threshold for the minimal clinically important change is advised as 8.5 point for ndi and 2.2 point for nprs . \n data were analyzed using spss 17 for windows ( spss , inc . , chicago , il , 1996 ) . \n paired t - test was used for comparison of the ndi and nprs scores from before to after the intervention . \n independent t - test was used to compare baseline characteristics and the amount of change in the mentioned scales between the two groups . \n chi - square test was also applied for comparison of baseline characteristics between the two groups . \n a p value < 0.05 was considered as indicating a significant difference in all analyses . \n this randomized , double - blinded , placebo - controlled trial was conducted on patients with cr referring to the clinic of neurology in kashani university hospital between 2011 and 2012 . \n adult patients with neck / shoulder pain for less than 1 month and neck disability index ( ndi ) score of 15 or more ( indicating moderate disability ) were enrolled into the study . \n diagnosis was confirmed by needle electromyography ( emg ) and nerve conduction study ( ncs ) tests and mr imaging of cervical spine . those with alarm symptoms of malignancy or infection ( e.g. , fever / chills , weight loss , history of malignancy ) , symptoms and signs of moderate to severe myelopathy , history of immunosuppressant or corticosteroid use , chronic liver disease , diabetes mellitus , osteoporosis , glaucoma , peptic ulcer disease , and pregnant / breastfeeding woman were excluded . \n considering type i error ( alpha ) = 0.05 , study power = 80% , and expecting at least one score difference between the two groups in the amount of change in 11-point numerical pain rating scale ( nprs ) score , sample size was calculated as 30 patients in each group . \n the study protocol was approved by the ethics committee of isfahan university of medical sciences and informed consent was obtained from the patients . \n the study has also been registered in iranian registry of clinical trials ( irct138801211804n1 ) . \n patients were randomized within two treatment group using random allocation software . neither the investigator nor the patient knew which treatment was to be administered . \n an individual without involvement in this study were asked to render medication packages ( placebo or prednisolone ) . \n patients in the prednisolone group received prednisolone ( aburaihan co. iran ) 50 mg / day for 5 days that was tapered within the following 5 days . \n all patients also received acetaminophen 325 mg three times a day as the standard treatment , and ranitidine two times a day for preventing adverse effects on gastrointestinal system . \n at the time of enrollment , patients were interviewed and examined with a neurologist . for confirmation of diagnosis , the emg and ncs tests were done using medelec synergy instrument and mr imaging of cervical spine . \n two methods were used for the measurement of pain before and after the study ; the ndi and the nprs both of them recommended as appropriate outcome measures for cr treatment trials . \n the ndi is a widely used self - administered questionnaire that measures neck pain - related disability . \n it contains 10 items questioning about different daily activities ( 7 items ) , pain intensity ( 2 items ) , and concentration ( 1 item ) . \n each item is scored from 0 ( no disability ) to 5 ( full disability ) and the total ndi score ranges from 0 to 50 point ( expressed as percentage in this study ) for which a higher score indicates a greater patient 's perceived disability . \n the ndi has good psychometric characteristics specially responsiveness to change , which is important for clinical trials . \n we also used the 11-point nprs , which is a general pain rating scale with appropriate psychometric characteristics among patients with cr . in the nprs , \n patient reports the current intensity of pain by choosing a score from 0 = no pain to 10 = worst pain imaginable . \n the threshold for the minimal clinically important change is advised as 8.5 point for ndi and 2.2 point for nprs . \n data were analyzed using spss 17 for windows ( spss , inc . , chicago , il , 1996 ) . \n paired t - test was used for comparison of the ndi and nprs scores from before to after the intervention . \n independent t - test was used to compare baseline characteristics and the amount of change in the mentioned scales between the two groups . \n chi - square test was also applied for comparison of baseline characteristics between the two groups . a p value < 0.05 was considered as indicating a significant difference in all analyses . \n a total of 59 patients including 31 females and 28 males with the mean age of 46.2 9.0 years completed the study . \n there was no significant difference between the two groups regarding baseline characteristics [ table 1 ] . \n patients ' demographic and baseline characteristics a significant decrease was observed regarding the ndi and nprs scores from baseline to the end of study in both groups ( p < 0.001 , table 2 ) . however , for both the ndi ( 35.7 21.4 vs. 12.9 10.2 ) and nprs ( 4.4 2.7 vs. 1.6 1.2 ) , the amount of decrease was greater in the prednisolone compared with the placebo group ( p < 0.001 , figures 1 and 2 ) . \n pain severity from before to after the study between in two groups amount of change in neck disability index score between the two groups amount of change in numeric pain rating scale score between the two groups based on the minimal clinically important change in ndi , pain was improved in 75.8% ( 22/29 ) of the prednisolone and 30% ( 9/30 ) of the placebo group ( p < 0.001 ) . \n there are two major approaches for the treatment of patients with cr ; surgical and nonsurgical interventions . \n the surgery is usually recommended when there are alarm symptoms / signs of spinal cord impairment , progressive neurologic deficit , or myelopathy , and also if pain is persistent despite for at least 6 - 12 weeks of nonsurgical treatments . \n the success rate reported by surgical interventions is about 75% while complications are rare but serious including injury to the spinal cord and nerve root . \n although there are few studies comparing surgical with nonsurgical interventions and the results showed comparable long - term efficacy , starting the therapy with nonsurgical interventions in patients without severe signs of cervical myelopathy seems reasonable . \n commonly used treatments in patients with cr include analgesic agents including nsaids and acetaminophen and injected or orally administered steroids . \n these medicines are recommended based on the role of inflammatory mediators released by the herniated disk . \n however , most of the commonly recommended nonsurgical therapies of cr are on the basis of anecdotal experiences and have not yet been tested in rcts . to the best of our knowledge , \n our study is the first report of a double - blinded , placebo - controlled trial on oral steroid therapy in patients with cr . \n the results of our study showed that a short course of therapy with prednisolone is highly effective in reducing neck pain resulting in improvement in two - third of the patients with cr . \n this success rate was comparable to steroid injection ( 73 - 81% ) reported by previous studies . \n steroid injection , however , is associated with rare but serious neurological complications including brain / spinal cord infarcts , especially considering that patients usually need repeated injections , though imaging techniques such as fluoroscopy can increase the safety of injection . \n we did not follow - up with the patients to check what happens after tapering prednisolone , if the cr recurred , need for another course of therapy , long - term side effects of such therapy , and if the patient needed surgery . \n steroids are associated with important side effects including impaired glycemic control in diabetes mellitus , worsening of hypertension , and gastritis , all of them are commonly seen in the fifth decade of age in which there is a peak for cr . \n therefore , further studies are warranted on dosing , duration , and long - term efficacy and safety of oral steroid therapy , and comparison with injection and also surgical approaches . \n the result of this rct showed that a short course of oral steroid therapy with prednisolone is highly effective in reducing pain in patients referring with uncomplicated cr . \n further studies are warranted on dosing , duration , and long - term efficacy and safety of oral steroid therapy , compared with the injection approach .", "role": "user" }, { "content": "background : steroids are commonly used in the treatment of cervical radiculopathy ( cr ) , but there is limited information in this regard . we evaluated the efficacy of oral prednisone in the treatment of cr.materials and methods : this randomized , double - blinded , placebo - controlled trial was conducted on adult patients with neck / shoulder pain for at least 1 month with no alarm symptoms / sings of malignancy , infection , or severe myelopathy , and no contraindication for corticosteroid use . \n patients were allocated to receive prednisolone 50 mg / day for 5 days that was tapered within the following 5 days , or placebo . \n all patients also received acetaminophen 325 mg three times a day and ranitidine 150 mg two times a day . \n neck disability index ( ndi ) and the verbal rating scale ( vrs ) were used to evaluate the outcomes.results:a total of 59 patients ( 31 female , mean sd age = 46.2 9.0 years ) completed the study . a significant decrease \n was observed regarding the ndi and vas scores from baseline to the end of study in both groups ( p < 0.001 ) . \n however , for both the ndi ( 35.7 21.4 vs. 12.9 10.2 ) and vrs ( 4.4 2.7 vs. 1.6 1.2 ) , the amount of decrease was greater in the prednisone compared with the placebo group ( p < 0.001 ) . based on the clinically important change in ndi , pain was improved in 75.8% ( 22/29 ) of the prednisolone and 30% ( 9/30 ) of the placebo group ( p < 0.001).conclusion : a short course of oral steroid therapy with prednisolone is highly effective in reducing pain in patients referring with uncomplicated cr . \n further studies are warranted on dosing , duration , and long - term efficacy and safety of oral steroid therapy , compared with injection approach .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: crown - root fracture is defined as a fracture involving both the crown and root of the teeth , usually display an oblique fracture and compromise the pulp . \n subgingival crown - root - fractured tooth restoration presents great challenge to prosthodontic dentists . in such situations , prosthodontic treatment alone or when only combined with crown lengthening procedure will cause the problems of discontinuous gingival margin , gingival irritation and crown / root ratio imbalance , etc . \n , we , hereby , report a multidisciplinary approach using the endodontic root canal treatment ( rct ) , orthodontic extrusion , crown lengthening surgery and post - core - crown procedure to restore a left maxillary central incisor and achieved a satisfied cosmetic result . \n a 26-year - old healthy female had traumatic fractured of left maxillary central incisor for 1 day . \n only the labial part was 1 mm above the gingival margin ; all the other parts , including mesial , distal and lingual parts , were 3 - 5 mm subgingival . \n further periapical radiography showed that the root canal was vacant , the fracture line was oblique , the periodontal membrane was normal and the remaining root length was about 14 mm , with no additional root fracture image on the remaining part of the root [ figure 2 ] . \n after full discussion with the patient about the advantages and disadvantages of the alternative treatment approaches , including immediate implant and tooth - extraction followed by fixed or removable partial denture replacement , the patient chose to preserve the remaining root and perform a multidisciplinary treatment . \n then the treatment plan was divided into four phases as follow : subgingivally fractured left maxillary central incisor pre - treatment periapical radiography root canal therapy was performed for left maxillary central incisor and the periapical radiography after rct was satisfied [ figure 3 ] . \n periapical radiography after root canal treatment completed full mouth periodontal prophylaxis cleaning and initial periodontal therapy were done before orthodontic extrusion . \n a 0.8 mm stainless steel ( ss ) wire was cemented into the root canal space for the retention of orthodontic arch wire . \n the standard edge wise brackets were bonded on maxillary teeth and 0.018 0.025 inch nickel - titanium ( niti ) full arch wire ( tp orthodontics . \n a 0.2 - 0.3 n levelling and alignment extrusion force was applied , readjusted every 2 weeks . \n after 9 weeks engagement , 2 mm tooth structure was occlusally elevated with the simultaneous elevation of the surrounding periodontal bone tissue [ figure 4 ] . \n orthodontic extrusion finished after 4-month retention to prevent relapse,123 the crown lengthening surgery including gingival flap operation , alveoloplasty and gingivoplasty were performed to create an optimal relation between the gingival and margin of restoration . during the operation , the necessary clinical crown and suitable gingiva anatomy were reserved [ figures 5 and 6 ] . \n crown lengthening surgery ( in operation ) crown lengthening surgery ( post operation ) two month after the periodontal crown lengthening surgery for the proper wound healing process , prosthodontic restoration was performed . \n after fibre post and resin core ( tenax fiber white , coltene whaledent inc . ) had been built up [ figure 7 ] , an accurately fitting provisional crown was fabricated and cemented . \n tooth preparation and silicon rubber impression were made , and all - ceramic crown was fabricated by lava ( 3 m espe ) . \n colour - selection was performed using a new crystaleye spectrophotometer ( olympus , japan ) . \n after transferring the colour - selection picture to computer , dentist discussed the shape and shade of final restoration with the patient and finally decided to reproduce the colour by simulating the right maxillary central incisor . \n one year follow - up evaluation indicated the restoration and gingival profile were healthy and stable without relapse . \n root canal therapy was performed for left maxillary central incisor and the periapical radiography after rct was satisfied [ figure 3 ] . \n periapical radiography after root canal treatment completed full mouth periodontal prophylaxis cleaning and initial periodontal therapy were done before orthodontic extrusion . \n a 0.8 mm stainless steel ( ss ) wire was cemented into the root canal space for the retention of orthodontic arch wire . \n the standard edge wise brackets were bonded on maxillary teeth and 0.018 0.025 inch nickel - titanium ( niti ) full arch wire ( tp orthodontics . \n a 0.2 - 0.3 n levelling and alignment extrusion force was applied , readjusted every 2 weeks . \n after 9 weeks engagement , 2 mm tooth structure was occlusally elevated with the simultaneous elevation of the surrounding periodontal bone tissue [ figure 4 ] . \n after 4-month retention to prevent relapse,123 the crown lengthening surgery including gingival flap operation , alveoloplasty and gingivoplasty were performed to create an optimal relation between the gingival and margin of restoration . during the operation , \n the necessary clinical crown and suitable gingiva anatomy were reserved [ figures 5 and 6 ] . \n two month after the periodontal crown lengthening surgery for the proper wound healing process , prosthodontic restoration was performed . after fibre post and resin core ( tenax fiber white , coltene whaledent inc . ) \n had been built up [ figure 7 ] , an accurately fitting provisional crown was fabricated and cemented . \n tooth preparation and silicon rubber impression were made , and all - ceramic crown was fabricated by lava ( 3 m espe ) . \n colour - selection was performed using a new crystaleye spectrophotometer ( olympus , japan ) . after transferring the colour - selection picture to computer , \n dentist discussed the shape and shade of final restoration with the patient and finally decided to reproduce the colour by simulating the right maxillary central incisor . \n one year follow - up evaluation indicated the restoration and gingival profile were healthy and stable without relapse . \n restoration of subgingival crown root fracture teeth is always a clinical challenge for the restorative dentist . \n prosthodontic treatment alone or when combined with crown lengthening procedure will have the potential problems such as discontinuous gingival margin , gingival irritation and crown root ratio imbalance , etc . \n , thus compromising the periodontal health and cosmetic profiles , especially at anterior aesthetic zone . orthodontic extrusion is recommended when existing clinical crown height can not permit the placement of a crown ferrule.45 it has been demonstrated in experimental and clinical studies that levels of gingival attachment and bone will follow the extrusive movement for single teeth.126 so , we combined orthodontic extrusion with crown lengthening surgery to obtain an optimal gingival margin of restoration between the fractured tooth and adjacent teeth . \n orthodontic extrusion procedure to elevate cervical fractured tooth for restoration was introduced by heithersey in 1973.7 only light forces are permissible when considering orthodontic extrusive movements.16 if the level of fracture does not invade the biological width and the residual tooth structure allows an adequate ferrule , it is possible to reconstruct the tooth and to prepare a viable prosthesis while maintaining an equilibrium between dental and periodontal structures.89 if the apical extent of the line of fracture involves the biologic width , no matter it is above or below the ridge , restorative therapy will not be feasible unless the remaining tooth structure has been exposed beyond the gingival margins . \n this exposure allows the tooth to be restored , provided that the health and stability of the gingival margin have been re - established with a proper biologic width.10 what 's more , crystaleye spectrophotometer was employed for colour selection procedure . as we know , colour selection is one of the most difficult parts in single anterior tooth restoration to achieve harmony to adjacent teeth . \n second , it could record and reproduce the tooth colour accurately , which made it possible for the dentist to communicate with the patient on the computer and decide the colour of different parts of the tooth , including the cervical part , middle part and incisal part of the tooth . in a word , \n the combination of endodontic , orthodontic , periodontal and prosthodontic disciplines is a satisfied and promising way to restore the crown - root - fractured tooth and the computer - based spectrophotometer plays an important role in the colour - selection procedure .", "role": "user" }, { "content": "restoration of a crown - root subgingival fractured tooth , especially at anterior aesthetic zones is still a great challenge for restorative dentists . \n crown lengthening procedure alone has the disadvantage of high gingival curve of the final restoration , which was not discontinuous to adjacent teeth and thus compromise cosmetic outcomes . the objective of this report is to display a new interdisciplinary approach which combining endodontic root canal treatment , orthodontic extrusion , periodontal crown lengthening surgery and prosthodontic post - core - crown restoration procedures to restore a crown - root subgingival fractured maxillary central incisor and achieved a satisfied cosmetic result . \n computer - based spectrophotometer was also used to accurately select colour without objective interference to achieve ideal cosmetic effects .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: injection of midazolam ( mdz ) , diazepam ( dz ) , or flunitrazepam ( fz ) , the rectification index ( ri = epsc65 mv / epsc+35 mv ) was significantly higher than in slices from saline - injected controls ( fig . \n similar rectification was measured after an injection of morphine ( mor ) , a member of the class of drugs that cause disinhibition of da neurons8 . \n the bdz antagonist flumazenil ( flu ) blocked rectification when co - injected with mdz but was without effect when co - injected with a control saline solution ( fig . 2 and supplementary fig . \n the adaptive plasticity induced by systemic bdzs was also observed 24 h after local application of mdz into the vta by stereotactic injection ( 0.5 l of a 8 mg / ml solution over 10 minutes ; fig . \n thus , bdz - dependent effects on vta circuitry are sufficient to induce this cellular hallmark of addictive drugs . \n bdzs bind to gabaars at the interface between and subunits9 in a subunit - dependent manner . \n gaba neurons in many parts of the brain express the 1 subunit isoform10 , while midbrain da neurons lack 1 but express 2 , 3 , and 4 subunit isoforms11 . \n thus , the addictive potential of bdzs might rely on the potentiation of 1-containing gabaars , which would selectively inhibit gaba neurons and lead to disinhibition of da neurons . to test this idea \n , we examined whether mdz ( i.e. a rapidly acting , non - selective bdz with a very strong brain uptake12 ) has an effect in mice with a point mutation ( h101r ) in the 1 subunit that disrupts the bdz binding site13 . in 1(h101r ) mice , mdz no longer had an effect on the ri of ampar epscs in da neurons ( fig . \n this was not due to a general loss of adaptive plasticity , as morphine still caused a strong rectification . \n stereotactic injections of mdz into the vta also failed to elicit rectifying ampar - mediated epscs in 1(h101r ) mice ( fig . \n furthermore , mdz increased the ampa / nmda ratio , while control injections of acsf were without effect in either genotype ( supplementary fig . \n zolpidem ( zol ) is a non - classical bdzs selective for 1-containing gabaars14 while the experimental compound l-838 417 does not modulate receptors that contain 115 . \n we therefore tested whether zol and l-838 417 could evoke synaptic plasticity in da neurons . \n we found that a single injection of zol led to rectifying ampar - mediated epscs , while l-838 417 did not affect the iv - curve ( fig . \n , we conclude that bdz - evoked synaptic plasticity depends on 1-containing gabaars within the vta . \n to identify 1-expressing cells in the vta , we next carried out immunohistochemical staining for tyrosine hydroxylase ( th ) and the 1 subunit isoform in gad-67 gfp mice ( fig . \n these experiments confirmed that 1 was expressed mainly in gfp - positive neurons , but not in th - positive da neurons . \n quantifications revealed that 81% of the gaba neurons contained the 1 subunit isoform , while this was the case only in 7% of the da neurons ( inset fig . \n we also observed 1-staining that could neither be associated to th - positive nor gad67-gfp - expressing cells . \n this may reflect the pool of the so - called tertiary cells that are neither da- nor gaba - neurons16,17 or be due to detectability limits in fine processes . to assess the functional consequences of this cell type - specific isoform expression for inhibitory transmission , we characterized miniature inhibitory postsynaptic currents ( mipscs ) in the presence of the glutamate receptor blocker kynurenic acid to isolate gabaar - mediated currents ( fig . \n 3b , c ) . on average mipscs in gaba neurons were slower and bigger than those in da neurons , leading to a significantly larger charge transfer in the former ( fig . \n this difference was of similar magnitude in wt and 1(h101r ) mice ( supplementary fig . \n 4 ) , in line with previous reports13 that baseline transmission in mutant mice is normal . moreover , the frequency of mipscs as well as the multiplicity factor ( see methods for detailed description , supplementary fig . \n although this approach has its limitations18 , it suggests that the numbers of inhibitory synapses are in the same range in the two cell types . to further confirm that synapses on gaba neurons express 1-containing gabaars , we tested for effects of mdz on charge transfer and frequency of mipscs in wt and 1(h101r ) mice . in da neurons , \n in gaba neurons , mdz increased the charge transfer and decreased mipsc frequency in slices from wt mice , but was without effect on mipscs recorded in slices from 1(h101r ) mice ( fig . \n 5a ) . as expected , mdz had no effect on mipsc amplitude in either cell type or genotype19 ( supplementary fig . \n the observation that the mipsc frequency is reduced by bdzs except in gaba neurons of 1(h101 ) mice is surprising at first , but could reflect presynaptic gabaars . \n in fact such receptors have been described in the vta , which , upon activation reduce the release probability20 . since da neurons express a set of many subunits11 the identification of the molecular composition of the gabaar is difficult . \n importantly the majority of gaba neurons do not express the 3 subunit isoform ( 70% ) even though significant heterogeneity was observed . \n in heterologous expressed systems , currents of 1-containing receptors are smaller than those of 3-containing ones21 . \n this however does not apply to da neurons in the vta since in 3 ko mice currents are reduced only by 50%22 . \n our results establish that in 1(h101r ) mice endogenous gabaa - mediated synaptic transmission is normal , while the positive modulation of mdz was abolished in gaba neurons , because the 1 subunit isoform is selectively expressed in these cells . \n in wt mice , mipscs in both gaba and da neurons were enhanced by bdzs . however , when bdzs are administered whilst transmission is intact , the extent of current amplification in da neurons depends on the frequency of synaptic events , which originate in the interneurons upstream . \n we therefore monitored the effect of mdz on spike - driven , spontaneous ipscs ( sipsc ) in da neurons ( fig . \n although , the charge transfer of sipscs on average increased after mdz ( in line with the mipsc data ) , there was a strong reduction of the frequency of spike - driven events in da neurons ( supplementary fig . 7 ) . \n as a result , when we integrated the charge transfer of sipscs over time before and after application of mdz ( relative total current ) , we found a significant decrease ( fig . \n 4b ) . because interneurons are efficiently inhibited by mdz , fewer spikes are generated , strongly decreasing the number of sipsc , an effect that predominates over the mdz amplification of the individual event . in 1(h101r ) mice , in contrast , we observed an increased total current in da neurons because the gaba neurons were insensitive to mdz . in summary , \n in the wt mice , mdz led to a net decrease of the total inhibitory current in da neurons , which could be sufficient to cause their disinhibition ( see supplementary fig . 1 for schematics ) . \n we therefore tested the effect of mdz on the firing rate of da neurons in the vta by performing extracellular single unit recordings in vivo . \n when the drug was injected into the tail vein of wt mice , we recorded a significant increase of the firing rate that was reversed by flu ( fig . \n in stark contrast , no such disinhibition could be observed in 1(h101r ) mice ( fig . \n in line with a disinhibition scenario , the data in the da neurons were mirrored by the observations in gaba neurons . \n mdz caused an inhibition of the spontaneous firing rates , at times leading to complete spike suppression ( fig . \n 5c , f , g ) . in 1(h101r ) mice mdz did not significantly affect firing in gaba neurons ( fig . \n the specificity of these findings are further demonstrated by the observation that , in mice where a different subunit isoform had been mutated ( 3(h126r ) mice)23 , mdz caused an increase in the firing rate of da neurons comparable to wt mice ( supplementary fig . \n the magnitude of increase in the firing rate was inversely related to the basal firing rate , which further suggests a disinhibition scenario ( fig . \n 5e ) . moreover , in 1(h101r ) mice disinhibition of da neurons was observed with mor , an effect that was also inversely correlated to the basal firing rate ( fig . \n although anesthesia may modify the overall distribution of firing rates and therefore the magnitude of the disinhibition , the mean basal firing rates observed here were comparable to values recorded in freely moving animals24,25 . \n the results above demonstrate that 1-containing gabaar mediate the increase of mesolimbic da in response to bdzs . furthermore da antagonists can reduce self - administration of and preference to these drugs26,27 . \n we therefore tested the impact of the 1 subunit isoform on oral self - administration of mdz , by offering the mice a free choice of two drinking solutions ( fig . \n finally , mdz was added to one of the two bottles . during the test period with mdz , \n a preference for the mdz solution developed rapidly in wt mice , but not 1(h101r ) mice ( fig . \n wt mice drank between 0.8 - 1.1 mg / kg/24h of mdz , which corresponds to a pharmacological dose . \n first , we offered 1(h101r ) mice a choice between water and a sucrose solution . \n both wt and mutant mice developed a strong preference for sucrose , indicating that 1(h101r ) mice are not generally deficient in reward reinforcement ( supplementary fig . \n we also tested whether 3(h126r ) mice , where mdz caused a normal disinhibition of da neurons ( supplementary fig . \n 8) would develop a preference for mdz , which was indeed the case ( supplementary fig . \n although bdzs , particularly mdz , may enhance taste perception28 , this is unlikely to influence the interpretation of these data , as several studies have shown that bdz - mediated taste enhancement is independent of 1-containing gabaar29,30 . \n based on our data , we propose that bdzs increase da levels through disinhibition , similar to opioids , cannabinoids , and ghb . \n this disinhibition is dependent on the bdz binding site on 1-containing gabaars in the vta . \n the net effect of bdzs on the vta circuit is dominated by the role of 1-containing gabaars , which is supported by the following three observations . \n first , gabaars mediated quantal transmission is stronger in gaba neurons than in da neurons , as evidenced by the larger charge transfer of mipscs ( fig . \n 3d ) . second , gaba neurons have a higher input resistance than da neurons17 , allowing the same charge transfer to more effectively change the membrane potential of gaba neurons than da neurons . \n finally , the bdz - dependent enhancement of each ipsc on da neurons causes little inhibition of da neuron activity because gaba neurons fall silent and no longer generate those ipscs . \n our model could also apply to earlier work probing the effect of the gabaar agonist muscimol31 . when administered directly into the vta \n this effect only occurs at low doses , which led to the conclusion that the effect is mediated indirectly on non - da neurons33,34 . \n this inverse dose - dependence may be due to the fact that muscimol , unlike bdzs , is not a positive modulator but an agonist . in line with this interpretation , muscimol at high concentrations in fact \n the implication of 1 in the addictive effect of bdzs is surprising since the clinically available compound zol is selective for this subunit and has been claimed to carry a low risk for addiction36 . \n however this optimistic view contrasts with the observation that zol is readily self - administered37 and the clinical reality . \n our data with the subunit isoform - selective compounds also show that zol triggers drug - evoked plasticity and suggest that 1-sparing compounds may be promising candidates in the search for bdzs devoid of addiction liability . since 1-containing gabaa receptors outside the vta mediate additional effects such as seizure control , sedation and anterograde amnesia38 , 1-sparing compounds will certainly not be suitable for all indications . \n the dissociation between anxiolysis , mainly 2-mediated23 , and addiction however seems possible in principle . \n this is particularly appealing since high anxiety levels suggest increased vulnerability for addiction39 . in conclusion , \n our work unravels the molecular basis of the defining pharmacological features that bdzs share with addictive drugs , which we believe will be key for designing new bdzs with lower addiction liability . \n however , we note that increased levels of mesolimbic dopamine are necessary for addiction , but not sufficient on their own . \n recent studies suggest that early drug - evoked plasticity in the vta may facilitate addiction by gating more enduring forms of adaptations in target regions of the mesolimbic system , which would represent the eventual locus underlying long - term addictive behaviors40,41 . coinciding factors of vulnerability , \n either in the initial events in the vta or subsequent events in mesolimbic targets , may ultimately explain individual variations in susceptibility to addiction , both for bdzs and for other drugs42 . \n horizontal slices of the midbrain ( 250 m ) were prepared as previously described43 from c57bl/6 mice , pitx3-gfp knock - in mice44 , gad67-gfp neo mice45 and 1(h101r ) knock - in mice13 24 h after i.p . or intra - vta ( ml 0.8 , ap -2.4 , dv -4.4 mm from bregma ) injections of different bdzs . \n mipscs were recorded in presence of kynurenic acid ( 2 mm ) and tetrodotoxin ( ttx , 500 nm ) . in vivo extracellular single unit recordings of da neurons in the vta ( ml : -1.2 , ap : -3.2 , dv -4 to 4.5 mm from the bregma ) were carried out in wt , 1(h101r ) and 3(h126r)23 knock - in mice . \n immunofluorescence with a guinea pig antibody against the 1 or 3 subunit , a mouse antibody against th , and a rabbit antibody against egfp was performed as previously described10 in gad67-gfp neo mice . for the oral self - administration of mdz \n , mice were housed with free access to two bottles containing either mdz in sucrose or sucrose alone . \n the one - way anova , bonferroni matched or the paired student 's t - tests were used . \n the levels of significance are indicated as follows : * p<0.05 , * * p<0.01 , * * * p<0.001 . \n ", "role": "user" }, { "content": "benzodiazepines are widely used in clinics and for recreational purposes , but will lead to addiction in vulnerable individuals . \n addictive drugs increase the levels of dopamine and also trigger long - lasting synaptic adaptations in the mesolimbic reward system that ultimately may induce the pathological behavior . \n the neural basis for the addictive nature of benzodiazepines however remains elusive . \n here we show that benzodiazepines increase firing of dopamine neurons of the ventral tegmental area through the positive modulation of gabaa receptors in nearby interneurons . \n such disinhibition , which relies on 1-containing gabaars expressed in these cells , triggers drug - evoked synaptic plasticity in excitatory afferents onto dopamine neurons and underlies drug reinforcement . \n taken together , our data provide evidence that benzodiazepines share defining pharmacological features of addictive drugs through cell type - specific expression of 1-containing gabaars in the ventral tegmental area . \n the data also suggest that subunitselective benzodiazepines sparing 1 may be devoid of addiction liability .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: karzinoide to describe a carcinoma - like small bowel tumor that behaved in a benign fashion . \n carcinoid represents a diverse group of neoplasms that arise from various neuroendocrine cell types and are characterized by variable biologic aggressiveness . \n carcinoid tumors of the thymus , ovaries , testes , heart and middle ear have also been reported . \n gastrointestinal carcinoids can secrete bioactive amines and peptides , including serotonin , 5-hydroxytryptophan , gastrin , calcitonin , somatostatin and glucagon . \n a common secretory product for all types of carcinoid tumors is the glycoprotein chromogranin a ( cga ) , the most important general tumor marker in these patients . \n sporadic foregut tumors often display allelic losses at chromosome 11q13 , and somatic men1 gene mutations have been reported in one third of sporadic foregut tumors . \n gene expression arrays for carcinoid tumors have demonstrated upregulation of the ret proto - oncogene , but no such mutations have been detected . \n the annual incidence of duodenal carcinoids is 0.07/100,000 . it is higher in males than in females and higher in blacks than in whites \n gastrin cell tumors represent the most frequent histopathologic type , accounting for 5060% of all duodenal carcinoids . \n they can be nonfunctioning or functioning as in zollinger - ellison syndrome ( zes ) and may be associated with the men1 syndrome . \n duodenal carcinoids are usually diagnosed on upper endoscopies performed for symptoms such as abdominal pain , upper gastrointestinal bleeding and anemia . \n a few patients with duodenal carcinoids ( < 10% ) present with symptoms and/or signs of hormone overproduction . \n carcinoid syndrome may occur in 4% , and in rare cases cushing syndrome and acromegaly may be seen . \n morphologically , gastrin tumor cells , which are the most common type , are uniform with rounded nuclei and abundant cytoplasm . \n most of the tumor cells are positive for neuroendocrine markers such as cga , synaptophysin , leu7 and neuron - specific enolase . \n well - differentiated , nonfunctioning duodenal carcinoids with no evidence of invasion of the muscularis layer and 1 cm or less in size can be endoscopically removed . \n here we present the case of a woman with a 1 cm duodenal carcinoid that was removed by emr . \n a 43-year - old woman of hispanic origin was referred to the gastroenterology clinic for evaluation of anemia . \n she complained of occasional upper abdominal pain , burning in nature , 7/10 in intensity , intermittent , nonradiating , worse with food , but no relieving factors . \n the patient denied any nausea , vomiting , fever , chills , changes in bowel habits , dysphagia , odynophagia , hematochezia , melena or weight loss . \n her past medical history was significant for hypertension and peptic ulcer disease with an upper endoscopy 1 year before revealing a gastric ulcer . \n she denied any history of surgeries or use of nsaids , tobacco , alcohol or illicit drugs . \n the abdomen was soft , nontender , nondistended , with no organomegaly and with normoactive bowel sounds . \n there were no icterus , cyanosis , clubbing , rash , joint swelling or deformities noted . \n complete blood count showed hemoglobin and hematocrit to be 7.4 g / dl and 23.9% , with a mcv of 63 fl and a rdw of 18.5% . \n iron panel showed evidence of iron deficiency anemia with iron 18 g / dl , total iron binding capacity 482 g / dl , ferritin 7 ng / ml and transferrin saturation 4% . \n upper endoscopy revealed a duodenal bulb mass with heaped - up edges ( fig . 1 ) and a small healing ulcer at the prepyloric area with heaped - up mucosa . \n histopathologic examination of the duodenal bulb mass biopsy was suggestive of a duodenal carcinoid tumor with a solid and trabecular pattern and no necrosis . \n immunohistochemistry staining was positive for both chromogranin and synaptophysin , confirming the diagnosis of a carcinoid tumor . \n ct of the abdomen and pelvis showed evidence of fatty liver but was otherwise normal . \n octreotide scan showed a prominent focal area of increased radiotracer uptake in the proximal duodenum correlating with the area of biopsy . \n examination with a 20 mhz high - resolution endoscopic ultrasound ( eus ) probe revealed the duodenal bulb mass to be confined to the mucosa . \n multiple clips were used to close the mucosal defect and prevent delayed bleeding ( fig . \n six - monthly surveillance eus revealed no evidence of new lesions or adjacent lymphadenopathy suggestive of any recurrence . \n repeat octreoscan failed to show the increased radiotracer uptake in the duodenal bulb seen earlier . \n to date eight different neuroendocrine cell types have been identified ultrastructurally : ecl- , ec- , g- , d- , d1- , a- , p- and x- . \n each cell type has characteristic neurosecretory granules , some with identified secretory products : enterochromaffin cells ( ec ) secrete serotonin , ec like cells ( ecl ) secrete histamine , a- cells secrete glucagon , d- cells secrete somatostatin , and g- cells secrete gastrin . \n they are identified histologically by their affinity for silver salts and by their positive reactions to neuroendocrine markers such as neuron - specific enolase , synaptophysin and chromogranin . \n the who classification of gastrointestinal endocrine tumors recognizes four main tumor categories : ( 1 ) well - differentiated endocrine tumor ( wdet , carcinoid ) , ( 2 ) well - differentiated endocrine carcinoma ( wdec , malignant carcinoid ) , ( 3 ) poorly differentiated endocrine ( small cell ) carcinoma ( pdec ) , and ( 4 ) mixed exocrine - endocrine tumors . \n the latest figures from the us surveillance epidemiology and end results ( seer ) register show that the number of neuroendocrine tumors of the small intestine has increased by 300500% in the past 35 years [ 4 , 5 ] . \n other risk factors for small intestinal carcinoids include alcohol , female gender , and positive family history . \n small intestinal carcinoids also occur with an increased frequency in a few inherited syndromes such as men1 . \n ( 1 ) gastrinomas ( type i ) are most common and are usually seen in the proximal duodenum . \n ( 2 ) second in frequency are somatostatinomas ( type ii ) , which often have a periampullary location . \n ( 3 ) gangliocytic paragangliomas ( type iii ) are benign tumors found at the ampulla or in the periampullary region . \n ( 4 ) type iv is rare and contains tumors that produce serotonin and calcitonin . \n ( 5 ) pdec ( type v ) is extremely rare and highly malignant and is usually located at the ampulla of vater . \n burke et al . reported 99 cases of duodenal carcinoid tumors , consisting of 59 men and 40 women with an average of 59 years . \n with regard to the lesion site , the duodenal bulb accounted for 43% of cases while 52% were found in the second portion of the duodenum . \n regarding invasion depth , 49% showed submucosal lesions and 51% invasion of the muscularis mucosa . \n most duodenal carcinoids are asymptomatic and detected during upper gastrointestinal endoscopy for unrelated symptoms such as abdominal pain ( 37% ) , upper gastrointestinal bleeding ( 21% ) , anemia ( 21% ) and jaundice ( 18% ) . \n in contrast , ampullary carcinoids more frequently cause symptoms with up to 60% presenting with jaundice . \n . however some may develop zes ( up to 10% ) or cushing syndrome ( 4% ) , and rarely patients have a duodenal neuroendocrine tumor that is an insulinoma or a glucagonoma or even a growth hormone factor - releasing tumor that manifests as acromegaly . \n very few patients develop carcinoid syndrome characterized by diarrhea , flushing , carcinoid heart disease , bronchial constriction and abdominal pain . a life - threatening exacerbation of carcinoid syndrome called carcinoid crisis can be triggered by anesthesia , drugs or surgery . \n eus should follow and allows the determination of the size and depth of infiltration and also assesses locoregional lymph nodes . \n serum and urine neuroendocrine markers ( such as cga and 5-hiaa ) may have diagnostic value . \n cga may also have prognostic significance and can be used during the follow - up of patients . \n serum gastrin should also be determined , and if elevated in combination with a hyperacidic stomach a secretin stimulation test should be done to establish zes . conventional imaging methods ( ct , mri ) \n burke et al . identified three pathologic features for the primary tumor as independent risk factors for metastasis : invasion of the muscularis propria , size > 2 cm and presence of mitotic figures . \n a large variety of carcinoid tumors and their metastases can express a high density of specific somatostatin receptors for which octreotide , a somatostatin analogue , has high affinity . \n octreoscan ( using in - labeled octreotide ) not only helps in detection , but also predicts therapeutic effect of somatostatin analogues in these tumors . \n ga - dotatoc - pet / ct is a new , very sensitive method for visualizing metastatic intestinal carcinoids [ 5 , 10 ] . due to frequent carcinoid heart disease ( 3060% of patients with carcinoid syndrome ) \n a tnm staging of foregut neuroendocrine tumors was recently approved by the european neuroendocrine tumor society ( table 1 ) . \n tumors limited to the lamina propria or submucosa and < 1 cm are assigned tx through t1 . \n multiple factors such as differentiation , tumor localization , tumor stage and patient - related factors must be taken into account when considering treatment options . \n endoscopic resection has been reported to be a safe , less invasive and effective procedure for tumors measuring < 1 cm in diameter that are located outside the periampullary region , with no eus signs of invasion of the muscularis layer . \n some authors suggest that for tumors 12 cm in diameter , operative full - thickness excision is preferred \n . however there has been a case report of a 12 mm duodenal carcinoid tumor that was removed via emr . \n nonetheless it may be difficult to remove completely endoscopically tumors > 1 cm , and they should be evaluated with eus before an attempt at endoscopic resection owing to their potential for invasion beyond the submucosa . \n endoscopic excision of a primary duodenal carcinoid tumor seems most appropriate for tumors 1 cm . \n endoscopic papillectomy and surgical tumor resection can be curative in early disease whereas patients with ampullary carcinoids > 2 cm may benefit from whipple procedure . \n ", "role": "user" }, { "content": "carcinoids are rare , slow - growing tumors originating from a variety of different neuroendocrine cell types . \n they are identified histologically by their affinity for silver salts and by positive reactions to neuroendocrine markers such as neuron - specific enolase , synaptophysin and chromogranin . \n they can present with various clinical symptoms and are difficult to diagnose . \n we present the case of a 43-year - old woman who was referred for evaluation of anemia . \n upper endoscopy showed a duodenal bulb mass around 1 cm in size . \n histopathological and immunohistochemistry staining were consistent with the diagnosis of a carcinoid tumor . \n further imaging and endoscopic studies showed no other synchronous carcinoid lesions . \n endoscopic ultrasound ( eus ) revealed a 1 cm lesion confined to the mucosa and no local lymphadenopathy . \n successful endoscopic mucosal resection of the mass was performed . \n follow - up surveillance 6 months later with eus and octreoscan revealed no new lesions suggestive of recurrence . \n no consensus guidelines exist for the endoscopic management of duodenal carcinoid tumors . however , endoscopic resection is safe and preferred for tumors measuring 1 cm or less with no evidence of invasion of the muscularis layer .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: humans are usually accidental hosts of these 2 mm long flies ; natural hosts include a variety of rodents , small mammals , and dogs . \n the disease is geographically and ecologically widespread , occurring in tropical and subtropical regions on all continents except australia ( 1 ) . a patient with leishmaniasis \n may be presented with one of three quite distinct clinical syndromes : visceral , cutaneous , or mucosal . \n disease progression is dependent on both the species of leishmania involved and the genetics and immune status of the host ( 2 ) . \n cutaneous leishmaniasis ( cl ) is defined as a skin ulcer at the site of the sandfly bite and generally heals spontaneously with a scar within 3 to 6 months ( 1 , 3 ) . \n cutaneous leishmaniasis requires treatment only when the lesions are large , multiple , disfiguring , or over a joint ( 3 ) . \n it needs multiple injections , are painful , not tolerated by most of the patients ; moreover , they are not always effective and resistance is reported too ( 4 , 5 ) . the world health organization / tropical disease research program emphasizes on the development of alternative treatments for cl . paromomycin sulfate ( pms ) , a very hydrophilic antibiotic , is an aminoglycoside antibiotic produced by streptomyces rimosus . \n the pms was reported to show anti - leishmania activity in the 1960s and since then promising results were seen in clinical trials against both cl and vl ( 6 - 8 ) . \n recently , the parental formulation of pms has been approved for the treatment of vl . nevertheless , systemic use of pms might cause nephrotoxicity , thus introducing a topical form could be advantageous . \n although the topical approach for the treatment of cl is attractive , there are some aspects that make the treatment more difficult , the most important one is that leishmania amastigotes lie deep in the dermal layer making penetration and achieving local therapeutic concentration difficult ( 9 ) . \n pms in the conventional ointment and cream bases is not that effective because of its relatively large molecular size ( c23h45n5o14 . \n h2so4 , mw = 713.71 ) , high water - solubility , and oligosaccharide nature , which can not penetrate through the stratum corneum of the skin . \n topically applied agents must be able to pass through the stratum corneum to be active against parasites inside the macrophages which lie deep in the dermal layer of skin and multiplied within the phagolysosome of the macrophage with a ph of 4.5 to 5.0 ( 7 , 10 ) . \n it is well known that macrophages internalize particulate carriers by the process of endocytosis and may act as a secondary drug depot , thus helping the localized delivery of the drug at the infected site ( 11 ) . \n this property of liposome is an advantage in the treatment of intracellular infections involving this type of cells . \n ( 12 ) investigated the antileishmanial effects of topical liposomal pms major - infected balb / c mice . \n they treated the lesions topically with 50 mg formulation twice a day for 4 weeks and reported that every mouse treated with liposomal pms was completely cured at the end of the treatment , and no relapse was seen 4 weeks after the treatment . \n the spleen parasite burden was significantly lower in mice treated with liposomal pms than in mice treated with pbs or control empty liposomes ( p < 0.001 ) . the treatment may have had an effect on the overall course of the infection and might be the reason for the lower parasite burdens in the spleens of lpmf - treated mice . \n furthermore , since some of these pms liposomes are very small , they can act as transdermal vehicles and pass from the epidermis intact and reach the bloodstream in the dermis . when liposomes are in the blood , spleen macrophages and kupffer cells in the liver are the main cells that phagocytize the liposomal particles . \n this study aimed to evaluate probable nephrotoxicity and hepatotoxicity of topically administered pms liposomes ( same formulation tested in jaafari et al . study ) . \n male wistar rats ( 6 - 7 weeks old ) were purchased from the center of animals maintenance and reproduction of ahvaz jundishapur university of medical sciences ( ajums ) . \n they were housed in animal house of the school of pharmacy in the well ventilated room , temperature of 21c , 12 hours natural light and 12 hours darkness , with free access to tap water and dry rat pellet . \n the animal experiments were carried out according to ethics committee acts of the ajums . \n soybean phosphatidylcholine ( spc ) was obtained from avanti polar lipids ( alabaster , al ) . \n pm , propylparaben ( pp ) , methylparaben ( mp ) , cholesterol , and hepes ( 4-(2-hydroxyethyl ) piperazine-1-ethanesulfonic acid or n-(2-hydroxyethyl ) piperazine - n'-(2-ethanesulfonic acid ) were purchased from sigma . \n liposomes containing pm were prepared by the fusion method . in brief , the lipid components consisted of spc ( 15% ) , cholesterol ( 2% ) , propylene glycol ( 7% ) , vitamin e ( 0 . \n 1% ) , and pp ( 0.02% ) ; these components were melted at about 75c ( lipid melts ) . \n hepes buffer ( 10 mm , ph = 7.0 ) and pms ( 10% ) were heated separately and added up to 100% to the previously heated melted lipids , and the mixture was vigorously vortexed and allowed to cool down at room temperature . \n the final products were then homogenized with a homogenizer ( ultra - turrax ika t50 ; ika werke gmbh & co. kg , staufen , germany ) for 5 min at 5,000 rpm . \n the same procedure was used for the preparation of control empty liposomes , except that pms portion was omitted ( 12 ) . from the formulated sample , \n 50 l twice a day were topically administered to 9 groups of rats consisting of 6 rats in each group that were studied in 3 time periods of 10 , 20 , and 30 days . \n group a as the control group , did not receive any medication ; group b received nanoliposome without paromomycin sulfate and group c received nanoliposomal formulations containing paromomycin sulfate . at the end of the experiment , \n the rats were weighed and blood samples collected through a carotid vein under ether anesthesia . \n the blood sample was allowed to clot , and serum was separated and used to determine the enzyme activities such as glutamate oxaloacetate transaminase ( sgot ) , glutamate pyruvic transaminase ( sgpt ) , alkaline phosphatase ( alt ) , bun , and creatinine . \n after blood collection , kidney and liver were removed from the body for histopathology examination . \n the results of liver function and kidney were calculated as mean and standard error of the mean ( mean sem ) ; differences between groups were tested using analysis of variance ( anova ) followed by the test method . \n furthermore , tukey post hoc was performed , and the data analysis method was used to test tukey . \n male wistar rats ( 6 - 7 weeks old ) were purchased from the center of animals maintenance and reproduction of ahvaz jundishapur university of medical sciences ( ajums ) . \n they were housed in animal house of the school of pharmacy in the well ventilated room , temperature of 21c , 12 hours natural light and 12 hours darkness , with free access to tap water and dry rat pellet . \n soybean phosphatidylcholine ( spc ) was obtained from avanti polar lipids ( alabaster , al ) . \n pm , propylparaben ( pp ) , methylparaben ( mp ) , cholesterol , and hepes ( 4-(2-hydroxyethyl ) piperazine-1-ethanesulfonic acid or n-(2-hydroxyethyl ) piperazine - n'-(2-ethanesulfonic acid ) were purchased from sigma . \n liposomes containing pm were prepared by the fusion method . in brief , the lipid components consisted of spc ( 15% ) , cholesterol ( 2% ) , propylene glycol ( 7% ) , vitamin e ( 0 . \n 1% ) , and pp ( 0.02% ) ; these components were melted at about 75c ( lipid melts ) . \n hepes buffer ( 10 mm , ph = 7.0 ) and pms ( 10% ) were heated separately and added up to 100% to the previously heated melted lipids , and the mixture was vigorously vortexed and allowed to cool down at room temperature . \n the final products were then homogenized with a homogenizer ( ultra - turrax ika t50 ; ika werke gmbh & co. kg , staufen , germany ) for 5 min at 5,000 rpm . \n the same procedure was used for the preparation of control empty liposomes , except that pms portion was omitted ( 12 ) . \n from the formulated sample , 50 l twice a day were topically administered to 9 groups of rats consisting of 6 rats in each group that were studied in 3 time periods of 10 , 20 , and 30 days . \n group a as the control group , did not receive any medication ; group b received nanoliposome without paromomycin sulfate and group c received nanoliposomal formulations containing paromomycin sulfate . at the end of the experiment , \n the rats were weighed and blood samples collected through a carotid vein under ether anesthesia . \n the blood sample was allowed to clot , and serum was separated and used to determine the enzyme activities such as glutamate oxaloacetate transaminase ( sgot ) , glutamate pyruvic transaminase ( sgpt ) , alkaline phosphatase ( alt ) , bun , and creatinine . \n after blood collection , kidney and liver were removed from the body for histopathology examination . \n the results of liver function and kidney were calculated as mean and standard error of the mean ( mean sem ) ; differences between groups were tested using analysis of variance ( anova ) followed by the test method . \n furthermore , tukey post hoc was performed , and the data analysis method was used to test tukey . \n the results of the liver tests showed that the groups receiving liposomal formulations containing paromomycin sulfate during three periods of 10 , 20 , 30 days compared with the control , and negative control groups , no significant difference was seen in the amount of alt ( figure 1 a ) , ast ( figure 1b ) , and alk ( figure 1 c ) . \n also , significant differences in the liver weight index ( figure 2 a ) were not observed in the study groups compared to the control and control positive groups . \n the results of kidney tests showed that there was no significant difference in the bun ( figure 3 a ) and serum creatinine ( figure 3 b ) between groups receiving topical application of liposomal formulations containing paromomycin sulfate ( examined of three periods 10 , 20 , 30 days ) and the control and control positive groups . \n also , no significant difference in the kidney weight index ( figure 2 b ) was observed in the study groups compared with the control and control negative groups . \n a , comparison of liver enzyme alt level in serum of control and negative control groups with positive group receiving pms during three periods of 10 , 20 , and 30 days in the rats . \n no significant difference was seen among the groups ( p > 0.05 ) ; b , comparison of liver enzyme ast level in serum of control and negative control groups with positive group receiving pms during three periods of 10 , 20 , and 30 days in the rats . \n no significant difference was seen among the groups ( p > 0.05 ) ; c , comparison of liver enzyme alk level in serum of control and negative control groups with positive group receiving pms in the during three periods of 10 , 20 , 30 days in the rats . \n a , comparison of liver index in control and negative control groups with positive group receiving pms during three periods of 10 , 20 , and 30 days in the rats . \n no significant difference was seen between groups ( p > 0.05 ) ; b , comparison of kidney index in control and negative control groups with positive group receiving pms during three periods of 10 , 20 , and 30 days in the rats . \n a , comparison of bun level in serum of control and negative control groups with positive group receiving pms during three periods times of 10 , 20 , and 30 days in the rats . \n no significant difference was seen between groups ( p > 0.05 ) ; b , comparison of cr level in serum of control and negative control groups and positive group receiving pms during three periods of 10 , 20 , and 30 days in the rats . \n nanoliposomal formulation containing paromomycin sulfate to assess potential effects on the liver and kidneys of rats after h&e staining : histopathological changes were evaluated in the rats ; kidney and liver in the positive control group were compared with control and negative control groups . \n livers of the animals in control and negative control groups , which were sacrificed after 10 , 20 and 30 days , showed a normal structure ( figures 1 - 4 ) . \n also , rats in the positive control group , which were euthanized in 10 and 20 days , had normal livers ( figures 5e and 5f ) . \n histopathological inspection of the positive control group that was euthanized after 30 days , revealed severe cell swelling in hepatocytes ( figure 5 g ) . \n vacant spaces in hepatocytes were diffused , and enlarged . a , control group ; b , negative control ( 10 days ) ; c , negative control ( 20 days ) ; d , negative control ( 30 days ) ; e , positive control ( 10 days ) ; f , positive control ( 20 days ) . \n note to the normal structure of liver ( figure 4 a - f ) and hepatocytes which are located around the central vein ( cv ) ; g , positive control ( 30 days ) . \n histopathological study of kidney in control and negative control groups showed a normal structure ( figures 5a - d ) . \n also , in the positive control group , the animals ' kidneys were sacrificed at 10 and 20 days , the kidneys ' structure was normal ( figures 5e and f ) . in 30-day group , \n mild tubular necrosis was seen ( figure 5 g ) . a , control group \n ; b , negative control ( 10 days ) ; c , negative control ( 20 days ) ; d , negative control ( 30 days ) ; e , positive control ( 10 days ) ; f , positive control ( 20 days ) . note to the normal structure of the kidney ( figures 5a - f ) ; g , positive control ( 30 days ) . \n the results of the liver tests showed that the groups receiving liposomal formulations containing paromomycin sulfate during three periods of 10 , 20 , 30 days compared with the control , and negative control groups , no significant difference was seen in the amount of alt ( figure 1 a ) , ast ( figure 1b ) , and alk ( figure 1 c ) . \n also , significant differences in the liver weight index ( figure 2 a ) were not observed in the study groups compared to the control and control positive groups . \n the results of kidney tests showed that there was no significant difference in the bun ( figure 3 a ) and serum creatinine ( figure 3 b ) between groups receiving topical application of liposomal formulations containing paromomycin sulfate ( examined of three periods 10 , 20 , 30 days ) and the control and control positive groups . \n also , no significant difference in the kidney weight index ( figure 2 b ) was observed in the study groups compared with the control and control negative groups . \n a , comparison of liver enzyme alt level in serum of control and negative control groups with positive group receiving pms during three periods of 10 , 20 , and 30 days in the rats . \n no significant difference was seen among the groups ( p > 0.05 ) ; b , comparison of liver enzyme ast level in serum of control and negative control groups with positive group receiving pms during three periods of 10 , 20 , and 30 days in the rats . \n no significant difference was seen among the groups ( p > 0.05 ) ; c , comparison of liver enzyme alk level in serum of control and negative control groups with positive group receiving pms in the during three periods of 10 , 20 , 30 days in the rats . \n a , comparison of liver index in control and negative control groups with positive group receiving pms during three periods of 10 , 20 , and 30 days in the rats . \n no significant difference was seen between groups ( p > 0.05 ) ; b , comparison of kidney index in control and negative control groups with positive group receiving pms during three periods of 10 , 20 , and 30 days in the rats . \n a , comparison of bun level in serum of control and negative control groups with positive group receiving pms during three periods times of 10 , 20 , and 30 days in the rats . \n no significant difference was seen between groups ( p > 0.05 ) ; b , comparison of cr level in serum of control and negative control groups and positive group receiving pms during three periods of 10 , 20 , and 30 days in the rats . \n nanoliposomal formulation containing paromomycin sulfate to assess potential effects on the liver and kidneys of rats after h&e staining : histopathological changes were evaluated in the rats ; kidney and liver in the positive control group were compared with control and negative control groups . \n livers of the animals in control and negative control groups , which were sacrificed after 10 , 20 and 30 days , showed a normal structure ( figures 1 - 4 ) . \n also , rats in the positive control group , which were euthanized in 10 and 20 days , had normal livers ( figures 5e and 5f ) . \n histopathological inspection of the positive control group that was euthanized after 30 days , revealed severe cell swelling in hepatocytes ( figure 5 g ) . \n vacant spaces in hepatocytes were diffused , and enlarged . a , control group ; b , negative control ( 10 days ) ; c , negative control ( 20 days ) ; d , negative control ( 30 days ) ; e , positive control ( 10 days ) ; f , positive control ( 20 days ) . \n note to the normal structure of liver ( figure 4 a - f ) and hepatocytes which are located around the central vein ( cv ) ; g , positive control ( 30 days ) . \n livers of the animals in control and negative control groups , which were sacrificed after 10 , 20 and 30 days , showed a normal structure ( figures 1 - 4 ) . \n also , rats in the positive control group , which were euthanized in 10 and 20 days , had normal livers ( figures 5e and 5f ) . \n histopathological inspection of the positive control group that was euthanized after 30 days , revealed severe cell swelling in hepatocytes ( figure 5 g ) . \n vacant spaces in hepatocytes were diffused , and enlarged . a , control group ; b , negative control ( 10 days ) ; c , negative control ( 20 days ) ; d , negative control ( 30 days ) ; e , positive control ( 10 days ) ; f , positive control ( 20 days ) . note to the normal structure of liver ( figure 4 a - f ) and hepatocytes which are located around the central vein ( cv ) ; g , positive control ( 30 days ) . cell \n histopathological study of kidney in control and negative control groups showed a normal structure ( figures 5a - d ) . \n also , in the positive control group , the animals ' kidneys were sacrificed at 10 and 20 days , the kidneys ' structure was normal ( figures 5e and f ) . in 30-day group , \n mild tubular necrosis was seen ( figure 5 g ) . a , control group \n ; b , negative control ( 10 days ) ; c , negative control ( 20 days ) ; d , negative control ( 30 days ) ; e , positive control ( 10 days ) ; f , positive control ( 20 days ) . \n note to the normal structure of the kidney ( figures 5a - f ) ; g , positive control ( 30 days ) . \n the liver is known as one of the main organisms in the human 's body and the key place for excretion and metabolism , which plays various roles in synthetizing proteins , detoxification , and producing the biochemical compounds essential for digestion system . \n liver diseases are considered as one of the major causes of morbidity and mortality in human in the world ; furthermore , it seems that hepatotoxicity due to drugs is the most common cause of the death . \n the damaged structural integrity of the liver increases serum levels of transaminases ( ast and alt ) and alp because they are usually found in the cytoplasm and released into the circulation system during cellular damage ( 13 ) . \n nephrotoxicity due to the drugs is usually associated with their accumulation in the renal cortex , their affinity to kidneys and kinetics of the drug trapping process ( 14 ) . \n aminoglycoside nephrotoxicity is functionally expressed by the reduced capacity of the urinary concentration , lysosomal enzymuria , reduced ammonium excretion , mild glycosuria , tubular proteinuria , and dropping glomerular filtration rate ( gfr ) . \n about 8% to 26% of patients receiving aminoglycosides for more than 7 to 10 days developed a mild renal injury , which was nearly at all times reversible ( 14 , 15 ) . \n gentamicin , which is a typical aminoglycoside antibiotic , is extensively used in the clinical practices . \n nephrotoxicity induced by gentamicin is characterized by direct tubular necrosis , without morphological changes in glomerular structures ( 14 ) . \n the use of liposomes in the pharmaceutical industries caused a considerable improvement , particularly through controlling and increasing the drug level in the body and its side effects and the dosage reduction ( 16 ) . \n in general , liposomal formulation compared with the normal formulation increases the penetration of drugs into the skin . \n also , the drug - delivery systems would be more stable and targeted ( 9 ) . \n the concentrations of phospholipid and the existence of polyunsaturated fatty acids in the liposomes are among the effective factors on the severity of the penetration of drugs into the skin . \n liposomes not only can pass through subcutaneous tissue , but also they can enter the systemic blood stream . \n one of the reasons for the application of the liposome in topical medication formulation is that phospholipid existing in the structure of the liposomes can penetrate the lipid compounds of the skin and can be released on the inside of the subcutaneous tissue , and as a result of interaction with them and the combination of liposomal phospholipid with lipids contained in the membranous skin layers , the membrane fluidity of the skin is impaired , and skin defensive characteristics reduce . \n penetration of hydrophilic drugs into the skin is difficult , because the nature of the skin is lipophilic ( 9 ) . \n since the liposomes size in the liposomal formulation containing paromomycin sulfate is very fine , they may enter the bloodstream through the epidermis by passing the derma . \n these particles when enter the bloodstream are phagocytosed by kupffer cells in the liver and splenic macrophage ( 12 ) . \n aminoglycosides cause proximal tubular injury and necrosis and renal dysfunction . about 10% of kidney problems \n also , its antileishmanial activity was reported in the clinical tests versus both forms of visceral leishmaniasis ( vl ) and cutaneous leishmaniasis ( cl ) . in jaafari \n et al . ( 12 ) in vivo study , results in balb / c mice infected with l. major showed that using topical formulations containing paromomycin sulfate induced a significantly smaller size lesion and lower spleen parasite burden than the control groups and pms cream . \n it is speculated that after topical application of pms formulations , at least some of the vesicles , especially those with smaller than 100 nm , pass through subcutaneous tissue of intact skin and reach the bloodstream . in this study , \n topical pms liposomes prepared by the fusion method plus homogenization provided liposomes of submicron sizes . \n analysis of the particle size distribution showed that the average size of lpmfs was less than 100 nm . to comment on the liver toxicity , tests for alk , ast \n , alt showed nanoliposome formulations containing paromomycin sulfate with 10% concentration in the group study had no significant difference in this enzyme compared with the control group and negative control groups during the three time periods , ( 10,20 , and 30 days ) and this indicates no drug hepatotoxicity in rats . on the contrary , increase in enzymes ast , alk , and \n it can be concluded that nanoliposomal formulation of paromomycin sulfate after topical application and systemic absorption has no toxic effects on liver cells . \n also for assessing nephrotoxicity , evaluation of creatinine and bun levels showed that liposomal formulation of paromomycin sulfate did not make significant changes in bun and creatinine levels . \n therefore , we can talk with more certainty about the effect of nanoliposomal formulations of paromomycin in kidney and liver of rats . \n the pathological result of the liver showed that the negative control group compared with the control group in periods of 10 , 20 , and 30 days , had a normal structure . \n positive control group during the periods of 10 and 20 days did not show changes in the liver compared with the control group and negative control groups . in 30-day period , in the positive group compared with the control and control negative groups , changes as cell swelling were observed , which were reversible and negligible . \n histopathological results of the kidney showed that structure of negative control and positive control groups compared with control group had not changed in the periods of 10 and 20 days is normal . \n the group receiving nanoliposomal paromomycin sulfate in the 30-day period was compared with the control and negative control groups and mild tubular necrosis was seen in the kidney . \n considering that previous studies have approved the effectiveness of the formulation of nanoliposomal formulation containing paromomycin sulfate on leishmania as well as topical use of this formulation cured the wounds relatively and reduced the microbial load of the spleen due to the systemic absorption of part of the drug ; therefore , the possibility existed that it causes toxicity . \n accordingly , this study examined renal and hepatic toxicity caused by topical formulation of nanoliposomal formulation containing paromomycin . \n the results showed that the short - term use of nanoliposomal topical formulations containing paromomycin sulfate formulations for treatment of the cl has not created certain toxicity in kidney and liver , but its long - term use leads to mild renal tubular necrosis and reversible cell swelling in the liver . therefore", "role": "user" }, { "content": "background : hepatotoxicity due to drugs is the most common cause of deaths . \n nephrotoxicity of the drugs is usually associated with the drugs accumulation in renal tissue . \n paromomycin sulfate ( pms ) is an anti - leishmania drug . \n although the topical approach for the treatment of leishmania is attractive , its use might cause nephrotoxicity and hepatotoxicity.objectives:this study aimed to evaluate probable nephrotoxicity and hepatotoxicity of topically administered pms liposomes.materials and methods : nine groups of male rats were used in this study ; each group consisted of 6 rats that were evaluated in 3 time periods of 10 , 20 , and 30 days . \n three groups were placed in each time period ; a control group did not receive any medicine ; a negative control group received liposome without paromomycin sulfate ; and a positive control group received nanoliposomal formulations containing paromomycin sulfate . \n pharmaceutical formulation ( topical form ) was used 2 times a day in a 12-hour interval . at the end of the period , hepatic enzymes ( alt , ast , and alk ) , bun levels , and serum creatinine \n were measured.results:the results showed that no significant change was occurred in the amount of the above factors compared with the control group with the negative control group in 3 time periods ( p > 0.05 ) . \n the histopathological results of the liver and kidney showed that there was no difference in the between the negative control and positive control groups and the control group in the 10- and 20-day periods , and they had a normal structure . \n however , after the 30-day time period a reversible cellular inflammation in the liver and mild kidney necrosis was seen in the positive control group versus the control and negative control groups.conclusions:in general , it can be said that the application of nanoliposomal paromomycin sulfate formulations for topical treatment of the cutaneous leishmaniasis does not create serious side effects in the short term , but its long - term use leads to mild renal and liver side effects that requires more attention .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: median arcuate ligament syndrome ( mals ) or celiac artery compression syndrome is a rare disorder caused by compression of celiac artery by the median arcuate ligament . \n clinical symptoms include postprandial abdominal pain , nausea , vomiting , epigastric bruit and weight loss . \n most of the patients with this syndrome are investigated with several diagnostic procedures and managed as functional gastrointestinal disorder ( fgid ) before a certain diagnosis is established . \n doppler ultrasonography reveals the stenosis / compression of celiac artery with increased flow velocity and computed tomography ( ct ) angiography confirms the compression of celiac trunk and therefore the diagnosis of mals . \n we report a case of a teenage female patient treated with laparoscopic release of the median arcuate ligament at our institution . \n a 17-year - old girl with chronic postprandial abdominal pain and weight loss was referred to our clinic . \n the other causes of chronic abdominal pain were investigated by several studies including gastrointestinal endoscopies and imaging ; however , no definitive cause could be identified . \n peak systolic velocity ( psv ) in the celiac trunk was measured as 250 cm / s , and dropped to 170 cm / s with deep inspiration ( psv = 80 cm / s ) . \n diagnosis was confirmed by three - dimensional ( 3d ) ct angiography confirming the narrowing of celiac artery at the beginning of the celiac trunk arising from abdominal aorta [ figure 1 ] . \n the narrowing of celiac artery at the beginning of the celiac trunk was demonstrated on computed tomography angiography the procedure was carried out via four 5 mm trocars . \n after opening the lesser omentum , crural fibers of diaphragm was dissected to expose median arcuate ligament . \n , arcuate ligament was dissected above celiac artery and released with a sealing device ( ligasure ; covidien ) [ figure 2 ] . \n after the releasing of the ligament , celiac trunk was free , and pulsation can be seen clearly at the distal branches of celiac artery . \n there were no intraoperative complications and the patient was discharged on the second postoperative day . in the postoperative period , patient was admitted to our clinic with recurrent symptoms of mild abdominal pain . \n psv in the celiac trunk was measured as 202 cm / s , and dropped to 162 cm / s with deep inspiration ( psv = 40cm / s ) . \n also , 3d ct angiography was performed to demonstrate the improvement in narrowing of celiac artery . \n although the pain was described to be of lower intensity when compared with presurgical state , it continued to be disturbing and required frequent use of analgesics . \n therefore , the patient was referred to the pain management service in the department of anesthesiology for paraspinal ganglion blockage . \n the patient is free of symptoms in the 9-month follow - up , gained weight and resumed normal daily activity . \n since the first description of mals in 1961 , there are several debates in the diagnosis and treatment of this rare clinical entity . \n postprandial abdominal pain , vomiting , and weight loss are the typical clinical symptoms for this syndrome \n . however , these patients are frequently diagnosed and treated as fgid before the correct diagnosis is confirmed . \n it is speculated that compression on celiac artery may result in impairment of intestinal perfusion , especially following enteral intake , and results in intestinal angina . \n other investigators , on the other hand , implicate that the course is a neurological pathology of the celiac ganglion , and consider this disease a primary neurological disorder . \n several management strategies are instituted for the treatment of mals including interventional angioplasty or stenting and surgical procedures such as releasing of the median arcuate ligament compressing the celiac artery or bypass surgeries . \n the releasing of the ligament may be done by open , laparoscopic or robotic surgery . \n minimally invasive techniques have gained popularity in the surgical management of this condition limiting open surgery to more complicated celiac by - pass procedures which do not appear in the pediatric surgical literature . \n minimally invasive techniques are very efficient in approaching to this surgical site and may be performed safely by an experienced surgeon . \n there are reports in the literature that complete resolution of symptoms may not be achieved in some patients as in our case . \n some patients may require prolonged use of analgesics while some others may necessitate para - spinal celiac ganglion blockage as an additional measure to completely alleviate the symptoms . \n mals should be considered in the differential diagnosis of patients with chronic abdominal pain , especially in those that are triggered postprandially . \n the diagnosis of fgid virtually requires to be scrutinized if the symptoms are persistent , and should be compelling for the physician / surgeon to search for this perhaps more frequent but rarely recognized entity . doppler ultrasonography revealing increased psv on celiac artery and ct angiography demonstrating compression on the truncus are diagnostic . \n laparoscopic release of the median arcuate ligament is safe and effective technique in the management of this disorder . \n \n \n ", "role": "user" }, { "content": "median arcuate ligament syndrome is a rare disorder characterized by chronic postprandial abdominal pain and weight loss caused by compression on celiac artery . \n a 17-year - old girl with chronic severe abdominal pain and weight loss was referred to our clinic . \n other causes of chronic abdominal pain were investigated and excluded . \n the compression on celiac artery was detected on doppler ultrasound and diagnosis was confirmed by computed tomography angiography . \n the patient underwent laparoscopic release of median arcuate ligament . \n there were no intraoperative complications ; however , partial pain response was observed postoperatively that necessitated para - spinal ganglion blockage . \n the patient is symptom - free in 1-year follow - up period .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: almost immediately after being funded , the center for biological and environmental nanotechnology ( cben ) found itself under intense scrutiny for their proposed research on the environmental and biological implications of nanomaterials . even though they had designed the center to emphasize the applications of nanotechnology to biological and environmental uses over the implications to environmental and biological health \n applications meant things like : membranes created with nanotechnology to filter polluted water ( an enviromental application ) or gold nanoshells used to treat cancer ( a bioengineering application ) . \n implications was fuzzier , but tended to mean concerns over fda approval , environmental impact and toxicity and exposure studies . \n internal to cben , there were tensions over whether implications research was properly scientific or not ; externally there were corporations and civil society actors demanding more focus on the risks of new nanomaterials like c60 and carbon nanotubes . in reaction to this focus on implications , understood as risks to environment and biology , many nanotechnologists outside of cben began to focus on the risks to nanotechnology itself also labeled \n implicationsthat would emerge if scientists started talking about and investigating the former kind of risks.10 fellow nanotechnologists , advisors , funders , deans and presidents , tried hard to silence two of the cben principals , vicki colvin and mark wiesner ; they tried to prevent them from speaking about the need for such research , prevent them from being invited to meetings , and at rice university , held high - level meetings with the administration concerning how to reign in their promotion of such research . \n the anxiety over the potential de - funding of nanotechnology due to public backlash was fueled from many sources fear and lack of understanding of the public ; popular misrepresentation in the press , novels and films ; and a general consensus that one must logically develop positive applications before testing them for negative consequences . \n the double meaning of implications severely confused the debate : implications sometimes meant risks to human health and environment , and sometimes meant risks to nanotechnology of a public backlash and subsequent de - funding . \n many human and social scientists also accepted this blurred meaning of implications , and have missed the opportunity , as ebbesen points out , to move beyond the issue of public acceptance . \n cben principals exacerbated this confusion by giving frequent talks ; wiesner spoke often about not repeating the failures associated with ddt , freon and asbestos . \n wow to yuck? trajectory of nanotechnology ( [ 23 , 24 ] ; see also the analysis by ) . by 2003 , \n colvin , wiesner and executive director of cben , kristen kulinowski had given versions of their wow to yuck? talk over two dozen times to public audiences . \n supplemental funding from the nsf for work on implications , and had begun to appear regularly on the roster of events as the keynote speaker who would address potential impacts of nanomaterials . in october of 2003 , vicki colvin published a \n it was the first high - impact review of its sort , and was based primarily on the existing literature studying the toxicology , exposure and transport of ultrafine particles . \n cben had begun collecting and curating articles related to toxicological and environmental issues around 2003 in a database that would become the centerpiece of the work that icon would do in 20045 , and was eventually transformed into a virtual journal highlighting specific articles in the area . \n colvin s piece was based on these and rehearsed some of the basic issues of studying ehs : the need for understanding exposure as well as toxicity ( such as occupational and manufacturing exposure and exposure through consumer products ) ; the various systems for testing toxicity ( human cell cultures , mouse fibroblasts , and animal models for pulmonary and neurological toxicology studies ) ; issues of water - solubility and aerosolization and issues of free radical chemistry and anti - oxidation functions of new nanomaterials . \n the paper explicitly invokes the specter of a more skeptical and demanding public that wants not only benefits but a commitment to anticipate and characterize potential risks as well . \n it ends with a version of what had by then become the cben party line which combined the two kinds of implications , risks to human and environmental health , and risks to nanotechnology : though it is challenging to assess the risks of engineered nanomaterials before commercial products are well defined , proactive research is critical to ensuring a sustainable nanotechnology industry ( 1169). colvin s nature biotechnology paper fueled the existing fire of controversy around studying the implications of nanotechnology . \n for one thing , it made explicit the concern that no data exists positive or negative and so speculating about risks was unwarranted . \n but this was also colvin s central message : without data , claims about the safety ( or even the proposed benefits ) of nanomaterials are equally as speculative , and perhaps more irresponsible . \n the paper posed the question in straight - forward terms : are nanomaterials hazardous? such a question was at the heart of the controversy . \n colvin s critics argued first that asking this question was inherently dangerous to the funding prospects of nanotechnology because of the unpredictability of the public and the media . \n more pointedly , they argued that it was not the responsibility of scientists in nanotechnology , but the responsibility of regulatory agencies and corporations who should test materials before commercializing them . at the heart of the debate was the question of the novelty of nanotechnology , and therefore the novelty of the risks of nanotechnology . \n if nanotechnology is really new , colvin frequently argued , then we need really new data about toxicity and exposure , which would require basic science in this area . \n if however , existing science and toxicology ( and regulation ) regarding bulk materials is good enough , then it suggests there is nothing genuinely new about the nanomaterials being produced . \n furthermore , it raised the question of whether new venues were needed are existing regulatory agencies equipped to deal with nano as if it were not new , or will new regulations , even new agencies , be necessary ? \n colvin argued that not asking these questions was as irresponsible and dangerous to humans and the environment as asking them was to nanotechnology s future . \n her critics consisted mainly of her colleagues in nanotechnology , chemistry and physics , and the leadership at nsf , including her own program manager . siding with her in different ways \n were social scientists , civil society and environmental groups , corporations , environmental scientists and toxicologists . \n a key reason for the intensified affect of the debate was the absence of data to argue about . \n as colvin puts it : we had no data , and we were beginning to speculate ... which makes scientists pretty angry.(vicki colvin , interview # 1 ; hereafter vc#1). in the period between 2001 and 2003 , almost no research on the toxicity or exposure of nanomaterials was funded ( or conducted ) through the national nanotechnology initiative ( nni ) . according to dunphy - guzman et al . \n , the nni spent only 0.5% of its budget between 2000 and 2004 on implications of engineered nanoparticlesthe vast majority of which went to cben through the national science foundation . \n ultrafine particles which were primarily incidentally ( not deliberately ) produced , and frequently divided into naturally occurring nanoparticles ( e.g. produced by forest fires or volcanos ) , unintentional anthropogenic ( such as diesel exhaust , metal fumes or cooking fumes ) and intentional anthropogenic ( buckyballs , nanotubes , rods and wires ) . \n the lack of data created the possibility for speculation both about the hazard and about the safety of nanomaterials . with little new research funding forthcoming , colvin realized ( in late 2003 ) that she needed to change her own research to address the problems she was discussing in public : the other thing that happened in 2003 is that i d had a lot of interactions with epa and they issued a call . \n they took all of their nano money [ about $ 16.5 million ] and they put it in implications and we basically wrote that call . \n i went out , i wrote it .... all of a sudden 5 million bucks a year started to flow into the area that was nt just us [ cben ] and so , somewhere around 2004 , i actually switched my research because i realized if i m out here talking about it , i need to be doing it . \n so i started to actually collaborate in this project more with the bio - engineers and some of the folks over at environmental engineering . \n [ vc#1 ] the other thing that happened in 2003 is that i d had a lot of interactions with epa and they issued a call . \n they took all of their nano money [ about $ 16.5 million ] and they put it in implications and we basically wrote that call . \n i went out , i wrote it .... all of a sudden 5 million bucks a year started to flow into the area that was nt just us [ cben ] and \n so , somewhere around 2004 , i actually switched my research because i realized if i m out here talking about it , i need to be doing it . \n so i started to actually collaborate in this project more with the bio - engineers and some of the folks over at environmental engineering . \n [ vc#1 ] it is somewhat of an irony that colvin , of the three principals of cben , turned out to be the one who would change her research so dramatically in the direction of toxicology , and not the environmental engineer mark wiesner ( who had extensive experience with the epa ) nor the bio - engineer jennifer west . \n colvin s desire to change her research seemed to issue in part from the fact that there was no data , but also in part from her reaction to people telling her not to do such research . \n like many scientists , colvin characterizes herself as someone who reacts very strongly when people tell her not to do something , or that something can not be done . \n colvin saw this as an opportunity to open up a new direction for research in her lab . \n wiesner , for his part , had also embarked on toxicology research , but opted for a slower and more deliberate entry into the field than colvin . \n wiesner recalls : in fact , we started work in that area around the same time but took a very different , and much slower approach from that of vicki . \n toxicology is a landmine of a field and i made the decision early on that it was not the sort of thing you learn to do in between snacks . \n so rather than try and do the tox work ourselves , we began collaborations with bonafide toxicologists - initially in france ( marseille medical school ) , since i had contacts there , and later at ucla . \n ultimately having access to environmental toxicologists and a medical school where we could do that kind of work was a key factor in my decision to come to duke ( personal communication , 2008 ) . \n in fact , we started work in that area around the same time but took a very different , and much slower approach from that of vicki . \n toxicology is a landmine of a field and i made the decision early on that it was not the sort of thing you learn to do in between snacks . \n so rather than try and do the tox work ourselves , we began collaborations with bonafide toxicologists - initially in france ( marseille medical school ) , since i had contacts there , and later at ucla . \n ultimately having access to environmental toxicologists and a medical school where we could do that kind of work was a key factor in my decision to come to duke ( personal communication , 2008 ) . \n wiesner s characterization captures the institutional and disciplinary locations of the different sciences . as an environmental engineer , rather than a materials chemist , \n his position vis - a - vis toxicology emphasized different aspects , both in terms of its internal complexity and in terms of what he might gain from such a collaboration . \n colvin , by contrast , eagerly wanted data with which she might argue with her colleagues in nanotechnology and materials chemistry , and not to move into the field of toxicology completely . \n cben s initial organization provided limited funding for toxicology , and did not refer to it as such . \n cben was not organized around the existing disciplinary lines of toxicology , eco - toxicology , or health research . \n indeed , one of the reasons that colvin s critics within the nsf had given for trying to silence her had been that the nsf does not fund toxicology . \n toxicology , they claimed , is more properly the province of the regulatory agencies such as the food and drug administration ( fda ) , environmental protection agency(epa ) , or the national institutes of health ( nih ) and implied that it was not basic science , and definitely not nanotechnology . \n however , the meaning of implications and the core research science differed depending on the discipline , a fact that became evident in the creation of cben . for the environmental engineer mark \n wiesner , eco - toxicology is basic science , whereas for bioengineer jennifer west , biological toxicology came further downstream , primarily at the fda , and after the materials had been created . \n colvin and her supporters had begun to realize , however , that neither the fda nor the epa had planned to treat nanotechnology as special in a regulatory sense , and instead to apply the same tests and standards it does to bulk materials . \n wiesner and west therefore represented two sides of a line that colvin was trying to walk : on the one hand , a mode privileging concern with strong roots in the environmental movement , suspicion of unregulated production , and a way of arguing in which indication of harm is a call to action and control ; on the other hand , a mode privileging control with strong roots in engineering , a suspicion of government regulation , a belief in unconstrained basic research and a way of arguing in which indication of benefit comes before testing and verification of safety . \n colvin s biography places her firmly in the latter camp : a born and bred nano person , specifically materials chemistry and optics of materials and a student of paul alivasatos with a widely cited paper and patent on cadmium selenide leds . but with the founding of cben and the interaction with wiesner and other environmental scientists , with the intense scrutiny of nanotechnology \n changing her research , therefore , did not imply that she was giving up the mode of control in favor of a mode of concern . \n the biggest barrier to this new research direction was that colvin had no graduate training in biology ( much less toxicology or environmental science ) . \n learning the tools and techniques of biology and environmental science posed a barrier to research , rather than a starting point . \n but in classic form , putting two of her students on projects related to toxicology was a way to learn fast ; and a way to work on making her career as well . \n all of a sudden , a whole new series of experimental tools and systems presented themselves : cell cultures and bacteria , rats and bass , systems biology , environmental science and ultrafine particle toxicology . \n the field of toxicology of ultrafine particles was one of the first to present itself as a likely venue for the kinds of questions that colvin sought to answer . \n gunter oberdoerster was one of the leaders in the study of mammalian toxicity of ultrafine particles , and colvin invited him to present his work to cben , with an eye to collaborating on studying the environmental toxicity of nanotechology . \n oberdoerster declined and instead suggested his daughter , eva , whose work was in the area of endocrine disruptors and environmental toxicology , and who ran a lab at southern methodist in dallas . \n the story of colvin s collaboration with oberdoerster , and its breakdown , reveal many aspects of how values in science work themselves into the heart of laboratory research . \n colvin s attempt to synthesize the two meanings of implications ramified into a personal story with both predictable and unpredictable elements . \n she sent her to dallas to learn from oberdoerster how to do toxicological studies both in cell culture and large mouth bass , of which oberdoerster had a school remaining in the lab from previous epa - funded work . \n for one of the first experiments on the large - mouth bass , colvin provided the fullerenes from the punch bowlfullerenes that had been made in - house and solubilized in water at rice . \n sayes lugged a large amount ( about 5 litres ) of pure fullerenes in water to dallas which were added to the water in which the fish swam . \n they conducted standard tests ( 48 and 96 h exposures ) and measured damage to the gills and brains of the fish . \n they compiled the results and continued with more studies to verify what they were finding : that there was indeed some evidence of damage to the gills and brains of the fish . \n but it was at this point that the external conditions of the state of nanotechnology research and the dual meaning of \n oberdoerster described the first hiccough this way : i was running out of fullerenes , so i asked vicki if she could send some more and she said , absolutely not . \n i do nt like the direction this is going ; that you are actually finding effects. she said \n honestly i did nt think you would find any toxicity and i do nt want this getting out. and \n but we ve done this and a priori we had planned out what we were gon na do and when we were going to publish ... \n ( eo interview # 1 , 2008 , hereafter eo#1 ) i was running out of fullerenes , so i asked vicki if she could send some more and she said , absolutely not . \n i do nt like the direction this is going ; that you are actually finding effects. she said \n honestly i did nt think you would find any toxicity and i do nt want this getting out. and \n i said oh , ok , that s oh , i see ... but we ve done this and a priori we had planned out what we were gon na do and when we were going to publish ... \n ( eo interview # 1 , 2008 , hereafter eo#1 ) oberdoerster felt the situation was especially unfortunate for sayes . \n she was in her lab , staying with her at her home and now caught in the middle of what was developing into a professional dispute . not knowing what to do with this new information , she awkwardly continued the research with sayes and went back and forth with colvin through the winter of 2004 . \n she argued that the data was solid , that it was an interesting result , that they were seeing damage but also seeing healing in the gills , and most important that she was eager to get the result out so that others could try to replicate it . sensing that vicki did not want the paper published , for whatever reason , oberdoerster eventually decided to go ahead with publishing the results.vicki , as she realized that this was going forward and getting ready for publication , asked that her name be withdrawn from it , and what she told me was that she never expected there to be toxicity , her whole career is based on these particles , and they can not be found toxic , because then she can not go forward with her research . \n ( eo # 1 ) vicki , as she realized that this was going forward and getting ready for publication , asked that her name be withdrawn from it , and what she told me was that she never expected there to be toxicity , her whole career is based on these particles , and they can not be found toxic , because then she can not go forward with her research . \n ( eo # 1 ) colvin also described asking for her name to be removed , but suggested that her reasoning was different . \n colvin argued that there was not enough data to be convincing , that the study was set to be controversial , and most importantly , that it dealt only with pure underivatized ( uncoated ) buckyballs a form that were not generally commercially available . \n taken together these elements enhanced colvin s sense that the risk to human health represented by these tentative results was probably a good deal smaller than the risk to nanotechnology represented by their publication . \n oberdoerster agrees that whatever the reason for colvin s decision to remove her name , there was tremendous resistance to this line of work , strong personalities in nanotechnology and other factors contributing to the decisions that each of them made about the timing of submission or publication . \n add to this , there was a clear sense of the advantage in career advancement that this kind of research represented to both of them ; whoever managed to publish first in this new field would be the one who gained the most attention in the media , amongst peers and hopefully with funders . \n but there are other confusing and some downright weird aspects to this part of the story . in the winter of 2004 \n , colvin had already begun her own series of studies on fullerenes and their effect on tissue culture ( work also done primarily by christie sayes ) , in the hopes of generating further data that might either challenge , supplement , or perhaps preempt the results that oberdoerster was getting . \n both women started to submit the results of this work around the same time , in early spring of 2004 and according to colvin , oberdoerster submitted to science \n right around the same time we tried to submit , which was part of the issue for one of the reviewers because he [ sic ] clearly had looked at both papers ( vc#2). in addition to claims about the data and its reliability , concern about the style of the research , and the possible risks to the health of nanotechnology by the publication of such work , issues of career advancement and gender also began to play a role . \n seen solely from the published literature it seems that oberdoerster published her study in environmental health perspectives in april of 2004 , and colvin published her first study later in nano letters in august of 2004 . behind the scenes or between them \n the new york times nonetheless tracked oberdoerster s experiment and publication , and in late march ( along with the appearance of her article ) ran a profile of oberdoerster and her study.11 for colvin this was not simply a competitive blow ( oberdoerster both published first , and was profiled in the new york times ) , but it also revealed and exacerbated a strange set of gender dynamics as well : the new york times did a huge article [ with a ] picture of eva ... and eva unfortunately kind of looks like me and so people got me and eva confused . \n this is weird , but if you re a woman in science ... so there was a tv interview right after that [ nyt article ] and i was very public in this tv interview , so then the , this connection between me and this new york times article became very large , even though i intentionally did not take part in [ eva s study ] , i did not quote it , i did nt want to have anything to do with it , predominantly because ... i was trying to walk this very fine line . \n so , so i became ambivalent myself about taking a public role because the perceived costs , you know losing the center , for example , as a director . \n ( vc#2 ) the new york times did a huge article [ with a ] picture of eva ... and eva unfortunately kind of looks like me and so people got me and eva confused . \n they would think i was eva and this , this is weird , but if you re a woman in science ... so there was a tv interview right after that [ nyt article ] and i was very public in this tv interview , so then the , this connection between me and this new york times article became very large , even though i intentionally did not take part in [ eva s study ] , i did not quote it , i did nt want to have anything to do with it , predominantly because ... i was trying to walk this very fine line . \n so , so i became ambivalent myself about taking a public role because the perceived costs , you know losing the center , for example , as a director . \n ( vc#2 ) the confusion of colvin and oberdoerster , especially by fellow scientists was problematic for more than the obvious reasons of gender inequity and power relations . \n oberdoerster is neither a nanotechnologist nor a chemist , but a toxicologist , and her study made a direct leap towards the effect of buckyballs on the whole animal ( brain and gill damage in largemouth bass ) . \n even if colvin were in principle in support of such research , she did not want to be associated with this particular style or have it confused with what cben was created to do , which was primarily to study applications of nano to biology and the environment . \n colvin claims she had scrubbed any recognition of my name or [ my grad student s ] name from that paper , but i had to acknowledge cben because we spent money on the project.(vc#2) the fine line that colvin was walking implied a difference between the scientific approach to understanding nanomaterials as such , and the downstream, less prestigious and risky ( to nanotechnology ) toxicology work . \n as colvin puts it , most scientists perceive toxicology as a simple question : did the rat die? and not something worthy of funding at a basic level , at a center like cben : there is something more fundamental here [ and ] i do nt know that i ve been able to make that case strongly with my community [ materials scientists and nanotechnologists ] yet ( vc#2). oberdoerster , by contrast , saw little to nothing new in nano toxicology . \n given that her father had worked on ultrafine particles since the 70s , that toxicology has a long history of theorizing risk rigorously through defining hazard and exposure , and the fact that synthetic chemists in the pharmaceutical industry routinely asked questions about how to measure and understand the safety of the compounds they created , colvin s questions seemed like business as usual or worse , as withholding research findings . for oberdoerster , it was the perceived threat to a nascent nanotechnology that overwhelmed colvin s ability to reason clearly about the science . \n strong personalities who can get things done but also create problems and pressures that can obscure the science . for oberdoerster , \n the work was routine ; novel only on the surface because of the material and because of the attention it garnered her by virtue of the media hype surrounding nano . \n fine line by being both a toxicology study and an attempt to explore something more fundamental. colvin s resistance to participating in oberdoerster s study was driven by an intuition that new modes of analyzing these materials were necessary that it was nt simply a toxicology question about a new material . \n in other words , it had to be formulated in terms which they could experience as within an established mode of veridiction. mark wiesner s comment that toxicology is not the sort of thing you learn to do in between snacks reflects his own concern with cben s ( and colvin s ) perhaps brazen entry into this already well - established field . \n colvin s attempt to forge a form of scientific work that brought materials chemistry to bear on problems for which toxicologists and environmental scientists already possessed tools and a history created exactly the kind of dangerous \n wiesner s more diplomatic approach was focused on bringing these fields together around existing tools and practices , rather than trying to forge a new space entirely . nonetheless , it s possible to see , even from the published literature alone , how colvin was attempting to change the nature of the question confronting both sides to in effect invent a new mode of veridiction . instead of asking \n is c60 toxic? as oberdoerster had , colvin started to ask instead : which species is most toxic and why? given colvin s background in chemistry and nanotechnology , her concern about the materials in question extended beyond the simple definition of c60 as a soccer - ball shaped particle with 60 carbon atoms . \n kroto and curl received a nobel prize for characterizing them but practically speaking they are nt particularly useful until they are \n derivatized or coated in order to increase their solubility , or turn them into substrates to which we can add other molecules for novel purposes . \n it is this feature of the control of materials that gives nanotechnology some of its novelty something that has its closest parallel in the work of synthetic chemists in the pharmaceutical industry , where approaches such as combinatorial chemistry can create a huge array of variations on a single molecule . \n the prospect of needing to find funding and scientists to study each and every one seemed both impossible to colvin , and scientifically inelegant . \n the first paper to be published from colvin s new experiments , also written with christie sayes , appeared in nano letters in august of 2004 : the differential cytotoxicity of water - soluble fullerenes, , and as the title suggests , focuses on comparing different toxicities of water - soluble species of c60 . \n fine lines. the abstract begins by stating we show that the cytotoxicity of water - soluble fullerenes is a sensitive function of surface derivatization suggesting that the question of toxicity is not a simple one , and furthermore , a sensitive one requiring careful scientific experiment and theorization . \n the article ends , this work demonstrates both a strategy for enhancing the toxicity of fullerenes for certain applications such as cancer therapeutics or bactericides , as well as a remediation for the possible unwanted biological effects of pristine fullerenes ( emphasis added ) . within the abstract arguably the most tightly and strategically written aspect of most scientific papers the battle lines over this kind of research are clear : colvin wants to associate herself with the ability to create new biological applications of nanomaterials , but also to characterize their toxicity as a function of their structure . on the one hand buckyballs are toxic , but on the other hand this can be a good thing . \n on the one hand fully derivatized buckyballs are safe ( or safer ) , and on the other hand \n pristine buckyballs can have possible unwanted biological effects. the article hews to the line that what makes nanotechnology new is the exploitation of the properties that materials have at the nanoscale ; what makes colvin s contribution new is that one of these properties is their toxicity and no one has yet characterized this clearly to her mind . compared to the oberdoerster piece , which remains resolutely in a mode of pure concern \n the nano letters piece uses an idiom that mixes concern and control calculated to navigate between the two kinds of implications : risks to environment and biology , and risks to nanotechnology . \n it creates a new mode of veridictiona new set of criteria for truth claims about nanomaterials . rather than making claims about toxicity in a language of hazard , exposure and risk \n , it makes claims about toxicity in a language of engineering and control of matter . rather than relying on data that would , in a roundabout way , provide evidence for or against actions taken ( e.g. by governments or corporations ) with respect to c60 , colvin s article presents data that might , in a roundabout way , serve as the basis for engineering materials differently . \n this new veridiction , however , would only function with an attendant jurisdiction within which it makes sense to make such claims , and this is what colvin s fine line indicates the problem of the legitimacy of this new approach . \n side:this provides striking evidence that water soluble functional groups on the surface of a fullerene molecule dramatically decrease the toxicity of pristine c60 ( 1886). which is to say , toxicity exists , but it is an interesting problem for materials chemists and nanotechnologists \n one related to the properties of the material , its derivatizations , and its surface chemistry . on the other side , a rhetorically complex assertion : this work demonstrates that hydroxylation of the c60 cage could be used as a remediation for the possible unintentional biological effects of pristine fullerenes ( 1886). coating buckyballs remediates possible unintentional effects of buckyballs ; which is to say , if they are coated , the possibility that pristine buckyballs have for causing unintended biological damage is remediated or presumably , prevented to begin with . \n colvin s article does not directly contest or engage oberdoerster s work , though it does cite it . \n many issues are collapsed in the appearance of these two articles they emerge from different trajectories , represent different ways of making truth claims about materials , different practical approaches to laboratory experiment , and different concerns about the significance of the results . \n the results of colvin s study are viewed with skepticism , even hostility , by many toxicologists and environmental scientists , but as colvin repeatedly pointed out in our interviews , prior to this point there was nothing to argue about no data and no results concerning new nanomaterials . skepticism and hostility , \n the number of papers had ballooned into a healthy debate conducted over a startlingly large number of journals . \n after these first publications in 2004 , research in the toxicity of buckyballs was underway , as were competing definitions of what would count as valid scientific research in this area . during this year , oberdoerster , together with mark wiesner and his students ( and with kristen kulinowski and colvin s help ) subsequently discovered that the supposedly pure c60 that colvin had contributed was actually not quite pure . \n it formed aggregates in solution , so - called nc60 , which in itself might suggest different effects to be tested for , but more importantly , the solubilization process combined with the formation of clusters meant that some of the toxic solvent ( tetrahydrofuran or thf ) used to make c60 enter into solution remained trapped inside \n eggs of c60.12 for oberdoerster this contamination was unfortunate , perhaps confounding the evidence of damage in her 2004 study , but more than that it represented an unrealistic environmental scenario : c60 would never enter solution in lakes and streams and sewers with the help of thf . to rectify this irrealism , she tried adding c60 to water and simply stirring it for days until it entered solution , which it slowly did . \n when some danish colleagues complained that they could nt get the same result , she also discovered that it the action of uv light from the window above the stir - plate that helped the solubilization along . \n both the action of stirring ( wave action ) and the presence of uv represented more realistic proxies of an environmental exposure route for the fullerenes . \n for oberdoerster , defining hazard and exposure , and doing so realistically were the priorities . for colvin , by contrast \n , hazard and exposure realism was secondary to the characterization of differential cytotoxicitya result that could be either good or bad , depending on a use case , and might be a route to something more fundamental. to say \n bucky balls are toxic , but this might be a good thing, as colvin s paper had , was to emphasize a different problem concerning nanomaterials than that highlighted by the realism of oberdoerster s approach , in which the toxicity of the substance is implicitly related to its entry into and persistence in the environment in particular natural ways . at the heart of the emerging debate , therefore , was not only a question of whether fullerenes were toxic , but which kinds , how to study them , and in what tradition of research and at the limit , a definition of what counts as natural and what as designed \n . looking at these first publications in detail , it is thus possible to see the battle being waged outside the laboratory . \n the questions colvin , wiesner and oberdoerster were asking were not bubbling up from laboratory exploration , but channeled into those labs by external debates . \n the scientific papers could be read on their own as mere statements of fact , as they are rhetorically constructed to do \n but when one reads more carefully the situation and history giving rise to the papers it becomes easy to see the complex political , and sometimes personal negotiation taking place.13 in the details of the experimental design and the careful justification of the results , one can chart the course between the pure need for research into the environmental and biological effects of nanomaterials ( a rhetorical necessity ) , and the intense affect , career maneuvering , political struggle and sometimes personal attacks on and among colvin , wiesner , oberdoerster as posing risks to the health of nanotechnology . \n the complex negotiation within the science , in the university , and in the public grew out of the confusion around the meaning of implications risks to biology and environment or risks to nanotechnology ? \n it was only by working through these differences that colvin and others could start to ask more precise questions in the laboratory \n questions different from those asked by toxicologists on the one hand , or nanotechnologists on the other . \n the differential cytotoxicity of water - soluble fullerenes is neither normal science nor paradigm - shattering , but a kind of strategic working over of the demand for responsibility , into a form of science that is both application and implication at once , both concern and control : it was an attempt to define safety as a fundamental property of materials . \n for the first four years of their work in cben , colvin and executive director kulinowski had pitched the story of wow to yuck? asking whether the initial love - affair with the benefits of nanotechnology would turn to a repugnance when facts about their danger to biology and environment emerged . \n such a framing was useful because it integrated the two kinds of implications though not intentionally . \n if heard from the perspective of nanotechnologists , the story was all about public perception of nano and risks to its health , if heard from perspective of toxicologists or social movement activists , the story was about the need to study hazards and risks of new materials . \n but then , a revelation , a moment on the road to damascus ( or in this case , perhaps it was d.c . ) , when colvin discovered a different way to integrate these two risks : i was on the road promoting it [ the new research ] and then a bizarre thing happened . \n it was really quick but all of a sudden i hit upon a message of how to pitch it and this this \n would not have happened if i was nt doing it and this is what i do take credit for . \n so i was struggling with rick [ smalley ] hating what we did he still hated what we did . and a lot of my own community im a nanotechnologist right \n so my own community was , i was becoming kind of ... i mean it was , it was pointed , things i was not invited to , places i had been before , you know . \n my thesis advisor taking me aside and saying do you realize what you re doing? you have to realize it s always couched in the science and the quality of the science and i kept saying \n it s just starting. but i hit upon a way to do it and that is the safety by design idea , the idea that you can study implications and from that go back and engineer materials and processes to be safer and to have less of the impact that you do nt want them to have ... once i flipped it , labeled it safety by design and started to push it , i stopped using \n ( vc # 1 ) i was on the road promoting it [ the new research ] and then a bizarre thing happened . \n it was really quick but all of a sudden i hit upon a message of how to pitch it and this this would not have happened if i was nt doing it and this is what i do take credit for . \n so i was struggling with rick [ smalley ] hating what we did he still hated what we did . and a lot of my own community \n so my own community was , i was becoming kind of ... i mean it was , it was pointed , things i was not invited to , places i had been before , you know . \n my thesis advisor taking me aside and saying do you realize what you re doing? you have to realize it s always couched in the science and the quality of the science and i kept saying \n it s just starting. but i hit upon a way to do it and that is the safety by design idea , the idea that you can study implications and from that go back and engineer materials and processes to be safer and to have less of the impact that you do nt want them to have ... once i flipped it , labeled it safety by design and started to push it , i stopped using wow to yuck? cause \n ( vc # 1 ) safety by design appealed immediately to chemists and nanotechnologists , without giving up on the fundamental message of risks to human and environmental health . \n it was a very clever label for the research cben saw as its core mission both safety and engineering . \n but as with any such label , it brought with it a whole new set of challenges . \n it turned out , it pissed off a lot of the toxicologists , because they were , like , well how do you know it s \n toxicologists raised a concern over conflict of interest : if the goal is to engineer safe materials , then of course the engineers qua toxicologists are going to find that it s safe . \n colvin s somewhat flip response to this was that the same accusations might be leveled at toxicologists : if they demonstrate toxicity , their funding remains safe . \n but it nonetheless remains a good question : what is the meaning of safety ? how is it defined and by whom ? \n safety by design angered the toxicologists because it presumed that safety was an issue of design , not a feature of the established risk framework of hazard levels and exposure routes ; on the other hand chemists and nanotechnologists were more comfortable with the message : it made my community feel better , because [ having the data ] taught ... them where the chemistry is . \n they understood oh yeah , biological properties , they re interesting , they can be general [ laughs ] . \n they re not just did the rat die? we can talk about what happened ! ... \n i think the time i knew i had fixed it [ was when ] nih had a big unveiling of their nano program and they invited eight academics . \n two were from rice , one was rick smalley and one was me ; we only had eight minutes , it was a big dog and pony show and it was web cast everywhere and i really pitched the safety by design idea and rick loved it . \n it s bad , it s going to kill us all , i found a way to pitch it that , that he really related to . \n ( vc#1 ) it made my community feel better , because [ having the data ] taught ... them where the chemistry is \n they understood oh yeah , biological properties , they re interesting , they can be general [ laughs ] . \n they re not just did the rat die? we can talk about what happened ! ... \n i think the time i knew i had fixed it [ was when ] nih had a big unveiling of their nano program and they invited eight academics . \n two were from rice , one was rick smalley and one was me ; we only had eight minutes , it was a big dog and pony show and it was web cast everywhere and i really pitched the safety by design idea and rick loved it . \n it s bad , it s going to kill us all , i found a way to pitch it that , that he really related to . \n ( vc#1 ) colvin had successfully not only walked , but actually dissolved the fine line . \n she saw her work as re - positioning the various disciplines involved around the materials they worked on and the kinds of questions they asked . \n rather than a classic , modernist hierarchy of science with chemistry as fundamental science and toxicology , biology and environmental science as lower in the hierarchy ( or outside it altogether ) , this new configuration brought biology , environmental science and toxicology into competition with physics as sciences that provide resources for nanotechnologists to characterize the relationship of structure and function of new materials . \n perhaps even more important , it was a message that colvin could use to make her own career to become the person identified with the engineering of new materials for the purposes of safety . \n history may or may not reward her with this recognition , but the goal and the success were real enough as they happened . \n applications of nanotechnology to biology and environment medical diagnostics , cancer cures , environmental remediation with membranes and so forth . with \n safety by design colvin managed to re - assert this vision , but with safety as a new key component a new function around which applications of new materials can be characterized . \n to say , as they did in their first paper , that buckyballs are toxic , but this can be a good thing , was a key feature of this approach . \n if we choose to exploit new materials for whatever reason we need to know not only properties like strength and conductivity , but safety and exposure as well they must be made theoretical , they need a mode of veridiction . however , \n it moves the fields of biology , toxicology and environmental science from being resources in terms of a potential field of applications , to resources in terms of a potential field of explanations , constraints and systems for control and regulation . \n colvin s bid to make her career in the same way as her advisors and mentors ( quantum dots and leds for alivasatos , carbon nanotubes and energy for smalley ) might not be just one success alongside others , but one that could potentially demand a reconfiguration of the kind of science everyone in nanotechnology and materials science pursues . \n it should come as no surprise that the proposal is met with such intense emotion and affect if it means that it directly affects the style , life and work of a large segment of scientists not just in nano , but in toxicology and environmental science as well . \n similarly , the approach implies that , while toxicology is essential to this reconfiguration , its theories of risk and hazard are inadequate to the issues raised by nanomaterials ; it suddenly appears insufficient to seek data about the risk and hazard of every new material and every functionalization of every new material . \n rather , it creates a new mode of veridiction a new set of truth claims about safety as a fundamental property of matter , claims that might be made about wide classes of materials and their uses and ultimately replace one version of risk analysis ( is it safe? ) with another and quite different version ( how do you engineer towards safety? ) \n safety by design opened up a range of difficult questions . far from being a scientific breakthrough or \n a simple scientific fact ( things many studies in the history and philosophy of science have demonstrated are hard won ) , safety by design is more like a solvent : it decomposes and reveals . \n colvin s work on this idea was born in controversy both public controversy over a threat to a new field and its funding as well as more conventional scientific controversy over the validity and legitimacy of her methods and findings . as cben and icon continued to pursue the question of implications , and others in the emergent field of nanotoxicology \n many of these , it is clear , have emerged because of the combination of the new venue of icon , which in its capacity as a kind of membrane , channeled the ramifications both into the lab and back out again and the attempt to make new kinds of truth claims about safety as a fundamental property of materials . \n first , safety by design re - opened a question about predictive toxicology can it be done and how ? \n toxicologists , especially those in the pharmaceutical industry , have long been asking this question . \n cben and icon as institutions had no ties to the pharmaceutical industry , but as questions formed about how to assess the potentially huge class of materials emerging from nanotech labs , colvin and others turned to the field of quantitative structure - activity relationship modelling ( qsar ) . \n qsar modelling has had modest success in screening compounds for toxic characteristics in the design of new pharmaceutical compounds [ 17 , 18 , 22 ] . \n it is controversial amongst some biologists however , because of its overly simplistic model of metabolism . \n for many biologists , and toxicologists like the oberdoersters , it is clear that molecules are transformed by the environment and transform the environment in turn . \n livers , lungs and skin metabolize and change molecules , and things like uv light and simple motion can transform a material in the body or the environment . \n colvin counters that nanomaterials are much smaller and simpler ( and arguably better understood ) than complex bio - molecules , but the question remains an open one . \n second , safety - by - design also raised questions about differing definitions of nature that divide biologists and nanotechnologists . \n bensaude - vincent has detailed the subtle differences between versions of nanotechnology that either engineer biomolecules or take inspiration from them for design . \n similarly , colvin s immediate community of materials chemists and nanotechnologists have a far more engineering - oriented approach to biology , which means that systems biologists and others attempting to understand biological entities in their \n natural state find their approach of nanotechnolgy to be dirty and uncontrolled . as colvin puts it : [ systems biologists ] kind of feel like , if we do nt understand the natural state why would we want a perturbation coming in , right ? \n they re interested in using quantum dots as tags and fluorescers and all that good stuff but i think to engage the biologists we re going to need another couple of years to come up with some good mechanisms for interactions . \n ( vc#1) for many in nanotechnology ( in a way similar to the field of synthetic biology ) , nanomaterials are probes for exploring what happens in different contexts , under the assumption that it will tell us something about structure and function . \n third , related to this is the issue of what standard contexts will define the meaning of biological or \n ongoing experiments use fish , rats , human cells and other proxies for the human body and its safety . \n these choices have effects on the validity of claims made in this new venue are we all using the same human cells , and do we ( nanotechnologists ) know how to handle them ? \n a mode of veridiction in which colvin and others might claim to have engineered a \n safe material also requires a mode of jurisdiction in which standardized tools , standardized nomenclature and standardized organisms allow these new claims to stick . \n if it is only colvin s lab that tests buckyballs in human hela cells , then the claims made thereby will have no juridical force amongst other researchers beyond unverifiable , they will simply have no legitimacy to other researchers . \n if cben and icon are successful in establishing new venues for this kind of research however , it establishes the beginning of a jurisdiction based in the standardization of media , tools and organisms for a small and growing community . \n finally , safety by design has also raised a new challenge to the definition of materials and their environmental regulation . in part because of work within icon to identify \n hot spots in the life cycle of materials ( a methodology introduced into discussions at icon by mike garner of intel ) , research in this area has focused on workplace manufacture and handling of these materials . in subsequent work with georgia tech colleague joseph hughes , the implications of colvin and wiesner s work on nc60 \n are connected more explicitly to the domains of regulation and workplace / industrial handling of nanomaterials . \n specifically , the article demonstrates how in aqueous systems , nano - c60 behaves neither as an individual molecule nor as a bulk solid ( 4315 ) . from this \n they draw conclusions that standard measures of the prediction of toxicity ( e.g. for polyaromatic hydrocarbons ) are inadequate : this work clearly illustrates the limitations of the current guidelines for the handling and disposal of c60 , which are based entirely on the properties of bulk carbon black ... these guidelines may need to be revisited . \n hot spot in the life cycle of nanomaterials therefore enters explicitly into the kinds of questions asked in nanotoxicology . \n by mid 2008 , the question of whether safety by design would succeed as a new mode of verdiction remained open . \n cben and icon were actively looking for ways to continue their work ( cben s funding ends officially in 2011 ) and to take the idea into new areas such as water treatment with magnetite nanocrystals and an attempt to innovate a form of open - source nanotechnology . in reflecting on its success , colvin makes a strong case that even the limited amount of research so far conducted has changed the way chemists think about their materials : what s happening now is really an interesting process of , of separation because now this issue [ toxicity and hazard ] is being used by nanotechnologists to differentiate their materials from somebody else s . \n use gold because it s totally safe , do nt use quantum dots , they re going to kill you , you know . \n so now what i get from my own technical community is in large part determined by what they make and what , what particular thing they re into . \n ( vc#1 ) what s happening now is really an interesting process of , of separation because now this issue [ toxicity and hazard ] is being used by nanotechnologists to differentiate their materials from somebody else s . \n use gold because it s totally safe , do nt use quantum dots , they re going to kill you , you know . \n so now what i get from my own technical community is in large part determined by what they make and what , what particular thing they re into . \n ( vc#1 ) the fact that nanotechnologists research and careers are closely tied to expertise with a specific material means that making \n safety into a fundamental property applies to everyone working with nanomaterials : quantum dots , rods , buckyballs and nanotubes and so on . \n communities of researchers formed around these different materials are handling such information differently , and as colvin and other researchers continue to conduct research on different materials . \n this ongoing research includes an article on the toxicity of functionalized carbon nanotubes [ 38 , 39 ] , one on the toxicity of nc60 and two on the toxicology of titanium dioxide [ 38 , 41 ] , each of which has drawn more and more nano - scientists into the debate.now we re in the secondary backlash [ that ] is more pointed , poignant , in that now that the data is emerging there are particular materials and particular issues about certain classes of materials which are very significant or potentially significant and those communities are then pushing back ... so quantum dots for example : you ca nt get a q - dot bio - imaging proposal through nih right now because of the toxicity of quantum dots ; and that community is handling it well . \n that community is owning up to it saying , well , duh ! we ve got cadmium in there you know , we re not idiots \n . we ve got to figure out a way to deal with this and we re going to make alternative quantum dots and we re going to learn how to wrap em up real tight and ... so i think that community is rolling with it . \n (vc#2 ) now we re in the secondary backlash [ that ] is more pointed , poignant , in that now that the data is emerging there are particular materials and particular issues about certain classes of materials which are very significant or potentially significant and those communities are then pushing back ... so quantum dots for example : you ca nt get a q - dot bio - imaging proposal through nih right now because of the toxicity of quantum dots ; and that community is handling it well . \n that community is owning up to it saying , well , duh ! we ve got cadmium in there you know , we re not idiots . \n we ve got to figure out a way to deal with this and we re going to make alternative quantum dots and we re going to learn how to wrap em up real tight and ... so i think that community is rolling with it . the carbon nanotube and carbon nanostructure community on the other hand is not . \n (vc#2 ) the differentiation of researchers based on the toxicity of their materials is new ( to the chemists ) ; never before has it been their task to manage and understand this aspect of their materials at the stage of characterizing them for a particular function . by the same token , very little information exists to date , \n so the anecdotal claim that the nih is resisting proposals for quantum dot bio - imaging might suggest that it has taken a more precautionary stance than ever before ; a stance in which it expects researchers to find ways to wrap em up real tight in a manner that is convincing to their peers and not only to the \n this shift in the configuration of power , in which nano - scientists are now paying more attention to such issues is by no means simply about the success of responsibility or \n ethics but also has to do with the active work of creating a novel field in which new things can be produced \n structure - function relationships that are both useful in terms of safety ( mode of concern ) and useful in more conventional terms of understanding how to control matter ( mode of control ) . \n thus , the evidence that buckyballs might be toxic , but this might be a good thing . \n understanding such a claim means getting over the language of applications and implications , on both sides of that debate . \n simplistic assertions of good and evil ( buckyballs are toxic , watch out ! ) , or absolute statements about precaution and danger , or risk and responsibility do not capture either the development of the science or the response and reformulation of ethics at work . getting over implications and applications ( going beyond good and evil ) , however , does not mean going beyond good and bad , but attending to the rank ordering of values taking place in the changing configuration of nanoscale science and engineering . \n there is an ongoing struggle within science to redefine how values will be incorporated into scientific research and this is also something that drives the research itself . \n the different modes of veridiction represented by toxicology and materials chemistry are synthesized into a new one by the invention of safety by design . \n furthermore , such a mode is not just a result of one scientists new claims , but requires the invention of new venues within which one can conduct such research , the definition of new modes of jurisdiction that can adjudicate ( across materials chemistry and nanotoxicology ) standards by which truth claims are judged and ultimately the creation of new objects , like functionalized buckyballs , which literalize these new configurations of knowledge around a usable , and very real , object .", "role": "user" }, { "content": "using long - term anthropological observations at the center for biological and environmental nanotechnology in houston , texas , the article demonstrates in detail the creation of new objects , new venues and new modes of veridiction which have reoriented the disciplines of materials chemistry and nanotoxicology . beginning with the confusion surrounding the meaning of implications and applications the article explores the creation of new venues ( cben and its offshoot the international council on nanotechnology ) \n ; it then demonstrates how the demands for a responsible , safe or ethical science were translated into new research and experiment in and through these venues . \n finally it shows how \n safety by design emerged as a way to go beyond implications and applications , even as it introduced a whole new array of controversies concerning its viability , validity and legitimacy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cancer is one of the major causes of childhood death in the developed and developing countries . \n it accounts for 4% of death of children under 5 years of age and 13% of children 5 - 15 years of age in the iranian population ; contributing to 15% of total loss of life in the under 15- year age group . \n however , despite the greatly improved clinical outcomes , children with cancer and their parents continue to experience significant distress throughout the course of the diagnosis and illness . \n a number of previous investigations demonstrated that parents of children with cancer experience elevated levels of distress [ 2 - 4 ] . \n findings vary based on measurement , but the most commonly identified types of distress are depression , anxiety , posttraumatic stress symptoms , and subjective symptoms of stress . \n it is estimated that moderate and severe symptoms of distress range from 15% to 51% [ 5 - 7 ] , especially in mothers [ 8 , 9 ] who report more emotional problems than fathers [ 10 , 11 ] . \n to date , there have been a few studies that have used parents as facilitators during their children s medical procedures . \n in fact , some studies [ 12 - 14 ] have designed stress management programs specifically for parents of children undergoing medical procedures . \n intervention programs generally incorporate procedural information and coping skills training ( i.e. , muscle relaxation , deep breathing , visual imagery , and positive self - statements ) . \n mbct includes mindfulness practices designed to cultivate nonjudgmental observation and acceptance of bodily sensations , cognitions , and emotions . \n participants learn to engage in sustained observation of these phenomena , with an attitude of interest and curiosity , and to accept them as they are , without trying to change or escape them . \n mbct also includes elements of cognitive therapy that are consistent with nonjudgmental acceptance of the experience . \n a decentered view of thoughts is emphasized , in which participants are encouraged to view their thoughts as transient mental events rather than as aspects of themselves or as necessarily accurate reflections of reality or truth . \n it is claimed that this interventional method has just recently been invented by cognitive therapists . \n however , historically the method had been considered by islamic philosophers few centuries ago i.e : imam fakhr razi who suggested the theory of imagination without judgment . \n the present study sought to evaluate the effectiveness of mbct on reduction of depression and anxiety symptoms in mothers of children with cancer . \n efficacy studies examine the effects of treatment in randomized controlled trials , involving recruited patients , using a highly structured treatment manual for a narrow problem focus . \n effectiveness studies examine the effects of treatment conducted in non research based clinical settings and purposive sampling . \n the aim of such research is to maximize the external validity or generalization of results to various settings . \n inclusion criteria were ( a ) possessing 19 score and above in beck depression inventory - ii ( bdi - ii ) ; ( b ) 15 score in beck anxiety inventory ( bai ) ; ( c ) meeting criteria for anxiety and depression determined by the modified version of the structured clinical interview for dsm iv ; ( d ) medically stable . \n patients with comorbid current major depression , substance abuse and/or dependence and psychosis were excluded from the study because of low concentration and orientation . \n one child was a girl and three were boys ( ages 5 - 12 ) . \n one child was diagnosed by neuroblastoma , and three by acute lymphoblastic leukaemia ( all ) . \n this paediatric treatment center had a social worker but s no treatment , systematic approach or recommendations were offered at this center regarding how mothers ' anxiety and depression should be handled during their children 's treatment procedures . \n ( table 1 ) the method used in this study was the single - case experimental design . in analyzing the data in the single case study , the dependent variable for the possible changes resulting from the independent variable \n the first criterion is to draw the graphs of subjects ' functions at the baseline and the intervention phase , and then compare them ; and the second criterion is to consider the slopes in each of the two - step graph - line during the intervention . \n thus , any trends or slopes in each stage are examined . in this study , \n we subtracted the pretest scores from the post - test scores and then divided the attained number by the pretest score . at the baseline state including 3 times measurement following 5 days of treatment , and 10 days after the end of the treatment and 10 days after the end of the treatment for follow up , subjects completed self - report measures of anxiety , and depressive symptomatology . to monitor the changes , \n the measurements were also performed at end of second , forth , sixth and eighth sessions . \n intervention program \n mindfulness training teaches a way of being rather than of doing , allowing participants to step back from automatic behaviours and habitual thought patterns . \n mbct is a psychological therapy which uses features of cognitive therapy with mindfulness techniques of buddhism . \n mbct consists of accepting thoughts and feelings without judgment rather than trying to push them out of consciousness , with aim of correcting cognitive distortions . \n mbct was found by zindel segal , mark williams and john teasdale , who based mbct on a program developed by jon kabat - zinn called mindfulness - based stress reduction ( mbsr ) , [ 21 - 23 ] which was adapted to use for patients with major depressive disorder . \n the aim of mbct is not directly provide relaxation or happiness , but is rather a \" freedom from the tendency to get drawn into automatic reactions to thoughts , feelings , and events \" . \n mbct programs usually consist of an eight week course with two - hour classes in each session with weekly assignments to be done after the sessions . \n the aim of the program is to enhance awareness so clients are able to respond to things instead of react to them . \n mindfulness practice helps us to see the patterns of the mind more clearly ; and to learn to recognize when our mood is beginning to go down . \n mindfulness teaches us a way in which we can get in touch with the experience of being alive . \n low mood can bring back memories and thoughts from the past , and make us worry about the future . \n mindfulness helps to halt the escalation of these negative thoughts and teaches us to focus on the present moment , rather than reliving the past or pre - living the future . when we start to feel low , we tend to react as if our emotions were a problem to be solved : we start trying to use our critical thinking strategies . \n when these do not work , we re - double our efforts to use them . \n we end up over - thinking , brooding , ruminating , and living in our heads . \n mindfulness helps us to enter an alternative mode of mind that includes thinking but is not just thinking . \n it teaches us to shift mental gears , from the mode of mind dominated by critical thinking ( likely to provoke and accelerate downward mood spirals ) to another mode of mind in which we experience the world directly , non - conceptually , and non - judgmentally . \n it helps develop our willingness to experience emotions , our capacity to be open to even painful emotions . \n it gives us the courage to let distressing moods , thoughts and sensations to come and go , without battling with them . \n increasing ability to rest within the present moment requires training in concentration and sustained attention . \n patients are trained to ground themselves in the moment as a starting point , for example , by paying attention to the movement of the breath or to body sensations . \n the body and the breath are constantly present , and the mind can return to them whenever awareness is lost . \n participants in the classes discover that they can not be fully aware of body sensations or the breath from moment to moment , if their minds wander off to another place or time . \n the body scan practice is designed to increase patients ability repeatedly to engage , sustain , and then disengage attention . \n participants move a focused spotlight of attention from one part of the body to another , as if they could breathe in to each location and explore sensations in depth just as they are before letting go and moving on . \n participants are encouraged to approach whatever sensations arise with an attitude of kindness , open curiosity , without judging them . \n when the mind wanders , they are invited simply to notice where it has gone and gently to shift attention back to the body . by staying with the body scan , mothers had an opportunity to notice how their experience changed from moment to moment and to practice a different way of responding to intense , uncomfortable sensations . \n developing nonjudgmental awareness of thoughts , body sensations , and physical stimuli ( sights , sounds ) facilitates adoption of this same nonjudgmental attitude when responding to negative thoughts , for example , about the self . \n participants develop an ability to see thoughts as mental events that pass through the mind , rather than as facts or central parts of their identity . \n for example , one exercise involves imagining thoughts that arise during sitting meditation as passing images on a cinema screen or as leaves floating past on a river . \n when mothers used this technique , they were surprised to discover that sustained but decenterd attention to the thoughts caused them to lose their ability to provoke an emotional reaction . \n the subjects found that many thoughts disappeared altogether as they watched them come and go ; and this made them to be keen to experience their thoughts and emotions by this technique in other situations . \n therapeutic package \n in this study , the interventions included in our manual were provided in eight sessions . in the first session , \n goals and techniques included building a rapport with the client , obtaining information from the client , providing psychoeducation on mindfulness , cbt , depression , and anxiety , identifying automatic thoughts and leading the client through a guided mindfulness meditation . in the second session , \n goals and techniques included helping the client recognize that most of her thoughts are not facts , teaching the client to use the thought record , educating client about cognitive distortion . \n goals and techniques in the third session included educating diaphragmatic breathing and sleep hygiene ; next , teaching the client a brief body scan exercise to reduce muscle tension . in the fourth session , \n goals and techniques included introducing mindful daily activity , teaching mindful eating and mindful labelling on thoughts , feelings and behaviours . in the fifth session , \n goals and techniques include to enhancing recognition of personal consequences of chronic worry , having the client perform a cost - benefit analysis of her chronic worry , scheduling worry time and mindful worry - free zones . \n goals and techniques in the sixth session included generating a hierarchy of worries , imaginary exposure with acceptance , incorporating in vivo exposure through increased participation in planned events . in the seventh session , \n goals and techniques included helping the client learn to identify and respond to early signs of relapse , collaborating with the client to generate responses to her early warning signs , helping the client practice developing a worry action plan . in the eighth session , \n goals and techniques included reviewing the insights and techniques found most useful by the client , identifying obstacles to practice mindfulness , providing a checklist of the techniques included in the program . \n beck anxiety inventory ( bai ) \n the bai ( 24 ) is a 21-item scale developed to address the need of an instrument that would reliably discriminate anxiety from depression while displaying convergent validity . \n the items are summed to obtain a total score which range from 0 to 63 . \n numerous studies have reported alpha internal consistency and the results are consistent across a wide range of respondents . \n for example , alpha of 0.90 was found for undergraduates and alpha of 0.94 was found for outpatients with anxiety disorder . \n considering concurrent validity , the correlation between the beck anxiety index and the hamilton rating scale for anxiety is 0.47 and correlation with brief symptom inventory ( anxiety scale ) is 0.69 . \n discriminate validity of scale was obtained in a study of psychiatric outpatients through their anxiety ( 94% ) [ 24 - 26 ] . \n beck depression inventory - ii ( bdi - ii ) \n the beck depression inventory - second edition ( bdi ii ) is a 21-item scale and one of the most widely used self - report measures of depression . \n beck cited alphas of 0.93 for college students and 0.92 for outpatients , in another study steer et al . reported an alpha of 0.92 for the bdi - ii . \n beck reviewed 11 studies that showed the bdi is capable of discriminating between groups that differ in level of depression . a further 35 concurrent validation studies compared the bdi with other ratings of depression . \n fourteen studies reported correlations between the bdi and clinical ratings ; coefficients for psychiatric patients ranged from 0.55 to 0.96 , with a mean of 0.72 . \n the correlation between the earlier version of bdi and ( bdi ii ) was 0/93 and kappa agreement was 0.70 . \n diagram 1 shows that the participant 's depression and anxiety level is 23 in bdi - ii and 34 in bai approximately at the baseline statement . \n these scores are severe and moderate rates of depression in bdi - ii and anxiety in bai . \n she obtained a score of 13 in bdi - ii and 15 in bai at end of session 2 ; and this reduction was continued except for session 6.between fifth and seventh sessions , her child was in chronic paediatric medical condition . \n her scores in posttest measurement was 10 in bdi - ii and 8 in bai that indicate reduction in symptoms of depression and anxiety . \n ( figure 1 ) diagram 2 shows that participant 's depression and anxiety levels were 19 - 29 in bdi - ii and 26 - 29 in bai approximately at the baseline statement . \n these scores are in severe and moderate range of depression in bdi - ii and anxiety in bai . she obtained a score of 16 in bdi - ii and 18 in bai at end of session 2 . her scores in post - test measurement were 6 in bdi - ii and 15 in bai that indicate reduction in symptoms of depression and anxiety . \n her improvement quotient was % 74 for depression and % 46 for anxiety.(figure 2 ) diagram 3 shows that participant 's depression and anxiety levels are 24 - 28 in bdi - ii and 31 - 38 in bai approximately at the baseline statement . \n these scores are in severe and moderate rate of depression in bdi - ii and anxiety in bai . \n she got the score of 22 in bdi - ii and 15 in bai at the end of session 2 . \n her scores in post - test measurement were 14 in bdi - ii and 8 in bai that indicate reduction in symptoms of depression and anxiety . \n her improvement quotient was % 46/83 for depression and % 77/14 for anxiety.(figure 3 ) diagram 4 shows that participant 's depression and anxiety levels are 21 - 26 in bdi - ii and 30 - 37 in bai approximately at the baseline statement . \n these scores are severe and moderate range of depression in bdi - ii and anxiety in bai . \n she got the score of 12 in bdi - ii and 22 in bai at the end of session 2 . \n her scores in post - test measurement were 7 in bdi - ii and 14 in bai that indicate reduction in symptoms of depression and anxiety . \n her improvement quotient was % 86/95 for depression and % 59/22 for anxiety.(figure 4 ) all participants showed scores of 21 - 28 at the baseline statement that indicated severe and moderate depression ( 19 - 29 ) in bdi - ii . \n post - test of three participants ( a , b and c ) is in low or no depression \n remain ( less than 10 ) and one participant ( d ) remains in low or moderate depression ( 10 to 18 score).(figure 5 ) all participant possessed scores of 26 - 38 at the baseline statement that indicated severe anxiety ( 19 - 29 ) in bai . visual observation of diagrams demonstrated a decline of scores . \n post - test of all participants showed low or moderate anxiety ( 8 - 18 score).(figure 6 ) \n there has been limited research regarding psychosocial interventions about mothers of children with cancer because their problems to be sophisticated . \n however , studies demonstrated that the symptoms of depression and anxiety have been reduced using mindfulness - based cognitive therapy in these mothers . \n the current study , which is consistent with ingram , hayes , and scott theory ( 2000 ) , explains the result in four areas to evaluate the performance of cognitive therapy . \n universality of change ( what is the percentage of the improvement ? ) \n differences between base line and post - test scores demonstrated that examinees show positive improvement on both beck depression and anxiety scales . \n the percentages of recovery on depression were : participant a : 78.87% ; participant b : 74% ; and participant c : 46.83% . \n percentages of recovery on anxiety were : participant a ( 76.92% ) ; participant b : ( 46% ) , participant c : ( 77.14% ) ; and participant d : ( 59.22% ) \n . \n generality of change ( what are the changes in relation to critical situations and jobs ? ) \n according to harding ( 1996 ) , madan - swain and brown ( 1991 ) , the studies showed that a child 's cancer effects parents in spending their energy on the patient diverted all his attention to care for the sick child and find himself detached from the other family members . at the end of the final sessions , the participant found himself having a better relationship with his spouse and child . \n however , it should be noted that the child seeks more attention from the mother . \n ( 2001 ) found that after using mindfulness - based cognitive therapy on patients with depression or dysthymia , recovery can be observed on their over general autobiographical memory . over general autobiographical memory \n is a capacity to recall categories of events in a coherent and continuous way when the subjects are asked to provide specific instances from their life ( 17 ) . \n participant b had more difficult problems with her husband about how to care for their sick child . \n she was suffering as a result of arguments with her husband at the presence of their child and this led to a big fight between them . at the end \n , she showed a significant improvement in her over general autobiographical memory and marital satisfaction . \n she was suffering from lack of concentration and chronic fatigue in her office during work hours ; she was late for work every morning and used up all her breaks and vacations that resulted in a critical job situation . at the end of the therapeutic sessions \n , she has shown an improvement on her anxiety symptoms by ( 77.8 % ) ; however , her anxiety improvement was poor compared to other subjects ( 47.7% ) , but still significant . \n participant d also showed ( 86.95% ) improvement in her depression rate ; however , less recovery was observed on her anxiety level ( 59.22% ) . \n while she was undergoing therapeutic sessions for her own anxiety symptoms , she was facing her son chronic medical condition . \n therefore , the result shows a strong correlation between her anxiety scores and her son relapse condition . \n this indicated the real extent of her condition . at the end of her anxiety therapy session , \n mohammad valimirza indicated that those children whose parents dealt with their condition more effectively , experience less situational anxiety . comparing the participants scores at base line , post - test , and follow up in both depression and anxiety showed a great deal of improvement on the scales , and led to a full recovery . \n stability ( treatment achievements ) \n follow up result ( 30 days after the last therapy session and 5 days after post - test ) indicated that depression of participants a and d both maintained in the score of less than 10 which indicates the state of no depression or least depression . \n participant b with the score of 10 , and participant c with the score of 16 were categorized in a range of 10 - 18 with a diagnosis of mild to moderate depression ; and it can be stated that mbct provided them with a relative stability . \n anxiety of participants a , b , and c with the score of 11 , 12 , and 5 respectively indicated the effectiveness of this kind of treatment for anxiety . \n participant d , with 1 score above the cut of point ( 15 ) , represented a poorer result in regards to the therapy achievements . in summary , the current study demonstrated that mindfulness - based cognitive therapy has a significant effect on both depression and anxiety on our sample . \n the anxiety and depression both changed in different ways . according to psychological interviews which the therapist carried out with mothers , this treatment approach significantly improved the relationship of these mothers with themselves , and their family , and also improved their social functions . \n the results have coherency with studies which emphasize the effectiveness of mbct for treatment of depression , anxiety and stress and to improve psychosocial adjustment of people [ 21- 23 ] . \n because psychological conditions of mothers can affect their children wellbeing , it is suggested that future research concentrate on direct effectiveness of mbct on the mothers and on indirect improvement of medical condition of children with cancer . \n as mentioned in the article , the root of mindfulness can be found in theories of some islamist logic experts such as imam fakhr razi . \n therefore , it is suggested that the whole procedure of mbct should be developed based on iranian- islamic culture . \n in summary , the current study demonstrated that mindfulness - based cognitive therapy has a significant effect on both depression and anxiety on our sample . \n the anxiety and depression both changed in different ways . according to psychological interviews which the therapist carried out with mothers , this treatment approach significantly improved the relationship of these mothers with themselves , and their family , and also improved their social functions . \n the results have coherency with studies which emphasize the effectiveness of mbct for treatment of depression , anxiety and stress and to improve psychosocial adjustment of people [ 21- 23 ] . \n because psychological conditions of mothers can affect their children wellbeing , it is suggested that future research concentrate on direct effectiveness of mbct on the mothers and on indirect improvement of medical condition of children with cancer . \n as mentioned in the article , the root of mindfulness can be found in theories of some islamist logic experts such as imam fakhr razi . \n therefore , it is suggested that the whole procedure of mbct should be developed based on iranian- islamic culture .", "role": "user" }, { "content": "backgroundfindings demonstrated that parents of children with cancer experience elevated levels of distress , depression , anxiety , posttraumatic stress symptoms , and subjective symptoms of stress . in this study , we determined effectiveness of mindfulness - based cognitive therapy ( mbct ) on reduction of depression and anxiety symptoms in mothers of children with cancer . \n methodsfour mothers whose children had cancer were diagnosed to have depression and anxiety symptoms , using beck anxiety inventory , beck depression inventory ii , and structured clinical interview for dsm - iv . \n they were selected through purposeful sampling to participate in this experimental single - case study . after the baseline was determined \n , subjects attended an eight - session program of mindfulness - based cognitive therapy.resultsthe comparison of baseline and post - test showed that depression and anxiety symptoms decreased through mbct . \n improvement quotient for depression and anxiety of each subject was good . \n conclusiondata showed that mbct reduced depression and anxiety symptoms in mothers of children with cancer .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: prostate - specific antigen ( psa ) and digital rectal examination ( dre ) are well known as the most valuable screening tests for diagnosis of prostate cancer . \n commonly , when serum psa is increased or the dre shows an unusual aspect , transrectal ultrasound - guided prostate biopsy ( trus biopsy ) is used to confirm the prostate cancer . in clinical practice , however , a significant number of negative biopsies are found according to these criteria . \n therefore , it is necessary to consider repeat prostate biopsy when patients have any clinical suspicion of prostate cancer , even if the initial prostate biopsy has a benign result . \n the economic burden and physical discomfort to the patient make it hard to decide whether to perform repeat biopsy . \n psa , psa density , and psa velocity are commonly assessed to determine the necessity of repeat biopsy , but each of these tools has limitations to some extent . to overcome these limitations \n , many urologists are making an effort to find more reliable diagnostic tools that can be used to more accurately select patients who need repeat biopsy . eventually , these efforts will lead to a reduction of unnecessary biopsies . according to lin et al . , the serum psa ratio ( baseline total serum psa and post - trus biopsy total serum psa ) of patients with benign prostatic hypertrophy ( bph ) is higher than that of prostate cancer patients . \n choi et al . reported similar results in a study from korea . in this study , we investigated whether the psa change ratio ( ratio of post - biopsy psa to baseline psa ) at the initial biopsy could be a predictive factor of prostate cancer and helpful when deciding whether to perform a repeat prostate biopsy . \n from january 2007 to december 2010 , 1,636 patients overall underwent trus biopsy in our clinic kyung - pook national university hospital for diagnosis of prostate cancer because of serum psa elevation of more than 3 ng / ml or abnormal dre findings . \n of the 1,636 patients , 151 patients who underwent repeat prostate biopsy due to clinical suspicion of prostate cancer ( sustained or elevated psa , abnormal dre , or hypoechoic lesion on follow - up trus ) despite initial benign results were included in this retrospective study . at the first prostate biopsy \n , all patients took oral quinolone antibiotics for 4 days from 1 day before the procedure to 3 days after . \n biopsy was done by use of an 18 g biopsy needle under the guidance of transrectal ultrasound ( acuson sequoia512 , siemens ag , medical solutions , forchheim , germany ) with the patient in the left - lateral decubitus position . \n we performed routine 10-core biopsy but took more cores in the case of hypoechoic lesions on trus or abnormal nodules on the dre . \n the baseline serum psa was measured right before prostate biopsy , psa density was calculated as baseline serum psa divided by total prostate volume , and post - biopsy serum psa blood sampling was done 60 minutes after the last biopsy core was attained . \n the psa change ratio was defined as the ratio of post - biopsy total serum psa to baseline total serum psa at the initial biopsy . \n we divided the patients into two groups according to the results of the repeat biopsy : benign prostate patients ( group a ) and prostate cancer patients ( group b ) . \n we compared age , biopsy interval , baseline psa , psa density , post - biopsy psa , and the psa change ratio between the two groups . \n sensitivity , specificity , positive predictive value ( ppv ) , and negative predictive value ( npv ) were calculated at each psa change ratio cut - off ( 1.5 , 2.0 , 2.5 , 3.0 , 3.5 , 4.0 , 4.5 , 5.0 ) . \n the most effective cut - off was analyzed by use of receiver operating characteristic ( roc ) curves . \n the data were compared and analyzed with the student 's t - test and paired t - test . \n of the 151 patients , 129 ( 85.4% ) patients were diagnosed with benign prostate ( group a ) and 22 ( 14.6% ) patients were diagnosed with prostate cancer ( group b ) according to the repeat biopsy results . \n mean age and biopsy interval were 64.82 years and 9.48 months in group a and 66.40 years and 8.91 months in group b , respectively . \n mean serum baseline psa , psa density , post - biopsy psa , and psa change ratio were 7.45 ng / ml , 0.177 ng / ml / cc , 64.87 ng / ml , and 11.03 in group a and 8.84 ng / ml , 0.198 ng / ml / cc , 24.29 ng / ml , and 2.98 in group b , respectively . there were significant differences in post - biopsy psa and the psa change ratio between the two groups ( p<0.001 and p<0.001 , respectively ) ( table 1 ) . \n sensitivity , specificity , ppv , and npv at each cut - off of the psa change ratio are shown in table 2 . \n the effective cutoffs were 3.0 , 3.5 , and 4.0 according to the roc curve analysis . \n taking 3.0 , 3.5 , and 4.0 as the cut - off values , sensitivity , specificity , ppv , and npv were 68.2% , 74.4% , 31.3% , and 93.2% ; 72.7% , 69.0% , 28.6% , and 93.7% ; and 77.3% , 65.1% , 27.4% , and 94.4% , respectively . in the roc curve analysis , \n the psa change ratio showed statistical significance for diagnosis of prostate cancer ( area under the curve , 0.800 ; 95% confidence interval , 0.706 to 0.893 ; p<0.01 ) ( fig . \n prostate cancer is the most common malignant tumor in american males and is dramatically increasing in korea because of changes in diet , the increasing population of elderly people , and the development of diagnostic techniques . according to song et al . \n , the estimated prostate cancer detection rate in korean men aged 55 years or older is 3.36% . \n moreover , according to the ministry of health and welfare 's annual report of cancer statistics in 2008 in korea , prostate cancer took 4th place in korean males with a 5-year prevalence of 8.2% of all cancers and took 5th place in 5-year incidence as 7% of all cancers . for the diagnosis of this increasing prostate cancer , serum psa and dre \n are very widely used as screening tests , and if prostate cancer is clinically suspected , prostate biopsy is recommended to confirm the prostate cancer [ 5 - 7 ] . \n serum psa is the most common screening test for diagnosis of prostate cancer and is a very specific marker for the prostate . normally , the serum psa density is low in disease - free adult males , and it is a traditionally well - known indication for prostate biopsy when it is higher than 4 ng / ml . in recent studies , \n however , the diagnosis of prostate cancer was shown to be more effective if prostate biopsy is recommended when serum psa is higher than 2.5 ng / ml . \n various psa cut - off values for prostate biopsy indication are used by different clinics . \n the biopsy indication at our clinic is when the psa is elevated to more than 3 ng / ml . although serum psa is the most commonly used indicator for prostate cancer screening and shows high specificity , it also increases in variable situations such as dre , cystoscopy , trus , bacterial prostatitis , and acute urinary retention . \n for example , age - adjusted psa , psa velocity , percent free psa , and psa density are used to increase sensitivity and specificity [ 11 - 15 ] . despite much effort to increase the sensitivity and specificity of prostate cancer screening , the negative detection rate of prostate biopsy \n is reported to be up to 75% . also , according to rabbani et al . \n considering these high false - negative rates , patients need repeat biopsy if they have clinical suspicion of prostate cancer even though the first biopsy shows benign results . \n several studies have shown that the cancer detection rate is as high as 24.3 to 36.2% from a systematic 10- or 12-core biopsy procedure in patients who previously had a negative sextant biopsy result . \n , it is necessary to consider repeat prostate biopsy when percent free psa is less than 30% or transition zone psa density is more than 0.26 ng / ml / cc to reduce unnecessary biopsies and increase specificity . \n this research shows that the sensitivity and specificity of repeat prostate biopsy were 90% and 50% when the percent free psa cutoff value was set at 30% , and 78% and 52% when the transition zone psa density cutoff value was set as 0.26 ng / ml / cc . \n some research suggests that it is necessary to consider repeat prostate biopsy when the first biopsy result shows high - grade prostatic intraepithelial neoplasm or atypical small acinar cell proliferation . \n furthermore , according to horinaga et al . , 1-antichymotrypsin - psa complex adjusted for transition zone volume has significance for determining whether to perform repeat prostate biopsy . \n first stated the phenomenon of a significant increase of the serum prostate acid phosphatase and psa after a prostate aspiration biopsy , and the psa increase was significantly greater in patients with bph than in those with prostate cancer . \n reported that prostate biopsy causes a transient increase in free and total psa . to explain these phenomena , lin et al . hypothesized that the psa clearance and conjugation mechanism of prostate cancer patients is on alert because the cancerous tissue has been continuously leaking psa . \n by contrast , psa clearance in bph patients is slower than that of prostate cancer patients , and benign prostate tissue leaks more psa than does prostate cancer tissue per unit when the prostate biopsy is performed . \n they analyzed the relationship between the psa change ratio and cancer detection rate on prostate biopsy and reported that sensitivity , specificity , ppv , and npv were 78.1% , 94.1% , 92.5% , and 82.1% , respectively , when the psa change ratio cut - off value was 2.0 , and the analysis was statistically significant . \n choi et al . performed similar research regarding the role of the psa change ratio in korea , but their results were solely limited to the first prostate biopsy and were not confirmed by re - biopsy . \n if the patients who showed a benign result initially were clinically suspicious in the follow - up , they should have been given second or third biopsies . \n our study complements the limitations of this previous research with further follow - up and repeat prostate biopsies . \n the result of the present study show that the psa change ratio at the initial biopsy has statistical significance for predicting prostate cancer in the repeat prostate biopsy ( p<0.01 ; cut - off value , 3.0 to 4.0 ) . \n the psa change ratio is thought to have a great role when doctors are faced with making the decision of whether to perform a repeat prostate biopsy \n . however , our results show a higher cut - off value than that previously reported in the studies of lin et al . or choi et al . \n it may be hard to distinguish whether the prostate cancer detected at the repeat biopsy was newly developed after the first biopsy or whether undetected cancer from the first biopsy was discovered at the second biopsy . \n also , our results have a limitation due to the small scale of the patient group . \n accordingly , we need to identify a strict cut - off value of the psa change ratio in a larger patient group . \n another limitation of our study is that the psa ratio was compared only at the first prostate biopsy . \n further investigations with third or later biopsy results are necessary to confirm our initial findings in this relatively small patient series . \n the psa change ratio could be a novel decision - making marker for performing repeat prostate biopsies . according to the results of our study , it is recommended that doctors consider repeat prostate biopsy when the psa change ratio is less than 3.0 to 4.0 . \n the psa change ratio could reduce unnecessary prostate biopsies ; however , we can not completely exclude prostate cancer even if the psa change ratio is more than 3.0 to 4.0 . \n active follow - up is still necessary for patients who are clinically suspicious for prostate cancer . \n further investigations with large - scale , multicenter studies are necessary to identify strict cut - off values of the psa change ratio .", "role": "user" }, { "content": "purposeprostate biopsy is used to confirm the prostate cancer . \n although first biopsy result was benign , repeat biopsy is recommended for the patient who has higher risk of prostate cancer . in this study , we investigated the psa change ratio ( post - biopsy psa to baseline psa ) whether it could be predictive factor of prostate cancer and helpful when decided to perform repeat biopsy.materials and methods151 patients , first diagnosed as benign , but underwent repeat biopsy due to clinical suspicion of prostate cancer were included . \n post - biopsy psa was checked 60 minutes later after biopsy . \n psa change ratio was defined as post - biopsy psa to baseline psa . according to results of repeat biopsy \n , patients were divided into benign group ( group a ) and cancer groups ( group b ) . between two group baseline psa , psa density , \n post - biopsy psa and psa change ratio were compared , and most effective cut - off value was analyzed using receiver operating characteristic ( roc).results129 men were benign , 22 men were prostate cancer according to results of repeat biopsy . between two groups , \n post - biopsy psa and psa change ratio were statically significant differences . \n ( p<0.001 , < 0.001 ) the effective cut - off value was 3.0 , 3.5 and 4.0 according to roc . at roc curve , \n psa change ratio was statistically significant for diagnosis of prostate cancer . \n ( auc 0.800 , p<0.001).conclusionspsa change ratio is thought be a predictive factor for prostate cancer . \n if the psa change ratio was less than 3.0 - 4.0 , repeat biopsy should be considered to confirm the diagnosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: among the various sources for the development of new drugs , compounds from living organisms , so called natural products , are of particular significance . \n approximately one third of today s best selling drugs are either natural products or have been developed based on lead structures provided by nature . \n recent examples of plant - derived anti - cancer drugs include paclitaxel ( taxol ) from taxus brevifolia , etoposide ( vepesid ) derived by partial synthesis from the lignan podophyllotoxin isolated from podophyllum peltatum and irinotecan ( camptosar ) obtained based on the lead structure of camptothecin isolated from camptotheca acuminata . \n use of medicinal plants is well documented throughout human history but is by no means restricted to humans as apes such a chimpanzees have been shown to use plants for the treatment of wounds or to fight intestinal parasites . \n looking at drugs from nature it is surprising that up to now almost all medicinally used natural products or derivatives thereof were obtained from terrestrial organisms rather than from those inhabiting the sea . \n the oceans cover more than 70% of the earthsurface and are an indispensable source of protein for human nutrition . with regard to drug discovery and development , \n however , the oceans started to attract interest from pharmaceutical companies and research institutions only approximately 50 years ago with the discovery of the sponge - derived nucleosides spongothymidine and spongouridine ( fig . \n 1 ) . since then well over 14,000 different natural products from marine organisms have been described , hundreds of patents describing new bioactive marine natural products have been filed and approximately 10 15 different marine natural products are currently in clinical trials mostly in the areas of cancer , pain or inflammatory diseases . in spite of all efforts in marine natural products chemistry over the last three decades , \n no marine - derived compound ( or analogue derived thereof ) has been so far successfully launched to the drug market except for the anti - viral drug acyclovir and the antibiotic cephalosporin . \n acyclovir which was synthetically known as ara a , was modeled based on sponge - derived spongothymidine or spongouridine . \n ara a along with its acetyl congener ara u , were later isolated as natural products from the gorgonian eunicella cavolini . \n the cephalosporins had first been described from fungi isolated close to a sewage effluent in the mediterranean sea . \n thus , the major break through in drug discovery from the sea has so far not happened but is still eagerly awaited by those active in the field . \n what are plausible reasons and obstacles that have slowed down marine drug development and what could be promising research avenues that will possibly provide solutions for the future ? \n the fact that virtually no marine natural product can so far be found on the shelves of pharmacies is certainly not due to a limited chemical diversity of marine organisms . as stated above marine sources \n have provided well over 14,000 different natural products many of them being structurally unique and absent from terrestrial organisms . \n incidence of biological or pharmacological activity in marine derived compounds is high especially with regard to cytotoxicity where marine - derived extracts clearly surpass those of terrestrial origin . \n it is no surprise therefore that marine natural products have their stronghold in the area of anti - cancer chemotherapy as indicated by the list of compounds currently under clinical investigation . \n closer inspection of this list reveals that marine invertebrates such as sponges , tunicates , bryozoans and molluscs are the most interesting sources of pharmacologically active metabolites whereas for example seaweeds that grow so abundantly or other marine algae appear to be less promising in comparison . \n 2 ) which is presently in clinical trials for the treatment of tumors has been derived from the cartilage of the dogfish shark , squalus acanthias . \n a serious problem with regard to drug development and sustainable production that is shared by marine sponges , tunicates and other chemically interesting invertebrates lies in the patchy occurrence of these organisms and the limited amounts of biomass available from wild stocks . \n the supply problem that applies to many marine organisms and compounds derived from the latter has in the past severely hampered drug development from marine sources . \n many pharmacologically interesting marine natural products such as ecteinascidin 743 ( et-743 ) ( fig . \n 3 ) from the tunicate ecteinascidia turbinata , the halichondrins from lissodendoryx sponges ( fig . \n 2 ) , all of which are presently under clinical evaluation or candidates for clinical trials , can be isolated only in minute yields . \n for example , in order to obtain approximately 1 g of the promising anti - cancer agent et-743 , close to 1 metric tonne ( wet weight ) of e. turbinata have to be collected and extracted . for halichondrin b , a powerful cytostatic polyketide of sponge \n origin the ratio of compounds vs. biomass is even more unfavorable : from 1 metric tonne of the sponge lissodendoryx sp . only ca . \n based on these extremely low yields clinical trials with patients are already a formidable challenge not to speak of the supply problem that will have to be met once a compound makes it to the market as a drug . \n for example , provided that the halichondrins will at one time be successfully launched for the treatment of cancer it is estimated that the annual need for these compounds will fall in the range of 1 5 kg per year . \n this corresponds to roughly 3,000 16,000 metric tonnes of sponge biomass which would have to be collected and processed annually . \n it is clear that this task could never be completed successfully given the limited distribution of the respective sponges . \n total synthesis of pharmacologically active marine natural products such as et-743 , halichondrin b , the bryostatins and others has been successfully established but is in many cases economically not feasible due to the complexity of the molecular structures and the low yields of final products achieved . \n a notable exception is the pain - killing peptide -conotoxin mviia ( snx-111 ) from the fish hunting marine mollusc conus magus ( generic name ziconotide ) ( fig . \n 2 ) which due to its peptide nature can be obtained in virtually unlimited amounts through synthesis . \n other strategies to solve the pressing supply problem which is the key issue in marine drug discovery appear to be more promising in the foreseeable future . \n one of these approaches is mariculture which has been successfully developed in the past for example for fishes or shrimps and is already earning billions of dollars annually worldwide . using mariculture for sustainable production of marine natural products other than polymeric carbohydrates such as agar , \n considerable progress in this area has been achieved with the bryozoan bugula neritina ( the source of the bryostatins ) and with the tunicate e. turbinata ( the source of et-743 ) . even though the biomass of marine invertebrates accessible through mariculture is up to now still not sufficient to meet \n the market demands provided that one of these compounds enters the drug market , this approach certainly holds considerable opportunities for the future and can be expected to contribute at least in some cases to a satisfactory solution of the supply problem . \n nevertheless possible problems related to mass culture of marine invertebrates should not be forgotten since destruction of culture facilities and stocks by storms or by diseases are possible scenarios and will make predictability of the year to year harvest difficult . \n close inspection of the structures of pharmacologically active natural products isolated from sponges , tunicates and other marine invertebrates sometimes reveals striking chemical similarities to known microbial metabolites ( fig . \n jaspamide ) that is isolated from marine jaspis sponges and is used as a molecular tool in cell biology being a cell permeable f - actin probe shows a close structural relation to chondramide d known from the myxobacterium chondromyces crocatus [ 12 ] . \n inspection of the structural features of et-743 from the tunicate e. turbinata reveals striking similarities to safracin b , a metabolite of pseudomonas fluorescens . \n this chemical similarity is in fact so pronounced that biotechnologically available cyanosafracin b provides a commercially feasible precursor for the partial synthesis of et-743 . \n 4 ) , a close structural analogue of dolastatin 10 isolated from the marine mollusc dolabella auricularia and currently in phase ii clinical trials was found to be a metabolite of the blue - green alga symploca hydnoides [ 15 , 16 , 17 ] . \n sometimes even identical metabolites are found both in microorganisms and marine invertebrates as exemplified by staurosporine recently isolated from the micronesian tunicate eudistoma toealensis and the predatory flatworm pseudoceros sp . . \n 4 ) is a typical metabolite of actinomycetes such as saccharothrix aerocolonigenes subsp . staurorosporea . \n derivatives of this alkaloid have received considerable attention due to their pronounced cytotoxic activity which at least in part results from inhibition of protein kinases . \n the striking similarity of some microbial metabolites and natural products from marine invertebrates has aroused much speculation in the past ( fig . \n 4 ) . given the fact that many marine invertebrates are filter feeders that ingest bacteria or other small particles from the inhaled sea water , it is possible that some bioactive metabolites previously isolated from sponges or tunicates are in fact of microbial origin and are actually taken up through the food chain . \n this has been shown for the protein phosphatase inhibitor okadaic acid obtained from halichondria sponges . \n later it was shown that this compound is produced by dinoflagellates of the genus prorocentrum . \n it can be speculated that the food chain will also be responsible for other structurally unusual metabolites recovered from marine invertebrates even though each suspected case needs to be carefully examined and generalizations must be avoided . \n sustainable production of the desired metabolites by biotechnological means could be envisaged if the respective producers are amenable to mass culturing and if a pharmacologically active natural product obtained from sponges or other invertebrates can be unequivocally traced to exogenous sources such as bacteria or cyanobacteria . \n however , sponges and other filter feeders do not only live from but also with bacteria as anatomical studies using electron microscopy usually reveal . \n sometimes these associated bacteria are responsible for a large proportion of the biomass of their host organism . \n for example , the bacterial concentration in the mediterranean sponge aplysina aerophoba exceeds that of the surrounding sea water by two or three orders of magnitude . \n judging from microscopic analysis , up to 40% of the sponge volume consists of bacteria and cyanobacteria . \n for some marine sponges a direct contribution of associated bacteria ( sometimes considered endosymbionts ) to natural product biosynthesis has been proven ( fig . \n the sponge theonella swinhoei collected in the philippines or in micronesia contains the cyclic peptide theopalauamide and the macrolide swinholide a. both compounds exhibit interesting biological activities . \n theopalauamide shows anti - fungal activity , swinholide a is strongly cytotoxic . using differential centrifugation several cellular fractions \n theopalauamide was detected in filamentous bacteria whereas swinholide a was found in a fraction containing mostly unicellular bacteria . \n based upon 16s rdna gene sequencing the filaments that contained theopalauamide were shown to belong to the -proteobacteria as a sister taxon to myxococcales . \n t. swinhoei is by no means a singular case since bacteria were also shown to be producers of natural products in the sponge dysidea herbacea . \n using a cell sorter it was demonstrated that the amino acid derivative 13-demethylisodysidenin ( fig . \n 5 ) was the major natural product identified in the fluorescent cell fraction ( cyanobacteria ) whereas sponge cells and bacteria ( the latter were not separated in this case ) contained spirodysin and herbadysidolide [ 23 , 24 ] . \n it would seem a logical step trying to isolate and cultivate putative bacterial producers outside of their invertebrate hosts in order to set up a sustainable and manageable source of pharmacologically active compounds . \n however , many ( if not most ) bacterial inhabitants in sponges appear to be highly selective with regard to culture media and conditions which probably reflects their evolutionary adaptation to the conditions provided by the host . \n attempts to culture the theopalauamide producing bacteria from the sponge t. swinhoei , for example , have have failed so far . from the sponge a. aerophoba \n less than 1% of the bacteria present within the host tissue could be cultured using the standard zobell medium . \n thus , considerable effort will have to be devoted in the future into the design of novel growth media and culturing conditions for sponge - associated bacteria in order to make these highly interesting organisms culturable under in vitro conditions and to tap their unique biosynthetic capacity for a biotechnological production of pharmacologically active natural products . \n should these efforts be ultimately successful , implications for solving the pressing supply problem for therapeutically relevant marine natural products would indeed seem tremendous . a further methodologically even more advanced approach with regard to a sustainable biotechnological production of pharmacologically important metabolites from marine invertebrates ( including their endosymbionts \n ) will certainly focus on cloning and expression of the respective key biosynthetic gene clusters . whereas this approach has so far not met with success for marine organisms the viability of this strategy \n was corroborated in a recent study on the genetic background of pederin production in paederus beetles . \n pederin is a polyketide amide present for example in paederus fuscipes beetles and shows strong cytotoxicity against various human cancer cell lines in vitro as well as in vivo . \n 3 ) from the marine sponge mycale sp . that shows likewise high toxicity to eukaryotic cells . \n 16s rrna analysis of pederin containing beetles indicated the presence of a predominant symbiotic bacterium with a close relationship to pseudomonas aeruginosa . \n the putative pederin biosynthesis genes were recently cloned from total dna of p. fuscipes beetles . \n sequence analysis of the gene cluster which includes a mixed modular polyketide synthase / nonribosomal peptide synthase and tailoring enzymes revealed typical bacterial gene architecture and homologies thus providing unequivocal proof for the prokaryotic origin of pederin . based on the close structural homologies between pederin and mycalamide \n a it is more than likely that the latter compound will also originate from microorganisms rather than from sponge cells even though experimental proof for this hypothesis is not available so far . as shown for pederin , knowledge of the biosynthetic origin of the respective compound and of the key enzymes involved ( polyketide synthase and nonribosomal peptide synthase ) can be of considerable advantage in elucidating the role of endosymbionts for natural products in invertebrates . for many other marine natural products , however , their biosynthetic origin is either completely unknown or only poorly understood [ 31 , 32 ] . \n obviously , advantages in this field will be important for understanding symbiotic relationships also of other eukaryotic hosts and their prokaryotic symbionts in the future . \n the study on the biosynthetic origin of pederin furthermore opens up new approaches for the biotechnological production of drugs or drug candidates from the sea without the various constraints such as culturability of eukaryotic hosts or prokaryotic symbionts that have been discussed above . with the steady advance of molecular biological techniques \n a solution of the still pressing supply problem of drugs from the sea appears to be indeed in sight in the foreseeable future .", "role": "user" }, { "content": "the supply problem with regard to drug development and sustainable production lies in the limited amounts of biomass of most marine invertebrates available from wild stocks . \n thus , most pharmacologically active marine natural products can only be isolated in minute yields . \n total synthesis of pharmacologically active natural products has been successfully established but is in many cases economically not feasible due to the complexity of the molecular structures and the low yields . to solve the pressing supply issue in marine drug discovery , other strategies appear to be more promising . \n one of these is mariculture which has successfully been established with the bryozoan bugula neritina ( the source of the bryostatins ) and the tunicate ecteinascidia turbinata ( the source of et-743 ) . \n another strategy involves partial synthesis from precursors which are biotechnologically available . \n an example is et-743 that can be partially synthesized from safracin b which is a metabolite of pseudomonas fluorescens . \n there have been many examples of striking structural similarities between natural products obtained from marine invertebrates and those of microbial origin which suggests that microorganisms living in their invertebrate hosts could be the actual producers of these secondary metabolites . with regard to sustainable biotechnological production of pharmacologically important metabolites from marine invertebrates and their endosymbionts \n , a more advanced strategy is to focus on cloning and expression of the respective key biosynthetic gene clusters . \n this molecular biological approach will open up new avenues for biotechnological production of drugs or drug candidates from the sea .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a transmitter compresses a set of sequences by constructing a regular expression that describes the regions of similarity in the sequences . to retrieve the original set of sequences \n an alignment algorithm uses minimum description length to encode and explore alternative expressions ; the expression with the shortest encoding provides the best overall alignment . \n when two substrings contain letters that are similar according to a substitution matrix , a code length function based on conditional probabilities defined by the matrix will encode the substrings with fewer bits . in one experiment , \n a second experiment measured the accuracy of the new method on pairwise alignments of sequences from the balibase alignment benchmark . \n ", "role": "user" }, { "content": "this paper presents a new information theoretic framework for aligning sequences in bioinformatics . \n a transmitter compresses a set of sequences by constructing a regular expression that describes the regions of similarity in the sequences . to retrieve the original set of sequences \n , a receiver generates all strings that match the expression . \n an alignment algorithm uses minimum description length to encode and explore alternative expressions ; the expression with the shortest encoding provides the best overall alignment . \n when two substrings contain letters that are similar according to a substitution matrix , a code length function based on conditional probabilities defined by the matrix will encode the substrings with fewer bits . in one experiment , \n alignments produced with this new method were found to be comparable to alignments from . \n a second experiment measured the accuracy of the new method on pairwise alignments of sequences from the balibase alignment benchmark .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: isolated torsion of the fallopian tube is an uncommon cause of acute lower abdominal pain . \n it is often found in reproductive - age women and is found less in prepubertal and perimenopausal women . \n we describe a 70-year - old postmenopausal woman who presented with lower abdominal pain and discomfort . \n ultrasonography revealed a well - defined , echo - free cystic mass measuring 5.3 cm 5.8 cm without septations . \n laparoscopic examination showed a dark - red , round - shaped cystic lesion that twisted at the right infundibulo - pelvic ligament site in the right adnexa area with adhesion to the posterior uterine surface and separation from the atrophic ovary . \n torsion of the hydro - salpinx is rare in postmenopausal women . in postmenopausal women presenting with low abdominal pain with an adnexal mass , the gynecologist should contemplate possible torsion of the hydrosalpinx \n the case was unusual in the postmenopausal age group , making it a rare presentation of a rare entity . \n isolated torsion of the fallopian tube is an uncommon cause of acute lower abdominal pain . \n it is often found in reproductiveage women and is found less in prepubertal and perimenopausal women . even if abdominal pain , nausea , and fever are accompanied by lesions , immediate diagnosis is sometimes difficult , especially in women without specific symptoms and signs . due to lack of specific symptoms , \n specific imaging or laboratory characteristics make this entity difficult to diagnose preoperatively , which can delay surgical intervention . \n introducing laparoscopy can be of great value not only by aiding accurate diagnosis but also by providing immediate successful management . \n a 70-year - old postmenopausal woman presented with a 1-week history of lower abdominal pain and discomfort . \n her obstetric history was unremarkable , with no history of tubal sterilization . on examination , she was afebrile and normotensive . \n ultrasound revealed a well - defined , echo - free cystic mass measuring 5.3 cm 5.8 cm without septations ( figure 1a ) . \n ( a ) transvaginal ultrasound showed an echo - free cystic lesion , 5.3 cm 5.8 cm without septations , located in the right adnexal area . \n ( b ) laparoscopic examination revealed a dark - red , round - shaped cystic lesion that twisted at the infundibulo - pelvic ligament site with adhesion to the right posterior surface of uterus . \n laparoscopic surgery was performed due to suspicion of a right adnexa cystic lesion and possible torsion . \n laparoscopic examination showed a dark - red , round - shaped cystic lesion that twisted at the right infundibulo - pelvic ligament site in the right adnexa area with adhesion to the posterior uterine surface with separation from the atrophic ovary ( figure 1b ) . \n right salpingo - oophorectomy by laparoscopy was smoothly performed , and the specimen was placed into a bag made from a glove and removed through the umbilical port site . \n histological examination revealed tubal dilatation with epithelial flattening and foci of hemorrhage within the wall . \n the patient 's hospital course was uneventful , and she was discharged 4 days after surgery . \n the exact cause of fallopian tube torsion is unknown , and various theories have been postulated . \n tubal abnormalities including previous tubal surgery , tubal ligation , tubal reconstruction , and inflammatory disease ( hydrosalpinx , hematosalpinx ) have been reported . \n isolated torsion is rare in a normal fallopian tube , but it might occur in a premenarchal female with no identifiable risk factors \n the most common symptom is pain located in the lower abdominal region or pelvis that may radiate to the flank or thigh . \n temperature , white blood cell count , and erythrocyte sedimentation rate may be normal or slightly elevated . \n . the ultrasound image associated with hydrosalpinx may reveal an elongated , convoluted cystic mass , tapering as it nears the uterine cornua and the ipsilateral ovary separate from the mass . \n doppler evaluation could be helpful in a patient with a history of tubal ligation if high impedance or absence of flow in a tubular structure is noted . \n however , it should be performed as early as possible to avoid irreversible damage to the tissue \n laparoscopic surgery serves not only as a diagnostic tool but is also an excellent therapeutic instrument except when contraindicated . \n this case is unusual in the postmenopausal age group , making it a rare presentation of a rare entity . \n laparoscopy could be a useful tool in diagnosis and treatment of isolated tubal torsion . in postmenopausal women with lower abdominal pain accompanied by a cystic lesion in the adnexal region , a differential diagnosis of isolated hydro - salpinx torsion", "role": "user" }, { "content": "objective : isolated torsion of the fallopian tube is an uncommon cause of acute lower abdominal pain . \n it is often found in reproductive - age women and is found less in prepubertal and perimenopausal women.methods:we describe a 70-year - old postmenopausal woman who presented with lower abdominal pain and discomfort . \n ultrasonography revealed a well - defined , echo - free cystic mass measuring 5.3 cm 5.8 cm without septations . \n laparoscopic examination showed a dark - red , round - shaped cystic lesion that twisted at the right infundibulo - pelvic ligament site in the right adnexa area with adhesion to the posterior uterine surface and separation from the atrophic ovary.results:the pathology study of the excised tumor showed hydrosalpinx with torsion . \n the patient was asymptomatic after the procedure . \n torsion of the hydro - salpinx is rare in postmenopausal women . in postmenopausal women presenting with low abdominal pain with an adnexal mass , \n the gynecologist should contemplate possible torsion of the hydrosalpinx.conclusions:the case was unusual in the postmenopausal age group , making it a rare presentation of a rare entity . \n laparoscopy could be a useful tool in diagnosing and treating isolated tubal torsion .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: all reactions utilizing air- and moisture - sensitive \n reagents were \n performed in dried glassware under an atmosphere of dry nitrogen . \n dry solvents ( thf , toluene and dcm ) were obtained from a braun mb - sps-800 . \n for thin - layer chromatography ( tlc ) analysis , \n merck precoated plates \n ( silica gel 60 f254 , art 5715 , 0.25 mm ) were used . \n column chromatography \n was performed on fluka silica gel ( 60 , 220440 mesh ) . \n h nmr , c nmr , and p nmr spectra \n were measured on bruker 400 or 500 mhz spectrometers . \n deuterated solvents \n ( methanol - d4 and chlorofrom - d ) were obtained from sigma - aldrich and used as supplied . \n the \n following compounds were synthesized according to literature \n procedures : 1 , d10-diethyl phosphite , 4-pyridyl diphenylphosphine l1 , 4-pyridyl \n diphenylphosphine oxide l2 , 4-pyridylmethyl diethylphosphonate l8 , 3-pyridylmethyl diethylphosphonate l9 . detailed \n synthetic procedures and characterization data can be found in the supporting information . \n p - h2 was produced by cooling h2 gas over fe2o3 at 30 k. samples \n involved the analysis of 5 mm concentrations \n of 1 and 5 or 6 equiv of substrate ( l1-l12 ) in \n methanol - d4 ( 0.6 or 3.0 ml ) solution that \n was located in either a 5 or 8 mm nmr tube fitted with a j. young s \n tap . \n the resulting solutions were degassed prior to the introduction \n of p - h2 at a pressure of 3 bar . \n samples \n were then shaken for 10 s in a specified fringe field of either a \n 9.4 t bruker avance ( iii ) nmr spectrometer or a 7 t bruker biospec \n preclinical mri scanner . \n they were then rapidly transported into the \n main magnetic field of the instrument for subsequent probing by nmr \n or mri methods . \n historically , n - heteroaromatic molecules have \n been shown to be excellent \n receptors for polarization transfer to h and c nuclei under sabre . \n we therefore synthesized a phosphine ( l1 ) , a phosphine oxide ( l2 ) , a phosphine sulfide ( l3 ) \n and a phosphonate ester ( l4 ) \n which incorporated a 4-substituted pyridine motif , as detailed in \n the supporting information ( figure 1 ) . \n we selected the 4-substitution pattern for this \n study in order to minimize any steric interactions between the hyperpolarization \n target l and the imes ligand in the catalyst 2 . \n we expected this restriction to promote activity in the widest \n range of analytes possible . \n a series of samples were then prepared \n in methanol - d4 that contained l1-l4 , at a concentration of 5 mm , and the catalyst precursor 1 at a 17% catalyst loading . \n these samples were probed after sabre \n had taken place at 298 k on a 400 mhz nmr spectrometer by the application \n of a simple 90 rf - pulse . \n we will discuss the \n effects of sabre on the pyridyl h polarization , then the p polarization , and finally the polarization received by \n the other substituent groups . \n when this 90 pulse was applied \n to the h nuclei of these samples , only l3 proved to exhibit weak pyridyl proton polarization . \n for example , the two h nmr signals of l4 , that were derived from the pyridine functionality , \n showed a 1499-fold total signal enhancement when the initial polarization \n transfer step was undertaken in a 45 g field . \n this high h ptc was reflected in the fact that the corresponding p signal exhibited a similarly impressive 545-fold signal enhancement . \n for p \n , ptc was maximized through transfer at 0.5 g rather \n than the 45 g field observed for its h nuclei . \n h and p signal intensity gains for analytes l1-l4 under sabre conditions using 1 as the catalyst . a series of control experiments \n were then undertaken on triphenylphosphine , \n triphenylphosphine oxide , and phenyldiethylphosphonate in order to \n explore the role that the pyridine substituent might play in the hyperpolarization \n transfer process . \n these experiments revealed that no polarization \n transfer took place into the h or p nuclei \n of these materials under the same sabre conditions as used to hyperpolarize l14 described \n above . \n based on this information it is clear that the pyridine motif \n is necessary for successful ptc under these conditions . \n this is achieved \n by the formation of an active sabre catalyst as typified in scheme 1 . \n we note that this situation differs from that \n reported when the related [ ircl(h)2(pph3)3 ] complex was used to successfully polarize triphenylphosphine \n at temperatures between 333 and 353 k by koptyug et al . in this case \n however , \n when 1 reacts with an excess of pph3 a series \n of new and rapidly relaxing hydride ligand signals are observed at \n 7.33 , 7.98 , and 8.59 which are indicative \n of the formation of [ ir(h)2(h2)(imes)(pph3)2]cl . \n the formation of such species precludes \n the observation of sabre in these samples because of their role in \n the rapid quenching of p - h2 ( see the supporting information ) . as a consequence of the formation of 2a - l4 , when the \n corresponding h nmr spectra are examined under sabre conditions \n polarized \n hydride resonances \n appear as a singlet in the region around \n 22.15 for the pair of chemically equivalent hydride ligands \n ( see the supporting information ) . \n characteristic \n signals for l4 , as a ligand in 2a - l4 , are also seen to be polarized in the associated p nmr spectra . \n we illustrate selected regions of these hyperpolarized h and p nmr spectra after ptc at 0.5 g , in figures 2 and 3 respectively to detail \n some of these effects . \n the hyperpolarized h nmr \n trace shown in figure 2 confirms that both \n of the two pairs of equivalent \n ring protons of bound l4 receive \n magnetization , while those of the axial group remain unaffected . \n this \n is manifested in the detection of emission signals for the free analyte \n at 8.76 and for the equatorial ligand at 8.50 . \n the \n magnetic state that produces this emission effect is single spin order \n in nature and associated with an enhanced but inverted zeeman population . \n in contrast , the corresponding pair of 3,5-ring \n protons in l4 produce antiphase \n peaks that are separated by 13.5 hz . \n this splitting corresponds to \n the value of jph in l4 and requires that a heteronuclear \n two - spin order proton - phosphorus term is created through sabre . \n application \n of a 90 rf - pulse to the h nuclei \n of this term creates the visible antiphase signal that is seen ; the \n creation of homonuclear proton terms of this type is a well - established \n characteristic of phip . for l4 , \n sabre enhanced h nmr spectrum ( lower ) and \n corresponding \n thermal reference spectrum ( upper , x64 vertical expansion ) of 2a - l4 and l4 ( = equatorial ligand signal , \n = axial ligand signal of 2a - l4 ) . \n the hyperpolarized p nmr spectrum of the l4 sample , collected as a single transient , \n also showed two antiphase peaks , at 14.44 and 13.73 for free \n and equatorially bound l4 respectively \n ( figure 3 ) . \n the signal for free l4 showed a 545-fold increase in size after \n ptc at 0.5 g relative to the corresponding thermally polarized trace . \n the separation between the point of maximum displacement and minimum \n displacement for the signal due to l4 in this nmr trace is 27.0 hz ( smaller jph couplings are hidden within the peak envelope ) \n and twice that of the separation shown in the h nmr spectrum . \n this difference confirms the creation of a proton - phosphorus two spin \n order term , which leads to a triplet when excited wherein the central \n feature has zero intensity ( 1:0 : + 1 ) . \n sabre enhanced p nmr spectrum \n ( lower ) and thermal \n reference spectrum ( upper , x64 vertical expansion ) of 2a - l4 and l4 ( = equatorial \n ligand , = axial ligand of 2a - l4 ) . \n interestingly , when 2a - l4 is \n probed by exsy methods both the axial and equatorial l4 ligands are observed to undergo exchange \n with the free ligand pool present in bulk solution . \n the exchange profile \n seen for axial - l4 suggests that \n there is some in - cage recombination of this ligand , a process which \n is not observed for equatorial - l4 ( see the supporting information ) . \n the \n axial ligand loss rate is 0.645 0.010 s at 283 k and slightly more rapid than equatorial ligand loss rate \n which is 0.522 0.007 s. the observed hyperpolarization \n seen in the equatorial - l4h and p signals is therefore a consequence of \n sabre prior to ligand loss . \n we note that pyridylphosphonates \n find widespread use within a biological \n setting as lysophosphatidic acid receptor antagonists , nucleotide analogues , and enzyme inhibitors . \n importantly , related compounds have been shown to exhibit low toxicity \n in rat studies ( ld50 of 3.2 g / kg ( oral ) ) . as a consequence of these facts and the observation that l4 delivers high levels of visible p hyperpolarization \n this was achieved by the synthesis of the phosphonate \n derivatives l5-l12 which are shown in table 1 , alongside the levels of h and p \n hyperpolarization that results from their analysis under sabre . for p , \n 5 mm concentrations of 1 with \n 5 equiv of l7 and 6 of equivalents \n of l5-l12 were employed at ( a ) 45 g and ( b ) 0.5 g. in order to examine \n the effect that the regiochemistry of substitution played on the polarization \n level we replaced the 4- substitution pattern exhibited by l1-l4 with 2- and 3- substitutions in the form of substrates l5 and l6 . polarization transfer into 2-pyridylphosphonate l5 proved to be unsuccessful , and this is due to \n the formation of a complex that yields a very broad hydride resonance \n at 31.3 which does not show phip . upon cooling the \n solution to 233 k \n this hydride ligand signal separates into two resonances \n at 30.2 and 32.1 which confirms that \n this complex is a dihydride . \n the corresponding hydride ligand signals \n yield an average t1 value of 0.56 s at 253 k and are \n therefore classically bonded and terminal in character . \n nonetheless , the presence of this complex in \n solution provides a pathway to rapidly destroy the p - h2 present , presumably via the formation of a dihydrogen - dihydride \n complex , with the result that there is very little observable polarization \n transfer into l5 . \n the measured h signal enhancement at 45 g for l6 was 2866-fold , and the corresponding p signal \n enhancement was 336-fold . \n clearly , the change to a 3-substitution \n pattern has improved the level of h ptc relative to 4-substitution \n but surprisingly decreased the efficiency for p transfer . \n the synthesis of the bis - phosphonate l7 was therefore undertaken , as this material contains two chemically \n equivalent p nuclei and one fewer pyridyl proton than \n the monosubstituted derivatives . \n we speculated that better p - ptc might result as a consequence of this change on the basis that \n each p - h2 molecule contains a specific \n amount of latent polarization , and consequently when shared with fewer \n acceptor sites a net gain in the level of observable transfer might \n result . \n the corresponding h and p signal \n enhancements for l7 were 2271- \n and 741-fold respectively when 6 equiv of the analyte was employed , \n and therefore this hypothesis is confirmed . \n however , one further and \n somewhat unexpected observation was made , the enhanced steric bulk \n of l7 results in a change in \n the active complex such that 2b - l7 results wherein one coordination \n site is occupied by chloride ( see the supporting \n information ) . \n the two hydride signals for this complex appear \n at 23.74 and 24.06 . because of this change in catalyst form we found that reducing the \n number of equivalents of l7 to \n 5 led to an improvement in ptc , giving h and p signal enhancements of 3689- and 860-fold after transfer at 45 \n and 0.5 g respectively . in order to further test the efficiency \n of polarization transfer \n to p in these systems we added a series of spacers between \n the pyridyl carbon and the phosphorus center . in l8 and l9 \n this \n corresponds to the introduction of a ch2 \n group , while for l10 it is nme \n and for l11 it is o. \n these analytes were sabre active , but while the pyridyl ring protons \n remained strongly enhanced the spacer acted to substantially reduce \n the levels of p polarization . \n this change again results in a reduction in the number of proton \n environments able to accept magnetization . while successful , the levels \n of both h and p signal enhancement were again \n lower than those achieved for the pyridylphosphonates . \n we now \n address the potential of these substrates to act as mri \n agents for which in - phase p signals are desirable . \n as \n we have indicated , all of the described p signals that \n were created through ptc in a 0.5 g appear in antiphase . \n while this \n effect can be refocused to produce an in - phase signal , we proposed \n that changing the polarization transfer field ( ptf ) might achieve \n a similar result . \n this would be achieved by changing the relative \n proportions of single spin ( in - phase ) and two spin ( antiphase ) components \n and result in a predominantly in - phase signal being obtained . \n a series \n of experiments were therefore performed in which the ptf was increased \n using a variable field polarizer and \n the resulting p signal monitored . \n significant \n in - phase contributions were observed after transfer at 45 g without \n any significant reduction in the overall p signal enhancement \n ( 216-fold vs 336-fold for l6 and \n 703-fold vs 860-fold for l7 at \n 45 and 0.5 g respectively ) . while ptfs above 45 g did result in an \n increase in the relative single spin contribution , a sharp decline \n in the overall signal enhancement was noted . \n for l6 the relative proportions of the single spin \n and two spin terms are 0.08:1 and 0.23:1 when the ptf is 0.5 and 45 \n g respectively . in contrast , when l7 is examined , the relative proportions are 0.06:1 at 0.5 g \n and 0.88:1 at 45 g respectively . \n we conclude from this that l7 is potentially the better mri probe \n for these model studies . \n this is because the signal for l4 proved to remain predominately antiphase \n at both 0.5 g ( 0.15:1 ) and 45 g ( 0.17:1 ) , and it is therefore less \n suitable for such measurements . \n sabre hyperpolarized p nmr \n traces for l4 [ a ] , l6 [ b ] , and l7 [ c ] that result \n after polarization transfer catalysis in a 45 or 0.5 g field . \n further examination of the hyperpolarized h nmr spectra \n revealed that the signal enhancements described so far also extend \n into the ethyl groups of the phosphonate . \n typically these h signal enhancements were 50-fold per ethyl group and reflect a \n relayed h - p - h transfer process . \n it was therefore reasoned that deuteration of the phosphonate ethyl \n esters would increase the level of retained p polarization \n as transfer to h is less efficient due to the large frequency \n difference that exists between them . \n therefore , we synthesized d10-l4 , d10-l6 , and d20-l7 and analyzed them under \n analogous conditions to their protio - counterparts ( figure 5 ) . \n the levels of hyperpolarization seen in the aromatic \n proton signals of d10-l4 , d10-l6 , and d20-l7 proved \n to remain comparable to those of their protio analogues , but the p signals were found to dramatically increase in intensity . \n structure \n of substrates d10-l4 , d10-l6 , and d20-l7 and \n their signal intensity gains , alongside those of their \n protio counterparts l4 , l6 , and l7 , under sabre after ptc at the specified ptf . \n substrate d20-l7 yielded a p \n signal gain of \n 3588 ( 2.3% polarization ) after ptc at 0.5 g. a 2251-fold signal enhancement \n ( 1.4% polarization ) is , however , achieved after ptc at 45 g with significant \n in - phase character being visible in the detected signal . \n we note this \n is an order of magnitude larger than previously reported for p enhancements using this technique and can be achieved without \n the need for elevated temperatures during the polarization transfer \n step . in a further development \n , we completed \n magnetization transfer by inserting the sample into a -magnetic \n shield , which attenuates the earth s field by a factor of 3000-fold , \n prior to moving it into the 9.4 t magnet for examination . while this \n created in - phase p magnetization , \n it would therefore appear that simply changing \n the polarization transfer field to a readily accessible value between \n 0.5 and 130 g reflects the optimal route to achieve in - phase signal . \n we also note that complexes of type 1 are known to catalyze \n hydrogen deuterium exchange , and , \n as such , there is the potential to detect 1-proton - phip in such analytes . \n hence , we prepared a sample of d20-l7 and 1 in methanol - d4 under 3-bar of h2 and followed it by h nmr for a period of 10 days . \n at this point , \n if the p enhancements \n that were seen here were due to a 1-proton - phip , then the enhancement \n levels should remain comparable to those observed at day 1 . \n this suggests \n that when such samples are examined they should be prepared shortly \n before their use . \n [ a]-[c ] thermally polarized p images of l6 , l7 , and d20-l7 , respectively collected over 2048 averages . \n the repetition time was 20 s. [ d]-[f ] hyperpolarized images \n of l6 , l7 , and d20-l7 , respectively collected in a single \n shot after ptc at 45 g. ( te / fov / slice thickness were 3.2 ms/4 \n 4 cm/5 mm respectively ) . \n [ g ] 2048-average thermal image and [ h ] 1 \n scan hyperpolarized p image of d20-l7 collected \n on a 7 t biospec 70/30 preclinical scanner . \n ( te / fov / slice thickness \n were 12 ms/3 3 cm/10 mm respectively ) . \n samples employed 5 mm \n concentrations of 1 in methanol - d4 ( 3 ml ) with l6 ( 6 equiv ) , l7 or d20-l7 ( 5 equiv ) and 3 bar \n of p - h2 . \n snr values were calculated by \n dividing the mean signal intensity value in the region with signal \n by the standard deviation of the residual signal seen in an analogously \n sized noise region . \n we \n have thus far exemplified the ability to hyperpolarize p , and we next evaluated the spin \n lattice relaxation times \n ( t1 ) of the analytes l4 , d10-l4 , l6 , d10-l6 , l7 , and d20-l7 . \n the \n t1 relaxation values of the zeeman based p \n polarization are 8.3 , 7.6 , 9.2 , 9.3 , 5.3 , and 6.0 s respectively in \n methanol - d4 . \n for d20-l7 they increase \n to 6.5 s in ethanol - d6 and decrease to \n 3.6 s in d2o . \n these t1 values , although short , \n do offer the opportunity to obtain images using the sabre technique . with a number of these substrates \n displaying favorable results we were hopeful that it would be possible \n to collect mri with improved spatial resolution and short acquisition \n times . \n a series of hyperpolarized samples were therefore interrogated \n in a 9.4 t vertical bore scanner using the rapid acquisition with \n relaxation enhancement ( rare ) pulse sequence . \n we employed an echo \n train length of 32 and a matrix size 32 32 with zero filling \n to 128 128 . \n this resulted in a total single scan acquisition \n time of 500 ms . for comparison purposes , thermal images of l6 , \n l7 , and d20-l7 were recorded with 2048 averages , as shown in \n figure 6 . under hyperpolarization conditions , \n the largest gains in signal - to - noise ratio ( snr ) were observed for d20-l7 ( 94.4 ) and reflected a > 8-fold improvement on that of the \n thermal control ( 11.4 ) . \n similar images \n were also recorded on a 7 t biospec 70/30 preclinical scanner using d20-l7 as the imaging agent ( figures 6 g and 6h ) . \n a > 6-fold improvement in snr was achieved \n in \n the single scan hyperpolarized image ( snr = 27.7 ) when compared to \n the corresponding 2048-average thermal average ( snr = 4.5 ) . \n we note \n that insertion of the sample tube into the horizontal scanner caused \n more residual motion of the sample than was apparent in the analogous \n measurements on the vertical bore scanner . \n in addition , the time taken \n to transfer the sample to the magnet is ca . 5 s longer \n for the horizontal scanner , and the magnetic fields experienced by \n the sample during transfer differ . \n a combination of these effects \n could account for the reduction in observed snr that is observed in \n the hyperpolarized images that were recorded on the biospec . \n we have demonstrated that the h and p \n nuclei of a series of pyridyl substituted phosphonate esters , a phosphine , \n and a phosphine oxide can be efficiently hyperpolarized using sabre . \n substitution at the 3-position delivered the greatest efficiency in \n polarization transfer catalysis to h and p , compared to substitution at the 2- and 4- positions . in the ligands \n that showed high performance , \n the phosphorus center was connected \n directly to the pyridyl ring such that a strong jph coupling of 13.5 hz exists between protons \n in the pyridyl ring and the p nucleus . \n these were shown to receive polarization via a relay mechanism which \n first polarized the pyridyl protons , then the p nucleus , \n and finally the ethyl protons . \n the net gain for the ethyl protons \n was of the order of 50-fold per ethyl group in comparison to the 23 \n thousand level shown by the aromatic protons . \n the effect of leakage \n of the p magnetization to the h nuclei of \n these ethyl groups was shown to reduce the level of retained p polarization . \n when the h and p polarization levels are \n compared between the protio forms of l4 and l6 and their deuterated ethyl counterparts d10-l4 and d10-l6 , it could be seen that the best levels of h polarization result for three - substituted d10-l6 . furthermore , the p polarization levels \n are broadly similar for these two substrates at 1% . however , this \n raw observation masks the fact that for symmetrical d10-l4 antiphase signal dominates at all monitored \n polarization transfer fields . \n in addition , the t1 values \n for d10-l4 are much less than those \n for four - substituted d10-l6 in \n the presence of 2 . \n the result of the small t1 of d10-l4 is that it must actually \n be better p polarized under sabre than d10-l6 ; we observe the magnetization ca . \n 3 s after polarization transfer has ceased and relaxation has reduced \n the hyperpolarized signal amplitude . \n these observations confirm that \n 3-substituted pyridines are more suitable candidates for the future \n rational design of mri contrast agents that exploit sabre . \n deuterium \n incorporation into the ethyl groups has also been shown to increase \n the level of p signal enhancement . \n the symmetric bis-3 - 5-substituted derivative l7 was also synthesized , which proved to deliver strong p polarization . \n we have shown that this is a consequence \n of more efficient transfer into the three remaining pyridyl protons \n and that this synthetic strategy would enable the most atom efficient \n route to delivering such a pyridyl substituted agent . as a consequence , \n for d20-l7 \n , the corresponding p signal gain exceeds 3500-fold ( 2.3% polarization ) which \n is an order of magnitude larger than that obtained using other approaches . \n we also prepared systems where a c , n , or o based spacer was \n introduced \n to separate the h and p functionalities . \n while the h nuclei of the pyridyl groups in these analytes \n still retained high levels of hyperpolarization , the level of transfer \n into the p center was reduced by an order of magnitude . \n we concluded that the addition of a spacer was therefore undesirable . in these studies , \n the process of sabre was found to result in the \n creation of two types of p hyperpolarization . \n these are \n single - spin zeeman magnetization and longitudinal two - spin heteronuclear \n h p magnetization . \n when the corresponding terms were probed \n by a radio frequency pulse to p they yield in - phase and \n antiphase signals , respectively . as an in - phase signal is desirable \n when investigating these hyperpolarized substrates using traditional \n mri sequences we demonstrated that if the magnetic field experienced \n by the sample at the point of polarization transfer catalysis is 45 \n g , optimal in - phase p signal enhancement results under \n sabre in these systems . \n interrogation of the resulting samples on \n a 9.4 t vertical bore scanner proved to allow images to be collected \n in a single scan at a 5 mm concentration . \n the snr of a typical image \n was 94.4 and far exceeds that of a similar 12 h measurement under \n normal conditions which employed 2048 averages . \n although the t1 values for these p signals proved \n to be around 6 s , we have demonstrated that we can obtain good images \n on phantoms . \n we are working toward creating further phosphorus containing \n molecules that have longer t1 values which \n might ultimately be used for in vivo applications . \n we expect that the methods of levitt and warren will be particularly \n relevant here .", "role": "user" }, { "content": "traditional 31p nmr or \n mri measurements suffer from \n low sensitivity relative to 1h detection and consequently \n require longer scan times . we show here that hyperpolarization of 31p nuclei through reversible interactions with parahydrogen can deliver substantial signal enhancements in a range of \n regioisomeric phosphonate esters containing a heteroaromatic motif \n which were synthesized in order to identify the optimum molecular \n scaffold for polarization transfer . \n a 3588-fold 31p signal \n enhancement ( 2.34% polarization ) was returned for a partially deuterated \n pyridyl substituted phosphonate ester . \n this hyperpolarization level \n is sufficient to allow single scan 31p mr images of a phantom \n to be recorded at a 9.4 t observation field in seconds that have signal - to - noise \n ratios of up to 94.4 when the analyte concentration is 10 mm . \n in contrast , \n a 12 h 2048 scan measurement under standard conditions yields a signal - to - noise \n ratio of just 11.4 . \n 31p - hyperpolarized images are also \n reported from a 7 t preclinical scanner .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the rapid growth of an aging population around the world has increased the use of \n removable dentures and prompted more studies to develop comfortable conventional acrylic \n resin dentures . \n the use of soft liners for relining removable dentures is usually \n advantageous to avoid stress concentrations and to have a healing effect on the mucosa \n as well as giving comfort to the patient . \n soft liners have several problems such as loss of \n softness , colonization by candida albicans , and bond failure between \n the liner and denture base . \n bond failures also create potential surfaces for bacterial \n growth , plaque , and calculus formation . \n soft lining materials can be divided into two main types : plasticized acrylic resins and \n silicone elastomers . \n the silicone soft lining materials generally consist of a hydroxy- \n or vinyl - terminated polydimethylsiloxane ( pdms ) . because of their basic \n structural differences to polymethylmethacrylate ( pmma ) denture base resin , soft liners \n usually need special adhesives that interact with the surface layer of the denture base \n and soft liner for adequate bond strength . \n that is , an organo - silane , which \n usually enhances bonding with its reactive groups . \n in this case , the working mechanism is to increase the \n wettability of the substrate and to overflow the surface layer with the polymeric \n ingredients . \n although adhesive application onto the base resin surface is frequently \n used to obtain an adequate bond , it is not enough to prevent debonding between the soft \n liner and the denture base resin material . \n recently , surface preparation techniques such as the silica coating system was used for \n the denture base resin surface to increase the bond strength between different resin \n materials and the denture base . \n the silica coating system based on an \n air abrasion technique provides ultrafine mechanical retention such as sandblasting with \n aluminum oxide particles . \n the effect of these systems on the bond \n strength can be explained by two mechanisms : formation of a topographic pattern that \n allows micromechanical bonding with the aid of the high - speed surface impact of the \n alumina particles modified by silica ( 30 m ) and a chemical bond formed between the \n silica - coated substrate and the resin material . in this system , \n the general formula of silane is r - y - six3 , where r is a \n nonhydrolyzable organic group , y is a linker and x is a hydrolyzable group . \n the \n nonhydrolyzable functional group ( eg , methacrylate ) can polymerize with the materials \n containing c = c double bonds ( eg , resin composite , soft liners with vinyl group ) \n . the \n hydrolyzable alkoxy groups can react with a hydroxyl group - rich inorganic substrate , \n such as a silica surface , and form chemical bonds . \n silica coating systems \n are applied in many dental practices to increase the bond strength between different \n materials \n . nevertheless , information about silica coating followed by silanization on the bonding \n of a soft denture liner and denture base material are not available . \n therefore , the aim \n of this study was to test the hypothesis that different applications of silica coating \n followed by a silanization to the denture base resin increase the bond strength between \n the silicone based soft denture liner and the heat - cured conventional denture base \n resin . since thermal cycling is a factor that can have effects on the durability of \n materials and it is an important parameter to simulate the oral conditions , the bond \n strength between the soft denture liner and denture base material was evaluated after \n thermal cycling . \n in addition , the present study also aimed to figure out the bonding \n mechanism between the soft denture liner and denture base resin through surface \n roughness and chemical composition investigated by the fourier transform infrared \n spectrometer ( ftir ) and x - ray photoelectron spectrometer ( xps ) analysis . \n in this study , one silicone resilient lining material ( ufi gel p ; voco gmbh , \n cuxhaven , germany ) and 1 heat - cure acrylic ( qc-20 , dentsply int inc , weybridge , \n surrey , uk ) denture base resin were used . for the tensile test , 100 rectangular \n specimens , 40x10x10 mm ( 10x10 mm cross - sectional area ) , were prepared in \n a sandwich configuration with a centrally located pmma portion for each resilient \n liner . \n the pmma specimens were prepared by investing a 3 mm thick brass spacer in a \n denture flask . \n dyes and spacer machined to the same dimensions were invested in hard \n but flexible silicone rubber ( zetaplus ; zhermack , rovigo , italy ) . \n specimens were made \n by processing resilient denture liners against heat - polymerized pmma blocks according \n to the manufacturer 's directions . after heat polymerization of the pmma , the brass \n spacer and \n the pmma resins were \n trimmed and the surfaces to be bonded were smoothed using # 100 , # 400 , and # 600 \n waterproof abrasive papers . \n the specimens consisting of a set of two acrylic blocks \n were divided into five groups ( n=10 ) and treated as follows : in group a , adhesive \n ( ufi gel p ; voco gmbh , cuxhaven , germany ) was applied to the acrylic base resin \n surfaces ; this group served as a control . in group \n s , acrylic base resin surfaces \n were sandblasted with 50-m al2o3 particles ( koraks ; bego , \n bremen , germany ) . in group \n scsil , acrylic resin surfaces were treated with 30-m \n al2o3 particles modified by silica ( cojet system ; 3 m espe , \n seefeld , germany ) using an airborne - particle - abrasion device ( cojet system ; 3 m espe ) \n filled with 30-m silicone - dioxide particles . \n the abrasive was applied perpendicular \n to the surface at 0.28 mpa for 15 seconds at a distance of 10 mm , then the surfaces \n were coated with a silane coupling agent ( silane ; 3 m espe ) and allowed to air dry for \n 5 minutes . in group sca , silica coating was applied to acrylic resin surfaces as \n described for group scsil and then adhesive ( ufi gel p ; voco ) was applied to the \n treated base resin surface according to the manufacturer 's recommendations . in group \n scsila , silica coating was applied to the acrylic resin surfaces as described for \n group scsil then an adhesive ( ufi gel p ; voco ) and a silane coupling agent ( silane ; \n 3 m espe ) were mixed and this mixture was applied to the treated surfaces and \n air - thinned for 3 seconds with air spray . \n the soft liner ( ufi gel p ; voco ) was packed \n into the space made by the brass spacer and polymerized according to the \n manufacturer 's directions . \n the specimens were removed from the flask , and waste \n materials were trimmed with a sharp knife . \n all specimens were thermocycled ( 5000 \n cycles ) between baths of 5 and 55c with a transfer time of 30 seconds and a dwell \n time of 30 seconds . \n then the specimens were stored for 24 hours in water at 37c \n before the bond test . \n the tensile bond strength was tested with a universal testing \n machine ( lloyd - lrx ; lloyd instruments ltd , fareham , uk ) at a crosshead speed of 0.5 \n mm / min using material testing software ( nexygen version 2.0 ; lloyd instruments ) . a \n 1-way analysis of variance ( anova ) and the duncan test \n were used to assess the \n significance of differences in the tensile bond strength between the groups , with the \n level of significance set at p<0.05 . after the surface treatment , one additional specimen from each group was coated with \n gold - palladium alloy using a sputter - coating technique ( hummer vii ; anatech ltd , \n alexandria , va ) and examined by scanning electron microscopy ( sem ) ( jsm-5600 scanning \n microscope ; jeol ltd , tokyo , japan ) at x500 magnification to observe the topographic \n patterns . \n the debonded specimen surfaces were examined by the same observer with a \n stereomicroscope ( leica mz 12 ; leica microsystems , bensheim , germany ) at x40 \n magnification to assess the mode of failure . \n adhesive and/or cohesive failure of \n bonding could occur at three locations : ( 1 ) adhesive failure at the interface between \n the denture base and soft liner ; ( 2 ) cohesive failure within the denture base or \n within the soft liner ; and ( 3 ) adhesive and cohesive failure at the same site , or a \n mixed failure . \n a bruker vertex 70 v fourier transform infrared spectrometer ( ftir ) ( bruker optics \n inc . \n , ettlingen , germany ) was used with a pike miracle attenuated total reflectance \n ( atr ) to identify the functional groups of material . \n ftir spectra of the groups and \n untreated surface of pmma sample ( 5x5x1.5 mm ) were obtained by placing the surface to \n be analyzed on the diamond crystal . \n ftir spectrum of adhesive was also taken by \n placing a few drops on a potassium bromide pellet . \n an x - ray photoelectron spectroscopy system ( xps ) ( sage 150 , specs gmbh , berlin , \n germany ) was used to obtain information about the composition and the chemical \n bonding of elements found in the surface region of untreated and treated samples . \n the specimens were investigated by \n xps survey spectra with 5 - 6 nm sampling depth , 100 spot size , 50.4 w power for \n carbon , oxygen and silicone elements . \n five disc - shaped samples ( 10 mm diameter and 2 mm thick ) of each group were prepared \n to evaluate the surface roughness . a perthometer m2 ( mahr , germany ) device was used . \n the mean surface roughness ( ra ) values of each group sample were obtained through the \n measurements 3 times , made by one observer . \n in this study , one silicone resilient lining material ( ufi gel p ; voco gmbh , \n cuxhaven , germany ) and 1 heat - cure acrylic ( qc-20 , dentsply int inc , weybridge , \n surrey , uk ) denture base resin were used . for the tensile test , 100 rectangular \n specimens , 40x10x10 mm ( 10x10 mm cross - sectional area ) , were prepared in \n a sandwich configuration with a centrally located pmma portion for each resilient \n liner . \n the pmma specimens were prepared by investing a 3 mm thick brass spacer in a \n denture flask . \n dyes and spacer machined to the same dimensions were invested in hard \n but flexible silicone rubber ( zetaplus ; zhermack , rovigo , italy ) . \n specimens were made \n by processing resilient denture liners against heat - polymerized pmma blocks according \n to the manufacturer 's directions . after heat polymerization of the pmma , the brass \n spacer and \n the pmma resins were \n trimmed and the surfaces to be bonded were smoothed using # 100 , # 400 , and # 600 \n waterproof abrasive papers . \n the specimens consisting of a set of two acrylic blocks \n were divided into five groups ( n=10 ) and treated as follows : in group a , adhesive \n ( ufi gel p ; voco gmbh , cuxhaven , germany ) was applied to the acrylic base resin \n surfaces ; this group served as a control . in group \n s , acrylic base resin surfaces \n were sandblasted with 50-m al2o3 particles ( koraks ; bego , \n bremen , germany ) . in group \n scsil , acrylic resin surfaces were treated with 30-m \n al2o3 particles modified by silica ( cojet system ; 3 m espe , \n seefeld , germany ) using an airborne - particle - abrasion device ( cojet system ; 3 m espe ) \n filled with 30-m silicone - dioxide particles . \n the abrasive was applied perpendicular \n to the surface at 0.28 mpa for 15 seconds at a distance of 10 mm , then the surfaces \n were coated with a silane coupling agent ( silane ; 3 m espe ) and allowed to air dry for \n 5 minutes . in group sca , silica coating was applied to acrylic resin surfaces as \n described for group scsil and then adhesive ( ufi gel p ; voco ) was applied to the \n treated base resin surface according to the manufacturer 's recommendations . in group \n scsila , silica coating was applied to the acrylic resin surfaces as described for \n group scsil then an adhesive ( ufi gel p ; voco ) and a silane coupling agent ( silane ; \n 3 m espe ) were mixed and this mixture was applied to the treated surfaces and \n air - thinned for 3 seconds with air spray . \n the soft liner ( ufi gel p ; voco ) was packed \n into the space made by the brass spacer and polymerized according to the \n manufacturer 's directions . \n the specimens were removed from the flask , and waste \n materials were trimmed with a sharp knife . \n all specimens were thermocycled ( 5000 \n cycles ) between baths of 5 and 55c with a transfer time of 30 seconds and a dwell \n time of 30 seconds . \n then the specimens were stored for 24 hours in water at 37c \n before the bond test . \n the tensile bond strength was tested with a universal testing \n machine ( lloyd - lrx ; lloyd instruments ltd , fareham , uk ) at a crosshead speed of 0.5 \n mm / min using material testing software ( nexygen version 2.0 ; lloyd instruments ) . a \n 1-way analysis of variance ( anova ) and the duncan test \n were used to assess the \n significance of differences in the tensile bond strength between the groups , with the \n level of significance set at p<0.05 . after the surface treatment , one additional specimen from each group was coated with \n gold - palladium alloy using a sputter - coating technique ( hummer vii ; anatech ltd , \n alexandria , va ) and examined by scanning electron microscopy ( sem ) ( jsm-5600 scanning \n microscope ; jeol ltd , tokyo , japan ) at x500 magnification to observe the topographic \n patterns . \n the debonded specimen surfaces were examined by the same observer with a \n stereomicroscope ( leica mz 12 ; leica microsystems , bensheim , germany ) at x40 \n magnification to assess the mode of failure . \n adhesive and/or cohesive failure of \n bonding could occur at three locations : ( 1 ) adhesive failure at the interface between \n the denture base and soft liner ; ( 2 ) cohesive failure within the denture base or \n within the soft liner ; and ( 3 ) adhesive and cohesive failure at the same site , or a \n mixed failure . \n a bruker vertex 70 v fourier transform infrared spectrometer ( ftir ) ( bruker optics \n inc . , \n ettlingen , germany ) was used with a pike miracle attenuated total reflectance \n ( atr ) to identify the functional groups of material . \n ftir spectra of the groups and \n untreated surface of pmma sample ( 5x5x1.5 mm ) were obtained by placing the surface to \n be analyzed on the diamond crystal . \n ftir spectrum of adhesive was also taken by \n placing a few drops on a potassium bromide pellet . \n an x - ray photoelectron spectroscopy system ( xps ) ( sage 150 , specs gmbh , berlin , \n germany ) was used to obtain information about the composition and the chemical \n bonding of elements found in the surface region of untreated and treated samples . \n the specimens were investigated by \n xps survey spectra with 5 - 6 nm sampling depth , 100 spot size , 50.4 w power for \n carbon , oxygen and silicone elements . \n five disc - shaped samples ( 10 mm diameter and 2 mm thick ) of each group were prepared \n to evaluate the surface roughness . a perthometer m2 ( mahr , germany ) \n the mean surface roughness ( ra ) values of each group sample were obtained through the \n measurements 3 times , made by one observer . \n the results of the 1-way anova revealed that the bond strengths differed significantly \n between the groups ( p<0.001 , sum of squares 8.37 , df=49 , f=146.89 ) . \n the mean tensile \n bond strength values and standard deviations of the groups and numbers of failure modes \n for each group are listed in table 1 . \n the \n highest bond strength was obtained with the adhesive application ( group a ) . \n the lowest \n bond strengths were obtained without adhesive application specimens ( group s and group \n scsil ) . \n the bond strength values were significantly higher for group sca and scila \n specimens than for group s and scsil specimens . \n the group bond strength values ( mpa ) and failure mode ( n=10 ) same superscripted letters indicate no significant difference ( p<0.001 ) sd : standard deviation . \n group a : adhesive treatment ; group s : sandblasting group scsil : silica coating and silanized with a silane coupling agent ( cojet \n system ) group sca : silica coating and adhesive application group scsila : silica coating , silane and adhesive treatment scanning electron microscopy images of differently treated acrylic surfaces are shown in \n figure 1 . \n the \n topographic patterns were also similar for group a , group sca and group scsila , which \n appeared to be affected by the treatment of adhesive . \n the images indicate that the \n adhesive infiltrated the roughened structures and led to more smooth and homogeneous \n surfaces than the others . \n note difference in surface texture between images , indicating \n that the sandblasted ( group s ) and silica coated followed by the silanization \n ( group scsil ) groups have rougher surfaces than the other groups ftir peaks ( wavenumber - cm ) of untreated pmma , soft liner , adhesive and \n experimental groups are listed in figure 2 . \n ftir analysis showed that group s had no functional \n siloxane ( si - o - si ) and vinyl ( ch2=ch ) group . \n the strong peak of vinyl at \n 988 - 904 cm was seen only in the adhesive treated groups ( group a , sca and \n scsila ) . \n height of trimethoxysilane ( si - och3 ) peaks at 1270 -1260 \n cm and siloxane peaks ( si - o - si ) at 1077 - 1008 cm were \n shorter in untreated pmma , groups s and scsil than the other experimental groups ( figure 3 ) . \n ftir analysis \n indicated that soft liner had strong si - o - si ( siloxane ) peak at 1070 , 1008 , and \n ch2=ch ( vinyl ) peak at 864,786 . \n the adhesive has strong si - o - si ( siloxane ) \n peak at 1091 cm , c = o ( carbonyl ) peak at 1731 cm-1 and ch2=ch \n ( vinyl group ) at 907 cm . \n c - h asymmetric vibration stretch band occurred at \n 2992 - 2951 cm-1 which indicates ch3 ( methyl ) , ch2 ( methylene ) , ch \n ( methyne ) in the adhesive . \n transmittance ftir peaks ( cm ) and group / structure of the untreated \n pmma , the soft liner , the adhesive and the experimental groups ftir = fourier transform infrared spectrometer pmma = polymethylmethacrylate fourier transform infrared spectrometer ( ftir ) spectra of the untreated \n polymethylmethacrylate ( pmma ) and the experimental groups fourier transform infrared spectrometer ( ftir ) spectra of the adhesive ( a ) and the \n soft liners ( b ) quantitative values of carbon ( c ) , oxygen ( o ) , and silicone ( si ) obtained from the xps \n analysis on the surface region of untreated and treated samples were as follows : \n untreated pmma 66.2% c , 25.6% o , 8.2% si ; group a 55.1% c , 33.6% o , 11.3% si ; group s \n 39.8% c , 51.9% o , 8.3% si ; group scsil 36.9% c , 53.1% o , 10% si ; group sca 53.9% c , \n 34.4% o , 11.7% si ; group scsila 54.4% c , 32.5% o , 13.1% si . \n the most significant change \n occurred in group s and scsil compared to the non - treated group based resin surface . \n the \n carbon content decreased from 66% to 37 - 40% and the oxygen content increased from 26% to \n 52 - 53% . \n group a , group sca and group scsila showed no significant difference between \n each other . \n the lowest silicone concentration was observed on the untreated base resin \n surface and s groups . \n the xps spectra for the surfaces of untreated pmma and \n experimental groups are shown in figure 5 . \n x - ray photoelectron spectrometer ( xps ) spectra for the surfaces of untreated \n polymethylmethacrylate ( a ) , group a ( b ) , group s ( c ) , group scsil ( d ) , group sca \n ( e ) and group scsila ( f ) the surface roughness of the groups and the standard deviation are shown in table 2 . statistically significant differences \n ( p<0.001 , sum of squares 17.9 , df=5 , f=228.3 ) were found between the groups . \n the \n roughest surfaces were observed in group s. although no significant differences were \n observed between group a , sca and scsila , the smoothest surfaces were found in group \n a. surface roughness means and standard deviations of the groups same superscripted letters indicate no significant difference ( p<0.05 ) \n denture resilient lining materials have become important in dental prosthetic treatment . \n however , one of the most serious problems is failure of the bond between the soft \n denture liner and the denture base resins . in this study , to increase the bond \n strength of the soft denture liner to the denture base materials , different surface \n conditioning methods such as silica coating , silica coating followed by silanization , \n adhesive and adhesive / silane mixture were applied to the base resin surface . \n the \n hypothesis of this study was that the bonding could be increased by the application of a \n silica coating , silane and/or adhesive / silane coupling agent mixture . \n although , group a ( adhesive treatment ) , scsila \n ( silica coating / silane / adhesive treatment ) and sca ( silica coating / adhesive treatment ) \n exceeded a clinically acceptable and adequate bond strength between the soft liner and \n denture base , the highest bond strengths were found \n in group a. the results of the tensile bond tests were also consistent with the failure \n modes . \n groups s ( sandblasting ) and scsil ( silica coating / silane treatment ) showed the \n lowest bond strengths and adhesive type failures , whereas group a , which had the highest \n bond strengths , showed mixed and cohesive type failures . \n tensile , shear and peel tests are widely accepted methods for evaluating the bond \n strength of soft denture liners to the denture base . in line with the previous \n studies \n , tensile tests \n were used to determine the bond strength between the soft denture liner and denture base \n resin . \n although the peel test is believed to be the best simulation test of the clinical \n condition for soft lining materials , the results show that peel tests have a higher \n probability of cohesive failures in the soft materials and this test can be influenced \n by the thickness of materials . \n the shear bond strength is also affected by the \n deformation rates of the materials . in the tensile bond test , \n the area involved as a \n whole is stressed simultaneously and no allowance is made for the deformation of the \n materials . \n although the tensile test does not simulate clinically exposed forces of \n lining material , it has been considered as a good method . \n this \n treatment allows repeated expansion and contraction between the soft denture liner and \n denture base material and results in stress at the bonding interface and thermal \n volumetric changes . \n it has been implicated that thermal cycling stress was one of the \n factors degrading the bond between the silicone liners and denture base resin . like the \n previous studies , the present study used thermocycling only with the \n purpose of simulating the oral environment . \n therefore bond strengths before and after \n thermocycling have not been compared . for the thermocycling procedure , \n a temperature \n range from 5c to 55c ( according to the temperatures that exist intraorally ) and 5000 \n thermal cycles ( simulates total prosthesis use in approximately 5 years ) were chosen in \n the present study . \n in addition to the bond strength test , the chemical and roughness analyses of surfaces \n provided interesting insights about the nature of the bond between the denture base \n resin and silicone soft liner . \n chemical compositions between the soft liner and base \n resin were investigated by ftir and xps analysis . while the ftir analysis was used to \n identify the functional groups of material , the xps analysis was used to obtain \n information about the composition and the chemical bonding of elements found in a \n surface region . \n ftir analyses of the adhesive and soft liner indicated that the adhesive \n had the siloxane ( 1091 cm ) , methyl ( 2992 - 2951 cm ) and vinyl \n ( 907 cm ( ) functional groups ( figure \n 4 ) . \n the main compound of the silicone soft liner has been siloxane polymer with \n vinyl groups . \n these studies revealed that silicone soft liner was a form of polydimethylsiloxane \n polymer bearing vinyl end groups and the adhesive of the soft liner was \n 3-methacryloxypropyltrimethoxy silane . in the present study , \n the ftir analysis showed that the adhesive and silane treated \n groups ( group a , sca , scsila and scsil ) had the trimethoxysilane ( si - och3 ) \n group which indicated the silane grafting and siloxane ( si - o - si ) group which was a \n result of the silane crosslinking during the grafting process ( figure 3 ) . \n the height of trimethoxysilane and \n siloxane peaks could be used as the corresponding value to compare the silane grafting \n efficiency . \n when the height of trimethoxysilane and silane peaks \n among the experimental group and untreated pmma were compared , the shortest peaks were \n observed in group s and untreated pmma . besides \n , the xps analysis results have shown an \n increasing number of si ( in atomic mol percent ) in the adhesive and silane treated \n group . when the tensile bond strength results were combined with those of the ftir and \n xps analysis , special silane ( with vinyl and methacrylate groups ) \n requirement could be \n stressed for better bonding between the soft liner and pmma . in light of these findings , it is concluded that pmma , which has a double bond \n terminated by other active centers , is compatible with the methacrylate end of the \n adhesive . \n the methacrylate end of the adhesive could be bound chemically to the pmma \n resin while the silicone ends with the soft lining material . \n vinyl groups of adhesives , \n pmma and soft lining material cause additional reactions . on the other hand \n , the si \n groups from the silicone soft lining material reacted with the methoxy - si groups from \n the adhesive which forms silane . as a result \n , the adhesive could bond the soft lining \n material to the pmma resin . in this study \n it was found that the \n roughest surface was observed in the sandblasted group ( group s ) and then silica - coated \n followed by the silanization group ( group scsil ) which can also be seen on the sem \n images ( figure 1 ) . \n the results of this study are consistent \n with the previous studies which found that sandblasting of base \n resin surface decreased the bond strength between the soft liners and base resin . \n lower \n bond strength can be explained by stresses that occurred after sandblasting at the \n interface and the reduced \n ability of the soft lining material to penetrate into the irregularities of the \n pmma . \n a review of the literature indicated that two previous studies used silica \n coating and silane surface treatment on the denture base resin surface to increase the \n bond strength of the gingival shade composite resin and the autopolymerizing repair \n resin . \n it was found that the silica coating system was effective in improving the bond \n strength . \n however , in this study , the surface treatment method ( silica coating followed \n by silanization ) of the denture base resin showed no improvement in the bond strength \n between the soft liner materials and denture base resin . \n these results may be attributed \n to the fact that silica coating systems lead the roughness surfaces and irregularities \n created by 30-m silicon - dioxide particles may not be sufficient to allow flow of the \n soft resilient lining material into the base resin . in future studies , the effects of different silane agents could be examined . \n 1- surface treatment methods ( sandblasting , silica coating and silica coating followed \n by silanization ) did not improve the bond strength of the silicone based soft denture \n liner ( ufi gel p ) to the heat - cured based resin ( qc-20 ) . \n 2- the highest bond strength between the denture base resin and the silicone based soft \n denture liner was obtained by adhesive application to the base resin . \n 3- ftir and xps analysis showed increased siloxane ( si - o - si ) groups in the adhesive \n treated groups ( group a , sca , scsila ) and these groups had also higher bond strengths \n compared to the others . \n 4- surface roughness created by silica coating and sandblasting was not suitable for the \n bonding mechanism between the silicone soft lining material and denture base resin . \n the \n groups had a rougher surface ( group s and scsil ) demonstrating a lower bond strength \n compared to the other groups . \n ", "role": "user" }, { "content": "objectivethis study investigated the effects of different surface treatments on the tensile \n bond strength of an autopolymerizing silicone denture liner to a denture base \n material after thermocycling . \n material and methodsfifty rectangular heat - polymerized acrylic resin ( qc-20 ) specimens consisting of a \n set of 2 acrylic blocks were used in the tensile test . \n specimens were divided into \n 5 test groups ( n=10 ) according to the bonding surface treatment as follows : group \n a , adhesive treatment ( ufi gel p adhesive ) ( control ) ; group s , sandblasting using \n 50-m al2o3 ; group scsil , silica coating using 30-m \n al2o3 modified by silica and silanized with silane agent \n ( cojet system ) ; group sca , silica coating and adhesive application ; group scsila , \n silica coating , silane and adhesive treatment . \n the 2 pmma blocks were placed into \n molds and the soft lining materials ( ufi gel p ) were packed into the space and \n polymerized . \n all specimens were thermocycled ( 5,000 cycles ) before the tensile \n test . \n bond strength data were analyzed using 1-way anova and duncan tests . \n fracture surfaces were observed by scanning electron microscopy . \n x - ray \n photoelectron spectrometer ( xps ) and fourier transform infrared spectrometer \n ( ftir ) analysis were used for the chemical analysis and a profilometer was used \n for the roughness of the sample surfaces . \n resultsthe highest bond strength test value was observed for group a ( 1.350.13 ) ; the \n lowest value was for group s ( 0.280.07 ) and group scsil ( 0.340.03 ) . \n mixed and \n cohesive type failures were seen in group a , sca and scsila . \n group s and scsil \n showed the least silicone integrations and the roughest surfaces . \n conclusionsandblasting , silica coating and silane surface treatments of the denture base \n resin did not increase the bond strength of the silicone based soft liner . \n however , in this study , the chemical analysis and surface profilometer provided \n interesting insights about the bonding mechanism between the denture base resin \n and silicone soft liner .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: since november 27 , 2012 , systematic nucleic acid amplification screening for hev has been used on blood donations ( pools of 96 samples ) in france for a 70-l plasma pool that was processed with solvent detergent . \n a mixture of 96 plasma samples ( 50 l from each sample ) was prepared by using a distributor ( tecan , mnnedorf , switzerland ) to give a final volume of 4.8 ml . \n simultaneously , a 96-well archive microplate was used for serologic testing and to identify individual hev rna positive samples . \n plasma samples were collected at 13/14 regional blood transfusion establishments of the french blood service in continental france ( figure 1 ) . \n prevalence ( no . samples positive / no . tested ) of hepatitis e virus rna in plasma collected during november 27 , 2012december 1 , 2013 , at regional establishments of the french blood agency , france . \n southern france : al , aquitaine - limousin ; pm , pyrnes - mditerrane ; am , alpes - mditerrane ( including corsica ) . \n northern france : ndf , nord de france ; no , normandie ; idf , ile de france ; lc , lorraine - champagne ; als , alsace ; br , bretagne ; pdl , pays de loire ; ca , centre atlantique ; bfc , bourgogne - france comt ; aulo , auvergne - loire ; ra , rhne - alphes . \n hev rna was extracted by using the nuclisens easy mag instrument ( biomrieux , marcy - letoile , france ) . \n amplification was performed by using the single - round realstar reverse transcription pcr ( altona diagnostics , courtaboeuf , france ) , which is specific for the open reading frame 2 ( orf2)orf3 overlapping region ( 12 ) ; the 95% detection limit was 23 iu / ml . \n hev rna quantification was performed as described ( 14 ) ; the limit of quantification was 60 iu / ml . \n hev genotyping was performed by sequencing a 305-nt fragment within the orf2 region and performing phylogenetic analysis . \n igg and igm against hev were detected by using an enzyme immunoassay ( wantai biologic pharmacy enterprise , beijing , china ) according to the manufacturer s instructions ( 13 ) . \n world health organization reference material for igg against hev was used to determine concentrations of igg against hev ( 15 ) . \n the limit of detection was 0.25 world health organization u / ml . we screened 558 pools ( 53,234 samples ) for hev rna . \n of these pools , 22 ( 3.94% ) showed positive results ( table 1 ) . \n we detected 1 hev rna positive sample in each of 20 pools and 2 hev rna \n . the estimated detection rate of hev rna in plasma donations was 0.045% ( 95% ci 0.043%0.047% ) . \n * hev , hepatitis e virus ; + , positive ; , negative ; nt , not tested because of insufficient material ; ind , indeterminate . the geographic distribution of hev - positive samples included all but 2 blood transfusion establishments ( in centre atlantique and ile de france ) ( figure 1 ) . the frequency of hev rna \n positive samples was 0.072% ( 95% ci 0.067%0.077% ) in 3 blood transfusion establishments in southern france and 0.037% ( 95% ci 0.035%0.037% , ) in establishments in northern france ( odds ratio [ or ] 1.98 , 95% ci 0.864.53 , p = 0.14 ) ( figure 2 ) . \n positive samples was 0.049% ( 95% ci 0.047%0.051% ) in men and 0.018% ( 95% ci 0.014%0.022% ) in women ( or 2.7 , 95% ci 0.4111.1 , p = 0.51 ) . \n positive samples was 0.048% ( 95% ci 0.046%0.052% ) for persons 45 years of age and 0.041% \n ( 95% ci 0.040%0.042% ) for persons < 45 years of age ( or 1.2 , 95% ci 0.52.9 , p = 0.83 ) . \n frequency of blood donations positive for hepatitis e virus ( hev ) rna , by location and donor age and sex , france , november 27 , 2012december 1 , 2013 . comparisons between groups by using and fisher exact tests showed no significant differences . \n hev rna concentrations in 11 pools were below the limit of quantification , and the plasma pool with the highest virus load contained 29,796 iu / ml ( table 1 ) . \n the range of virus load in individual plasma samples was 468 iu / ml5,155 800 iu / ml . all strains that were available for sequence analysis were assigned to hev genotype 3 ( technical appendix ) . \n a total of 59% of the strains were subgenotype 3f and 36% were subgenotype 3c ( table 2 ) . * \n hev , hepatitis e virus ; , negative ; + , positive ; nt , not tested because of insufficient material . of the 183 pools tested for igg against hev , 175 had positive results and 8 eight had indeterminate results . of these 175 igg - positive pools , \n 173 were negative for igm against hev ; the remaining 2 pools had indeterminate results . \n the range of igg titers against hev was 0.3 u / ml10.6 u / ml . all hev rna \n positive pools were negative for igm against hev and positive for igg against hev , except for 1 pool that was negative for igg against hev ( table 1 ) . \n igg titers against hev in viremic pools ranged from 0.3 u / ml to 2.7 u / ml . the prevalence of igg against hev for 861 blood donors ( whose samples were included in the first 9 hev rna \n igg - positive pools included 13.5%30.2% of plasma collected from blood donors who were positive for igg against hev . \n most ( 22/24 , 91.7% ) viremic blood donors were negative for igm and igg against hev at the time of their donation , which indicated recent infection . \n two donors ( d6 and d21 ) were positive for igg and igm against hev ( table 2 ) . \n we conducted a prospective study with a sensitive method to screen plasma pools for hev rna and found that the frequency of hev infections in donated blood in france was relatively high ( 1/2,218 ) . \n frequencies in europe were 1/14,520 in scotland ( 7 ) , 1/7,040 in england ( 10 ) , 1/4,525 and 1/1,240 in germany ( 5,12 ) and 1/2,700 in the netherlands ( 11 ) . \n therefore , the true frequency of viremic samples could have been underestimated because of a dilution effect . \n the limit of detection of the pcr was low ( < 23 iu / ml ) . \n however , some pools could have been missed , although 5 positive individual donations having hev rna concentrations of 468 iu / ml2,293 iu / ml were detected ( table 2 ) . \n the detection rate for viremic blood donations in southern france was 2-fold greater than that for the rest of france . \n this finding is consistent with a previously reported high seroprevalence ( 52% ) of igg against hev in blood donors ( 13 ) and the high incidence ( 3.2% ) of infection documented by molecular techniques in local transplantation patients ( 15 ) . \n however , hev - positive blood donations were detected in all but 2 of the regions of continental france tested . \n all strains were genotype 3 and the proportions of subgenotypes 3f and 3c strains was similar to those observed in hev - infected pigs in france , which suggested a zoonotic origin of the 24 hev infections as reported by kamar et al . \n infections were detected at an early stage because serologic markers were absent for > 90% of the cases . since november 2012 , testing for hev rna has reduced the risk for hev transmission in patients in france who are given plasma processed with solvent detergent . \n this testing helps overcome the situation that this treatment does not inactivate hev , a nonenveloped virus . in january 2015 , nucleic acid amplification testing for hev will begin in europe for plasma processed with solvent detergent . \n we detected igg against hev in nearly all plasma pools , and igg concentrations ranged from 0.3 u / ml to 10.6 u / ml . the potential of antibodies against hev to neutralize virus infectivity if the unit is transfused is unknown , but a recent study indicated that igg against hev at a concentration of < 10 u / ml can not protect immunocompromised patients against reinfection ( 15 ) . \n our findings should be useful for determining the best safety measures to prevent hev transmission by blood transfusion . \n the implementation of nucleic acid amplification testing relies on full assessment of transfusion risk in exposed patients and the cost - effectiveness of different strategies . \n phylogenetic analysis of hepatitis e virus rna sequences by using the neighbor - joining method and a kimura 2-parameter distance matrix based on a 305-nt fragment of open reading frame 2 .", "role": "user" }, { "content": "we screened plasma samples ( minipools of 96 samples , corresponding to 53,234 blood donations ) from france that had been processed with solvent \n detergent for hepatitis e virus rna . \n the detection rate was 1 hev - positive sample/2,218 blood donations . \n most samples ( 22/24 ) from viremic donors were negative for igg and igm against hev .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: blepharochalasis is a rare degenerative disease unique to the skin of the lids , clinically characterized by primary bilateral swelling followed by progressive loss of subcutaneous tissue resulting in fine wrinkling and the skin of the upper lid hangs in thin folds . \n a 24-year - old female presented with history of interference of vision due to laxity of upper eyelids since 6 years . \n she had several attacks of lid oedema at the interval of 4 - 6 months which persisted for one day each time since the age of 14 years . \n for the past 4 years she did not experience lid oedema but developed laxity of skin of upper eyelids . \n the redundant skin folds extended over the margins of the eyelids . a 23-year - old female presented with right upper eyelid lax skin since the age of 12 years . \n there was history of on and off edema of right eyelid for one and a half year before the onset of lax skin . \n a 23-year - old male presented with lax and wrinkled skin of lower eyelid since 4 years . \n patient gives history of painless swelling of both eyelids associated with erythema on and off since 13 years . \n the episodes used to occur daily and used to subside within 2 hours . for the past one year \n patient was a known diabetic ( type 1 diabetes mellitus ) since 10 years and on treatment . \n all haematological investigations were within normal limits except for case 3 who was a case of type 1 dm . \n for first two patients upper eyelid blepharoplasty was done and case 3 underwent lower eyelid blepharoplasty . \n preoperative markings were made with the patient sitting upright in neutral gaze with the brow properly positioned . \n the upper eyelid was injected with 2% lignocaine with 1:1,00,000 epinephrine and with the help of a no 15 bard parker blade incision was made along the skin markings . \n the lower limit of excision was made along the eyelid crease , and the lateral extent of the marking was limited by an imaginary line joining the lateral end of the brow to the lateral canthus . \n the extent of excision was made upto 10 mm from the inferior border of the browand medial and central fat was excised along with skin and closed with 7 - 0 absorbable suture [ figure 1 ] . before and after photographs of upper eyelid blepharoplasty transcutaneous lower eyelid blepharoplasty was done by giving an elliptical incision 8 mm below the eyelid margin , excess fat and skin was excised and closed by 7 - 0 absorbable suture [ figures 24 ] . \n markings in lower eyelid ( 2 mm below eyelid margin ) showing excised excess skin and fat with closure of the wound with 7 - 0 suture before and after photograph of lower eyelid transcutaneous blepharoplasty \n a 24-year - old female presented with history of interference of vision due to laxity of upper eyelids since 6 years . \n she had several attacks of lid oedema at the interval of 4 - 6 months which persisted for one day each time since the age of 14 years . \n for the past 4 years she did not experience lid oedema but developed laxity of skin of upper eyelids . \n a 23-year - old female presented with right upper eyelid lax skin since the age of 12 years . \n there was history of on and off edema of right eyelid for one and a half year before the onset of lax skin . \n a 23-year - old male presented with lax and wrinkled skin of lower eyelid since 4 years . \n patient gives history of painless swelling of both eyelids associated with erythema on and off since 13 years . \n the episodes used to occur daily and used to subside within 2 hours . for the past one year \n patient was a known diabetic ( type 1 diabetes mellitus ) since 10 years and on treatment . \n all haematological investigations were within normal limits except for case 3 who was a case of type 1 dm . \n first two patients upper eyelid blepharoplasty was done and case 3 underwent lower eyelid blepharoplasty . \n preoperative markings were made with the patient sitting upright in neutral gaze with the brow properly positioned . \n the upper eyelid was injected with 2% lignocaine with 1:1,00,000 epinephrine and with the help of a no 15 bard parker blade incision was made along the skin markings . \n the lower limit of excision was made along the eyelid crease , and the lateral extent of the marking was limited by an imaginary line joining the lateral end of the brow to the lateral canthus . \n the extent of excision was made upto 10 mm from the inferior border of the browand medial and central fat was excised along with skin and closed with 7 - 0 absorbable suture [ figure 1 ] . before and after photographs of upper eyelid blepharoplasty transcutaneous lower eyelid blepharoplasty was done by giving an elliptical incision 8 mm below the eyelid margin , excess fat and skin was excised and closed by 7 - 0 absorbable suture [ figures 24 ] . in all the patients there were cosmetically acceptable results . \n markings in lower eyelid ( 2 mm below eyelid margin ) showing excised excess skin and fat with closure of the wound with 7 - 0 suture before and after photograph of lower eyelid transcutaneous blepharoplasty \n however , the condition being commonly reported during puberty , the role of endocrines is difficult to rule out . in one third of the cases in which the disease starts before the age of 10 years the autosomal dominant heredity probably plays an important role . \n three stages of blepharochalasis are described.[13 ] first stage is the intermittent painless and transient oedematous swelling of upper lids . in the second stage ( atonic ptosis ) \n the skin becomes discoloured , heavily venuled and flabby and hangs over the lashes and the power to lift the eye lid is decreased . in the third stage \n there is relaxation of the tissues of orbital septum and narrowing of palpebral tissue occurrence which results in interference with vision . \n the lacrimal gland may be pulled below the orbital margin giving the face tired debauchery . \n this is the advanced stage termed as ptosis adiposa.[13 ] though the upper lids are commonly involved , lower lid and unilateral involvement may be seen . \n the only effective treatment is correction by plastic surgery after the disease has run its course ; otherwise subsequent attacks of lid edema may interfere with the results . \n preoperative patient evaluation for blepharoplasty should document medical and ophthalmologic history . a simple upper or lower eyelid blepharoplasty where only skin or fat is excised can be performed under local anesthesia . for upper eyelid blepharoplasty , preoperative markings should be made with the patient sitting upright in neutral gaze with the brow properly positioned . \n the eyelid crease is situated above the ciliary margin approximately 8 to 9 mm in women and 7 to 8 mm in men \n . the lower limit of excision should be along the eyelid crease , and the lateral extent of the marking should be limited by an imaginary line joining the lateral end of the brow to the lateral canthus . a minimum of 20 mm of vertical lid height should be preserved for normal eye closure . the location of fat should be determined and marked preoperatively . \n skin incision can be made either with a no 15 bard parker blade or the empire tip of radiofrequency monopolar cautery . \n the skin incision can be closed using running or interrupted sutures with various absorbable or permanent material . \n we report 3 cases of blepharochalasis , of which 2 cases involved upper eyelid ( 1 case was unilateral ) and 1 case involving bilateral lower eyelids .", "role": "user" }, { "content": "blepharochalasis is a rare degenerative disease of skin of lids . \n we report 3 cases of blepharochalasis , out of which two involved upper eyelids and one involved lower eyelids . \n all the three cases were treated with transcutaneous blepharoplasty with acceptable cosmetic results .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: acquired von willebrand syndrome in high intracardiac shear stress conditions , such as aortic stenosis , ventricular septal defect and patent ductus arteriosus , has been clearly defined in its epidemiology , pathophysiology and clinical correlations . \n platelet and blood clotting activation has been shown in patients with mitral valve prolapse but no data exist on the prevalence of primary hemostatic defects and acquired von willebrand disease in mitral valve prolapse with severe regurgitation . \n the fluid dynamics of a regurgitant valve are , in many ways , similar to the fluid dynamics of a stenotic valve ; however , the anatomy of the regurgitant orifice and the dynamics of the regurgitant flow are complex and not fully understood . the shape and the direction of the regurgitant jet depends on multiple factors , including the anatomy and orientation of the regurgitant orifice , the driving force across the valve , and the size and compli - ance of the receiving chamber . \n given these facts , we hypothesized that primary hemostasis defects could be a feature in patients with mitral valve prolapse . \n aim of this study was to evaluate the prevalence of primary hemostasis disorders in patients with severe mitral regurgitation due to prolapse without an history of pathological mucocutaneous bleeding , by means of pfa-100 and to define their pathophysiology and clinical implications . \n 65 consecutive patients undergoing open heart surgery for valve operations were prospectively evaluated ; 41 patients underwent mitral valve repair for severe mitral regurgitation ( study group ) , 24 of them underwent aortic valve replacement for severe aortic stenosis ( control group ) . \n 5 patients were excluded from the analysis for postoperative re - exploration with evident source of surgical bleeding . \n patients were not included if operated on urgency - emergency priority or with a minimally invasive approach or had chronic atrial fibrillation . \n no patient received warfarin or antiplatelet drugs within 7 days before surgery ; patients on intravenous heparin had it stopped at least 6 hours preoperatively . \n patients were not considered eligible if the preoperative platelet count was < 80,000 x 10/l , if they had preoperative pt and/or aptt ratios > 1.2 or if they had a history of hematological or hepatic disease ( e.g. , active hepatitis or cirrhosis ) , or chronic renal failure requiring dialysis . \n all patients signed an informed consent , according to the declaration of helsinki , after approval of the protocol by the ethics committee of our institution . \n the pfa-100 provides an ex vivo quantitative measure of platelet function under high shear conditions simulating primary haemostatic events following vascular injury . the platelet function analyzer ( pfa-100 , dade behring , inc , deerfield , ill . ) \n performs analyses on citrated whole blood samples ( vacutainer tubes , becton dickinson ; citrate 129 mmol / l ; 3.8% ) and measures the time needed for a platelet plug to form after activation of platelets by collagen and adenosin diphosphate ( cadp , 50 g ) or collagen and epinephrine ( cepi , 10 g ) . \n the sample is aspirated under constant negative pressure through a 200 m capillary into a small reservoir , by passing through an 150 m opening coated with collagen / epinephrine ( cepi ) or collagen / adp ( cadp ) . as blood contacts the collagen - coated membrane , \n the platelet agonist ( epinephrine or adp ) is solubilized , resulting in platelet stimulation . \n the instrument provides the closure time ( ct ) parameter , indicating the time duration of the test : results are expressed in seconds , with a maximum test time of 300 seconds . \n our assays were performed with cadp cartridges in order to remove the effect of antiplatelets acting on adp receptors . \n patients management \n prior to institution of cardiopulmonary bypass ( cpb ) , patients received intravenous porcine heparin ( 300 iu / kg of body weight ) and , during cpb , additional doses ( 5000 iu ) , if required , to maintain the activated clotting time ( act ) > 480 sec . \n act measurements were carried out 2 minutes after heparin administration and every 20 minutes thereafter . \n after termination of cpb and surgical hemostasis , heparin was neutralized with protamine sulphate ( 1:1 ratio ) . \n all patients received an intraoperative infusion of tranexamic acid ( 1 g in 20 minutes before skin incision , followed by a continuous infusion of 400 mg / h until completion of surgery ) according to our institutional protocol . at the end of the surgical procedure \n postoperative blood loss was collected in a graduated reservoir connected to a closed evacuation system ( argyle , aqua - seal , sherwood medical , tullamore , ireland ) . \n cardiopulmonary bypass circuit \n extracorporeal circulation was instituted in all patients by draining blood by gravity into an open venous reservoir ( avant reservoir , dideco , mirandola , italy ) , and by driving it by means of a roller peristaltic pump ( caps , stckert instruments , munich , germany ) through a heat exchanger integrated with a hollow fiber membrane oxygenator ( avant d903 , or avant d903 ph.i.s.i.o . , dideco , mirandola , italy ) and through an arterial filter ( d734 micro 40 , dideco , mirandola , italy ) back into the patient at a mean flowrate of 2.4 l / min / m . \n the same custom pack of pvc / silicone tubing ( dideco , mirandola , italy ) was used for all patients . \n the circuit was primed with 1500-ml ringer lactate solution , 100 ml mannitol 18% , and 5000 iu porcine heparin . \n intermittent cold blood cardioplegia ( 4c ) was infused by means of a heat exchanger ( d720 helios c , dideco , mirandola , italy ) and two roller pumps , according to buckberg s protocol . \n mild - to - moderate hypothermia was employed ( mean internal temperature : 31.4c ) . \n shed mediastinal blood suction and left heart venting were actively performed with two separated roller pumps . \n additionally , blood was aspirated from the operative field with a vacuum suction device ( d745 , dideco , mirandola , italy ) , processed in a cell saver ( compact - a , dideco , mirandola , italy ) , and then reinfused after closure of the chest . \n blood samples were collected from a radial arterial catheter by means of a two - syringe technique . \n the first syringe was used to withdraw 10 ml of blood and then the sample was obtained in the second syringe . \n sample time points were as follows : a ) preoperatively ( baseline ) ; b ) before heparin administration ( pre - hep ) ; c ) after removal of the aortic crossclamp ( unclamp ) ; d ) 4 minutes after the administration of protamine ( post - prota ) ; e ) at icu arrival ( icu - arrival ) ; f ) 4 hours after icu arrival ( icu-4h ) ; g ) the morning following surgery ( icu-18h ) . \n blood samples were collected in siliconized vacutainer tubes ( becton dickinson , plymouth , uk ) containing tri - sodium citrate ( 0.19 m ) ; within 1 hour from blood collection , platelet poor plasma was obtained by centrifugation for 20 minutes at 2000 rpm at room temperature . \n plasma aliquots of platelet - poor plasma ( 0.4 ml ) were snap - frozen with methanol and dry ice and finally stored at -80 c until assayed . \n von willebrand factor antigen ( vwf : ag ) was determinated by commercially available elisa assays ( asserachrom vwf , diagnostica stago , asnier sur seine , france ) . \n ristocetin cofactor activity ( vwf : ricof ) was measured by commercially available lyophilized platelet reagents ( dade - behring , marburg , germany ) using an automated coagulometer ( acl 9000 ; instrumentation laboratory , lexington , massachusset , usa ) . \n all results are the mean of the two determinations and expressed as iu / dl of plasma . \n statistical analyses \n descriptive data are expressed as mean standard deviation or median with interquartile range ( iqr ) as appropri - ate according to the skewedness of the observed distribution . \n statistical significance of the difference between continuous variables was assessed by using a student t - test or a mann - whitney u - test as appropriate . \n compari - son of proportions was performed by chi - square or fisher exact tests as appropriate . all \n statistical analyses were performed using the spss statistical package version 11.5.1 ( spss inc , chicago , usa ) . \n patients demographics were similar in the two groups ( mitral valve repair / study group vs aortic valve replace - ment / control group ) . \n platelet count and hematocrit did not differ between the two groups at all time points ( figure 1 and 2 ) . \n time course of hemostasis : ( % ) ( t - test ) mean sd . \n there were no differences in closure time in the two groups at all time points ( figure 3 ) : the median closure time at baseline was above the normality range ( less than 118 sec . ) in both groups ( 146 sec . \n [ 106 - 299 , 25th-75th percentile ] in the study group vs 183 sec . \n [ 128 - 299 , 25 - 75 percentile ] in the control group , p=0.22 ) ; only three patients in the control group exhibited a \n . closure time ( mann - whitney ) median ( 25 - 75 percentile ) . \n five patients in the control group had non closure ( ct > 300 sec . ) \n median ( ct ) of all patients significantly decreased from baseline at icu arrival and 18 hours postoperatively ( 163sec . \n [ 66 - 112 , 25 - 75 percentile ] , p<0.001 ) ( table 1 ) ; similarly the haematocrit and platelet count decreased . \n these variables were inversely related to ct at all time points ( plt p<0.001 , r=-0.424 ; hct p<0.003 , r=-0.353 at icu arrival ( spearman test ) . \n time course of platelet function analyzer closure time [ median ( 25 - 75 percentile ) ] in the overall population . \n the concentration of plasma vwf : ag was within normal limits in all patients preoperatively . \n ( vwf : ag ) levels did not differ at all time points in the two groups ; after surgery , a significant increase was observed in both groups from baseline ( 199+/-144 mcg / dl vs 295+/-141 mcg / dl in the study group , p=0.002 ; 243+/-141 mcg / dl vs 338+/-154 mcg / dl in the control group , p=0.009 ) ( figures 4 , 5 and 6 ) . \n the ratio of vwf : ricof to vwf : ag was slightly decreased preoperatively in both groups ( ratio=0.91 ; normal range greater than 0.7 ) and showed a marked increase in the postoperative period ( ratio= 0.22 ) as , probably , new hemostatically effective large multimeric forms of vwf were released . \n the correlations between ct and vwf : ag and vwf : ricof could not be calculated because of a number of patients had an infinite ct ( > 300 sec . ) . \n however , our results indicate that , on the whole , the prolongation of the ct was inversely proportional to the level of vwf : ag and of vwf : ricof ( figure 3 ) . \n postoperative bleeding did not differ in the two groups ( 280 ml [ 220 - 400 , 25 - 75 percentile ] vs 300 ml [ 180 - 400 , 25 - 75 percentile ] ) and no significant correlation was detected between nor preoperative or post - protamine ct and postoperative mediastinal drainage . however , among the patients population , five patients had no formation of the platelet plug at baseline ( ct>300 or non - closure ) : this subgroup showed a statistically significant higher postoperative bleeding as compared to the rest of other patients ( 350 ml [ 240 - 400 , 25 - 75 percentile ] vs 220 ml [ 180 - 290 , 25 - 75 percentile ] ) , p=0.05 ) which was related to ct at baseline ( r=0.441 , p=0.035 ) . \n patients with high intracardiac shear stress have a certain degree of proteolysis of high molecular weight vwf and such a condition may contribute to the increased risk of postoperative bleeding . \n pfa-100 has been found to be both sensitive ( 90 - 100% ) and specific ( 88 - 95% ) in the detection of von willebrand disease . \n our study shows that patients with mitral valve regurgitation due to prolapse have high intracardiac shear stress which is responsible for the development of defects of primary hemostasis , which can be detected by means of pfa-100 . despite these biological alterations , however \n , these patients do not show any pathological mucocutaneous or surgical bleeding , confirming the discrepancy between the low frequency of bleeding symptoms and the high prevalence of hemostatic abnormalities in this setting . \n this subclinical defect of primary hemostasis is quickly corrected by valve replacement due to the quick restoration of vwf levels ; however it is responsible for a higher postoperative bleeding in those patients with the most severe deficiencies . \n the pfa-100 , however , is a sensitive , specific and reproducible test which might be useful to screen patients preoperatively to identify those who could benefit from correct diagnosis and appropriate therapy to reduce their complications . \n high shear rates prevail in stenotic valves : under these conditions , large molecular weight multimers of vwf are changed in shape and exposed to the action of , which results in their proteolysis . \n platelet adhesion to the subendothelial matrix of injured arterial vessels wall requires adhesion of platelets to subendothelially located vwf and of plasma vwf to subendothelial collagen . \n in addition , vwf enhances the adhesion of platelets to fibrin clots and stabilizes coagulation factor viii . \n although aortic stenosis is a relevant in vivo model of shear stress induced cleavage of vwf with resultant loss of its largest multimers , fluid dynamics of mitral regurgitation are also characterized by high shear stress . \n these anomalies measured with pfa-100 were reversed by surgical correction of the regurgitant valve on the first postoperative day , a finding which is consistent with the 12-to-20-hour half - life of vwf in vivo . \n the correction of pfa-100 abnormalities after surgical repair or replacement of the diseased valve indicates that the passage of blood through the diseased valve causes a disturbance of flow , thereby generating high shear stress and turbulence , may be responsible , at least in part , for a heightened vwf proteolysis . \n however , the overall imbalance of primary hemostasis is usually mild and the pfa-100 abnormalities are not an accurate predictor of a bleeding tendency , unless non closure is present . \n reported their evaluation of vwf in mitral valve prolapse : they conclude that there is a relationship between mitral valve prolapse and low levels of vwf : ag . \n however , vwf : ag levels are normal in those patients with mitral valve prolapse and heart failure , as it may account for an increased release of vwf . \n slaughter et al . have investigated the pfa-100 in cabg patients : they showed that an impaired adp mediated platelet aggregation is not corrected after surgery in 17 of 19 patients . \n moreover , they reported that 80% of patients having cabg with abnormal chest tube output had prolonged pfa-100 measurements 15 minutes after administration of protamine sulphate . \n raman et al . identified 16 bleeders after cabg : in 15 of those whose bleeding was controlled by platelet transfusion , pfa-100 after protamine sulphate was prolonged . \n they suggested a potential role for pfa-100 measurements to help identify which patient could benefit from platelet transfusion after cabg . \n first , plasma concentration of vwf has large variations , as it is influenced by abo blood type , lewis blood type race and age . moreover , \n the plasma level of vwf transiently increases in response to a variety of physiological conditions including trauma , surgery , atherosclerosis , inflammatory states and -adrenergic stimulation . \n in conclusion , mitral regurgitation secondary to prolapse is responsible for a certain degree of proteolysis of high molecular weight vwf as shown by abnormal shear induced platelet aggregation . \n this defect of primary hemostasis is quickly corrected by valve repair due to the prompt restoration of vwf levels and this condition is not associated with an increased risk of bleeding , except for those patients with the most severe deficiencies . on the basis of these data , \n postoperative bleeding after mitral valve repair should prompt a search for other causes than von willebrand disease . \n in addition , our observation confirms the discrepancy between the low frequency of bleeding symptoms and the high prevalence of hemostatic abnormalities in the setting heart valve disease . \n although aortic stenosis and mitral regurgitation are a relevant in vivo model of shear - stress induced cleavage of vwf with resultant loss of its largest multimers , the diagnosis of von willebrand syndrome should be restricted to those patients who have bleeding . \n shear induced platelet aggregation is significantly increased after cardiac surgery , but the role that this phe - nomenon might play in the development of postoperative thromboembolic complications remains to be addressed .", "role": "user" }, { "content": "introductionno data exist on the prevalence of primary hemostatic defects and acquired von willebrand disease in mitral valve prolapse with severe regurgitation.methodsprimary hemostasis was evaluated by pfa-100 , von willebrand factor antigen ( vwf : ag ) and ristocetin cofactor ( vwf : ricof ) assays in a prospective observational trial . \n sixty - five consecutive patients with mitral regurgitation ( study group ) or aortic stenosis ( control group ) who were operated for mitral valve repair or aortic valve replacement were enrolled in the study.resultsthere were no differences in closure time in the two groups at all time points . \n the concentration of plasma vwf : ag was within normal limits in all patients preoperatively ; after surgery , a significant increase was observed in both groups from baseline ( 199 + /- \n 144 mcg / dl vs. 295 + /-141 mcg / dl in the study group , p=0.002 ; 243 + /- \n 141 mcg / dll vs 338 + /- \n 154 mcg / dl in the control group , p=0.009 ) . \n the ratio of vwf : ricof to vwf : ag was slightly decreased preoperatively in both groups ( ratio= 0.91 ) and showed a marked increase in the postoperative period ( ratio=0.22 ) as , probably , new hemostatically effective large multimeric forms of vwf were released.conclusionspatients who present for surgery with a valvular pathology with high shear stress have some degree of primary hemostasis defect ; nevertheless , the potent stimulus of surgery and the correction of the underlying disease allow quick restoration of vwf activity and normalization of pfa-100 .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cardiovascular diseases ( cvd ) are the world 's largest killers , claiming 17.1 million lives a year ( 1 ) . as a paradigm shift \n was needed into the management of comprehensive cvd risk , who ( 2 ) has recommended total cholesterol ( tc ) as the only lipid parameter for cvd risk assessment of individuals detected to have hypertension , diabetes or smoking behavior in low and medium resource settings where it is both time - consuming and costly to measure tc , tg , ldl - c and hdl - c altogether . \n a single measurement of tc in middle aged retains its information in being associated with coronary heart disease ( chd ) events and predicts them with similar or only slightly decreasing , strength for a long period of time ( 3 , 4 ) , it is confirmed that the magnitude of multivariate coefficients for serum cholesterol in predicting coronary events is similar across different populations , characterized by different cholesterol levels and different death rates from chd ( 5 ) . \n thus , reducing high blood cholesterol , a risk factor for cvd events in people with and without a past history of chd is an important goal of pharmacotherapy ( 6 ) . \n however , the relation of cholesterol to total mortality and non - cvd mortality varied by country and gender in contrast to chd mortality ( 7 ) . \n the shape of the relationship between total cholesterol and non - chd mortality has been inconsistent ( 8) . \n in addition , a japanese study concluded that high cholesterol was not a risk factor for cvd mortality while low cholesterol was related to high mortality ( 9 ) . \n the purpose was to study the association of a single serum cholesterol measurement with cvd deaths in korean adults by a prospective cohort study . \n the study participants were taken from the cohort for epidemiologic investigation on cancer risk in residents nearby nuclear power plants in korea ( 10 ) . \n subjects were residents in youngkwang , wolsung , kori , uljin , chungju , yangpyong , and haman county . \n this multi - sites collaborative dynamic prospective cohort was constructed between 1992 and 2005 with a total follow - up of 303,542 person - years in 36,176 subjects . because nuclear power plants in korea were mainly located in countryside , the enrollee of this cohort was represented in a population of rural district rather than of urban . \n all subjects provided written informed consent . and this study has approved by the institutional review board of seoul national university college of medicine ( irb no . \n the three exclusion criteria from the cohort were applied to construct the study participants : first , members without measurement of total cholesterol ( tc ) levels ( n = 16,330 ) ; second , members aged under 40- or over 70 yr old \n ( n = 5,718 ) ; last , members having previous history of cardiovascular diseases on entry ( n = 1,388 ) . \n non - fasting blood specimens were drawn in order to determine total cholesterol ( tc ) , triglyceride ( tg ) , and high - density lipoprotein ( hdl ) cholesterol . \n quality - control procedures were achieved in agreement with the korean association of laboratory quality control . \n deaths among study participants through december 31 , 2008 , were confirmed by linking the information to the death certificates in the statistics korea ( 11 ) . \n the death from cardiovascular diseases was confirmed from abstractors ' coded causes of death by the ' i00 ' to ' i69 ' in korea standard classification of cause of death ( kcd ) , 6th revision ( 12 ) . to conduct the subgroup analysis , deaths from heart diseases and stroke were defined by a combination of kcd codes ' i00 ' to ' i52 ' , and ' i60 ' to ' i69 ' , respectively . \n total person - years were calculated by determining the number of days from the entry , until the date of death from cvd , or the end of follow - up , 31 december 2008 , after which the number of days was converted into years . \n subjects were divided into 4 groups based on the cutoff value of 160 , 200 , 240 mg / dl in tc level . \n the cutoff value of tc used was selected on the basis of past research ( 9 ) for comparing results , while the cut - points of tg and hdl were obtained from 25th , 50th , and 75th percentile in distribution . \n the second lowest group ( 160 - 199 mg / dl ) in tc and tg was used as the reference group . \n a potential confounder among the variables of the baseline information was defined as a variable showing a statistical significance based on the crude hazard ratios ( chr ) of deaths from cvd . by this definition , \n the following eight potential confounders were chosen : age , sex , current smoking / drinking habit on entry , body mass index and distribution of blood pressure , as well as level of tg and hdl cholesterol ( table 1 ) . because tg and hdl cholesterol are highly correlated to tc , another model excluding tg and hdl was applied in multivariable analysis for considering over - adjustment . \n age at entry was categorized into 10-yr groups of 40 - 49 , 50 - 59 , and 60 - 69 yr old . \n the other confounding factors were categorized such as current smoking / drinking habit on entry ( no / quit / yes ) , body mass index ( bmi ; thin , normal , overweight , and obesity ) and distribution of blood pressure ( normal , pre - hypertension , and hypertension ) . \n the bmi was categorized as less than 20.0 , 20.0 to 24.9 , 25.0 to 29.9 , and 30.0 or more . \n the blood pressure was grouped by the classification in the seventh report of the joint national committee , 2003 ( 13 ) . to control the confounders , \n cox 's proportional - hazards regression was used to evaluate the association between the baseline cholesterol and death from cvd . \n confidence intervals were obtained by the wald method and all reported p values are two sided . the chi - square test for trend \n the study participants were taken from the cohort for epidemiologic investigation on cancer risk in residents nearby nuclear power plants in korea ( 10 ) . \n subjects were residents in youngkwang , wolsung , kori , uljin , chungju , yangpyong , and haman county . \n this multi - sites collaborative dynamic prospective cohort was constructed between 1992 and 2005 with a total follow - up of 303,542 person - years in 36,176 subjects . because nuclear power plants in korea were mainly located in countryside , the enrollee of this cohort was represented in a population of rural district rather than of urban . \n all subjects provided written informed consent . and this study has approved by the institutional review board of seoul national university college of medicine ( irb no . \n the three exclusion criteria from the cohort were applied to construct the study participants : first , members without measurement of total cholesterol ( tc ) levels ( n = 16,330 ) ; second , members aged under 40- or over 70 yr old \n ( n = 5,718 ) ; last , members having previous history of cardiovascular diseases on entry ( n = 1,388 ) . \n non - fasting blood specimens were drawn in order to determine total cholesterol ( tc ) , triglyceride ( tg ) , and high - density lipoprotein ( hdl ) cholesterol . \n quality - control procedures were achieved in agreement with the korean association of laboratory quality control . \n deaths among study participants through december 31 , 2008 , were confirmed by linking the information to the death certificates in the statistics korea ( 11 ) . the death from cardiovascular diseases was confirmed from abstractors ' coded causes of death by the ' i00 ' to ' i69 ' in korea standard classification of cause of death ( kcd ) , 6th revision ( 12 ) . to conduct the subgroup analysis , deaths from heart diseases and stroke were defined by a combination of kcd codes ' i00 ' to ' i52 ' , and ' i60 ' to ' i69 ' , respectively . \n total person - years were calculated by determining the number of days from the entry , until the date of death from cvd , or the end of follow - up , 31 december 2008 , after which the number of days was converted into years . \n subjects were divided into 4 groups based on the cutoff value of 160 , 200 , 240 mg / dl in tc level . \n the cutoff value of tc used was selected on the basis of past research ( 9 ) for comparing results , while the cut - points of tg and hdl were obtained from 25th , 50th , and 75th percentile in distribution . \n the second lowest group ( 160 - 199 mg / dl ) in tc and tg was used as the reference group . \n a potential confounder among the variables of the baseline information was defined as a variable showing a statistical significance based on the crude hazard ratios ( chr ) of deaths from cvd . by this definition , \n the following eight potential confounders were chosen : age , sex , current smoking / drinking habit on entry , body mass index and distribution of blood pressure , as well as level of tg and hdl cholesterol ( table 1 ) . because tg and hdl cholesterol are highly correlated to tc , another model excluding tg and hdl was applied in multivariable analysis for considering over - adjustment . \n age at entry was categorized into 10-yr groups of 40 - 49 , 50 - 59 , and 60 - 69 yr old . \n the other confounding factors were categorized such as current smoking / drinking habit on entry ( no / quit / yes ) , body mass index ( bmi ; thin , normal , overweight , and obesity ) and distribution of blood pressure ( normal , pre - hypertension , and hypertension ) . \n the bmi was categorized as less than 20.0 , 20.0 to 24.9 , 25.0 to 29.9 , and 30.0 or more . \n the blood pressure was grouped by the classification in the seventh report of the joint national committee , 2003 ( 13 ) . to control the confounders , \n cox 's proportional - hazards regression was used to evaluate the association between the baseline cholesterol and death from cvd . \n confidence intervals were obtained by the wald method and all reported p values are two sided . \n the average of age and bmi are 56.2 yr - old and 24.2 ( kg / m ) for both sexes , respectively ( sd 8.38 in age , 18.49 in bmi ) . during a follow - up of totally 73,064,487 person - years \n smoking history , drinking history , high blood pressure , and hdl cholesterol have a linear trend with statistical significance . \n bmi and tc cholesterol show the u - shaped curve in the risk of death from cvd ( table 1 ) . \n 1 displays the distribution of tc with 194 mg / dl in mean and 47.2 in sd . \n table 2 indicates that the lowest group having tc < 160 mg / dl as well as the highest group having > = 240 mg / dl are associated with higher cvd mortality in cox proportional hazards analysis adjusting for age , sex , smoking and drinking status , body mass index , level of blood pressure , tg and hdl cholesterol . even if excluding tg and hdl cholesterol for considering over - adjustment ( model 2 in table 2 ) \n while the distribution of adjusted hrs shows the u - shaped curve , the adjusted hrs of the lowest cholesterol group ( < 160 mg / ml ) in a risk of cvd death are 1.55 ( 95% ci , 0.93 - 2.59 ) for men and 1.31 ( 0.57 - 3.03 ) for women . in the highest cholesterol group ( 240 mg / dl ) \n , the adjusted hr in men only has the statistical significance ( ahr 2.01 , 95% ci 1.04 - 3.87 ) . \n when a subgroup analysis in mortality from heart disease and stroke has conducted , all adjusted hrs by cholesterol groups and both sexes do not show a statistical significance , in spite of keeping the u - shaped distribution . \n cvd encompasses a wide range of disease including ischemic heart disease , coronary heart disease ( e.g. heart attack ) , cerebrovascular disease ( e.g. stroke ) , raised blood pressure , hypertension , rheumatic heart disease and heart failure ( 6 ) . \n as cvd is ranked as the number one cause of mortality and is a major cause of morbidity world wide ( 1 ) , cvd imposes high social costs , including impaired quality of life and reduced economic activity , and accounts for a large share of health service resources ( 15 ) . in the general population , \n the relationship between hyperlipidemia ( dyslipidemia ) and cvd ( predominantly cad ) is well established ( 16 ) and there are proven benefits of lipid - lowering with statins ( 6 ) . while this study has several strengths , including a prospective design , large sample size , prolonged duration of follow - up , a large number of deaths , and actually complete mortality follow - up , the distribution of multivariable - adjusted hrs shows the u - shaped curve in korean adults . \n especially , the fact that low cholesterol was related to high mortality of cvd is as same as that of a japanese study ( 9 ) in table 4 . \n similar inverse , ' j ' or ' u'-shaped relationships between lipid levels and all cause mortality have been reported in other populations and are thought to reflect a high prevalence of co - morbid disease in patients with low cholesterol levels ( 16 , 17 ) . in the honolulu heart study of japanese - americans ( 18 ) , low serum cholesterol was associated with increased mortality , but only among individuals with the risk factors of smoking , high alcohol consumption , and untreated hypertension . \n in other words , the association is not invariant , but appears to vary across populations of different social or lifestyle characteristics ( 7 ) . \n although the increase in mortality at low levels of tc was explained by chance , regression dilution bias , competing risks , cause - effect , effect - cause , and residual confounding such as smoking ( 17 ) , the terms of ' reverse epidemiology ' and ' obesity paradox ' ( 19 , 20 ) in marked contrast to the effects of tc or obesity on mortality in the general population , especially the framingham paradigm ( 21 ) , have been proposed . \n associations compatible with the concept of \" reverse epidemiology \" have been described in several other chronic conditions such as end - stage renal disease , malignancies , chronic obstructive lung disease , aids as well as in the elderly ( 22 ) . \n ( 23 ) reported that the higher the tc levels , the lower mortality in the elderly . \n in addition , strandberg et al . ( 24 ) suggested that low serum cholesterol level in midlife predicted not only better survival but also better physical function and quality of life ( qol ) in old age . \n interestingly , table 3 showed that the adjusted hr of heart disease mortality was in the opposite direction between men and women , especially in tc over 240 mg / dl ( 2.27 in men vs 0.47 in women ) . \n japanese in the same level of tc in table 4 also showed the same fact ( 2.14 in men vs 0.39 in women ) . while the cvd mortality in men are generally higher than in women , further studies for explaining this phenomenon will be needed . \n the fact that only the multivariable - adjusted hr in men has the statistical significance should be interpreted carefully because this study has a number of limitations . \n first limitation is that results were based on a one - time measurement of serum lipids . in longitudinal studies \n the use of baseline measurements only may underestimate the associations between usual risk factors and cvd mortality due to regression dilution effects ( 25 ) . \n second limitation is that tc levels in this study were measured in the non - fasting state . \n although similar results were obtained when analyses were repeated with non - fasting serum ( 26 ) , subjects would be grouped into higher tc level . \n based on this fact , calculated hrs would be assumed as under - estimated with toward the null . \n third limitation is the issue of reverse - causality because some underlying diseases could influence the level of lipid . to controlling this bias , \n last limitation is that the \" healthy peopler \" would have a higher chance to register as a cohort participant in general population ( 27 ) . \n the effect on mortality might have been slightly underestimated by the increased level of tc during follow - up . \n cvd is multi - factorial in its causation and lifestyle changes are the basis of any treatment strategy , with patients often requiring behavioral counseling ( 6 ) . considering reductions in cvd mortality with statins , there have still been controversies regarding the truly long - term prognostic value of low cholesterol on cvd mortality , especially in older individuals ( 5 , 28 ) . based on the results of this study , \n caution should be taken in prescribing statins for primary prevention among people at low cardiovascular risk .", "role": "user" }, { "content": "this study was conducted to evaluate the association of single serum total cholesterol ( tc ) measurement with cardiovascular diseases ( cvd ) deaths in korean adults . \n the study subjects were taken from the multi - site collaborative dynamic prospective cohort for epidemiologic investigation on cancer risk in residents nearby nuclear power plants in korea . \n a total of 12,740 adults aged 40 to 69 yr who underwent a mass screening examination were followed up from 1993 to 2008 . \n occurring cvd deaths were confirmed by the death certificates in the national statistical office , korea . \n groups with the lowest group having tc < 160 mg / dl as well as the highest group having > = 240 mg / dl were associated with higher cvd mortality in cox proportional hazards analysis adjusting for age , sex , smoking and drinking status , body mass index , level of blood pressure , triglyceride and high density lipoprotein cholesterol . \n the distribution of adjusted hazard ratios showed the u - shaped curve . based on the results of this study , caution \n should be taken in prescribing statins for primary prevention among people at low cardiovascular risk in korean adults .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: computer - assisted surgery has been popularized in orthopedic surgery in the last 10 years . whilst a number of recent randomized control trials have shown some benefit in terms of implant position over conventional jig - based referencing,1 \n many navigation systems require the use of reference arrays , which are fixed to the tibia and femur with pins . \n a 58-year - old man with a diagnosis of varus osteoarthritis ( oa ) of the right knee underwent navigated total knee arthroplasty ( tka ) using standard technique . \n we use a passive reflector - based system ( brainlab , feldkirchen , germany ) with fixation of the femoral reference array using two 3-mm - diameter threaded pins . \n these are inserted anteriorly through stab incisions , with the knee in flexion , as proximally as the tourniquet will allow . \n tibial pins are inserted in the mid diaphysis into the subcutaneous surface of the tibia [ figure 1 ] . \n all pins are bicortical in order to maintain secure fixation for the duration of surgery . \n peroperative photographs ( a ) insertion of tibial and femoral reference arrays ( b ) the styloid used to map out the tibia and femur computer registration is performed with digitalization of the hip and ankle centers and specific landmarks of the knee . a size 6 generation ii cemented femoral implant and a size 6 generationii cemented tibial component were implanted with an 11-mm polyethylene insert . \n the patient had some pain and thigh swelling postoperatively , but this was considered to be in keeping with recent surgery . \n he was discharged on the third postoperative day , having satisfied physiotherapy and occupational therapy goals . \n he reported 3 days later with increased right thigh pain , swelling , and a limited range of movement . \n an ultrasound guided diagnosis of a quadriceps hematoma at the site of the femoral pins was made . \n this was confirmed by computerized topography ( ct ) with intravenous contrast [ figure 2 ] , which showed a large quadriceps hematoma and active bleeding into the femoral canal from a branch of the superficial femoral artery as it entered linea aspera at the site of pin insertion . \n two ct scan images showing active bleeding into the femoral canal on day 10 , the hematoma was evacuated and two 14-mm unicortical screws were inserted into the femur at the site of the bleed to tamponade the bleed . \n unicortical screws were used to reduce the risk of further arterial injury with bicortical screws and the ct scan also showed unicortical injury . at 2 weeks post presentation \n he then had a flexion of 090 , but also had some persistent swelling and was prescribed a short course of diazepam . \n he showed continued improvement since the second operation and had no further complications at the final followup 6 months later [ figure 3 ] . \n computer navigated tka has the potential advantage of improved implant position , which is known to reduce the rate of aseptic loosening . \n there have been a number of studies reporting complications of computer navigated tka among these . \n bhling et al.,9 chin et al.,10 and bthis et al.11 demonstrated longer tourniquet time with computer navigation . \n kalairajah et al.12 reported a longer tourniquet time as well as a statistically significant decrease in blood drainage . \n chauhan et al.13 and jenny et al.4 found that computerized navigation was associated with a longer operating time . \n stckl et al.14 reported one case of poor tibial tracker stability , related to osteoporotic bone , resulting in abandonment of computer navigation , from 64 patients . \n hernadez - vaquero15 reported four cases of failed pin fixation ( three iliac crest and one femur ) requiring abandonment of computer navigation from a total of 112 patients . \n our report is the only case of arterial injury in the literature related to navigation pin usage . \n if the patient develops an unexpected postoperative swelling with increasing pain this diagnosis needs to be taken into consideration .", "role": "user" }, { "content": "the use of computer navigation has the potential to improve implant position in total knee arthroplasty ( tka ) , but pin fixation of reference arrays introduces an additional potential source of complications . \n we report a case of vascular injury related to the insertion of a femoral pin during navigated tka .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the ever - aging american population is presenting to spinal surgeons increasingly with high expectations of continued quality of life well into the seventh , eighth , and ninth decades of life . \n however , while surgical treatment of asd is the only viable option for patients failing conservative measures , the surgical interventions are associated with relatively high morbidity and mortality rates . indeed , in a series reported from johns ' hopkins consisting of 361 patients , the 30-day mortality rate was found to be 2.4% . in a more series by smith et al . , multicenter data from the spinal deformity study group demonstrated that even in expert centers 26.2% of patients suffered a minor complication and 15.5% suffered a major complication . \n several factors contribute to these high complication rates , including reduced bone mass and weaker fixation points , a higher associated rate of medical comorbidites , patient deconditioning due to immobility , and a rigid and nonflexible deformity [ 3 , 4 ] . \n in addition , the surgical enterprise necessary to correct asd is typically a long - segment fusion with instrumentation and osteotomies . \n therefore , in this population , a major surgical intervention is being applied in a highly compromised patient population [ 5 , 6 ] . to combat these challenges , \n modern surgeons have begun to apply minimally invasive surgery ( mis ) techniques to address asd [ 79 ] . \n mis techniques have been associated with reduced intraoperative blood loss , lower infection rates , and quicker mobilization , all of which would be highly desirable in the asd population . while the early mis fusion experience has focused on one- and two - level procedures for degenerative spinal disease , a variety of techniques have been developed more recently for use in asd . \n pelvic fixation is an important tool in the armamentarium of the modern spinal surgeon , as screws or bolts of a large diameter and length can be placed safely for caudal anchoring and extend anterior to the spine in the sagittal plane and lateral to it in the coronal plane . \n iliac fixation is useful in asd for long instrumentation constructs , sagittal and coronal deformity corrections , and stabilization of low sacropelvic instability [ 1113 ] . \n this paper builds upon that experience with the application of this technique in the setting of asd . \n a consecutive series of 10 patients were treated over an 18-month period at a single institution . \n all patients underwent mis treatment of asd using expandable interbody cage placement and percutaneous pedicle and iliac screws . \n asd was defined as a cobb angle greater than 20. all deformities were rigid with less than 10 of motion in the coronal or sagittal planes across the deformity segments on flexion , extension , and lateral bending films . \n all patients had also failed conservative measures and had severe back and/or back and leg pain with distance limited gait . \n the accuracy of iliac screw insertion was examined using postoperative spiral ct scanning to confirm that screws were entirely within the bony confines . \n patients were positioned prone on the jackson table so that the pelvis would not be obscured on fluoroscopic imaging by the base of the operating table . \n pre - operative imaging , including 3 d reconstructed ct scans of the pelvis , was helpful for planning screw placement trajectories and to validate the fluoroscopic data in the operating room . \n iliac cannulation is performed prior to pedicle screw cannulation to maximize the ability to image the pelvis . \n in addition , the decompression , osteotomies , and interbody fusion are accomplished prior to screw placement . \n for each side of the iliac crest , the fluoroscope is angled in the sagittal and coronal planes in the obturator outlet view so that the x - ray beams are approximately parallel to both the inner and outer tables of the ilium ( figure 1 ) . \n the teardrop that is visualized is the safe corridor and placement of instrumentation within this two - dimensional space ensures safe screw placement , even with 80 mm long screws ( figure 2 ) . \n a 1.5 cm incision is then made overlying the posterior superior iliac spine of the pelvis ( psis ) . \n a jamshidi needle is then docked onto the most superficial aspect of the psis and walked ventromedially , with care not to enter into the sacroiliac joint . \n however , the exact starting point along the superinferior plane of the psis can vary according to the specific screw trajectory desired , as multiple acceptable paths are acceptable . \n a drill or osteotome can be used to create a bony depression to better seat the screw or bolt head to minimize hardware prominence ( figure 3 ) . after entering 5575 mm , the jamshidi needle \n cannulated cancellous screw taps are then placed over the k - wire followed by final screw insertion . \n pedicle screw cannulation and placement then proceed followed by rod insertion and hookup ( figure 4 ) . \n since the iliac screws will be more dorsal and lateral than pedicle screws , the appropriate rod bending in two planes facilitates screw - rod mating . \n in addition , starting the s1 screws high and the iliac screws low provides more distance between the screw heads , making the connection easier ( figure 5 ) . bending the rods while attached to the rod holder facilitates this two - plane bending when using a french bender . \n the exact amount of curvature to place in the rods is based upon the surgeon 's judgement of preoperative curvature , desired degree of correction , and flexibility in the spine after decompression and osteotomies . \n the series was consecutive with no patients lost to followup , and in no case was conversion to a traditional open technique necessary . \n a total of 10 patients ( 7 women and 3 men ) were treated using this technique ( table 1 ) . \n a total of 69 segmental levels were treated ( mean = 6.9 ) , with a range of 49 . \n the mean operative time was 302 minutes from skin - to - skin , and the mean intraoperative blood loss as measured by the perfusionist was 480 cc . \n length of acute care stay averaged 5.6 days ( range of 47 ) after surgery . \n three of the 10 patients were discharged to an inpatient rehabilitation facility , and the rest were discharged to home . \n 65 mm 8 mm screws were used in 5 patients , and 80 mm 8 mm screws were used in 5 patients . \n early radiographic outcomes were determined using pre - and postoperative 36 standing x - rays at last followup . \n the mean preoperative cobb angle was 35 which improved to a mean of 8.0 , reflecting an average of 27 of improvement . \n the mean preoperative global lumbar lordosis as measured between l1 and s1 was 27 which improved to a mean of 48 , reflecting an average of 21 of improvement . \n there were no intraoperative complications . however , one patient had two asymptomatic medial screw breaches at t10 and l5 . \n due to the many benefits of mis surgery , it has the potential to improve the outcomes of surgery for asd . \n because these patients are often medically compromised , a reduction in infection rates , intraoperative blood loss , and quicker mobilization may have a significant impact on their recovery . \n while in the past mis surgeons focused primarily on short segment fusions for degenerative disease , there is increasing interest in using mis techniques for asd . \n however , the concept that is emerging for mis deformity surgery is that the goals and standards being developed for open deformity surgery must also be met with mis surgery . in this paper \n while the series is of limited size , radiographic evaluation demonstrated safe iliac screw placement using a relatively straightforward technique that did not require specialized equipment is possible . using a single c - arm and the obturator outlet view , standard size iliac screws \n while image guidance can be helpful in many settings , navigation systems are expensive , prone to error , and require additional setup time . \n thus , we have chosen to continue using a simplified c - arm method for screw placement . \n the introduction of commercially available cannulated iliac screws has also helped to make this procedure widely accessible to surgeons and renders the procedure as accessible as open screw placement . \n it should however be remembered that screw misplacement with any surgical technique can result in sciatic nerve injury , major vessel disruption , pelvic fracture , or retroperitoneal hematoma formation , and these risks are higher in the asd population . \n when applying this technique , many of the considerations for open surgery are relevant to the mis setting . \n it is critical to recess the iliac screw heads to reduce complaints of hardware prominence . \n this can be accomplished by using the drill or osteotome to created an opening in the posterior cortical wall of the ilium . \n in additional , starting the screw below the psis keeps the saddle low . with regard to hardware connections , placing the iliac screw heads medial and the pedicle screws lateral keeps the screw saddles in a single plane and facilitates rod - screw mating . \n however , despite these efforts , multiple - rod plane bending is often necessary as lateral offset connectors can not be applied using a truly percutaneous method . \n it should also be noted that in this series the screws were either 65 or 80 mm in length . \n open deformity surgeons commonly use longer screws to obtain superior fixation . in this series , \n we generally did not treat cases of severe scoliosis ( > 60 ) or major kyphosis , and the series also did not include serious revisions and thus have had success with the shorter iliac screws . furthermore , maintenance of the soft tissue envelope and posterior tension band with mis surgery preserves the spine 's native integrity and thus may obviate the need for these longer screws . \n ultimately , the placement of screws greater than 100 mm in length should be feasible but will be yet another area requiring validation in the clinical setting . \n while mis surgery for asd has not been able to completely replace open , conventional methods , the expanding spectrum of mis techniques has allowed the modern mis surgeon to perform ever more complex surgeries in this patient population . \n percutaneous iliac screws represent one such advance to allow for successful caudal anchoring of long - segment spinal fixation constructs .", "role": "user" }, { "content": "introduction . \n adult spinal deformity ( asd ) surgeries carry significant morbidity , and this has led many surgeons to apply minimally invasive surgery ( mis ) techniques to reduce the blood loss , infections , and other peri - operative complications . \n a spectrum of techniques for mis correction of asd has thus evolved , most recently the application of percutaneous iliac screws . \n methods . over an 18 months 10 patients with thoracolumbar scoliosis underwent mis surgery . \n the mean age was 73 years ( 70% females ) . \n patients were treated with multi - level facet osteotomies and interbody fusion using expandable cages followed by percutaneous screw fixation . \n percutaneous iliac screws were placed bilaterally using the obturator outlet view to target the ischial body . \n results . \n all patients were successfully instrumented without conversion to an open technique . \n mean operative time was 302 minutes and the mean blood loss was 480 cc , with no intraoperative complications . \n a total of 20 screws were placed successfully as judged by ct scanning to confirm no bony violations . \n complications included : two asymptomatic medial breaches at t10 and l5 , and one patient requiring delayed epidural hematoma evacuation . \n conclusions . \n percutaneous iliac screws can be placed safely in patients with asd . \n this mis technique allows for successful caudal anchoring to stress - shield the sacrum and l5-s1 fusion site in long - segment constructs .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: pachydermoperiostosis is a rare hereditary syndrome characterised by primary idiopathic hypertrophic osteoarthropathy ( hoa ) associated with thickened skin of face , seborrhoea and hyperhydrosis . \n the term cutis verticis gyrata refers to an associated folded hyperplasia involving scalp skin . \n the disease process usually begins during adolescence with gradual thickening of facial skin , which ultimately resembles that of an elephant ( pachyderm ) and hence the name . \n a diagnosis of touraine solente gole syndrome can be entertained only after various causes of secondary hoa are carefully excluded , since it accounts for only 3 - 5% of all hoa . close follow - up of these patients for long - term complications like arthritis and myelofibrosis is recommended . \n a 27-year - old male presented with complaints of progressive thickening of facial skin for past 5 years . thickened forehead skin subsequently developed deep transverse furrows [ figure 1 ] . \n associated broadening of fingers and toes with painless clubbing of nails were noticed [ figure 2 ] . \n recurrent episodes of pain and swelling over knee and ankle joints had occurred over the past 1 year , for which he was prescribed steroid and non - steroidal anti - inflammatory medications causing symptomatic relief . there were no significant complaints pertaining to cardiac respiratory or gastrointestinal systems , any history of fever or recent weight loss . \n pre - operative photograph showing forehead furrows , coarse facial features and acral enlargement of left hand hands showing bilateral acral enlargement and clubbing of digits on examination , the patient showed coarse facial features with increased facial skin thickness , seborrhoeic hyperplasia , deepening of nasolabial folds and furrowing of forehead skin into multiple transverse folds . \n scalp skin showed furrows oriented parallel to the sagittal plane , with normal hair distribution and no fixity of skin to the underlying calvarium [ figure 3 ] . \n shaved area of scalp skin with cutis verticis gyrata on investigation , his haemogram , blood counts , erythrocyte sedimentation rate , peripheral smear , platelet counts , liver and renal function tests and serum electrophoresis were within the normal limits . \n anti - nuclear antibody and rheumatoid factor were negative , with elevated c reactive protein value of 41.6 mg / l . \n human growth hormone assay showed 1.34 ng / ml using chemiluminescence immunoassay method . age and sex matched insulin - like growth factor 1 level was also within normal limits . \n x - rays of long bones showed minimal skeletal changes with periosteal reaction involving diaphysis of fibula , without any evidence of joint effusions [ figure 5 ] . \n magnetic resonance imaging showed diploic space enlargement in calvarium indicating marrow hyperplasia [ figure 4 ] . \n skin biopsy showed increased pilosebaceous structures and minimal increase in perivascular and periappendageal inflammatory infiltration . \n magnetic resonance imaging scan showing diploeic widening in calvarium plain radiograph of fibula showing periostosis a frontal rhytidectomy through a browlift incision , with dissection into forehead in the subgaleal and subfrontalis planes was done . \n skin was sutured without excessive tension , frontalis muscle was repaired with tacking sutures to periosteum . \n this procedure caused considerable improvement in his forehead furrows , though he is expected to require revision surgeries in future with progression of the disease [ figure 6 ] . \n a frontal rhytidectomy through a browlift incision , with dissection into forehead in the subgaleal and subfrontalis planes was done . \n skin was sutured without excessive tension , frontalis muscle was repaired with tacking sutures to periosteum . \n this procedure caused considerable improvement in his forehead furrows , though he is expected to require revision surgeries in future with progression of the disease [ figure 6 ] . \n pachydermoperiostosis is a rare hereditary disorder characterised by primary hoa associated with thickening of scalp and facial skin , seborrhoea and hyperhidrosis . in later stages \n , the disease is epitomised by extensive digital clubbing , disfiguring pachydermia , mechanical ptosis and arthritis . \n the condition was first described by nikoleus frederich in 1868 as a familial case of hoa . in 1890 , pierre marie described it as osteoarthropathie hypertrophiante pneumique. touraine , solente and gole recognised the entity as a primary form of hoa in 1935 and proposed a classification into the complete form - with pachydermia , clubbing and periostosis ; the fruste form - with prominent pachydermia and minimal skeletal changes and an incomplete form - with no pachydermia . \n cutis verticis gyrate as described by unna in 1906 is a frequent association of pachydermoperiostosis . \n touraine solente gole syndrome is a rare entity described in many races , but precise incidence is unknown . \n it occurs predominantly in males and inheritance is attributed to an autosomal dominant gene with variable expressivity . \n radiologic survey of asymptomatic family members have yielded positive results in 25 - 38% cases . \n onset is usually in adolescence as enlargement of distal extremities with clubbing causing spade like hands and feet with cylindrical arms and legs due to circumferential diffuse periosteal ossifications . \n bone scans show a higher uptake of technitium 99 methylene - diphosphonate especially at the ends of tibia , fibula , radius and ulna . \n the skin and bone changes progress over next 5 - 20 years and then remain unchanged throughout life . coarsening and furrowing of facial skin with deep nasolabial folds and mechanical ptosis result in a characteristic facial expression of weariness and despair . increased seborrhoeic activity ( in 90% cases ) and troublesome hyperhidrosis ( in 44 - 67% ) are frequent associations . \n a diagnosis of primary hoa can be made only after exclusion of secondary pachydermoperiostosis with rapid bone changes and painful clubbing which may occur as a manifestation of severe pulmonary diseases such as adenocarcinoma of bronchus , pleural mesothelioma , bronchiectasis , gastric carcinoma or cyanotic heart diseases . \n other differential diagnoses include acromegaly , thyroid acropachy , psoriasis , rhematoid arthritis and hematodermias . \n patients with predominantly cutaneous manifestations may also have to be differentiated from the rare hyperelasticity disorders such as ehler danlos syndrome , cutis laxa , meretoga 's syndrome , marfan 's syndrome and pseudoxanthoma elasticum , which may cause forehead furrows . \n our patient essentially manifested a complete form of touraine solente gole syndrome with predominant cutaneous changes in the form of deep furrows of forehead , prominent nasolabial folds , cutis verticis gyrata , seborrhoea and hyperhidrosis . \n he had early skeletal deformities of hands and feet in the form of acral enlargement of digits , clubbing and palmolplantar hyperkeratosis . \n osteoarthropathic changes have been controlled with the early administration of steroids and non - steroidal anti - inflammatory drugs . \n colchicine and biphosphonates for articular symptoms and isotretinoin to improve skin changes have also been described with variable results . \n surgical management is limited to frontal rhytidectomy for forehead furrows , blepharoplasty for ptosis correction and soft - tissue reduction in digital enlargements . \n our patient had considerable aesthetic improvement with frontal rhytidectomy though he may require repetition of such procedures in future with further progression of the disease .", "role": "user" }, { "content": "touraine solente gole syndrome is a rare hereditary syndrome of primary pachydermoperiostosis , with the characteristic triad of pachydermia ( or elephant like skin ) , periostosis and acropachia . \n a 27-year - old patient presented with aesthetic deformity of forehead due to deep skin folds and coarsening of facial features due to progressive thickening of skin . associated palmoplantar hyperkeratosis with broadened of finger and toe tips and digital clubbing were noticed . \n dermatologic evaluation revealed cutis verticis gyrata of scalp , seborrhoeic hyperplasia of face and hyperhidrosis . \n natural history of the disease and aetiopathogenesis were reviewed . \n aesthetic correction of forehead through frontal rhytidectomy was attempted .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the autonomic nervous system ( ans ) directs voluntary and involuntary physiologic processes such as digestion , blood pressure , hormonal regulation , energy metabolism , and heart rate and is therefore considered an important regulator of homeostasis [ 13 ] . \n heart rate variability ( hrv ) is widely considered a standard noninvasive method for assessing ans function , due to ans regulation of heart rate in a continuous , beat - to - beat manner , with lower hrv generally considered an indicator of poorer autonomic function . \n lower hrv or autonomic dysfunction has been associated with several conditions of significant public health concern , including diabetes and diseases of the cardiovascular system [ 511 ] . \n obesity , an important risk factor for diabetes and cardiovascular disease , is associated with dysregulation of autonomic function . \n it has been suggested that ans dysfunction is an important mediator in the development of obesity - associated disease and insulin resistance although the nature of the link between adiposity and insulin sensitivity is still unclear [ 1215 ] . \n studies of the relationship between body mass index ( bmi ) and hrv have reported conflicting results with stronger associations observed in younger populations [ 1619 ] . understanding the mechanism that connects obesity and ans function is important because of the increasing obesity prevalence documented among men and women of all ages . \n one explanation for controversial data on the associations between bmi and hrv is that the distribution of body fat may be more important than a measure of overall obesity , such as bmi , due to the metabolic activity of visceral or abdominal adipose tissue [ 2123 ] \n . this could be especially problematic in older persons for whom bmi might be a poorer indicator of adiposity . \n we hypothesized that central ( abdominal ) adiposity , not overall adiposity , accounts for obesity - related autonomic dysfunction . to examine this hypothesis , we compared the strength of association between hrv and wc to that of hrv and bmi , anticipating stronger , negative associations between hrv and wc compared to that of hrv and bmi . furthermore , since obesity tends to be a stronger risk factor for cardiovascular morbidity and mortality in young and middle - aged persons than in older persons , we examined whether wc and bmi relationships with ans differ by age , independent of specific health conditions known to impact hrv . \n the baltimore longitudinal study of aging ( blsa ) is an observational study sponsored by the national institutes of health and the national institute on aging ( nia ) that began in 1958 to study normative aging in a volunteer cohort of healthy persons 18 years of age and older at study entry . \n most blsa participants reside in the eastern usa , predominantly the baltimore - washington dc area , and visit the nia advanced studies in translational research on aging unit every one to four years depending on their age . in 2004 , 24-hour ambulatory electrocardiograms were implemented in the blsa to assess hrv . \n the first two hundred fourteen participants with holter data analyzed consecutively in the blsa were evaluated . \n these participants underwent a two - to - three day assessment between march 2004 and march 2006 , which included a battery of tests including a standardized medical examination and interview , sociodemographic interview , anthropometric assessment , fasting blood tests , and an oral glucose tolerance test ( ogtt ) using a standard 75 gram glucose load . \n this study complied with the ethical rules for human experimentation as stated in the declaration of helsinki and was approved by the medstar research institute institutional review board . \n hrv was assessed from ambulatory 24-hour holter monitors that use digitalized technology with compact flashcards and hrv software ( delmar reynolds lifecard cf , 1024 samples per second , impresario software ) . \n an initial analysis was planned for the first 200 recordings processed , and 214 had been completed at the time of this analysis . \n all recordings were visually reviewed and manually edited in a beat - by - beat analysis using a standardized protocol to identify artifact and nonsinus beats . \n exclusion criteria for hrv analysis on holter data were ( 1 ) implanted pacemakers , ( 2 ) transient or persistent nonsinus rhythm during the recording , such as atrial fibrillation , and ( 3 ) wandering atrial pacemakers ( waps ) . although wap is generally considered a benign condition , it may produce invalid readings and constitutes a typical exclusion [ 2628 ] . \n hrv measures can be affected by frequent premature beats , artifact , and total hours of recordings . \n thus , hrv data were excluded when recordings were less than 18 hours , more than 10% of beats were premature , or artifact time exceeded 5% of recorded time . \n this analysis focused on standard time domain hrv measurements , sdnn ( standard deviation of successive differences in normal - to - normal ( \n n - n ) intervals ) , and rmssd ( root mean square of successive differences between n - n intervals ) . \n sdnn represents a measure of overall ans function ( sympathetic and some parasympathetic function ) while rmssd represents a measure of parasympathetic function . \n time domain measures have been suggested for ambulatory studies as they are less susceptible to respiratory and movement artifacts . \n because hrv can be affected by activity and sleep , sdnn and rmssd were obtained separately for day ( 6:00 am10:30 pm unless otherwise reported in diary and was of similar hours ) and night ( 1:00 am5:00 am ) . \n nighttime hours were also selected to provide a constant length of time for hrv analysis in which participants were all sleeping . \n the autonomic nervous system contributes to the circadian patterns of hrv with sympathetic nerve discharges associated with activity , such as during daytime wakefulness . \n the circadian patterns of parasympathetic activity also demonstrate a peak which occurs at night and plateaus during the day . because of this \n , the hrv outcomes of interest will focus on daytime sdnn , to describe overall function , sympathetic more so than parasympathetic function , and nighttime rmssd , to describe parasympathetic function . height , weight , and waist circumference , \n ( wc , centimeter , one inch above the anterior superior iliac crests ) were measured with participants disrobed or in light clothes and barefoot . \n bmi was calculated as weight in kilograms / height in meters as a measure of overall adiposity whereas wc was considered a measure of central or visceral adiposity . \n this was based on findings from the rancho bernardo heart and chronic disease study , which showed wc to be strongly correlated with most measures of central obesity in men and women aged 6596 years . \n conditions known to be associated with hrv and body composition were assessed as covariates , including glucose intolerance , hypertension , and physical activity [ 10 , 12 , 32 ] . \n blood pressure was taken using a manual sphygmomanometer with the participant resting supine for 5 minutes in a quiet , climate - controlled room with low lighting , using the first and fifth korotkoff sounds . the second and third systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp ) measurements were averaged . \n hypertension was defined as use of antihypertensive medication , self - reported diagnosis confirmed with medical record review , or sbp > 140 mm hg or dbp > 90 mm hg during the physical examination . \n diabetes was defined as use of hypoglycemic medications , self - reported diagnosis of diabetes confirmed by medical records , fasting glucose of 126 mg / dl or greater , or a 2-hour ogtt value 200 mg / dl . angina and myocardial infarction were assessed by self - report , review of medical records , and by major q - waves on resting electrocardiograms using standard minnesota coding system criteria . due to the infrequent occurrence of diabetes , angina , and myocardial infarction \n race was categorized as black ( self - reported race as black or african american ) and nonblack . \n simple comparisons of continuous variables by sex were performed with nonparametric wilcoxon tests and categorical variables with chi - square tests . \n the correlation between continuous variables was assessed using spearman 's correlation coefficient . because bmi and wc have different units , we used standardized coefficients of each to assess whether one was associated more with the hrv outcomes than the other . \n akaike 's information criterion ( aic ) was used to compare models ( wc versus bmi ) , with lower aic indicating a better fitted model . to account for nonnormal distributions of hrv , standard generalized linear models with gamma distribution and log link \n were used to assess relationships between adiposity measures ( bmi and wc ) and hrv ( nighttime rmssd and daytime sdnn ) . to determine whether these relationships differ by age , age - by - bmi and age - by - wc interaction terms were included . \n all models were adjusted for age , sex , race , physical activity , and hyperglycemia using the ogtt 2-hour glucose . \n previously published studies suggest that hrv may differ across age by sex and race , and some studies suggest that glucose metabolism differs by sex [ 35 , 36 ] . \n thus , we also evaluated these interactions by including age - by - sex , age - by - race , and sex - by - ogtt glucose terms . \n relationships were reported as relative ratios ( rr ) , to describe the multiplicative increases and decreases in hrv associated with a unit change in the explanatory variable , similar to a relative risk for binary data . \n for example , an rr of 1.2 for male sex suggests a 20% higher hrv in men than in women . \n lastly , because of the potential for beta blockers to improve hrv , we repeated all analyses after excluding participants on beta blockers . \n all analyses were conducted using sas 9.1 statistical software ( sas institute inc . , cary , nc ) . \n of 214 participants with holter data , we excluded two participants with recordings less than 18 hours , one with nonsinus rhythm who also had a pacemaker , and 33 with wandering atrial pacemakers , leaving 178 with hrv data . among these , \n nine were excluded from the ogtt ( two were taking insulin , six used corticosteroids in the previous three months , and one refused ) . \n of the 169 remaining participants , three were missing data on wc and seven were missing ogtt glucose due to difficult intravenous access , leaving 159 participants for the current analysis . of these , one participant lacked a nighttime assessment . \n only 15 participants ( 8% ) were diabetic and 8 ( 4.5% ) had angina or myocardial infarction ; 116 ( 65% ) were hypertensive . \n characteristics of the 178 participants with valid hrv data are presented in table 1 . \n the similarity between the lines representing the gamma distribution and the kernel density smoother of the actual data suggests a good fit of the gamma model . \n wc and bmi were significantly correlated ( r = 0.73 , p < .0001 ) . despite this high correlation \n , a wide range of wc was observed for any given bmi , suggesting that wc describes potentially different information than bmi in this population . \n the relationship between rmssd and wc differed by age , with rmssd decreasing as wc increased in younger but not older participants ( p for interaction = 0.008 ) ( table 2 and figure 2 , left panel ) . \n figure 2 illustrates a comparison of the expected nighttime rmssd , based on model results , for an average participant at two different ages : 45 years and 85 years if the standardized wc increased . with increasing wc \n , the rmssd decreases in the 45-year - old but not in the 85-year - old participant . in contrast , neither the main effect of bmi nor the bmi - by - age interaction was statistically significant , suggesting that bmi was not associated with rmssd at young or old ages ( p = 0.403 ) ( figure 2 , right panels ) . \n furthermore , the aic for the rmssd models suggested that wc provided a better fitted model than did bmi ( aic = 819 versus 842 ) . \n increasing wc was also associated with decreasing sdnn in younger but not older participants ( p for interaction = 0.003 ) ( figure 2 , table 2 ) . there was no statistically significant association between bmi and sdnn ( figure 2 , table 2 ) . \n in addition , the model fit for wc was superior to the model fit for bmi ( aic = 953 versus 982 ) . when participants with coronary artery disease or diabetes or those taking beta blockers were excluded , we found similar results for both sdnn and rmssd . \n specifically , the parameter estimates remained similar , and statistical significance was unchanged despite a smaller sample ( data not shown ) . \n to our knowledge , this is the first study to assess the roles of overall and abdominal adiposity on ans function in young and old persons . \n the findings showed that central adiposity , measured by waist circumference , was associated with poorer ans function at younger but not older ages . \n this relationship was observed for a measure of overall ans function that includes sympathetic and parasympathetic activity and for a measure of primarily parasympathetic activity . \n overall adiposity , measured using bmi , was not associated with either measure of ans function . \n thus , abdominal adiposity , as opposed to overall adiposity tissue , could adversely affect ans function at younger ages with potentially unfavorable effects in later life . \n our results are in accordance with a small study by christou et al . , which reported higher abdominal - to - peripheral body fat distributions measured by dxa were strongly correlated with lower sympathetic and parasympathetic function in young ( mean age 25 1 year ) and old ( mean age 65 1 year ) healthy men . \n other studies have also shown that body fat distribution accounts for obesity - associated risk more so than total fat , with visceral fat carrying the greatest risk for insulin resistance , hyperglycemia , hypertriglyceridemia , cardiovascular disease , metabolic syndrome , and mortality [ 22 , 23 , 3941 ] . \n our findings suggest that abdominal adiposity may also contribute to poorer sympathetic and parasympathetic function as well . \n the ans innervates fat depots , which are positively associated with catecholamine production by the ans [ 42 , 43 ] . \n the biologic mechanisms whereby visceral fat could contribute to ans dysfunction could involve adipocytokines secreted by fat cells [ 44 , 45 ] . \n although metabolic activity of central adipose tissue could account for the associations between ans function and obesity , lack of association with bmi at older ages could be explained by the poor ability of bmi to accurately reflect body fat at older age . \n this does not explain , however , the lack of associations observed in young persons . \n future studies should examine the role of adipocytokines in mediating the effects of obesity on ans function . \n the lack of association for either measure of obesity at older ages supports recent arguments that a little extra around the middle may be good for older adults , or at least not as harmful as in young and middle age [ 46 , 47 ] . \n our findings lend some support for this or , at least , fail to demonstrate that central adiposity , within the range observed in this population , was associated with poorer ans function in the oldest participants . \n in contrast , younger participants with more central adiposity appeared to have ans function similar to older participants , that is , premature aging of the ans . \n the long - term sequelae of impaired ans function manifested as lower hrv are unknown but could contribute to cardiovascular , lipid , and endocrine abnormalities as these mechanisms are regulated by the ans . \n evidence for this includes studies that demonstrate associations between lower hrv and coronary artery disease , heart failure , hyperlipidemia , hypertension , and prediabetic and diabetic states [ 911 , 13 , 48 , 49 ] . \n additionally , the relationship between central adiposity and ans function observed in this study independent of blood pressure and glucose could explain how three of the most important components of the metabolic syndrome ( i.e. , hypertension , diabetes , and obesity ) act synergistically on the cardiovascular system that is , through the derangement of ans function . regarding limitations , \n however , the blsa is an ongoing study so future analyses will assess the robustness of these findings both cross - sectionally and longitudinally . \n nevertheless , observing the association between wc and hrv in healthy persons suggests that ans dysfunction can be detected early and at relatively young ages , therefore providing an opportunity for early intervention . \n the cross - sectional design limits our ability to establish causal relationships , and , in fact , one hypothesis proposes that central effects of adipocytokines could alter sympathetic and parasympathetic balance , leading to changes in the distribution of visceral and subcutaneous fat . \n for instance , longitudinal analyses will be conducted to determine how changes in wc and ans function at younger ages contribute to health risk in late life . in summary \n , we observed an inverse association between central adiposity measured by wc and ans function at young and middle but not old - age . \n this was true for a measure of primarily parasympathetic function ( rmssd ) as well as a measure of mixed sympathetic and parasympathetic function ( sdnn ) .", "role": "user" }, { "content": "while frank obesity is associated with reduced hrv , indicative of poorer autonomic nervous system ( ans ) function , the association between body mass index ( bmi ) and hrv is less clear . \n we hypothesized that effects of adiposity on ans are mostly mediated by visceral fat and less by subcutaneous fat ; therefore , centrally distributed adipose tissue , that is , waist circumference ( wc ) , should be more strongly associated with hrv than overall adiposity ( bmi ) . to examine this hypothesis , we used data collected in a subset of the baltimore longitudinal study of aging to compare strength of association between hrv and wc to that of hrv and bmi . \n time domain hrv variables sdnn ( standard deviation of successive differences in normal - to - normal ( \n n - n ) intervals ) and rmssd ( root mean square of successive differences in n - n intervals ) were calculated from 24-hour holter recordings in 159 participants ( 2996 years ) . \n increasing wc was associated with decreasing sdnn and rmssd in younger but not older participants ( p value for wc - by - age interaction = 0.003 ) . \n bmi was not associated with either sdnn or rmssd at any age . in conclusion \n , central adiposity may contribute to sympathetic and parasympathetic ans declines early in life .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the fact that hypoxia increases tumour resistance to the effects of radiotherapy has been known for over 70 years . \n forty - five years ago , tomlinson and gray showed that hypoxia exists in human tumours and that necrosis occurs about 100 m from the \n nearest blood vessel which is also the diffusion distance of soluble oxygen . \n decades of research in radiation therapy have focused on attempts to circumvent hypoxia mediated radio - resistance with moderate success . over the last decade \n , it has become known that hypoxia changes the pattern of gene expression that alters the malignant potential of tumours leading to more aggressive survival traits , as a result of which cancer cells become difficult to treat by radiation and chemotherapy . \n for the majority of solid tumours hypoxia develops because of the inability of the vascular system to supply the growing tumour mass with adequate amounts of oxygen . \n the major factors in the development of tumour cell hypoxia are the known abnormalities in structure and functioning of tumour microvessels , the increased diffusion distances between blood vessels ( many of which may not even carry oxygenated red blood cells ) , the expanding tumour cell mass with increased metabolic needs and the reduced oxygen carrying capacity of blood due to disease- or treatment - related anaemia . \n thus , there are three distinct types of tumour hypoxia : \n\n ( 1 ) perfusion related ( acute ) hypoxia which results from inadequate blood flow in tumours ; it is generally the consequence of recognised structural and functional abnormalities of the tumour neovasculature . \n such acute hypoxia is often transient , caused by temporary occlusions and temporary rises in interstitial pressure . \n ( 2)diffusion related ( chronic ) hypoxia is caused by increased oxygen diffusion distances due to tumour expansion and affects tumour cells greater than 70100 m \n from the nearest capillary , depending on where tumour cells lie in relation to the arterial or venous end of capillaries . \n ( 3)anaemic hypoxia , which is related to the reduced o 2-carrying \n capacity of the blood . \n ( 1 ) perfusion related ( acute ) hypoxia which results from inadequate blood flow in tumours ; it is generally the consequence of recognised structural and functional abnormalities of the tumour neovasculature . \n such acute hypoxia is often transient , caused by temporary occlusions and temporary rises in interstitial pressure . \n ( 2)diffusion related ( chronic ) hypoxia is caused by increased oxygen diffusion distances due to tumour expansion and affects tumour cells greater than 70100 m \n from the nearest capillary , depending on where tumour cells lie in relation to the arterial or venous end of capillaries . \n ( 3)anaemic hypoxia , which is related to the reduced o 2-carrying \n capacity of the blood . \n as noted above , the presence of tumour hypoxia appears to impair the effectiveness of radiotherapy and radiosensitivity is progressively limited as tumour po 2 levels fall . \n hypoxia - induced radioresistance is multifactorial with the presence of oxygen mediating dna damage through the formation of oxygen free radicals which occurs after the interaction of radiation with intracellular water . \n the ratio of doses administered under well - oxygenated to hypoxic conditions needed to achieve the same biological effect ( i.e. \n cell kill ) is called the oxygen enhancement ratio ( oer ) . for sparsely ionising radiations such as x- and gamma rays \n that is , well oxygenated cells are about three times more sensitive to x- and gamma radiation than the same cells when they are hypoxic . \n half maximal sensitivity to x- and gamma rays occurs at oxygen tensions of approximately 25 mmhg ; above po 2 values of approximately 1015 \n mmhg near maximal oxygen effects are seen . \n however , it should be recognised that sensitivity of cells to radiation is dependent on the phase of the cell cycle , with cells in the g 1 phase having a lower oer ( i.e. more radiosensitive ) than cells in s - phase . \n as noted above \n , the oxygen effect is not the only mechanism for radioresistance in hypoxic tumour cells . \n evidence is accumulating that the hypoxia - mediated proteomic and genomic changes may also contribute to radioresistance by increasing the levels of heat shock proteins ( hsps ) ( hsps are induced in response to environmental stresses like heat , cold and oxygen deprivation ) or by increasing the number of tumour cells that can resist apoptosis by mutating p53 ( the slowing of cell division is dependent on a protein brake known as p53 ; the disruption of the functioning of this protein is associated with approximately 5055% of human cancers ) . \n the presence of hypoxia within human tumours before starting treatment has been observed in squamous cell carcinomas , gliomas , adenocarcinomas ( breast and pancreas ) and in sarcomas . \n oxygen probes , that is , electrodes implanted directly into tissues have shown that the normal cervix po 2 is a median of 42 mmhg compared to a median of 10 mmhg in squamous \n carcinomas [ 79 ] . furthermore , in cervix cancer , for example , the oxygenation status is independent of size , stage , histopathological type , grade of malignancy , and heterogeneity within and between the same tumour types . \n hypoxia contributes to poor prognosis ; po 2<10 mmhg results in poor local tumour control , \n disease - free survival and overall survival in squamous carcinomas of the head and neck and of cervix cancers [ 10 , 11 ] . \n there is debate about whether there is a critical intratumoural po 2 below which detrimental changes begin to occur that is common across cell types . \n this occurs because experiments performed in cell cultures may not be applicable to in vivo \n environments and some of the literature variation can be attributed to the tumour cell type chosen for experiments and the demands of host tissues . with these caveats in mind , \n the critical po 2 tensions below which cellular functions progressively cease or \n anticancer treatments are impaired are approximately as follows : effectiveness of immunotherapy becomes impaired ( 3035 mmhg ) ; photodynamic therapy ( 1535 mmhg ) ; cell death on exposure to radiation ( 2530 mmhg ) ; binding of hypoxia immunohistochemical markers ( 1020 mmhg ) ; proteome changes ( 115 mmhg ) and genome changes ( 0.21 mmhg ) . \n the differences in these numbers are smaller than the similarities so that , from a practical perspective , for solid tissue tumors in vivo , a value of between 5 and 15 mmhg is a good number to remember because of its impact on therapy . \n there are a number of ways in which tissue oxygenation status can be assessed in vivo ( both invasive and non - invasive ) or in vitro using material from biopsy . \n non - imaging methods of assessing for the presence of hypoxia in tissues include histological appearance , immunohistochemical staining for intrinsic markers of hypoxia ( e.g. carbonic anhydrase ix ( ca - ix ) and hypoxia inducible factor-1 ( hif-1 ) ) and for the binding of externally administered nitroimidazoles . from an imaging perspective , an ideal test \n would : ( 1 ) distinguish normoxia / hypoxia / anoxia / necrosis ; ( 2 ) distinguish between perfusion - related ( acute ) and diffusion - related ( chronic ) hypoxia if possible ; ( 3 ) reflect cellular in preference to vascular po 2 ; ( 4 ) be \n applicable to any tumour site with complete loco - regional evaluation ; ( 5 ) be simple to perform , non - toxic and allow repeated measurements , and ( 6 ) be sensitive at po 2 \n levels relevant to tumour therapy . \n therefore , the challenge for hypoxia imaging is to measure low levels of tissue po 2 on a spatial scale similar to the o \n 2 diffusion distance ( 70100 \n m ) , a much smaller dimension than can be achieved with human imaging techniques . \n [ f]fluoromisonidazole-3-fluoro-1-(2 \n -nitro-1 \n -imidazolyl)-2-propanol ( [ f]miso ) and [ cu]diacetyl - bis(n - methylthiosemicarbazone ( cu - atsm)-positron emission tomography ( pet ) , the leading imaging contenders , are compared with other techniques \n in \n table 1 and discussed in greater detail below . \n uptake is homogeneous in most normal tissues , reflecting its high partition coefficient ( near unity ) , and delivery to tumours is not limited by perfusion . \n the initial distribution of [ f]miso is flow dependent , as with any freely diffusible tracer , but local oxygen tension is the major determinant of its retention above normal background in tissues after 2 h. [ f]miso accumulates in tissues by binding to intracellular macromolecules when po \n 2<10 mmhg . \n retention within tissues is dependent on nitroreductase activity ( i.e. on reduction status of a no \n 2 group on the imidazole ring ) and accumulation in hypoxic tissues over a range of blood flows has been noted , including within the intestinal lumen where it is retained in \n anaerobes . \n hypoxia can be imaged with [ f]miso pet in a procedure that is well tolerated by the patients . \n imaging requires 2030 min and starts anywhere from 75 to 150 min after injection , making it similar to the bone scan with which most cancer patients are familiar . \n useful and well - validated images can be achieved with a modest \n dose of radiation , typically 250 mbq . \n no arterial sampling or metabolite analysis is required and synthesis is achieved through relatively simple modifications of nucleophilic displacement / deprotection synthesis boxes such as are used for fluorodeoxyglucose ( [ f]fdg ) . in the united states , f - miso has investigational new drug \n ( ind ) authorization from the food and drug administration ( fda ) as an investigational product for use in humans . unlike eppendorf po 2 histography , \n [ f]miso is only sensitive to the presence of hypoxia in viable cells ; [ f]miso is not retained in necrosis because the electron transport chain that reduces the nitroimidazole to a bioreductive alkylating agent is no longer active \n . limitations of [ f]miso pet include the modest signal - to - noise ratio of raw [ f]miso pet images but if a venous blood sample is acquired during the mid - course of the imaging procedure and used to calculate a tumour \n /blood ( t \n /b ) ratio image , then normoxic uptake ( t \n /b \n < \n several studies in a range of hypoxic tumours , stroke and hypoxic myocardium have shown that a t \n /b of \n > 1.2 reliably identifies the presence of hypoxia . \n the presence of high normal liver uptake impairs complete assessment of liver lesions and urinary excretion interferes with imaging near the \n bladder . \n [ f]miso pet is able to monitor the changing hypoxia status of lung tumours during radiotherapy . \n studies in sarcoma and \n head and neck cancer [ 1820 ] have demonstrated a correlation of [ f]fmiso uptake with poor outcome to radiation and \n chemotherapy . \n cu - atsm holds exceptional promise as an agent for delineating the extent of hypoxia within tumours with pet . \n numerous pre - clinical studies have evaluated and validated its use for imaging of hypoxia in tumours and other tissues [ 2128 ] . \n the mechanism of retention of the reagent in hypoxic tissues is largely attributed to the low oxygen tensions and the subsequent altered redox environment of hypoxic tumours ( increased nadh levels ) . \n clinical studies , well tolerated by patients , involved [ cu]atsm imaging sessions of \n about 60 min with analysis of 3060 min summed images . \n this time frame yields excellent data with good image quality in a very short time frame which opens up the opportunity with the shorter - lived cu to perform multiple imaging sessions . \n a \n number of radioactive copper isotopes with longer half lives are available , e.g. cu ( t1/2=12.74 h ) , enabling wide geographic \n distribution . in human studies of lung and cervical cancers , encouraging evidence has emerged that [ cu]atsm can act as a prognostic \n indicator for response to therapy . in a prospective study of 14 humans with non - small cell lung cancer , \n a semi - quantitative analysis of the [ cu]atsm \n muscle - to - tumour ratio was able to discriminate those likely to respond to therapy from non - responders . \n a similar study in 14 women with cervical cancer demonstrated a similar predictive value in the tumour response to therapy . \n to summarize , tumour hypoxia is common and its effects represents a significant challenge to the curability of human tumours leading to treatment resistance and enhanced tumour progression . \n tumour hypoxia can be detected by non - invasive and invasive techniques but the inter - relationship between these techniques needs to be better defined ; human validation of imaging finding is sparse at best . \n anti - hypoxia therapies exist in the clinic ( but do not work very well or we do not know how to use them optimally ) and more are on their way . hypoxia imaging may allow better definition of a population that would benefit from novel anti - hypoxia directed therapies . \n comparison of techniques for evaluating human tumour hypoxia \n [ dhb ] in \n rbcs , deoxyhaemoglobin concentration in red blood cells .", "role": "user" }, { "content": "tumour hypoxia represents a significant challenge to the curability of human tumours leading to treatment resistance and enhanced tumour progression . \n tumour hypoxia can be detected by non - invasive and invasive techniques but the inter - relationships between these remains largely undefined . \n [ 18f]fluoromisonidazole-3-fluoro-1-(2 \n -nitro-1 \n -imidazolyl)-2-propanol ( [ 18f]miso ) and cu - diacetyl - bis(n4-methylthiosemicarbazone ( cu - atsm)-positron emission tomography ( pet ) , and blood oxygen level - dependent ( bold)-magnetic resonance imaging ( mri ) are the lead contenders for human application based on their non - invasive nature , ease of use and robustness , measurement of hypoxia status , validity , ability to \n demonstrate heterogeneity and general availability ; pet techniques are the primary focus of this review .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the flowering aerial parts of o. gratissimum and o. sanctum were collected from the medicinal garden of regional medical research centre ( rmrc ) , belgaum . \n the plants were identified and authenticated by a taxonomist at rmrc , belgaum , where the voucher specimens have been deposited ( rmrc-530 : o. gratissimum and rmrc-531 : o. sanctum ) . \n fresh flowering aerial parts ( 1.0 kg each ) of o. gratissimum and o. sanctum were steam distilled separately using copper still fitted with spiral glass condensers for 3 h. water distillate was extracted with hexane and dichloromethane . \n the organic phase was dried over anhydrous sodium sulfate and the solvent was distilled off using thin film rotary vacuum evaporator at temperature range 25 - 30. the oils were stored in tightly closed dark vials at 4 until analysis . \n the oil was analyzed by using a varian 450 ( tg-5 , 30 m0.25 mm i.d . , \n the oven temperature was programmed from 60 to 220 at 3/min , using nitrogen as carrier gas . \n the injector temperature was 230 and the detector ( fid ) temperature 240. gc - ms utilized a thermo scientific trace ultra gc interfaced with a thermo scientific itq 1100 mass spectrometer fitted with a tg-5 ( thermo scientific ) fused silica capillary column ( 30 m0.25 mm ; 0.25 m film thickness ) . \n the oven temperature range was 60 - 220 at 3/min using helium as carrier gas at 1.0 ml / min . \n the injector temperature was 230 , and the injection size 0.1 l in n - hexane , with a split ratio of 1:50 . \n ms were taken at 70 ev with a mass range of m / z 40 - 450 . \n the essential oils of o. gratissimum and o. sanctum ( 5.0 g each ) were chromatographed separately on a silica gel ( 230 - 400 mesh ; qualigens fine chemicals , mumbai , india ) column ( 3.5100 cm ) eluted with increasing polarity mixtures of n - hexane / diethyl ether to give eugenol and methyl eugenol . \n the purity ( 99.80% for eugenol and 99.65% for methyl eugenol ) was determine by gc ( varian 450 gas chromatograph ) using the above analytical conditions . \n each oil component and their isolated constituents were identified on the basis of their retention index ( ri , determined with reference to homologous series of n - alkanes c8-c25 , under identical experimental condition ) , from ms library searches using the nist and wiley gc - ms databases and by comparison with literature mass spectral data . \n the structure of eugenol and methyl eugenol was further confirmed by h- and c - nmr . \n the microorganisms were obtained from the national collection of industrial microorganisms ( ncim ) , national chemical laboratory , pune . \n the microorganisms includes , gram - positive bacteria ( staphylococcus aureus ncim 2079 , staphylococcus epidermidis ncim 2493 , streptococcus faecalis ncmi 2080 , micrococcus flavus ncim 2379 , micrococcus luteus ncim 2103 , bacillus subtilis \n ncim2063 ) , gram - negative bacteria ( escherichia coli ncim 2574 , klebsiella pneumoniae ncim 2957 , serratia marcescens ncim 2078 , proteus vulgaris \n ncim 2813 , proteus mirabilis ncim 2241 , pseudomonas aeruginosa ncim5029 , salmonella typhimurium ncim 2501 , enterobacter aerogenes ncim 2694 ) and fungal strains ( aspergillus niger ncim 620 , aspergillus fumigatus ncim 902 and penicillium chrysogenum ncim 733 ) . \n the essential oils , eugenol and methyl eugenol , were dissolved in 10% dimethyl sulfoxide ( dmso ) . \n solan , himachal pradesh , india ) , amikacin ( iskon remedies , sirmour , himachal pradesh , india ) and amphotericin b ( chandra bhagat pharma pvt . ltd . , \n ankleshwar , india ) were used as the positive reference standards for gram - positive , gram - negative bacteria , and fungi , respectively . \n the inocula of microbial strains were prepared from 18 h old culture and suspensions were adjusted to 0.5 mcfarland standard turbidity ( 10 for bacteria and 10 for fungi colony forming unit ( cfu ) per milliliter ) . \n tube - dilution method was used to determine the minimum inhibitory concentration ( mic ) . \n essential oils , eugenol , and methyl eugenol were dissolved in 10% dmso separately with final concentrations of 5.0 mg / ml . \n serial two - fold dilutions were prepared from the stock solution to give concentration ranging from 5.0 to 0.009 mg / ml . \n erythromycin , amikacin , and amphotericin b were dissolved in sterile distilled water and two - fold dilutions were prepared ( 1.0 - 0.002 mg / ml ) . \n a total of 1 ml of each concentration was mixed with 1.0 ml of sterile nutrient broth for bacteria except for streptococcus faecalis ( mrs broth ) while peptone water was used for fungi ( at 0.5 mcfarland turbidity standard ) . \n solvent control was prepared with dmso ( 10% ) while blank control was prepared from virgin media . \n tubes were incubated for 24 and 48 h at 37 for bacteria and fungi , respectively . \n assay was performed in replicates and the mean value of six experiments was recorded ( n=6 ) with sem . \n the antioxidant activity of the essential oils , eugenol , and methyl eugenol was determined using 2,2-diphenyl-1-picrylhydrazyl ( dpph ) radical according to the method of hou et al .. dpph was dissolved in ethanol to give a 0.05 mm solution . \n final concentration of trolox ( antioxidant reference ) , essential oil of o. gratissimum and eugenol was 2.4 mg / ml , while 10 mg / ml was used for essential oil of o. sanctum and methyl eugenol . \n aliquots containing various concentrations ( 5 - 30 g / ml ) of trolox in the final volume of 1.0 ml were mixed with 1.0 ml of ethanol dpph solution . \n the oil of o. gratissimum and eugenol were tested at concentration range of 25 - 50 g / ml while oil of o. sanctum and methyl eugenol at 50 - 300 g / ml using the same method . \n the ethanol solution of dpph ( 1.0 ml ) with equal amount of ethanol served as control . \n reaction mixtures were incubated at 37 for 20 min and the dpph radical scavenging activity was determined by measuring the absorbance at 517 nm using a spectrophotometer . \n 2,2- azino - bis ( 3-ethylbenzthiazoline-6-sulphonic acid ) ( abts ) diammonium salt radical cation decolorization test was performed using spectrophotometric method of pellegrini et al .. the abts reagent stock was prepared by mixing 88 l of 140 mm potassium persulfate ( k2s2o8 ) with 5 ml of 7 mm of abts stock solution ( ph 7.4 ) . \n the working abts reagent was prepared by diluting the stock solution with ethanol to give an absorbance of 0.70.05 at 734 nm . \n the tested concentrations of trolox , oil of o. gratissimum , o. sanctum , and eugenol and methyl eugenol were same as represented in dpph assay . \n the abts working solution ( 1.0 ml ) with equal amount of ethanol served as control . \n the reaction mixtures were incubated at room temperature ( 28 ) for 30 min and the absorbance was measured at 734 nm . \n the scavenging dpph and abts activities of the tested samples were calculated as the following formula : percent ( % ) inhibition of dpph or abts=(1absorbance of sample / absorbance of control)100 . \n fresh flowering aerial parts ( 1.0 kg each ) of o. gratissimum and o. sanctum were steam distilled separately using copper still fitted with spiral glass condensers for 3 h. water distillate was extracted with hexane and dichloromethane . \n the organic phase was dried over anhydrous sodium sulfate and the solvent was distilled off using thin film rotary vacuum evaporator at temperature range 25 - 30. the oils were stored in tightly closed dark vials at 4 until analysis . \n the oil was analyzed by using a varian 450 ( tg-5 , 30 m0.25 mm i.d . , \n the oven temperature was programmed from 60 to 220 at 3/min , using nitrogen as carrier gas . \n the injector temperature was 230 and the detector ( fid ) temperature 240. gc - ms utilized a thermo scientific trace ultra gc interfaced with a thermo scientific itq 1100 mass spectrometer fitted with a tg-5 ( thermo scientific ) fused silica capillary column ( 30 m0.25 mm ; 0.25 m film thickness ) . \n the oven temperature range was 60 - 220 at 3/min using helium as carrier gas at 1.0 ml / min . \n the injector temperature was 230 , and the injection size 0.1 l in n - hexane , with a split ratio of 1:50 . \n ms were taken at 70 ev with a mass range of m / z 40 - 450 . \n the essential oils of o. gratissimum and o. sanctum ( 5.0 g each ) were chromatographed separately on a silica gel ( 230 - 400 mesh ; qualigens fine chemicals , mumbai , india ) column ( 3.5100 cm ) eluted with increasing polarity mixtures of n - hexane / diethyl ether to give eugenol and methyl eugenol . the purity ( 99.80% for eugenol and 99.65% for methyl eugenol ) \n was determine by gc ( varian 450 gas chromatograph ) using the above analytical conditions . \n each oil component and their isolated constituents were identified on the basis of their retention index ( ri , determined with reference to homologous series of n - alkanes c8-c25 , under identical experimental condition ) , from ms library searches using the nist and wiley gc - ms databases and by comparison with literature mass spectral data . \n the structure of eugenol and methyl eugenol was further confirmed by h- and c - nmr . \n the microorganisms were obtained from the national collection of industrial microorganisms ( ncim ) , national chemical laboratory , pune . \n the microorganisms includes , gram - positive bacteria ( staphylococcus aureus ncim 2079 , staphylococcus epidermidis ncim 2493 , streptococcus faecalis ncmi 2080 , micrococcus flavus ncim 2379 , micrococcus luteus ncim 2103 , bacillus subtilis \n ncim2063 ) , gram - negative bacteria ( escherichia coli ncim 2574 , klebsiella pneumoniae ncim 2957 , serratia marcescens ncim 2078 , proteus vulgaris ncim 2813 , proteus mirabilis ncim 2241 , pseudomonas aeruginosa ncim5029 , salmonella typhimurium ncim 2501 , \n enterobacter aerogenes ncim 2694 ) and fungal strains ( aspergillus niger ncim 620 , aspergillus fumigatus ncim 902 and penicillium chrysogenum ncim 733 ) . \n the essential oils , eugenol and methyl eugenol , were dissolved in 10% dimethyl sulfoxide ( dmso ) . \n solan , himachal pradesh , india ) , amikacin ( iskon remedies , sirmour , himachal pradesh , india ) and amphotericin b ( chandra bhagat pharma pvt . ltd . , \n ankleshwar , india ) were used as the positive reference standards for gram - positive , gram - negative bacteria , and fungi , respectively . \n the inocula of microbial strains were prepared from 18 h old culture and suspensions were adjusted to 0.5 mcfarland standard turbidity ( 10 for bacteria and 10 for fungi colony forming unit ( cfu ) per milliliter ) . \n tube - dilution method was used to determine the minimum inhibitory concentration ( mic ) . \n essential oils , eugenol , and methyl eugenol were dissolved in 10% dmso separately with final concentrations of 5.0 mg / ml . \n serial two - fold dilutions were prepared from the stock solution to give concentration ranging from 5.0 to 0.009 mg / ml . \n erythromycin , amikacin , and amphotericin b were dissolved in sterile distilled water and two - fold dilutions were prepared ( 1.0 - 0.002 mg / ml ) . \n a total of 1 ml of each concentration was mixed with 1.0 ml of sterile nutrient broth for bacteria except for streptococcus faecalis ( mrs broth ) while peptone water was used for fungi ( at 0.5 mcfarland turbidity standard ) . \n solvent control was prepared with dmso ( 10% ) while blank control was prepared from virgin media . \n tubes were incubated for 24 and 48 h at 37 for bacteria and fungi , respectively . \n assay was performed in replicates and the mean value of six experiments was recorded ( n=6 ) with sem . \n the antioxidant activity of the essential oils , eugenol , and methyl eugenol was determined using 2,2-diphenyl-1-picrylhydrazyl ( dpph ) radical according to the method of hou et al .. dpph was dissolved in ethanol to give a 0.05 mm solution . \n final concentration of trolox ( antioxidant reference ) , essential oil of o. gratissimum and eugenol was 2.4 mg / ml , while 10 mg / ml was used for essential oil of o. sanctum and methyl eugenol . \n aliquots containing various concentrations ( 5 - 30 g / ml ) of trolox in the final volume of 1.0 ml were mixed with 1.0 ml of ethanol dpph solution . \n the oil of o. gratissimum and eugenol were tested at concentration range of 25 - 50 g / ml while oil of o. sanctum and methyl eugenol at 50 - 300 g / ml using the same method . \n the ethanol solution of dpph ( 1.0 ml ) with equal amount of ethanol served as control . \n reaction mixtures were incubated at 37 for 20 min and the dpph radical scavenging activity was determined by measuring the absorbance at 517 nm using a spectrophotometer . \n 2,2- azino - bis ( 3-ethylbenzthiazoline-6-sulphonic acid ) ( abts ) diammonium salt radical cation decolorization test was performed using spectrophotometric method of pellegrini et al .. the abts reagent stock was prepared by mixing 88 l of 140 mm potassium persulfate ( k2s2o8 ) with 5 ml of 7 mm of abts stock solution ( ph 7.4 ) . \n the working abts reagent was prepared by diluting the stock solution with ethanol to give an absorbance of 0.70.05 at 734 nm . \n the tested concentrations of trolox , oil of o. gratissimum , o. sanctum , and eugenol and methyl eugenol were same as represented in dpph assay . \n the abts working solution ( 1.0 ml ) with equal amount of ethanol served as control . \n the reaction mixtures were incubated at room temperature ( 28 ) for 30 min and the absorbance was measured at 734 nm . \n the scavenging dpph and abts activities of the tested samples were calculated as the following formula : percent ( % ) inhibition of dpph or abts=(1absorbance of sample / absorbance of control)100 . \n the yields of essential oils from o. gratissimum and o. sanctum were 1.05 and 1.20% , respectively . \n table 1 shows the compounds identified in the oils of o. gratissimum and o. sanctum along with their percentage composition and retention index on a tg-5 capillary column . \n volatile constituents identified in the o. gratissimum were 10 monoterpene hydrocarbons ( 15.5% ) , 6 oxygenated monoterpenes ( 1.6% ) , 9 sesquiterpene hydrocarbons ( 6.1% ) , 1 oxygenated sesquiterpene ( 0.1% ) , and 5 phenyl derivatives ( 76.0% ) comprising 31 constituents ( 99.3% ) of the total oil . \n the other minor compounds were terpinolene ( 14.2% ) and germacrene d ( 3.9% ) . \n essential oil composition of o. gratissimum and o. sanctum the major volatile constituent identified in the essential oil of o. sanctum was methyl eugenol ( 92.4% ) . \n the class compositions were 5 monoterpene hydrocarbons ( 0.3% ) , -caryophyllene ( 1.3% ) . \n the class compositions were 5 monoterpene hydrocarbons ( 0.3% ) , 3 oxygenated monoterpenes ( 0.2% ) , 9 sesquiterpene hydrocarbons ( 2.6% ) , 5 oxygenated sesquiterpenes ( 0.9% ) and 3 phenyl derivatives ( 94.9% ) , comprising 25 constituents ( 98.9% ) of the total oil . \n ten compounds were found to be common in the oils of o. gratissimum and o. sanctum , which were -pinene , e--ocimene , terpinolene , -terpineol , eugenol , -cubenene , -caryophyllene , - muurolene , -muurolene , epi - cubebol , and -cubebol , and -cadinene in less quantity . \n the results of antimicrobial activity of the essential oils , eugenol and methyl eugenol are presented in table 2 . the minimum inhibitory concentration ( mic ) values are represented as mg / ml . \n the essential oil of o. gratissimum was found highly active against e. coli , s. marcescens , and k. pneumoniae . \n the essential oil of o. sanctum was found to posses significant antimicrobial activity against the microorganisms like s. epidermis , p. aeruginosa , a. niger , and s. faecalis . \n methyl eugenol was found to possess significant antimicrobial activity against p. aeruginosa and p. mirabilis , while eugenol was found to be effective only against s. aureus . \n mic values of o. gratissimum and o. sanctum essential oils and eugenol and methyl eugenol compared to the standard antibacterial agents used in the study ( erythromycin , amikacin , and amphotericin b ) , the essential oils of o. gratissimum and o. sanctum and their main components have a weaker antibacterial activity . \n according to wan et al . , the majority of the essential oils assayed for their antibacterial properties showed a more pronounced effect against the gram - positive bacteria . \n the resistance of gram - negative bacteria to essential oil has been ascribed to their hydrophilic outer membrane which can block the penetration of hydrophobic compounds into target cell membrane . \n thus , the methyl eugenol is more hydrophobic than eugenol ; however , hydroxyl group of eugenol may not be involved for hydrogen bonding due to the presence of ome group in ortho position of eugenol produced steric hindrance . \n this may explain the weaker antimicrobial activity of the eugenol and methyl eugenol against gram - negative bacteria . \n the other phenolic components though low in the essential oils of o. gratissimum and o. sanctum could be contributing for antimicrobial activity by causing leakage of intracellular atp and potassium ions leading to cell death . \n dpph and abts assay were adopted for evaluation of antioxidant properties of essential oils , eugenol , and methyl eugenol . \n antioxidant activity in series of two - fold dilutions , the concentration of each oil and isolated compounds were used to calculate the inhibition concentration ic50 in g / ml . \n the amount of sample required to decrease the absorption of dpph and abts by 50% were calculated graphically ( % of inhibition was plotted against the concentration in g / ml ) . \n the essential oil of o. gratissimum showed potent antioxidant activity , which could be due to high amount of eugenol ( > 75% ) . \n this higher antioxidant capacity of the oil of o. gratissimum could be the synergistic property due to the presence of other phenolic constituents viz . \n cis - sabinene hydrate , trans - sabinene hydrate , terpine-4-ol , -terpineol , thymol , carvacrol , and epi - cubebol present in small quantity ( 2.1% of the total oil ) . \n hence , the oil of o. gratissimum showed better antioxidant property than pure eugenol . on the other hand , \n essential oil of o. sanctum expressed feeble antioxidant activity with dpph and abts models with ic50 values of 219.161.01 and 241.501.08 , respectively , while methyl eugenol did not show any initial antioxidant activity , which may be due to the absence of participating electron delocalization group or proton ( s ) . \n the presence of the cineol-1,8 , -terpineol , eugenol , epi - cubebol , cubebol , 10-epi - cubebol , 1,10-di - epi - cubenol , and epi--cadinol comprising 3.50% of the total oil could show weak antioxidant activity . \n the essential oils , eugenol , were compared with known synthetic antioxidant trolox ( table 3 ) . \n the most obvious are the nonspecific responses and synergistic effects of the compounds present in the crude extracts . \n for this reason a bioassay - directed fractionation of an active extract does not always lead to the isolation of active compounds . \n an apparent loss of activity on separation of synergistically acting components of low individual potency can not be easily distinguished from the loss of activity resulting from chemical changes induced by a particular isolation technique . in this study \n , we concluded that o. gratissimum and o. sanctum of this region can be used as a source of food additives , preservatives , and as an antiseptic . \n antioxidant activity of o. gratissimum , o. sanctum oils , eugenol , methyl eugenol and trolox determined by dpph and abts methods", "role": "user" }, { "content": "the essential oils of the flowering aerial parts of two ocimum species viz . \n , ocimum gratissimum and o. sanctum were analyzed by gas chromatography and gas chromatography / mass spectroscopy . \n the principal constituent of o. gratissimum and o. sanctum was eugenol ( 75.1% ) and methyl eugenol ( 92.4% ) , comprising 99.3 and 98.9% of the total oils , respectively . in vitro antimicrobial activity of the essential oils of o. gratissimum \n , o. sanctum and their major compounds eugenol and methyl eugenol were screened by using tube dilution methods . o. gratissimum oil was found highly active against s. marcescens while o. sanctum oil showed significant activity against a. niger and s. faecalis . \n methyl eugenol exhibited significant activity against p. aeruginosa while eugenol was effective only against s. aureus . \n antioxidant activity of oils , eugenol , and methyl eugenol was determined by 2,2-diphenyl-1-picrylhydrazyl and 2,2- azino - bis(3-ethylbenzthiazoline-6-sulphonic acid ) assays . \n essential oil of o. gratissimum showed comparative antioxidant activity with ic50 values 23.660.55 and 23.910.49 g / ml in 2,2-diphenyl-1-picrylhydrazyl and 2,2- azino - bis(3-ethylbenzthiazoline-6-sulphonic acid ) models , respectively . \n eugenol showed slightly weaker antioxidant activity compared to oil of o. gratissimum , while o. sanctum oil demonstrated very feeble antioxidant activity and methyl eugenol did not show any activity . \n eugenol and methyl eugenol would be elite source from o. gratissimum and o. sanctum , respectively , of this region could be consider as a source of natural food antioxidant , preservatives , and as an antiseptic .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: head and neck cancer is one of the most important cancers worldwide , and it is the third common malignancy in developing countries . among these cancers , squamous cell carcinoma ( scc ) with 54% mortality rate has the highest frequency . \n so a vast part of oncologic studies has been done on this neoplasm . despite many improvements in treatment over the past 30 years \n therefore , the prevention and any innovation that facilitates early detection of this neoplasm have the potential to improve survival and quality of life . \n evaluation of histopathological similarity of these tumors to their parent tissue and the amount of their keratin production is called grading . \n in addition to histopathological features that can affect on its prognosis , many efforts have been done to find molecular markers that can predict its biologic behavior . \n furthermore , many studies have evaluated the molecular signals that initiate carcinogenesis , but they are still unidentified . \n heat shock proteins ( hsps ) are a family of cytoprotective proteins vary in molecular size from 8 to 150 kda that are known to play a role in the repair of denatured proteins in the cell . \n it seems that cytoprotective properties of hsps may help in malignant development by facilitating tumor cell growth and survival . among the several hsps , hsp27 and 70 \n have been reported to have a strong relationship with cancer and either increase or decrease of their levels have been shown during carcinogenesis . \n for example lo muzio , wan - yu lo and anxun wang and colleagues reported that expression of hsp27 in scc was significantly higher than normal mucosa . \n moreover studies of lee and xiaoping wang revealed that expression levels of hsp70 in scc were higher than normal epithelium ; but unlike hsp27 , it had reverse correlation with differentiation . \n the present study was performed with the aim of estimating the amount of the immunohistochemical expression of hsp27 and hsp70 in the histopathological grades of scc original hypothesis in this study is that there is a correlation between expression of hsp27 and hsp70 and histopathological grades of scc . \n this retrospective , analytical study involved the following four procedures : the achieved tissue samples from 51 cases of scc from various sites of oral and paraoral regions such as alveolar mucosa , tongue , oropharynx , buccal mucosa , larynx and esophagus ( 17 well differentiated , 17 moderately differentiated , 17 poorly differentiated ) and 10 normal oral epithelium specimens from normal mucosa over the third impacted molar were used in this study . \n the patients consist of 38 men and 19 women with a mean age of 66.9 years who had undergone excisional biopsy between 2005 and 2010 . \n in addition , samples with insufficient fixation and those containing hemorrhage or necrosis were excluded . \n diagnosis was based on histological examination of hematoxylin and eosin stained sections and the tumor grade was classified according to the bryne 's classification 3 - 4 micron sections from paraffin embedded specimens were mounted on poly - l - lysine - coated glass slides . after rinsing with 3 changes of xylol for deparaffinization \n , the sections were rehydrated with alcohol at different discending concentrations ( 100% , 100% , 95% , 85% , and 75% ) . in order to inactivate endogenous peroxidase , \n sections were incubated for 5 min in 3% h2o2 , and were then rinsed with phosphate - buffered saline ( pbs ) . \n specimens were incubated for 1 h with the lyophilized monoclonal anti - hsp27 ( ncl - hsp27 . \n clone 2b4 ; novocastra , germany ) at a dilution of 1:20 and the lyophilised monoclonal anti - hsp70 ( ncl - hsp70 , 8b11 ; novocastra , germany ) at a dilution of 1:100 . \n immune complexes were subsequently treated with post primary block and then detected by novolink polymer ( novocastra , germany ) for 30min , both incubated for 30 min at room temperature . after rinsing with pbs , \n the prepared specimens were stained with hematoxyline ( harris ) , mounted with p.v mount and evaluated via light microscopy ( olympus bx41tf , tokyo , japon ) by two independent observers . \n a scale of 0 to 4 was used to score relative intensity with 0 corresponding to non detectable immunoreactivity and 1 , 2 , 3 , 4 for very low , low , moderate and high staining , respectively . after staining , \n the mean percentage of positive cells in 10 high power field of microscope was determined at a scale of 1 to 4 was used . \n 1 showed staining of 0 - 25% of cells and 2 , 3 , 4 showed 25 - 50% , 50 - 75% , 75- 100% staining respectively . \n when inter - observer dissimilarity was seen between scores , the slides were re examined concurrently using a double headed light microscope . \n finally staining - intensity distribution ( sid ) index was determined by multiplying these two scores for each specimen . \n the achieved tissue samples from 51 cases of scc from various sites of oral and paraoral regions such as alveolar mucosa , tongue , oropharynx , buccal mucosa , larynx and esophagus ( 17 well differentiated , 17 moderately differentiated , 17 poorly differentiated ) and 10 normal oral epithelium specimens from normal mucosa over the third impacted molar were used in this study . \n the patients consist of 38 men and 19 women with a mean age of 66.9 years who had undergone excisional biopsy between 2005 and 2010 . \n metastatic tumors and small samples were eliminated in this study . in addition , samples with insufficient fixation and those containing hemorrhage or necrosis were excluded . \n diagnosis was based on histological examination of hematoxylin and eosin stained sections and the tumor grade was classified according to the bryne 's classification \n 3 - 4 micron sections from paraffin embedded specimens were mounted on poly - l - lysine - coated glass slides . \n after rinsing with 3 changes of xylol for deparaffinization , the sections were rehydrated with alcohol at different discending concentrations ( 100% , 100% , 95% , 85% , and 75% ) . in order to inactivate endogenous peroxidase , \n sections were incubated for 5 min in 3% h2o2 , and were then rinsed with phosphate - buffered saline ( pbs ) . \n specimens were incubated for 1 h with the lyophilized monoclonal anti - hsp27 ( ncl - hsp27 . \n clone 2b4 ; novocastra , germany ) at a dilution of 1:20 and the lyophilised monoclonal anti - hsp70 ( ncl - hsp70 , 8b11 ; novocastra , germany ) at a dilution of 1:100 . \n immune complexes were subsequently treated with post primary block and then detected by novolink polymer ( novocastra , germany ) for 30min , both incubated for 30 min at room temperature . after rinsing with pbs , \n the prepared specimens were stained with hematoxyline ( harris ) , mounted with p.v mount and evaluated via light microscopy ( olympus bx41tf , tokyo , japon ) by two independent observers . \n a scale of 0 to 4 was used to score relative intensity with 0 corresponding to non detectable immunoreactivity and 1 , 2 , 3 , 4 for very low , low , moderate and high staining , respectively . after staining , \n the mean percentage of positive cells in 10 high power field of microscope was determined at a scale of 1 to 4 was used . \n 1 showed staining of 0 - 25% of cells and 2 , 3 , 4 showed 25 - 50% , 50 - 75% , 75- 100% staining respectively . when inter - observer dissimilarity was seen between scores , \n finally staining - intensity distribution ( sid ) index was determined by multiplying these two scores for each specimen . \n statistical analysis was performed using kruskal wallis , mann whitney and spearman rho correlation tests . \n diffuse hsp27 staining was seen with higher intensity in differentiated areas [ figure 1 ] . \n immunohistochemistry analysis of hsp27 expression : ( 100 ) ( a ) normal mucosa ( 1-cytoplasmic staining of parabasal layers , 2-basal layer without staining ) ( b ) well differentiated scc ( 1- cytoplasmic staining of epithelial pearls ) ( c ) moderately differentiated scc ( 1-cytoplasmic staining of epithelial nests ) ( d ) poorly differentiated scc ( 1- cytoplasmic staining of epithelial nests ) percentage of stained cells with hsp27 figure 2 shows the mean expression levels of hsp27 in different grades of scc . \n mean sid index for hsp27 in different grades of scc the expression of hsp27 in well - differentiated scc was significantly higher than normal epithelium ( p=0.007 ) and in moderately differentiated scc higher than poorly differentiated scc ( p=0.023 ) . \n statistical analysis showed inverse correlation between hsp27 expression and scc 's histopathological grade ( p=0.001 , r=0.448 ) [ table 2 ] . \n spearman 's rho correlation of hsp27 with differentiation grade cytoplasmic staining for hsp70 was observed diffusely in normal mucosa and scc [ figure 3 ] . \n immunohistochemistry analysis of hsp70 expression ( 100 ) : ( a ) normal mucosa ( poor cytoplasmic staining ) ( b ) well differentiated scc ( poor cytoplasmic staining ) ( c ) moderately differentiated scc ( poor cytoplasmic staining ) ( d ) poorly differentiated scc ( poor cytoplasmic staining ) percentage of stained cells with hsp70 mean sid index for hsp70 in different grades of scc there was no significant difference between hsp70 staining of specimens ( p=0.38 ) . \n hsps are unique cytoprotective proteins that are thought to be the most ancient defense system in all living microorganisms of the earth . \n they were principally named because of their expression after heat exposure , but now it is known that variety of environmental and metabolic stresses may stimulate their expression . \n hsps are requisite for folding of newly formed proteins and repair of denatured proteins after stress or injury . in addition \n atypical levels of hsps have been reported in numerous diseases such as autoimmune diseases , alzheimer 's disease and malignancies . among hsps , hsp70 and \n hsp27 seem to have a strong association with cancer and many studies have found alteration of their expression level in different cancers . in this study , \n the reasons for this increased expression could be as follows : hsp27 prevents function of cytochrome c and procaspase and could prevent mitochondrial apoptosis via this mechanism . because defective apoptosis is one of the known mechanisms of cancer development , so hsp27 can cause increased risk of cancer progression . \n hsp27 expression is increased by the production of free radicals and increases cell resistance to oxidative damage . \n based on previous studies that show free radicals can lead cells to become malignant , it can be suggested that the increase in free radicals in cancer cells may be at least somewhat responsible for higher expression of hsp27 in scc . \n our findings were consistent with the results of lo muzio , anxun wang and wan - yu lo romanucci stated that hsp27 plays an important role in differentiation ; this theory was also evident in this study because the expression of hsp27 was inversely related to histopathologic grade of scc so that the lowest expression of hsp27 was observed in poorly differentiated scc . \n moreover , in most specimens of the normal epithelium , staining for hsp27 was limited to parabasal layers with higher intensity in superficial layers which are more differentiated . \n these observations were consistent with anxun wang 's findings in 2009 . despite these findings , \n although in some studies , relationship between hsp27 expression and survival rate was found , inverse correlation was observed in another study . \n these conflicting results may be due to heterogeneity of oncogenic pathways ; so , some oncogenic pathways may remain normal despite cancer development . among hsps \n many studies have been done on the role of hsp70 in cell survival and its probable influence on cancer development and apoptosis . \n for example , dudeja and colleagues expressed that hsp70 can prevent apoptosis of cultured pancreatic cancer cells . \n but unlike these two , mosser had reached the conclusion that increased hsp70 can not protect cells against apoptosis . in another study \n , liossis announced that higher expression of hsp70 facilitates fas - mediated apoptosis in jurkat cells . \n joo showed that hsp70 has a polyotropic function in cell survival and can prevent or cause apoptosis under various conditions . \n this study examined the relationship between the expression of hsp70 with oral scc , and no significant differences between the expression of this marker in normal tissue and oral cancer was observed . \n lee showed increased expression levels of hsp70 in scc associated with chewing areca quid ; it is possible that the increased expression of hsp70 was due to specific condition of his study ( chewing areca ) as he also mentioned that high copper content in areca is the probable reason of increase in hsp70 expression . \n moreover , xiaoping wang in 2010 found significant correlation between hsp72 ( a subgroup of hsp70 ) and progression of esophageal scc . \n these different results may be due to various roles of hsp70 and also structural variations of its subgroups that can have distinct biological behaviors . \n additional studies may be warranted to evaluate the correlation between hsp27 and hsp70 expression and clinical stages of scc and it is also proposed to concentrate on only oral samples in further researches for elimination of confounder variable . \n the current study revealed that the expression level of hsp27 was inversely related to histopathological grade of scc and it may offer prognostic value for patients with scc . \n however there was no significant relationship between the expression of hsp70 and histopathological grades of scc .", "role": "user" }, { "content": "background : heat shock proteins ( hsps ) are a family of proteins that are known to play a significant role in the repair of denatured proteins in the cell . \n it seems that cytoprotective properties of hsps may help in malignant progression by facilitating tumor cell growth and survival . \n the purpose of this study is to evaluate hsp27 and hsp70 expression in various histopathological grades of squamous cell carcinoma ( scc).materials and methods : in this retrospective - analytical study , the sections of 51 formalin - fixed paraffin - embedded biopsy specimens of scc from various sites of oral and paraoral regions and 10 normal oral mucosa were immunostained by novolink polymer technique to determine the expression of hsp27 and hsp70 . \n then the data were analyzed according to the kruskal \n walis , mann whitney and the spearman correlation tests ( p<0.05).results : the expression of hsp27 in well - differentiated scc was significantly higher than normal epithelium ( p=0.007 ) and in moderately differentiated scc higher than poorly - differentiated scc ( p=0.023 ) . \n inverse correlation was observed between hsp27 expression and scc 's histopathological grade ( p=0.001 , r=-0.448 ) . \n there was no significant difference between hsp70 staining of specimens ( p=0.38).conclusions : the present study revealed that the expression level of hsp27 was inversely related to histopathological grade of scc and it may provide prognostic value for patients with scc , but there was no significant relationship between the expression of hsp70 and histopathological grades of scc .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: brachytherapy ( bt ) , a type of radiotherapy using energy from radionuclides inserted directly into the tumor , is increasingly used in cancer treatment . \n it has become a standard therapy for cervical cancer and an important part of the treatment guidelines for other malignancies including head and neck , skin , breast , and prostate [ 1 , 2 ] . \n compared to external beam radiotherapy ( ebrt ) , it has the potential to deliver an ablative radiation dose over a short time period directly to the altered tissue area with the advantage of a rapid fall - off in dose and consequent sparing of neighboring organs . as a result \n , the patient is allowed to complete the treatment sooner and the risks of a second cancer are lower than in conventional radiotherapy . \n generally , two competitive techniques of bt are commonly and increasingly used : low - dose - rate ( ldr ) , involving permanent implantation of radioactive seeds ( in prostate cancer ) , and high - dose - rate ( hdr ) with the dose delivered from a single high - activity radioactive source ( usually iridium 192 [ ir ] or cobalt 60 [ co ] ) . \n including poland , both ldr and hdr are being used what allows comparison of their efficiency and side effects [ 4 , 5 ] . \n moreover , a combination of bt and ebrt has been shown to be an effective treatment for some types of malignancies , e.g. cervical cancer . consecutively , in advanced cancers bt can be combined with chemotherapy ( chemoradiotherapy ) to improve survival and decrease the risk of disease recurrence . \n as in the case of any other medical treatment , bt in the form of ldr or hdr , applied alone or in combination with ebrt or pharmacological methods can generate various side effects , which may profoundly decrease patients quality of life [ 8 , 9 ] . \n the overall toxicity of bt is a resultant of the treatment type , irradiated body area , the individual characteristics , and susceptibility of patients . \n the acute toxicity of radiation therapy is usually evaluated using morbidity scoring criteria , which is useful in the comparison of side effects induced by various types of radiotherapy methods and patient conditions [ 10 , 11 , 12 ] . to the best of our knowledge \n , no study has so far evaluated the side effects of bt as perceived by patients , or assessed the occurrence and severity of these side effects in relation to different patient characteristics . \n the aim of the following study was to determine the frequency and severity of various physical and psychosocial side - effects of hdr bt and ldr bt in patients shortly after completing the treatment plan . \n the research also aimed to identify , which patient characteristics ( including age , weight , cigarette smoking , and alcohol consumption ) may influence the occurrence of early toxic effects of bt . \n the identification of factors , which can increase the frequency of bt side effects , is potentially useful in the preparation of patients for therapy . \n it may help reduce the severity of adverse events and also have a beneficial impact on the patient 's quality of life following the treatment . \n a group of 70 consecutive patients who underwent ldr ( prostate cancer ) or hdr ( breast cancer , head and neck cancer , prostate cancer ) bt at the greater poland cancer centre ( poznan , poland ) were enrolled into the study . \n patients undergoing it in combination with ebrt , chemotherapy , or hormone therapy were excluded from the study . \n the treatment was performed using the microselectron hdr and oncentra masterplan vs 3.2 ( nucletron , an elekta company , elekta ab , stockholm , sweden ) treatment planning system . for ldr bt in prostate cancer , the spot / swift oncentra masterplan vs. 3.2 ( nucletron ) \n was also used . for prostate cancer , hdr bt in 3 fractions of 10.5 gy , or in ldr bt 145 gy ( total dose ) were given . \n all patients were interviewed face - to - face at the end of their course of treatment . \n the former were categorized into 6 groups including dermatological ( 3 ) , gastroenterological ( 16 ) , neurological ( 8) , ocular ( 2 ) , pulmonological ( 3 ) , and urological ( 3 ) symptoms . \n patients , divided into three groups according to the treated cancer type , were asked to describe the severity of each physical symptom using a five point scale ( not occurring , mild , moderate , intense , very intense ) . \n the effect of bt on psychosocial function was described using a four point scale ( no effect , mild effect , moderate effect , strong effect ) . \n information on gender , age , body mass index ( bmi ) , smoking , and drinking habits , as well as radiated body part and number of bt treatments was acquired for each enrolled patient . \n the study was approved by board of directors of greater poland cancer centre and its design was consistent with the declaration of helsinki . \n statistical analyses were performed using the statistica v.10.0 software package ( statsoft , tulsa , ok , usa ) . \n pearson 's 2 test was applied to compare the frequencies of the answers among the different groups . \n the relationship between the two datasets was determined with non - parametric spearman 's rank correlation coefficient . \n a group of 70 consecutive patients who underwent ldr ( prostate cancer ) or hdr ( breast cancer , head and neck cancer , prostate cancer ) bt at the greater poland cancer centre ( poznan , poland ) were enrolled into the study . \n patients undergoing it in combination with ebrt , chemotherapy , or hormone therapy were excluded from the study . \n the treatment was performed using the microselectron hdr and oncentra masterplan vs 3.2 ( nucletron , an elekta company , elekta ab , stockholm , sweden ) treatment planning system . for ldr bt in prostate cancer , the spot / swift oncentra masterplan vs. 3.2 ( nucletron ) \n was also used . for prostate cancer , hdr bt in 3 fractions of 10.5 gy , or in ldr bt 145 gy ( total dose ) were given . \n all patients were interviewed face - to - face at the end of their course of treatment . \n the former were categorized into 6 groups including dermatological ( 3 ) , gastroenterological ( 16 ) , neurological ( 8) , ocular ( 2 ) , pulmonological ( 3 ) , and urological ( 3 ) symptoms . \n patients , divided into three groups according to the treated cancer type , were asked to describe the severity of each physical symptom using a five point scale ( not occurring , mild , moderate , intense , very intense ) . \n the effect of bt on psychosocial function was described using a four point scale ( no effect , mild effect , moderate effect , strong effect ) . \n information on gender , age , body mass index ( bmi ) , smoking , and drinking habits , as well as radiated body part and number of bt treatments was acquired for each enrolled patient . \n the study was approved by board of directors of greater poland cancer centre and its design was consistent with the declaration of helsinki . \n statistical analyses were performed using the statistica v.10.0 software package ( statsoft , tulsa , ok , usa ) . \n pearson 's 2 test was applied to compare the frequencies of the answers among the different groups . \n the relationship between the two datasets was determined with non - parametric spearman 's rank correlation coefficient . \n the demographical characteristics of the bt patients enrolled in the study are presented in table 1 . \n all patients were interviewed after completing their planned hdr and ldr bt therapy of head and neck , breast , or prostate cancer . \n the group included 56 males ( 80% ) and 14 females ( 20% ) of a mean age of 66.9 10.3 . \n the majority of patients were non - smoking ( 85.7% ) and did not drink alcohol ( 61.4% ) during the therapy . \n due to low number of patients treated at head and neck area , the statistical comparison were conducted only between groups treated for breast or prostate cancer . \n demographical characteristics of patients undergoing brachytherapy enrolled in the study the irradiated body part affected the frequency of the studied symptoms ( table 2 , table 3 ) . chewing difficulties and dysphagia \n they did not , however , report headaches , concentration difficulties , or insomnia . in turn , bt of prostate cancer was characterized by the greatest frequency of bloating and weight gain , and a relatively high frequency of neurological symptoms . \n patients irradiated with breast cancer were found to report skin inflammation more often than prostate cancer patients ( table 3 ) . \n the frequency ( % ) of gastroenterological side effects of brachytherapy according to the radiated body part and patient characteristics . \n asterisks indicate statistical difference between compared groups ( p < 0.05 , test ) . \n head and neck group was excluded from comparison due to low number of employed patients the frequency ( % ) of dermatological ( d ) , neurological ( n ) , ocular ( o ) , pulmonological ( p ) , and urological ( u ) side effects of brachytherapy according to the patient characteristics . \n asterisks indicate statistical difference between compared groups ( p < 0.05 , test ) . \n head and neck group was excluded from comparison due to low number of employed patients in general , patient characteristics affected the frequencies of side effects ( table 2 ) . \n cigarette smoking significantly increased the frequency of nausea , rectal pain , dyschezia , and weight loss following the bt treatment . \n patients who consumed alcohol during the period of bt treatment reported chewing difficulties more often but none of them experienced taste impairment ( table 2 ) . \n urinary incontinence was reported more frequently by alcohol - drinking patients but was significantly lower in the overweight group . \n overweight subjects experienced a higher frequency of insomnia while non - smoking and alcohol - drinking patients suffered more commonly from drowsiness . \n no differences in the frequencies of ocular or pulmonological side effects were observed in patients differing in weight , cigarette smoking , and alcohol consumption ( table 3 ) . \n brachytherapy treatment was found to be responsible for various adverse psychosocial effects in the studied group ( fig . \n over 50% of patients reported that the treatment had decreased their general life satisfaction , over 40% that it decreased their sense of security , while over 30% stated that it had affected their self - esteem and altered their financial status . \n no differences in the frequency of any psychosocial effects of bt were reported in groups of patients suffering from different forms of cancer . \n however , it was found that compared to patients with bmi in the 18.5 - 24.9 range , overweight patients experienced a higher frequency of decreased self - esteem ( 9.1 vs. 40.0% ; p < 0.05 ) and a lessened sense of security ( 38.2 vs. 53.3% ; p < 0.05 ) following the bt treatment . \n the frequency of reported brachytherapy effects on the psychosocial function of treated patients in general , the frequency of side effects reported as \n the greatest severity was reported for skin inflammation ( 4.3% reported as very intense and 7.1% as intense ) , for gastroenterological weight gain ( 5.7% reported it as intense ) , for neurological headaches ( 8.6% reported it as intense ) , for ocular keratoconjunctivitis ( 1.4% reported it as very intense ) , for pulmonological dyspnea ( 4.3% reported it as intense ) , and for urological pollakiuria ( 17.1 reported it as intense and 7.1% as very intense ) . \n the number of bt treatments had a significant effect on the severity of pollakiuria ( rs = 0.32 , p < 0.05 ) , urinary incontinence ( rs = 0.31 , p < 0.05 ) , and dyschezia ( rs = 0.29 , p < 0.05 ) . age was significantly associated with the severity of urological symptoms : pollakiuria ( rs = 0.27 , p < 0.05 ) and urinary incontinence ( rs = 0.28 , p < 0.05 ) . \n moreover , the severity of dyschezia also increased with age ( rs = 0.34 , p < 0.05 ) . \n in turn , increased bmi was followed by less severe urinary incontinence ( rs = 0.25 , p < 0.05 ) . as far as psychosocial side effects are concerned , \n patient age was negatively correlated with the severity of the effect of bt on professional careers ( rs = 0.43 , p < 0.05 ) . in turn \n , the bmi of patients was positively correlated with a decrease of self - esteem ( rs = 0.30 , p < 0.05 ) and sense of security ( rs = 0.25 , p < 0.05 ) . \n the number of bt treatments did not affect the severity of any of the studied psychosocial side effects . \n the demographical characteristics of the bt patients enrolled in the study are presented in table 1 . \n all patients were interviewed after completing their planned hdr and ldr bt therapy of head and neck , breast , or prostate cancer . \n the group included 56 males ( 80% ) and 14 females ( 20% ) of a mean age of 66.9 10.3 . \n the majority of patients were non - smoking ( 85.7% ) and did not drink alcohol ( 61.4% ) during the therapy . \n due to low number of patients treated at head and neck area , the statistical comparison were conducted only between groups treated for breast or prostate cancer . \n the irradiated body part affected the frequency of the studied symptoms ( table 2 , table 3 ) . \n chewing difficulties and dysphagia were reported most often by patients treated in the head and neck area . \n they did not , however , report headaches , concentration difficulties , or insomnia . in turn , bt of prostate cancer was characterized by the greatest frequency of bloating and weight gain , and a relatively high frequency of neurological symptoms . \n patients irradiated with breast cancer were found to report skin inflammation more often than prostate cancer patients ( table 3 ) . \n the frequency ( % ) of gastroenterological side effects of brachytherapy according to the radiated body part and patient characteristics . \n asterisks indicate statistical difference between compared groups ( p < 0.05 , test ) . \n head and neck group was excluded from comparison due to low number of employed patients the frequency ( % ) of dermatological ( d ) , neurological ( n ) , ocular ( o ) , pulmonological ( p ) , and urological ( u ) side effects of brachytherapy according to the patient characteristics . \n asterisks indicate statistical difference between compared groups ( p < 0.05 , test ) . \n head and neck group was excluded from comparison due to low number of employed patients in general , patient characteristics affected the frequencies of side effects ( table 2 ) . \n cigarette smoking significantly increased the frequency of nausea , rectal pain , dyschezia , and weight loss following the bt treatment . \n patients who consumed alcohol during the period of bt treatment reported chewing difficulties more often but none of them experienced taste impairment ( table 2 ) . \n urinary incontinence was reported more frequently by alcohol - drinking patients but was significantly lower in the overweight group . \n overweight subjects experienced a higher frequency of insomnia while non - smoking and alcohol - drinking patients suffered more commonly from drowsiness . \n no differences in the frequencies of ocular or pulmonological side effects were observed in patients differing in weight , cigarette smoking , and alcohol consumption ( table 3 ) . \n brachytherapy treatment was found to be responsible for various adverse psychosocial effects in the studied group ( fig . \n over 50% of patients reported that the treatment had decreased their general life satisfaction , over 40% that it decreased their sense of security , while over 30% stated that it had affected their self - esteem and altered their financial status . \n no differences in the frequency of any psychosocial effects of bt were reported in groups of patients suffering from different forms of cancer . \n however , it was found that compared to patients with bmi in the 18.5 - 24.9 range , overweight patients experienced a higher frequency of decreased self - esteem ( 9.1 vs. 40.0% ; p < 0.05 ) and a lessened sense of security ( 38.2 vs. 53.3% ; p < 0.05 ) following the bt treatment . \n in general , the frequency of side effects reported as intense or very intense was relatively low . for dermatological symptoms , \n the greatest severity was reported for skin inflammation ( 4.3% reported as very intense and 7.1% as intense ) , for gastroenterological weight gain ( 5.7% reported it as intense ) , for neurological headaches ( 8.6% reported it as intense ) , for ocular keratoconjunctivitis ( 1.4% reported it as very intense ) , for pulmonological dyspnea ( 4.3% reported it as intense ) , and for urological pollakiuria ( 17.1 reported it as intense and 7.1% as very intense ) . \n the number of bt treatments had a significant effect on the severity of pollakiuria ( rs = 0.32 , p < 0.05 ) , urinary incontinence ( rs = 0.31 , p < 0.05 ) , and dyschezia ( rs = 0.29 , p < 0.05 ) . \n age was significantly associated with the severity of urological symptoms : pollakiuria ( rs = 0.27 , p < 0.05 ) and urinary incontinence ( rs = 0.28 , p < 0.05 ) . moreover \n , the severity of dyschezia also increased with age ( rs = 0.34 , p < 0.05 ) . in turn , increased bmi was followed by less severe urinary incontinence ( rs = 0.25 , p < 0.05 ) . as far as psychosocial side effects are concerned , \n patient age was negatively correlated with the severity of the effect of bt on professional careers ( rs = 0.43 , p < 0.05 ) . in turn , the bmi of patients was positively correlated with a decrease of self - esteem ( rs = 0.30 , p < 0.05 ) and sense of security ( rs = 0.25 , p < 0.05 ) . \n the number of bt treatments did not affect the severity of any of the studied psychosocial side effects . \n the study aimed to evaluate the frequency and severity of side effects induced by ldr bt or hdr bt treatment . as demonstrated , the therapy may induce various physical and psychosocial consequences , although their severity depended on several factors . \n in general , cigarette smokers suffered more commonly from gastroenterological effects while being overweight and consumption of alcohol increased the occurrence of various gastroenterological , neurological , and urological symptoms . \n the severity of the latter was also found to increase with patient age . as anticipated , the number of treatments and the irradiated body part was also an important factor in differentiating the frequency and severity of the studied side effects . despite the fact that bt allows overall exposure to radiation to be decreased and radiation does not disperse significantly through the body , it may still induce various systemic effects . \n the present study demonstrated that prostate bt treatment can induce a high frequency of urological effects , mainly urinary incontinence and pollakiuria , which is in line with other studies [ 13 , 14 ] . \n these symptoms arise due to the close proximity of the bladder and are not usually long - term . \n it was however observed that for some patients dysuria may last up to as long as 1 year after bt treatment . \n importantly , pollakiuria has also been reported by patients with irradiated breast cancer indicating that the side effects of bt may not necessarily be site - specific . \n as presented above , treatment of the head / neck area with bt resulted in an increased frequency of dysphagia and chewing difficulties compared to other body parts . \n nevertheless , in comparison with conventional radiotherapy and chemoradiotherapy , bt substantially reduces the dose delivered to neighboring tissues , specifically the neighboring swallowing structures [ 17 , 18 ] . in the present study , \n dysphagia was reported by over 30% of patients undergoing treatment of the head and neck area . \n however , these patients demonstrated the lowest rate of gastrointestinal side - effects with several symptoms not reported to occur at all . \n importantly , this group of effects , common among patients treated in the chest or prostate area , does not demonstrate late toxicities , and most of them can be treated using conventional and widely available methods ( e.g. diarrhea ) . \n it should be , however , noted that size of the group treated at head and neck area was low and that further studies , employing larger number of patients are necessary to fully assess the short - term toxicities in this particular treatment . \n the most important finding of the present study is the role of age , bmi , cigarette smoking , and alcohol consumption in the occurrence and severity of bt side effects . \n as demonstrated , being overweight increased the occurrence of dyschezia and insomnia , having a distinct impact on the severity of the former . \n this is likely to be associated with an increased content of fatty tissue in overweight individuals , and consequently higher absorption of ionizing radiation and prevention of its further dispersion [ 19 , 20 ] . \n brachytherapy has previously been shown to profoundly affect the patients quality of life [ 8 , 21 ] . in the present study , \n a decrease in life satisfaction , sense of security , and self - esteem were among the most frequently reported psychosocial effects . \n the two former effects were , however , more common in the group of overweight subjects . \n various cross - sectional studies have shown that people who are overweight or obese demonstrate lower health - related quality of life [ 22 , 23 , 24 ] . \n therefore , their baseline psychosocial characteristics may be decreased compared to patients of normal weight , and therefore the effect of bt on their lives may be more significant . in conclusion , \n bt treatment is associated with differences in the frequency of a variety of physical and psychosocial side effects . \n the present study shows that it is possible to identify groups of patients who may be characterized by an increased susceptibility to some of these effects . \n for example , patients treated for prostate cancer can be expected to suffer more often from gastroenterological symptoms , while cigarette smoking can be associated with a higher frequency of dyschezia , nausea , and weight loss . \n overweight patients may be more susceptible to such effects as insomnia and dyschezia , as well as being more likely to experience a decrease in self - esteem and sense of security following bt treatment . \n these findings are important if one considers that some of the studied factors shown to increase the occurrence and severity of particular bt side effects are modifiable prior to therapy or can be prevented . \n in other cases , patients should be advised of the possible increased risk of particular adverse events resulting from the treatment , so as to forewarn them and ensure that they are able to prepare themselves mentally for the upcoming therapy . \n ", "role": "user" }, { "content": "purposebrachytherapy ( bt ) plays an important role in cancer treatment . like any other medical therapy it may \n , however , induce side effects whose recognition can affect the patient 's quality of life . therefore , the present study evaluated the frequency and severity of physical and psychosocial adverse effects of bt.material and methodspatients ( n = 70 ) undergoing high - dose - rate ( hdr ) bt or low - dose - rate ( ldr ) of head and neck , breast , and prostate cancers were interviewed face - to - face at the end of their course of treatment . \n interviews concerned the occurrence of 35 physical ( dermatological , gastroenterological , neurological , ocular , pulmonological , and urological ) and 10 psychosocial side effects of bt.resultsa high percentage of patients reported that bt decreased their life satisfaction ( 54.3% ) , sense of security ( 41.4% ) , and self - esteem ( 34.3% ) . the highest frequency of gastroenterological and urological symptoms was reported by prostate cancer patients . \n cigarette smoking increased the frequency of nausea , dyschezia , and weight loss . \n overweight patients were characterized by an increased rate of urinary incontinence and dyschezia , as well as more pronounced decrease of self - esteem and sense of security following bt treatment.conclusionsthese findings are not only highly relevant to the way patients can be prepared for the therapy but also have a bearing on ways to minimize the number and severity of bt side effects .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: zinc transporter-8 ( znt8 ) is an islet cell secretory granule membrane protein recently identified as an autoantigen in type 1 diabetes ( t1d ) . \n autoantibodies to znt8 ( znt8a ) complement the established antibodies to insulin ( iaa ) , gad ( glutamic acid decarboxylase antibodies , gada ) , and protein tyrosine phosphatase ( insulinoma-2 antigen antibodies , ia2a ) . \n antibodies to znt8 have been detected in 60 - 80% of caucasian and 33 - 58% of asian population with t1d . \n the combined determination of established diabetes autoantibodies together with the znt8a increases the diagnostic sensitivity to over 90% for new onset cases of t1d in caucasians . a high frequency of patients ( 45% ) with presumed diagnosis of t1d in india lack gada and ia2a autoantibodies , \n a low frequency of ia2a in t1d has been reported from different studies from india . \n inclusion of znt8a presumably reduces the proportion of patients with negative autoantibodies . as no data on znt8a in indian population \n are available , the aim of our study was to estimate the prevalence of znt8a in t1d patients of indian origin and determine the utility of znt8a as an independent marker of autoimmunity either alone in antibody - negative subjects or in conjunction with gada and ia2a . \n eighty - eight patients who were diagnosed with diabetes before 18 years of age according to american diabetes association ( ada ) criteria and classified as type 1 diabetic patient on clinical grounds were recruited to the study . \n type 1 diabetes ( t1d ) was defined on the clinical grounds by ketosis at presentation , lean phenotype , requirement for insulin , and/or low c - peptide . \n twenty - one of the patients were newly diagnosed cases , and the blood sample was obtained from them within a week after diagnosis . \n patients were consecutively recruited from two centers in bangalore , bangalore diabetes hospital and m s ramaiah medical college between 2010 and 2012 . \n sex - matched healthy nondiabetic controls aged 2 - 18 years ( n = 88 ) were also recruited . \n children with disease duration > 48 months , evidence of secondary diabetes , and those with hormonal abnormalities were excluded . abdominal x - ray and/or ultrasound were done to rule out pancreatic calcification . \n znt8 , gad , and ia2 antibodies were estimated using commercial enzyme - linked immunosorbent assay ( elisa ) ( dld diagnotika , gmbh , germany ) . \n znt8 autoantibody elisa kit detects autoantibodies specific to arginine ( r ) or to tryptophan ( w ) at residue 325 , or to nonspecific variants at residue 325 . in znt8 antibody elisa , znt8a in test patients sera , \n calibrators , and controls were allowed to interact with znt8 coated onto elisa plate wells . \n after 16 20 h incubation , the samples were discarded leaving znt8 autoantibodies bound to znt8 coated wells . \n znt8 biotin was added in the second incubation step where , through the ability of znt8 autoantibodies in the samples to act bivalently ( or polyvalently ) , a bridge would be formed between znt8 immobilized on the plate and znt8 biotin . \n unbound znt8 biotin was then removed in a wash step , and the amount of bound znt8 biotin determined ( in the third incubation step ) by addition of streptavidin peroxidase ( sa - pod ) , which bound specifically to biotin . \n excess , unbound sa - pod was then washed away and addition of 3,3,5,5-tetramethylbenzidine ( tmb ) resulted in formation of a blue color . \n this reaction was stopped by addition of stop solution causing the well contents to turn yellow . \n the absorbance of the yellow reaction mixture at 405 and 450 nm was then read using an elisa plate reader . \n low values ( less than 50 u / ml ) were read off with the 450 nm calibration curve and high values ( more than 50 u / ml ) were read off with 405 nm calibration curve . \n a cut - off value of 15 u / ml was considered as positive . cut - off values for positive results for gad and ia2 antibodies were 20 and 7.5 u / ml , respectively based on our laboratory reference norms . results were expressed as mean sd unless otherwise indicated . \n autoantibody frequencies and anthropometric and biochemical parameters between patients and controls were compared using the test , fisher 's exact test , analysis of variance ( anova ) test , and student 's t - test ( two - tailed , independent ) where appropriate \n . diagnostic performance of three antibody tests was analyzed using receiver operating characteristic ( roc ) analysis and pairwise comparison of areas under curves of roc plots of the autoantibodies were done by a dichotomous , binary classification of the test results as positive or negative . \n znt8 , gad , and ia2 antibodies were estimated using commercial enzyme - linked immunosorbent assay ( elisa ) ( dld diagnotika , gmbh , germany ) . \n znt8 autoantibody elisa kit detects autoantibodies specific to arginine ( r ) or to tryptophan ( w ) at residue 325 , or to nonspecific variants at residue 325 . in znt8 antibody elisa , znt8a in test patients sera , calibrators , and controls \n after 16 20 h incubation , the samples were discarded leaving znt8 autoantibodies bound to znt8 coated wells . \n znt8 biotin was added in the second incubation step where , through the ability of znt8 autoantibodies in the samples to act bivalently ( or polyvalently ) , a bridge would be formed between znt8 immobilized on the plate and znt8 biotin . \n unbound znt8 biotin was then removed in a wash step , and the amount of bound znt8 biotin determined ( in the third incubation step ) by addition of streptavidin peroxidase ( sa - pod ) , which bound specifically to biotin . \n excess , unbound sa - pod was then washed away and addition of 3,3,5,5-tetramethylbenzidine ( tmb ) resulted in formation of a blue color . \n this reaction was stopped by addition of stop solution causing the well contents to turn yellow . \n the absorbance of the yellow reaction mixture at 405 and 450 nm was then read using an elisa plate reader . \n low values ( less than 50 u / ml ) were read off with the 450 nm calibration curve and high values ( more than 50 u / ml ) were read off with 405 nm calibration curve . \n a cut - off value of 15 u / ml was considered as positive . cut - off values for positive results for gad and ia2 antibodies were 20 and 7.5 u / ml , respectively based on our laboratory reference norms . \n results were expressed as mean sd unless otherwise indicated . autoantibody frequencies and anthropometric and biochemical parameters between patients and controls \n were compared using the test , fisher 's exact test , analysis of variance ( anova ) test , and student 's t - test ( two - tailed , independent ) where appropriate . \n diagnostic performance of three antibody tests was analyzed using receiver operating characteristic ( roc ) analysis and pairwise comparison of areas under curves of roc plots of the autoantibodies were done by a dichotomous , binary classification of the test results as positive or negative . \n sixty - eight ( 77.3% ) patients were positive for at least one antibody and five of them were positive for all three antibodies [ figure 1 ] . \n znt8a were positive in 33.3% of patients positive for gada and 40% of patients positive for ia2a . \n gada were positive in 60% of patients negative for other antibodies , whereas ia2 was positive in only two patients negative for other two antibodies . \n clinical characteristics of patients and controls venn diagram of frequencies and codetection of autoantibody combinations in in antibody positive patients with t1d znt8a and gada identified 97.7% of antibody positive patients detected by the combined use of all three antibodies . \n znt8a increased the proportion of patients positive for at least one of the antibodies from 64.5 to 75% when compared to gad alone , from 69 to 77.3% when compared to gada and ia2a combined . \n none of them were positive for more than one antibody and antibody titers were much lower compared to patients . \n diagnostic characteristics of three antibody assays in objectifying autoimmunity in type 1 diabetes are presented in table 2 . in roc analysis , \n the performances of gada and znt8as were better than that of ia2a , and aucs of gada , znt8a , and ia2a for the prediction of t1d were 0.8 , 0.65 and 0.59 respectively [ table 2 and figure 2 ] . in pair wise comparison of aucs of roc curves , auc of gada was significantly greater than that of znta and ia2a . \n auc of znt8a was greater than that of ia2a but did nt reach statistical significance [ table 3 ] . \n diagnostic performance of the antibody tests in receiver operating characteristic analysis roc curve analysis of three autoantibody tests area under curve ( auc ) of gada-0.647 , auc of znt8a-0.32 , auc of ia2a-0.19 pairwise comparison of receiver operating characteristic curves of three antibody tests \n the present study shows that znt8 antibody is a specific marker of juvenile onset t1d in line with previous studies . \n znt8a were positive in nearly one - third of the patients , and their prevalence was much higher than that of ia2a . in newly diagnosed cases , \n znta were found in one - quarter of t1d subjects classified as autoantibody - negative based on gada and ia2a . \n the frequency of znta in our subjects was much lower compared to that reported among caucasians . in a study by wenzlau et al . \n , znt8a were detected in 63% of t1d patients at the diagnosis and 2% of healthy controls , and they were positive in 26% of t1d patients who were negative for other islet autoantibodies . in another study involving swedish children and adolescents with t1d , znta were detected in 65% of subjects . in a japanese study , \n znt8a frequency was 58% in childhood onset patients and 34% in adult onset t1d patients . \n the same authors reported znt8a prevalences of 58% patients with acute onset and 20% with slow onset type 1 diabetes . \n in newly diagnosed cases , the prevalence of znt8a in our subjects was higher than that reported from china ( 32.9% ) . \n genetic factors , specifically histocompatibility leukocyte antigen ( hla ) haplotypic diversification and slc30a8 gene polymorphism could be responsible for the differences in frequencies noted among different ethnic populations as shown in previous studies . a high frequency of type 1b diabetes ( 45% ) has been reported among children and adolescents with recent onset t1d from north india based on negativity for gada and ia2a . \n the most significant finding from our study was that the inclusion of znt8a increased the antibody detection rate to nearly 80% . \n this could aid in better classification and risk stratification of early onset diabetes and help differentiating from t1d mimicking forms of diabetes seen in india . in the present study , \n the results from this analysis suggest that znt8a is a better diagnostic tool than ia2a for diagnosis of t1d with higher sensitivity , only a slightly lower specificity , but a higher diagnostic accuracy . \n the combined presence of both the antibodies in serum compared with znt8a alone increases the specificity , but contributes little to sensitivity and overall accuracy . \n higher prevalence of type 1b diabetes in india is predominantly due to lower positivity of ia2a antibodies as has been reported from different studies . \n most of the ia2a positive patients in our study were positive for either gada or znt8a and combined use of gada and znt8a could detect > 97% of antibody positive patients detected with the integrated use of all three antibodies , implying that the utility of ia2a was limited and to a large extent redundant . whereas , inclusion of znt8a reduced the proportion of patients with negative autoantibodies , ia2a did not contribute any further in this regard . \n these findings suggest that znt8a have a potential to replace ia2a for screening autoimmunity in indian t1d patients without loss of sensitivity and specificity . \n antibody screening could be done in a cost - effective manner and testing for ia2a reserved for only those patients who are gada and znt8a negative . \n we recruited newly diagnosed t1d patients and those with a shorter duration of diabetes ( < 4 years ) only . \n the reason for doing this was because znt8a titers have been shown to decline exponentially from the clinical onset of t1d with a t1/2 similar to that of c - peptide . \n we excluded adults with t1d because the frequency of znt8a has been shown to be much lower when compared to children and adolescents with t1d . \n we did not examine the relation of znt8a to glycemic control and progression of t1d and the prevalence of znt8a in adult onset t1d . \n further studies are warranted on the kinetics of post onset decline of znt8a and their prevalences in patients with different disease durations . \n studies examining how hla haplotype variation and slc30a8 gene polymorphism modulate humoral autoreactivity to znt8 are also required . in summary , this is the first study on prevalence of znt8 antibodies in juvenile onset t1d from india . \n znt8a complements gada and increases the diagnostic sensitivity for detection of autoimmunity in juvenile onset t1d . \n znt8a can replace ia2a as a serological marker for autoimmunity in indian t1d patients without loss of sensitivity and specificity .", "role": "user" }, { "content": "introduction : zinc transporter-8 ( znt8 ) is an islet cell secretory granule membrane protein recently identified as an autoantigen in type 1 diabetes ( t1d ) . the aim of this study was to estimate the prevalence of antibodies to znt8 ( znt8a ) in juvenile onset t1d and to determine the utility of znt8a as an independent marker of autoimmunity either alone in antibody - negative subjects or in conjunction with glutamic acid decarboxylase ( gad ) and insulinoma-2 antigen antibodies ( gada and ia2a).research design : znt8a , gada , and ia2a were measured in sera of consecutive t1d patients ( n = 88 , age range 2 - 18 years ) within 4 years of diagnosis and 88 sex - matched controls.results:the prevalences of gada , znt8a , and ia2a were 64.7% , 31.8% and 19.3% , respectively . in newly diagnosed patients , \n the frequency of znt8a was 45% . \n znt8a were positive in 26% of patients negative for both gada and ia2a . \n ia2a were positive only in two patients who were negative for other two antibodies . \n combined use of znt8a and gada could detect 97% of antibody positive patients . in receiver operating characteristic ( roc ) analysis , \n the performances of gada and znt8as were better than that of ia2a ; and aucs of gada , znt8a , and ia2a for the prediction of t1d were 0.8 , 0.65 , and 0.59 , respectively.conclusions:znt8a complements gada and increases the diagnostic sensitivity for detection of autoimmunity in juvenile - onset t1d . \n inclusion of znt8a increases the proportion of patients with antibody positivity to nearly 80% . \n znt8a can replace ia2a as a serological marker for autoimmunity in indian t1d patients without loss of sensitivity and specificity .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: nodal involvement is the most important prognostic factor in determining survival for patients with non - small cell lung cancer ( nsclc ) ( 1 , 2 ) . \n however , conventional lymph node ( ln ) staging does not effectively reflect the wide differences in ln involvement and patient survival , even in patients classified within the same ln stage ( 3 , 4 ) . \n some investigators have also postulated the possible classification of a subgroup of multiple station n2 patients who have more unfavorable results compared to single station n2 patients with stage iiia n2 nsclc ( 3 , 5 - 7 ) . in this retrospective study \n , we attempted to clarify the prognostic significance of multiple station n2 patients with stage iiia n2 lung cancer and to propose an adequate tnm staging position for multiple station n2 disease by comparing the survival of multiple station n2 patients to the survival patients with stage iiib disease . \n between 1990 and 2005 , 1,326 patients underwent operations for non - small cell lung cancer at our institution . of these patients , \n 430 patients were diagnosed with either stage iiia n2 or stage iiib disease by pathological examination . \n patients who received preoperative induction therapy ( n=55 ) and those who died within 1-month postoperatively ( n=17 ) were excluded from our study . \n clinical staging was determined by bronchoscopy , chest ct , abdominal ultrasonogram , and bone scans . \n the mediastinal node status was assessed according to the system defined by mountain and dresler ( 8) . \n systematic node dissection of the both hilar and mediastinal lymph nodes was performed in all patients except for in 14 open and closure cases and 2 wedge resection cases . \n six cycles of cisplatin - based adjuvant chemotherapy were considered for all patients with stage ii through stage iii from the early 1990s to 2004 . \n postoperative radiotherapy was considered for patients who had n2-positive and those who had positive resection margin . \n a multiple station n2 was defined as lymph node metastsis involving more than one n2 station . \n the group was comprised of 75 female and 283 male patients , with a median age of 61 yr ( range , 31 to 78 yr ) . \n 262 patients were classified with stage iiia n2 disease and 96 patients were classified with stage iiib disease . among the stage \n iiib patients , 14 patients were open and closure cases . of these 14 patients , 10 cases did not have a proven pathological node stage . \n the median follow - up duration was 18.5 months ( range , 1.2 to 184.2 months ) . \n all patients were followed up until either death or the last follow - up date ( december 31 , 2006 ) . \n the clinocopathological records of each patient with stage iiia n2 disease were examined for prognostic factors such as age , sex , right or left side , type of surgical procedure ( pneumonectomy or other procedure ) , histology , adjuvant chemotherapy , tumor location ( upper or lower ) , t stage , metastatic node station ( single or multiple station ) , and distribution of metastatic nodes ( skip n2 or non skip n2 ) . \n the survival rates of patients with stage iiia n2 disease according to significant prognostic factors were compared with those of patients with stage iiib disease . \n the institutional review board granted us permission to retrospectively review and publish the patient records . \n the association between variables was analyzed by either chisquare or analysis of variances ( anova ) tests . \n the duration of survival was defined as the interval between the date of surgery and either the date of death or the last follow - up date . \n survival rates were calculated using the kaplan - meier method , and univariate analyses were performed using the log - rank test . \n multivariate analyses were performed by means of the cox proportional hazard model in variables that had p values less than 0.05 as determined by univariate analyses . a p value less than 0.05 was considered significant . \n the association between variables was analyzed by either chisquare or analysis of variances ( anova ) tests . \n the duration of survival was defined as the interval between the date of surgery and either the date of death or the last follow - up date . \n survival rates were calculated using the kaplan - meier method , and univariate analyses were performed using the log - rank test . \n multivariate analyses were performed by means of the cox proportional hazard model in variables that had p values less than 0.05 as determined by univariate analyses . a p value less than 0.05 was considered significant . \n the overall 5-yr survival rates were 29.1% ( 95% confidence interval [ ci ] , 23.6 to 34.6% ) for patients with stage iiia n2 disease and 15.5% ( 95% ci , 8.3 to 22.7% ) for patients with stage iiib disease , with median survival durations of 21.6 months ( 95% ci , 17.5 to 25.6 months ) and 15.8 months ( 95% ci , 11.0 to 20.6 months ) , respectively . \n this difference in survival rates between the two patient groups was statistically significant ( p=0.011 ) ( fig . \n iiia n2 nsclc , a univariate analysis using the variables listed in table 2 showed that the following factors were significantly associated with poor outcome : age>60 , male , t3 factor , pneumonectomy , clinical n2 , no adjuvant chemotherapy , and multiple station n2 . using multivariate analysis \n , we found that the independent unfavorable prognostic factors were age>60 , no adjuvant chemotherapy , and multiple station n2 ( table 3 ) . \n we evaluated the effect of the number of metastatic n2 stations upon stage iiia patient survival . \n the overall 5-yr survival rates were 33.8% ( 95% ci , 26.8 to 40.8% ) in single station n2 patients and 20.4% ( 95% ci , 13.3 to 27.5% ) in multiple station n2 patients . \n the median survival times in single station n2 and multiple station n2 patients were 26.4 months ( 95% ci , 20.3 to 32.5 months ) and 18.2 months ( 95% ci , 12.8 to 23.6months ) , respectively . \n furthermore , the survival rate of multiple station n2 patients in stage iiia was compared with the survival rate of stage iiib patients , and we found no significant difference ( p=0.585 ) ( fig . \n 2 ) . among the three groups , we found no difference in clinocopathological variables such as age , sex , histopathology , tumor size , number of resected lns , or type of procedure performed ( except for the 14 open and closure cases ) . \n the overall 5-yr survival rates were 29.1% ( 95% confidence interval [ ci ] , 23.6 to 34.6% ) for patients with stage iiia n2 disease and 15.5% ( 95% ci , 8.3 to 22.7% ) for patients with stage iiib disease , with median survival durations of 21.6 months ( 95% ci , 17.5 to 25.6 months ) and 15.8 months ( 95% ci , 11.0 to 20.6 months ) , respectively . \n this difference in survival rates between the two patient groups was statistically significant ( p=0.011 ) ( fig . \n in stage iiia n2 nsclc , a univariate analysis using the variables listed in table 2 showed that the following factors were significantly associated with poor outcome : age>60 , male , t3 factor , pneumonectomy , clinical n2 , no adjuvant chemotherapy , and multiple station n2 . using multivariate analysis , we found that the independent unfavorable prognostic factors were age>60 , no adjuvant chemotherapy , and multiple station n2 ( table 3 ) . \n we evaluated the effect of the number of metastatic n2 stations upon stage iiia patient survival . \n the overall 5-yr survival rates were 33.8% ( 95% ci , 26.8 to 40.8% ) in single station n2 patients and 20.4% ( 95% ci , 13.3 to 27.5% ) in multiple station n2 patients . \n the median survival times in single station n2 and multiple station n2 patients were 26.4 months ( 95% ci , 20.3 to 32.5 months ) and 18.2 months ( 95% ci , 12.8 to 23.6months ) , respectively . \n furthermore , the survival rate of multiple station n2 patients in stage iiia was compared with the survival rate of stage iiib patients , and we found no significant difference ( p=0.585 ) ( fig . \n 2 ) . among the three groups , we found no difference in clinocopathological variables such as age , sex , histopathology , tumor size , number of resected lns , or type of procedure performed ( except for the 14 open and closure cases ) . \n our results indicate that the multiple station n2 criteria was one of the most important prognostic factors for poor outcome after surgery in patients with stage iiia n2 nsclc . \n furthermore , we found that the multiple station n2 patients with stage iiia had a survival rate that was similar to the stage iiib patient survival rate . \n several factors , such as the clinical n2 factor , the number of metastatic n2 stations , t factor , tumor location , and skip n2 , have been reported as important prognostic factors in patients with stage iiia n2 cancer ( 7 , 8 , 10 - 13 ) . \n our uninvariate analysis study showed that the significant unfavorable prognostic factors were age>60 , male , t3 factor , pneumonectomy , clinical n2 , no history of adjuvant chemotherapy , and multiple station n2 . \n tumor location , histology , and skip n2 status showed no prognostic significance in this study . \n furthermore , multivariate analysis confirmed that multiple station n2 , age > 60 , and no history of adjuvant chemotherapy were significant , unfavorable prognostic factors . \n several studies have shown that the number of metastatic mediastinal lns was an important prognostic factor ( 14 - 16 ) . \n vansteenkiste and associates ( 17 ) reported that the 5-yr survival for patients with single station n2 was 29.6% versus 20.8% for those with multiple station n2 ( p=0.008 ) . in our study , the overall 5-yr survival rates were 33.8% in patients with single station n2 and 20.4% in patients with multiple station n2 ( p=0.016 ) . besides the number of the metastatic mediastinal lns , the clinical n factor and skip metastatis have also been considered prognostic factors in nodal factors ( 13 , 17 ) . in our study \n in addition , clinical n2 patients showed significantly unfavorable clinical outcomes on univariate analysis but did not show a survival difference on to multivariate analysis . with these results , \n the number of the involved mediastinal ln stations can be recognized as a single and reliable finding that indicates highly advanced n2 lung cancer . \n the role of adjuvant chemotherapy is considered controversial , but recent clinical trials have begun to demonstrate the survival benefit of adjuvant chemotherapy in select cases of nsclc patients . \n recent guidelines generally recommend adjuvant chemotherapy for patients with completely resected stage ib through stage iii nsclc ( 18 , 19 ) . \n the current staging system for nsclc has served us well for a number of years . \n this system has helped us design a treatment plan and discuss patient prognoses . however , the most complex and unsatisfactory aspect of the current tnm staging system is the method of assessing nodal disease . at present , \n however , there is a huge variation in the extent of n2 disease , ranging from incidental nodal metastasis to bulky multiple station , unresectable lymphadenopathy . \n clearly , these variations in stage iiia n2 disease have far - reaching implications with respect to both therapy and prognosis . grouping all stage iiia n2 disease into one stage \n furthermore , we need formal recognition for a subclassification of stage iiia n2 that considers variation . \n previous proposals have called for such a change in n2 disease classification ( 3 , 5 , 6 ) . \n the previous subclassifications of ln metastsis largely depended on the clinical node factor , which were then decided by the size of the lns , but these classifications were not always correct because ln size is influenced by several inflammatory processes , such as tuberculosis and anthracosis ( 20 , 21 ) . in our study , clinical n2 did not have a statistical significance . \n the number of metastatic mediastinal lns is another prognostic factor that has been considered a subclassification indicator . \n multiple station n2s have been accepted as one of the most important prognostic factors ( 14 - 17 ) . in our study , \n these results confirm the relevance of subclassification based on the number of lymph node stations involved . therefore , \n stage iiia n2 nsclc patients should be classified into two basically distinct patient subgroups : single station n2 iiia ; multiple station n2 iiia . \n furthermore , the survival outcome in the present study showed no difference between multiple station n2 iiia and stage iiib patients . \n andre and associates ( 5 ) reported that the prognosis of clinical n2 and multiple station n2 patients with stage iiia disease was close to the prognosis of stage iiib disease patients . according to these results \n , we suggest that multiple station n2 disease should be considered similar to stage iiib disease for predicting patient survival and therefore that multiple station n2 disease should receive a new position in the tnm staging system . in our study , we compared multiple station n2 with stage iiib for survival , but a better comparison might be between multiple station n2 and n3 disease as a subgroup of stage iiib nsclc . \n pathologically proven n3 was not available in surgically resected patients because these patients are not usually indicated for surgery . in our institution \n , we treated only 16 patients with n3 who underwent surgery and then were proven to be n3 after the operation . since this number of patients was not enough to compare \n multiple station n2 was one of the most important single prognostic factors indicating a poor survival rate in pathological stage iiia n2 nsclc patients . \n we found no difference in survival between multiple station n2 stage iiia and stage iiib patients . \n therefore , we suggest that multiple station n2 disease should be considered similar to stage iiib disease for predicting patient survival and that these criteria should receive a new position in a new tnm staging system .", "role": "user" }, { "content": "mediastinal ( n2 ) lymph node involvement is heterogenous with huge variation in the extent and grouped together under stage iiia . \n however , they showed a different survival even in the same stage . \n we tried to determine the prognostic implication of the multiple station n2 lymph node metastasis in stage iiia n2 non - small cell lung cancer ( nsclc ) . \n the survival of stage iiia n2 was analyzed according to the number of n2 station and their survival was compared with that of stage iiib . in stage iiia \n n2 nsclc , multivariate analysis indicated that multiple station n2 was one of the independent prognostic factors for poor survival . \n the 5-yr survival of multiple station n2 iiia ( 20.4% ) was lower than that of single station n2 iiia ( 33.8% ) significantly ( p=0.016 ) . \n but when it was compared with that of stage iiib ( 15.5% ) , there was no difference . \n therefore , we suggest that multiple station n2 should be considered similar to stage iiib disease with regard to predicting survival and accordingly should receive a new position in the tnm staging system .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: levamisole , which was first developed as an antihelminthic agent in the 1960s , is widely utilized to adulterate cocaine . \n it has been detected with increased frequency in the illicit cocaine supply in the usa over the last decade and is now estimated to be present in 7080% of the cocaine entering the country [ 1 , 2 ] . prolonged exposure to this compound can induce a distinct clinical syndrome characterized by cutaneous vasculitis ( polyangiitis ) and/or agranulocytosis accompanied by an unusual constellation of serologic abnormalities including the presence of antiphospholipid antibodies , lupus anticoagulants and high titers of antineutrophil cytoplasmic antibodies ( ancas ) . \n there have been an increasing number of case reports suggesting that levamisole - adulterated cocaine may lead to renal disease in the form of a pauci - immune complex type of necrotizing and crescentic glomerulonephritis ( gn ) , alternately called microscopic polyangiitis [ 4 , 5 ] . \n an isolated case of membranous nephropathy ( mn ) associated with levamisole exposure has been reported recently in abstract form . \n we present the first case , to our knowledge , of a patient with pauci - immune complex type necrotizing and crescentic gn and concurrent mn in the setting of chronic cocaine abuse with probable ingestion of levamisole . \n a 34-year - old female with a history of chronic alcohol and cocaine abuse was referred for the management of acute renal failure . \n she had been hospitalized 3 weeks prior due to multiple ulcers involving both lower extremities , requiring ulcer debridement and skin grafting . \n a review of her medical records showed anti - hepatitis c virus antibody positivity in the past , with subsequent spontaneous clearance and a recent negative polymerase chain reaction ( pcr ) test for viremia . on admission , \n the patient was afebrile with a blood pressure ( bp ) of 116/78 mmhg and a heart rate of 93 beats per minute . on examination , \n she was noted to have extensive , painful , bilateral lower extremity wounds , which on the left leg were fairly clean , but on the lower right leg the skin was focally necrotic . \n laboratory testing showed a serum creatinine of 4.2 mg / dl , increased from a baseline of 0.70 mg / dl measured 2 weeks previously . \n hemoglobin was 9.9 g / dl , hematocrit 28.5% , white blood cell count 5.6 10 3/l , platelet count 69.000/l , haptoglobin 252 mg / dl , serum albumin 2.3 mg / dl , serum total protein 5.8 g / dl and normal liver function test results . \n a protein - to - creatinine ratio measurement in the patient 's spot urine sample was 2.4 mg / mg . urinalysis revealed hematuria with dysmorphic red blood cells . \n serologic tests were weakly positive for antinuclear antibody but negative for anti - double - stranded dna , anti - glomerular basement membrane ( anti - gbm ) antibody , anti - hiv , anti - hepatitis b virus and anti - hepatitis c virus antibodies . \n serologic studies were notable for the presence of circulating perinuclear anti - ancas ( pancas ) ; a test for the corresponding presence of circulating antibodies to myeloperoxidase ( mpo ) was markedly elevated ( 311.4 u , normal < 1 u ) , while a test for circulating anti - pr3 antibodies was negative . a coagulation panel revealed a prolonged partial thromboplastin time ( ptt ) of 51 s ( normal 2636 s ) and an increased dilute russell viper venom time ( drvvt ) of 1.9 ( normal 0.01.1 ) , raising suspicion of a lupus anticoagulant ( lac ) . testing for anticardiolipin was not performed . \n a renal biopsy showed 9 glomeruli per level section with necrotizing and crescentic gn involving up to 3040% of the glomeruli ( figure 1a and b ) . \n intact glomerular capillary loops were thickened and contained rarefactions , which were best seen on jones ' silver stain . \n the tubular parenchyma showed focal red blood cell casts , moderate interstitial inflammation and edema and mild tubulointerstitial fibrosis . \n immunofluorescence ( if ) microscopy ( figure 1c ) revealed finely granular staining for igg kappa and lambda light chains of 2 + intensity ( on a semiquantitative scale of 0 to 4 + ) predominantly in glomerular capillary walls , including a few portions of capillary walls where they were reflected over mesangial regions ; there was similarly distributed staining of trace intensity for c3 . \n an if stain for the presence of phospholipase a2 receptor ( pla2r ) antigen within the glomerular immune deposits was negative . \n electron microscopy ( figure 2a and b ) detected numerous immune - type electron - dense deposits in peripheral capillary walls in intramembranous and subepithelial locations . \n the deposits were somewhat irregularly distributed and a minority of capillary basement membranes were without such deposits . \n rare , small , ill - defined electron densities consistent with either hyaline or possible deposits of immune complexes were present in mesangial regions . based on these biopsy results , \n the distribution of the patient 's skin lesions and positive serologies , a diagnosis of cocaine / levamisole - induced anca - associated systemic microscopic polyangiitis and concurrent mn was made . \n 1.(a ) two glomeruli show segmental necrotizing lesions and are involved by cellular crescents compressing the glomerular tufts . \n a periglomerular inflammatory infiltrate is present ( jones silver stain ; original magnification 100 ) . \n ( b ) a glomerulus involved by a circumferential cellular crescent ( jones silver stain ; original magnification 600 ) . \n ( c ) if staining revealed finely granular staining of 2 + intensity for igg predominantly in glomerular capillary walls but also involving a few mesangial regions ( original magnification 200 ) . \n 2.(a and b ) electron micrographs show numerous immune - type electron - dense deposits in peripheral capillary walls in intramembranous and subepithelial locations ( arrows ) . \n spikes of basement membrane matrix separating the deposits and incorporating them into the basement membranes [ original magnification : ( a ) 7960 ; ( b ) 11900 ] . \n ( a ) two glomeruli show segmental necrotizing lesions and are involved by cellular crescents compressing the glomerular tufts . \n a periglomerular inflammatory infiltrate is present ( jones silver stain ; original magnification 100 ) . \n ( b ) a glomerulus involved by a circumferential cellular crescent ( jones silver stain ; original magnification 600 ) . \n ( c ) if staining revealed finely granular staining of 2 + intensity for igg predominantly in glomerular capillary walls but also involving a few mesangial regions ( original magnification 200 ) . \n ( a and b ) electron micrographs show numerous immune - type electron - dense deposits in peripheral capillary walls in intramembranous and subepithelial locations ( arrows ) . \n spikes of basement membrane matrix separating the deposits and incorporating them into the basement membranes [ original magnification : ( a ) 7960 ; ( b ) 11900 ] . \n the patient was started on pulse methylprednisolone ( 3 doses of 1 g each ) with subsequent taper , along with plasmapheresis ( 7 total treatments ) and rituximab infusions ( 2 doses of 1 g each ) . due to the severity of the renal impairment , temporary hemodialysis treatment was required . \n overall , she tolerated these therapies well and her kidney function improved considerably , with creatinine levels dropping from 5 to 1.6 mg / dl and cessation of her hemodialysis requirement . \n her lower extremity wounds improved during this treatment course . the clinical course during hospitalization was complicated by spontaneous right colon rupture secondary to constipation from chronic opioid use , requiring right hemicolectomy . \n two months after discharge , the patient was noted to have resumed cocaine use , and a urine toxicology screen at that time was positive for cocaine . she has been lost for further follow - up \n levamisole may enhance noradrenergic neurotransmission by partially metabolizing into an amphetamine - like compound or increasing endogenous opioids . \n the possible stimulant properties of levamisole led it to be used as a cocaine adulterant ( cocaine cutting agent ) . \n an adulterant is a substance found within other substances ( e.g. food , beverages ) , although not legally allowed . \n levamisole reversibly and noncompetitively inhibits most isoforms of alkaline phosphatase ( e.g. human liver , bone , kidney and spleen ) . \n it is thus used to reduce background alkaline phosphatase activity in biomedical assays such as in situ hybridization or western blot protocols where alkaline phosphatase is used for signal amplification . \n levamisole is readily absorbed from the gastrointestinal tract and metabolized in the liver , excreted primarily through the kidneys . \n levamisole has been used therapeutically as an immunomodulatory agent and has been shown to promote neutrophil mobility and chemotaxis , enhance dendritic cell maturation , promote t cell proliferation and induce circulating autoantibodies [ 810 ] . \n these effects on innate and adaptive immune responses may explain its propensity to induce autoimmunity and vasculitis [ 4 , 11 , 12 ] . \n toxicity eventually led to its withdrawal from human use in 1999 [ 5 , 13 ] . in the last decade , \n levamisole toxicity has reemerged as a medical problem in the usa , with multiple reports linking the use of levamisole - adulterated cocaine to neutropenia , life - threatening agranulocytosis and vasculitis - like purpuric skin eruption of the face and extremities [ 3 , 1418 ] . \n there is growing evidence that prolonged use of levamisole - adulterated cocaine can lead to a drug - induced autoimmune disease ( microscopic polyangiitis ) complicated by a pauci - immune complex type gn [ 1 , 4 , 5 , 19 ] . \n our case is notable for the unusual concurrence of both pauci - immune complex necrotizing and crescentic gn and mn . in renal biopsies of mn , fibrinoid \n when present , these changes suggest three diagnostic possibilities . first , is a combination of focal or diffuse lupus nephritis with crescent formation and mn ( class iii or iv plus v lupus nephritis ) in patients with systemic lupus erythematosus ( sle ) . in the absence of clinical evidence of sle or pathologic findings highly suggestive of lupus mn , \n other possibilities include mn with superimposed anti - gbm disease or anca - associated necrotizing and crescentic gn . \n concurrent anti - gbm disease and mn was first reported by klassen et al . in 1974 , and since that time at least 25 cases have been described [ 2123 ] . the negative serologic test and \n nasr et al . reported the largest clinical experience to date ( 14 patients ) . \n there are also rare reports of concomitant mn and crescentic gn in which there is no evidence of anti - gbm disease , anca seropositivity or sle . in these cases \n , crescent formation may represent an unusual morphologic expression of mn [ 24 , 25 ] . in our case , the finding of high - titer panca in the presence of crescentic and necrotizing lesions suggested a pauci - immune , anca - associated gn superimposed upon preexisting mn . \n this is the first case , to our knowledge , where this dual glomerulopathy process occurred in the setting of chronic cocaine abuse and presumptive levamisole exposure . \n one possible scenario would be damage to the gbm occurring from membranous immune deposits , resulting in the release of antigens to the circulation that in turn leads to formation of autoantibodies , or vice versa . \n however , mn is a relatively common glomerular disease , but mn complicated by anca - associated disease is not , and so the clinical evidence to support such a scenario is limited . \n we know of no experimental animal models whereby mn - type lesions lead to a subsequent polyangiitis type of glomerular injury , and so are unable to draw from the experimental literature in support of such a scenario . \n interpretation of negative if staining for plar2r in our case provides some evidence in favor of a secondary form of mn . \n the complex medical history of polysubstance abuse , the remote exposure to hcv and the presence of multiple possible sources of bacterial infection ( extensive skin ulcers ) make it difficult to establish a clear etiologic basis for the mn in this case , but the history of chronic cocaine abuse suggests the intriguing hypothesis of levamisole as a causative agent in the development of mn . to our knowledge , the only case of mn associated with levamisole - adulterated cocaine was described by wang and morfin in a recent abstract . \n the kidney biopsy in this patient showed typical features of mn , but a necrotizing and crescentic gn was not present . \n as in the previously published series , a lack of documentation of levamisole in patient samples is clearly a limitation in our case . \n the adulterant can be detected in serum and urine using gas chromatography and mass spectrometry , but its half - life is quite short ( 5.6 h ) and these tests are not routinely performed in the clinical setting . \n however , recent data show that exposure to levamisole has become almost ubiquitous among regular cocaine users within the usa , supporting our interpretation that this patient 's renal disease is likely consequent to levamisole exposure [ 24 , 11 ] . \n furthermore , patients with vasculitis associated with levamisole - adulterated cocaine classically demonstrate unique serologic abnormalities characterized by unusually high titers of p - anca and , the majority of cases , show positivity for antiphospholipid antibodies as well as antinuclear and anti - double - stranded dna antibodies [ 1 , 19 ] . \n all of these , except for positive anti - double - stranded dna antibodies , were present in our case . clinically , besides the renal involvement , the dramatic cutaneous lesions presented by our patient are also a typical feature of this syndrome . in summary , this case demonstrates a unique constellation of renal pathology findings in a patient who has been exposed to levamisole by virtue of her use of illicit cocaine . \n one type of renal toxicity , microscopic polyangiitis , is a well - known toxicity of this drug , but mn has been rarely associated with levamisole use . \n this combination of renal pathology changes in the setting of levamisole exposure is without precedent . \n ", "role": "user" }, { "content": "levamisole is an antihelminthic agent widely used as an adulterant of illicit cocaine recently implicated as a cause of antineutrophil cytoplasmic antibody ( anca)associated microscopic polyangiitis in cocaine abusers . \n an isolated case of membranous nephropathy ( mn ) associated with levamisole exposure has also been reported . \n we report the first case , to our knowledge , of a patient with both microscopic polyangiitis manifest as a pauci - immune necrotizing and crescentic glomerulonephritis and concurrent mn in the setting of chronic cocaine abuse and presumed levamisole exposure , raising the hypothesis that levamisole was the causative agent in the development of this rare dual glomerulopathy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: dengue ( den ) viruses are flaviviruses that cause dengue fever ( df ) , dengue haemorrhagic fever ( dhf ) , and dengue shock syndrome ( dss ) in humans and are transmitted primarily by infected aedes aegyptii or aedes albopictus mosquitoes . by immunological and genetic typing \n , den viruses are divided into 4 serotypes including den-1 , den-2 , den-3 , and den-4 . \n secondary infection of humans with a den serotype that differs from the serotype of an initial den infection often results in illness of greater severity . \n this disease severity has been attributed to antibody dependent enhancement and increased activation of chemokines . \n unsuccessful control of the mosquito vectors of dens has resulted in increased incidence of dengue disease in several southeast asian countries , and the virus is currently endemic in tropical regions worldwide . \n the optimal strategy for preventing dengue disease appears to be vaccination . however , there is currently no safe and effective den vaccine approved for human use , although a number of den vaccine candidates are in preclinical development or in clinical trials . \n significant obstacles to vaccine development include the need to develop a tetravalent vaccine that protects recipients against all four den serotypes , and the lack of a relevant animal model for dengue pathogenesis . \n the den viral genome is a single - stranded positive - sense rna molecule containing about 11,000 bases and is organized as follows : 5 noncoding region ( 5-ncr ) , 3 structural genes encoding capsid ( c ) , premembrane / membrane ( prm / m ) and envelope ( e ) proteins , 7 nonstructural ( ns ) genes encoded for ns1 , ns2a , ns2b , ns3 , ns4a , ns4b , and ns5 proteins , and 3 ncr . in the virus - infected cell , the 10 coding genes are translated from a single long open reading frame into a polyprotein that is processed into the individual proteins by both cellular and virus - specified enzymes \n . the mechanisms of flavivirus replication and translation have been widely studied , and the involvement of both 5 and 3 ncrs has been well documented [ 15 ] . \n mutations in the 5-ncr of rna viruses such as poliovirus [ 6 , 7 ] , venezuelan equine encephalitis and sindbis alphaviruses [ 8 , 9 ] , and the den-2 16681 virus [ 10 , 11 ] have resulted in varying degrees of attenuation of viral virulence . \n rna secondary structure in the 5-ncr appears to be involved in viral replication [ 1214 ] . \n mutations that disrupt base pairing within complementary sequences at the 5 or 3 ends of den genomic rna can dramatically decrease rna synthesis . \n one of the den viruses that has been shown to have potential as an effective vaccine component of a tetravalent den vaccine is the live - attenuated den-2 pdk-53 strain , which has appeared to be safe and effective in clinical trials [ 1517 ] . \n the pdk-53 virus exhibits a number of phenotypic markers often associated with viral attenuation , including small plaque size , decreased replication in mosquito cells , temperature sensitivity , attenuation of neurovirulence in suckling mice , and reduced viremia in monkeys compared to the wild - type parental den-2 virus , strain 16681 . \n the apparent attenuated phenotypic markers of the pdk-53 virus are encoded by a nucleotide mutation at position 57 in the 5ncr-57 and two other mutations that encode amino acid changes at amino acid positions ns1 - 53 and ns3 - 250 . \n these genetic markers of attenuation were identified by utilizing infectious cdna clones of the den-2 16681 virus and its vaccine derivative , strain pdk-53 [ 10 , 11 ] . \n the cdna clone of pdk-53 virus has been used to engineer chimeric vaccine candidates that express the prm / e region of den-1 , den-3 , and den-4 viruses , as well as west nile virus , in the attenuated genetic background of the den-2 pdk-53 virus . \n these chimeric viruses were shown to retain the phenotypic markers of the pdk-53 virus , relative to the wild - type den-1 , -3 , and -4 viruses and west nile virus [ 1820 ] . \n of the three genetic markers of den-2 pdk-53 attenuation , only the 5-ncr-57 locus has shown a propensity to revert to the wild - type residue . in this study \n , we constructed and characterized several variants of den-2 16681 virus that contained a single nucleotide substitution in the 5 ncr to determine if other attenuating mutations in this region could be identified and perhaps incorporated into a second generation , pdk-53-based candidate vaccine . \n we previously showed that a number of mutations in the 5-ncr , particularly those involving deletions of bases , were lethal . \n here , we used the m - fold software , which predicts rna secondary structure , to engineer single point mutations at genomic nucleotide positions 14 , 15 , and 57 that were predicted to have only minor effect on the stem - structure in the 5-ncr . \n the infectious cdna clone , designated pd2/ic-30p - a , of den2 - 16681 virus served as template for mutagenesis . a small subclone ( plasmid pf1 ) containing the t7 promoter and den genomic nucleotide positions 11380 was used as template for pcr - mediated site - directed mutagenesis . \n single nucleotide substitutions in the 5-ncr were performed by designed primer pairs that contained the desired nucleotide substitutions at positions 14 ( c changed to a ) , 15 ( g changed to u ) , and 57 ( c changed to u ) . \n pcr cycles were set at 94c for 15 sec , 50c for 30 sec , and 72c for 1 min for 35 cycles . \n pcr products were separated by electrophoresis in 0.8% agarose gels ( tbe buffer ) , then extracted from the agarose and purified over spin columns . \n the purified cdna from pcr products was ligated into the appropriate restriction enzyme sites of plasmid pf1 , and the recombinant plasmid was transformed into e. coli xl-1 blue by electroporation . \n the resulting variant pf1 plasmids were sequenced to validate the presence of the desired mutation , and cdna cassettes containing designed mutations were reintegrated between the ssti and sphi sites in the full - length pd2-ic/30pa clone . \n the ligated products were electroporated into e. coli xl - i blue , and those infectious clone plasmids ( pd2 - 14.5m , -15.5m , and -57.5m ) containing the correct inserts were amplified in , and extracted from , e. coli . in vitro transcription of the xbai - linearized infectious clone plasmids was performed for 2 h at 37c by using the ampliscribe t7 transcription kit ( epicentre technologies ) and rna cap structure analog 7 mg ( 5 ) ppp ( 5 ) a ( new england biolabs ) . \n the transcribed viral rna was transfected into llc - mk2 cells ( 0.5 ml containing 46 10 cells / ml ) by electroporation ( bio - rad gene pulser ) . \n the cells were shocked twice , then transferred to a 75 cm flask in dulbecco 's modified minimal essential medium ( dmem ) containing 10% fetal bovine serum ( fbs ) supplemented with penicillin / streptomycin , and finally incubated in a 5% co2 incubator at 37c . \n infection was evaluated by the presence of cytopathic effect ( cpe ) and den - specific immunofluorescence assay ( ifa ) after 710 days in culture . \n the infectious medium was harvested and made in 20% in fbs , clarified by centrifugation , and the recombinant viruses were in aliquots at 70c . \n kinetic of replication in llc - mk2 and in c6/36 cellsllc - mk2 and c6/36 cells cultured in 75 cm flask were infected at a multiplicity of infection ( moi ) of 0.001 pfu / cell with den-2 16681 ( wild type ) or d2 - 5m ( d2 - 14.5m , d2 - 15.5m , and d2 - 57.5m ) virus . \n virus was adsorbed for 2 h to llc - mk2 cells at 37c and to c6/36 cells at 2830c . \n then , infected cells were transferred to a 5% co2 incubator at the appropriate temperature for cells . \n viral replication kinetics were determined by plaque titration assays in 6-well plates containing confluent monolayers of llc - mk2 cells . \n llc - mk2 and c6/36 cells cultured in 75 cm flask were infected at a multiplicity of infection ( moi ) of 0.001 pfu / cell with den-2 16681 ( wild type ) or d2 - 5m ( d2 - 14.5m , d2 - 15.5m , and d2 - 57.5m ) virus . \n virus was adsorbed for 2 h to llc - mk2 cells at 37c and to c6/36 cells at 2830c . \n then , infected cells were transferred to a 5% co2 incubator at the appropriate temperature for cells . \n viral replication kinetics were determined by plaque titration assays in 6-well plates containing confluent monolayers of llc - mk2 cells . \n kinetics of replication in aedes aegypti mosquitoesfemale aedes aegypti mosquitoes were housed in cages at 302c , 80% humidity , and with a 12 : 12 h light : dark period . \n they were reared with a normal rat chow diet and 10% sucrose solution until infection . \n mosquitoes were starved 1 day before being fed with a mixture of blood : dmem containing 10 pfu of virus : 10% sucrose in the ratio 0.5 : 1.5 : 0.5 until their stomachs became engorged . \n six infected mosquitoes were randomly sampled at day 412 postinfection to determine the presence of viral infection by ifa . \n female aedes aegypti mosquitoes were housed in cages at 302c , 80% humidity , and with a 12 : 12 h light : dark period . \n they were reared with a normal rat chow diet and 10% sucrose solution until infection . \n mosquitoes were starved 1 day before being fed with a mixture of blood : dmem containing 10 pfu of virus : 10% sucrose in the ratio 0.5 : 1.5 : 0.5 until their stomachs became engorged . \n six infected mosquitoes were randomly sampled at day 412 postinfection to determine the presence of viral infection by ifa . \n determination of viral transmission and disseminationpercent infection and dissemination rates were determine at day 21 after oral infection . \n virus - infected mosquitoes were sampled ( 25 mosquitoes from each group ) and killed by freezing . head and \n body portions were severed and squashed on slides , which were treated with prechilled 90% acetone to fixed antigen . the slides were air dried at room temperature and then analyzed by indirect ifa using the anti - den - e protein - specific 3h5 monoclonal antibody . \n positive ifa of the body part indicated oral infection , and positive ifa of head squashes indicated viral dissemination . \n virus - infected mosquitoes were sampled ( 25 mosquitoes from each group ) and killed by freezing . \n head and body portions were severed and squashed on slides , which were treated with prechilled 90% acetone to fixed antigen . the slides were air dried at room temperature and then analyzed by indirect ifa using the anti - den - e protein - specific 3h5 monoclonal antibody . \n positive ifa of the body part indicated oral infection , and positive ifa of head squashes indicated viral dissemination . \n standard plaque titration and plaque size determinationstenfold serial dilution series of the mutant viral seeds were made in ba-1 diluent . \n monolayers of llc - mk2 cells were inoculated with 0.2 ml of diluted virus , and adsorption was performed for 1 h at 37c and 5% co2 . \n four ml of agarose overlay medium ( 2 nutrient solution and 2% agarose solution , 1 : 1 ) was added , and after 7 days of incubation the cultures were overlaid with 2 ml of agarose overlay medium containing 80 ug / ml ( diluted from 1% stock ) neutral red solution ( gibco ) and reincubated in the co2 chamber . \n . \n tenfold serial dilution series of the mutant viral seeds were made in ba-1 diluent . \n monolayers of llc - mk2 cells were inoculated with 0.2 ml of diluted virus , and adsorption was performed for 1 h at 37c and 5% co2 . \n four ml of agarose overlay medium ( 2 nutrient solution and 2% agarose solution , 1 : 1 ) was added , and after 7 days of incubation the cultures were overlaid with 2 ml of agarose overlay medium containing 80 ug / ml ( diluted from 1% stock ) neutral red solution ( gibco ) and reincubated in the co2 chamber . \n two sets of llc - mk2 cell cultures in 25 cm flask were inoculated with virus at moi of 0.001 pfu / cell , incubated for 2 h at 37c , and then overlaid with 10 ml of m199 medium containing 5% fbs . \n one set of infected cells was incubated for 79 days in 5% co2 at 37c , the other set at 39c . \n newborn white icr mice were infected intracranially with 10 pfu of virus in a 0.02 ml volume . \n female white icr mice ( 3 wk - old , 9 mice per group ) were injected subcutaneously ( s.c ) with 10 pfu of virus . \n two weeks after the second boost , at day 35 , the mice were challenged intraperitoneally with 10 pfu of wild - type den-2 16681 virus . at day 5 , 19 , and 33 , mice were bled by orbital sinus venipuncture . \n the blood was collected in nonheparinized capillary tubes , and the serum was separated and kept frozen at 70c . \n the serum aliquots were tested for anti - den-2 neutralizing antibody by serum dilution - plaque reduction neutralization test ( prnt50 ) without addition of exogenous complement . in brief , twofold serial dilutions of heat - inactivated serum ( at 56c , 30 min ) were incubated overnight at 4c with an equal volume of diluent containing 60 pfu of den-2 16681 virus . \n llc - mk2 cells in 6-well plates were inoculated with the serum - virus mixtures , then , incubated for 90 min at 37c and 5% co2 . \n the plates were treated as described for the plaque titration assay using the double agarose overlay technique . \n back titrations of the input wild - type den-2 16681 virus were included in duplicate in the assays . \n the neutralizing antibody titer was identified as the highest serum dilution that reduced the number of input plaques in the test by 50% or greater . \n the level of virus circulating in the blood ( viremia ) was determined by the plaque titration assay . \n female mosquitoes that had been mated with uninfected males were starved 1 day before feeding with blood mixtures containing 10 pfu of virus . \n the female mosquitoes ( generation 1 , or g1 ) that hatched from eggs from this initial mating were in turn mated , starved , and fed virus - containing blood meals . \n this procedure was repeated through g5 , and adult females from each generation were assayed for viral rna and infectious viral titers . \n percentage of mosquito infection and dissemination was determined by ifa of mosquitoes ' body and head tissues ( 50 mosquitoes from each group ) . \n after replication in cell cultures and in mosquitoes , viral genomic rnas were extracted and either ( a ) reverse transcribed with rav2-rt using the 5 race ( rapid amplification of 5 cdna ends ) kit ( gibco , brl ) to obtain 5-terminal cdna sequencing or ( b ) subjected to rt - pcr using den-2-specific primer pairs to amplify segments covering the complete genome for whole genomic sequencing to verify the presence of the desired mutation in the 5-ncr and lack of spurious mutations in the rest of the genome . \n viral rna secondary structure analysis was performed by using the mfold program version 3.1 created by zuker . \n in llc - mk2 cells , variant viruses d2 - 14.5m , -15.5m , and 57.5m replicated to much lower peak titers of 6.8 0.5 , 6.9 0.7 , and 6.3 0.5log10 pfu / ml , relative to the peak 8.8 0.7log10 pfu / ml titer of the wild - type 16681 virus ( figure 1(a ) ) . in c6/36 cells , variant viruses d2 - 14.5m and -15.5m also replicated to much lower peak titers ( 6.7 0.8 , 6.2 0.5log10 pfu / ml ) than the 16681 virus ( 8.9 1.1log10 pfu / ml ; see figure 1(b ) ) . \n however the d2 - 57.5m variant replicated to a peak titer of 8.9 1.1log10 pfu / ml that was equivalent to the peak titer of 16681 virus in c6/36 cells . \n the latter result contrasts with the results of butrapet , who reported that the 5ncr-57 mutant replicated to significantly lower levels than 16681 virus in c6/36 cells . \n the kinetics of replication of all 3 mutants , particularly the d2 - 15.5m mutant , were decreased in aedes aegypti mosquitoes ( figure 1(c ) ) . at day 21 \n , the titer of the d2 - 57.5m virus approached that of wild - type virus , while the titers of d2 - 15.5m and -14.5m remained depressed ( figure 1(c ) ) . \n however , the plaque sizes of d2 - 14.5m ( 1.17 0.02 mm mean plaque diameter ) , d2 - 15.5m ( 1.16 0.02 mm ) , and d2 - 57.5m ( 1.49 0.06 mm ) were statistically significantly ( p < .0001 ) smaller from the plaque size of the 16681 virus ( 1.99 0.07 mm ) ( data not shown ) . these relative plaque sizes of these four viruses were maintained following passage of the viruses in c6/36 cells and aedes aegypti mosquitoes ( not shown ) . \n newborn icr mice were challenged intracranially with each of the four viruses in two separate experiments ( 16 mice each ) ( table 1 ) . the wild - type 16681 virus caused 100% fatality . \n virus variants d2 - 14.5m , -15.5m , and -57.5m all resulted in 31%32.5% mortality . \n the average survival times ( asts ) of mice challenged with d2 - 14.5m , d2 - 15.5m , and d2 - 57.5m , and which suffered mortality , were statistically significantly greater than the ast of mice challenged with the 16681 virus ( p < .0001 ) . excluding the animals which suffered mortality , the weekly incremental increases in mean body weights were similar for each experimental group during the experimental period . \n the wild - type 16681 virus , as well as all three of the variant viruses , was not temperature sensitive when replicated in llc - mk2 cells . \n the 16681 and d2 - 15.5m viruses showed similar 37c - titer/39c - titer ratios of 1.3 and 1.2 , respectively , while the d2 - 14.5m and d2 - 57.5m variants had ratios of 1.7 and 1.6 , respectively . \n the presence of virus in the mosquitoes was assayed by ifa at 21 days after feeding . \n positive ifa detection in mosquitoes ' bodies indicated susceptibility to viral infection . nearly all ( 96% ) of the tested mosquitoes became infected with the wild - type 16681 virus ; whereas the three variant viruses resulted in 6480% positive infection rate ( table 2 ) . \n positive ifa detection in mosquitoes ' heads indicated viral dissemination from the midgut and the potential for transmission of the virus . \n of the 25 mosquitoes tested in each virus group , the three variant viruses exhibited much reduced rates of dissemination to the head , 42%55% , than did the wild - type 16681 virus ( 79% ) . to determine whether the mutant viruses could be maintained in the blood circulation and be able to boost mice immune response , the blood taken from immunized mice were titered for replication kinetic . \n the mutant viruses exhibited significantly lower replication efficiency than the wild type ( figure 2 ) . \n the viremia titers of d2 - 5m were significant difference from d2 - 16681 viruses ( p = .002.0001 ) . \n the plaque phenotypes of all the viruses were not significantly changed from the primary derived viruses ( data not shown ) . the neutralizing antibody production from immunized mice with d2 - 16681and d2 - 5m determined at day 5 , \n 19 , 33 , and 38 by prnt50 assay showed some extent of inducing immunogenic response . \n obviously , the mutant viruses induced 28 folds less titers than the wild type ( table 3 ) . to determine the replication phenotype of virus in the mosquito progeny \n the result indicated that the viruses isolated from mosquitoes infected with d2 - 5m and d2 - 16681 maintained their growth and replication characteristics , in which d2 - 5m viruses were lower efficient than d2 - 16681 ( figure 3 ) . \n furthermore , full - length nucleotide sequencing analysis of the virus before mosquito ingestion and after 5 generations of vector transmission indicated stable rna sequences of the viral gene ( data not showed ) . \n substitution mutation at nucleotide position 14 , 15 , and 57 in 5 ncr of d2 gene caused mild alteration of rna secondary structure from that of the wild type ( figure 4(a ) ) . \n at the stem-2 and loop-2 region , d2 - 14.5m showed a small splitting stem ( figure 4(b ) ) , d2 - 15.5m showed shortening stem and widening loop ( figure 4(c ) ) , while d2 - 57.5m maintained a similar pattern to the wild type ( figure 4(d ) ) . \n the recombinant viruses that carried a single point substitution in the conserved 5ncr gene of den-2 were genetically stable in the aedes aegypti mosquito vector and in mice . \n the variant viruses exhibited decreased replication efficiency in llc - mk2 and , except for the d2 - 57.5m virus which replicated as well as the 16681 virus , in c6/36 cells as well . \n these three viruses produced smaller plaque and were less virulent in newborn mice compared to the wild - type virus . \n an independently engineered variant at 5ncr-57 also exhibited similar small plaque size and decreased neurovirulence level for newborn mice , but differed from the d2 - 57.5m results reported here in having a decreased replication profile in c6/36 cells . \n we are presently unable to explain the discrepancy in the c6/36 replication profiles between the d2 - 5m virus and the 5ncr-57 virus reported previously . \n based on the modified in vitro and in vivo phenotypes of the variant viruses , these viruses were considered to have vaccine potential . \n mice immunized with three high doses ( 10 pfu each ) of each of the variant viruses developed significant levels of neutralizing antibodies and challenging with den2 - 16681 . the mice infection with den2 - 16681 and its derived mutants , however , demonstrated some degree of neurovirulence including paralysis and weakness after 38 days and at least 1 mouse from each group died during the assay . \n although involving only a minor alteration in the 5ncr predicted rna secondary structure , the single base - substitution mutations at 5ncr positions 14 , 15 , and 57 resulted in significant alterations in in vitro and in vivo viral . \n a single nucleotide substitution at position 69 of the american den-2 genotype , leading to a minor change ( shortening ) of stem-1 , has been shown to encode a low - virulence genotype . in our previous study , we were unable to derive infectious viruses from multiple - site ( > 2 nucleotides ) substitutions between 5ncr positions 5661 of the . \n the present study provides further evidence for the potential biological significance of single nucleotide substitutions that cause apparently minor perturbations in rna secondary structure in the 5ncr . \n characterization of the mutants in aedes aegypti mosquito suggested that they were competent for replication in this vector . \n although both den-2 wild type and the d2 - 5m viruses were capable of vertical transmission in aedes aegypti , the mutants ' growth and replication in infected mosquitoes and the progenies were less efficient than those of the wild type . \n the rates of viral infection and dissemination were significantly decreased after 5 generations of mosquito life cycle . \n the lower transmission and dissemination in the mosquito suggested the poorer potency of the mutants to be transmitted to human host . \n den2 - 16681 wild - type and the derived d2 - 5m viruses remained genetically stable in the vector even after passage for 5 generations . in conclusion , \n the d2 - 14.5m and d2 - 15.5m variant viruses exhibited in vitro and in vivo phenotypic markers of attenuation that were similar to many of the markers reported earlier for the 5ncr-57 mutation . \n the 5ncr-57 c(wild - type)-to - t(vaccine candidate ) mutation is one of the three dominant mutations that have been reported to encode the attenuated phenotype of the candidate den-2 \n the d2 - 57.5m mutation has been shown to have a propensity to revert to the wild - type c residue upon serial passage in vero cell culture . \n incorporation of one or both d2 - 14.5m and d2 - 15.5m mutations together with the d2 - 57.5m mutation may lead to a more stable attenuation locus in the 5ncr of the den-2 viral genome . \n the single - point mutants appeared to retain their plaque size and replication phenotypes following passage in mice and vertical transmission in mosquitoes .", "role": "user" }, { "content": "variants of wild - type dengue serotype 2 ( den-2 ) virus containing nucleotide substitutions at positions 14 , 15 , or 57 in the 5 ncr were constructed by pcr - mediated site - directed mutagenesis . \n all three viruses containing a single point substitution demonstrated attenuation phenotype as evidenced by decreases replication and plaque size in cell culture assay . \n all three variants were less neurovirulent in newborn mice compared to the wild type . \n the mutants were immunogenic in adult mice immunogenicity and maintained stable replication characteristics following passage in mice . \n the variant viruses were competent for replication in aedes aegypi mosquito vector , albeit at lower levels of infection and dissemination in the mosquito than the wild - type den-2 16681 virus . \n although all of the viruses , including the wild type , were found transmissible in mosquito life cycles , they were found subsequentially decreased in efficiency of infection , transmission , and dissemination rates along the mosquito generations and all of them remained genetically stable .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: recovery of function after spinal cord injury ( sci ) has been limited by failure of axons in the central nervous system ( cns ) to regenerate and restore neurological connectivity . \n this has been ascribed to both inhibitory environmental molecular cues and the intrinsic characteristics of cns neurons . \n ras homolog gene family , member a ( rhoa ) is a small gtpase that is activated and/or upregulated locally at the site of sci , and is thought to be an important participant in limiting recovery . \n , 2003 ; conrad et al . , 2005 ; hu et al . , 2017 ) . \n evidence suggests that rhoa is a convergence point for intraneuronal signaling of several extracellular molecules implicated in restricting recovery after sci , e.g. , the chondroitin sulfate proteoglycans ( cspgs ) , and myelin - associated glycoprotein ( mag ) , oligodendrocyte myelin glycoprotein ( omgp ) , nogo and their corresponding receptors . \n this makes rhoa a promising target to promote axon growth and improve functional recovery after sci ( lehmann et al . , 1999 ; \n the means by which rhoa limits recovery are complex , and may involve at least two types of neural responses to sci : 1 ) neuronal apoptosis ; and 2 ) regenerative failure . how these two phenomena relate to each other \n is not clear , but it is not simply that dead neurons can not regenerate . \n the results of experiments on sci in vivo are difficult to interpret in mammals for three reasons : 1 ) it is difficult to distinguish true regeneration of injured axons from collateral sprouting of spared axons . \n we have used the sea lamprey as a model to address these ambiguities because its large , individually identified reticulospinal ( rs ) neurons show great heterogeneity in the ability of their axons to regenerate through the same spinal cord environment ( jacobs et al . , 1997 ) \n ( figure 1 ) , and to survive long term after axotomy ( shifman et al . , 2008 ) . \n we have used these features of the lamprey to analyze the factors underlying axotomy - induced retrograde neuronal death , and also the failure of axons to regenerate . moreover , the neurons whose axons regenerate poorly at early time points post - sci , eventually die at a later time ( shifman et al . , 2008 ) . this has suggested that the pathways for inhibition of axon regeneration and for survival of the parent neurons may converge , possibly through rhoa . \n rhoa and its downstream signaling molecules are highly conserved between lamprey and mammals , so the mechanisms revealed by these experiments are likely to be the same . \n it is the anatomical simplicity of the lamprey cns and the presence of individually identified rs neurons that make the results of experiments easier to interpret in the lamprey compared to mammals . \n individually identified reticulospinal ( rs ) neurons in the brain were labeled retrogradely with dextran tetramethylrhodamine ( dtmr ) . \n these neurons are named according to the nomenclature of rovainen ( 1967 ) as modified by swain et al . \n m : mesencephalic ; i : isthmic ; b : bulbar ; mth : mauthner cell . \n c3 transferase ( c3 ) from clostridium botulinum can block rho activation by adp - ribosylation . \n c3 was first used to inhibit rho activation in the mouse optic nerve crush ( onc ) model ( lehmann et al . , 1999 ) . \n the investigators applied c3 either at the crush site or to the cell bodies of the retinal ganglion cells ( rgcs ) , and found that it promoted regrowth of the optic nerve axons across the lesion site . \n soon after , c3 was tested in sci models , and was found to promote functional recovery and growth of corticospinal tract ( cst ) fibers beyond a partial sci in mice ( dergham et al . , 2002 ) . \n these studies in mammalian models suggest that inhibiting rho produced a complicated and only partial axon regeneration benefit . in these studies , \n c3 was applied directly to the lesion either by gelform plus elvax tube ( lehmann et al . , 1999 ) or a fibrin adhesive delivery system ( dergham et al . , 2002 ) . \n in these procedures , the c3 available to the target tissue was relatively limited , and the mechanical procedures themselves might have caused secondary damage . \n it also is possible that rho activity affects collateral sprouting of spared cst or other axons , rather than true regeneration of injured ones ( tuszynski and steward , 2012 ) . \n recently , a non - replicating herpes simplex virus ( hsv ) vector carrying the gene coding for c3 has been generated . \n subcutaneous inoculation of the vector into the skin of the forepaw 1 week after a dorsal c5t1 rhizotomy resulted in expression of c3 in dorsal root ganglion ( drg ) neurons . \n this efficiently inhibited rho activation , resulting in extensive axonal regeneration into the spinal cord and improved sensory - motor coordination of the forepaw ( zhou et al . , 2012 ) . \n c3 also can activate microglia , which is the immune - competent element of the cns and believed to protect the neurons against any potentially harmful change of the environment . \n activated microglia can trigger the release of nitric oxide and several pro - inflammatory cytokines and chemokines ( hoffmann et al . , \n thus , any regenerative benefits of c3 might not be limited to its effects on rhoa . to clarify the role of rhoa in axon regeneration after injury \n , there is a need to increase the specificity and efficiency with which rhoa is inhibited in vivo . \n several methods other than c3 application have been developed in the past few years to improve the specificity with which rhoa expression can be manipulated . \n adeno - associated viral ( aav ) vectors have been generated to downregulate rhoa specifically via shrna ( koch et al . , 2014 ) . \n in the rat onc model in vivo , specific rhoa knockdown significantly enhanced axon regeneration . moreover , survival of rgc transduced with aav expressing rhoa - shrna was substantially increased at 2 weeks after onc ( koch et al . , 2014 ) . \n the cationic , amphiphilic copolymers poly-(lactide - co - glycolide)-g - polyethylenimine ( pgp ) have been used to deliver sirna targeting rhoa , and were evaluated in a sci compression model ( gwak et al . , 2017 ) . \n pgp / sirhoa polyplexes were locally injected into the lesion site and significantly reduced rhoa mrna and protein expression for up to 4 weeks post - injury ( gwak et al . , 2017 ) . \n histological analysis showed that rhoa knockdown was accompanied by a reduction in local apoptosis , cavity size , and astrogliosis , and an increase in axonal regeneration within the lesion site at 4 weeks post - injury , suggesting that pgp is an efficient non - viral carrier for delivery of therapeutic sirhoa to the injured spinal cord , and may be a promising platform for the development of combinatorial therapies ( gwak et al . , 2017 ) . \n specificity of rhoa knockdown has been increased in the lamprey sci model through the use of morpholino antisense oligonucleotides ( mos ) ( hu et al . , 2017 ) . \n compared to mammals , the lamprey cns is relatively simple , with special advantages for the study of axon regeneration and related mechanisms . in the lamprey , \n the main supraspinal inputs are the rs neurons , which are responsible for initiating and controlling locomotion , steering , and equilibrium . of the approximately 2,000 rs neurons , \n their axons extend the entire length of spinal cord , and therefore are always severed by a complete spinal cord transection ( tx ) . \n the regeneration capabilities of these axons after tx have been documented extensively , and are very heterogeneous . moreover , \n the severed axons and their neuronal cell bodies can be back - labeled with dextran alexa fluor 488 ( daf-488 , green ) ( figure 2a ) . \n if a second tx is made 5 mm caudal to the first tx , and dextran tetramethyrhodamine ( dtmr , red ) is applied to the rostral cut end , axons that have regenerated 5 mm will be re - axotomized , and their neurons will be double - labeled with daf-488 and dtmr ( yellow , figure 2b ) . on the other hand , \n neurons and axons that did not regenerate , or regenerated less than 5 mm , will be labeled only with daf-488 ( green , figure 2b ) . with this design , because rhoa is highly conserved across species , we have evaluated the effects of mo - mediated specific rhoa knockdown on true axon regeneration , as opposed to collateral sprouting , and on neuronal apoptotic signaling after axotomy . in the mo experiments , we used either fluorescently labeled rhoa mo or control mo as the first dye to label the neurons and axons undergoing axotomy , and dtmr as the second dye to label the regenerated neurons and axons ( hu et al . , 2017 ) . \n ( a ) a first transection ( tx ) is performed at the level of the 5 gill , and gelfoam soaked with dextran alexa fluor 488 ( daf-488 ) or oligonucleotides ( mo ) ( green ) is inserted into the tx site . \n axons that have been severed by this lesion will take up the dye at the cut tip and the label transported retrogradely to the identified reticulospinal ( rs ) neurons in brainstem . \n ( b ) 10 weeks later , a second tx is performed 5 mm caudal to the first tx and gelfoam soaked with dextran tetramethyrhodamine ( dtmr ) ( red ) is applied , to label the neurons whose axons have regenerated more than 5 mm beyond the original tx . \n mos are oligomers , usually 25 bases in length , which can bind complementary rna to knock down gene expression specifically . \n we designed a mo to target the start codon of rhoa mrna and its upstream , untranslated region , thus blocking translation of rhoa protein ( hu et al . , 2017 ) . \n in the lamprey , mos are efficiently transported retrogradely in axotomized rs axons from the tx site to their neurons in brain . with the fluorescently labeled mos , \n thus , we used mos in vivo to specifically knockdown rhoa in rs neurons after tx , and imaged the cut axon tips . during the first 2 weeks post - tx \n , rhoa knockdown greatly increased the number of axons regenerating more than 5 mm ( hu et al . , 2017 ) \n activation of pten by rhoa / rock has been reported in cell lines but not yet in neurons or in cns in vivo . \n bad : bcl-2-associated death promoter ; cns : central nervous system ; cspg : chondroitin sulfate proteoglycans ; pten : phosphatase and tensin homolog ; rhoa : ras homolog gene family , member a ; rock : rho - associated protein kinase ; rptps : receptor protein tyrosine phosphatases ; sci : spinal cord injury ; tgf : transforming growth factor . \n near the site of a sci , neurons and other cells undergo apoptosis , and in mammals , inhibition of rhoa with c3 reduced the apoptotic signaling ( dubreuil et al . , 2003 ; wu et al . , 2016 ; gwak et al . , \n a role for rhoa in axotomy - induced neuronal death is not clear , since non - neuronal cells were also affected , and the neuronal death could have been due to other mechanisms such as inflammation , reactive oxidation and excitotoxicity . in order to address this question \n , we used mos in vivo to retrogradely knockdown rhoa in rs neurons after sci . \n rs neurons often experience very delayed retrograde apoptosis , signaled by late tunel staining ( shifman et al . , 2008 ) and earlier caspases activation ( hu et al . , 2017 \n ) . because these neurons are located far from their cut axon tips , local mechanisms of secondary injury are not responsible for the death of these neurons \n caspase activation was significantly reduced in individual rs neurons , as indicated by fluorochrome - labeled inhibitors of caspases ( flica ) . \n the reduction of retrograde apoptosis signaling began at 2 weeks post - tx and lasted until at least 8 weeks post - tx ( hu et al . , 2017 ) . \n thus , in vivo rhoa knockdown can both promote true axon regeneration and reduce retrograde apoptosis signaling after sci ( figure 3 ) . \n these findings have clarified ambiguities in the results of previous sci studies using mammalian partial injury or contusion injury models . \n it is clear that the small gtpase rhoa has effects on axonal outgrowth and neuronal vulnerability to apoptosis after sci ( figure 3 ) . \n however , the usefulness of targeting rhoa to promote axon regeneration and neuronal survival depends on our understanding of the molecular mechanisms of rhoa in axon regeneration and apoptosis and the possible toxicities of the therapeutic interventions . \n in addition to increasing the levels of extracellular growth - inhibitory molecules , sci also induces neuronal changes in the expression of the corresponding receptors . \n for instance , p75 has been shown to induce local apoptosis after sci via rhoa ( dubreuil et al . , 2003 ) . \n lar and ptp also act on rhoa to mediate cspg inhibitory effects on axon regeneration ( ohtake et al . , \n studies also suggest that in addition to its traditional downstream cytoskeletal effects , rhoa activates cpla2 ( wu et al . , 2016 ) to execute its functions . \n interestingly , our preliminary data indicate that rhoa might reduce the phosphorylation of akt ( unpublished ) , thus inducing retrograde neuronal death and inhibiting axon regeneration . \n it is not clear at what point the effects of rhoa are most acutely felt by the neurons . \n axon retraction was reduced in the first 2 weeks after mo application , but immunohistochemical findings suggested that rhoa levels remained reduced for at least 10 weeks ( hu et al . , 2017 ) . since axon regeneration continues for at least that long , it is possible that the influence of rhoa knockdown on regeneration reflected sustained actions . \n many questions remain about the role of rhoa in neuronal responses to sci , and there is a need for more research to elucidate the specific signaling pathways involved in rhoa 's role in the pathogenesis of sci , and on the mechanisms by which rhoa inhibition enhances functional recovery .", "role": "user" }, { "content": "paralysis following spinal cord injury ( sci ) is due to failure of axonal regeneration . \n it is believed that the capacities of neurons to regrow their axons are due partly to their intrinsic characteristics , which in turn are greatly influenced by several types of inhibitory molecules that are present , or even increased in the extracellular environment of the injured spinal cord . \n many of these inhibitory molecules have been studied extensively in recent years . \n it has been suggested that the small gtpase rhoa is an intracellular convergence point for signaling by these extracellular inhibitory molecules , but due to the complexity of the central nervous system ( cns ) in mammals , and the limitation of pharmacological tools , the specific roles of rhoa are unclear . by exploiting the anatomical and technical advantages of the lamprey cns \n , we recently demonstrated that rhoa knockdown promotes true axon regeneration through the lesion site after sci . \n in addition , we found that rhoa knockdown protects the large , identified reticulospinal neurons from apoptosis after their axons were axotomized in spinal cord . \n therefore , manipulation of the rhoa signaling pathway may be an important approach in the development of treatments that are both neuroprotective and axon regeneration - promoting , to enhance functional recovery after sci .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: amblyopia is a developmental ocular disorder characterized by a unilateral or bilateral visual deficiency that is out of proportion with any structural abnormalities that are present in the eye [ 14 ] . \n , extensive neuroimaging studies have found decreased gray / white matter volumes [ 57 ] and reduced functional activation or connectivity [ 812 ] in the visual cortical areas or in the visual pathway regions in cases of amblyopia . in a previous study , we also found disrupted spontaneous activity patterns of some brain regions , such as the precuneus , the medial prefrontal cortex , and the cerebellum , in anisometropic amblyopic individuals , which suggested that the decreased visuomotor processing ability and compensatory plasticity coexist in amblyopia . \n the primary visual cortex ( also known as v1 , anatomically equivalent to brodmann area 17 ( ba 17 ) ) is a koniocortex ( sensory - type cortex ) located in and around the calcarine fissure of the occipital lobe . \n each hemisphere of the primary visual cortex receives information directly from its ipsilateral lateral geniculate nucleus and transmits information to the dorsal and ventral streams . \n previous studies have observed functional deficits and morphological alterations in the lateral geniculate nucleus in cases of amblyopia [ 1315 ] , which may suggest that the input pathway could be affected in subjects without normal sight . \n yu and colleagues have demonstrated that blind subjects show decreased functional connectivity ( functional connectivity may refer to any study examining interregional correlations in neuronal variability . here , it is a measurement of the spatiotemporal synchrony or correlations of the blood oxygen level - dependent ( bold ) fmri signal between anatomically distinct brain regions of cerebral cortex . ) between the primary visual area and the somatosensory motor areas . \n qin et al . suggested that the development of the dorsal and ventral visual areas depends on different visual experiences ; these findings support the hypothesis that the development of the human brain is modulated by compensatory plasticity and visual loss effects [ 12 , 19 ] . the two - stream ( dorsal and ventral ) hypothesis is an influential and widely accepted model of visual information processing . \n it is generally believed that the dorsal stream ( the how pathway ) , which involves areas such as the middle temporal cortex ( mt ) and the medial superior temporal area , processes spatial location information . the ventral pathway ( the what pathway ) includes area v4 and the inferior temporal lobe and is associated with the processing of object identification and recognition . \n interestingly , numerous psychophysical studies have observed that both the ventral and dorsal extrastriate cortical processing functions are disrupted in amblyopia subjects [ 2023 ] . in particular , the cortical areas extending from v1 , including v3a / mt , are implicated in the global motion deficits reported in amblyopia [ 2426 ] . using an effective connectivity analysis based on task ( retinotopic mapping ) related functional magnetic resonance imaging ( fmri ) , li and colleagues \n have found that both the feedforward and feedback interactions are anomalous in amblyopia and that this disrupted connectivity extends throughout the thalamocortical pathway . \n li and colleagues have also found small but consistent reductions in activation in area v1 when stimulating ( spatially broadband ) the amblyopic eye compared to that of the fellow fixing eye . \n however , the functional connectivity pattern of the primary visual cortex in patients with amblyopia remains unclear . \n the aim of the present study was to investigate the characteristics of the functional connectivity pattern of the primary visual cortex in patients with amblyopia . \n a group of subjects with amblyopia and their age / gender - matched normal - sighted control subjects were recruited . \n a correlation analysis was computed between the mean time series of the bilateral primary visual areas and other brain regions . \n then , two - sample t - tests were accessed in a voxel - wise manner to determine which brain areas showed significant differences between the normal - sighted subjects and the patients with amblyopia for each hemisphere of the primary visual area . \n parts of the dataset have been used in our previous study to investigate the regional homogeneity of spontaneous activity patterns in amblyopic subjects . to maintain the scientific integrity of the current paper \n this study was approved by the ethics committee of zhong shan ophthalmic center at sun yat - sen university and followed the tenets of the declaration of helsinki . \n all participants received detailed eye examinations that included assessments of their visual acuity , intraocular pressure and refraction , slit lamp examination , ophthalmoscopy , binocular alignment , ocular motility , and random - dot butterfly stereograms . in total , fourteen anisometropic amblyopic patients , sixteen mixed ( anisometropic and strabismic ) amblyopic patients , and twenty - two healthy individuals were enrolled in the study . \n three participants ( one healthy volunteer and two patients with amblyopia ) had excessive head motions during the scanning and were excluded , leaving twenty - one healthy volunteers and twenty - eight patients with amblyopia to be included in the analysis . \n all of the subjects were right - handed and had no history of other ocular diseases , surgery , neurological disorders , or brain abnormalities based on mri scans . \n the volunteers had normal or corrected - to - normal visual acuity in both eyes . \n detailed clinical data on the subjects are shown in table s1 in supplementary material available at http://dx.doi.org/10.1155/2013/612086 . \n the mri data were obtained using a 3.0 tesla mr scanner ( trio tim system ; siemens , erlangen , germany ) . \n resting - state fmri scans were performed with an echo planar imaging sequence with the following scan parameters : repetition time = 2000 ms , echo time = 30 ms , flip angle = 90 , matrix = 64 64 , field of view = 220 220 mm , slice thickness = 3 mm , and slice gap = 1 mm . \n each brain volume was composed of 32 axial slices , and each functional run contained 270 volumes . during the scans , \n all subjects were instructed to keep their eyes closed , relax , and move as little as possible . \n tight but comfortable foam padding was used to minimize head motion , and earplugs were used to reduce scanner noise . \n the structural magnetization prepared rapid gradient - echo imaging sequence which was used to acquire structural t1-weighted images in a sagittal orientation . \n the parameters were as follows : repetition time = 2000 ms , echo time = 2.6 ms , flip angle = 9 , acquisition matrix = 512 448 , and field of view = 256 224 mm . \n the scanning time was approximately 5 min , and a total of 192 images with 1 mm thick slices were obtained . \n the fmri images were conventionally preprocessed using statistical parametric mapping software ( spm8 , http://www.fil.ion.ucl.ac.uk/spm/ ) . \n the primary visual cortex of the brain generally refers to brodmann area 17 ( ba 17 ) , and the bilateral primary visual cortices were defined using the method used in a previous study . \n the detailed procedure is as follows : ( 1 ) each hemisphere of ba 17 and the gray matter were selected from the td ( talairach daemon ) brodmann area atlas ; ( 2 ) the left ba 17 and the gray matter were intersected to generate the left primary visual cortex ; and ( 3 ) in the same way , the right primary visual cortex was generated . \n a seed reference time series for each hemisphere of the primary visual cortex was obtained by averaging the fmri time series of all voxels within the area . \n a pearson correlation analysis of the time series was performed between the mean time series and other brain regions in a voxel - wise manner . for further statistical analysis \n , a fisher r - to - z transformation was performed to improve the normality of the correlation coefficients . in this study , we investigated alterations in the connectivity pattern of the visual cortex and other brain areas in amblyopic subjects . a two - sample \n , two - tailed t - test was performed to investigate the group differences in the functional connectivity map of the bilateral primary visual cortex between the anisometropic amblyopic subjects and subjects with normal vision after regressing out the effects of age and gender . \n the statistical threshold for each voxel was set at palpha < 0.01 with a cluster size of at least 130 voxels based on the results of a monte carlo simulation ( http://afni.nimh.nih.gov/pub/dist/doc/manual/alphasim.pdf ; alphasim with the following parameters : single voxel p = 0.01 , fwhm = 6 mm , with the aal template in the mircron software as a mask ) . \n the same statistical analyses were performed between the mixed amblyopic subjects and normal - sighted subjects and between the anisometropic and mixed amblyopic subjects . \n exactly the same statistical analyses were performed for the right primary visual cortex to obtain functional connectivity maps of the right primary visual area . to evaluate the alterations in the connectivity pattern of the primary visual area in the amblyopic subjects , \n all of the regions identified from the two comparisons ( anisometropic amblyopic subjects versus normal - sighted and mixed amblyopic subjects versus normal - sighted ) were overlapped to investigate the impaired regions in the two patient groups . \n the demographic and psychological characteristics of the two amblyopic groups ( anisometropic amblyopia : 5 males , 8 females , mean age : 22.3 7.2 years ; mixed amblyopia : 8 males , 7 females , mean age : 23.4 7.1 years ) are summarized in table s1 . \n the 21 normal - sighted volunteer individuals ( 8 males , 13 females ; mean age : 23.5 2.1 years ) were well matched with the amblyopic group in age ( p = 0.81 , two - sample two - tailed t - test ) and gender ( p = 0.616 , chi - squared test ) . \n additionally , an extra evaluation of the differences in movement parameters between subjects with amblyopia and with normal vision was performed according to the procedures described in van dijk et al . to further evaluate the influence of head motion on the functional connectivity results . \n no significant differences were found between the three groups ( table 1 ) . compared to subjects with normal sight ( n = 21 ) , \n anisometropic amblyopic individuals ( n = 13 ) showed significantly decreased functional connectivity with the left primary visual area in the cerebellum ( left cerebellum 1 , right cerebellum crus 1/2 , 8/9 ) , the conjunction area of the bilateral inferior parietal lobe and the angular lobe ( ipl / ang , ba 40 ) and the conjunction area of the left middle frontal lobe and the precentral gyrus ( mfg / precg.l , ba 8/9 ) ( figure 1 , table s2 ) . decreased functional connectivity with the right primary visual area \n was found in the bilateral cerebellum ( left cerebellum crus 1/2 / lingual / vermis_6/9 , left cerebellum crus 1/8/9 , right cerebellum crus 1/6 ) and the conjunction area of the left inferior parietal lobe and the angular lobe ( ipl / ang , ba 40 ) , while increased functional connectivity with the right primary visual area was found in the left postcentral gyrus ( postcg.l ) and the conjunction area of the left paracentral lobule and the middle frontal gyrus ( pcl / mfg , ba 6/31 ) ( figure 1 , table s3 ) . \n compared to the subjects with normal vision ( n = 21 ) , subjects with mixed amblyopia ( n = 15 ) showed significantly decreased functional connectivity with the left primary visual area in the cerebellum ( cerebellum crus 1 , crus 6/8/9 , cerebellum crus6/vermis_9 ) , the conjunction area of the bilateral inferior parietal lobe and the angular lobe ( ipl / ang , ba 7/40 ) , the medial frontal cortex ( mfg , ba 11 ) , the conjunction area of the posterior cingulate cortex and the precuneus ( pcc / precun , ba 30 ) , the left middle frontal - precentral gyri ( mfg / precg.l , ba 8/9 ) , the left inferior temporal gyrus ( itg.l , ba 20 ) , and the bilateral thalamus ( figure 2 , table s4 ) . decreased functional connectivity with the right primary visual area was found in the conjunction area of the left inferior parietal lobe and the angular lobe ( ipl / ang , ba 40 ) , the bilateral conjunction area of the postcentral gyrus and the precentral gyrus ( postcg / precg , ba 3/4 ) , the precuneus ( ba 31 ) , the conjunction area of the posterior cingulate cortex and the middle cingulate cortex ( ba 31 ) , the conjunction area of the left posterior cingulate cortex and the precuneus ( pcc / precun.l ) , the lingual gyrus / vermis_6 , the middle occipital cortex ( mog , ba 19 ) , and the hippocampus / parahippocampus ( hip / phip ) ( figure 2 , table s5 ) . \n we also found overlapping brain areas with altered functional connectivity with the primary visual area in anisometropic and mixed amblyopic individuals ( 70 voxels ) . \n the overlapping brain regions that showed altered functional connectivity with the left primary visual area were located in the cerebellum ( cerebellum tonsil , vermis 9/vermis 7 , and cerebellum crus 1/6 ) and the conjunction area of the bilateral inferior parietal lobe and the angular lobe ( ipl / ang ) ( table 2 ) . \n the overlapping brain region showing altered functional connectivity with the right primary visual area was restricted to the adjacent region of the lingual and vermis_6 and the left ipl / ang ( figure 3 , table 2 ) . compared to the patients with anisometropic amblyopia , patients with mixed amblyopia showed increased functional connectivity between the medial / inferior temporal gyri and the left primary visual area and decreased functional connectivity between cerebellar crus 1/6/8 and the right primary visual area ( figure 4 , table 3 ) . \n in the present study , we investigated the functional connectivity between the primary visual cortex and other brain areas in amblyopic individuals using a resting - state functional connectivity technique . from our results \n , we mainly find significant decreases in functional connectivity with the primary visual area in the inferior parietal lobule and the posterior cerebellum in both anisometropic amblyopia and mixed amblyopia . \n the dorsal stream , sometimes called the where pathway or the how pathway \n , originates from the v1 area , passes through the v2 and mt ( also known as v5 ) areas , and arrives at the inferior parietal lobule . \n this pathway primarily participates in the detection of motion , the representation of object locations , and the control of the eyes and arms , especially when visual information is used to guide saccades or reaching behaviors [ 31 , 32 ] . \n recent neurophysiological studies have demonstrated abnormalities in visuomotor processing in subjects with amblyopia [ 3336 ] . \n the decreased connectivity between the primary visual area and the inferior parietal lobule , which plays a special role in the stereo pathway , may also explain the deficit in stereoscopic depth perception observed in subjects with amblyopia . \n hence , the decreased functional connectivity between the primary visual area and the inferior parietal lobule in amblyopic individuals may reflect functional deficits in the dorsal stream . in one of our previous studies , yan et al . \n found that the dorsal visual pathway was abnormal or impaired in patients with comitant exotropia . \n the present study provides further evidence for deficits in the dorsal stream in subjects with amblyopia . \n we also found a decrease in the functional connectivity between the primary visual area and the cerebellum ( cerebellum tonsil , vermis 9 , cerebellum crus 2/vermis 7 , and cerebellum crus 1/6 ) . \n the cerebellum , which functionally interacts with the frontal eye fields [ 3841 ] , is also involved in the control of eye movements [ 4246 ] . \n thus , we conclude that the observed decrease in functional connectivity between the primary visual area and the cerebellum might explain the visuomotor processing deficits in amblyopia . in some strabismic subjects , \n we have found altered functional connectivity between the mtg and the left primary visual cortex and between the cerebellum crus and the right primary cortex in mixed amblyopic subjects compared to anisometropic amblyopic subjects . \n this might occur because the amblyopic subjects with strabismus would have severely affected gaze judgment and information interaction between the sensory motor and visual areas ( table 3 ) . \n we found increased functional connectivity between the right primary visual area and the left postcg in cases of anisometropic amblyopia . \n this corresponds to our previous finding of increased spontaneous activity in the postcg and precg , which may reflect the compensatory plasticity that compensates for amblyopia - related deficits . \n nevertheless , it should be noted that we found decreased functional connectivity between the right primary visual area and the conjunction area of the postcg / precg , the thalamus and the hippocampus / parahippocampus in mixed amblyopia ( figure 2 ) . \n we know that inputs from the retina are sent to the lateral geniculate nucleus of the thalamus , which in turn projects to the primary visual cortex ( area v1 ) in the occipital lobe . \n previous studies have also observed functional deficits and morphological changes in the lateral geniculate nucleus in anisometropic amblyopic subjects [ 1315 ] and in some animal studies [ 48 , 49 ] . \n the alteration of the functional connectivity between the thalamus and the primary visual cortex might suggest that the lateral geniculate nucleus plays a fundamental part in the processing deficit that has been attributed to the visual cortex in amblyopic subjects . to the best of our knowledge , \n we did not find a possible reason for the altered functional connectivity between the sensory motor regions and the primary visual cortex ; therefore , task - related fmri studies are needed in the future . in the initial experimental design of the present study , we only wanted to determine the alteration of spontaneous activity and the functional connectivity pattern in the amblyopic individuals in the resting state . \n in fact , stereopsis - related changes may provide deeper insight into the neural substrate of the impaired binocular perception in the patient groups . \n meanwhile , we did not find a statistically significant correlation between altered functional connectivity and disease severity ( visual acuity of bilateral eyes ) in the patient groups . \n furthermore , our results should be interpreted carefully because we did not consider the side of the eye impairments due to the small sample size . in the future , a larger sample neurophysiological and neuroimaging study is required to distinguish the differences among the affected brain regions in the different types of amblyopia .", "role": "user" }, { "content": "amblyopia , which usually occurs during early childhood and results in poor or blurred vision , is a disorder of the visual system that is characterized by a deficiency in an otherwise physically normal eye or by a deficiency that is out of proportion with the structural or functional abnormalities of the eye . \n our previous study demonstrated alterations in the spontaneous activity patterns of some brain regions in individuals with anisometropic amblyopia compared to subjects with normal vision . to date , it remains unknown whether patients with amblyopia show characteristic alterations in the functional connectivity patterns in the visual areas of the brain , particularly the primary visual area . in the present study , we investigated the differences in the functional connectivity of the primary visual area between individuals with amblyopia and normal - sighted subjects using resting functional magnetic resonance imaging . \n our findings demonstrated that the cerebellum and the inferior parietal lobule showed altered functional connectivity with the primary visual area in individuals with amblyopia , and this finding provides further evidence for the disruption of the dorsal visual pathway in amblyopic subjects .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: intracavitary brachytherapy ( icbt ) , in conjunction with external beam radiation ( ebrt ) and chemotherapy , is the standard of care in the curative management of locally advanced cervical cancer . while cure rates for early cervical cancer with combinations of ebrt and icbt are excellent , the unpredictable nature of serious morbidity of the bladder and rectum remains a serious problem . \n a successful treatment includes not only an improvement on tumor control , but also a reduction in treatment - related complications . \n it has been documented in the medical literature that there is a linear correlation between complications and total dose to the bladder and rectum [ 2 , 3 ] . \n clinically significant consequences of irradiation of the urinary bladder in icbt for cervical cancer have been well recognized . \n shape and volume of bladder during icbt may affect dosimetric patterns of bladder , rectum and sigmoid colon . \n evacuation of bladder by foley 's catheter is a common practice in icbt , but even so , residual volume of urine is still seen on three dimensional ( 3d ) imaging . \n non - contiguous high dose areas especially in lateral horns of bladders are a major factor of dose heterogeneity of bladder . \n it may be assumed that bladder tone may affect bladder shape by influencing dose distribution . \n parity which influences bladder tone may be confounding factor for bladder volume - dose linear relationship . in 1981 , \n pilepich et al . found that by maintaining a good residual bladder volume radiation exposure to a large part of the bladder was reduced significantly . \n bladder distension also affects dose distribution of rectum and sigmoid colon as distended bladder shifts the rectum and sigmoid colon . \n cengiz et al . did not found any significant differences in the dose distributions between an empty or full bladder . but \n bladder fullness significantly affected the dose to the small intestine , rectum , and sigmoid colon . \n this study aims to evaluate the effects of bladder distension on dosimetry , assessed by 3d image based planning techniques , in bladder , rectum , sigmoid colon and small intestine in cervical cancer patients during brachytherapy , and also to search for any other factor influencing the scenario . in this study \n we have analyzed the potential effects on dosimetry while the clinical correlation will be discussed at a later time . \n the study included forty seven patients of cervical cancer treated in our institute between 2009 and 2011 . all patients with pathologically proved cervical cancer ( stage ib to iva ) who had given a written consent \n age below 18 years or more than 70 years , patients having pregnancy , or prior exposure to radiation therapy due to any other reason were excluded from the study . \n all patients were treated with ebrt ( theratron 780c , theratronics international , kanata , ontario , canada ) to the whole pelvis ( 50 gy in 25 fractions using four field box technique ) . \n intracavitary brachytherapy was done under sedation using ct compatible applicators ( manchester type or fletcher - suit type ) . soon after first intracavitary insertion patients were sent for planning ct scan ( brilliancect-16 slice with accusim virtual simulation , philips health care solutions , da best , the netherlands ) . \n ct scans were obtained from the level of the obturator foramen to at least 1 cm beyond the tandem tip in the cephalad direction with 3 mm slice thickness . in thirty six patients , just before ct scan , we instilled different fixed volumes of normal saline in urinary bladder by foley 's catheter , followed by clamping of the catheter while the rest were scanned with empty bladder with continuous drainage by foley 's catheter . patients were stratified into 4 different groups : group a empty bladder group ( defined as no extra saline or contrast material given after foley 's catheter insertion , gentle evacuation of bladder done by foley 's catheter ) ; group b ( up to 40 cc instillation ) ; group c ( 4180 cc instillation ) ; group d ( 81 cc and above instillation ) . \n the ct data was transferred to the treatment - planning system ( brachyvision tps , eclipse , varian medical systems , palo alto ca , usa ) computer . \n contrast material was mixed with saline to define the bladder wall ; barium was instilled into the sigmoid and rectum . \n the external contour of the bladder , rectum , sigmoid colon , and small bowel in the pelvis were delineated on each ct slice . in this study , \n the rectum was delineated from the anal verge to the recto - sigmoid junction , and the sigmoid colon was defined as the large bowel above the rectum to the level of the lumbosacral interspace . \n the bowel excluding the sigmoid colon and rectum in the pelvis was defined as small bowel . \n the reason for contouring the whole organ is a possibility of thinning of walls due to bladder distension leading to changes in dvh parameters of small volume doses if only wall is taken for contouring . \n the prescribed dose was either 7 gy 3 fractions or 9 gy 2 fractions of hdr at point a. point a was defined as 2 cm superior of the upper surface in the middle of the ovoid and 2 cm lateral to the uterine tandem ( same coronal plane ) on reconstructed ct image . \n 3d manual optimization of the hdr plans were done , if required , to achieve acceptable doses to point a , bladder , rectum and sigmoid colon . \n patient were then treated by the gammamedplus hdr afterloader unit ( varian medical systems , palo alto , ca , usa ) using iridium-192 ( figs . 1 , 2 ) . \n different doses and dose volume data were assessed for the bladder , rectum and sigmoid colon from the cumulative dose volume histograms ( dvh ) . these include doses to 0.1 cc , 1 cc and 2 cc volumes of each of the structures , as well as the maximum and mean doses ( fig . \n 3 ) . statistical analysis was done using the spss software ( version 19.0 ) . \n dose volume data from different groups were compared using independent t sample test , multivariate regression model ( anova , post hoc test ) . \n adjustment for potential confounders ( including parity , tumor stages , and type of applicator used ) was performed in multiple linear regression models . \n image of axial section of computer tomography showing isodose curves during intracavitary brachytherapy of cervical cancer patient image of coronal section of computer tomography showing isodose curves during intracavitary brachytherapy of cervical cancer patient image of dose volume histogram showing dose distribution pattern over cervix , bladder , rectum , sigmoid colon during intracavitary brachytherapy of cervical cancer \n among all forty seven patients , maximum population was in group c ( n = 18 , 38% ) and minimum patient population was observed in group d ( n = 6 , 12% ) . most common stage was stage iib ( n = 21 , 44% ) followed by stage iiib ( n = 10 , 21% ) . \n majority of patients were treated with manchester type of applicator ( n = 28 , 59.6% ) ( table 1 ) . \n median value of point a dose in all groups was 6.99 gy ; mean value of point a dose was 7.028 0.67 gy ( table 2 ) . \n detailed dose patterns of bladder doses ( maximum dose , mean dose , 0.1 ml dose , 1 ml dose , 2 ml dose ) are described in table 3 . \n on post hoc test analysis and multivariate analysis during multiple comparisons among each groups we found that mean dose of bladder was significantly decreased in group d in comparison to group a ( p = 0.001 ) and also with group b ( p = 0.038 ) ( table 4 ) . \n mean values of mean doses of bladder were 3.2 gy in group a , 2.9 gy in group b , 2.8 gy in group c and 2.2 gy in group d. these findings were also validated by kruskal wallis test ( monte carlo significance was 0.02 ) and mann whitney u test . \n description of different dose distribution parameters of rectum and sigmoid colon are given in table 5 and table 6 . \n descripted statistics group a : empty bladder ; group b : up to 40 cc ; group c : 41 - 80 cc ; group d : > 81 cc point a dose in different study groups comparative dose distrbution pattern in bladder in different groups 0.1 cc dose : minimum dose to the maximally exposed 0.1 cc volume extrapolated from statistically significant bladder mean dose distribution on multiple comparison ( post hoc test ) p value < 0.05 is statistically significant comparative dose distribution pattern in rectum among different groups 0.1 cc dose : minimum dose to the maximally exposed 0.1 cc volume extrapolated from dose volume histogram comparative dose distribution pattern in sigmoid colon among different groups 0.1 cc dose : minimum dose to the maximally exposed 0.1 cc volume extrapolated from dose volume histogram in the same way we compared the different dose distribution patterns ( maximum dose , mean dose , 0.1 cc , 1 cc and 2 cc volume dose ) of rectum and sigmoid colon by using multivariate analysis , post hoc test and kruskal wallis test . \n there were statistically insignificant minute changes in dose distribution in rectum and sigmoid colon ( tables 5 and 6 ) . \n mann whitney u test was used to compare different groups , but no statistically significant difference was found . on analysing results of independent t sample test results of the dosimetric data of small intestine we found that dose values ( maximum dose , 1 cc , 2 cc doses ) are significantly decreased only in group d in comparison to group a. however , no statistical difference exists while comparing other groups ( table 7 ) . \n comparative dose distribution pattern in small intestine between group a and d ( independent t sample test ) 0.1 cc dose : minimum dose to the maximally exposed 0.1 cc volume extrapolated from dose volume histogram p value < 0.05 significant on analysing covariables such as parity , stage , applicator type ( multivariate analysis ) \n it has been found that maximum dose , 0.1 cc and 1 cc volume doses increased with parity ( p = 0.0025 ) and they were significantly correlated ( pearson correlation coefficient = 455.25 ) ( table 8) . but no significant change was seen 2 cc bladder , rectum and sigmoid colon dose parameters . \n dose pattern changes were not influenced either by stage of the disease or applicator type . \n it was also evident from data analysis that in the empty bladder group ( group a ) there was a significant amount of urine collection was noticed even after evacuation . \n mean bladder volume ( contoured ) from the ct images was 129.25 19.1 cc . \n relation of parity and bladder dose ( anova test result corrected model using parity as co variable ) p value < 0.05 is statistically significant minimum dose to maximally exposed 0.1 cc volume of bladder \n this study investigated the bladder distension effect on dosimetry in 47 patients with cervical cancer receiving icbt . \n we found that bladder mean dose significantly decreases from empty bladder group to distended bladder group ( 3.2 gy in group a , 2.9 gy in group b , 2.8 gy in group c and 2.2 gy in group d ) . \n this concept was especially beneficial for low - dose - rate ( ldr ) brachytherapy where the treatment time was longer . \n alteration of bladder filling status and shape and position of bladder alters the relative anatomy of uterus , sigmoid colon intestinal loop and also rectum . \n it had been assumed that the distended bladder might shift the sigmoid colon and intestinal loop from the uterus , thereby having a sparing effect on sigmoid colon , intestinal loop and may be on rectum . in 1981 , pilepich et al . \n they found that by maintaining a residual vesical volume of 200 - 300 cc with contrast material , the radiation exposure to a large part of the bladder was reduced significantly , while only a minor displacement of the implant system was noted . \n analyzed dvh data of 20 cervical cancer patients with empty and full bladder volumes and found that there is a statistically significant association between bladder filling status and median bladder wall absorbed dose . \n bladder distension can approximately reduce the median bladder wall absorbed dose by 48% , and they concluded that this procedure may reduce the incidence of acute reactions and long - term complications . \n have studied over 29 women regarding determination of the impact of the filling status of the organs at risk ( bladder and rectum ) on the uterus mobility and on their integral dose distribution in radiotherapy of gynecological cancer . \n they have found that full bladder is an important factor for sparing dose burden for this organ , particularly if more than one third of the bladder is taken into consideration . \n kim et al . have shown that an increase in bladder volume resulted in a significant reduction in 2 cc bowel volume doses at the expense of an increase in 2 cc bladder volume doses . \n however , this study did not provide any information regarding clinical correlation of these changes . \n have studied ten patients with empty and full bladder and found no significant difference regarding the dose distribution and target volumes between an empty or full bladder . but bladder fullness significantly affected the dose to the small intestine , rectum , and sigmoid colon . \n our study was intended to reevaluate these findings . in our study , there were four groups . \n in group a ( empty bladder group ) we tried gentle evacuation of bladder by foley 's catheter . \n but still there was a significant residual urine volumes ( mean contoured volume was 129 19 cc ) . \n in group d average instillation was 100 cc ( 80 - 120 cc ) unlike previous studies . \n this volume was comfortably tolerated by patients . unlike other studies we treated all the patients with same bladder filling status as done during imaging . \n no magnetic resonance imaging ( mri ) was done . during contouring we took whole organ for contouring , \n calculation and comparison mean values of maximum , mean doses of bladder , rectum and sigmoid colon were taken as like previous studies . \n we also included small volume dose values ( 0.1 cc , 1 cc , 2 cc ) following gec - estro recommendations [ 5 , 9 ] , as these volumes are key parameters to evaluate late toxicities . \n main emphasis was given during analysis on how these small dose volume parameters were affected . during intergroup analysis we found all the dose volumes were changing in different groups , but all the changes were not statistically significant . \n there was no significant change in the mean value of maximum dose to bladder unlike previous studies . \n only the mean value of bladder mean dose significantly decreases with increasing bladder ( p = 0.001 ) distension . \n there were no significant changes in 0.1 cc , 1 cc , 2 cc volume dose values of bladder . \n unlike previous studies changes of dose volume parameters of rectum and sigmoid colon were not significant . \n but in case of small intestine , the analyzed dose parameters ( maximum dose , 0.1 ml dose , 1 ml dose and 2 cc dose ) are significantly decreased on bladder distension . in a similar prospective study , kim et al . \n found an increase in bladder volume resulted in a significant reduction in bowel 2 cc dose values at the expense of an increase in bladder 2 cc and mean dose values . \n they conclude that the treatment with a distended bladder is preferable to protect the bowel . \n our study results partially corroborate with these findings . on analyzing the confounding factors it was evident that weak positive correlation exists between parity and mean values of bladder maximum dose ( average p = 0.0025 ) . \n we assumed that high parity might have influenced bladder tone and increase the high dose areas of lateral horns , which was evident on comparing the planning ct images . analyzing all these changes , though there was decrease in bladder mean dose in distended bladder group , the result was not encouraging , as there was no change of 1 cc and 2 cc bladder volume doses . \n but interestingly , our results revealed decrease in all small intestine volume dose parameters in this group . \n the group a population had significant residual volume of urine after evacuation which may be a confounding factor , though not statistically significant ( p = 0.46 ) . \n clinical outcomes were not evaluated in this study , the dosimetry alteration shown by the treatment planning system may not completely reflect clinical bladder complications . \n there is no significant change in dosimetric parameters of bladder , rectum and sigmoid colon with bladder distention except small intestine , where the values ( maximum doses , 0.1 cc , 1 cc and 2 cc doses ) are decreased on bladder distension . \n but the small volume dose parameters ( 0.1 cc , 1 cc and 2 cc ) of bladder , rectum and sigmoid colon , which are actually important for late toxicities in icbt patients , were unchanged . clinical significance of these changes are unknown . a larger study with clinical correlation of late toxicities", "role": "user" }, { "content": "purposedistension and shape of urinary bladder may vary during intracavitary brachytherapy ( icbt ) for cervical cancer , significantly affecting doses to bladder , rectum , sigmoid colon and small intestine and consequently late radiation toxicities . \n this study is to evaluate the effects of different fixed volume bladder distention on dosimetry , assessed by three dimensional image based planning , in different organs at risk during the treatment of cervical cancer with icbt.material and methodsforty seven cervical cancer patients ( stage ib to iva ) were qualified for icbt following external beam radiotherapy . \n urinary bladder was distended with different volumes of normal saline instilled by a foley 's catheter . planning ct scans were performed after insertion of applicators and three dimensional treatment planning was done on brachyvision treatment planning system ( varian medical systems , palo alto , ca ) . \n dose volume histograms were analyzed . \n bladder , rectum , sigmoid colon and small intestine doses were collected for individual plans and compared , based on the amount of bladder filling.resultsmean dose to the bladder significantly decreased with increased bladder filling . \n however , doses to the small volumes ( 0.1 cc , 1 cc , 2 cc ) which are relevant for brachytherapy , did not change significantly with bladder filling for bladder , rectum or sigmoid colon . nevertheless , all dose values of small intestine are decreased significantly with bladder filling.conclusionsbladder distension has no significant effect on doses received during brachytherapy by relevant volumes of bladder , rectum and sigmoid colon except intestine where values are decreased with bladder distension . \n a larger study with clinical correlation of late toxicities is essential for proper evaluation of this strategy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in fact , relevant and required information should be correctly identified , and then the process begins . \n rapid increase in information and specialization of sciences has made the accessibility to appropriate information difficult . \n it is essential to identify the information needs of each individual or society correctly and to plan for fulfilling them in a society where everything is based on the information and everyone searches for fast and easy access to information . besides , one of the priorities of information system designers is to identify the method of searching and applying information ( information - seeking behavior ) of users . \n information seeking is a process by which a person purposefully tries to change the status of the knowledge . \n as we know , people use information to solve problems , to do work , or to increase knowledge . therefore , identifying their seeking behavior as a part of social behavior helps us to design better information systems . \n patients are among the groups of people who need to have information about their disease because this way , they would be able to control their diseases , reduce the risks of their illness , recognize the side effects of medicines , find appropriate medical centers , and be informed about their treatment . despite the strong need of patients to learn about their disease and the importance of their information - seeking behavior , \n these few ones are about the information - seeking behavior in medical team such as physicians and nurses . \n ghasemi found that doctors use medical journals in the first place , followed by books and monographs for keeping up with new advances in medicine in masjed soleyman . \n also , 77.1% of the respondents said that their main impersonal problem for keeping up with the new developments in medicine had been lack of network and databases ; 74.2% mentioned lack of time as the personal problem . \n forty - five percent of the respondents had used internet to get up - to - date information . \n the results of the paper written by davarpanah and azami showed that consulting with colleagues and doctors and studying patients documents have been the most important information sources for nurses . \n the most important obstacles among nurses have been shortage of time , having no access , lack of information - seeking skills , and not being familiar with information resources . \n leydon found in his research while all patients wanted basic information on diagnosis and treatment , not all of them wanted further information at different stages of their illness . \n cancer patients attitudes to cancer and their strategies for coping with their illness can constrain their wish for information and their efforts to obtain it . the results of a study by talosig - garciaa and \n davis showed that the top sources for cancer information were books , brochures , and pamphlets and doctors or other health professionals ; only 17% of the study respondents had ever used the internet . \n the patients tended to want more information , particularly related to prognosis . educational attainment , age , treatment status , gender , and ethnicity were all significant predictors of scores in various domains . \n milewski and chen found in their research that the most important barriers for patients to search information are lack of motivation , passiveness , inconsistency of information , generality of information , and loss of information . \n gleser et al . showed that majority of the patients receiving information identified doctors as the primary source . \n the patients prioritized needs for information were all the aspects of their diagnosis and treatment and the side effects of radiotherapy . \n overall , the results indicate that most patients required information about their treatment and also experienced a variety of symptoms . the majority of patients obtained information from their physician , and they believed that their physician was a very or \n concluded that participants with low health literacy were less likely to be engaged with health information - seeking behavior . \n participants with intermediate health literacy were more likely to source arthritis - focused health information from newspapers , television , and within their informal social network . \n those with high health literacy sourced information from the internet and specialist health sources , and were providers of information within their informal social network . \n mufunda et al . studied diabetic patients and showed the majority of the respondents scored average knowledge on all three sub - scales : general knowledge , insulin use , and total knowledge . \n low diabetes knowledge was associated with female gender and could be a risk factor for development of diabetes - related complications . \n the results of the study by naidoo indicated that patients current needs influenced their need to seek out information . \n the study concluded that the patients relied heavily on the information provided by the doctor , the dietician , and the hand - outs and pamphlets that were available at the clinic . \n healthcare - seeking behavior in patients with diabetes mellitus has been investigated by hjelm and atwine . \n they found that healthcare was mainly sought among doctors and nurses in the professional sector . \n hicks showed in a study that the doctor was the only source of information for 27% of participants . also , 44.4% of the respondents reported obtaining information from the media and a total of 72.9% of the respondents cited family and friends as a source of information . \n 's study indicate that the most important information needs for the majority of the respondents are symptoms of disease , etiology and course of disease , specific diagnosis information , treatment plan , treatment description , and advice on symptom management . \n yan described in his study that to seek information , professional health sites were the majority sites visited . \n health topics searched ranged from women's / men 's health to chronic diseases such as heart diseases , cancer , and diabetes . over 60% \n considered online health information useful ; however , about 44% were uncertain about the reliability of this information . \n as it can be seen , studies from iran are about information - seeking behavior in the medical team and none of them have dealt with patients seeking health information . \n therefore , the aim of this study was to identify the information - seeking behavior of cardiovascular patients hospitalized in isfahan university of medical sciences hospitals . \n the study population consisted of all cardiovascular patients hospitalized in isfahan university of medical sciences hospitals ( shahid chamran , alzahra , feiz , and noor - ali asghar ) during the winter of 2013 . according to statistics obtained from the hospitals , the number of patients was approximately 6000 . \n the sample size was determined based on the formula of cochran and 400 patients were randomly selected . \n the second part consisted of 43 five - choice questions which had been planned in likert scale . \n four dimensions of information - seeking behavior were measured this way : attitude on health information - seeking behavior ( questions 16 ) , information needs ( questions 7 - 20 ) , information sources ( questions 21 - 35 ) , and barriers to access health information ( questions 1 - 6 ) . \n validity of the questionnaire was confirmed by medical information specialists and reliability of the questionnaire was obtained as 0.723 using cronbach 's alpha test . \n researcher went to the hospitals to visit the patients directly for data gathering , so that the questions could be clarified for illiterate patients or patients of lower education level . \n data were analyzed by descriptive statistics and inferential statistics . in descriptive statistics , frequency distribution , mean , and standard deviation were used , and in inferential statistics , one - sample t - test , independent t - test statistics , analysis of variance ( anova ) , and pearson and spearman correlation tests were used . \n the demographic data showed that 41.5% of the respondents were females and 58.5% were males . \n considering the age of respondents , 6% were below 30 years old , 19.8% were 31 - 40 years old , 36% were 41 - 50 years old , 31% were 51 - 60 years old , and 7.3% were above 60 years of age . regarding the level of education , \n 47% had not finished high school , 29.8% had high school diploma , 10.3% had associate degree , 11.3% had bachelor 's degree , and 1.3% had master 's degree and higher . in terms of job , 24.8% of patients were workers , 5.3% were employees , 21% had nongovernmental jobs , \n 18.5% were retired , 1.3% was students , 7.5% had no job , and 21% had other jobs . in terms of place of residence , 61.4% lived in esfahan city and 28.9% in the subsidiary cities of esfahan and 9.6% in villages . to study the patients attitude about their disease \n this means that a positive attitude exists toward the usefulness of this type of information . \n they found information about their disease not only useful , but also as a tool for disease control , and knew the best ways of treating . \n the results of one - sample t test for patients attitude toward health information as patients have their own specific information needs like other groups , one - sample t - test was used to determine their most important information needs . \n table 2 shows the results of this test . as it can be seen , being aware of the chances of recovery , finding the right medical centers , and awareness of the appropriate methods of treatment are the most significant needs of patients . \n the results of one - sample t test for patients information needs to determine the amount of various information sources to get health information by patients and to identify which of these sources of information had been used more , the one - sample t - test was used . as it is obvious in table 3 , usage of different information sources is either average or more than average , except the internet , librarian , telephone counseling service , healthcare organizations , and medical books . \n the results showed that physicians , television , and radio were the most important sources of health information but . \n the results of one - sample t test for patients usage of information sources one - sample t - test was used to investigate and evaluate the problems and barriers that patients faced in obtaining information about their disease . \n , the mean score is average or above average . results also show that lack of familiarity with medical terminology and the lack of staff 's accountability were the most important problems in obtaining information related to their disease . \n the results of one - sample t test for patients barriers to access health information as gender was measured in nominal scale ( two values ) and information - seeking behavior in interval scale , independent - samples t - test was used to determine the relationship between these two items . the obtained significance level ( p > 0.001 ) \n shows that there was no significant difference in the information - seeking behavior between women and men in any of the four dimensions . to determine the relationship between age and the patients information - seeking behavior , pearson correlation coefficient was used because both the variables were quantitative . \n except the barriers to access information , there was an indirect relationship between age and information - seeking behavior of patients in other dimensions , considering the level of significance ( p < 0.001 ) . \n as education was measured in ordinal scale and information - seeking behavior in interval scale , spearman correlation was used to determine the relationship between these two items . \n there was a direct significant positive correlation between level of education and information - seeking behavior of patients according to the calculated level of significance ( p < 0.001 ) in all four dimensions . \n as occupation was measured in nominal scale ( multiple values ) and information - seeking behavior in quantitative scale , to determine the relationship between them , anova was used . \n there was a significant difference between the information - seeking behaviors of different occupations in all dimensions except for the dimension of barriers to access health information . \n the test results indicate that there were differences between the groups of employees and workers , employees and self - employed , retired and employees , and the employees and other jobs . as place of residence \n was measured in nominal scale ( multiple values ) and information - seeking behavior in quantitative scale , to determine the relationship between them , anova was used . according to the obtained significance level \n , there was a significant difference between information - seeking behavior and different places of residence in the dimension of attitudes toward health information and in the dimension of information needs . \n but no significant difference was seen in the other two dimensions ( information sources usage and barriers to access information ) . \n to study the patients attitude about their disease , one - sample t - test was used . \n this means that a positive attitude exists toward the usefulness of this type of information . \n they found information about their disease not only useful , but also as a tool for disease control , and knew the best ways of treating . \n as patients have their own specific information needs like other groups , one - sample t - test was used to determine their most important information needs . \n as it can be seen , being aware of the chances of recovery , finding the right medical centers , and awareness of the appropriate methods of treatment are the most significant needs of patients . \n to determine the amount of various information sources to get health information by patients and to identify which of these sources of information had been used more , the one - sample t - test was used . as it is obvious in table 3 , \n usage of different information sources is either average or more than average , except the internet , librarian , telephone counseling service , healthcare organizations , and medical books . \n the results showed that physicians , television , and radio were the most important sources of health information but . \n one - sample t - test was used to investigate and evaluate the problems and barriers that patients faced in obtaining information about their disease . \n , the mean score is average or above average . results also show that lack of familiarity with medical terminology and the lack of staff 's accountability were the most important problems in obtaining information related to their disease . \n as gender was measured in nominal scale ( two values ) and information - seeking behavior in interval scale , independent - samples t - test was used to determine the relationship between these two items . the obtained significance level ( p > 0.001 ) \n shows that there was no significant difference in the information - seeking behavior between women and men in any of the four dimensions . to determine the relationship between age and the patients information - seeking behavior , pearson correlation coefficient was used because both the variables were quantitative . \n except the barriers to access information , there was an indirect relationship between age and information - seeking behavior of patients in other dimensions , considering the level of significance ( p < 0.001 ) . \n as education was measured in ordinal scale and information - seeking behavior in interval scale , spearman correlation was used to determine the relationship between these two items . \n there was a direct significant positive correlation between level of education and information - seeking behavior of patients according to the calculated level of significance ( p < 0.001 ) in all four dimensions . as occupation was measured in nominal scale ( multiple values ) and information - seeking behavior in quantitative scale , to determine the relationship between them , anova was used . \n there was a significant difference between the information - seeking behaviors of different occupations in all dimensions except for the dimension of barriers to access health information . \n the test results indicate that there were differences between the groups of employees and workers , employees and self - employed , retired and employees , and the employees and other jobs . as place of residence \n was measured in nominal scale ( multiple values ) and information - seeking behavior in quantitative scale , to determine the relationship between them , anova was used . according to the obtained significance level \n , there was a significant difference between information - seeking behavior and different places of residence in the dimension of attitudes toward health information and in the dimension of information needs . \n but no significant difference was seen in the other two dimensions ( information sources usage and barriers to access information ) . \n the results showed patients positive attitudes toward using health information as most of them found it useful . \n they believe that having health information can play an important role in controlling the disease and side effects of drugs . \n these findings are in accordance with the findings of mufunda et al . and yan . our findings showed that the awareness of the probability to recover , finding appropriate medical care centers , and knowing the methods of treatment were the most significant information needs of patients . \n , gleser et al . , and yang et al . the range of information sources usage is more than average based on the results of this study . \n also , doctor , television , and radio were the most important sources of health information . \n this result is consistent with the results of davarpanah and azami , lin , naidoo , and hjelm and atwine , and does not agree with the results of the studies of ghasemi , afshar et al . \n , talosig - garcia and davis , and yan . it seems that the main reason for this inconsistency is the different characteristics of the statistical population and the research place and facilities . \n lack of familiarity with medical terminology and inadequate information by healthcare staff , particularly physicians , had been the most important problems in obtaining information by the patients . \n this can be due to the characteristics of the research population and their information needs and environmental facilities . \n however , there was a significant relationship between some of the demographic characteristics ( e.g. age , education , and place of residence ) and patients information - seeking behavior . \n the research findings show that although some patients may prefer to be unaware of their disease , the patients who had been studied in this research believed that knowing the details of the disease could help them to control it and prevent aggravation . in total \n , they had a positive attitude toward health information and found it useful to know the details of their condition . \n the information they needed the most was about the chance of healing and finding appropriate treatment centers . \n this information may be received by different ways such as through health staff , media channels , and informal channels . \n the results , despite the mentioned obstacles , showed that doctors and television were the most important sources of information for the patients to get health information . \n since most of our patients were elderly and had a low educational level , these results could be predictable . \n there was no significant difference between the information - seeking behavior of men and women , while it was different based on some of the characteristics such as age , education , and place of living . \n younger patients who normally have higher education levels had different information - seeking behavior in terms of information needs , information sources used , and also the mentioned obstacles . \n these differences were observed in the patients living in the center of the province with better educational and healthcare facilities than in the patients living in towns and villages . \n considering the findings of this research , it is suggested that medical staff inform the patients according to their level of education and some effective factors mentioned above . \n also , since media such as television play a considerable role in providing health information to the public , they can be helpful in distributing health information .", "role": "user" }, { "content": "background : patients , as one of the most prominent groups requiring health - based information , encounter numerous problems in order to obtain these pieces of information and apply them . \n the aim of this study was to determine the information - seeking behavior of cardiovascular patients who were hospitalized in isfahan university of medical sciences hospitals.materials and methods : this is a survey research . \n the population consisted of all patients with cardiovascular disease who were hospitalized in the hospitals of isfahan university of medical sciences during 2012 . according to the statistics , the number of patients was 6000 . \n the sample size was determined based on the formula of cochran ; 400 patients were randomly selected . \n data were collected by researcher - made questionnaire . \n two - level descriptive statistics and inferential statistics were used for analysis.results:the data showed that the awareness of the probability to recover and finding appropriate medical care centers were the most significant informational needs . \n the practitioners , television , and radio were used more than the other informational resources . \n lack of familiarity to medical terminologies and unaccountability of medical staff were the major obstacles faced by the patients to obtain information . \n the results also showed that there was no significant relationship between the patients gender and information - seeking behavior , whereas there was a significant relationship between the demographic features ( age , education , place of residence ) and information - seeking behavior.conclusion:giving information about health to the patients can help them to control their disease . \n appropriate methods and ways should be used based on patients willingness . despite the variety of information resources \n , patients expressed medical staff as the best source for getting health information . \n information - seeking behavior of the patients was found to be influenced by different demographic and environmental factors .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: we report a case of intracerebral fibroma , an exceedingly rare neoplasm found in the central nervous system . since 1985 , only two cases have been reported . \n a 41-year - old woman with no known history of seizures presented to the emergency department after a witnessed fall from standing . \n the patient had transient loss of consciousness , suffered a seizure and experienced post - ictal amnesia . \n the patient reported a history of falls , occurring approximately once per month over the past 23 years . \n diagnostic computed tomography ( ct ) and magnetic resonance imaging ( mri ) studies of the brain revealed a right - sided temporoparietal 2.5 2.0 cm high - attenuation lesion with associated vasogenic edema and heterogeneous enhancement after gadolinium administration ( fig . \n 1 ) . ct body imaging also indicated a 5-mm pulmonary nodule within the left upper lobe and a pelvic soft tissue irregularity with fluid in the region of the uterus . \n subsequent gynecologic workup revealed this to be a simple cyst ; however , given the body imaging profile , our differential diagnosis included meningioma or metastatic neoplasm . \n there was a pial interface between the lesion and the brain , allowing for gross total resection of the tumor and its capsule . \n the final pathology report reflected intracerebral fibroma , which was reviewed both at our institution and confirmed at johns hopkins reference laboratories . \n there were no whorls , psammoma bodies , meningothelial cells or other stigmata of meningioma . \n immunohistochemistry for ema , s-100 and sma were non - contributory ( figs 3 and 4 ) . \n the patient had an uneventful postoperative hospital course and was subsequently discharged to home on postoperative day 6 . \n she was seen 2 weeks later in clinic , and the neurological examination revealed no deficits . furthermore , she has remained seizure - free since the operation . \n an electronic search of the literature dating back to 1950 , using the keywords intracerebral fibroma , yields only 10 previously reported cases [ 17 ] , with only 2 cases reported since 1985 [ 8 , 9 ] . of the 10 prior cases , all but one were located supratentorially . \n similar to the tumor in our patient , most of these early described tumors reported a hard rubbery intracerebral mass unrelated to the meninges . in only two cases \n did the authors report an attachment to the falx or dura [ 6 , 7 ] . \n previously reported specimens indicate a tumor composed of elongated cells with the features of fibroblasts , embedded in abundant collagen bundles ; however , immunohistochemical staining was not described . \n table 1previously documented cases of intracerebral fibroma [ 19]case numberagesexlocationpathologic specimensizecd expression111 monthsmalesupratentorial , right frontal lobetotal resection5 5 5 cmna29 yearsfemalesupratentorial , left temporoparietal lobeopen biopsy , subtotal resection3 3 3 cmcd34 negative310 yearsfemalesupratentorial , right frontal lobeobserved upon autopsy5 5 5 cmna411 yearsfemalesupratentorial , right lateral ventricletotal resection3 cmna517 yearsmalesupratentorial , right parietal lobetotal resectionnana619 yearsfemalesupratentorial , right temporoparietal lobetotal resectionnana719 yearsmaleinfratentorial , left cerebellar hemispheretotal resection5 4 4 cmna824 yearsfemalesupratentorial , left frontotemporoparietal lobeobserved upon autopsynana942 yearsnasupratentorial , temporoparietal lobetotal resectionnana1052 yearsmalesupratentorial , right parietal lobetotal resection5 2.5 5 cmna previously documented cases of intracerebral fibroma [ 19 ] a closely related intracranial finding is that of solitary fibrous tumor ( sft ) of the meninges . \n the ultrastructural findings of sfts are similar to intracranial fibromas , in that they have spindle - cell proliferation with areas of collagenization . the main difference is found in the immunohistochemical staining and site of dural attachment . \n recent immunohistochemical and ultrastructural studies indicate that these tumors arise from mesenchymal fibroblast - like cells in the meningeal covering , and are classified as mesenchymal , non - meningothelial tumors , which is an important differential consideration . \n the immunohistochemical profile of sfts includes strong reactivity for cd34 and vimentin but not ema or s-100 . \n cd34 is a transmembrane glycoprotein , which is expressed by hematopoietic progenitor cells , endothelium and certain populations of mesenchymal stromal cells in the dermis and , by all accounts , is the most sensitive marker for sfts . \n intracerebral fibromas do not stain for cd34 , which is a clear difference in differentiating intracerebral fibroma and sft . \n currently , mri appears to be the modality of choice for initial detection of these tumors . \n however , there is no clear imaging differentiation between intracerebral fibroma and other fibrous tumors found within the intracranial cavity such as sft , meningioma or schwannoma . \n this increases the importance of adequate histological and immunohistochemical evaluation of these lesions in order to arrive at the appropriate tumor diagnosis . \n ultimately , the diagnosis of intracerebal fibroma was based on the tumor being unassociated with the dura , the histological evaluation of spindle - shaped cells interspersed with a dense collagen matrix and the immunohistochemical profile . \n few cases have been described , and little is known regarding the pathogenesis and diagnosis of these lesions . \n the diagnosis depends greatly on immunohistochemical and histologic correlation , and complete surgical resection remains the goal of treatment . \n further reports are needed to refine the true incidence of intracerebral fibromas and to provide a more clear definition of these lesions . \n ", "role": "user" }, { "content": "intracerebral fibromas are among the most rare neoplasms found in the central nervous system . \n ten previously reported cases have been documented in the literature including only two reported cases since 1985 . as a result , \n little is known about these uncommon intracerebral fibrous tumors . \n we report a case of an intracerebral fibroma without dural or leptomeningeal attachment , discuss the pertinent diagnostic findings and briefly review all prior reports of this entity .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: osteoarthritis ( oa ) affects over 27 million adults in the united states today , and the prevalence is expected to increase to 67 million by 2030 . \n the pathogenesis of osteoarthritis is likely multifactorial involving mechanical , biological , biochemical , and genetic factors [ 14 ] . \n these factors can all contribute to progressive degeneration and loss of articular cartilage . in the earliest stages of cartilage injury and degeneration , proteolytic breakdown of the extracellular matrix , which is comprised primarily of collagen type - ii and glycosaminoglycans , occurs [ 24 ] . \n in addition , there may also be actual or functional loss of articular chondrocytes . \n however , the balance between anabolic and catabolic processes ultimately exceeds the repair capabilities of the chondrocytes resulting in matrix destruction , cartilage loss , and eventually , osteoarthritis [ 3 , 4 ] . \n current clinical modalities employed to evaluate cartilage health in orthopaedic surgery include radiography , mri , and arthroscopy . \n unfortunately , these assessment methods can not reliably diagnose early cartilage injury and degeneration prior to loss of articular cartilage surface integrity , following which the pathological changes may be irreversible . \n experimental evidence shows that chondrocyte metabolic deficits occurring prior to breakdown of the articular surface may be reversible . as such , clinically useful methods to detect subsurface cartilage injury and degeneration are important for development and testing of chondroprotective and chondrorestorative therapies . \n optical coherence tomography ( oct ) is a novel , nondestructive imaging technology capable of near - real - time cross - sectional imaging of articular cartilage at high resolutions comparable to low power histology [ 611 ] . \n the following describes the advent of oct for arthroscopic imaging of articular cartilage and the potential use of oct as a new clinical tool for enhanced clinical diagnosis and staging of early cartilage injury and degeneration . \n minimally invasive arthroscopic imaging of the articular cartilage is considered the clinical standard for detection of early cartilage injury and degeneration . during arthroscopy , \n the cartilage is graded from 0 to 4 using the outerbridge scoring system ( 0 = firm cartilage , 1 = softening , 2 = fissuring of < 50% of cartilage thickness , 3 = fissuring > 50% of cartilage thickness , and 4 = exposed bone ) . \n , arthroscopy falls short of the laboratory assessment standards of histopathology , metabolic study and biomechanical testing . \n experimentally , biopsy and histology can detect matrix degradation and structural breakdown in cartilage that exhibits no gross surface abnormalities when observed by arthroscopy . however , this is not a practical means for routine clinical detection of early arthritis since histology requires removal and destruction of the tissue being examined . \n however only end - stage bone - related changes are reliably detectable by radiographic exam which does not adequately show soft tissues or directly image articular cartilage . \n mri , while being a noninvasive cross - sectional imaging technology , suffers from low resolution and the inability of standard mri to discern matrix changes leading to cartilage softening . \n as such , arthroscopy remains the current clinical standard for diagnosis and staging of early articular cartilage injury and degeneration . \n optical coherence tomography ( oct ) is a novel imaging modality that allows for a nondestructive , cross - sectional optical biopsy of tissue [ 10 , 14 ] . \n the technology has been well described and is currently used clinically by ophthalmology to image the cornea and retina and is used experimentally to image coronary arteries and malignancies [ 6 , 1517 ] . at a very basic level , \n optical coherence tomography can be considered similar to ultrasound except that oct uses infrared light instead of sound waves [ 6 , 10 ] . \n the backscatter of light reflected by the tissue is detected and filtered such that only coherent waves are processed by the oct system producing an ultra high - resolution ( 420 m ) digital image on a computer screen ( figure 1 ) [ 5 , 6 , 10 , 1820 ] . in early oct systems , the measurement of time - of - flight by the optical signal allows for production of a two - dimensional image and detection of spatial relationships between adjacent structures . \n this oct technology is referred to as time - domain oct because the image production and resolution is based on a function of distance traveled over time by the infrared light signal . \n in contrast , spectral - domain oct detect differences in tissue composition based on changes in the frequency of backscattered light allowing for more efficient data acquisition and faster scan speeds producing near - real - time images [ 16 , 21 , 22 ] . \n in addition , polarization - sensitive oct ( ps - oct ) is another oct technology that differs again by containing the ability to detect changes in the polarization state of the backscattered light permitting quantification of tissue birefringence . \n articular cartilage exhibits natural birefringence that is detectable by light microscopy due to the organization of its collagen fibrils . \n herrmann et al . showed that normal cartilage is sensitive to the polarization state of the incident light of oct and that the cartilage birefringence could be evaluated using polarization sensitive oct . early in the progression of osteoarthritis , collagen fibrils of articular cartilage \n drexler et al . examined the relationship between the polarization sensitivity of cartilage as detected by oct and the changes seen in collagen organization as determined by polarized microscopy of human osteochondral explants . \n they determined that collagen disorganization found in arthritic articular cartilage as detected by polarized microscopy is detectable by ps - oct as a loss of normal form birefringence . using a polarized fiberoptic oct system , chu et al . \n evaluated healthy and degenerating cartilage in grossly normal appearing human articular cartilage and showed high intraobserver and interobserver reproducibility in detecting the presence or absence of a discernible banding pattern described as cartilage oct form birefringence . \n bear et al . showed that the degree of oct form birefringence correlated with polarized microscopy . \n furthermore , metabolic study of fresh human cartilage explants with and without oct form birefringence suggest that loss of oct form birefringence may be a marker for early cartilage degeneration . \n explants with no surface abnormality and a lack of form birefringence exhibited insensitivity to the anabolic effects of igf-1 while those retaining form birefringence showed increased proteogy can synthesis in response to igf-1 ( p < .05 ) . \n both chondrocyte insensitivity to growth factors and microstructural loss of collagen organization are seen in the earliest stages of cartilage degeneration and therefore give support to oct as a nondestructive imaging modality for early diagnosis of cartilage pathology [ 5 , 7 ] . \n sought to evaluate the utility and limitations of oct by immediate , high - resolution microstructural analysis of articular repair tissue following allogeneic chondrocyte implantation without excising or sectioning the specimen in a mammalian animal model . \n following chondral defect formation and chondrocyte implantation in the trochlear grove of a rabbit knee , the subsequent repair tissue was analyzed by arthroscopic surface imaging , oct , and histology . \n the authors found that oct enabled the micro - structural evaluation of articular repair tissue and the detection of surface fibrillation , tissue hypertrophy , and cartilage integration similar to low power microscopy without damaging the repair . \n most importantly , oct was able to detect subsurface gaps between the repair tissue and native cartilage that were undetectable by arthroscopic assessment . \n these results demonstrate that oct is capable of providing an optical biopsy of articular repair cartilage without damaging the specimen , and suggest that , if incorporated into an arthroscope , it could potentially be used to evaluate articular cartilage repair in vivo . following these encouraging results , \n using fiber optic technology , described the use of a hand - held oct probe capable of providing an optical biopsy of articular cartilage while fully immersed in saline during arthroscopy ( figure 2 ) . \n the authors then evaluated the ability of the arthroscopic oct probe to nondestructively detect microstructural cartilage changes as compared to histology in human cadaver knees . \n the cartilage of human cadaver knees was graded both arthroscopically using oct and then histologically using a modified mankin structural score following excisional biopsy . using weighted kappa statistics \n , the investigators found good agreement ( = 0.80 ) between oct and histology overall , but found substantial agreement ( = 0.87 ) for specimens assigned a modified mankin score of 03 indicating improved diagnostic aptitude at the earlier stages of cartilage degeneration . \n mri is another nondestructive imaging modality with sequences such as t2 mapping that have been shown to be sensitive to collagen orientation and biomechanical integrity and is postulated to be dependent on collagen orientation and tissue hydration . \n experimentally , oct was found to correlate with mri t2 map and with progressive cartilage degeneration as determined by polarized microscopy . in a level 1 clinical diagnostic study , chu et al . \n compared arthroscopic oct , and high resolution 3 tesla mri t2 mapping against arthroscopy as the clinical standard in 30 human subjects undergoing arthroscopy for degenerative meniscus tears ( figure 3 ) . when compared to arthroscopy \n , quantitative oct was found to strongly correlate with arthroscopic grading ( r = 0.85 , p = .0002 ) while mri t2 map did not . \n this correlation is important as oct improves on conventional arthroscopy by high resolution imaging of subsurface as well as surface abnormalities and by contributing quantifiable data . \n mri is a low resolution cross - sectional imaging modality and was unable to accurately diagnose subtle surface abnormalities found on arthroscopy . \n however , a correlation was found between superficial mri t2 map and quantitative oct likely because both metrics were based on cross sectional imaging data . \n this finding is important in supporting a diagnostic potential of mri t2 map and other quantitative mri technologies that are noninvasive and therefore can be more widely performed than arthroscopy or oct . \n currently , the clinical diagnostic potential of mri t2 map and other mri technologies for cartilage abnormalities is controversial in part due to the previously noted limitations of arthroscopy as a clinical standard . \n oct provides quantifiable high - resolution cross - sectional data to improve on some of the shortcomings of conventional arthroscopy and was able to support the mri t2 map findings . \n oct is therefore shown to be an important translational clinical research tool , to assist in validating noninvasive but lower - resolution cross - sectional mri technologies that may poorly correlate with conventional arthroscopy . \n acute articular cartilage injury following joint injuries such as anterior cruciate ligament tear and intra - articular fracture likely contribute to development of posttraumatic osteoarthritis . \n the joint - injured patient represents a population at high risk for early disabling osteoarthritis who would benefit from diagnosis and treatment of cartilage injury and degeneration prior to the development of irreversible changes [ 3 , 28 ] . \n we and others are currently studying potential chondroprotective agents that may improve cartilage survival after impact injury . in a study evaluating oct and its ability to detect acute cartilage changes following impact injury , bear et al \n . showed significant correlation between histology , chondrocyte death , and oct grading following impact injury even at energies insufficient to fracture the articular surface ( r = 0.48 , p < .001 ) . in a pilot study of acl - injured subjects , \n oct was found to detect microscopic subsurface injuries that were predictive of mri t2 map changes at 6 and 12 months following acl reconstruction ( unpublished data ) . \n these data further show a potential for oct to nondestructively detect microstructural subsurface injuries to articular cartilage that were undetectable by conventional surface examination . \n the potential clinical implications of early diagnosis and staging of acute cartilage injury include supporting a clinical paradigm shift from viewing osteoarthritis as an untreatable degenerative condition to that of a potentially modifiable chronic disease process . towards this end , \n laboratory studies show oct can potentially provide microstructural information on cartilage health that can be used to improve the diagnosis and staging of early cartilage injury and degeneration [ 7 , 24 , 28 ] . \n translational clinical studies support the use of oct arthroscopically for these purposes [ 5 , 8 ] . \n recent technological developments include decreasing the size of the oct probe to where it can be inserted through an 18 gauge needle , potentially making oct evaluation of the cartilage an office procedure . \n recent studies additionally show oct to be a powerful translational research tool in assessing the clinical utility of new mri technologies for noninvasive early detection of cartilage injury and degeneration . \n further study of oct and related new technologies for assessment of articular cartilage will assist in the development of the clinical diagnostic power needed for implementation and evaluation of potential new treatment strategies to delay or prevent the onset of osteoarthritis .", "role": "user" }, { "content": "osteoarthritis ( oa ) is a progressive , debilitating disease that is increasing in prevalence . \n the pathogenesis of oa is likely multifactorial but ultimately leads to progressive breakdown of collagen matrix and loss of chondrocytes . \n current clinical modalities employed to evaluate cartilage health and diagnose osteoarthritis in orthopaedic surgery include , radiography , mri , and arthroscopy . \n while these assessment methods can show cartilage fissuring and loss , they are limited in ability to diagnose cartilage injury and degeneration prior breakdown of the articular surface . \n an improved clinical ability to detect subsurface cartilage pathology is important for development and testing of chondroprotective and chondrorestorative treatments because the pathological changes following surface breakdown are generally considered to be irreversible . \n optical coherence tomography ( oct ) , is a novel , non - destructive imaging technology capable of near - real time cross - sectional images of articular cartilage at high resolutions comparable to low power histology . \n this review discusses a series of bench to bedside studies supporting the potential use of oct for enhanced clinical diagnosis and staging of early cartilage injury and degeneration . \n oct was also found to be useful as a translations research tool to assist in clinical evaluation of novel quantitative mri technologies for non - invasive evaluation of articular cartilage .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: this work was supported by the frontier research laboratory program at the korea basic science institute .", "role": "user" }, { "content": "we present synthesis , structure and magnetic properties of structurally well - ordered single - crystalline -mno2nanorods of 50100 nm diameter and several m length . \n thorough structural characterization shows that the basic -mno2material is covered by a thin surface layer ( 2.5 nm ) of -mn2o3phase with a reduced mn valence that adds its own magnetic signal to the total magnetization of the -mno2nanorods . \n the relatively complicated temperature - dependent magnetism of the nanorods can be explained in terms of a superposition of bulk magnetic properties of spatially segregated -mno2and -mn2o3constituent phases and the soft ferromagnetism of the thin interface layer between these two phases .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: we evaluated 25 fnac specimens from 25 patients with well - documented cases of pl according to serum parathyroid hormone ( pth ) level , immunohistochemical staining , ultrasonography , and pathology results at the korea cancer center hospital from january 2006 to may 2011 . \n cases that presented as a single mass were included , and those that were not confirmed by operation or immunohistochemistry were excluded . \n clinicoradiologic information , such as signs or symptoms , serum pth level , ultrasonography , and operation records , were obtained from patients ' medical records . \n the aspirated material was smeared onto four glass slides that were immediately fixed in 95% alcohol and subjected to papanicolaou staining . \n thyroid transcription factor-1 ( ttf-1 ) , pth , and chromogranin a were selectively used for immunohistochemistry on cell blocks . diagnostic terminology of \" parathyroid lesion \" ( pl ) was used if the cytological findings or immunohistochemistry results indicated a parathyroid origin . \n twenty patients underwent surgery , and five patients did not . in those patients who underwent surgery , all sections of the resection specimens \n the five patients who did not receive surgery , pl was confirmed by immunohistochemical staining of cell blocks . \n all the slides were reviewed with a multi - headed microscope by two separate pathologists . \n the cytological features were categorized as follows : architectural features ( scattered naked nuclei , loose clusters , a papillary pattern with a fibrovascular core , tight clusters , and a follicular pattern ) , nuclear features ( anisokaryosis , stippled chromatin , prominent nucleoli , intranuclear pseudoinclusion , and eccentric nuclei ) and other features ( a well - defined cell border , oxyphilic cytoplasm , colloid - like material , and macrophages ) . \n the patient population included six males and 19 females with an age range of 39 to 71 years ( mean age , 51 years ) ( table 1 ) . \n of the 25 patients , 22 were evaluated for serum pth before the cytological examination . \n the pl was found at the posterior surface of the thyroid gland in nine patients ( 36% ) , inferior to the thyroid gland in seven patients ( 28% ) , in the thyroid parenchyma in six patients ( 24% ) , and in the paratracheal area in three patients ( 12% ) . the clinicoradiologic impression consisted of 11 incidentalomas ( 44% ) , eight phpts ( 32% ) , four pls ( 16% ) , and two metastatic papillary thyroid carcinomas ( ptc ) ( 8% ) . \n eighteen of the 25 cases ( 72% ) were cytologically diagnosed as pl ; the remaining seven patients were diagnosed as follows : two with benign follicular cells ( 8% ) , two with adenomatous goiter ( 8% ) , two with atypical cells ( 8% ) , and one with metastatic carcinoma ( 4% ) . when the clinicoradiologic impression suggested pl , the sensitivity of the cytological diagnosis was 86.7% ( 13/15 ) . in all other cases , \n a minimally invasive parathyroidectomy was performed in 17 of the 20 patients who underwent surgery , and the remaining three patients received thyroid surgery or neck dissection . \n eighteen of the 20 cases who received surgery were diagnosed as parathyroid adenoma , and the remaining two were determined to have parathyroid carcinoma . in the aspirates from the five patients who did not receive surgery , \n pth was expressed in two , and the remaining three aspirates demonstrated positivity for chromogranin a. ttf-1 was negative in all four cases who were examined ( fig . \n the most impressive feature of the parathyroid aspirates was the diversity of the architectural features . \n most of the smears showed scattered naked nuclei ( 25/25 , 100% ) and loose clusters ( 22/25 , 88% ) in varying degrees . \n other architectural features included a papillary pattern with a fibrovascular core ( 17/25 , 68% ) , tight clusters ( 14/25 , 56% ) , and a follicular pattern ( 11/25 , 44% ) ( table 2 , fig . \n each aspirate showed a combination of foregoing architectures in varying degrees . in three aspirates , \n the entire specimen consisted of scattered naked nuclei and closely resembled thyroiditis ( 3/25 , 12% ) . \n almost all nuclei were centrally located , round to oval and similar in size to red blood cells with a regular nuclear membrane . \n a small proportion of parathyroid cells showed mild to moderate anisokaryosis in each aspirate ( 24/25 , 96% ) . \n prominent nucleoli and intranuclear pseudoinclusions were only detected in one aspirate ( 1/25 , 4% ) ( table 2 , fig . \n 3 ) . many parathyroid cells had finely granular cytoplasm , and a small portion of cells revealed a well - defined cell border ( 9/25 , 36% ) and oxyphilic cytoplasm ( 9/25 , 36% ) . \n fragments of hyaline colloid - like material were noted in three aspirates ( 12% ) . \n another two cases ( patients nos . 3 and 4 ) were diagnosed as adenomatous goiter ; these patients underwent minimally invasive parathyroidectomy because pl was diagnosed using an intraoperative frozen biopsy . \n clinical impression and cytological diagnosis were metastatic carcinoma , so neck dissection was performed . the dominant cytological architecture in this case consisted of tight clusters , although other cytological features of pl were present in small proportions . \n a papillary pattern with a fibrovascular core , anisokaryosis and stippled chromatin were also found . \n although pl was diagnosed using intraoperative frozen biopsy , the remaining lobe was removed by lobectomy . in patient no . \n 7 , who had simultaneous ptc , the paratracheal mass was clinically thought to be metastatic ptc . \n the dominant architecture was loose clusters , and other cytological findings were a papillary pattern with scattered naked nuclei , tight clusters , a follicular pattern , anisokaryosis , and stippled chromatin . \n the patient population included six males and 19 females with an age range of 39 to 71 years ( mean age , 51 years ) ( table 1 ) . \n of the 25 patients , 22 were evaluated for serum pth before the cytological examination . \n the pl was found at the posterior surface of the thyroid gland in nine patients ( 36% ) , inferior to the thyroid gland in seven patients ( 28% ) , in the thyroid parenchyma in six patients ( 24% ) , and in the paratracheal area in three patients ( 12% ) . the clinicoradiologic impression consisted of 11 incidentalomas ( 44% ) , eight phpts ( 32% ) , four pls ( 16% ) , and two metastatic papillary thyroid carcinomas ( ptc ) ( 8% ) . \n eighteen of the 25 cases ( 72% ) were cytologically diagnosed as pl ; the remaining seven patients were diagnosed as follows : two with benign follicular cells ( 8% ) , two with adenomatous goiter ( 8% ) , two with atypical cells ( 8% ) , and one with metastatic carcinoma ( 4% ) . when the clinicoradiologic impression suggested pl , the sensitivity of the cytological diagnosis was 86.7% ( 13/15 ) . in all other cases , \n a minimally invasive parathyroidectomy was performed in 17 of the 20 patients who underwent surgery , and the remaining three patients received thyroid surgery or neck dissection . \n eighteen of the 20 cases who received surgery were diagnosed as parathyroid adenoma , and the remaining two were determined to have parathyroid carcinoma . in the aspirates from the five patients who did not receive surgery , \n pth was expressed in two , and the remaining three aspirates demonstrated positivity for chromogranin a. ttf-1 was negative in all four cases who were examined ( fig . \n the most impressive feature of the parathyroid aspirates was the diversity of the architectural features . \n most of the smears showed scattered naked nuclei ( 25/25 , 100% ) and loose clusters ( 22/25 , 88% ) in varying degrees . \n other architectural features included a papillary pattern with a fibrovascular core ( 17/25 , 68% ) , tight clusters ( 14/25 , 56% ) , and a follicular pattern ( 11/25 , 44% ) ( table 2 , fig . \n each aspirate showed a combination of foregoing architectures in varying degrees . in three aspirates , \n the entire specimen consisted of scattered naked nuclei and closely resembled thyroiditis ( 3/25 , 12% ) . \n almost all nuclei were centrally located , round to oval and similar in size to red blood cells with a regular nuclear membrane . \n a small proportion of parathyroid cells showed mild to moderate anisokaryosis in each aspirate ( 24/25 , 96% ) . \n prominent nucleoli and intranuclear pseudoinclusions were only detected in one aspirate ( 1/25 , 4% ) ( table 2 , fig . \n many parathyroid cells had finely granular cytoplasm , and a small portion of cells revealed a well - defined cell border ( 9/25 , 36% ) and oxyphilic cytoplasm ( 9/25 , 36% ) . \n fragments of hyaline colloid - like material were noted in three aspirates ( 12% ) . \n another two cases ( patients nos . 3 and 4 ) were diagnosed as adenomatous goiter ; these patients underwent minimally invasive parathyroidectomy because pl was diagnosed using an intraoperative frozen biopsy . \n clinical impression and cytological diagnosis were metastatic carcinoma , so neck dissection was performed . the dominant cytological architecture in this case consisted of tight clusters , \n a papillary pattern with a fibrovascular core , anisokaryosis and stippled chromatin were also found . \n although pl was diagnosed using intraoperative frozen biopsy , the remaining lobe was removed by lobectomy . in patient no . \n 7 , who had simultaneous ptc , the paratracheal mass was clinically thought to be metastatic ptc . \n the dominant architecture was loose clusters , and other cytological findings were a papillary pattern with scattered naked nuclei , tight clusters , a follicular pattern , anisokaryosis , and stippled chromatin . \n the ability to distinguish between pl and thyroid lesions using fnac has important clinicoradiologic significance for the treatment and quality of life of patients.6 in thyroid neoplasm , a more extensive operation , such as a lobectomy , total thyroidectomy , or neck dissection , is required , whereas pl can be selectively removed with minimal incisions.4 therefore , pathologists need to note the cytomorphologic features of pl to ensure accurate diagnoses . in our study , the variable architectural and cytological features of pl were well presented as follows : scattered naked nuclei , loose clusters , a papillary pattern with a fibrovascular core , tight clusters , a follicular pattern , anisokaryosis , stippled chromatin , a well - defined cell border , and oxyphilic cytoplasm . \n although a few cases showed absolute predominance of one type of architecture , most cases had variable cytological features , each being mixed in varying degrees . \n absher et al.2 reported that the presence of a pl may be suspected when recognizing a combination of diverse cytological features rather than a single distinct factor . \n a few attempts were made to distinguish between pl and thyroid lesions by using fnac . \n absher et al.2 recommended determining certain characteristic features of pl , including cohesive cellular fragments admixed with numerous single naked nuclei , absent or inconspicuous nucleoli , round to oval uniform nuclei , smaller nuclei than thyroid nuclei , anisokaryosis , and hyperchromatic chromatin rather than finely granular chromatin . \n dimashkieh and krishnamurthy6 documented that smaller nuclei than thyroid follicular cells , bare nuclei , stippled chromatin , and a prominent vascular network with epithelial cells indicated parathyroid origin . the papillary pattern with a fibrovascular core presented in our study corresponded well with the prominent vascular network and the attached epithelial cells as well as the specific \" spot of fire \" hypervascularity pattern of the parathyroid gland observed on the color doppler sonogram.4 past studies have stated that colloid - like substances and macrophage accumulation are distinguishing cytological features of thyroid lesions from pl.1,7,8 however , recent studies have revealed that they also can be seen in pl.2,3,6 similarly , colloid - like substances were observed in three of our cases ( 12% ) , even though macrophages were not detected . \n there was one case with intranuclear pseudoinclusion , which postoperatively proved to be a parathyroid carcinoma . \n however , intranuclear pseudoinclusion has also been described in parathyroid tumors,9,10 and it was noted in just a few cells in this case . \n that particular patient had a history of total thyroidectomy due to ptc , and there was no evidence of ptc recurrence . \n clinicoradiologic features and ancillary tests , such as immunohistochemical testing , can contribute to the correct diagnosis of pl.2,3,6 the sensitivity of cytological diagnosis varied substantially depending upon available clinicoradiologic information , such as serum pth , ultrasonography , and location . \n an unusual location and other radiologic findings of pl can increase diagnostic difficulty . in our series , six of 25 pls ( 24% ) \n this number is higher than the previously reported incidence of 53 of 4,868 ( 1% ) parathyroid adenomas.11 in general , there are no distinguishing cytological features between parathyroid adenoma and hyperplasia.2,6 therefore , it is recommended that pl is used in the routine cytological diagnosis if an aspirate suggests a parathyroid origin.2 however , a few studies have indicated that there might be distinguishing cytological features between parathyroid adenoma and hyperplasia.1,12,13 in conclusion , fnac is a very useful method for the diagnosis of pl , although a few reports have mentioned the limitations of parathyroid fnac , such as its low sensitivity , smear inadequacy , and contamination with thyroid tissue.3,8,13 on the basis of the findings from previous reports as well as our study , common cytological architectures of pl are scattered naked nuclei , loose clusters , prominent vasculature with epithelial cells resembling a papillary pattern , tight clusters , and a follicular pattern . \n common cellular features included anisokaryosis , stippled chromatin , a well - defined cell border , oxyphilic cytoplasm , and smaller nuclei than thyroid follicular cells . \n minor features include intranuclear pseudoinclusions , colloid - like material , prominent nuclei , and eccentric nuclei . \n fnac of the parathyroid can easily be confused with that of the thyroid because of their overlap in cytological features . \n although no single cytomorphologic characteristic can be used as a diagnostic tool,2 a combination of cytological parameters and clinicoradiologic findings should be used to improve the diagnostic sensitivity of pl .", "role": "user" }, { "content": "backgroundthere has been an increase in the use of fine needle aspiration cytology ( fnac ) for the diagnosis of parathyroid lesions ( pls ) . \n differentiation between a thyroid lesion and a pl is not easy because of their similar features . \n we reviewed parathyroid aspirates in our institution and aimed to uncover trends in diagnostic criteria.methodswe selected 25 parathyroid aspirates ( from 6 men and 19 women ) confirmed surgically or immunohistochemically from 2006 to 2011.resultsmajor architectural findings of pls include scattered naked nuclei , loose clusters , a papillary pattern with a fibrovascular core , tight clusters , and a follicular pattern . \n these architectures were commonly admixed with one another . \n cytological features included anisokaryosis , stippled chromatin , a well - defined cell border , and oxyphilic cytoplasm . \n eighteen of the 25 patients were diagnosed with pl using fnac . \n seven patients had been misdiagnosed with atypical cells ( n=2 ) , benign follicular cells ( n=2 ) , adenomatous goiter ( n=2 ) and metastatic carcinoma ( n=1 ) in fnac . \n using clinicoradiologic data , the sensitivity of the cytological diagnosis was 86.7% . \n the cytological sensitivity decreased to 50% without this information.conclusionsfnac of pl is easily confused with thyroid lesions . \n a combination of cytological parameters and clinical data will be required to improve the diagnostic sensitivity of pls .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a major component of the adaptive immune response to infection is the generation of protective and long - lasting humoral immunity , but factors governing selection of the particular antigens recognized are unclear . \n it is not uncommon for viruses encoding a small number of proteins to generate antibodies against each encoded protein . \n but for infectious agents containing hundreds or thousands of proteins only a subset of the proteome is recognized and little is known about the extent or the characterisitics of this subset of antigens . \n methods for making a complete empirical accounting of the immunoproteome have limitations , particularly when the genome of the organism is large . here \n we describe a b. melitensis proteome microarray that enables this problem to be directly addressed by applying an unbiased systems biology approach to identify immunodominant and serodiagnostic antigens and to classify the reactive antigens based on functional and physical properties . \n protein microarrays can be used with relative ease to probe the entire proteome of different infectious microorganisms including bacteria , viruses and parasites . \n this approach permits assessing the repertoire of antibodies produced in response to infections or vaccinations from large collections of individual patient sera , and can be used to perform large - scale sero - epidemiological and sero - surveillance analyses not possible with other technologies , while consuming small quantities ( < 2 l ) of each serum sample . probing large numbers of patient specimens empowers the statistical tests resulting in more reliable conclusions while correcting for false discovery required for multiple comparison testing inherent in microarray analysis . \n moreover , microarrays can display all proteins of an infectious agent and may allow for identification of novel antigens , otherwise undetectable by methods like 2-d gels that are highly biased by microbial protein expression patterns . \n brucella melitensis , the most virulent species infecting humans , also infects goats , sheep and cattle , in central and south america , the middle east , east asia , and some southern european countries . \n consumption of animal products , direct animal contact and inhalation of aerosolized bacteria in the laboratory setting ( indicating the potential for air - borne spread via a bioterrorism - type attack ) are well - recognized routes of infection . \n the current knowledge of protein antigens recognized by humans and reservoir animals is based on limited numbers of studies on brucella melitensis and brucella abortus . \n we recently constructed a pilot proteome array consisting of 1406 b. melitensis proteins and observed marked differences in immune responses between humans and goats.(5 ) here we have expanded our previous study to the full proteome microarray consisting of 3046 b. melitensis proteins , by including expression of newly cloned 1640 bm genes . in addition to developing a better classifier capable of predicting disease based on serological response , more importantly , this study allows an estimate of the extent of immune reactivity against the whole proteome , and prediction of proteomic features that may dictate immune recognition for other yet uncharacterized gram - negative bacteria . \n human sera were obtained from patients enrolled in a prospective clinical study of brucellosis in lima , peru . \n the human subjects part of the study was approved by the humans research protections committee of the university of california san diego , the comite de tica of universidad peruana cayetano heredia , lima , peru and the comite de tica of asociacin benfica prisma , lima , peru , all of whom have maintained federal wide assurances with the united states department of health and human services . \n all patients provided written informed consent prior to enrollment in the study , and signed consent forms have been stored in locked files in study offices at upch and ab prisma , lima , peru . \n forty- two patients were confirmed to have acute brucellosis by positive culture , positive rose bengal test and by tube agglutination tests titers 1/160 . \n eighteen patients presenting with brucellosis - compatible syndromes were culture negative and rose bengal positive , and treated according to standard antibiotic therapy within 2 days of serum sampling . \n additional control patient samples included 13 sera from rose bengal - negative patients , 44 samples from ambulatory healthy controls from north lima where brucellosis occasionally affects patients , and sera from humans in the u.s . where brucellosis is not found . \n approximately 10 g of autoclaved pellet of b. melitensis 16 m were used to isolate lps using the hot phenol - water method.(32 ) the purified lps was treated with rnase , dnase and proteinase - k , and the hot phenol - water treament was repeated . \n b. melitensis lps obtained from both upper phenol saturated aqueous layer ( aqueous phase ) and lower water saturated phenol layer ( phenol phase ) were pooled . \n the lps from e. coli 055:b5 and b. melitensis 16 m were analyzed on a gradient 412% tris - glycine sodium dodecyl sulfate ( sds ) polyacrylamide gel ( invitrogen corp . , \n the presence of lps in the gels was detected with a periodic acid silver stain(33 ) and protein using coomassie blue stain . \n b. melitensis lps was quantified using a colorimetric assay to measure 2-keto-3-deoxyoctonate ( kdo ) concentration.(34)e . \n all orfs from brucella melitensis 16 m genomic dna were identified using genbank nc_003317 and nc_003318 , and 1640 orfs that were absent from pilot chip were amplified and cloned using a high - throughput pcr and recombination cloning method described previously.(5 ) microarrays and immunostrips were fabricated and probed as described before.(5 ) plasmids were expressed at 24 c for 16 h in in vitro transcription / translation e. coli reactions ( expressway maxi kits from invitrogen ) , according to the manufacturer s instructions . for microarrays , \n 10 l of reaction was mixed with 3.3 l 0.2% tween 20 to give a final concentration of 0.05% tween 20 , and printed onto nitrocellulose coated glass fast slides ( whatman ) using an omni grid 100 microarray printer ( genomic solutions ) . for immunostrips , \n b. melitensis lps was printed at 0.01 mg / ml . all antigens were printed on optitran ba - s 85 0.45 m nitrocellulose membrane ( whatman ) using biojet dispenser ( biodot ) at 1 l / cm , and cut into 3 mm strips . \n human sera samples were diluted to 1:200 with 10 mg / ml e. coli lysate ( mclab ) . \n microarray slides were incubated in biotin - conjugated secondary antibody ( jackson immunoresearch ) diluted 1/200 in blocking buffer , and detected by incubation with streptavidin - conjugated surelight p-3 ( columbia biosciences ) . \n microarray slides were scanned and analyzed using a perkin - elmer scanarray express ht microarray scanner . \n human sera were diluted to 1/200 in 5% bsa solution containing 20% e. coli lysate ( mclab ) . \n strips were then incubated in alkaline phosphatase conjugated donkey antihuman immunoglobulin ( anti - igg , fc fragment - specific , jackson immunoresearch ) secondary antibody , diluted to 1/2000 , and reactive bands were visualized by incubating with 1-step nitro - blue tetrazolium chloride/5-bromo-4-chloro-3-indolyphosphate p - toluidine salt ( nbt / bcip ) developing buffer ( thermo fisher scientific ) . \n immunostrips were scanned with hewlett - packard document scanner , and were quantified using image j software . \n the mass spectrometry data set characterization of host and pathogen proteins affected by brucella abortus infection was from caprion proteomics studies of b abortus , downloadable from pathogen portal web site hosted by proteomics resource center at http://www.pathogenportal.org/portal/portal/pathport/home . \n samples were processed for intact bacteria or cell envelope preparations from exponentially growing bacteria according to the caprion protocol 24401 and 24302 , as described before . \n briefly , to process intact bacteria for ms analysis , 50 l aliquots of 20 g protein samples were denatured in 50 mm ammonium bicarbonate ( sigma - aldrich , st . \n after sonication , samples were centrifuged at 2000 g for 1 min and a 950 l cold ( 20 c ) chloroform / methanol solution ( 2:1 v / v ) were added . \n samples were vortex mixed and incubated at 20 c for 2 h. subsequently , 100 l cold ( 20 c ) methanol was added and samples were clarified by centrifugation at 21 000 g for 10 min at 4 c . \n the supernatants were dried under vacuum , resuspended in 100 mm ammonium bicarbonate containing 8 m urea and 1% ( w / v ) of acid - labile surfactant ( als ; waters , milford , ma ) and sonicated for 10 min . \n after centrifugation for 20 s at 2000 g , samples were incubated for 1 h at ambient temperature . \n a volume of 450 l of 100 mm ammonium bicarbonate containing 5% ( v / v ) of acetonitrile was added . \n lys - c ( wako , richmond , va ) was added to yield a 1:50 enzyme to protein ratio . \n trypsin ( promega , madison , wi ) was then added at a 1:50 enzyme to protein ratio and samples were incubated for an additional 16 h. following proteolysis , tcep ( pierce , rockford , il ) was added to a final concentration of 10 mm and samples were incubated for 30 min at ambient temperature and then lyophilized . to cleave the acid labile surfactant \n n hcl and 100 l of water were added into each sample with subsequent incubation for another half hour at ambient temperature . to process cell envelope for ms analysis , supernatants of exponentially growing b. abortus strains were clarified , centrifuged at 100 000 g for 6 h at 4 c , pellets resuspended in double distilled water . \n the sample was sonicated , and 50 mm ammonium bicarbonate containing 2% acid - labile surfactant and 8 m urea were added . \n the sample was vortex mixed for 1 h. a sample of 50 l of the om suspension was added to a final volume of 1 ml of a chloroform / methanol solution ( 2:1 v / v ) . \n the sample was vortex mixed and incubated at 20 c for 2 h. subsequently , 100 l of cold methanol ( 20 c ) was added , and the sample was cleared by centrifugation for 10 min at 21 000 g. the supernatant was dried under vacuum and resuspended in 4 m urea ; 50 mm ammonium bicarbonate ph 8.0 . \n the samples were then diluted 4:1 with 50 mm ammonium bicarbonate buffer ph 8.0 , and trypsin was added at a 1:25 protein ratio for an additional 16 h. following proteolysis , the samples were distributed into 96-well plates for mass spectrometry analysis . \n peptide digests were analyzed by liquid chromatography coupled to mass spectrometry ( lc - ms ) as described . \n ms system consisted of a caplc ( waters , milford , ma ) with a cooled autosampler and a qtof ultima ( waters , milford , ma ) controlled by masslynx version 4.0 software . \n the peptide concentrations were normalized and the samples were injected into a reversed - phase column ( jupiter c18 , phenomenex , torrance , ca ) for hplc separation . \n ms spectra to mascot software ( matrixscience , boston , ma ) for searching against the national center for biotechnology information protein database ( ncbi ) . \n numbers of different peptides for each identified protein were counted and listed in table s4 ( supporting information ) . \n data analysis was performed using the r ( http://www.r-project.org ) and sas ( http://www.sas.com/ ) statistical software . \n it has been noted in literature that data derived from microarray platforms is heteroskedatic . to stabilize the variance , the vsn normalization method implemented as part of the bioconductor suite ( www.bioconductor.org ) \n in addition to removing heteroskedacity , this procedure corrects for nonspecific noise effects by finding maximum likelihood shifting and scaling parameters for each array such that control probe variance is minimized . \n this calibration has been shown to be effective on a number of platforms.(42 ) differentially reactive proteins between groups were determined using a bayes regularized t test adapted from cyber - t for protein arrays , which has been shown to be more effective than other differential expression techniques.(44 ) to account for multiple comparison conditions , the benjamini and hochberg ( bh ) method was used to control the false discovery rate.(45 ) after benjamini and hochberg correction , p - value smaller than 0.05 was considered significant , and the corresponding protein was considered differentially reactive and serodiagnostic . \n multiplex classifiers were constructed using linear and nonlinear support vector machines ( svms ) using the e1071 r package . plots of receiver operating characteristic ( roc ) curves were made with the rocr r package . \n sensitivity specificity and area under the curve ( auc ) were determined from the resulting roc curves . \n principle component analysis ( pca ) to visually reduce and summarize signal intensity variance among the subjects was conducted in jmp software ( www.jmp.com ) . \n hierarchical clustering was used to group sera samples into subsets , such that those within each cluster ( subset ) are more closely related to one another than samples assigned to other clusters . \n clustering is based on the degree of similarity between the protein intensity for each individual . \n mev v4.6 ( tm4microarray software suite , www.tm4.org ) was used to perform the clustering analysis . \n tmhmm v2.0 was utilized for transmembrane domains prediction(46 ) ( http://www.cbs.dtu.dk/services/tmhmm/ ) , signalp v3.0 for signal peptide prediction(47 ) ( http://www.cbs.dtu.dk/services/signalp/ ) , psortb v3.0 . \n pi / mw tool from swiss institute of bioinformatics was used to determine isolectric point ( http://ca.expasy.org/tools/pi_tool.html ) . \n p value for enrichment statistical analysis was calculated using fisher s exact test in the r environment . \n the 3198 predicted orfs of b. melitensis ( bm ) 16 m were subjected to amplification from genomic dna , and 1406 orfs were cloned and printed on pilot chip.(5 ) in this study , another 1640 orfs were successfully cloned using our high throughput recombination method . \n about one - fourth of the cloned genes were sequenced and > 99% of sequenced clones had the correct sequence . \n all 3046 bm orfs cloned in pxt7 vector ( > 95% of proteome ) were expressed under t7 promoter in the e. coli in vitro transcription / translation system , and printed on microarrays . over 98% of protein spots \n bm protein arrays were probed with sera from acute brucellosis patients in lima , peru obtained within 13 weeks of the onset of symptoms , and sera from bm culture - positive humans ( figure s1b , supporting information ) showed robust reactivity against a collection of antigens compared to unexposed individuals . among the 3046 antigens tested , 1464 antigens reacted with at least one culture positive individual , accounting for 48% of the proteome ( figure 1 ) . within this immunoproteome , \n , with mean reactivity greater than the mean of the no dna controls plus 2.5 standard deviations among culture positive individuals ( figure 2 , figure s2 and table s1 , supporting information ) . of these , \n 33 protein antigens were serodiagnostic , and were significantly differentially reactive between nave and culture positive patients from peru ( benjamini and hochberg adjusted cyber - t p - value < 0.05 ) . \n most of these antigens also reacted strongly with sera from brucellosis cases that were culture negative but positive for the rose bengal diagnostic test . \n an unbiased hierarchical clustering analysis segregated most of the individual specimens into two groups , with a few infected cases with weak reactivity sporadically clustered among samples diagnosed as uninfected ( figure s2 , supporting information ) . \n we also identified 90 cross - reactive antigens that reacted similarly among all human samples , whether from nave individuals or individuals diagnosed to be infected . \n the raised bars of any color represent 1464 reactive proteins , which define the immunoproteome ( approximately 48% of the proteome ) . \n there are 538 antigens reactive in 1 sample , 648 antigens reactive in 25 samples , 143 antigens reactive in 69 samples and 135 antigens reactive in 1042 samples . bmei0536 and bmei1079 reacted in all 42 bm culture positive samples . \n all serodiagnostic antigens except bmei0503 reacted in 1042 samples ; bmei0503 reacted in 9 samples . \n discovery of new human serodiagnostic antigens by probing the full b. melitensis proteome arrays with a collection of b. melitensis peruvian nave and culture positive human sera . \n the mean sera reactivity of the 3046 antigens was compared between the culture positive and peruvian naive groups . \n antigens with benjamini hochberg corrected p - value less than 0.05 ( serodiagnostic ) are organized to the left and cross - reactive ( bh_p > 0.05 ) antigens to the right . shown \n are the 33 serodiagnostic protein antigens , bm lps , and a subset of cross - reactive antigens . \n we performed unsupervised principal component analysis and showed that the 33 serodiagnostic antigens clearly separated the peruvian naive from culture positive groups ( figure 3a ) . to further determine the accuracy of distinguishing brucellosis cases from controls , cross - validation receiver operating characteristic ( roc ) curves and area under the curve ( auc ) \n the top four orfs , bmei0536 ( bp26 ) , bmei0805 ( hypothetical protein ) , bmei1330 ( protease do ) , and bmei 1890 ( transporter ) , as wells as bm lps , all have an individual antigen auc greater than 0.90 ( table s1 , supporting information ) . \n three of the antigens were identified previously on microarrays.(5 ) antigen bp26 ( bmei0536 ; auc 0.991 ; bh p - value < 1 10 ) gave the best single antigen discrimination with 95% sensitivity and specificity rate . \n variability and mean value of accuracy from this model has been shown in the auc boxplot . \n the top 5 antigens all produced sensitivity and specificity over 96% ( figure 3c ) . with the top 3 antigens , this classifier yielded a highest sensitivity and specificity rate of 98.6 and 98.6% , respectively . altogether 33 protein antigens plus lps produced sensitivity and specificity over 93% \n ( a ) unsupervised principal component analysis of the signal intensity for samples from peruvian naives and culture positive groups revealed that these two groups could be segregated on the basis of 33 selected serodianosis protein antigens and 2 bm lps ( at 0.1 mg / ml or 0.01 mg / ml ) . the serodiagnostic antigens were ranked by single antigen auc . \n ( b ) cross - validation auc boxplot with variance and mean value and ( c ) cross - validation roc graphs show classifiers with increasing number of human serodiagnostic antigens . with the top 3 antigens , this classifier yielded a highest sensitivity and specificity rate of 98.6% and 98.6% , respectively . \n all 33 antigens plus bm lps also produced sensitivity and specificity over 93% . eighteen serodiagnostic proteins and bm lps \n the individual strips were probed with 31 different randomly selected culture positive sera and 31 peruvian naive sera . \n brucellosis patients reacted strongly against the serodiagnostic antigens with variable signal intensities among the patients . \n the roc curve ( figure 4b ) shows that this immunostrip test yielded a high auc of 0.97 , with sensitivity rate of 96.7% and specificity rate of 96.7% . \n ( a ) eineteen serodiagnostic antigens and bm lps at 0.01 mg / ml were printed onto nitrocellulose membrane in adjacent stripes using a biodot jet dispenser as described in materials and methods . \n strips were probed with culture positive or peruvian naive sera diluted 1/200 followed by alkaline phosphatase conjugated secondary antibody and enzyme substrate . weak reactivity in the nave healthy controls \n ( b ) cross - validation roc curve was generated and sensitivity and specificity of immunostrips test is 96% and 96% , respectively . \n serological tests are routinely used to diagnose brucellosis . while the qualitative agglutination test ( rose bengal ) \n is 90% sensitive for screening for acute / subacute brucellosis , quantitative agglutination testing ( e.g. , tube agglutination test ( tat ) ) with titer typically greater than 1/160 used as a more precise diagnostic criterion , can also be used to diagnose relapse . \n often blood cultures are negative at the time of initial presentation or relapse , possibly because of low levels of bacteremia or antecedent use of antibiotics . without being able to ascertain whether the sera used in this study were obtained from patients who might have taken antibiotics prior to blood cultures \n , we queried our data set to determine whether sera from blood culture - positive , rose bengal positive brucellosis patients ( gold standard diagnosis ) vs blood culture - negative , rose bengal positive ( tat not done ) subjects ( presumptive positive , unconfirmed ) recognized different proteins on the protein microarrays . \n sera from blood culture - negative , rose bengal positive subjects reacted with 10 b. melitensis antigens much more strongly than blood culture - positive , rose bengal positive individuals ( figure s3 , supporting information ) . \n this unique set of 10 antigens was distinct from the 33 antigens that distinguish culture positive cases from peruvian naves . \n these results indicate that protein microarray analysis was able to delineate distinct antibody profiles in blood culture positive and negative patients , which has the potential to identify antigens capable of differentiating active acute / subacute brucellosis from previously exposed patients \n . these findings may suggest novel biological interactions between bacteria and host that need to be further explored because culture negativity / rose bengal seropositivity might be associated with some biological difference between human hosts , perhaps an immune response that might lower bacterial loads to levels difficult to culture from blood . \n alternatively , it is possible that antibiotic use might lead to an altered host immune response to killed bacteria that no longer would subvert the host immune responses ( typical of intracellular pathogens such as brucella ) . to better understand the determinants of antigenicity in bacteria , we performed a functional enrichment analysis of the serodominant and serodiagnostic antigens identified in this study . \n a total of 543 proteins are unassociated with cogs , and 39 proteins are associated with cogs but have not been assigned to a category , shown as \n some proteins have multiple cog assignments so there are 3,291 cogs in total for 3046 proteins on chip . proteins with predicted cog- u function , involved in intracellular trafficking and secretion , were 6.2- fold enriched in serodiagnostic antigens and 4.3- fold enriched in serodominant antigens . \n proteins in the cog - m category , cell envelope biogenesis and outer membrane , were 2-fold enriched in serodominant antigens ( p - value 0.01 ) . \n proteins in cog - n category , cell motility and secretion , were 3.5-fold enriched in serodominant antigens ( p = 0.027 ) . \n proteins with predicted cog - o function , posttranslational modification , protein turnover , chaperones , were also significantly enriched at 3.0-fold in serodominant antigens . \n there was only 1 serodominant antigen out of 176 cog - k category proteins , predicted to be involved in transcription and identified as serodominant , which was 0.1- fold enrichment and significantly underrepresented with p value of 0.014 ( figure 5a , table s3a , supporting information ) . \n overview of an enrichment analysis of bm proteome classified with cogs and computational predictions categories . \n the size of each slice represents the number of proteins assigned to each cog category . \n proteins classified with cogs - u , m , n , o categories are significantly overrepresented in serodominant antigens and shown in extracted red . \n cog - k proteins are significantly underrepresented in serodominant antigens are shown in extracted black . \n cog categories with < 5 proteins were not included in the figure ( cogs - b , w ) . \n significant over- and under - representations are shown in extracted red or black , respectively . \n numbers of serodominant antigens within these categories / number of total proteins within these categories are in parentheses in the legend \n . results of the complete cog analysis and computational predictions are in table s3 ( supporting information ) . \n ( c ) correlation between enrichment fold and peptide numbers detected by mass spectrometry . as peptide numbers for serdiagnostic antigens \n in contrast , enrichment fold for cross - reactive antigens decreases as peptide numbers for cross - reactive antigens increase . \n as shown in figure 5b and table s3b ( supporting information ) , proteins with 1 transmembrane domain were significantly enriched in serodominant , serodiagnostic and cross - reactive antigens groups , with enrichment fold at 4.3 , 5.0 , and 4.0 , respectively . \n interestingly , proteins with more than 1 transmembrane domain were also significantly underrepresented among the serodominant and cross - reactive antigens . \n proteins with predicted signal peptides ( signalp score > 0.7 ) were significantly enriched in all three groups at a range of 2.8- to 3.6-fold . \n conversely , proteins without signal peptides ( signalp score < 0.7 ) were significantly underrepresented . \n psortb predicted 4 serodiagnostic and 5 serodominant outermembrane antigens , resulting in 11.5- and 3.9-fold enrichment , respectively . \n however , psortb cytoplasmic proteins were 0.5- to 0.7-fold underrepresented in serodominant and serodiagnostic antigens groups . \n we also found that proteins with isoelectric points lower than 5 were 1.7- to 2.0-fold enriched in serodominant and cross - reactive antigen groups , whereas , proteins with pi = 9 to 14 were 0.6- and 0.5-fold underrepresented in these two groups . \n another potential feature that could account for protein antigenicity is the level of in vivo expression ; proteins expressed at a high level in vivo would be expected more likely to be seen by the immune system than proteins expressed at a low level . to test this hypothesis \n , we compared the group of antigenic b. melitensis proteins with an existing data set of expressed protein peptide data from a very closely related species , b. abortus . in this study , cytosolic proteins and cell envelope proteins from b. abortus in the log phase of in vitro growth , were extracted and subjected to lc mass spectrometry ( ms ) analysis as described in materials and methods . \n the number of different peptides identified for each protein was listed in table s4 ( supporting information ) . \n two - hundred forty proteins were exclusively expressed in the cytosol of b. abortus with 1 to12 detected peptides , and 53 proteins exclusively expressed in the cell envelope of b. abortus with 1 to 15 detected peptides , and 80 overlapping proteins expressed in both conditions . of these , 356 proteins were printed on our proteome chip . not surprisingly , expression was a significant enriching feature with 5.2-fold enrichment among serodiagnostic antigens ( p - value 1.87 10 ) , and 2.9-fold in serodominant antigens ( p - value 5.28 10 ) ( table 1 ) . \n interestingly , the fold enrichment was directly proportional to the number of peptides detected ( figure 5c ) . \n there was 8.4- fold enrichment of serodiagnostic antigens in proteins detected with more than 1 peptide ( p - value 3.56 10 ) , 16.2- fold in proteins detected with 5 or more peptides ( p - value 1.30 10 ) , 23.1- fold enrichment in proteins detected with 7 or more peptides ( p - value 1.90 10 ) , and 20.5-fold enrichment in proteins detected with 9 or more peptides ( p - value 3.91 10 ) . \n conversely , proteins that were not identified by ms were significantly underrepresented at 0.4-fold among the serodiagnostic and 0.8-fold among serodominant antigens . \n the data suggests that protein expression level is an important factor contributing to antigenicity of protein antigens . \n this was also supported by data in other experimental systems from different research groups.(55 ) significant enrichment or underrepresentation for certain features are underlined and bold . \n there are a total of 10 enriching features that fall into 3 categories : ( i ) functionally annotated cogs u , m , n and o , ( ii ) computationally predicted features ( tmhmm = 1 , signalp > 0.7 , psort outermembrane , psort periplasmic , and pi < 5 ) , and ( iii ) ms evidence of expression . \n the venn diagrams summarize the number of enriched proteins found in each of these 3 categories , showing overlap among the proteins found in each category ( figure 6 ) . \n there are 338 proteins in the enriched cog categories , 696 computationally predicted proteins , and 356 proteins that were positive by ms ( table 2 ) . \n accounting for the overlap between categories , 1128 proteins in all enriched categories represented 37% of the proteome . \n cogs accounted for 30% of the serodiagnostic hits , the computationally predicted features accounted for 61% of the hits , and ms positive proteins contained 61% of the hits . \n all together the three categories account for 37% of the proteome and include 91% of the serodiagnostic antigens . \n but there is only 1 unique serodiagnostic cog antigen that is not represented in either the computationally predicted or ms+ categories ( bmei1060 , table s1 , supporting information ) . \n so by combining the pool of computationally predicted and ms+ proteins representing 30% of the proteome , 88% of the serodiagnostic antigens can be predicted . \n enriching features are classified into three categories : ( 1 ) cogs - umno , for proteins assigned to one or more of these four cogs ; ( 2 ) computational predictions with enriching features , for proteins predicted to have one or more of the following features , that is , tmhmm = 1 , signalp > 0.7 , psort outermembrane , psort periplasmic , or pi < 5 , and ( 3 ) protein expression as detected by peptide presence in mass spectrometry . separately shown \n are numbers of antigens with enriching features , including all such 1128 antigens on chip , 99 serodominant , and 30 serodiagnostic antigens . \n numbers of antigens having more than one category of enriching features are also presented in the overlapping region of such categories . enriching features are classified into three categories : ( 1 ) cogs - umno , for proteins assigned to one or more of these four cogs ; \n ( 2 ) computational predictions with enriching features , for proteins predicted to have one or more of the following features , i.e. , tmhmm = 1 , signalp > 0.7 , psort outermembrane , psort periplasmic , or pi < 5 ; and ( 3 ) protein expression as detected by mass spectrometry . \n today with increasing efficiency , accuracy and speed we access completed genome sequences from thousands of infectious microorganisms . \n however , systems- level studies to understand the complete network of antibody responses have not been widely performed . \n this work was motivated by the disturbing lack of a detailed scientific understanding of the antibody responses to infectious diseases . \n we have been taking a systems biology approach to account for all of the antibodies that develop after exposure to infectious microorganisms and to identify specific antibody signatures associated with each disease , in order to understand the molecular basis for antigen selection by the immune system and to predict serodiagnostic and vaccine antigens targets . \n our previous study identified a set of serodiagnostic antigens from a randomly selected half of the b. melitensis proteome . \n however , an important difference between the present study and this previous report is that analysis of the complete proteome not only has allowed us to delineate additional serodiagnostic antigens but , more fundamentally , also provided the basis for a rigorous , comprehensive and quantitative determination of basic biological characteristics of the entire set of the serodominant antigens on a genomic level . \n the current standard serological screening assay , an agglutination test that uses tinted , killed bacteria as antigen ( rose bengal ) is based primarily on identification of antibodies to lps in patient serum . in the present microarray study , \n we confirmed lps reactivity ( with purified lps spotted onto the microarray ) , and identified novel protein antigens . \n although antibody responses against all 33 protein antigens used together can predict disease with 92% accuracy , using the serological responses against the top 3 individual antigens together improves accuracy to > 98% for diagnosis of acute human brucellosis . \n one limitation is that the humans studied here only had acute or subacute brucellosis - fever but not focal or chronic disease . \n future studies are needed to assess suspected cases that are agglutination test negative , for example chronic neurobrucellosis or focal disease such as orchitis or vertebral osteomyelitis . \n eleven of the 33 serodiagnostic antigens identified in this study were also identified on the pilot array(5 ) ( table s1 , supporting information ) . \n our findings are in good agreement with published studies that identified well characterized antigens from other brucella spp , including bp26 ( bmei0536 ) , htra / degp ( bmei1330),(28 ) omp16 ( bmei0340),(29 ) the chaperonin groel protein ( bmeii1048 ) and omp 10 ( bmeii0017 ) . \n in addition to the well characterized antigens , we also identified 21 novel serodiagnostic antigens on the current array , including top antigen hypothetical protein bmei0805 . \n two pyruvate dehydrogenase complex molecules and the associated acetyl coa hydrolase , which together form a large multimeric structure consisting of 60 subunits , are also differentially recognized ; this large enzyme complex is found in most bacteria and is frequently a target of immune recognition for other infections . \n protein microarrays enable enrichment analyses to identify proteomic features that are enriched in the immunodominant antigen set , and development of protein antigenicity prediction tools based on enriched features . \n the prediction tools then can be applied on a high - throughput scale to existing or new proteomes to identify key antigenic proteins that may have serodiagnostic or protective characteristics . \n the proteomic features fall into 3 categories : ( i ) cog annotations , ( ii ) computationally predicted proteomic features , and ( iii ) proteins with ms evidence of expression in viable organisms . \n no single proteomic feature or category of features is sufficient to identify all these signature antigens . \n our data suggests that cloning of 37% of genome with these enriching features would reveal more than 90% of serodiagnostic antigens . \n we have classified the reactive immunodominant antigens for numerous agents and have consistently found these features predict antigenicity . \n these results describe the relationship between antigenicity and in vivo expression of individual proteins . in our study \n , we utilized the expression of proteins quantified by ms of a closely related strain , b. abortus during in vitro growth . \n we found that mass spec positive antigens were significantly enriched among serodiagnostic antigens but not among the cross- reactive antigens . \n this validates the classification of the serodiagnostic antigens being derived from actively replicating organisms , and validates the classification of cross - reactive antigens being derived from previous exposure to nonbrucellosis infections . \n although the number of peptides observed per protein has been applied to estimating protein abundance , we are aware that mass spectra of cultured organisms may not reflect the expression during infection in vivo . \n first , nutrients are not limiting in log phase growth in vitro , whereas in vivo , brucella is likely to be within a nutrient - limited intracellular environment.(63 ) second , the ms method may not be particularly quantitative , especially for membrane proteins . \n our protein array technology is also able to provide strong evidence of the comprehensive set of proteins expressed in vivo within a mammalian host by b. melitensis , by virtue of their exposure to the host immune system . \n the expression and abundance of proteins during in vivo growth merits further examination by other novel technologies , such as measurement of transcript abundance from rna - seq ( deep sequencing ) technique.(64 ) the b. melitensis immunoproteome comprises 1464 antigens that are significantly reactive in at least one of the individuals in this study . \n answers to questions of why and how the immune system focuses on 4% of the potential target antigens are not yet apparent from this work . \n one might expect that an immune response against a larger collection of antigens could result in a more effective immune response attack against the infectious agent . but \n antibody responses against thousands of antigens from hundreds of clinical infections could accumulate during a lifetime , leading to cross reactivity against autologous antigens and autoimmune chaos . \n the observation that dozens of organism- specific antibody responses develop after b. melitensis infection is consistent with similar observations from other infectious agents , and has implications for subunit vaccine discovery and development . mimicking the natural response to infection could be considered a viable strategy for vaccine development but most subunit vaccines aim to derive protection from immunization with only a single antigen . attenuated or killed \n whole organism vaccines produce an antibody reactivity profile against dozens of antigens more similar to natural infection.(6 ) this systematic genome scale analysis of human antibody responses against b. melitensis proteins provides a top hit list of antigens worthy of assessing for improved diagnostics , and furthermore , enables development of a predictive model of proteomic features that determine whether a protein is antigenic and produces antibodies that confer protection . \n this systems biology approach provides an empirical basis for understanding the breadth and specificity of the immune response to b. melitensis and a new framework for comparing the humoral responses against other organisms .", "role": "user" }, { "content": "a complete understanding of the factors that determine selection of antigens recognized by the humoral immune response following infectious agent challenge is lacking . here \n we illustrate a systems biology approach to identify the antibody signature associated with brucella melitensis ( bm ) infection in humans and predict proteomic features of serodiagnostic antigens . by taking advantage of a full proteome microarray expressing \n previously cloned 1406 and newly cloned 1640 bm genes , we were able to identify 122 immunodominant antigens and 33 serodiagnostic antigens . \n the reactive antigens were then classified according to annotated functional features ( cogs ) , computationally predicted features ( e.g. , subcellular localization , physical properties ) , and protein expression estimated by mass spectrometry ( ms ) . \n enrichment analyses indicated that membrane association and secretion were significant enriching features of the reactive antigens , as were proteins predicted to have a signal peptide , a single transmembrane domain , and outer membrane or periplasmic location . \n these features accounted for 67% of the serodiagnostic antigens . \n an overlay of the seroreactive antigen set with proteomic data sets generated by ms identified an additional 24% , suggesting that protein expression in bacteria is an additional determinant in the induction of brucella - specific antibodies . \n this analysis indicates that one - third of the proteome contains enriching features that account for 91% of the antigens recognized , and after b. melitensis infection the immune system develops significant antibody titers against 10% of the proteins with these enriching features . \n this systems biology approach provides an empirical basis for understanding the breadth and specificity of the immune response to b. melitensis and a new framework for comparing the humoral responses against other microorganisms .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: endoscopic ultrasonography ( eus ) and endobronchial ultrasound - fine - needle aspiration ( ebus - fna ) , is an accurate technique for evaluation of mediastinal lymph nodes ( mln ) and stadification of lung cancer . \n the aims of the study are to evaluate the feasibility and the efficacy of the combined technique compared with mediastinoscopy for the diagnosis of mln . \n all patients with suspected malignant mln and/or lung lesion identified by positron emission tomography - computed tomography underwent combined eus - ebus - fna . the combined procedure was performed in outpatients under general anesthesia for eus and sedation by intravenous midazolam for ebus when performed separately , using linear - array echoendoscopes . \n the mln were punctured during the eus and ebus - fna procedures with a 22 gauge needle . \n thirty - four patients underwent consecutively eus and ebus - fna between september 2011 and november 2013 ( 8 women , 26 men , mean age of 65.9 year , range : 51 - 83 ) . \n combined eus - ebus - fna was performed in a single time procedure in 26 patients ( mean time 50 min ) and in two different times in eight patients ( mean delay 3 days ) . \n mediastinoscopy was performed in nine patients and confirmed in eight patients the initial combined eus - ebus - fna diagnosis . \n the diagnosis was obtained in 91.2% with eus - fna , 70.6% with ebus - fna and 97% when combined procedure was performed . \n the overall sensitivity , specificity , positive and negative predictive values of eus - ebus - fna for diagnosing malignancy were 96.5% , 100% , 100% and 90% respectively . \n combined eus - ebus - fna represents an accurate technique in the diagnosis of mln , can be done in a single time procedure and has the advantage of being less invasive than mediastinoscopy .", "role": "user" }, { "content": "objectives : endoscopic ultrasonography ( eus ) and endobronchial ultrasound - fine - needle aspiration ( ebus - fna ) , is an accurate technique for evaluation of mediastinal lymph nodes ( mln ) and stadification of lung cancer . \n the aims of the study are to evaluate the feasibility and the efficacy of the combined technique compared with mediastinoscopy for the diagnosis of mln.design and methods : all patients with suspected malignant mln and/or lung lesion identified by positron emission tomography - computed tomography underwent combined eus - ebus - fna . the combined procedure was performed in outpatients under general anesthesia for eus and sedation by intravenous midazolam for ebus when performed separately , using linear - array echoendoscopes . \n the mln were punctured during the eus and ebus - fna procedures with a 22 gauge needle.results : thirty - four patients underwent consecutively eus and ebus - fna between september 2011 and november 2013 ( 8 women , 26 men , mean age of 65.9 year , range : 51 - 83 ) . \n combined eus - ebus - fna was performed in a single time procedure in 26 patients ( mean time 50 min ) and in two different times in eight patients ( mean delay 3 days ) . \n twenty - five malignant and 9 inflammatory lesions were diagnosed . \n mediastinoscopy was performed in nine patients and confirmed in eight patients the initial combined eus - ebus - fna diagnosis . \n the diagnosis was obtained in 91.2% with eus - fna , 70.6% with ebus - fna and 97% when combined procedure was performed . \n the overall sensitivity , specificity , positive and negative predictive values of eus - ebus - fna for diagnosing malignancy were 96.5% , 100% , 100% and 90% respectively . \n no complications related to the procedure were observed.conclusion:combined eus - ebus - fna represents an accurate technique in the diagnosis of mln , can be done in a single time procedure and has the advantage of being less invasive than mediastinoscopy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: there can be a difference between patients performance of a given activity of daily living \n ( adl ) on a day - to - day basis , such as at home or in a hospital ward , and their capacity to \n perform that adl as assessed in a controlled environment such as during rehabilitation \n training . \n this gap between capacity and performance is often observed in stroke \n patients1 , and it is important that this \n gap is minimized to prevent the nonperformance of the adl and to facilitate the early \n discharge of the patient . \n dressing is an example of an adl in which such a gap is frequently \n observed2 . \n independence in dressing is \n considered necessary for maintaining dignity , self - esteem , and a sense of accomplishment in \n patients2 . \n furthermore , there is a \n strong association between independence in dressing at the time of discharge from hospital \n and near independence in adls at home 5 years after the onset of stroke3 . \n dressing is therefore an activity that patients should \n achieve independence in before returning home . \n although a previous study showed that the gap between adl capacity and performance is \n dependent on patient motivation and environmental conditions4 , to our best knowledge , the relationship between physical functions \n or visual perception and the gap between capacity and performance has not been investigated , \n nor have been specific adls such as dressing and eating . \n some studies have suggested that motor functions such as that of the affected upper and \n lower limbs5 , trunk function6 , 7 , \n balance8 , 9 , and unilateral spatial neglect10 are majorly involved in the ability to dress independently . because \n of the strong relationship between motor function or unilateral spatial neglect and dressing \n independence , it was hypothesized in this study that the gap between capacity and \n performance is influenced by these factors . \n therefore , the aim of this study was to \n investigate the relationship between motor functions or unilateral spatial neglect and the \n gap between adl capacity and performance . \n the study included 60 stroke patients ( age , 69.1 12.6 years ) admitted and discharged from \n the convalescent rehabilitation ward of a hospital . \n the inclusion criteria were as follows : \n patients with first stroke ( a unilateral supratentorial hemispheric lesion ) , patients able \n to dress independently in rehabilitation training ( as judged by an occupational therapist ) , \n and patients with no marked deterioration in motivation ( assessed as a score of 8 by using \n the vitality index)9 . \n the patients characteristics are shown in table \n 1table 1.stroke-related characteristics of the study patientsoverall ( n=60)independent ( n=46)assistance ( n=14)males ( % ) 58.360.950.0right - side hemiparesis ( % ) 21.726.17.1time post - stroke ( days)85.3 31.085.3 31.885.6 29.5data are presented as mean sd .. informed consent was not obtained from the patients because this study had a \n retrospective design without intervention . however , \n our protocol was deliberated and \n approved by the institutional ethics review board of northern fukushima medical center ( no . \n 56 ) and tohoku fukushi university ( rs141201 ) . \n data from electronic medical records from the time of discharge were collected and \n analyzed . \n fim instrument11 \n subscores for dressing the upper and lower body were used to assess the actual performance \n level in dressing . \n the stroke impairment assessment set12 was used to assess the gross motor function of the affected side \n ( by using items for motor function ) , trunk function ( by using items for trunk function ) , \n visuospatial deficit ( by using items for unilateral spatial neglect ) , and strength on the \n unaffected side ( by using items for quadriceps strength on that side ) . the simple test for \n evaluating hand function13 \n was used to \n assess the function of the upper limb , and the berg balance scale14 was used to assess balance . \n cognitive function was \n assessed by using the revised hasegawa dementia rating scale ( hds - r)15 and the fim instrument cognitive subscore . \n the patients were divided into two groups according to their fim instrument \n subscores ( indicating their actual performance level ) : an independent dressing group ( n=46 ) , \n who scored 6 for dressing both their upper body and lower body , and an assistance group \n ( n=14 ) , who scored 5 in one or both of these body sections . \n the results of the physical \n function and unilateral spatial neglect and cognitive tests were then compared between the \n two groups . \n student s t - test and the mann - whitney u - test were used to compare the \n groups . to clarify the effect of motor functions and unilateral spatial neglect on the gap between \n capacity and performance in dressing , \n age and cognitive function in both groups were first \n adjusted through propensity score matching16 , 17 before making the comparison between motor \n functions and unilateral spatial neglect . \n propensity score matching is a method of \n estimating the causal effect in observational studies when random allocation is impossible . \n it adjusts confounding factors in which multiple covariates are aggregated into a single \n variable . in this study , \n propensity scores were calculated by using binary logistic \n regression with the independent dressing and assistance groups as dependent variables , and \n age , hds - r score , and cognitive items in the fim instrument ( comprehension , \n expression , problem solving , social interaction , and memory ) as independent variables . the \n predicted probability \n the model \n discrimination was assessed by using c - statistics , and calibration was assessed by using \n hosmer - lemeshow statistics . \n one - to - one pairs of independent dressing and assistance group \n patients were randomly matched by using a caliper width of a quarter of a standard deviation \n of the estimated propensity scores16 , 17 . \n the software spss statistics 22.0 was \n used for the statistical analysis , and the level of significance was set at p<0.05 . \n in the actual performance of dressing , 23.3% ( n=14 of 60 ) of the patients required \n monitoring or assistance by caregivers or nurses despite having the capacity to dress \n independently . before the propensity score matching , a significant difference was observed \n between the independent dressing and assistance groups in age ; hds - r score ; and \n fim instrument expression , problem solving , and memory item scores ( table 2table 2.comparison of cognitive functions by groupoverall pairs matched by psindependent ( n=46)assistance ( n=14)independent ( n=11)assistance ( n=11)age ( years)67.2 11.975.5 13.2 * 73.2 7.773.9 13.7hds - r25.0 4.920.7 5.4 * * 21.7 4.521.6 5.4fim comprehension6.4 0.85.8 1.26.0 0.95.9 0.9fim expression6.4 0.95.6 1.1 * * 6.0 0.95.8 1.1fim social interaction6.7 0.86.4 0.96.8 0.46.6 0.7fim problem solving6.0 1.04.9 1.2 * * 5.3 1.25.7 1.0fim memory 6.4 1.15.5 1.6 * 5.9 1.45.7 1.0data are presented as mean sd . \n ps : propensity score ; \n hds - r : hasegawa dementia rating scale , revised ) . \n ps : propensity score ; \n hds - r : hasegawa dementia rating scale , revised eleven pairs were selected from the independent dressing and assistance groups in the \n propensity score matching . \n the hosmer - lemeshow test showed p=0.60 ( i.e. , there was no \n evidence of a poor fit ) , and the c - statistic was 0.83 , indicating a strong model . \n , no significant \n differences were observed between the two groups adjusted for age , hds - r score , and \n cognitive items in the fim instrument ; the mean values were also similar . in \n terms of motor function \n , a significant difference was observed between the two groups only \n in the berg balance scale ( table 3table 3.comparison of motor functions by groupindependent(n=11)assistance(n=11)motor function of affected - side limbsknee mouth test ( sias)4.1 0.93.6 1.6finger - function test ( sias)3.7 1.53.3 1.7hip - flexion test ( sias)4.5 0.94.2 1.2knee - extension test ( sias)4.6 0.73.9 1.4foot - pat test ( sias)4.3 1.13.6 2.0sensory function of affected - side \n limbsupper - limb light touch ( sias)2.6 0.72.5 0.7lower - limb light touch ( sias)2.4 0.92.5 0.7upper - limb position sense ( sias)2.7 0.92.6 0.7lower - limb position sense ( sias)2.6 0.92.6 0.5motor function of trunkverticality test ( sias)3.0 0.02.9 0.3abdominal muscle strength ( sias)2.7 0.52.3 0.5muscle strength of unaffected sidegrip strength ( sias)2.6 0.72.0 0.4quadriceps strength ( sias)2.9 0.32.6 0.8motor function of upper limbaffected side ( stef)90.6 4.786.0 10.6unaffected side ( stef)59.8 35.336.8 38.9balanceberg balance scale47.8 7.4 31.0 12.3 * * visuospatial deficit ( sias)3.0 0.02.8 0.4data are presented as mean sd . * * p<0.01 . \n sias : stroke impairment assessment set ; \n stef : simple test for evaluating hand function ) , with the independent dressing group showing significantly better balance \n scores ( p<0.01 ) . \n sias : stroke impairment assessment set ; \n stef : simple test for evaluating hand function \n the results of this study showed that balance has an effect on the gap between the capacity \n to dress and the actual performance of dressing in stroke patients . \n a previous study \n suggested that motivation and environmental conditions are linked to such a gap4 . in the present study , however , motivation \n and environmental conditions were adjusted for through the inclusion criteria ( the absence \n of a marked deterioration in motivation and the patients all being in the same hospital \n ward ) ; this allowed investigating the relationship between motor functions and the \n capacity performance gap in dressing . confounding factors such as age and cognitive function \n were also adjusted for by using propensity score matching before the motor functions were \n analyzed . to the best of our knowledge , \n this is the first study to investigate the causes of \n the gap between adl capacity and performance from the standpoint of motor functions . \n motor functions associated with the level of independence in dressing is related to the \n gross motor function of the affected upper and lower limbs5 , verticality in the seated position6 , abdominal muscle strength7 , and balance8 , 9 . \n however , the results of this study \n suggested that the balance function is a more important factor affecting the gap between \n capacity and performance in dressing than the motor function of the affected side and trunk . \n a poor balance function is associated with a reduction in a patient s ability to dress in \n normal life because it induces a fear of falls in both the patient and the caregivers . in \n other words , \n patients with a deteriorated balance function maintain a low level of \n independence in dressing performance despite being able to dress independently because of \n the priority placed on safety . \n it is therefore possible that balance exercises may improve \n the level of actual performance of dressing independently . \n one of the limitations of this study is that many samples for which matching was difficult \n with the present propensity score matching procedure were dropped from the analysis , \n resulting in a population that was not exactly the same between before and after \n matching18 .", "role": "user" }, { "content": "[ purpose ] dressing is an activity of daily living for which stroke patients often show \n discrepancies between capacity and actual performance . \n the aim of this study was to \n elucidate the physical function and unilateral spatial neglect in stroke patients that \n reduce their level of actual performance despite having the capacity for dressing \n independently . \n [ subjects and methods ] this retrospective study included 60 first - time \n stroke patients judged by occupational therapists as able to dress independently . \n the \n patients were divided into two groups according to their fim instrument scores \n for dressing the upper and lower body : an independent group with both scores 6 and an \n assistance group with one or both scores 5 . after adjusting for confounding factors \n through propensity score matching , \n the groups were compared by using stroke impairment \n assessment set items , the simple test for evaluating hand function of both upper limbs , \n and the berg balance scale . [ results ] the assistance group had a significantly lower score \n for the berg balance scale than the independent dressing group ( 31.0 12.3 vs. 47.8 \n 7.4 ) . [ conclusion ] the results of the present study suggested that the balance function \n has an effect on the discrepancy between dressing capacity and performance .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a lingual cystic mass in a newborn is an interesting challenge for the pediatric surgeons . \n some of these masses present with respiratory distress requiring emergency intervention . among the different lesions that can arise in the tongue , \n the foregut duplication cyst is of special interest because of its rarity , variable characteristics , and its puzzling embryogenesis . until now \n , only ten cases of intralingual foregut duplication cysts lined with gastric mucosa have been reported in the literature [ table 1].[39 ] reported cases of gastric variety of intralingual foregut duplication cyst \n this neonate presented with mass in tongue on tenth day of life [ figure 1 ] , which was diagnosed as tongue lymphangioma in anomaly scan at the 8 month of gestation . \n fullterm child with 3 kg birth weight was not able to take breast feed and was on spoon feeding . on examination , \n his right side of the tongue and floor of mouth was diffusely enlarged , and a bulge was noted at the right submandibular region . \n on palpation , cystic , nonpulsatile mass was felt in the body of the tongue . \n ultrasound revealed a 4 4 2.2 cm mixed cystic mass , probably lymphangioma . computed tomography ( ct ) scan detected a 3.6 3.4 4.2 cm solid mass with cystic areas confined to the tongue with involvement of floor of mouth . \n postoperatively the mass gradually increased in size and by the age of 2.5 months he began exhibiting difficulty in feeding . \n magnetic resonance imaging ( mri ) revealed multicystic purely tongue - based lesion with involvement of floor of mouth and with no involvement of other surrounding structures [ figure 2 ] . \n patient underwent surgery under general anesthesia with nasotracheal intubation and throat pack [ figure 3 ] . \n it featured an outer smooth - muscle layer ( muscularis propria , with circular and longitudinal layers ) , submucosa , and areas of mucosal lining that contained pits and glands and were consistent with gastric mucosa . \n other areas of the mucosa were of the simple columnar type [ figure 6 ] . \n a cystic mass in the anterior two - thirds of the tongue in a newborn can represent ranula , lymphangima , haemangioma , and dermoid cyst . since first reported by duncan and daniel in 1942 , cysts lined with gastric and/or intestinal mucosa have rarely been seen in the tongue or the floor of the mouth . \n these cysts have usually been reported along the alimentary tract , from the esophagus to the colon , and in the gallbladder , pancreas , lungs , larynx , and urinary bladder . \n congenital gastric and intestinal cysts of the oral cavity are more common in boys than in girls . \n these masses involve the anterior aspect of the tongue in 60% of cases . some are asymptomatic , and some cause various degrees of feeding and breathing difficulties or manifest in unexpected ways , such as recurrent bleeding or a brownish discharge from a lingual sinus . \n most of these cysts are solitary , but in some cases more than one cyst has been present . \n these lesions have been given several names , including cystic choristoma , heterotopic gastrointestinal cyst , enterocystoma , and duplication cyst . \n our case fulfilled rickham 's diagnostic criteria for duplication cysts including the presence of a smooth - muscle coat , an attachment of the cyst to a part of the alimentary tract , and the presence of a mucosal lining from the alimentary tract . \n extensive research revealed only ten cases of which only two were multilocular.[3917 ] lingual foregut duplication cysts are believed to arise from endodermal cells that become trapped during the fusion of the lateral lingual swelling ( distal tongue bud ) and the tuberculum impar ( median tongue bud ) in the 3- to 4-mm embryo . \n these pluripotential cells can differentiate into various types of epithelium , including gastric , intestinal , colonic , and even respiratory [ figure 7 ] . developmental picture in addition to a clinical examination , the initial evaluation of a newborn with a lingual mass can include ultrasonography , computed tomography(ct ) , and/or magnetic resonance imaging(mri ) . \n excising an intralingual cyst whose wall adheres to the surrounding muscles is a tedious exercise , especially in an infant with a large cyst . \n intralingual foregut duplication cyst should be considered in the differential diagnosis of a lingual cystic mass in an infant . \n early surgical excision in a symptomatic patient is desirable in order to avoid failure - to - thrive , respiratory distress , or more extensive surgery later .", "role": "user" }, { "content": "congenital lingual cystic masses are challenging entities that can be detected prenatally or are discovered in various forms after birth . \n foregut duplication cyst of tongue is an extremely rare condition . here \n we present the eleventh case in literature on foregut duplication cyst in tongue lined with gastric mucosa . \n complete excision was curative with no recurrence on followup .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cardiomyopathy is a main cause of death in most developed countries ( mortality and causes of death , 2015 ) . according to the american heart association s definition , \n cardiomyopathy is a group of diseases of the myocardium characterized by improper ventricular hypertrophy or dilation , and lead to mechanical and electrical dysfunction of the heart ( maron et al . , 2006 ) . \n based on morphological abnormalities and clinical manifestations , cardiomyopathies are classified as hypertrophic cardiomyopathy ( hcm ) , dilated cardiomyopathy ( dcm ) , arrhythmogenic right ventricular cardiomyopathy ( arvc ) , restrictive cardiomyopathy ( rcm ) , lv noncompaction , conduction system disease , ion channelopathies , myocarditis ( inflammatory cardiomyopathy ) , or stress cardiomyopathy . \n patients with dcm typically exhibit enlargement of the left ventricular chamber and often experience systolic abnormalities . \n dcm is the third leading cause of heart failure and frequently requires heart transplantation ( maron et al . , 2006 ) . \n , 1989 ; miura et al . , 2002 ) . moreover , approximately 2035% of dcms is familial and is associated with at least 40 genes or loci . with advances in genetic technologies used for diagnosis of dcms , the number of genes proposed to contribute to cardiomyopathy has increased to at least 100 ( dellefave and mcnally , 2010 ) . \n genetic alterations detected in patients with familial dcm are usually inherited in a dominant - negative manner . \n although only a subset of dcm is caused by specific gene mutations , studies of these gene mutations and their phenotypes will provide molecular insights into the etiology of dcm . \n familial dcm was once considered a single specific disease ; however , it is now known to have heterogeneous histopathological features and penetrance according to the causative gene mutations . \n genes associated with dcms are classified into several groups , including genes encoding nuclear envelope proteins , sarcomere proteins , structural proteins , ion channels , and unclassified proteins ( dellefave and mcnally , 2010 ) . in this review \n 1 ) . contractile force generation in cardiomyocytes and its faithful delivery to the extracellular matrix and neighboring cells are essential for heart function . \n over 300 mutations in sarcomere proteins have been shown as causes of dcm and other heart diseases ( morita et al . , 2005 ) . \n human genetic studies have shown that many familial dcm cases are linked to alterations in sarcomere proteins such as cardiac actin ( actc1 ) , myosin - binding protein c ( mybpc3 ) , -myosin heavy chain ( myh6 ) , -myosin heavy chain ( myh7 ) , troponin c ( tnnc1 ) , troponin i ( tnni3 ) , troponin t ( tnnt2 ) , -tropomyosin ( tpm1 ) , and titin ( ttn ) ( fatkin et al . \n , 2014 ; kamisago et al . , 2000 ) . among genes encoding these proteins , mutations in myh7 and ttn \n are most common in familial dcm cases ( fatkin et al . , 2014 ; sanbe , 2013 ) . \n myh7 encodes the -myosin heavy chain ( mhc- ) , which is predominantly found in the heart and it forms the thick filament in the cardiac muscle together with other regulatory light chain proteins encoded by myl2 and myl3 . \n the interaction between the head domains of mhc and cardiac actins provides the mechanical force required for cardiac muscle contraction . \n myh7 mutations in residues s532 and f764 , which are positioned in the actin binding and converter domains , respectively , were first reported as a cause of dcm ( kamisago et al . , 2000 ) . moreover , \n an assay that utilizes myosin harvested from s532p and f764l mutant mice revealed that alterations in these residues lead to reduced performance of myosin , which in turn results in dcm through defective force generation in the process of sarcomere contraction ( debold et al . \n in other genetic screening , additional myh7 mutations ( i201 t , t412n , a550v [ head domain ] , t1019n , r1193s , e1426k , and r1634s [ tail domain ] ) were identified as causes of familial dcm ( villard et al . , 2005 ) . \n in all tested patients with these mutations , skeletal muscle defects were not detected , consistent with the predominant expression of myh7 in the heart . \n various titin isoforms form a separate filamentous system in the sarcomere ; this system provides elasticity and structural integrity to the sarcomere . \n titin isoforms range from 3.0 to 3.8 mega daltons in molecular weight and are encoded by the single gene ttn , which consists of 363 exons ( bang et al . , 2001 ) . \n the n - terminal domains of titin proteins from two adjacent sarcomeres are anchored at the z - disc in an antiparallel fashion , overlapping with each other . \n interactions of titin with z - disc proteins ( i.e. , t - cap / telethonin and -actinin ) are implicated in this intersarcomere linkage . \n the centrally positioned i - band region is responsible for the elasticity of titin filaments . the large isoformal variation within the i - band region of titin results in various titin filaments in different types of muscle . for example , the n2b domain is cardiac muscle - specific , whereas both skeletal and cardiac titin have the n2a domain . \n the c - terminal region of titin is connected to myosin filaments through binding to myosin and myosin - binding protein c , which may account for the force transmission generated by atp - driven myosin movement along the actin filaments during muscle contraction . \n similar to the n - terminal regions , the c - terminal regions of titin from each side in a sarcomere juxtapose at the m - line . \n this overlapped positioning of titin at the n- and c - terminal regions enables two sarcomeres to be physically linked and provides the myofibrils with mechanical elasticity . in 2002 , mutations in titin were first identified as a cause of dcm ( itoh - satoh et al . , 2002 ) . \n v54 m and a743v mutations positioned in the z - disc anchoring region of titin have been detected in japanese patients with dcm . \n an in vitro assay revealed that these mutations reduced the binding affinity of titin to z - disc proteins . in the same study , \n although titin is considered to be a primary genetic factor associated with dcm , the comprehensive study of its mutations has been hampered by the large size of the gene . \n using advanced dna sequencing technologies , a recent human genetic study revealed mutations in ttn in 72 of 312 dcm cases , with cosegregation observed in most affected families ( herman et al . , 2012 ) . \n most of these sequence variations are nonsense , frame - shift , or splicing - site mutations , which are likely to generate truncated titin proteins . \n these mutations in titin are highly enriched in the a band region , whereas no mutation has been found in the m - line and z - disc regions . \n therefore , truncation mutations in the a band region of titin are most common in patients with dcm . \n normal heart function requires faithful delivery of contractile force from the sarcomere to the plasma membrane ( the sarcolemma for muscle cells ) and the extracellular matrix . \n multiple filamentous systems that physically connect the sarcomere to the sarcolemma are thought to play critical roles in force transmission ( fig . \n 1 ) . desmin , encoded by the des gene , forms a filamentous system that links the nucleus , myofibrils , and plasma membrane . \n desmin filaments surround the myofibrils at the z - disc and attach to the sarcolemma via desmosome proteins , such as desmoplakin , plakoglobin , and plakophilin-2 . internally \n these interactions result in bundling of adjacent myofibrils and anchor the myofibril bundle to the sarcolemma and the nuclear envelope , providing structural integrity to the sarcomere . in a candidate - gene approach , \n the i451 m mutation of the tail region of desmin was identified as a cause of dcm ( li et al . , 1999 ) and found to cosegregate in a four - generation family with dcm . \n affected family members had left ventricular dilation and heart failure , followed by sudden death . \n a mutation in the central rod domain of desmin was also found to be associated with skeletal muscle diseases ; however , patients with dcm harboring the i451 m mutation did not exhibit clinically significant indications of skeletal muscle defects , suggesting that there are distinct molecular pathways underlying skeletal and cardiac myopathies . \n consistent with this notion , desmin - null mice exhibit abnormal alignment of myofibrils in cardiomyocytes , leading to degeneration and necrosis of the myocardium ( milner et al . , \n the connections among sarcomeric actin , dystrophin , dystrophin - associated proteins , and the extracellular matrix also play important roles in force transmission and provide structural integrity to the sarcolemma . \n an actin - binding domain in the n - terminus and dystroglycan complex - binding domain in the c - terminus are divided by a long central rod domain . although mutations in dystrophin manifest as skeletal muscular dystrophy , affected individuals also exhibit dcm phenotypes . \n dmd , the single gene encoding dystrophin , is expanded 2.5 megabases on the x chromosome . \n duchenne muscular dystrophy ( dmd ) is the most prevalent disease resulting from mutations in dmd and is characterized by gradual muscle weakness in young boys ; female carriers rarely have symptoms upon x chromosome inactivation . \n patients with dmd often exhibit cardiac disorders and develop heart failure , mostly at the last stage of the disease . \n a few recent reports have shown that cardiovascular treatments improve the clinical status in patients with dystrophin muscular dystrophy ( kamdar and garry , 2016 ) . \n in several cases , mutations in dmd caused x - linked dilated cardiomyopathy ( xldcm ) without clinical signs of skeletal muscle defects ( berko and swift , 1987 ; muntoni et al . , 1993 ) . \n xldcm is characterized by a more rapid progression of cardiomyopathy compared with dmd and leads to the death of affected individuals at the age of 1020 years . \n a mouse experiment revealed that coxsackievirus - mediated postnatal cleavage of dystrophin caused disassembly of the dystrophin complex and development of dcm in infected mice , suggesting that malfunction of dystrophin can cause acquired dcm ( badorff et al . , 1999 ) . \n the n - terminus of dystrophin interacts with actin , and the c - terminus binds the extracellular matrix via the dystrophin - associated glycoprotein complex ( dgc ) , which is a multi - protein complex spanning the plasma membrane . \n the dgc consists of - , - , - , and -sarcoglycans ; - and -dystroglycans ; syntrophin ; dgc - associated proteins ( daps ) ; dystrobrevin ; caveolin-3 ; and neuronal nitric oxide synthase ( nnos ) . \n fragility of the sarcolemma caused by loss of dgc proteins is thought to cause dcm . \n indeed , mutation in the sgcd gene encoding -sarcoglycan leads to familial and sporadic dcm ( tsubata et al . , 2000 ) . \n ca enters cardiomyocytes through voltage - gated calcium channels ( ltccs ) embedded in the sarcolemma . \n influx of ca triggers opening of the ryr calcium channel in the sarcoplasmic reticulum ( sr ) , which initiates sarcomere contraction . \n re - influx of released cytoplasmic ca into the sr to relax the sarcomere is mediated by the sr calcium - atpase pump ( serca2a ) . \n phospholamban , encoded by the pln gene , modulates ca recycling by inhibiting serca2a , and its activity is blocked by protein kinase a ( pka)-mediated phosphorylation . \n the r9c mutation in phospholamban causes dcm in a dominant - negative manner ( schmitt et al . , 2003 ) . \n a transgenic mouse experiment revealed that the r9c mutation prevents pka - mediated phosphorylation of phospholamban , leading to constitutive inhibition of serca2a and delaying uptake of cytoplasmic ca . \n therefore , abnormal intracellular ca cycling is thought to cause dcm in human patients with the r9c mutation . \n scn5a protein is predominantly found in the heart and it plays a critical role in the modulation of the heartbeat . \n dcm has been found to be caused by missense and deletion mutations in scn5a ( olson et al . , 2005 ) . \n patients with scn5a mutations exhibit early - onset dcm with concomitant atrial fibrillation and conduction defects . \n the sur2a subunit of the atp - sensitive potassium channel in the heart , which is thought to adjust the membrane potential required for metabolic sensing of heart function . \n mutations in the abcc9 consists gene encoding sur2a have been reported as causes of dcm ( bienengraeber et al . , 2004 ) . \n the nuclear envelope consists of inner and outer nuclear membranes , being divided by a perinuclear space ( fig . \n the nuclear lamina is a protein meshwork located beneath the inner nuclear membrane ( butin - israeli et al . , 2012 ) . \n lamin proteins are the major components of the nuclear lamina . in mammals , three lamin genes , \n i.e. lmnb1 , lmnb2 , and lmna , encode all known lamin isoforms ( burke and gerace , 1986 ; gerace and blobel , 1980 ) . \n emery - dreifuss muscular dystrophy ( edmd ) is a genetic disorder with joint contracture and progressive wasting and weakness of skeletal muscles ( emery , 2000 ) . \n mutations in lmna cause autosomal - dominant ( ad - edmd ) and less frequent recessive ( ar - edmd ) forms of edmd ( bonne et al . , 1999 ; raffaele di barletta et al . , 2000 ) . \n mutations causing ad - edmd identified by an initial genetic analysis include q6x , r453w , r527p , and l530p ; these mutations are enriched in the c - terminal tail domain of lamin a / c ( bonne et al . , 1999 ) . \n later studies showed that ad - edmd also results from h222y and r249q mutations ( bonne et al . \n a family study revealed that lmna mutations also resulted in dcm without skeletal muscle disorders ( fatkin et al . , 1999 ) . in this study , 11 families with autosomal dominant dcm and conduction system failure were evaluated , and five novel lmna mutations were identified : r60 g , l85r , n195k , e205 g , and r571s . \n each mutation caused inheritable conduction system disorders ( atrial arrhythmia , atrioventricular conduction block , or sinus bradycardia ) and dcm . \n however , no family member had clinical indications of edmd , such as joint contracture or skeletal myopathy . moreover , \n four of these five mutations are positioned in -helical rod domains , whereas the remaining mutation was detected in the c - terminal tail domain of lamin a / c ( fatkin et al . , 1999 ) . \n this result implies that structural alteration of the -helical domain of lamin a / c selectively causes dcm with conduction system disorders , whereas defects in the tail domain lead to diverse clinical features . \n indeed , another mutation in the tail domain of lmna ( r482q ) was identified in patients with dunnigan - type familial partial lipodystrophy ( fpld ) , which is associated with adipocyte defects , insulin resistance and diabetes , does not induce muscular or cardiac defects ( cao and hegele , 2000 ) . \n lmna mice are the first lmna - mutant animal model created ( sullivan et al . , 1999 ) and were established by removing the c - terminal regions encoded by exon 8 to the first half of exon 11 . \n lmna offspring resulting from intercross of lmna mice undergo overtly normal embryonic development as compared to their heterozygous and wild - type littermates . \n however , their growth is significantly reduced starting from 23 weeks after birth , and they finally die at approximately 8 weeks of age , primarily because of muscle and cardiac defects . in a detailed study , dcm with conduction abnormality was developed by 46 weeks of age in lmna mice ( nikolova et al . , 2004 ) , and \n the left ventricle ( lv ) of the heart was found to be dilated , round in shape , and thin - walled compared to that in wild - type mice . \n lmna mice show an intermediate severity of cardiac dysfunction and cellular defects in cardiomyocytes at 46 weeks of age . \n interestingly , an independent study showed that lmna mice develop severe cardiac abnormalities at 12 months of age analogous to those in humans with lmna - mediated dcm ( wolf et al . , 2008 ) . \n created the lmna mouse model to study loss of function of lmna ( kubben et al . , 2011 ) . \n lmna mice were created by placing a gene trap cassette between exon 1c and exon 2 of lmna , which introduced the lmna exon 1- or exon 1c--geo fusion allele . \n consequently , lmna mice did not produce any functional or dominant - negative variants of lamin a or lamin c protein . \n in contrast , lmna mice express a truncated protein from exon 1 to exon 7 that seemingly exerts weak toxic effects . \n , the growth of lmna mice is reduced , and growth ceases at postnatal day 13 . \n the mice then die at approximately 1618 days of age , exhibiting defective postnatal development in multiple tissues ; therefore , this is the mouse model closest to complete lmna loss of function to date . \n mouse models of missense lmna mutations identified in patients with ad - edmd have been also reported . \n lmna mice were created by introducing a point mutation into exon 4 of lmna ( arimura et al . , 2005 ) , and they exhibit indications of muscular dystrophy and dcm at approximately 8 weeks after birth , which is analogous to the symptoms observed in humans with ad - edmd . in another study , a transgenic mouse line that overexpresses \n lmna m371k had a significantly lower birth rate than expected and typically died at 27 weeks after birth , which suggests that the m371k mutation in lmna can recapitulate human disease in a dominant - negative manner . \n immunohistochemical examination revealed that expression of the m371k isoform of lamin a in cardiomyocytes leads to distortion of nuclear shape , which may lead to tissue and organ disorder . \n ( 2005 ) generated lmna mice , which harbor a missense mutation in exon 3 of lmna . \n these mice develop dcm - specific phenotypes and eventually die from arrhythmia at 1216 weeks of age . \n mouse models of lmna cardiomyopathy provide significant molecular insights into the pathophysiology of this disease . \n gene expression profiling indicated that hearts from lmna mice overexpressed downstream targets of the mapk cascade such as erk1/2 and jnk ( muchir et al . , 2007 ) . \n treatment of lmna mice with the mek inhibitor pd98059 significantly reduced cardiac defects as measured by normal cardiac function without overt lv dilation at 4 months of age ( muchir et al . , \n administration of the jnk inhibitor sp600125 to lmna mice also alleviated cardiac defects ( wu et al . \n studies using the lmna mouse model have proposed another target for treatment of lmna cardiomyopathy . \n recent studies showed the expression level of mtorc1 pathway components was increased in heart and skeletal muscles of lmna mice ( choi et al . \n treatment of lmna mice with rapamycin or temsirolimus , which are mtor inhibitors , effectively blocked mtorc1 signaling , alleviated muscle dysfunctions , and prolonged the lifespan of these mice . \n dcm is a life - threatening disease that frequently results in heart failure . identifying genetic factors that cause the clinical manifestation of a disease \n is required for defining the molecular trigger that initiates the disorder and the cellular response to the trigger . moreover , \n complete profiling of the genetic causes of a disease is beneficial for an accurate diagnosis , particularly for diseases in which the clinical outcome is unclear or overlaps with other diseases . to date , genetic analyses of patients with familial dcm have shown causative relationships for mutations in more than 40 genes . \n these gene products are classified as sarcomere and structural proteins , ion channels , and nuclear envelope components . \n failure of contractile force generation and transfer to the extracellular matrix , inefficient ca cycling , defective ion transport , and nuclear fragility can lead to dilation of ventricles and systolic dysfunction . although current treatment of dcm is largely limited to the alleviation of clinical symptoms , further elucidation of these molecular processes and their cellular responses should provide new strategies to cure or mitigate cardiac dysfunction and heart failure . moreover , monogenic genetic disorders such as familial dcm may be excellent targets for gene editing technology . \n the crispr / cas9 system binds to the target sequence in the genome and generates double - stranded breaks with an unprecedented high efficiency . \n mutated genes can be replaced by correct sequences via homology - directed repair ( hdr ) . \n indeed , the crispr / cas9 system has been used to successfully correct dystrophin gene mutations in mdx mice . \n therefore , this newly emerged technique is of great interest for therapies to treat human patients with familial dcm .", "role": "user" }, { "content": "cardiomyopathy is a major cause of death worldwide . \n based on pathohistological abnormalities and clinical manifestation , cardiomyopathies are categorized into several groups : hypertrophic , dilated , restricted , arrhythmogenic right ventricular , and unclassified . \n dilated cardiomyopathy , which is characterized by dilation of the left ventricle and systolic dysfunction , is the most severe and prevalent form of cardiomyopathy and usually requires heart transplantation . \n its etiology remains unclear . \n recent genetic studies of single gene mutations have provided significant insights into the complex processes of cardiac dysfunction . to date , over 40 genes have been demonstrated to contribute to dilated cardiomyopathy . with advances in genetic screening techniques , novel genes associated with this disease are continuously being identified . \n the respective gene products can be classified into several functional groups such as sarcomere proteins , structural proteins , ion channels , and nuclear envelope proteins . \n nuclear envelope proteins are emerging as potential molecular targets in dilated cardiomyopathy . \n because they are not directly associated with contractile force generation and transmission , the molecular pathways through which these proteins cause cardiac muscle disorder remain unclear . \n however , nuclear envelope proteins are involved in many essential cellular processes . \n therefore , integrating apparently distinct cellular processes is of great interest in elucidating the etiology of dilated cardiomyopathy . in this mini review , \n we summarize the genetic factors associated with dilated cardiomyopathy and discuss their cellular functions .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: mitochondria are double - membrane cytoplasmic organelles essential for energy supply to the cell . adenosine-5-triphosphate ( atp ) , \n the molecular unit of currency for intracellular energy transfer , is produced by the last of five multisubunit complexes embedded in the inner mitochondrial membrane , which form the respiratory chain ( rc ) responsible for oxidative phosphorylation ( oxphos ) . \n mitochondria have their own dna ( mtdna ) that is a circular , double - stranded molecule ; in humans , it is 16.569 base pairs long and contains genes encoding 13 protein subunits of rc complexes i , iii , iv , and v as well as transfer ( t ) and ribosomal ( r ) rna encoding genes for mtdna - specific translation . \n however , hundreds of additional gene products , providing the components necessary for mtdna replication and expression , many rc complex subunits , and the complex protein network needed for rc formation , activity , and turnover , are nuclear - encoded . \n the term mitochondrial disorder refers to diseases that are caused by oxphos dysfunction and comprises a clinically and genetically heterogeneous group of syndromes that all together are amongst the most common inherited human diseases , with a prevalence of 1 : 5000 . \n deficiencies of single rc complex are generally caused by mutations in genes encoding structural subunits or proteins involved in the assembly of a specific oxphos enzyme complex . on the contrary , \n combined oxphos defects are often associated with impairment of processes such as replication , transcription , or translation of mtdna , which can be due to mutations in either mtdna - encoded rnas ( trnas and rrnas ) or nuclear dna - encoded proteins [ 1 , 2 ] . hundreds of rna and protein factors have been maintained through evolution of eukaryotes to carry out the synthesis of a few , but essential , mtdna - encoded proteins , carried out in situ by organelle - specific translation machinery . \n given the multitude of proteins required for proper mitochondrial protein synthesis , it is not surprising that mitochondrial disorders due to impairment of this essential process are genetically heterogeneous and that , in many patients , the molecular genetic defect remains unknown . \n this review will focus on a group of enzymes with a key role in mitochondrial protein synthesis , the aminoacyl trna synthetases ( mt - aarss ) , mutations of which are responsible for an increasing number of oxphos deficiencies and diseases ( table 1 ) . \n protein synthesis is a complex process that in mitochondria supplies the mtdna - encoded subunits of rc complexes through an organellar - specific translational apparatus distinct from the cytosolic counterpart . \n in fact , there are some distinguishing features for the mitochondrial translation , including the mitochondrial genetic code , which differs from the universal one ( i.e. , aua codes for methionine and uga , instead of being a stop codon , codes for tryptophan ) , and the structure of mitochondrial mrnas , which have no or few 5 untranslated nucleotides , is uncapped and contains a poly ( a ) immediately after the stop codon . the human mitoribosome is made up of 2 ribosomal rnas ( rrna ) and 81 mitochondrial ribosomal proteins ( mrps ) and comprises two subunits , the small ( ssu or 28s ) and the large ( lsu or 39s ) . \n mammalian mitoribosome differs markedly from bacteria , cytosolic , and also from other mitochondrial ribosomes , due to the peculiar recruitment of numerous extraproteins . \n most of the protein components involved in mitochondrial translation such as a multitude of initiation , elongation and termination factors , subunits and assembly protein of mitoribosome , trna - modifying enzymes , and the mt - aarss are encoded by nuclear genes , whereas 2 mitochondrial ribosomal and 22 transfer rnas ( rrnas and trnas ) are encoded by mtdna . \n mitochondrial mrna translation has been hypothesized to take place in a complex bound to the inner membrane through electrostatic force and maybe protein interaction . \n the basic model of mitochondrial protein synthesis is derived from studies in bacteria and can be divided into three phases : initiation , elongation , and termination [ 3 , 6 ] . due to the unusual characteristics of mitochondrial mrna , it is not fully clear how the protein synthesis starts . \n it is thought that mitochondrial initiation factor mtif3 ( the ortholog of prokaryotic if3 ) induces the dissociation of the mitoribosome into its two components , the small ( ssu or 28s ) and the large ( lsu or 39s ) subunits . \n this facilitates the binding of the mrna to the ssu subunit directing the ribosome to the start codon . \n mammalian mitochondria use a single trna for both the initiation and elongation phases ; after aminoacylation , the trna needs to be formylated by methionyl - trna transformylase ( forming fmet - trna ) to initiate mitochondrial translation . a second mitochondrial initiation factor , mtif2 , \n recombining of the mitoribosome subunits and gtp hydrolysis promote the release of mtif3 and mtif2 and the completion of the initiation phase . in the elongation phase , a crucial role \n is played by the elongations factors mteftu , mtefts , and mtefg ( 1 and 2 ) . \n mteftu forms a complex with gtp and a trna charged with its corresponding amino acid , protecting the latter from hydrolysis and facilitating the codon - anticodon recognition at the acceptor site a of the ssu . \n the aminoacyl - trna moves into the peptidyl ( p ) site of the mitoribosome , where the amino acid is added to the growing peptide . \n mtefg1 catalyzes the translocation of trnas from p to exit ( e ) site of the mitoribosome , while mrna is advanced by one codon . \n this last step has been derived from the prokaryotic model ; the e site has been suggested to be very weak or even absent in the mitoribosome . \n the termination phase initiates with the recognition of a stop codon by the mitochondrial release factor ( mtrf1 or mtrf1a ) . \n this causes the detachment of the polypeptide linked to the last trna present in the p site . \n after release of the newly synthesized protein , mitochondrial ribosome recycling factors ( mtrrf and possibly mtefg2 ) enable the mitoribosomal subunits , trna and mrna , to dissociate from each other , allowing the reuse of them for a new round of protein synthesis [ 7 , 8 ] . \n mitochondrial disorders with different clinical presentation have been associated with defects in several enzymes involved in mitochondrial translation including trna - modifying enzyme like trmu ( trna 5-methylaminomethyl-2-thiouridylate methyltransferase , omim#613070 ) and mto1 ( mitochondrial translation optimization 1 , omim#614702 ) or elongation factors like gfm1/efg1 ( omim#609060 ) , tsfm / efts ( omim#610505 ) , and tufm / eftu ( omim#610678 ) [ 11 , 12 ] . \n aminoacyl - trna synthetases ( aarss ) are key enzymes in the translation of the genetic information . \n in fact , they catalyze the specific attachment of each of the 20 amino acids ( aa ) to a cognate trna , through a two - step reaction , where they first activate the amino acid with atp , forming an intermediate aminoacyl - adenylate , and then transfer the aminoacyl group to the 3-end of its own trna [ 3 , 13 ] . with the exception of gars and kars , mitochondrial and cytoplasmic aarss are encoded by distinct nuclear genes . \n the gene for mitochondrial glutaminyl - trna synthetase has not been found yet , possibly because mitochondrial glutamyl - trna synthetase ( ears2 ) efficiently misaminoacylates mt trna to form glutamate charged - trna . \n hence , mt - aarss are 19 instead of 20 , including the 2 with double localization . \n mt - aarss are encoded by nuclear genes ( aars2 ) , imported into mitochondria , and their interaction with cognate trnas seems to be essential for their amount and stability . \n mt - trna genes are located in three transcription units : the short h - strand unit ( with the rrna region and two trna genes ) is transcribed twice as fast as the l - strand that contains eight trna genes and more frequently then the entire h - strand unit that produces 14 trnas . \n king and attardi showed that steady - state levels of different trnas remain uniform suggesting a mechanism of posttranscriptional regulation of redundant trnas . \n aarss structure typically presents a catalytic domain and an anticodon binding domain ; some of them have also an editing domain to deacylate mischarged amino acids , preventing insertion of incorrect amino acids during protein synthesis . \n these enzymes can be classified into two distinct classes according to the structure of the catalytic site : class i enzymes bear the classical rossmann fold ( defined as an adenylic - nucleotides recognition site ) that displays five parallel -strands connected via -helices and the two signature motifs ; class ii enzymes display an alternate folding , mainly constituted by a sheet of six antiparallel -strands and three motifs of less - conserved sequences . during evolution , \n cytosolic aarss have been discovered to play many other roles with either extracellular ( cytokines or angiogenesis regulators ) or cytoplasmic activities being involved in apoptosis , synthesis of rrna , or trna export to the cytosol . on the other hand , also mt - aarss have been investigated for having additional functions ; for instance , it has been demonstrated that the yeast homologue of human mitochondrial lysyl - trna synthetase is a dual function protein , involved in both aminoacylation of mitochondrial trna and import of cytosolic trna into mitochondria . \n an increasing fraction of mitochondrial protein synthesis deficiencies are caused by mutations in one of the aars2 genes and have been associated with diverse clinical presentations , usually with an early onset and transmitted as autosomal recessive traits . \n such a broad clinical spectrum can be partially explained by the multiple and still unknown functions of mt - aarss . \n however , there is a strict genotype - phenotype correlation for most of these genes , albeit the reason for specific and different cellular or tissue damage , being all aarss ubiquitous enzymes working in the same pathway is not clear . because of the fundamental function of these enzymes \n , it has been suggested that mt - aarss loss of function mutations is not compatible with extrauterine life and that a residual enzymatic activity can result in different tissue alterations after development . \n we present an overview of the main clinical presentations associated with mutations in aars2s , which have been identified in the last 10 years , initially by linkage mapping / homozygosity mapping and candidate gene analysis and , more recently , by next - generation whole exome sequencing ( wes ) . \n dars2 , encoding the mitochondrial aspartyl - trna synthetase ( mt - asprs ) , was the first aars2 gene reported to cause a human disease , characterized by a peculiar leukoencephalopathy named lbsl ( leukoencephalopathy with brain stem and spinal cord involvement , omim # 611105 ) associated with cerebellar ataxia , spasticity , and variable degree of cognitive impairment . \n to date , more than 30 families have been described with mutations in dars2 ( table 1 ) . in mutant patients , high \n white matter changes , involving brain stem and spinal cord tracts , are very peculiar . \n almost all patients with lbsl are compound heterozygotes , sharing a complex rearrangement in one allele that involves a t - c stretch upstream from exon 3 ( 228 - 20/-21delttinsc ) and a second variable , usually missense , mutation . \n the splice site mutation in intron 2 is a hypomorphic mutation that partially interferes with the splicing of exon 3 , leading to frameshift and premature truncation ( arg76serfsx5 ) of only a fraction of dars2 transcripts , maintaining some mt - asprs residual activity . \n van berge et al . tried to explain the brain tissue specificity showing differences in mrna splicing process between neurons and other cells . \n some compound heterozygous patients have been reported to show atypical presentations including specific mri pattern associated with no clinical symptoms or no lactate elevation . \n homozygous dars2 mutations have been shown to cause a more severe phenotype [ 26 , 27 ] or exercise - induced paroxysmal gait ataxia and areflexia . surprisingly , blue - native page as well as spectrophotometric measurements often revealed normal oxphos enzyme activities in muscle and cultured cells . \n mutations in rars2 gene have been described so far in more than 10 families ( table 1 ) . \n the first patients described with mutations in rars2 , the gene encoding for the mitochondrial arginyl - trna synthetase ( mt - argrs ) , presented progressive atrophy in cerebellum , pons ( pontocerebellar hypoplasia type 6 , pch6 ; omim#611523 ) , with cerebral cortex and white matter involvement , causing a severe infantile clinical picture characterized by lethargy , seizures with apneic spells , hypotonia , and premature death . \n these consanguineous sephardic jewish patients harboured a homozygous splice site variant ( ivs2 + 5a > g ) and showed multiple rc defects in muscle and fibroblasts . \n however , at least three rars2 mutant patients , carrying missense mutations , have been reported without any rc defect in muscle [ 30 , 31 ] . later \n , it has been demonstrated that the subtype 1 of pontocerebellar hypoplasia ( omim#607596 ) , characterized by a neuropathological profile with loss of spinal anterior horn cells , diffuse gliosis , flat cerebellar folia , loss of purkinje cells , and pontocerebellar hypoplasia , can be also caused by mutation in rars2 . \n recently , compound heterozygous rars2 mutations have been described in patients with neonatal onset epileptic encephalopathy and typical pch6 mri findings . \n these mutations have been shown to cause reduced rars2 amount and activity , associated with impaired trna stability . \n only two missense mutations in this gene have been reported till now , associated with myopathy , lactic acidosis , and sideroblastic anemia ( mlasa , omim#613561 ) . \n these mutations , present in homozygous state in different patients , affect the enzyme catalytic domain causing generalized mitochondrial translation defect in myoblasts . \n recently , a more severe phenotype has been described associated with the known homozygous mutation c.156c > g ; p.phe52leu . \n complexes i , iii , and iv were defective in skeletal muscle but not in fibroblasts . \n gel filtration experiments showed that mt - tyrrs is part of high - molecular - weight complexes ( 250 kda and 1 mda ) , suggesting that , like some of the cytoplasmic aarss , mt - aarss could also occur in high - molecular - weight complexes . \n described three probably related palestinian infants with a homozygous mutation c.1169a > g ( p.asp390gly ) in sars2 , the gene encoding the mitochondrial seryl - trna synthetase ( mt - serrs ) . \n they were affected by a multisystem disorder , characterized by prematurity , progressive renal failure leading to electrolyte imbalances , metabolic alkalosis , and pulmonary hypertension , called hupra syndrome ( hyperuricemia , pulmonary hypertension , renal failure , and alkalosis , omim#613845 ) , and died within the first 14 months of life . \n mt - trna catalyzes the ligation of serine to two mitochondrial trna isoacceptors : trna and trna . \n the asp390gly mutation impacts the acylation of trna but probably not that of trna with severe decrease in the expression of the nonacylated transcript and the complete absence of the acylated trna . \n recently , a novel sars2 homozygous mutation c.1205g > a ( p.arg402his ) has been identified in a girl and her brother with hupra syndrome . \n all alanyl - trna synthetase orthologs have an aa binding pocket equally accessible by alanine , serine , and glycine ; hence , this enzyme contains an editing domain , in addition to the catalytic one , essential to deacylate the mischarged trnas . in 2011 , gtz et al . \n described aars2 mutations causing hypertrophic cardiomyopathy and lactic acidosis in infants from two different families , one being homozygous for the p.arg592trp mutation and the other being compound heterozygous for the p.arg592trp and the missense p.leu155arg . \n all patients died at few months of age ; they showed a drastic deficiency of rc complexes i , iii , and iv in heart tissue , with less severe defects in brain and skeletal muscle ( omim#612035 ) . \n p.arg592trp localizes in the editing domain , thus probably affecting the recognition of mischarged trnas , while the other missense mutation is located in the aminoacylation domain . \n aars2 mutations can be also associated with a different clinical presentation , characterized by cerebellar ataxia and psychotic features with leukoencephalopathy . \n described mutations in mars2 encoding the mitochondrial methionyl - trna synthetase ( mt - metrs ) , which cause autosomal recessive spastic ataxia with leukoencephalopathy ( arsal or spastic ataxia 3 , omim#611390 ) in humans and neurodegeneration in flies . \n patients ' brain mri showed cerebellar atrophy and white matter alterations sometimes associated with thin corpus callosum ; disease onset was very variable . in all arsal subjects , \n complex gene rearrangements were identified in mars2 , including homozygous duplication or compound heterozygous duplication - deletion ( in this last case , disease onset was anticipated ) . despite increased levels of aberrant mars2 transcripts , \n furthermore , patients ' fibroblasts displayed a reduced complex i activity as in mutant flies and immortalized lymphoblast lines showed an impaired translation . \n mutations in hars2 , encoding the mitochondrial histidyl - trna synthetase ( mt - hisrs ) , have been associated with perrault syndrome in a family with five members affected ( omim#614926 ) . \n this recessive syndrome is genetically heterogeneous , being caused by mutations in different genes ( hsd17b4 , clpp , and lars2 , besides hars2 ) , and is associated with premature ovarian failure in females and progressive hearing loss in both males and females . \n the hars2 mutant patients were compound heterozygous for two missense mutations , p.val368leu and p.leu200val , the latter creating an alternative splice site that causes an in - frame deletion of 12 codons . both missense mutations caused significantly decreased enzyme activity compared to wild type . \n the enzymatic defect and the oxidative phenotype in the yeast model were more severe for the p.val368leu mutation . \n more recently homozygous mutations in lars2 , encoding the mitochondrial leucyl - trna synthetase ( mt - leurs ) , have been found in patients with perrault syndrome ( omim#615300 ) . \n three affected subjects from a consanguineous palestinian family carried a homozygous p.thr522asn substitution of a highly conserved residue in the catalytic domain , whereas compound heterozygous mutations were found in a slovenian woman : a c.1866c > t transition resulting in a p.thr629met substitution at a residue conserved in mammals , and a 1-bp deletion ( c.1077delt ) predicted to yield a 373-amino - acid truncated protein with 14 novel amino acids at the c terminus ( p.ile360phefster15 ) . \n analysis in yeast models suggested reduced activity relative to wild type for the identified mutations . \n mutations in the mitochondrial phenylalanine - trna synthetase , fars2 ( mt - phers ) , have been identified by wes in two couples of siblings , characterized by fatal epileptic encephalopathy , liver disease , and lactic acidosis . \n neuropathological findings together with liver disease filled the criteria for alpers - huttenlocher syndrome ( omim#614946 ) . \n the saudi siblings were homozygous for a homozygous 431a - g transition , resulting in a tyr144cys ( y144c ) substitution at a highly conserved residue in the catalytic domain . \n the finnish siblings were compound heterozygous for two missense variants , c.986t > c ( p.ile329thr ) and c.1172a > t ( p.asp391val ) , affecting residues in the atp - binding site in the aminoacylation domain , or in the anticodon stem - binding domain , respectively . \n blue - native gel electrophoresis showed a defective complex iv in both brain and muscle , whereas complex i was decreased only in brain . \n recently , a partial genomic deletion and a p.asp325tyr missense mutation in fars2 have been described in a patient with early - onset epilepsy and isolated complex iv deficiency in muscle . \n the biochemical defect was found in myoblasts but not in fibroblasts and was associated with decreased steady - state levels of coxi and coxii proteins and reduced steady - state levels of the mt - trna transcript . \n mutations in this gene have been identified by wes in a single italian patient and then found in 11 additional patients with similar mri alterations , described as ltbl ( leukoencephalopathy with thalamus and brain stem involvement and high lactate , omim#614924 ) . only one additional patient with ears2 mutations has been described to date . \n ears2 mutant patients presented a peculiar biphasic clinical course : an infantile disease onset with rapid progression followed by stabilization , and in some cases improvement , and partial recovery of lost skills . \n mri displayed abnormal thalami , midbrain , pons , and medulla oblongata and alterations of cerebral and cerebellar white matter . \n all patients were compound heterozygous for a severe mutation and a milder one , suggesting that there is a threshold for mtglurs activity to cause the disease . \n the only patient reported with a homozygous severe mutation ( p.lys65glu ) presented a dramatic phenotype with brain and liver involvement and a fatal outcome at age 3 months . \n recently , mutations in other two mt - aarss have been reported as causative of severe recessive infantile disorders with oxphos deficiency . a homozygous missense mutation ( p.thr367ile ) in vars2 \n , the gene encoding the mitochondrial valyl - trna synthetase ( mt - valrs ) , has been found in a child with psychomotor delay , seizures , and facial dysmorphisms . \n two siblings with phenotype characterized by hypotonia , psychomotor retardation , and premature death were found to be compound heterozygous for a splice site ( c.695 + 3a > g ) and a missense ( p.pro282leu ) mutation in the mitochondrial threonyl - trna synthetase gene tars2 . \n in addition to genes coding for mitochondrial - only or cytosolic - only aarss , two genes , gars and kars , encode enzymes , glycyl - trna synthetase ( glyrs ) and lysil - trna synthetase ( lysrs ) , which catalyze the reaction in both mitochondria and cytosol . \n dominant gars mutations have been found in patients with charcot - marie - tooth disease type 2d ( cmt2d ; omim#601472 ) and with distal hereditary motor neuronopathy type va ( hmn5a ; omim#600794 ) [ 48 , 49 ] . experimental evidence demonstrated a key role for glycine - trna synthetase in maintaining peripheral axons . \n the dominant transmission can be ascribed to either loss of function ( haploinsufficiency ) or a dominant - negative loss - of - function effect , but also aberrant pathogenic function of the mutant protein has been hypothesized . \n remarkably , most of the known mutations in cytoplasmic arss are associated with a cmt phenotype or related neuropathies . \n mutations in yars have been described in patients with dominant intermediate ( di ) cmt type c , whereas aars mutations have been found in patients with a cmt2 phenotype and cmt2n ; hars mutations have been also associated with axonal peripheral neuropathy . \n mutations in kars have been initially described in a patient with an intermediate form of autosomal recessive charcot - marie - tooth disease ( cmtrib ; omim#613641 ) , developmental delay , self - abusive behavior , dysmorphic features , and vestibular schwannoma . \n the p.tyr173serfsx7 variant represents a loss - of - function allele , and p.leu133his represents a severely hypomorphic allele in yeast growth and aminoacylation assays , respectively . \n the presence of compound heterozygosity for a null and severely hypomorphic kars allele may explain the more severe or complex neuropathy phenotype than those found associated with other heterozygous dominant - negative aars mutation . \n very recently , kars homozygous missense mutations have been identified by wes in affected subjects from three consanguineous pakistani families , with nonsyndromic - hearing - impairment phenotype . \n it has been hypothesized that kars variants affect aminoacylation by interfering with binding activity to trna and with formation of the active lysrs tetramer . \n because of the proven localization of lysrs within the cochlea , the authors suggested that perturbations in aminoacylation might affect many of the cellular processes of the different specialized cells of the cochlea and therefore result in hearing impairment . \n as gars and kars encode for both the mitochondrial and cytoplasmic aarss , the evaluation of mitochondrial involvement in these phenotypes is complicated and has not been studied in detail . \n given the function of the mt - aarss , pathogenic mutations are expected to impair binding between trnas and their cognate amino acids , resulting in reduction of charged trna , albeit other defects can be envisaged , such as defective mitochondrial targeting . \n however , analysis of amino acylation is a tricky process that requires a large amount of starting material , and it is rarely performed . \n usually the target of the studies is a downstream effect of mt - aarss dysfunction , such as altered mitochondrial protein synthesis or oxphos deficiency . \n the lack of clear biochemical phenotypes ( oxphos or mitochondrial protein synthesis defects ) in skin fibroblasts and myoblasts from most of mutant aars2 patients prevented the use of cultured cells for functional studies . \n in few rars2 patients , fibroblasts showed oxphos defects , with rc enzymes variably affected ; yars2 patients presented deficient mitochondrial protein synthesis in myotubes but not in cultured fibroblasts . \n microscale oxygraphy ( by seahorse instrument ) could be a more sensible approach to reveal biochemical defects in cell lines : in ears2 mutant fibroblasts , microoxygraphic analysis revealed reduction of maximal respiratory rate and reduced oxygen consumption rate to extracellular acidification rate ratio , reflecting increased production of lactate . \n otherwise , induced pluripotent stem cells derived from patient cell lines , differentiated into various cell types , may offer advantages in future studies . \n the high degree of conservation of several mt - aarss during evolution makes feasible the use of user - friendly bacterial and yeast model to evaluate the effects of identified variants on protein function . in some studies , \n the recombinant mt - aarss proteins ( i.e. , mt - phers and mt - asprs ) were expressed and purified in escherichia coli , allowing the comparison of enzyme parameters such as catalytic activity , atp binding , and protein stability between mutant and wt species . in other works , ( \n i.e. , rars2 , hars2 , lars2 , and kars ) mutations were studied on facultative aerobic yeast saccharomyces cerevisiae \n . the yeast orthologous gene can be inactivated by homologous recombination and the resulting cells then transformed with a centromeric plasmid containing either the wild type or a mutant allele . \n usually , all strains are able to grow in a medium containing a fermentable sugar , but strains with mutations affecting the oxphos system show decreased or abolished respiration and display a reduced growth on nonfermentable medium . \n a restriction in the use of this approach is the high number of yeast aars genes coding enzymes with a double localization , both mitochondrial and cytosolic . \n this limitation can be bypassed with a more complex strategy , based on the inactivation of the endogenous bifunctional enzyme and the reexpression of modified plasmids coding specifically either the cytosolic or the mitochondrial enzyme . at the moment , no mouse model for mt - aarss has been fully characterized and published . \n only two mutagenesis - induced mouse models for gars have been described : a dominant model caused by an in - frame indel mutation at pro278 and a second model with a point mutation ( c201r ) that leads to a nonconservative substitution . \n heterozygous mutant mice showed neurodegenerative changes at the neuromuscular junctions , whereas homozygous mutant mice were embryonic lethal . \n the second model was less severe but displayed locomotor and sensory deficits , with myelination defects not detected in the former model , representing a valuable resource to study the mechanism of axonopathy resulting from gars mutations . \n they recently reported that constitutive knock - out ( ko ) mice had an early developmental arrest with embryonic lethality , whereas conditional cardiac and skeletal muscle ko mice showed dramatically shortened life span and a gradual increase in heart / body weight ratio , with strong reduction of all assembled respiratory chain complexes , except complex ii , in both heart and skeletal muscle . \n two probably more interesting mouse models are undergoing study , based on different brain - specific dars2 depletion in either adult forebrain neurons or in myelin - producing oligodendrocytes . \n the production of conditional tissue - specific mouse models for different mt - aarss could provide an insight into the pathological mechanisms and the selective tissue involvement caused by mutations in these ubiquitously expressed enzymes . \n it is hard to explain why genetic defects in mt - aarss , which are ubiquitous enzymes necessary for mitochondrial translation , can cause so many different phenotypes usually affecting specific tissues or organs . \n different hypotheses have been proposed to explain this variability , but none seems to cover all aspects of this phenomenon , that is probably the result of several different mechanisms altered in mt - aarss mutant patients . \n the first patients with splice - site mutation in either dars2 or rars2 presented with encephalopathy . \n differences in mrna splicing machinery , in abundance of splicing factors , and splicing efficiency between neuronal and other cell types have been hypothesized to explain this tissue specificity . \n however , other patients harbouring dars2 or rars2 missense mutations have been reported later weakening the general value of this hypothesis . \n in addition to dars2 and rars2 mutations , also the tissue specificity present in hars2 mutant patients may be influenced by splicing efficiency in different tissues / organs , in the latter case ovaries and ears . \n however , only one family has been described till now and the identification of other patients with hars2 mutations is required to confirm this observation . \n other types of mutations and their location inside the protein could have an influence on the resulting phenotype . \n for instance , the aars2 p.arg592trp mutation is located at the surface of the editing domain , which functions in deacylating the mischarged trnas , and is predicted to affect the recognition of mischarged trnas . \n the pathogenic mechanism of this mutation may be linked to mitochondrial mistranslation and hence be different from other mt - aars defects . \n why mistranslation would lead specifically to cardiomyopathy , while translation deficiencies caused by other mt - aarss mutations are usually not associated with heart damage remains an open question . \n noteworthy , mutations affecting mto1 , an enzyme responsible for trna modifications that increases the accuracy and efficiency of mtdna translation , have been found in patients with hypertrophic cardiomyopathy . \n alternatively , the bigger susceptibility of some cell types , in particular neurons , for aminoacyl - trna synthetase dysfunction could be linked to the variable expression of mitochondrial trnas in different cells , to the amount of cognate amino acid in a particular tissue , or to different threshold required for optimal enzymatic activity of each mt - aars . \n the brain expresses higher levels of mitochondrial - encoded trnas as compared to other examined tissue , including liver , vulva , testis and ovary , thymus , lymph node , and spleen . \n moreover , variations in the relative expression of trna isoacceptors among tissues have been observed : thus the trna levels could influence the usage of different codons among different tissues . for aars2 mutations , \n the tissue - specific manifestation of the cardiomyopathy could be explained by variable amino acid concentrations in different tissues ; in fact , increased levels of alanine have been found in affected tissue ( heart and muscle ) , but not in the unaffected liver . \n this observation could be due to a compensatory feedback mechanism occurring upon deficient trna aminoacylation or be an unspecific response to rc defect reflecting the alanine secreted from rc - deficient skeletal muscle for gluconeogenesis . \n in addition to yars2 mutations , mlasa can be caused also by mutation in pus1 , encoding pseudouridylate synthase 1 . \n this observation suggests that trna and not a general mitochondrial translation defect is specifically responsible for the combined myopathy and anemia in yars2 mutant patients . \n gars and kars , encoding enzymes acting both in mitochondria and cytosol , require ad hoc comments and considerations . \n few pathological pictures , mainly cmt , have been described caused by defective cytoplasmic aarss ; hence , the neuropathy phenotypes associated with gars or kars mutations have been ascribed mainly to impairment of the cytoplasmic enzyme . \n however , the possible contribution of faulty mitochondrial functionality in the development of the phenotype has not been fully analyzed . \n it should be noted that axonal cmt is frequently caused by mutations in a mitochondrial protein , mfn2 , involved in mitochondrial fusion ; however , it is not known if and how glyrs or lysrs could be linked directly to mitochondrial dynamics or how a mitochondrial synthesis deficiency could lead to axonal dysfunction . while mutations in gars or other cytosolic aarss are inherited as dominant trait , kars mutation are recessive and \n the presence of two mutant alleles has been suggested as responsible for the most severe phenotype in these patients , including acoustic neuroma and dysmorphisms besides cmt . \n more recently , recessive kars mutations have been reported in patients with nonsyndromic hearing impairment without neuropathy , expanding the spectrum of phenotypes associated with kars mutation . \n unfortunately , the selective impairment of mitochondrial protein synthesis has not been investigated in these patients . \n interestingly , hearing problems are present also in patients with pch6 ( due to rars2 mutations ) or perrault syndrome ( caused by lars2 or hars2 mutations ) . in addition , a number of different mutations in several genes of the mitochondrial genome , mainly mtrnr1 encoding the mitochondrial ribosomal rna 12s , and many trna - encoding genes , are responsible for hearing impairment or deafness , in some cases associated with a variety of additional clinical features . \n mutations in dars , encoding the cytosolic asprs , have been recently found in a cohort of patients with a leukoencephalopathy characterized by hypomyelination with brain stem and spinal cord involvement and legs spasticity ( hbsl , omim#615281 ) . \n hbsl resembles lbsl , which is caused by mutations in dars2 , suggesting that these two diseases might share a common underlying molecular pathology . \n many aarss have additional functions beyond translation [ 19 , 65 ] including asprs , which is involved in asparagine biosynthesis . \n it is possible that a common function for dars and dars2 , not strictly related to aminoacylation , could be responsible for the very similar clinical presentations in hbsl and lbsl . \n according to the channeling hypothesis , interaction of mitochondrial trna with proteins , including mt - aarss , are not only necessary for trna synthesis , maturation , and function but also to protect trnas from degradation . \n rapid turnover of free mt - trnas , not aminoacylated or bound to any protein partner , provides a general mechanism for the quality control of the trna pool within the human mitochondria . \n the data obtained from studies on mutated mt - trna support this hypothesis : pathogenic mutations in mt - trna are usually associated with a reduction in trna amount and a decrease of the aminoacylated form . \n similar indications came from studies on patients with aars2 mutations . in mutant rars2 fibroblasts , \n a residual argrs activity is probably present that could aminoacylate a small portion of the trnas , whereas the uncharged trnas become unstable and are degraded . in lymphocytes from patients bearing a homozygous sars2 mutation , \n the amount of trna was strongly reduced and fully nonacylated , whereas the amount of trna isoacceptor was nearly normal . \n the authors concluded that mutation in sars2 significantly impairs the ability of the enzyme to aminoacylate selectively the trna , leading to degradation of the uncharged trna molecules . \n therefore , mutations affecting either mt - trnas or mt - aarss , perturbing their stabilizing interaction , lead to decreased trna levels . additional findings in support to the channeling theory have been obtained in both yeast and human cell lines [ 15 , 67 , 68 ] : the overexpression of cognate , or even noncognate , mt - aarss has been demonstrated to be able to reduce / correct the deleterious effects of some mt - trna point mutations , leading to partial recovery of the steady - state levels of mutated trnas . \n notably , the enzymatic activity of mt - aarss seems to be not required for its rescuing effect . in yeast carrying trna mutations , the recovery has also been obtained by overexpression of an isolated c - terminal portion of yeast leurs , lacking the catalytic domain ; it has been proposed that this polypeptide may act as a chaperone , by directly interacting with mutant mt - trnas , making them less prone to degradation or maintaining them in a structural conformation fostered to react with the endogenous mt - leurs . \n increasing evidences suggest that the pathophysiology of mt - aarss - associated disorders is driven by processes and interactions that are not yet fully understood . for instance , tissue - specific proteins that could interact differentially with the wild - type or mutant mt - aarss , by inhibiting the enzymatic activity or any additional function , might be identified . in general , mt - aarss \n generation of animal models will allow us to better understand mt - aarss functions , interactions , and possibly tissue specificity . \n these studies will surely provide important knowledge about the pathogenetic role of synthetases in the different human diseases .", "role": "user" }, { "content": "mitochondrial respiratory chain ( rc ) disorders are a group of genetically and clinically heterogeneous diseases . \n this is because protein components of the rc are encoded by both mitochondrial and nuclear genomes and are essential in all cells . \n in addition , the biogenesis and maintenance of mitochondria , including mitochondrial dna ( mtdna ) replication , transcription , and translation , require nuclear - encoded genes . in the past decade , a growing number of syndromes associated with dysfunction of mtdna translation have been reported . \n this paper reviews the current knowledge of mutations affecting mitochondrial aminoacyl trnas synthetases and their role in the pathogenic mechanisms underlying the different clinical presentations .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: inflammatory bowel diseases(ibd ) including ulcerative colitis(uc ) and crohn s disease(cd ) are chronic inflammatory disorders of the gastrointestinal tract identified by episodes of relapse and remission . \n ibd had uncertain etiology ; it imagined to be caused by interplaying among different environmental , genetic and immunologic factors . \n previous study revealed that different factors such as infectious diseases and nutrition during infancy , tonsillectomy , appendectomy , lifestyle factors and diet , domestic hygiene , refrigeration of food , time scales of socioeconomic evolution , drugs ( nonsteroidal anti - inflammatory drugs [ nsaids ] and oral contraceptive pills [ ocps ] ) , smoking , intestinal pathogens , and measles vaccination play a role in ibd . \n based on geographical , racial , genetic , sexual , and habitual differences , epidemiological studies are needful . \n numerous studies which have been directed on the epidemiology of ibd ; show considerable differences on geographical incidence . in recent decades \n , the incidence of ibd has been relatively stable , in areas such as u.s . and \n it is estimated that up to 1.4 million people in the united states and 250,000 people in the united kingdom suffer from ibd . however , incidence of ibd increased in previously low incidence areas such as asia . \n ng et al . expressed that the crude annual overall incidence values per 100,000 individuals were 1.37 for ibd in asia ( 0.76 for uc , 0.54 for cd , and 0.07 for ibd - undetermined ) . \n this increase most likely relates to improved physician awareness and diagnostic modalities , environmental and lifestyle factors according to socioeconomic change and rapid industrialization in asian countries . \n although the prevalence and incidence of ibd have not been properly studied in iran , our country is mentioned as a country with an increasing rate of ibd . \n iran is a wide country with different ethnicities , so more studies with focus on epidemiologic and clinical features of ibd can elucidate its pattern in iran . \n this study aimed to survey the epidemiologic features of ibd in guilan province , north of iran . \n in this retrospective cross sectional study , we assessed the documents of 868 patients with ibd that referred to private and governmental clinics and hospitals of guilan province , north of iran , during 2002 - 2012 . \n the diagnosis of ibd was confirmed based on clinical manifestation , radiologic , colonoscopic and pathologic findings and opinion of a gastroenterologist . \n variables such as demographic data ( age , gender , place of living ) , risk factors ( smoking , family history , age at initiation of disease , duration of disease and age at initiation of complication ) , and diagnosis ( site of involvement , pathologic and radiologic findings ) , extraintestinal manifestations and type of treatment ( corticosteroids , immunosuppressive drugs , salicylates , antibiotics and anti tnf drugs ) were evaluated . \n extraintestinal manifestations consist of musculoskeletal , ocular , renal , dermatological , hepatic and pulmonary systems involvements . according to esmat et al.,our diagnosis of uc \n was also based on the evidence of diffuse mucosal disease of colon with different proximal extentions from the rectum , superficial inflammation , crypt abscess , cryptitis and rectal involvement without any evidence of small bowel involvement other than backwash ileitis , in the same way cd was defined as skip lesions at endoscopy , cobblestone appearance , mucosal ulceration on colonoscopy , aphtus lesion found during upper endoscopy , deep inflammation or chronic terminal ileal inflammation with or without radiologic evidence of skip lesions , structuring disease , fistulizing disease existence of perianal disease(skin tags , abscess , fistula ) , or small intestinal involvement and noncaseating granulomas . \n indeterminate colitis ( ic ) was defined as an active and patchy architectural distortion , in the absence of small bowel involvement after radiologic evaluation , ileal intubations , an inconclusive endoscopic appearance , and histologic features that were not specifically diagnostic for cd or uc . \n all the information was collected for each case and then statistical analysis of quantitative and qualitative data was conducted using spss software ( version 18 , usa ) by chi square test . \n this study was approved by ethics committee of gastrointestinal and liver diseases research center ( gldrc ) . \n table 1 shows the demographic and clinical profile of the total number of patients with ibd , 756 people ( 87.1% ) had uc and 112 of them ( 12.9% ) had cd . \n the mean age of patients with uc and cd was 46.7315.79 and 40.1514.27 years respectively . \n the most common age of disease in uc was 40 - 59 years and in cd was 20 - 39 years . \n study 12.6 % of patients with uc and 12.5 % in cd had a family history of ibd . \n frequency of positive family history and cigarette smoking was not different between two disease groups ( p=0.9 and p=0.7 ) . \n the mean age at initiation of disease in patients with uc and cd was 40 and 34.5 years respectively . \n the most common age of disease initiation in uc was 40 - 49 years and in cd 20 - 29 years that was significantly different ( p<0.001 ) . \n the mean duration of disease was 4 and 5 years in uc and cd respectively . \n the mean age at initiation of complication was 40 years in uc and 32 years in cd . \n complications significantly initiated earlier in patients with cd ( p<0.001 ) . in most of patients , complication was initiated at 30 - 39 years in uc ( 28% ) and 20 - 29 years in cd ( 23.6% ) . in present study , 25.4 percent of patients with ibd suffered from extraintestinal manifestations of ibd ( 191 patients in uc and 30 patients in cd ) ( table 1 ) . \n \n the frequency of arthritis , as the most prevalent extraintestinal manifestation was 36 percent . \n most of patients were treated with combination of two drugs ( 60% in uc and 72.3% in cd ) . \n then salicylates were the most common drugs in both groups ( 38.4% in uc and 25.9% in cd ) . \n in the recent decades , the incidence of uc in western countries gradually increased and a few years later , a similar increase was occurred in cd . \n studies in developing countries indicated that although , in comparison with europe and north america , ibd still has a low incidence and prevalence in asian countries , it is increasing rapidly . \n previous studies in iran revealed an increasing rate of uc and cd . in this study \n we assessed the epidemiological features of 868 patients with ibd in a clinic and hospital based study in guilan province during 10 past years . \n our study showed that cd was presented significantly more common in younger patients than uc . \n the mean age of patients with uc and cd was 46.73 and 40.15 years respectively in our study . \n another study in iran showed about 37 and 32 years for uc and cd respectively . \n the ratio of male to female in this study is different with other studies ( 0.92:1 in uc and 0.75:1 in cd ) . in a report by shirazi et al , it was 1.08:1 in uc and 1.83:1 in cd.16 just the same as taghavi et al . \n reported male / female ratio was 0.9:1 and 0.98:1 for uc and cd patients , respectively . \n in iran , the male / female ratio was reported to be 0.8:1 and0.7:1 for uc , also fallahi et al . and derakhshan et al \n . stated 1.4:1 and 1.2:1 for cd patients , in series . a review study in asia by \n prideaux showed an equal gender distribution for uc and demonstrating male predominance for cd . \n \n in asia , \n positive family history was reported in 0.0 - 3.4% of patients with ibd that is lower than the 10 - 25% in western countries . in similar studies conducted by thia \n aghazadeh et al . and shirazi et al . reported lower positive family history in their population . in our study , the rate of positive family history were higher than previous studies . \n our study showed that 12.6 % of patients with uc and 12.5 % in cd had a family history of ibd . \n therefore , when a patient has lower gi symptom and family history of ibd , this disease should be considered for screening . \n studies in the west have shown that smoking is a risk factor for the development of cd but is protective for the development of uc . \n revealed that frequency of smoking was 5.2% in uc and 7.4% in cd . in our study , 3.3% and \n 4.5% smoked cigarette in patients with uc and cd respectively that is lower than previous studies . \n \n in previous studies , \n the prevalence of extraintestinal manifestations of ibd was 25.4% . \n \n in a report by jiang and colleagues , \n 90.5% of patients were prescribed 5-asa , whereas approxi - mately 33.0% took steroids and 27.5% were prescribed immunosuppressors . \n reported the majority of patients with cd ( 41.2% ) and uc ( 76% ) were treated with only 5-amino salicylic acid ( 5-asa ) . \n our study showed that most of patients were treated with combination of two drugs : salicylates and azathioprine ( 60% in uc and 72.3% in cd ) . \n then salicylates were the most common drugs in both groups ( 38.4% in uc and 25.9% in cd ) . \n this difference can be related to severity of disease in patients that we did not consider it in our study . \n this study showed that the incidence of ibd gradually increased during the past 4 years . \n taghavi et al . also showed an obvious increase in the new cases of ibd in the past three decades . \n this development can be associated with augmentation of the diagnostic services and /or increase in public information , although ; it is still not obvious whether this increase in iran is attributable to the environmental features emanating from industrialization or other unfamiliar factors . \n \n as a limitation , \n so it is suggested to do population based prospective studies with considering all related factors and details of disease in future . \n this study showed that cd were presented significantly more common in younger patients than uc and totally the disease was slightly more common in female . \n it is suggested to plan more educational program to improve the time of diagnosis . \n this study was supported by the gastrointestinal and liver diseases research center ( gldrc ) of guilan university of medical sciences ( gums).this survey was approved by ethical committee of gldrc . \n we would like to thank all members of gastrointestinal and liver diseases research center ( gldrc ) that assisted us in this study . \n sources of funding : this study was initiated and conducted by gastrointestinal and liver diseases research center ( gldrc ) of guilan university of medical sciences ( gums ) . \n ", "role": "user" }, { "content": "backgroundthe geographical incidence of ibd varies considerably . \n this study aimed to survey the epidemiologic features of ibd in guilan province , north of iran , during ten years duration . \n methods \n\n in this retrospective cross - sectional study , we assessed the documents of 868 patients with ibd referred to private and governmental clinics of guilan province between 2002 and 2012 . \n variables such as demographic data , risk factors , diagnosis , extraintestinal manifestations and type of treatment were collected . \n results \n\n among 868 patients with ibd , 756 patients ( 87.1% ) diagnosed as uc and 112 patients ( 12.9% ) as cd . the mean age of patients with uc and cd was 46.7315.79 and 40.1514.27 years respectively . \n male / female ratio in uc and cd was 0.92:1 and 0.75:1 respectively . \n the most common age of disease initiation in uc was 40 - 59 years and in cd 20 - 39 years ( p<0.001 ) . \n extraintestinal manifestations were seen in 25.4 percent of patients with ibd . \n most of patients were treated with combination of two drugs : salicylates and azathioprine ( p<0.04 ) . \n the incidence of ibd gradually increased during the past 4 years in guilan province . \n conclusion \n\n this study showed that cd were presented significantly more common in younger patients than uc and totally the disease was slightly more common in female .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: niacin , also called vitamin b3 , refers to both nicotinamide and nicotinic acid . the only route by which nicotinamide is biosynthesized is from tryptophan.1 niacin in the form of coenzymes nad and nadp functions in many reactions such as redox reactions , adp ribosylation , and sirtuin activation . \n niacin deficiency leads to pellagra , the typical symptoms of which are diarrhea , dermatitis , dementia , and death . \n pellagra was common in the united states and parts of europe in the early 20th century among people consuming foods containing low levels of niacin and tryptophan , such as corn . \n pellagra epidemics have been documented in several areas associated with a high dietary dependence on unfortified corn.2 nicotinamide can be synthesized from tryptophan in mammals , and the resultant nicotinamide is distributed to non - hepatic tissues.1 dietary surveys have shown that the amount of nicotinamide biosynthesized from tryptophan is equal to the amount of pre - formed niacin from food intake in japan , and matches the niacin requirement in humans.1,3,4 although niacin can be supplied from amino acid tryptophan , nicotinamide biosynthesized from tryptophan is considered to be a byproduct of the kynurenine pathway , and the amount is thought not to be sufficient to meet the requirement . thus niacin has been recognized as a vitamin . \n disorders resulting from abnormal tryptophan metabolism , such as hartnup disease , show symptoms similar to those of pellagra.5 these facts suggest that conversion of nicotinamide from tryptophan is important in maintaining niacin nutrition . \n conversion from tryptophan to nicotinamide requires nine steps , and this route is called the tryptophan nicotinamide pathway ( fig . \n the tryptophan nicotinamide pathway is divided into two parts : the first part involves metabolic conversion of tryptophan to -amino--carboxymuconate - - semialdehyde ( acms ) , also called the kynurenine pathway , while the second part involves metabolic conversion of acms to nicotinamide . \n most acms is metabolized to -aminomuconate - - semialdehyde by acms decarboxylase ( acmsd ) , leading to picolinic acid or the tricarboxylic acid ( tca ) cycle via glutaryl - coa and acetyl - coa , while some acms is spontaneously cyclized to quinolinic acid . \n the second part consists of quinolinic acid formation , the nad cycle , and nicotinamide catabolism ( fig . \n , quinolinic acid is converted to nicotinic acid mononucleotide in the presence of 5-phosphoribosyl-1- pyrophosphate by quinolinic acid phosphoribosyltransferase ( qprt ) . \n nicotinamide is methylated to n - methylnicotinamide ( mna ) , and mna is then oxidized to either n - methyl-2-pyridone-5- carboxamide ( 2-py ) or n - methyl-4- pyridone-3-carboxamide ( 4-py ) . since nicotinamide and these nicotinamide metabolites \n are excreted in urine , the amounts of urinary nicotinamide and its metabolites can be used as indices to evaluate the amount of nicotinamide biosynthesized from tryptophan.6 of three rate- limiting or key enzymes , the initial enzyme tryptophan 2,3-dioxygenase ( tdo ) , acmsd and qprt in the tryptophan nicotinamide pathway , acmsd is considered to play a crucial role in the formation of nicotinamide . in the present article , recent findings from our animal experiments and human studies are described to elucidate the importance of the tryptophan nicotinamide pathway for maintaining niacin nutrition . in animal experiments , a 14%20% casein diet containing 30 mg / kg nicotinic acid has been generally used . \n we investigated whether rats can maintain their niacin nutrition from nicotinamide supplied only from tryptophan with no dietary niacin.7 rats were fed a niacin - free 20% casein diet starting from the age of 3 weeks until the age of 80 weeks . \n blood nad and liver nicotinamide levels as nutritional biomarkers for niacin in aged rats were the same as those in young rats . \n although urinary excretion of nicotinamide and its metabolites , used as indices of the conversion of nicotinamide from tryptophan , gradually decreased to 60% from 30 weeks of age , these results show that enough dietary tryptophan can sustain niacin nutrition without niacin intake in rats . \n human studies have shown that urinary excretion of nicotinamide metabolites and blood nad levels in elderly japanese are not different from those in young japanese , suggesting a similar conversion ratio in the elderly and young.8,9 although many studies have shown the effects of age on the tryptophan metabolism in animals and humans,1012 little is known about the tryptophan nicotinamide metabolism from nutritional aspects in the elderly people . \n the processes involved in the tryptophan nicotinamide pathway occur in the liver and kidneys . \n the kidneys lack several enzymes , such as tdo and kynureninase.13 to determine the tissue that plays a critical role in the biosynthesize of nicotinamide , we created animal models of renal failure and liver injury , and investigated the relationships between tissue enzyme activities and niacin nutritional status.13,14 rats were fed a diet containing orotic acid , which induces fatty liver.14 in the fatty liver , tdo activity was decreased to 40% , the conversion ratio of tryptophan to nicotinamide to 30% , and liver nad levels to 60% of the values in control animals . \n chronic renal failure was induced by feeding an adenine - containing diet.13 renal failure led to decreases in liver tdo , liver qprt , and kidney acmsd activities , and to an increase in liver acmsd activity , causing the liver enzymes to suppress the conversion of nicotinamide to tryptophan and the kidney enzymes to enhance it . \n the renal failure rats showed lower blood and liver nad levels , and conversion of tryptophan to nicotinamide , corresponding to the changes in liver enzyme activities but not in the kidney enzyme activities . \n these results show that the liver plays a critical role in nicotinamide supply to peripheral tissues ( fig . \n 2 ) . since the kidneys have higher acmsd activity than the liver , and the rats with renal insufficiency showed higher serum quinolinic acid levels,15 the kidney may have the pathway to eliminate tryptophan metabolites rather than to product nicotinamide . \n the processes involved in tryptophan nicotinamide metabolism can be elucidated by measurement of tryptophan metabolites in urine as several urinary tryptophan metabolites increase following tryptophan intake.16 changes in urinary tryptophan nicotinamide metabolites reflect their enzyme activities , and thus can be used as biomarkers to evaluate changes in the pathway.9,17,18 furthermore , apparent tryptophan nicotinamide conversion can be calculated using nicotinamide and its metabolites in urine as output versus tryptophan intake as input in animals fed a niacinfree diet.19 using these techniques , many factors have been found to affect the tryptophan nicotinamide pathway . \n animal studies have shown that the tryptophan nicotinamide pathway is affected by conditions such as diabetes , renal failure , and pregnancy,13,20,21 as well as by nutrients such as protein and fatty acids,22,23 hormones such as thyroxin and adrenaline,24,25 and chemicals such as the anti - tuberculosis drug pyrazinamide , the peroxisomal proliferator clofibrate , and phthalate ester plasticizers.18,26,27 to investigate niacin deficiency , niacin - free and tryptophan - imbalanced diets have been used to create a niacin deficiency animal model.2831 these diets contain low casein levels , high sucrose levels and additional amino acids without niacin , and the rodents show reductions in body weight gain and tissue nad levels which can be prevented by feeding niacin - containing diets . \n however , many factors affect tryptophan nicotinamide metabolism , and elucidation of the effects of factors that affect niacin deficiency , is sometimes difficult in animals fed niacin - free and tryptophan - imbalanced diets . to study the niacin nutritional status regardless of tryptophan status , we generated mice that are missing the qprt gene.32 growth retardation , lower niacin nutritional status including blood and liver nad levels , and no detection of urinary nicotinamide or its metabolites were observed in the qprt - deficient mice fed a niacin - free diet , but not in mice fed a niacin- containing diet . \n histological observation of tissues from the qprt mice fed a niacin - free diet revealed disappearance of the inner circular layer of smooth muscle cells in the small intestine . \n these results indicate that the qprt - deficient mice may be a useful animal model to study niacin deficiency . \n as previously mentioned , dietary surveys of japanese populations have shown that half of the niacin utilized is nicotinamide biosynthesized from tryptophan.4 estimates of how much tryptophan is convertible to nicotinamide are important in deciding niacin requirements in humans . in 1956 \n , a human study first showed that in men approximately 60 mg of tryptophan is equivalent to 1 mg of niacin calculated using supplemented intake of the free form of tryptophan and urinary mna , one of the metabolites of nicotinamide.33 various conversion ratios of tryptophan to nicotinamide were subsequently reported.34,35 one of the reasons for this might be related to the methodologies used : calculations were based on supplemental tryptophan intake and not on proteinous tryptophan intake , not all urinary nicotinamide metabolite was measured , and urinary nicotinamide metabolites are derived from both tryptophan and dietary niacin . \n therefore , we performed a study in humans to determine the conversion ratio of tryptophan to nicotinamide in japanese women fed a niacin - free purified diet not supplemented with the free form of tryptophan.36 young japanese women consumed the niacin - free purified diet for 7 days ; the diet contained 0.67 g / day of tryptophan corresponding to habitual tryptophan intake in japanese women . \n the conversion ratio was calculated from dietary tryptophan and urinary nicotinamide and its metabolites , and 67 mg of tryptophan was found to be equivalent to 1 mg of nicotinamide . \n this finding was adopted as part of the evidence for setting the conversion ratio for tryptophan to nicotinamide in the dietary reference intakes for japanese 2010.3 the ministry of health , labor , and welfare of japan releases dietary reference intakes for japanese every 5 years . \n the dietary reference intakes for japanese 2010 was published in 2009 and was developed to provide reference values for the intake of energy and 34 nutrients for the maintenance and promotion of health and the primary prevention of lifestyle - related diseases in healthy individuals and groups . \n the dietary habits of pregnant women are important for meeting the nutritional needs of the women and their unborn children , especially in the early stages of the growth of the fetus . \n although increased excretion of urinary nicotinamide metabolites during pregnancy was reported as early as the 1940s,37 no evidence has been found as to how tryptophan nicotinamide metabolism is altered in pregnancy . since understanding tryptophan \n nicotinamide metabolism during pregnancy is important in maintaining niacin nutrition in pregnant women and their unborn children , we investigated the urinary excretion of metabolites of the tryptophan nicotinamide pathway from spot urine samples taken from pregnant women.21 spot urine samples were collected from a total of 434 pregnant japanese women who were between 5 to 40 weeks of gestation , and the intermediates and metabolites of the tryptophan nicotinamide pathway in the urine samples were measured . \n urinary excretion of nicotinamide metabolites increased from 20 weeks of gestation during the second trimester , reached a peak of 2.3 times normal at 33 weeks during the third trimester , and declined to control levels postpartum . \n the changes in urinary excretion of 3-hydroxyanthranilic acid and quinolinic acid showed similar patterns to those of all nicotinamide metabolites such as mna , 2-py and 4-py , increasing from 1520 weeks of gestation , reaching a peak at 3035 weeks , and then declining postpartum . \n these results show that tryptophan nicotinamide metabolism is enhanced during mid and late pregnancy . \n energy and nutrient requirements increase during pregnancy to allow for fetal growth , and these findings suggest that nicotinamide production is also enhanced during pregnancy to compensate for the increase in niacin requirement . \n these findings also contributed to the dietary reference intakes for japanese 2010 for niacin in pregnant women , which notes that the amount of nicotinamide biosynthesized from tryptophan increases during pregnancy , and this compensates for the increase in niacin requirement . thus , pregnant women do not require additional niacin intake.3 \n in animal experiments , a 14%20% casein diet containing 30 mg / kg nicotinic acid has been generally used . \n we investigated whether rats can maintain their niacin nutrition from nicotinamide supplied only from tryptophan with no dietary niacin.7 rats were fed a niacin - free 20% casein diet starting from the age of 3 weeks until the age of 80 weeks . \n blood nad and liver nicotinamide levels as nutritional biomarkers for niacin in aged rats were the same as those in young rats . \n although urinary excretion of nicotinamide and its metabolites , used as indices of the conversion of nicotinamide from tryptophan , gradually decreased to 60% from 30 weeks of age , these results show that enough dietary tryptophan can sustain niacin nutrition without niacin intake in rats . \n human studies have shown that urinary excretion of nicotinamide metabolites and blood nad levels in elderly japanese are not different from those in young japanese , suggesting a similar conversion ratio in the elderly and young.8,9 although many studies have shown the effects of age on the tryptophan metabolism in animals and humans,1012 little is known about the tryptophan nicotinamide metabolism from nutritional aspects in the elderly people . \n the processes involved in the tryptophan nicotinamide pathway occur in the liver and kidneys . only the liver has all the pathway enzymes . \n the kidneys lack several enzymes , such as tdo and kynureninase.13 to determine the tissue that plays a critical role in the biosynthesize of nicotinamide , we created animal models of renal failure and liver injury , and investigated the relationships between tissue enzyme activities and niacin nutritional status.13,14 rats were fed a diet containing orotic acid , which induces fatty liver.14 in the fatty liver , tdo activity was decreased to 40% , the conversion ratio of tryptophan to nicotinamide to 30% , and liver nad levels to 60% of the values in control animals . \n chronic renal failure was induced by feeding an adenine - containing diet.13 renal failure led to decreases in liver tdo , liver qprt , and kidney acmsd activities , and to an increase in liver acmsd activity , causing the liver enzymes to suppress the conversion of nicotinamide to tryptophan and the kidney enzymes to enhance it . \n the renal failure rats showed lower blood and liver nad levels , and conversion of tryptophan to nicotinamide , corresponding to the changes in liver enzyme activities but not in the kidney enzyme activities . \n these results show that the liver plays a critical role in nicotinamide supply to peripheral tissues ( fig . \n 2 ) . since the kidneys have higher acmsd activity than the liver , and the rats with renal insufficiency showed higher serum quinolinic acid levels,15 the kidney may have the pathway to eliminate tryptophan metabolites rather than to product nicotinamide . \n the processes involved in tryptophan nicotinamide metabolism can be elucidated by measurement of tryptophan metabolites in urine as several urinary tryptophan metabolites increase following tryptophan intake.16 changes in urinary tryptophan \n nicotinamide metabolites reflect their enzyme activities , and thus can be used as biomarkers to evaluate changes in the pathway.9,17,18 furthermore , apparent tryptophan nicotinamide conversion can be calculated using nicotinamide and its metabolites in urine as output versus tryptophan intake as input in animals fed a niacinfree diet.19 using these techniques , many factors have been found to affect the tryptophan nicotinamide pathway . \n animal studies have shown that the tryptophan nicotinamide pathway is affected by conditions such as diabetes , renal failure , and pregnancy,13,20,21 as well as by nutrients such as protein and fatty acids,22,23 hormones such as thyroxin and adrenaline,24,25 and chemicals such as the anti - tuberculosis drug pyrazinamide , the peroxisomal proliferator clofibrate , and phthalate ester plasticizers.18,26,27 \n to investigate niacin deficiency , niacin - free and tryptophan - imbalanced diets have been used to create a niacin deficiency animal model.2831 these diets contain low casein levels , high sucrose levels and additional amino acids without niacin , and the rodents show reductions in body weight gain and tissue nad levels which can be prevented by feeding niacin - containing diets . however \n , many factors affect tryptophan nicotinamide metabolism , and elucidation of the effects of factors that affect niacin deficiency , is sometimes difficult in animals fed niacin - free and tryptophan - imbalanced diets . to study the niacin nutritional status \n regardless of tryptophan status , we generated mice that are missing the qprt gene.32 growth retardation , lower niacin nutritional status including blood and liver nad levels , and no detection of urinary nicotinamide or its metabolites were observed in the qprt - deficient mice fed a niacin - free diet , but not in mice fed a niacin- containing diet . \n histological observation of tissues from the qprt mice fed a niacin - free diet revealed disappearance of the inner circular layer of smooth muscle cells in the small intestine . \n these results indicate that the qprt - deficient mice may be a useful animal model to study niacin deficiency . \n as previously mentioned , dietary surveys of japanese populations have shown that half of the niacin utilized is nicotinamide biosynthesized from tryptophan.4 estimates of how much tryptophan is convertible to nicotinamide are important in deciding niacin requirements in humans . in 1956 , \n a human study first showed that in men approximately 60 mg of tryptophan is equivalent to 1 mg of niacin calculated using supplemented intake of the free form of tryptophan and urinary mna , one of the metabolites of nicotinamide.33 various conversion ratios of tryptophan to nicotinamide were subsequently reported.34,35 one of the reasons for this might be related to the methodologies used : calculations were based on supplemental tryptophan intake and not on proteinous tryptophan intake , not all urinary nicotinamide metabolite was measured , and urinary nicotinamide metabolites are derived from both tryptophan and dietary niacin . \n therefore , we performed a study in humans to determine the conversion ratio of tryptophan to nicotinamide in japanese women fed a niacin - free purified diet not supplemented with the free form of tryptophan.36 young japanese women consumed the niacin - free purified diet for 7 days ; the diet contained 0.67 g / day of tryptophan corresponding to habitual tryptophan intake in japanese women . \n the conversion ratio was calculated from dietary tryptophan and urinary nicotinamide and its metabolites , and 67 mg of tryptophan was found to be equivalent to 1 mg of nicotinamide . \n this finding was adopted as part of the evidence for setting the conversion ratio for tryptophan to nicotinamide in the dietary reference intakes for japanese 2010.3 the ministry of health , labor , and welfare of japan releases dietary reference intakes for japanese every 5 years . \n the dietary reference intakes for japanese 2010 was published in 2009 and was developed to provide reference values for the intake of energy and 34 nutrients for the maintenance and promotion of health and the primary prevention of lifestyle - related diseases in healthy individuals and groups . \n the dietary habits of pregnant women are important for meeting the nutritional needs of the women and their unborn children , especially in the early stages of the growth of the fetus . \n although increased excretion of urinary nicotinamide metabolites during pregnancy was reported as early as the 1940s,37 no evidence has been found as to how tryptophan nicotinamide metabolism is altered in pregnancy . since understanding tryptophan \n nicotinamide metabolism during pregnancy is important in maintaining niacin nutrition in pregnant women and their unborn children , we investigated the urinary excretion of metabolites of the tryptophan nicotinamide pathway from spot urine samples taken from pregnant women.21 spot urine samples were collected from a total of 434 pregnant japanese women who were between 5 to 40 weeks of gestation , and the intermediates and metabolites of the tryptophan nicotinamide pathway in the urine samples were measured . \n urinary excretion of nicotinamide metabolites increased from 20 weeks of gestation during the second trimester , reached a peak of 2.3 times normal at 33 weeks during the third trimester , and declined to control levels postpartum . \n the changes in urinary excretion of 3-hydroxyanthranilic acid and quinolinic acid showed similar patterns to those of all nicotinamide metabolites such as mna , 2-py and 4-py , increasing from 1520 weeks of gestation , reaching a peak at 3035 weeks , and then declining postpartum . \n these results show that tryptophan nicotinamide metabolism is enhanced during mid and late pregnancy . \n energy and nutrient requirements increase during pregnancy to allow for fetal growth , and these findings suggest that nicotinamide production is also enhanced during pregnancy to compensate for the increase in niacin requirement . \n these findings also contributed to the dietary reference intakes for japanese 2010 for niacin in pregnant women , which notes that the amount of nicotinamide biosynthesized from tryptophan increases during pregnancy , and this compensates for the increase in niacin requirement . thus , pregnant women do not require additional niacin intake.3 \n we conclude that the tryptophan nicotinamide pathway plays a critical role in maintaining niacin nutrition via supply of biosynthesized nicotinamide to the peripheral . \n in addition , many factors affect tryptophan nicotinamide metabolism , and these changes should be considered in maintaining niacin nutrition \n we have recently generated qprt - deficient mice , and hope that these mice will contribute to the elucidation of the tryptophan nicotinamide pathway at the molecular level .", "role": "user" }, { "content": "mammals , including humans , can synthesize the vitamin nicotinamide from tryptophan in the liver . \n the resultant nicotinamide is distributed to non - hepatic tissues . \n we have studied the effects of changes in tryptophan nicotinamide metabolism on niacin nutritional status . \n the liver plays a critical role in nicotinamide supply . \n animal studies showed that the tryptophan nicotinamide pathway is affected by physiological conditions , the presence of disease , nutrients , hormones , and chemicals . \n human studies have shown that 1 mg of nicotinamide is produced from 67 mg of tryptophan intake , and that the conversion ratio of tryptophan to nicotinamide is enhanced from mid to late pregnancy . \n these findings have contributed to the determination of dietary reference intakes for niacin recommended in the dietary reference intakes for japanese 2010 . \n our findings suggest that the conversion of nicotinamide from tryptophan is important in maintaining niacin nutrition .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: nonobese diabetic ( nod ) mice are the most frequently preferred animal models in research related to type 1 diabetes ( t1d ) and other autoimmune conditions [ 1 , 2 ] . \n selection of appropriate controls for nod mice depends on the type and aim of research . \n nonobese diabetes - resistant ( nor ) mice are defined by the producer jackson lab as suitable control strains for nod mice in non - mhc - related studies . \n nor / ltj mice produced by jackson lab are thought to have originated from the nod / ltj strain through a genetic contamination with c57blks / j , where limited regions of the nod / ltj genome have been replaced by genome from the c57blks / j strain . while sharing the same mhc as nod mice , nor mice display a stronger t cell function compared to nod mice , and islet inflammation in these mice does not progress beyond peri - insulitis [ 3 , 4 ] . \n spontaneous diabetes development takes approximately 30 weeks in nod mice with a requirement for pathogen - free conditions . \n thus , development of diabetes is frequently accelerated in nod mice via agents such as streptozotocin ( stz ) and cyclophosphamide ( cy ) . \n while cy exerts its primary effect on cd4cd25 treg cells , stz is internalized through glut2 glucose transporters which are located exclusively on beta cells in the pancreatic setting , and also in liver , kidney , and small intestine cells . accordingly , glut2 knockout mice are not susceptible to stz . \n stz is an antibiotic produced by streptomyces achromogenes and is also used as an fda - approved drug in the metastatic cancer of pancreatic islets cells . \n it inhibits glucose oxidation and glucose - induced insulin secretion in beta cells via nitric oxide production , alkylation , and dna fragmentation [ 710 ] \n . dna fragmentation is followed by poly(adp - ribose ) activation and a sustained reduction in cellular nad levels that induces cell death . \n glucose transporter 2 ( glut2 ) is a transmembrane carrier protein which provides passive glucose transport through the cell membrane . while being a member of facilitative glucose transporters family which uptake and release glucose and other certain sugars , glut2 is unique in accepting fructose as a substrate and also in its ability to act as a glucose sensor \n thus , it plays an important role in glucose homeostasis , functioning as a part of the glucose sensory mechanism in pancreatic beta cells . \n glut2 is expressed primarily in pancreatic beta cells and liver cells , as well as in absorptive epithelial cells such as the basolateral membrane of the kidney proximal tubules , and the small intestine . \n glut2 is known to act as the main glucose transporter and sensor in rodent islets . \n although claimed not to be the primary glucose transporter in human beta cells , snps in glut2 gene was found to predict conversion to diabetes from impaired glucose tolerance [ 1416 ] . \n glut2 expression levels in pancreatic beta cells are defined as a marker for degree of susceptibility to stz in various animal models . \n for instance , old world monkeys have lower levels of glut2 expression in beta cells , which is reflected as resistance to stz . on the other hand , new world monkeys with higher glut2 expression in pancreatic beta cells are fairly susceptible to the diabetogenic effects of stz . \n stz leads to kidney and liver toxicity as well as beta cell damage . in a previous study by our group , where we accelerated t1d in nod mice by stz and \n cy applications , nor mice were put through similar applications as a control strain . however , nor mice displayed a considerably higher sensitivity against stz compared to the nod mice . while no unexpected deaths were observed in nod mice during the 14-day follow - up after stz application , sudden deaths were evident in nor mice starting from day six . \n cy , which exerts its diabetogenic effect through regulator t cell suppression , did not have any diabetic / toxic effects on nor mice . \n we hypothesized that the strong effect of stz in these mice could be due to a species - specific difference , most likely related with high glut2 receptor expression in pancreatic beta cells . \n thus we investigated in situ glut2 expression levels in pancreatic tissues of nod and nor mice prior to and following stz application , while evaluating pancreatic islet compositions in these mice through various stages of disease . \n in addition , glut2 expression levels in liver and kidney tissues of the two strains were compared by western blot protein analysis . \n animal tissues used in this study ( paraffin - embedded pancreata and frozen liver and kidneys ) belong to female nod and nor mice that were purchased from the jackson laboratory , usa , for an earlier study . all animals had received a single dose of 150 mg / kg stz at 10 weeks of age . \n all animal works in the previous study , which provided the frozen and paraffin - embedded materials for the present study , were conducted under the approval of the institutional animal care and use ethics committee of akdeniz university ( permit number 07 - 09/01 ) and in accordance with the helsinki declaration guidelines . applied procedures included stz injections , anesthesia , and tissue extractions . for immunofluorescence staining , \n after xylol and alcohol series , heat - mediated antigen retrieval was performed in 10 mm sodium citrate buffer ( ph 6.0 ) . donkey serum ( 5% ) \n was applied for 1 hour at room temperature ( rt ) to prevent nonspecific stainings . \n overnight incubation at 4c by primary antibodies was done in following dilutions : guinea pig anti - insulin at 1/100 dilution ( abcam , ab7842 ) , rabbit anti - glucagon at 1/50 dilution ( abcam , ab18461 ) , and goat anti - glut2 at 1/50 dilution ( abcam , ab111117 ) . \n next day after pbs wash series , secondary antibodies were applied for 1 hour at rt at 1/200 dilution : anti - guinea pig cy2 ( jackson immunoresearch , 706 - 226 - 148 ) , anti - rabbit texas red ( santa cruz , sc-2784 ) , and anti - goat texas red ( abcam , ab7123 ) . \n glut2 fluorescence rate was normalized to the surface area of the insulin - positive cells . \n colored pictures taken from dual - stained islets were converted into gray - toned images . \n insulin - stained areas were defined in individual islets , and the corresponding surface areas were calculated . \n these defined areas were then merged on the glut2-stained areas , and the fluorescence intensities were determined . dividing the measured fluorescence intensities into surface area values of the insulin - stained cells gave us the \n three different pancreata and 5 to 25 islets from each of the pancreata were analysed . \n alpha and beta cell ratios were determined by counting insulin and glucagon - stained cells in islets following dual immunofluorescence stainings . \n three different pancreata were examined to reach average values in each study group , with 5 to 25 islets evaluated in each pancreas . \n heat - mediated antigen retrieval application in 10 mm sodium citrate buffer ( ph 6.0 ) was followed by quenching of endogenous peroxidase activity through hydrogen peroxide block treatment for 30 minutes at rt . \n ultra v blocking was performed for 5 minutes at rt for inhibition of nonspecific stainings . \n after removal of blocking solution , sections were incubated with rabbit - derived primary antibody against glut2 receptor at 4c overnight , at a 1/50 antibody dilution ( abcam , ab104622 ) . \n next day , tissues were washed in pbs series and kept in hrp - conjugated anti - rabbit secondary antibody ( abcam , ab6721 ) , at a 1/200 dilution , for 1 hour at rt . \n after 20 seconds of hematoxylin staining of the cell nuclei , alcohol and xylol series were applied . \n the stained slides were blind - evaluated by a pathologist ( goe ) who had no prior knowledge on tissue origins . \n the scoring system is based on both intensity and distribution ( percentage of the positively stained cells ) of glut2 stainings . \n positive cells counted at 400x magnification were evaluated relative to the total number of cells . \n intensity of stainings was classified as ( 0 ) negative ; ( 1 ) weak ; ( 2 ) moderate ; and ( 3 ) strong . \n marker distribution was scored as ( 0 ) less than 10% , ( 1 ) between 10% and 40% , ( 2 ) between 40% and 70% , and ( 3 ) for more than 70% of the cells stained positive . \n frozen kidneys and livers from nod and nor mice were homogenized in lysis buffer ( ph 7.4 ) containing 100 mm naf , 50 mm hepes , 150 mm nacl , 10% glycerol , 1.2% triton x , 1 mm mgcl2 , 1 mm edta , 1 mm na3vo4 , and protease inhibitor cocktail ( roche , 11836145001 ) . \n lysates ( 50 g protein ) were run in 8% sds - page and transferred to pvdf membrane ( millipore ) . \n membranes were blocked for 10 minutes at room temperature with 5% milk and were incubated overnight at 4c with antibodies against glut2 ( 1 : 1,000 , sc-9117 ; santa cruz biotechnology ) or -actin ( 1 : 1,000 , sc-81178 ; santa cruz biotechnology ) . after three washing series ( 10 minutes ) \n , the membranes were incubated for 1 hour at rt with antibodies against rabbit igg - hrp conjugate ( 1 ; 2000 , # 170 - 6515 , bio - rad ) or mouse igg - hrp conjugate ( 1 ; 2000 , # 170 - 6516 , bio - rad ) . \n after three 10-minute washes , signals were visualized via ecl ( roche ) and quantified using imagequant version 5.1 software . \n normality tests were carried out by shapiro - wilk method , and mann - whitney u test was used for comparisons of the scores between two independent groups . \n following a single dose of 150 mg / kg stz injection , the pancreatic islet morphology changed gradually in both nod and nor mice during the 14 days of follow - up . \n beta cell numbers decreased in both strains , with a faster rate in nor mice ( figure 1 ) . \n we observed that nor mice had nearly half the beta cell content compared to that of nod mice at day 2 and less number of beta cells at all points after that . \n alpha and beta cell percentages in each test point are shown in figure 2 . \n pancreatic islets of nod and nor mice were dually stained for insulin and glut2 expressions prior to and following stz injection , and immunofluorescence intensities were analysed . \n similar glut2 expression levels were evident in both mice strains at day 0 ( figure 3 ) . \n differences in islet glut2 expressions between nod and nor mice following stz application were comparatively analysed . furthermore \n , progressive changes in islet glut2 expression levels after stz injection were evaluated separately in each of the mice in comparison to the day 0 values of the corresponding strain . according to our results , \n glut2 levels did not change significantly in islets of nod mice throughout the 14-day follow - up , while it was elevated in nor mice starting from day 4 of injection . \n glut 2 expression levels in nor mice islets were significantly higher compared to nods , between days 4 and 14 . \n glut2 expressions were maintained significantly higher in nor mice after stz injection , in comparison to day 0 values ( figure 3(b ) ) . \n lysates obtained from frozen kidneys and livers of the non - stz treated nod and nor mice ( day 0 tissues ) were used for western blot analysis of glut2 expressions ( figure 5 ) . \n scarce levels of glut2 were detected in the livers of 10-week - old , non - stz treated female nod mice . \n the sex- and age - matched nor mice , on the other hand , displayed higher levels of glut2 in liver . \n this result was confirmed by immunohistochemical stainings on the same tissues following paraffin embedding ( figure 5 ) . \n glut2 levels in the kidneys of the non - stz treated nor mice were substantially higher compared to the nods . \n streptozotocin ( stz ) is a glucose analogue frequently used as a diabetic agent in various animal models . \n we previously observed strong adverse effects caused by 150 mg / kg stz injection in 10-week - old female nonobese diabetes - resistant ( nor ) mice that were intended to be used as age- and sex - matched controls for nonobese diabetic ( nod ) mice . to investigate the underlying mechanism , we examined pancreas , liver , and kidney tissues of the animals for possible differences in glut2 expression levels between the two mice strains . \n as expected , stz injection triggered a decrease in pancreatic beta cell count , in both nod and nor mice [ 21 , 22 ] . \n interestingly , nor mice displayed a faster decrease in beta cell numbers and a wider difference between the alpha and beta cell percentages within the islets , at most time points chosen for analysis ( figure 2 ) . yet in spite of fast reductions in beta cell numbers , glut2 expression levels significantly increased gradually in the islets of nor mice , unlike those of the nod mice ( figure 3 ) . \n higher blood sugar levels were also evident in these mice in periodic measurements , compared to the nod mice . as glut2 expression is confined to beta cells in the islet setting , higher blood sugar concentrations due to stz - induced beta cell failure is likely to be the mechanism responsible from the rise in glut2 expression levels . \n glucose - stimulated upregulation of glut2 expression was shown in hepatocytes via direct effect on gene transcription and in rat proximal tubule brush border membrane [ 13 , 23 , 24 ] . \n in contrast , islets prepared from c57bl/6 male mice treated with multiple low doses of stz displayed decreased glut2 expression levels . \n we applied a single high dose of stz to both nod and nor mice , which rather caused quick and sharp rises in blood sugar levels apparently due to more immediate beta cell destruction , thus to immediate high blood sugar levels and presumably the increased glut2 expression levels . \n it is also noteworthy that we observed no rise in glut2 expression levels in the pancreatic beta cells of the t1d - prone nod mice , while glut2 levels were significantly raised in the pancreatic beta cells of the t1d resistant nor mice . in general , nor mice had higher blood sugar levels and were affected more adversely from stz application compared to the nods . \n we suggested that a possible explanation might involve higher glut2 expression levels in the islets of nor mice before stz application . \n however , we found no significant differences in islet glut2 expression levels measured prior to stz injection in nod and nor mice ( figure 3 ) . \n stz is also known to affect liver and kidney tissues at varying degrees in different species . \n this effect is in accordance with localization of glut2 receptors primarily in pancreatic beta cells and hepatocytes , as well as in epithelial cells of the kidney . \n as well known , kidneys reabsorb all the filtered glucose and thus play an important role in glucose homeostasis , to ensure sufficient energy for the fasting conditions . \n this mechanism is known to be destructed in the diabetic setting because hyperglycemia increases the expression and activity of glut2 receptors in the kidney proximal tubules . \n furthermore , stz - induced diabetes in rats is known to produce alterations in structures of hepatocytes and the hepatic functions , accompanied by impairment in glucose utilization in stz - induced diabetes . \n stz induction in hepg2 liver cells led to an increase in oxidative stress markers , caused mitochondrial respiratory dysfunction , and resulted in limited induction of mitochondrial apoptotic pathways . \n increase in glut2 expression levels in a glucose concentration manner was reported in primary rat hepatocytes and hepatocyte cell lines [ 24 , 30 ] . \n thus higher glut2 expression levels in the liver and kidney tissues of the nor mice compared to nods before stz application suggested higher initial exposures to stz in these tissues and thus higher toxicity . \n differing degrees of glut2 expression levels in pancreatic , hepatic , and renal tissues , as well as between different species , appear to determine the intensity of the harm caused by stz application at a given dose . \n for instance , common marmosets were reported as fairly resistant to any rise in blood sugar levels following stz application due to low glut2 expression levels in pancreatic islets . \n furthermore , the toxic effects of stz on livers and kidneys of common marmosets were reported to outweigh its diabetogenic effects . \n we observed that liver and kidney tissues of nor mice displayed higher glut2 levels prior to stz application , compared to the nod mice ( figure 5 ) . \n although we do not have specific values to demonstrate the degree of hepatic and renal toxicity in the mice strains used in our study , nor mice were in very poor health starting from day 4 of stz application , with observable fatigue and lack of motion , most likely due to very high blood sugar levels ( measured over 600 mg / dl ) . in consequence , our results reveal more adverse effects in the diabetes - resistant nor mice in response to injection of a single dose of ( 150 mg / kg ) stz , compared to the diabetes - prone nod mice which received the same treatment . \n yet we could not correlate this adverse reaction with differential glut2 levels in pancreatic islets of the two strains as would be expected . instead \n , more severe diabetogenic effects caused by stz in nor mice compared to nods are revealed by extremely high blood glucose levels throughout the follow - up , correlated with higher glut2 levels in liver and kidney tissues . \n as well known , stz is a frequently used experimental diabetes - inducing agent in animal models , as well as an fda - approved chemotherapeutic drug . besides revealing that nor mice should be carefully considered for studies involving relatively high doses of stz , our results also refer to the significance of individual differences in glut2 expression levels in hepatic and renal tissues as determinants of stz toxicity levels", "role": "user" }, { "content": "nonobese diabetic ( nod ) mice are susceptible strains for type 1 diabetes development , and nonobese diabetes - resistant ( nor ) mice are defined as suitable controls for nod mice in non - mhc - related research . \n diabetes is often accelerated in nod mice via streptozotocin ( stz ) . \n stz is taken inside cells via glut2 transmembrane carrier proteins , the major glucose transporter isoforms in pancreatic beta cells , liver , kidneys , and the small intestine . \n we observed severe adverse effects in nor mice treated with stz compared to nod mice that were made diabetic with a similar dose . \n we suggested that the underlying mechanism could be differential glut2 expressions in pancreatic beta cells , yet immunofluorescent and immunohistochemical studies revealed similar glut2 expression levels . \n we also detected glut2 expression profiles in nod and nor hepatic and renal tissues by western blot analysis and observed considerably higher glut2 expression levels in liver and kidney tissues of nor mice . \n although beta cell glut2 expression levels are frequently evaluated as a marker predicting stz sensitivity in animal models , we report here very different diabetic responses to stz in two different animal strains , in spite of similar initial glut2 expressions in beta cells . \n furthermore , use of nor mice in stz - mediated experimental diabetes settings should be considered accordingly .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: benidipine is a triple calcium channel blocker , simultaneously blocking l , t , and n type channels . \n it is reported that the effect on t channel is stronger than that on l channel , making it a great potential protection for kidney . \n a number of studies explored the rho signaling pathway , renal interstitial fibrosis , and tubular epithelium cell transdifferentiation ( emt ) [ 24 ] . \n the blocking of t calcium channel ( tcc ) was reported to inhibit the activity of rho kinase , and this is essential in podocyte effacement in immune complex - mediated glomerular disease and other kidney injuries . \n furthermore , under cellular stress , rho kinase activation results in cytoskeletal rearrangement , stress fiber formation , and loss of cellular integrity and function . \n these suggested that blocking t channel may have a protective effect on diabetic kidney and reduce epithelium - mesenchymal transdifferentiation and fibrosis via inhibiting rock1 ( rho kinase 1 ) activity . \n it was suggested that fasudil , a rho kinase inhibitor , may attenuate emt through reduced activation of rhoa / rock signaling and be a renoprotective agent for the treatment of dn . \n based on that , in this study , we proposed that by inhibiting rho kinase activity , benidipine reduces epithelium - mesenchymal transdifferentiation and protects kidney in rats with type 1 diabetes ( t1 dm ) . by treating type 1 diabetic rats with benidipine and using rho kinase inhibitor fasudil as positive control \n , we studied the effects of benidipine on the activity of rho kinase and emt in diabetic nephropathy in vivo . \n eight - week old male wistar rats weighed at 180200 g ( spf class ) were supplied by the center for animal experiment of wuhan university ( produce permission no . \n rabbit antibody p - mypt1 ( p853 ) and e - cadherin antibody were purchased from bioworld technology , usa , rock1 antibody was purchased from santa cruz , usa , rabbit antibody -sma from sigma , usa , secondary antibody for internal control protein from santa cruz , usa , enzyme - labeling secondary antibody from sigma usa , streptozocin ( stz ) from sigma usa , hydrochloride fasudil injection from tianjin hongri pharmaceutical inc . \n ( lot : 070525 ) , benidipine from japanese kyowa hakko kogyo co. , ltd . \n ( lot : 119afi ) , anti - rabbit / rat universal immunohistochemistry kit from denmark ( dako ) , protein extraction buffer from shanghai xinghan ( dbi ) , real - time pcr master mix from japanese toyobo biotech , real - time fluorescence pcr equipment from biorad usa , and the analysis software for fluorescence quantitation was purchased from icycler ( version 3.1.7050 ) . \n fifty - four spf male wistar rats were fed with normal chow diet , had free access to water , with room temperature of 20~25c and relative humidity of 40%~70% , and were in the 12 h light - dark cycle . \n the rats were randomly assigned into normal group ( n = 8) and diabetic model group ( n = 46 ) . \n after a one - week adaption , the model group was injected intraperitoneally with a single dose of streptozocin ( stz ) 60 mg / kg ( dissolved in 10 mmol / l citrate buffer , ph 4.5 ) , after a 12-hour fasting . \n seventy - two hours after the injection , blood glucose was tested with the samples from tail vein for 3 consecutive days . \n the criteria for diabetic models were as follows : nonfasting blood glucose is 11.1 mmol / l ( all was 16.7 \n mmol / l in this study ) , urine output exceeds the controls over 50% , and urine glucose is strongly positive . during the procedure , 3 rats died and 6 did not meet the criteria . \n thirty - seven diabetic rats were randomly assigned into three groups : diabetic without treatment ( d , n = 13 ) , diabetic treated with fasudil ( f , n = 12 ) , and diabetic treated with benidipine ( b , n = 12 ) . \n fasudil was injected intraperitoneally with 10 mg / kg / d ; benidipine was dissolved in 0.3% carboxymethyl cellulose solution and given via gastric tubing with 3 mg / kg / d . \n after three months , 8 rats in n group , 9 in d group , 9 in f group , and 8 in b group survived and were sacrificed accordingly . \n one day prior to the sacrifice , 24-hour urine was collected in metabolic chamber . on the same day of sacrifice \n , tail artery blood pressure was measured with noninvasive blood pressure meter and blood samples were collected . after rinsing with normal saline , \n some of the kidney tissues were fixed with 10% neutral formalin , embedded with paraffin , made into 3 m slides , and stained with he for pathological analysis . \n twenty - four - hour urine protein quantification was measured with sulfosalicylic acid method ; serum creatinine ( scr ) was tested with picric acid method ; blood glucose was tested with glucose oxidase method ; and nag activity was measured with colorimetry as described previously . \n deparaffin the slides routinely , heat repair with microwave , incubate in 3% peroxide at room temperature for 15 minutes , and rinse with pbs ( ph 7.4 ) for three times , 5 minutes for each . add rabbit antibody p - mypt1 ( 1 : 50 ) , -sma ( 1 : 50 ) , and e - cadherin ( 1 : 100 ) antibody , respectively , and incubate at 4c overnight . \n incubate with horseradish peroxidase - labeled chemmatetmenvision secondary antibody at room temperature for 45 minutes , detect with dab , repeat staining with he , dehydrate , and seal the film with transparent plastic membrane . \n the total proteins of kidney tissues were extracted with total protein extraction kit . the protein concentration was analyzed with uv spectrophotometry at 260 nm wavelength . \n thirty g of total protein was loaded for sds - page electrophoresis , then was transferred to nitrocellulose membrane , and then was observed with ponceau s staining . \n wash with pbs , then add rabbit anti - rat p - mypt1 ( 1 : 1000 ) , rock1 ( 1 : 400 ) , -sma ( 1 : 400 ) , e - cadherin ( 1 : 1000 ) , and -actin ( 1 : 1000 ) , respectively , and incubate overnight . and then incubate with 1 : 2000 hrp - labeled goat anti - rabbit igg . detect with chromogenic agent and expose the film . scan the image and analyze absorbance with computer software . \n take the kidney cortex tissue 0.1 g from each rat , extract total rna with trizol , and remove genomic dna with dnase i. reverse rna and obtain cdna . \n the fluorescence pcr quantification of cdna was performed with sybr green , with triplets for each sample per protocol . \n the total volume of each reaction was 30 l , with the following condition : 95c for 3 min for predenature , then 95c for 20 s , 60c for 20 s , and 72c for 30 s and repeat for 35 cycles , and then 72c for 5 min . \n take the ct ratio of each sample to internal control as the relative value of the gene expression of this sample . \n normal distributed quantitative variables were presented as mean sd . comparison among groups was performed with anova , snk , and lsd tests . \n abnormally distributed variables were log - transformed into normal distributed variables and then analyzed thereafter ; data were presented with median . \n as shown in table 2 , at 12 weeks , compared with n group , d group had elevated 24-hour urine protein , nag activity , scr ( p < 0.05 ) , and decreased ccr ( p < 0.05 ) . compared with d group , f group had decreased 24-hour urine protein , nag activity , and scr ( p < 0.05 ) . there was no significant difference between f and b groups . \n there was no significant difference for blood pressure or glucose among groups , as shown in table 3 . compared with n and f groups , \n d group had significant expanded glomerular mesangial matrix , increased cell number , thickened basement membrane , with multiple inflammatory cells infiltrated in interstitial space , dilated renal tubular , and fibrosis in interstitial space . \n there were mild proliferation of glomerular mesangial matrix , inflammatory infiltration , tubular dilatation , and fibrosis in f and b groups , as shown in figure 1 . \n the expression of rock1 showed trace in tubular epithelium cells in n group , was enhanced in d group which mainly distributed in dilated renal tubular , and was reduced in f and b groups . \n -sma was presented in the smooth muscle cells of renal small artery in n group and visible in epithelium of renal tubular in d group with majority expressed in medullar area but no expression in f or d group . \n e - cadherin was mainly presented in the epithelium cells of renal tubular in n group , especially in the cell conjunction area , with partial expression for f and b groups which was enhanced at the cell junction area but no expression on tubular epithelium in d group , as shown in figure 2 . as shown in figure 3 , \n compared with n group , the rats in d group had enhanced protein expressions of p - mypt1 , rock1 , and -sma in renal cortex but reduced e - cadherin . compared with d group , f group and b group had reduced protein expressions for p - mypt1 , rock1 , and -sma and enhanced e - cadherin which was still less than that of the normal group . there was no significant difference between f and b groups , as shown in figure 3 and table 4 . \n compared with n group , mrna expression of rock1 in renal cortex was increased in d group . \n compared with d group , there was less mrna expression of rock1 in f and b groups , lower than normal , as shown in figure 4 . \n in this study , by treating rats with type 1 diabetic nephropathy with benidipine , a triple channel blocker , and fasudil , a rho kinase inhibitor , we successfully investigated the effect of benidipine on epithelium - mesenchymal transdifferentiation and its possible mechanism via inhibiting rho kinase activity . these results were consistent with some previous studies . \n rock directly affects myosin light chain ( mlc ) or indirectly affects the target subunit of myosin phosphatase ( mypt1 ) and thus increases the phosphorylation of mlc in plasma and controls the attachment , chemoattractant , contraction , and so forth . \n fasudil is a rock - specific inhibitor and inhibits rock activity by competitively combining atp sites of rock catalytic domain . \n rocki and rockii were both reported . in kidney tissues , rocki is the major one presented . \n recent studies revealed that abnormal activation of rock signaling pathway played a very important role in the pathophysiology of all kinds of complications of diabetes [ 13 , 14 ] . \n our study confirmed that there was rock activation in renal tubular epithelium cells of 12 weeks of diabetic rats , and the effects of rock on diabetic renal interstitial space were through rock1 . \n further study found that the protein expression of e - cadherin , the marker protein of renal tubular epithelium cells , was downregulated in diabetic rats , while the protein expression of -sma , the marker protein of myofibrillar cells , was upregulated , indicating that there was emt in diabetic nephropathy of rats . \n benidipine or fasudil can significantly inhibit nag activity , reduce urine protein and scr level , decrease the expression of p - mypt1 , rock1 , and -sma , and increase the expression of e - cadherin without affecting blood glucose or pressure . \n benidipine has protective effect on diabetic nephropathy of rats , independent of its effect of lowering blood pressure . \n tcc is a low - voltage activated channel , mainly located in renal efferent arterioles and pacing cells of the heart . through its strong blocking effects on tcc , benidipine dilates renal afferent and efferent arterioles equally and thus effectively reduces the resistance of renal vessels and intrarenal pressure . \n it is showed that , besides its effects on adjusting capillary pressure of glomerular , tcc has many nonhemodynamic effects [ 1619 ] . \n it regulates the activity of nf - k and thus inhibits inflammation , promotes the secretion and release of aldosterone , improves the remodeling of the heart and kidney , and anti - oxygenize and anti - proliferate [ 2023 ] . \n it is found that in the subremoval kidney models , by inhibiting rho kinase activity , selective t channel blocker improves renal interstitial fibrosis and emt . \n however , there are limitations of our study ; the sample size was rather small , and it is a study in animals instead of human being . in summary , \n our study is the first study suggesting that benidipine protects kidney in rats with type 1 diabetes , possibly through its effect of inhibiting rho kinase activity and thus reducing epithelium - mesenchymal transdifferentiation ( emt ) . \n this may guide further animal studies , clinical trials on the importance of benidipine in diabetic emt development especially in type 1 diabetic , and the possible mechanism involved . from the long run \n , it may direct the clinical use of benidipine in treating patients with diabetic nephropathy especially those in t1 dm .", "role": "user" }, { "content": "we investigated the protective effect of benidipine , by testing the changes of the activity of rho kinase and transdifferentiation of renal tubular epithelium cells in vivo . \n wistar rats were randomly divided into two groups : normal ( n ) and diabetes . \n stz were used to make the rats type 1 diabetic and were randomly assigned as diabetes without treatment ( d ) , diabetes treated with benidipine ( b ) , and diabetes treated with fasudil ( f ) and treated for 3 months . \n immunohistochemistry and western blotting were for protein expressions of rock1 , -sma , and e - cadherin and real - time pcr for the mrna quantification of rock1 . compared with n group , \n d group had significant proliferation of glomerular mesangial matrix , increased cell number , thickened basement membrane , widely infiltrated by inflammatory cells and fibrosis in the renal interstitial , and dilated tubular . \n those presentations in f and b groups were milder . compared with n group , d group showed elevated mypt1 phosphorylation , increased expression of rock1 , -sma protein , and rock1 mrna and decreased expression of e - cadherin protein . \n b group showed attenuated mypt1 phosphorylation , decreased rock1 , -sma protein , and rock1 mrna expression and increased expression of e - cadherin protein . in conclusion \n , benidipine reduces the epithelium - mesenchymal transdifferentiation and renal interstitial fibrosis in diabetic kidney by inhibiting rock1 activity .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: since the one gene - one enzyme hypothesis ( beadle and tatum , 1941 ) and the one gene - one polypeptide hypothesis ( ingram , 1957 ) were proposed , the perception among geneticists and molecular biologists earlier on was that proteins were the only core molecules that controlled diverse cellular processes and gene expression regulation , and that rnas were passive carriers of genetic information ( crick , 1970 ) . \n however , this hypothesis was challenged by polypeptides arising from alternative splicing . in the 1980s , thomas cech s group first demonstrated that the role of rna molecules extended beyond that , to enzymatic regulation ( bussard , 2005 ; kruger et al . , 1982 ) . \n hypothesis was proposed , according to which the earliest forms of genetic information and effector molecules were rnas . \n this hypothesis has been supported by the observation of self - cleavage of viral rnas with a structural model of the active sites ( forster and symons , 1987 ) and additional enzymatic activities such as rna - catalyzed rna polymerization ( johnston et al . , 2001 ) and \n however , it was still believed that such transcriptional and translational roles of rnas were later taken over by dna and protein , respectively , and that rna had no such regulatory roles in genomes . \n eventually , the protein- and dna - centric view was challenged by the discovery of a small regulatory noncoding rna ( ncrna ) group , which included micrornas ( mirnas ) ( lee et al . , 1993 ; reinhart et al . , 2000 \n 1993 ) and the steroid receptor rna activator ( sra ; a ncrna with both coding and noncoding function ) ( chooniedass - kothari et al . , 2004 ; lanz et al . , 1999 ) , which was considered a bifunctional rna . \n mirna downregulates hundreds of conserved mrna targets by base - pairing to the 3-untranslated region ( utr ) of the target in a posttranscriptional and translational manner ( bartel , 2009 ) . \n thousands of mirnas participate in modulating diverse biological processes by controlling the expression level of more than 50% of protein - coding genes ( bartel , 2009 ) . \n the first mammalian bifunctional rna discovered , sra , mediates the transactivation of eukaryotic gene expression as an rna ( lanz et al . , 1999 ) and encodes a highly conserved sra protein in breast cancer cells ( chooniedass - kothari et al . , 2004 ) . \n the sra protein np95 mediates epigenetic upregulation of gene expression by recruiting dnmt1 to methylated dna ( sharif et al . , 2007 ) . \n in turn , vegt and oskar have been classified as bifunctional rna with coding and noncoding functions in animal development ( jenny et al . , 2006 ; kloc et al . , \n , reproducible transcription across mammalian coding and noncoding genomes were extensively discovered using high - throughput sequencing technology ( consortium , 2012 ) . in the human genome , \n approximately 62% of the genome has been reproducibly transcribed ( consortium , 2012 ) , of which approximately 30% corresponds to exonic and intronic regions of protein - coding genes , and the remainder mostly comprise long ncrnas ( lncrnas ) transcribed in intergenic regions or antisense strands ( hangauer et al . , 2013 ) . \n furthermore , protein - coding genes encode nine multiple isoforms on an average , very few of which lack coding potential and are regarded as noncoding isoforms ( mascarenhas et al . , 2015 ) . \n date , tens of thousands of lncrnas have been discovered in genomes and found to be involved in diverse biological functions such as regulating gene expression at the level of transcription , rna processing , or translation ; protecting genomes from transposons or viral dnas ; and guiding dna synthesis , genome rearrangement , or genome editing ( cech and steitz , 2014 ) . \n the versatile functions of lncrnas suggest that rnas actively participate in diverse cellular processes and play a regulatory role in the expression of genetic information . \n ever - increasing evidence of the existence of bifunctional rnas with coding and noncoding potential is being provided by current high - throughput rna sequencing ( rna - seq ) and ribosome footprinting followed by sequencing ( ribo - seq ) ( andrews and rothnagel , 2014 ; kumari and sampath , 2015 ) . \n the existence of lncrnas with small open reading frames ( sorfs ) ( andrews and rothnagel , 2014 ) and the intrinsic rna function of protein - coding genes ( kumari and sampath , 2015 ) in species ranging from bacteria to mammals indicates that the bifunctional mode of rnas has been evolutionarily conserved . although mono - functional rnas might be major players in current genomes , bifunctional rnas seem to have significantly contributed to the complexity and robustness of gene expression regulation over time . in this mini - review , we discuss three major types of bifunctional rnas with both coding and noncoding potential : lncrna with sorfs , coding mrnas with noncoding functions , and noncoding isoforms of protein - coding genes . \n we then go on to summarize the functional categories of rnas and their corresponding proteins or peptides . \n recent studies have reported that a number of lncrnas contain sorfs that extensively translate small peptides ( anderson et al . , 2015 ; aspden et al . , 2014 ; mackowiak et al . , 2015 ; \n , 2015 ; mackowiak et al . , 2015 ) and high - throughput sequencing of ribosome - protected fragments ( rpfs ) ( aspden et al . , 2014 ; olexiouk et al . , 2016 ; \n have shown that small peptides from a considerable number of well - studied lncrnas are actively synthesized ( andrews and rothnagel , 2014 ) . \n although the majority of functional proteins are composed of more than 100 amino acids , a considerable number of small peptides , comprising fewer than 100 amino acids , attributed to lncrna , are also detectable from cells by ribosome footprinting and proteomics approaches . \n in addition , some sorfs but not their host lncrnas are evolutionarily conserved in other genomes ( calviello et al . , 2016 ; ji et al . , 2015 ) , indicating that they might play a functional role not related to the lncrna functions in cells ( fig . \n so far , a dozen protein - coding mrnas were revealed to have an intrinsic noncoding function , independent of the protein that they encode ( fig . \n 1b ) ( karapetyan et al . , 2013 ; kumari and sampath , 2015 ) . \n the intrinsic noncoding function of mrnas is involved in core molecular processes such as transcriptional , posttranscriptional , and translational regulation , as well as protein scaffolding in cis- and trans - acting manners ( kumari and sampath , 2015 ) . \n the third type of bifunctional rna is protein - coding rna having either noncoding isoforms by alternative splicing or allele - specific transcripts with variants that destroy coding potential ( figs . \n the noncoding isoforms of protein - coding genes are often regarded as potential targets of nonsense - mediated mrna decay ( nmd ) ; however , a considerable number appear to be sufficiently stable to have functional roles in cells ( mayba et al . , 2014 ) . \n lncrna is defined as a long rna molecule with no coding potential and no sequence similarity to protein - coding genes ; however , several annotated lncrnas appear to be highly associated with ribosomes ( table 1 ) , indicating that lncrnas contain a coding region that translates a peptide . of the lncrnas \n manually curated in vega ( http://vega.sanger.ac.uk/ ) , a few display strong ribosomal association , indicating a high translation efficiency , in hela and mouse neutrophil cells ( table 1 ) . \n intriguingly , the ribosome association is mostly restricted to sorfs , and this association rapidly decays at the location of ribosome release at the stop codon , estimated as the ribosome release score ( rrs ) ( guttman et al . , 2013 ) . \n for example , malat1 is highly expressed in the nucleus during cancer metastasis ( ji et al . , 2003 ) and has a putative sorf that can encode about 71 amino acids . \n although in vitro translation experiments have failed to detect peptides from the putative sorf ( ji et al . , 2003 ) , the strong ribosome association supports translation activity on the sorf . \n in addition , the movement of the 80s ribosome along the mrna makes it possible to discern whether the sorf is actively translated . \n for example , rp11 - 21n3_1 lncrna includes three putative sorfs strongly associated with ribosomes within a sorf with a subcodon positional bias of the 5 termini of rpfs ( fig . \n another type of lncrna , the mirna host transcript , sometimes includes ribosome footprints on the rna . \n for example , pri - mir171b in arabidopsis thaliana is processed into mir171b and downregulates several solute carrier family members . \n its primary transcript , called mipep171b , has two sorfs , which encode five and twenty amino acids , respectively . \n these peptides specifically enhance the expression of mir171b , affecting lateral root development ( lauressergues et al . , 2015 ) . \n besides their protein - coding functions , mrnas play functional roles as rna , such as transcriptional and translational gene regulation and localization and scaffolding of proteins ( table 2 ) . in general , the intrinsic rna function is mediated by either cis- or trans - acting elements on the rna . \n in fact , the utr of protein - coding mrnas often harbors cis - acting factors that control their own stability , localization , and translation efficiency , which could be regarded as intrinsic functions of the mrnas . \n for example , the 3-utrs of dmpk , oskar , and sqt include motifs recognized by rna - binding proteins ( rbps ) , induce the formation of scaffolds of the rbps during embryo development , and also encode dna sequences of proteins composed of hundreds of amino acids ( jansen et al . \n all protein - coding rnas that have spatially separable functions of coding in coding sequences and noncoding in utrs can be regarded as bifunctional rnas . \n intriguingly , the base compositions , structures , and functions of 3-utrs are similar to those of lncrna genes ( niazi and valadkhan , 2012 ; wan et al . , 2012 ) , which indicates that utrs might be traces ( or fossils ) of ancient regulatory rnas in the view of the rna world hypothesis . \n of course , utrs also mediate trans - gene regulation by competing with other endogenous rnas . \n for example , the hairpin structure of the hic 3-utr binds to and translationally activates p - tefb by displacing 7sk rna from the inhibitory complex ( young et al . , 2007 ) \n in addition , the utrs interact with lncrnas via imperfect base pairing based on alu repeats , facilitating the formation of stau1-binding sites ( gong and maquat , 2011 ) . \n this recruitment of stau1 directs staufen - mediated mrna decay ( smd ) , which controls the stability of the smd target mrnas ( table 2 ) . \n notably , mrnas with functional utrs tend to have either sorfs or long utrs , resembling lncrnas with sorfs . \n for example , sgrs and enod40 mrnas , which encode 43 and 27 amino acids , respectively , and yet have utrs 100 nt and 600 nt in length , have noncoding functions of translational regulation and rna stability ( hanada et al . , 2007 ; \n , 2014 ; sousa et al . , 2001 ; wadler and vanderpool , 2007 ) ( table 2 ) . in some cases , \n the region responsible for the noncoding function , however , is barely separable from that required for its coding function . \n for example , rnaiii in staphylococcus aureus encodes a delta - hemolysin comprising 26 amino acids , which induces the lysis of the host cell membranes . \n the rna sequence includes the cds and has an intrinsic function of regulating the stability and translation of virulence factors by base pairing ( verdon et al . , 2009 ) . \n vegt mrna , which encodes a t - box transcription factor that patterns the mesendoderm of xenopus laevis , plays a structural role in the organization of the cytoskeleton at the vegetal cortex ( kloc et al . , 2005 ) \n in addition , c - myc , h2b , tp53 , bcmaas , and p23 have regulatory roles at the rna level , but the regions for these functions are not clearly separable from the cds regions ( table 2 ) . \n for spatially inseparable functional elements on rna , it is difficult to pinpoint the functional roles of the elements by simply removing them . \n rather , the functional role of these regions can be determined by introducing mutations in the element but with a minimal effect on the rna sequence . \n a major isoform analysis of human transcriptomes has revealed that 15.2620.64% of protein - coding genes in primary tissues express the major isoform that lacks an annotated cds in gencode ( gonzalez - porta et al . , 2013 ) . \n the major noncoding isoforms are recurrently expressed across tissues and cell lines , and their subcellular localization showed that they are enriched in the nucleus compared to other major coding isoforms . \n although some of the noncoding isoforms enriched in the nucleus are likely to be retained introns , about half are processed transcripts , and their abundant levels indicate their functional roles in the primary tissues . \n processed noncoding transcripts are often generated by alternative splicing , which either introduces a premature stop codon ( ptc ) or disrupts the orf ( gonzalez - porta et al . , \n because transcripts with a ptc are easily damaged by the nmd pathway , processed noncoding transcripts with high expression levels are more likely to be non - nmd targets . \n major noncoding isoforms mainly arise by alternative splicing or skipping the first or last exon , including the start or stop codons . \n for example , the sra gene expresses coding isoforms produced by alternative start codons in the first exon and noncoding isoforms with a truncated or missed first exon ( chooniedass - kothari et al . , 2004 ; hube et al . , 2011 ; lanz et al . , 1999 ) \n the ratio of coding and noncoding isoforms is dynamically altered across different cell states or types . \n in fact , the fraction of noncoding isoforms increases during myogenic differentiation of primary human satellite cells , while the fraction decreases in myotonic dystrophy muscles ( hube et al . , 2011 ) . the production of coding and noncoding isoforms of sra is also observed in the mouse transcriptome , indicating that the dual function of coding and noncoding isoforms of sra has been evolutionary conserved ( fig . \n 3 ) . an alternative source of noncoding transcripts of protein - coding genes could be allele - specific isoforms generated by heterozygous mutations that cause a loss of coding potential . \n in many cases , mutations in splice sites cause the truncation or retention of introns of transcripts , some of which are damaged by the nmd pathway ( rivas et al . , 2015 ) . in particular , these allele - specific isoforms are frequently discovered in cancer cells ( mayba et al . , 2014 ) , suggesting that the allelic imbalance of coding and noncoding transcripts of a protein - coding gene might be involved in the origin of cancer . \n how can we distinguish genuine coding rna , ncrna , and bifunctional rna at the genome level ? \n how do we examine the coding and noncoding functions of rna ? finally , why do cells maintain the evolutionarily conserved dual functions of rnas across species ? to address these questions , genome - wide experimental and computational approaches to identify noncoding functions of protein - coding genes , detect putative sorfs in noncoding genes , and reconstruct noncoding isoforms in coding loci could be useful . \n the coding potential of lncrnas has been predicted computationally by comparing phylogenetic codon models across species , such as phylocsf ( lin et al . , 2011 ) , or by experimentally detecting rna regions associated with ribosomes ( guttman et al . , 2013 ; ingolia et al . , 2014 \n despite the successful detection of putative sorfs in lncrnas by the above methods , we need to further examine whether the peptides are productively generated , whether the peptides are stable in cells , and whether peptides from sorfs are functionally relevant . a more prevalent source of bifunctional rnas might be the noncoding isoforms of protein - coding genes . \n however , detecting the noncoding isoforms of protein - coding genes at the genome level is a challenging task . for this \n in addition , to verify the function of the noncoding isoform , we can examine whether the function is maintained after removing the coding potential by introducing a frameshift mutation or nonsense mutation in the coding isoform . \n recently , many truncated proteins encoded from nmd targets and noncoding isoforms of protein - coding genes have been shown to have a stable form in nmd - deficient conditions , and to be involved in cancer development ( liu et al . , 2014 ; \n this highlights the need to understand how distinct rnas and proteins of bifunctional rnas are pathologically relevant , which will in turn provide interesting biological insights with potential medical implications .", "role": "user" }, { "content": "since the rna world hypothesis was proposed , a large number of regulatory noncoding rnas ( ncrnas ) have been identified in many species , ranging from microorganisms to mammals . during the characterization of these newly discovered rnas , rnas having both coding and noncoding functions were discovered , and these were considered bifunctional rnas . \n the recent use of computational and high - throughput experimental approaches has revealed increasing evidence of various sources of bifunctional rnas , such as protein - coding mrnas with a noncoding isoform and long ncrnas bearing a small open reading frame . \n therefore , the genomic diversity of janus - faced rna molecules that have dual characteristics of coding and noncoding indicates that the functional roles of rnas have to be revisited in cells on a genome - wide scale . \n such studies would allow us to further understand the complex gene - regulatory network in cells . in this review \n , we discuss three major genomic sources of bifunctional rnas and present a handful of examples of bifunctional rna along with their functional roles .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: functional involvement of the thalamus in cognitive processing was first proposed by hillemand and lhermitte , who described atypical aphasic symptoms after pathologically confirmed left thalamic hemorrhage . \n these anecdotal descriptions were later confirmed by fisher , who reported aphasia , agnosia , and sensory deficits as the main clinical features of left thalamic hemorrhage . \n it is now accepted that left thalamic hemorrhage often causes aphasia characterized by fluent but sometimes hypophonic speech , paraphasia , and moderate to mild disturbances in auditory and reading comprehension . \n agraphia , an acquired impairment in writing ability with preserved oral language competence and reading , is often observed with other aphasic symptoms after stroke . \n enduring agraphia after recovery from aphasia has also been reported in stroke patients , but few such cases have been described following thalamic hemorrhage . here \n we report a case of sustained agraphia with transient aphasia and agnosia following left thalamic hemorrhage . \n the patient was a 71-year - old right - handed man with 12 years of formal education . \n he had no history of diabetes , hypertension , or neurological or metabolic complications , and he had no preexisting neuropsychological deficits . \n the patient initially experienced weakness of the right arm and leg and had difficulty in walking . \n he was transported to our hospital by ambulance , where he was diagnosed with cerebral hemorrhage and received conservative treatment . \n , he was alert but disoriented with regard to time and place because of mild aphasia . \n he also presented with right hemiplegia , impaired thermal nociception , and impaired deep sensation on his right side . \n his visual acuity and visual field were normal , and there were no other detectable abnormalities of the central nervous system . \n formal language assessment was undertaken 3 days after stroke onset using the standard language test for aphasia ( slta ; fig . \n 1 ) . he had fluent spontaneous speech with only occasional difficulty in choosing the correct word ( paraphasia ) , and he could repeat spoken words . \n he had slight difficulty in visual recognition of words and aural comprehension at the sentence level , but he could read words aloud , whether written in kanji ( chinese - based characters ) or kana ( syllable - based characters ) . however , he had difficulty in writing both types of characters . \n he scored 16/30 on the mini - mental state examination ( mmse ) , with poor performance in orientation , attention and calculation , and reproduction . \n his raven 's colored progressive matrices ( rcpm ) score was 18/36 and that on the frontal assessment battery ( fab ) was 11/18 . \n a word fluency test requiring the patient to produce exemplars from given categories resulted in scores of 17 , 7 , and 9 for the categories animal , \n vehicle , respectively . a test requiring the production of words that begin with specified letters resulted in scores of 0 , 6 , and 7 for the letters \n re , respectively . a head computed tomography ( ct ) scan at stroke onset revealed a thalamic hemorrhage in the left lateral and posterior thalamus with slight extension to the posterior limb of the internal capsule ( fig . \n single - photon emission ct ( spect ) performed around the same time showed decreased blood flow in the left thalamus , in the left cortex extending from the superior temporal gyrus to the parietal lobe , and in the frontal lobe ( fig . \n aphasia gradually resolved as the patient 's slta score improved to population norms in the areas of comprehension and oral language by 2 weeks after stroke onset . \n the patient could manage to write with his right hand , but used his left hand for writing because of his difficulty in delicate motor control . despite signs of general cognitive recovery , his writing ability remained clearly disturbed . \n most errors were incorrect responses to word dictation , termed paragraphia , although the selection and array of characters used were normal . \n he could transcribe characters and generally wrote the characters in the correct stroke order , but he often substituted one character for another with a similar shape or sound , perseverated , and wrote characters with 180 rotation ( mirror script ) ( fig . \n 3 ) . he could write 67 of 102 kana characters and 62 of 160 kanji characters , which are learned during the second grade in japan . at 2 weeks after stroke onset , wechsler adult intelligence scale - iii ( wais - iii ) scores were 83 for verbal intelligence quotient ( iq ) , 65 for performance iq , and 72 for full scale iq , while the wechsler memory scale - revised ( wms - r ) scores were 77 for verbal memory , 73 for visual memory , 74 for general memory , 81 for attention and concentration , and 57 for delayed recall . compared with the results obtained 3 days after stroke onset , the scores were slightly higher on the mmse ( 20/30 vs. 16/30 ) , rcpm ( 26/36 vs. 18/36 ) , and fab ( 12/18 vs. 11/18 ) . \n in contrast , word fluency test results were similar for both categories ( 16 , 8 , and 9 ) and specific first letters ( 7 , 4 , and 6 ) , although the shi deficit had recovered . at 6 weeks after stroke onset \n formal language assessment was undertaken 3 days after stroke onset using the standard language test for aphasia ( slta ; fig . \n 1 ) . he had fluent spontaneous speech with only occasional difficulty in choosing the correct word ( paraphasia ) , and he could repeat spoken words . \n he had slight difficulty in visual recognition of words and aural comprehension at the sentence level , but he could read words aloud , whether written in kanji ( chinese - based characters ) or kana ( syllable - based characters ) . however , he had difficulty in writing both types of characters . \n he scored 16/30 on the mini - mental state examination ( mmse ) , with poor performance in orientation , attention and calculation , and reproduction . \n his raven 's colored progressive matrices ( rcpm ) score was 18/36 and that on the frontal assessment battery ( fab ) was 11/18 . \n a word fluency test requiring the patient to produce exemplars from given categories resulted in scores of 17 , 7 , and 9 for the categories animal , \n vehicle , respectively . a test requiring the production of words that begin with specified letters resulted in scores of 0 , 6 , and 7 for the letters shi , i , and \n a head computed tomography ( ct ) scan at stroke onset revealed a thalamic hemorrhage in the left lateral and posterior thalamus with slight extension to the posterior limb of the internal capsule ( fig . \n single - photon emission ct ( spect ) performed around the same time showed decreased blood flow in the left thalamus , in the left cortex extending from the superior temporal gyrus to the parietal lobe , and in the frontal lobe ( fig . \n aphasia gradually resolved as the patient 's slta score improved to population norms in the areas of comprehension and oral language by 2 weeks after stroke onset . \n the patient could manage to write with his right hand , but used his left hand for writing because of his difficulty in delicate motor control . despite signs of general cognitive recovery , his writing ability remained clearly disturbed . \n most errors were incorrect responses to word dictation , termed paragraphia , although the selection and array of characters used were normal . \n he could transcribe characters and generally wrote the characters in the correct stroke order , but he often substituted one character for another with a similar shape or sound , perseverated , and wrote characters with 180 rotation ( mirror script ) ( fig . \n 3 ) . he could write 67 of 102 kana characters and 62 of 160 kanji characters , which are learned during the second grade in japan . at 2 weeks after stroke onset , \n wechsler adult intelligence scale - iii ( wais - iii ) scores were 83 for verbal intelligence quotient ( iq ) , 65 for performance iq , and 72 for full scale iq , while the wechsler memory scale - revised ( wms - r ) scores were 77 for verbal memory , 73 for visual memory , 74 for general memory , 81 for attention and concentration , and 57 for delayed recall . compared with the results obtained 3 days after stroke onset , the scores were slightly higher on the mmse ( 20/30 vs. 16/30 ) , rcpm ( 26/36 vs. 18/36 ) , and fab ( 12/18 vs. 11/18 ) . \n in contrast , word fluency test results were similar for both categories ( 16 , 8 , and 9 ) and specific first letters ( 7 , 4 , and 6 ) , although the shi deficit had recovered . at 6 weeks after stroke onset \n in our patient , oral language and reading comprehension rapidly improved over the first 2 weeks after stroke onset , but agraphia continued for at least 6 weeks . \n he could transcribe kanji and kana characters and write them with the correct stroke order , and the selection and array of characters were normal , but there were mistakes in transcription . \n the act of writing engages multiple cortical areas ; thus , agraphia may result from a general reduction in brain function or acute delirium , decreased memory retention due to thalamic lesions , or secondary cortical impairments . \n however , in the present case , the patient exhibited no disturbance of consciousness and had relatively intact general cognitive function at 2 weeks after stroke onset , while agraphia for kana or kanji characters remained . \n the japanese language has two writing systems , kanji and kana , which are often used for comparison of handwriting . \n some patients with left posterior inferior temporal lobe lesions may have agraphia specifically for kanji [ 9 , 10 ] , while some patients with frontal or parietal lobe lesions are unable to write kanji or kana . \n reported a case of agraphia following thalamic hemorrhage in which the degree of agraphia for kanji was greater than that for kana . in our patient , a spect scan revealed decreased blood flow over an expansive area of the left frontal and temporal lobes . \n maeshima et al . reported a case of thalamic hemorrhage causing agraphia for kanji and mentioned that a spect scan showed decreased blood flow in the left thalamus , left superior temporal gyrus extending to the parietal lobe , and the frontal lobe . \n sakurai et al . suggested that two separate lesions of the left thalamus could cause agraphia ; damage to the ventral lateral nucleus can impair kana character recall , whereas damage to the dorsomedial nucleus can cause a deficit primarily for kanji character recall . in our patient , the hematoma extended throughout both the lateral and medial left thalamus , suggesting a possible explanation for agraphia for both kanji and kana characters . a ct scan of the head revealed no abnormalities , except for those in the left thalamus , but spect showed a decrease in regional cerebral blood flow in the left temporal and parietal lobes and in the frontal lobe ( as well as in the thalamus ) . \n it is well known that neuropsychological disturbances in patients with posterolateral thalamic hemorrhage are prominent , with aphasia in those with left - sided lesions and hemineglect in those with right - sided lesions [ 13 , 14 ] . \n crosson formulated the most extensive theoretical model for the roles of different subcortical structures in language comprehension and production . \n according to this model , the striatum and cortico - striato - pallido - thalamocortical loop are as important as anterior and posterior language structures ( broca 's area and wernicke 's area ) , with striatal and thalamic areas particularly important for correcting errors in meaning . \n the dorsomedial nucleus of the thalamic medial nuclear group projects mainly to the prefrontal area , the ventral anterior nucleus of the ventral nuclear group to the premotor area , the posterior lateral nucleus and pulvinar nucleus of the lateral nuclear group to the parietal lobe , the medial geniculate body to the primary visual area of the occipital lobe , and the medial geniculate body to the primary auditory area of the temporal lobe . \n aphasia and neglect were likely caused by damage to the thalamocortical and cortico - thalamocortical projection fibers due to thalamic hemorrhage , resulting in a widespread decrease in cortical function [ 16 , 17 ] . \n we suggested that agraphia in our patient may be caused by a general decrease in left cortical function concomitant with a disruption of the thalamocortical and cortico - thalamocortical projection fibers resulting from thalamic hemorrhage in the lateral nuclear group .", "role": "user" }, { "content": "a 71-year - old right - handed man was admitted to our hospital with right hemiparesis and sensory impairment associated with mild aphasia . \n although aphasia gradually resolved within 2 weeks after stroke onset , his writing ability remained disturbed . \n a computed tomography ( ct ) scan at stroke onset revealed a hematoma in the left thalamus , but no cortical lesions were observed . \n further , a single - photon emission ct ( spect ) scan showed decreased blood flow in the left thalamus , in the cortical region extending from the left superior temporal gyrus to the parietal lobe , and in the frontal lobe . \n it is possible that agraphia may have directly resulted from the thalamic lesion , but spect findings strongly suggested that a general decrease in left cortical function concomitant with a disruption of the thalamocortical and cortico - thalamocortical projection fibers produced these cognitive deficits .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: acute pancreatitis ( ap ) is a common disease of the gastrointestinal tract , with a serious potential to burden the patient with physical , emotional , and economic problems . \n the reported case fatality rate for ap has gone down over time ; however , the overall population mortality rate has not meaningfully changed . \n ap is typically characterized by edema and inflammatory infiltration . however , it might also manifest with necrosis and hemorrhage in severe cases . \n a full recovery is usually expected in the vast majority of the cases that show a non - complicated progress . however , the disease progress into the severe form in 1520% of cases . \n this severe form is called necrotizing pancreatitis and might exhibit a mortality rate as high as 30% . \n there are still debates over the exact mechanism of pancreatitis , which remains a complex disease . \n injured pancreatic acinar cells pave the way for a series of complex events , including increased generation of reactive oxygen species ( ros ) . \n polyunsaturated fatty acids , which are abundantly present in the mitochondrial membrane and in the plasma membrane , are easily targeted by ros . \n a reaction between these acids and ros ( especially hydroxyl free radicals ) causes lipid peroxide formation , resulting in membrane disintegration and pancreatic necrosis . \n silybin is a flavonolignan that accounts for 60% of silymarin . as a major active agent , \n it exerts antioxidant effects by inhibiting formation of radicals , scavenging free radicals , and hampering lipid peroxidation of membranes and thereby controlling membrane permeability , and causing increased intracellular content of scavenger . in several hepatoxicity models \n . moreover , it was reported to prevent severe hepatic failure and save lives when administered within 48 h after amanita phalloides mushroom poisoning in humans . \n the aim of the present study was to investigate the potential effect of silybin on ap , considering its experimentally and clinically proven antioxidant effects on hepatic diseases . \n it was performed at the experimental animals and research laboratory of the faculty of medicine of dicle university ( diyarbakir , turkey ) . \n all the animals were provided with proper care in accordance with the principle of laboratory animal care formulated by the national society for medical research . \n they were maintained in a 12-h light / dark cycle at 21c for 1 week prior to the study . \n they were placed on restricted food intake with no restriction on water intake 12 h before the induction of anesthesia . \n ap was induced by 2 injections of 250 mg/100 g of l - arginine ( sigma chemical , st . \n louis , mo , usa ) prepared with 20% 0.15 m nacl and administered via intraperitoneal ( i.p . ) \n route at 1-h intervals . as in the previously reported studies , 528.5 mg of silybin ( legalon sil , madaus co. , koln , germany ) \n was dissolved in 35 ml of 0.9% nacl+5% dextrose water ( d5sn ) and administered at a single dose of 100 mg / kg by i.p . \n the rats were anesthetized with 50 mg / kg of ketamine hydrochloride ( ketalar pfizer , istanbul ) and 5 mg / kg of xylazine hydrochloride ( rompon bayer , sisli , istanbul ) administered via intramuscular ( i.m . ) route under aseptic conditions . with the rats placed in the spine position , \n after 7 days of acclimatization , the rats were divided into 5 groups ( n=8 per group ) . \n the slla group received a single i.p injection of silybin at a dose of 100 mg / kg body weight 60 min before the induction of ap with l - arginine , whereas the lasl group received the same dose of silybin after the second injection of l - arginine . \n blood samples were taken from the rats following cardiac puncture to measure amylase , tas , and tos levels . \n these samples were placed in ice and transported to the biochemistry laboratory , where they were centrifuged at 3000 rpm for 3 min for separation . \n the pancreatic tissue samples were fixed in 10% neutral buffered formalin solution for histopathological analysis . \n all histopathological analyses were performed under light microscopy in a blinded manner by the same pathologist ( i.i . ) . \n edema , acinar cell necrosis , hemorrhage , and inflammation were histopathologically evaluated in the pancreas ( figure 1 ) . \n amylase levels were measured on an architect c 16000 device manufactured by abbott , using the original abbott kits . \n tas and tos levels were measured with the abbott architect c16000 auto analyzer ( illinois , usa ) using the commercially available kits ( relassay , turkey ) . \n the automated colorimetric measurement methods developed by erel were employed for tas and tos measurements . \n osi was calculated using the following formula : osi = tos ( mol / l h2o2)/[tas ( mol / l trolox)*100 ] . \n multiple comparisons among groups were performed by means of the kruskal - wallis test and the mann - whitney u test . \n statistical significance was determined using two - tailed tests . a p value smaller than 0.05 was considered statistically significant . \n after 7 days of acclimatization , the rats were divided into 5 groups ( n=8 per group ) . \n the slla group received a single i.p injection of silybin at a dose of 100 mg / kg body weight 60 min before the induction of ap with l - arginine , whereas the lasl group received the same dose of silybin after the second injection of l - arginine . \n blood samples were taken from the rats following cardiac puncture to measure amylase , tas , and tos levels . \n these samples were placed in ice and transported to the biochemistry laboratory , where they were centrifuged at 3000 rpm for 3 min for separation . \n the pancreatic tissue samples were fixed in 10% neutral buffered formalin solution for histopathological analysis . \n all histopathological analyses were performed under light microscopy in a blinded manner by the same pathologist ( i.i . ) . \n edema , acinar cell necrosis , hemorrhage , and inflammation were histopathologically evaluated in the pancreas ( figure 1 ) . \n amylase levels were measured on an architect c 16000 device manufactured by abbott , using the original abbott kits . \n tas and tos levels were measured with the abbott architect c16000 auto analyzer ( illinois , usa ) using the commercially available kits ( relassay , turkey ) . \n the automated colorimetric measurement methods developed by erel were employed for tas and tos measurements . \n osi was calculated using the following formula : osi = tos ( mol / l h2o2)/[tas ( mol / l trolox)*100 ] . \n multiple comparisons among groups were performed by means of the kruskal - wallis test and the mann - whitney u test . \n statistical significance was determined using two - tailed tests . a p value smaller than 0.05 was considered statistically significant . \n one of the rats in the group la died before the procedure . as a result \n the sl group exhibited no significant alterations in the measured parameters in comparison to the control group . \n the highest amylase level was observed in the la group ( 13961154 iu / ml ) . \n there was a significant difference between the la group and the control group in amylase levels ( p=0.008 ) . \n tos and osi levels were significantly elevated in the la group compared to the slla and lasl groups ( p=0.001 and p=0.005 , respectively ) . \n equivalent / l ) and the lowest in the la group ( 0.570.10 m h2o2 equivalent/ ) . \n tas levels in the slla and lasl groups were significantly higher than those in the la group ( p=0.001 and 0.003 , respectively ) . \n the histopathological analyses revealed that edema , perivascular inflammation , and necrosis scores , as well as total scores , were highest in the la group . \n all the scores except for hemorrhage score were significantly higher in the la group compared to the control group ( p=0.001 ) . \n the histopathological evaluations demonstrated that perivascular inflammation and necrosis scores as well as total scores were significantly lower in the slla group than in the la group ( p=0.004 , p=0.011 and p=0.007 , respectively ) . \n total scores and perivascular inflammation scores were significantly lower in the slla group than in the lasl group ( p=0.012 and p=0.044 , respectively ) . \n although it has long been a prominent subject of research , pancreatic inflammation still lacks a through pathogenetic explanation and a specific treatment strategy . today , common therapeutic approaches used for ap include enteral and parenteral nutrition , antibiotic treatment , and surgical removal of the necrotic tissue , which mostly fail to target the primary insult to the pancreas and instead deal with symptoms and complications . therefore , experimental studies investigating potential treatment strategies that might complement the available therapeutic approaches for this catastrophic disease are of paramount importance . in this experimental study , \n we found that serum levels of oxidative stress parameters were significantly elevated in the rats with l - arginine - induced ap . \n when compared to the la group , the lasl group showed significant improvements in serum oxidative stress parameters only , whereas the slla group exhibited these improvements in both histopathological and serum oxidative parameters . \n although the pathogenesis of ap has yet to be fully explained , the involvement of oxidative stress is quite obvious . \n unstable reactive nitrogen species ( rns ) and ros are inclined to reaction with essential cellular components . \n the pancreatic concentration of gsh is the fourth largest concentration among all visceral organs . although gsh has the major cellular antioxidant capacity in the pancreas , there are also other cellular antioxidants in the pancreas \n . elimination of ros in general , and of ros in the peroxide family ( rooh ) in particular , happens through the actions of an enzyme containing selenium \n gpx causes a facilitated process of peroxide reduction into water or related alcohols via oxidation of gsh . \n reduced activity and/or expression of enzymes with antioxidant effects adds to the oxidative stress in pancreatitis . \n the levels of pancreatic gpx were reported to show significant alterations in different experimental ap and cp models . \n induction of ap by administration of arginine was shown to cause a reduction in pancreatic gpx activity . \n in addition , patients with severe ap had lower serum gpx activity than patients with mild ap , which suggests a correlation between gpx activity and severity of disease . \n oxidative stress shows a self - amplifying property , which is due to the recruitment of ros - producing inflammatory cells to the pancreas . \n these recruited cells cause further insult to the pancreas as they put an extra oxidative burden on the glands through a respiratory burst . \n mitogen - activated protein kinase ( mapk ) and nuclear factor kappa b ( nfkb ) , which control a number functions related to cytoskeletal regulation , transcription factor activation , apoptosis , differentiation , proliferation , growth and inflammation , are sensitive to oxidative stress . \n ros initiate the activation of mapk and regulate nfkb , an effective proinflammatory transcription factor . \n l - arginine is an essential amino acid that was previously used to induce severe necrotizing ap in rats . \n l - arginine creates free oxygen radicals ( for ) and exerts effects on microcirculation , whereby it damages the pancreas . . \n it shows antioxidant effects by inhibiting formation of radicals , scavenging free radicals , hampering lipid peroxidation of membranes ( thereby controlling membrane permeability ) , and causing an increased intracellular content of scavenger . in broad terms , silymarin and silybin \n interfere with the transduction cascade controlled by nfkb , an inducible and abundantly expressed dna - binding protein acting as a transcription factor for genes engaged in cell survival , differentiation , inflammation , and growth . in the present study , \n histopathological evaluations revealed significant improvements in inflammation and necrosis scores in the slla group , which received early prophylactic treatment , whereas such improvements were limited to edema scores in the lasl group . \n similarly , a previous study in a rat model of l - arginine - induced ap demonstrated distant organ improvements in the lungs as well as pancreatic improvements following early antioxidant treatment . \n it is likely that these results arise from the recruitment of inflammatory cells and less strong induction of nfkb as a result of reduced self - amplifying effects of ros in the presence of strong antioxidants at the outset of the inflammation . \n severe ap , characterized by persistent organ failure that fails to resolve within 48 h and/or death , represents 1520% of the cases . \n polyunsaturated fatty acids , which are abundantly present in the mitochondrial membrane as well as in the plasma membrane , are easily targeted by ros / rns . \n a reaction between these acids and ros ( especially hydroxyl free radicals ) causes lipid peroxide formation , resulting in membrane disintegration and pancreatic necrosis . in the present study , \n silybin was shown to cause significant improvements in pancreatic necrosis scores in the slla group compared to the la group ( p=0.006 ) . \n it is the most frequently observed complication of endoscopic retrograde cholangiopancreatography ( ercp ) , which was reported to occur in 510% of the cases and in 2040% of certain high - risk procedures . \n numerous pharmacological drug trials were undertaken in an effort to prevent this complication , but they mostly failed to give the desired results . in this respect , the drugs with the most promising results in weakening the inflammatory response of ap are the non - steroidal anti - inflammatory drugs ( nsaids ) . \n rectal nsaids have considerable potential to prevent post - ercp pancreatitis ; however , they fail to show the same potential to prevent the development of severe post - ercp pancreatitis . in the present study , \n the greatest improvements in oxidative stress and histopathological parameters were observed in the prophylaxis group , suggesting that prophylactic administration of silybin could be helpful in avoiding post - ercp pancreatitis , which remains a serious complication today . \n ap is a multi - system disease that can involve not only pancreas but also liver , lungs , and kidneys , with serious potential to cause distant organ dysfunction and death . \n the liver assumes pivotal importance in metabolic homeostasis and clearance of toxic substances and is involved in the systemic response to critical illnesses . in a caerulein - induced ap model , esresfoglu et al . demonstrated the restrictive power the antioxidant agents exerted over pancreatic and hepatic damage through tissue antioxidant enzyme activities . \n silybin , which was experimentally and clinically shown to be effective in hepatic diseases , is likely to be as effective as other antioxidants in hepatic damage caused by ap [ 911 ] . \n ap was previously reported to interfere with the endocrine functions of the pancreas . on the other hand , \n silybin was shown in animal and human studies to exert positive effects on these functions . \n these studies demonstrated the significant effects of silybin on plasma glucose and triglyceride levels , with a trend toward reduced levels of hemoglobin a1c . \n prophylactic administration of silybin , on the other hand , ameliorated both histopathological and oxidative stress parameters . \n available therapeutic approaches targeting oxidative stress , a critical pathogenic factor , fail to produce the desired results in acute inflammation of the pancreas . \n the present study shows that silybin , which has both antioxidant and anti - inflammatory properties and can safely be used in hepatic diseases , can be a helpful clinical agent in ap", "role": "user" }, { "content": "backgroundoxidative stress have been shown to play a role in the pathogenesis of acute pancreatitis . \n the aim of this study was to investigate the potential effect of silybin , a potent antioxidant , on l - arginine - induced acute pancreatitis in an experimental rat model.material/methodsforty female wistar albino rats were divided into 5 groups as follows : group 1 ( c ) : control group ( n=8 ) , group 2 ( sl ) : silybin group ( n=8 ) , group 3 ( la ) : acute pancreatitis group ( n=8 ) , group 4 ( slla ) : prophylaxis group ( n=8 ) , and group 5 ( lasl ) : treatment group ( n=8 ) . \n group c ( control ) received 2 intraperitoneal ( i.p . ) \n injections of physiological saline at an interval of 1 h. group sl received only a single i.p . \n injection of silybin . \n the slla group received a single i.p . \n injection of silybin before the induction of acute pancreatitis with l - arginine , whereas the lasl group received the same injection after the induction of acute pancreatitis with l - arginine . \n pancreatic tissues were histopathologically examined . \n levels of amylase and oxidative stress markers ( total oxidant status and total anti - oxidant status ) were determined in the blood samples . \n oxidative stress index was calculated.resultsin comparison to the la , the prophylaxis and treatment groups showed significant improvements in serum oxidative stress parameters ( p=0.001 and p=0.005 , respectively ) . \n histopathological analysis showed that the treatment group had significant improvements in edema scores only ( p=0.006 ) , whereas the prophylaxis group had the same improvements in inflammation and necrosis scores as well as in total scores ( p=0.004 , 0.006 , and 0.004 , respectively).conclusionswhen used for prophylactic rather than therapeutic purposes , silybin ameliorates serum oxidative stress parameters and improves histopathological results via its antioxidant and anti - inflammatory properties .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: vilmann , a gastroenterologist and leader in the field of esophageal ultrasound ( eus ) , who did some of the pioneering work on esophageal access of mediastinal structures for the diagnosis and staging of thoracic diseases , stated : but how can we proceed to implement eus - fna as a routine procedure in respiratory medicine ? now most groups performing eus - fna in the chest are still gastroenterologists , because the method was originally developed in this specialty 1 . \n this quote is as relevant today as it was then ; it has subsequently been shown that pulmonologists can effectively use the esophagus alone or simultaneously with airway access using the endoscope originally designed for bronchoscopic ultrasound and that pulmonologists can be trained to use the endoscope used by gastroenterology 2 \n 3 \n 4 \n 5 \n 6 \n 7 , but eus for the diagnosis of mediastinal disease is not widely performed by pulmonologists and is , in fact , discouraged by some of them 8 . \n there have been few studies of performance characteristics of eus vs. ebus . in our practice , we perform both ebus and eus and the approach chosen is based upon patient anatomy . \n we performed a retrospective review of our database specifically to contrast ebus with eus and to investigate relationships between route of access and other procedural parameters . \n after institutional review board approval , all ultrasound - guided endoscopies performed by interventional pulmonary at a single institution from august 1 , 2012 until april 30 , 2013 were retrospectively reviewed . to allow head - to - head comparison of eus and ebus procedures , \n patients requiring sedation for additional procedures such as regular bronchoscopy or chest tube insertion were excluded . \n all procedures were performed by one or both of the authors , both of whom are pulmonologists . at our institution , the endoscope that was originally designed for ebus ( bf - uc180f , olympus medical supply corporation , melville , new york , united states ) was used for both ebus and eus ; however , if indicated , crossover from one route of access to the other was readily possible . \n ( we limited our use of both techniques to the diagnosis of thoracic disease ; endosonography for primary gastrointestinal processes was performed by gastroenterology . ) \n all sampling was performed with the 21-gauge needle made by olympus for the bf - uc180f endoscope . \n the number of punctures was determined by on - site adequacy evaluation and by the level of suspiction for malignant involvment , and if so , the suspect lesions were sampled up to ten times . however \n rapid on - site cytologic evaluation ( rose ) was available for all procedures . \n the following parameters were selected for comparison : type of procedure ( eus , ebus , eus + ebus ) , sedation dosing , number of sites biopsied , specific sites biopsied , yield , procedure time , maximal oxygen flow during the procedure , time on oxygen post - procedure , and total time from procedure termination ( scope out ) until discharge . \n student s t - tests were used to determine significance with p < 0.05 considered significant . \n one hundred and sixty - five ultrasound - guided needle aspiration biopsy procedures were performed over the study interval . for three of these procedures , propofol was used for sedation , making it impossible to do comparative analysis . for seven procedures , \n these ten procedures were eliminated from the analysis , leaving 155 patient procedures for review . \n there were 61 patients who underwent eus alone , 73 patients who underwent ebus alone , and 21 patients who underwent combined procedures . \n age distribution , drug doses administered , procedure times , oxygen flow rates , and recovery times are presented in table 1 . \n one hundred and fifty of the procedures were performed for both diagnosis and staging of lung cancer . \n the remaining five procedures were performed to evaluate for possible mediastinal metastases of cancers previously diagnosed . \n these procedures were performed on four patients diagnosed with adenocarcinoma of the lung previously diagnosed using ct - guided biopsy and one patient diagnosed with adenocarcinoma of the breast . \n the midazolam dosing for eus alone was lower than for ebus alone ( p < 0.0002 ) and for the combined procedure ( p < 0.001 ) . \n there was no significant midazolam dosing difference between the ebus and eus + ebus groups . \n the same pattern was found for fentanyl dosing ; fentanyl dosing for eus alone was lower than for ebus alone ( p < 0.0001 ) and for the combined procedure ( p < 0.002 ) , although there was no significant fentanyl dosing difference between the ebus and eus + ebus groups . \n mean number of sites sampled varied significantly between groups and for eus vs. the other two groups ( p < 0.0001 ) . \n the mean procedure time for eus was approximately one - half the mean procedure time required for ebus ( p < 0.0001 ) . \n time to discharge was shortest for patients who underwent eus ( p < 0.0002 ) . \n whereas the significant differences in characteristics could have been related to the fact that fewer sites were sampled with eus , we compared all procedures that involved sampling of two or fewer sites with each approach ( none of the combined approach procedures involved sampling of fewer than two sites ) . \n there were 56 such eus procedures and 52 such ebus procedures , with a mean of 1.4 0.6 sites for eus and 1.6 0.6 for ebus ( ns , p = 0.18 ) . \n all data apart from maximal oxygen flow rates were significantly different when the results from these two groups were compared ( p < 0.001 ) . \n time to discharge remained shorter for the eus group ( p = 0.001 ) . \n patients in which both eus and ebus were performed ( n = 21 ) were reviewed . in twelve of these patients \n the sequence was eus followed by ebus , and in the remaining nine patients it was ebus followed by eus . \n the most common reason for a combined procedure ( n = 13 , 62 % ) was lack of diagnosis from the first approach based upon rose ; negative findings from one approach led to accessing other sites , or ( particularly with station 7 ) other areas of a nodal station to be certain that a significant pathologic process had not been missed . in six of the 21 patients ( 28 % ) \n the change in approach led to a positive diagnosis that was originally missed using the first approach ( 2/12 eus ebus , 4/9 ebus eus ) . in one patient , \n initial on - site eus cytology was negative , however , a slide obtained by eus before ebus but processed after the change to ebus was found to be positive for malignancy . in one patient , we switched from ebus to eus to obtain additional ( station 7 ) material for flow cytometry because of patient discomfort with the endoscope in the airways . \n sites accessed are listed in table 3 . as expected , the most frequently biopsied area was station 7 , which was followed by 4 r , 4 l , and 11 r. 4 r was occasionally accessible via the esophagus . \n a mass / structure other than a node was accessed 13 % of the time ( 36/282 needle aspiration biopsies ) . \n mean nodal sizes are also listed in table 3 although nodal size did not impact the capacity to sample it . \n an exception to this generalization is in 4 r from the esophagus ; it is not generally accessible from the esophagus , but in some instances it was so enlarged that esophageal access was possible . \n the mean number of passes was 3.42 ( minimum of 3 and maximum of 10 ) . \n seventy eus procedures were performed ( 61 as the initial procedure , nine as crossover studies ) . there were two false negatives , which were documented by crossover to ebus . in one patient , \n station 7 was negative from the esophagus and positive from the airway , and in a second patient , station 7 was not visualized from the esophagus , but was observed and was positive from the airway . \n eus was diagnostic in the remaining 97 % of patients : pathologic diagnoses among 73 % and no pathology found among 23 % of patients ( sensitivity , 0.96 ; 95 % ci 0.86 0.99 ; specificity , 1 ; 95 % ci 0.76 1 ) . \n negatives were shown to be negative for pathology by stability or regression over a two - year follow - up or , occasionally , by surgical resection . \n four false negative results were documented by crossover to eus , which yielded three station 7 nodes and one 4 l node . \n ebus was diagnostic in the remaining 81 procedures examined , with 74 % pathologic and 20 % benign diagnoses ( sensitivity , 0.92 ; 95 % ci 0.84 0.98 ; specificity , 1 ; 95 % ci 0.74 1 ) . \n once again , a benign designation was substantiated by two - year follow - up and occasionally by surgery . \n if the crossover studies were examined as a separate subset , diagnostic accuracy was 100 % ( 74 % pathologic , 26 % benign , confirmed with two - year follow - up or with surgical resection ) . \n two patients experienced severe post - procedural hypoxia ( one ebus and one ebus + eus ) . \n one patient had mediastinal bleeding related to the procedure ( ebus + eus ) . \n the primary objective of this study was to analyze differences in procedure characteristics related to differences in approach , but the data were also analyzed with respect to whether or not a specific diagnosis was achieved . achieving \n a specific diagnosis did have a significant impact upon study characteristics ; for all procedures combined , studies for which a diagnosis was achieved involved sampling of 1.8 0.8 stations over 19.3 9.7 min , whereas studies without specific diagnoses involved sampling of 2.4 0.8 stations over 27.3 7.1 min ( p = 0.007 and p = 0.017 , respectively ) . \n endoscopic ultrasound has revolutionized the diagnosis of mediastinal abnormalities and the nodal staging of lung cancer . the first ultrasound endoscope to be developed was for the gastrointestinal tract 9 . \n eus was initially used for the diagnostic evaluation of diseases of the gastrointestinal tract , but its application to lung cancer diagnosis and staging was rapidly conceptualized and brought to fruition 10 . the first clinical use of the smaller - diameter convex curvilinear ultrasound bronchoscope ( ebus scope ) was reported in 2004 11 , and ebus as a diagnostic tool has been widely adopted by the pulmonary community . \n it was subsequently shown both that the ebus scope can be used for eus and that pulmonologists can be trained to use the gastrointestinal endosonoscope 2 \n 3 \n 4 \n 5 \n 7 . \n eus with the ebus endoscope has not , however , been widely adopted by the pulmonary community , and prominent pulmonologists have questioned the true value of adding eus to ebus and stated that ebus is the initial procedure of choice : we agree that ebus - tena ( their term for eus - fna with ebus scope ) should be used only in circumstances when lymph node stations are difficult or are not accessible by tbna . \n 8 their bottom line was that eus using either endoscope might be better tolerated but was rarely indicated for the diagnosis of thoracic disease . \n kang et al investigated the value of ebus vs. eus in the diagnosis of potentially resectable lung cancers 12 . \n they found that if they did eus first , adding ebus contributed significantly to diagnostic yield , but if they did ebus first there was not a significant increase , leading to the conclusion that there is no complementary role for eus . \n kang et al . were unable to comment on parameters such as sedation differences between ebus and eus given the mandated crossover . \n they concluded that ebus is the appropriate initial approach , and the lack of complementary data from eus would lead to the conclusion that ebus is the only approach that should be used . \n eus - fna is generally well tolerated , and procedure tolerance may affect the selection procedure . in a second prospective study , oki et al randomized all candidates for endosonography with lesions accessible from both airway and esophagus and performed either ebus - tbna alone or eus - fna alone while monitoring performance characteristics 13 . \n with both study groups sedated to the extent that there was equal patient procedure tolerance , diagnostic eus - fna was associated with lower doses of lidocaine ( p < 0.001 ) and sedatives ( p = 0.02 ) , shorter procedure times ( p < 0.001 ) , and fewer oxygen desaturations ( p < 0.001 ) . also noted was that endoscopists preferred the esophageal approach ( p < 0.001 ) . \n our study has the disadvantage of not being prospective / randomized and the advantage of reflecting the application of both approaches to routine clinical practice . in our laboratory \n , we use the same scope for both ebus and eus ; there is no gradient of experience that leads us to choose one route over the other . \n it has been recurrently suggested in the literature that eus is better tolerated than ebus 3 \n 8 \n 12 \n 14 \n 15 \n 16 . \n our data combined with those of oki et al provide objective confirmation for this impression . \n when eus alone sufficed to achieve our clinical goals , we were able to do so with statistically significant economies of sedation , oxygen requirements , and recovery time . \n this was true when we looked at all diagnostic studies regardless of required sampling and remained true when we limited analysis to sampling of an equivalent number of nodes . \n when a crossover study was performed , total procedure time , sedation , oxygen requirements , and recovery for the combined study were significantly higher than for eus alone but not significantly different from those for ebus alone ; there was no negative impact upon these parameters from having started with eus . in our study with no mandated crossover \n in so doing , we did more ebus than eus , reflecting the fact that more nodes were accessible via ebus than via eus . \n the numbers were not , however , dramatically different ; 71 patients were diagnosed by ebus alone and 61 by eus alone . \n the major differences in sedation for the two routes occurred 1 ) at the time of insertion across the vocal cords and , subsequently , 2 ) when cough or discomfort made us wait for additional medication ( systemic or endobronchial ) to take effect , or 3 ) when patient desaturation made us pause . \n however , nodes are not more difficult to see or to reach from the airway vs. the esophagus , and identification of any specific node takes a matter of seconds . in a calm patient , one can reach 4 r from the airway just as fast as 8 r from the esophagus . \n crossover to from eus to ebus ( or vice versa ) is always an option in our lab , and in our study ebus was just as likely as eus to require a crossover procedure . \n the most important finding from the crossover data are that the two approaches were complementary ; in patients not diagnosed by the initial approach , crossover led to a diagnosis 28 % of the time . \n as noted , kang et al . did not find eus and ebus to be complementary , 12 but there is a significant body of literature that , like our data , suggests that they are 4 \n 5 \n 17 \n 18 \n 19 . \n this study examined needle aspiration of solid tissue structures with eus and ebus , and we alternated between the two approaches in some patients in both \n procedure ; the dirtiest structure involved in these procedures is the mouth , and both ebus and eus involve passing the endoscope through this bacteria - laden environment . \n we consider this to be the dominant etiology of risk and have felt that entry into the esophagus before the trachea does not increase that risk . \n notably , aspiration of cystic structures has been associated with a higher risk 21 ; we did encounter one of these situations . based upon our understanding \n , we have routinely performed ebus and eus - fna interchangeably , with the first procedure performed to a ) maximize yield ( diagnosis , staging if relevant ) and b ) minimize risk and discomfort . \n we have performed over 1000 combined procedures , and we have yet to see an infectious complication . in summary , villman s vision of eus becoming a routine pulmonary procedure has not been realized ; only a small fraction of the pulmonary community has incorporated eus , some using the ebus endoscope and an even smaller minority using the gastrointestinal endoscope . \n the data of kang et al would lead to the conclusion that that ebus alone is all that is required for evaluation of diseases involving the mediastinum 12 . \n the data of oki et al coupled with our data leads to different conclusions 22 . \n the impression that eus is better tolerated is now supported by data demonstrating efficiencies of sedation , time , and oxygenation with eus vs. ebus . \n this study demonstrates advantages of eus , regardless of whether the operator is a pulmonologist or a gastroenterologist . \n the advantages of pulmonary alone performing both with the same endoscope include economies of time , sedation , and equipment and a seamless transition between modalities . in an institution with separate physicians performing ebus and eus \n , we would suggest careful pre - review of the radiologic data and a collaborative procedure if both routes of access are likely to yield important data . \n based upon our data , we conclude that if eus might adequately establish a diagnosis ( and , if relevant , a stage ) , then eus should be the first procedure . \n integration of the two procedures can be achieved either via cross - training by pulmonologists or by collaborative procedures including both pulmonology and gastroenterology .", "role": "user" }, { "content": "background and study aims : one can approach mediastinal pathology via esophageal ultrasound ( eus ) and/or endobronchial ultrasound ( ebus ) . \n it has been suggested that eus is better tolerated by patients . \n if so , eus might be the procedure of choice when suspect lesions are accessible via eus . \n we studied procedural characteristics of eus with fine needle aspiration ( eus - fna ) and ebus with transbronchial needle aspiration ( ebus - tbna ) to see how they differed . \n patients and methods : retrospective review of consecutive ebus and eus procedures performed on patients over nine months . \n one hundred fifty - five procedures were analyzed ( 61 eus , 73 ebus , 21 eus + ebus ) . \n for eus , ebus , and eus + ebus , 1.4 , 2.0 and 2.5 sites ( mean ) were sampled , respectively . \n eus required approximately one - half of the time of ebus or the combined procedures ; 13.1 vs. 24.1 and 26.9 min , respectively ( p < 0.0001 for eus vs. both ebus and eus + ebus ) . \n sedation dosing was statistically lower for eus and not significantly different between ebus and the combined approach . \n eus also involved lower oxygen requirements and shorter time to discharge . because fewer mean \n sites were sampled with eus than with ebus or the combined procedure , we performed analysis restricted to procedures that involved sampling of 2 sites to determine whether approach - related differences in procedure characteristics were preserved . \n there were 56 such eus procedures and 52 such ebus procedures . \n eus remained significantly faster and required less patient sedation . \n conclusions : eus involved statistically significant economies of time and sedation . \n this has implications with respect to safety and productivity . when applicable , eus is the procedure of choice .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: health - related quality of life ( hrqol ) is a concept that involves an individual s perception of her or his health status in relation to the culture and value systems in which they live . \n in addition to their expectations , goals , concerns , and living standards , hrqol takes into account the presence of physical , mental , and social well - being . \n chronic liver disease ( cld ) includes a broad spectrum of diseases , including viral and alcoholic hepatitis , and autoimmune and metabolic diseases , all of which may result in cirrhosis and hepatocellular carcinomas . \n patients may suffer from different types of clds and concomitant symptoms , including fatigue , anorexia , pruritus , and depression . \n the long recrudescent course of the disease exerts considerable negative impact on patients health and lifestyle . \n therefore , several arrangements and validated questionnaires have been designed to measure the hrqol in cld patients . in patients with clds \n , the severity of disease , as determined by stage of fibrosis or child - pugh scores , appears to have a considerable relationship with hrqol . \n considering the percentage of the general population affected by clds and the severity and chronic nature of the symptoms , a need emerges for evaluating the quality of life using standard protocol questionnaires in different age - groups . \n the aim of this study is to assess the hrqol in children with cld using the pedsql 4.0 questionnaire based on child self - report and parent proxy - report forms . \n we assumed that cld in children would exert a significant negative effect on their quality of life and the severity of the disease would also be a matter of importance . \n this was a prospective case - control study approved by the ethics committee of islamic azad university . \n patients and their parents were informed of the purpose of the current trial and they signed informed consent forms before their enrollment . \n a total of 164 children ( 55 cld and 109 healthy children ) were recruited from the pediatric department at ghaem hospital in mashhad from 2010 to 2014 . \n inclusion criteria included children and adolescents ( aged 2 to 18 years old ) affected by chronic liver disease without considering its etiology . \n chronic disease was defined as a disease that lasted for 6 months or more for which there is no cure . \n parents of patients did not suffered from any type of liver dysfunction . the current hrqol questionnaire in pediatrics \n was designed by the world health organization ( who ) and consisted of the 23-item hrqol generic core scales for children and teens aged 2 to 18 years old . \n we used the pedsql 4.0 questionnaire farsi version that evaluated the reliability , validity , and feasibility of the questioner in healthy iranian children of the same age group . \n the pedsql 4.0 generic core scale is a 23-item questionnaire of self and proxy reports consisting of 4 scales to evaluate physical , emotional , social , and academic functioning . \n a 5-point response scale ranges from 0 ( never a problem ) to 4 ( almost always a problem ) . \n each item is reverse - scored and linearly transformed to a 0100 scale , with higher agreement placed at the top of the scale . \n our participants were aged between 6 and 17 years and if the child or teen was unable to complete the self - report forms , the study administrator read a questionnaire aloud for them and avoided suggesting a specific answer by avoiding intonation change . \n parents self - administered the pedsql 4.0 after a brief instruction from the administrator . upon entry , we also gathered the required demographic data and laboratory tests related to cld to calculate child pugh and meld / peld scores in the case group . \n the mean score of each scale was calculated for further statistical analysis . in order to measure the magnitude of the differences between two groups , we calculated the effect size defined as the difference between the means of the case and control groups , divided by the pooled standard deviation ( sd ) . \n the most well - known benchmarks have been presented by cohen , whereby 0.2 equates to a small effect , 0.5 equates to a medium effect , and effects larger than 0.8 equate are considered large ( 14 ) . \n a negative effect size means that , on average , the control group performed better than case group . \n statistical analysis was performed with the wilcoxon rank - sum test , chi - square analysis , fisher s exact test , and spearman s rank correlation coefficient . \n among the 164 participants , 55 cld cases ( 27 boys and 28 girls ) and 109 healthy individuals ( 52 boys and 56 girls ) were enrolled and completed the questionnaire . \n we matched the two groups based on their ages ( case=8.914.73 vs. control=8.974.54 years old ) , sex , and ethnicity . \n the demographic characteristics of our patients ( table 1 ) showed that the most common etiology of chronic liver disease was autoimmune hepatitis and metabolic diseases were the most common cause of cirrhosis ( 25.5% ) . \n children and their parents completed the pedsql 4.0 questionnaire independently and the final results are presented in tables 2 and 3 . according to the results , the total hrqol of child self - report scores in the case group ( 89.939.63 ) was significantly lower ( p=0.006 ) than cld control group ( 93.059.28 ) . \n while based on parent proxy - reports , total hrqol was slightly higher in control group , but not statistically significantly different . \n the effective size for both reports were in the small range ( tables 2 and 3 ) . comparing each scale in both groups , there was only a significant difference in emotional functioning based on the child self - reports ( p=0.001 ) and total hrqol score ( p=0.006 ) , with the majority of effect sizes in the small range ( > 0.2 ) . according to the parent proxy - reports , hrqol scores in children with cld were statistically significant with regards to emotional functioning in comparison to the control group ( p=0.002 ) , with small effect sizes across all domains . \n the greatest negative effect size ( 0.29 ) occurred in emotional functioning based on child self- and parent proxy reports . \n moreover , the analysis showed significant correlation between cld children and their parents scores ( p=0.001 ) on all four pedsql 4.0 generic scales ( physical ( r=0.723 ) , emotional ( r=0.726 ) , social ( r=0.528 ) , and school ( r=0.740 ) functions ) , with the greatest level of agreement with the pedsql 4.0 school scale \n . there were no significant differences in total hrqol scores between girls ( 88.6612.16 ) and boys ( 91.275.986 ) in the children self - reports ( p=0.865 ) and the parent proxy - reports ( p=0.533 ) . \n our results found no correlation between age and total hrqol considering child self - reports ( r=0.133 , p=0.227 ) and parent proxy - reports ( r=0.554 , p=0.082 ) . \n we also evaluated the severity of cld disease based on child - pugh and meld / peld scores in the case group ( table 4 ) . \n based on child self - reports , there was no statistically significant correlation between severity and hrqol score scales , except that physical functioning was statistically related to the child - pugh score ( p=0.03 , r=0.31 ) and meld / peld scores ( p=0.01 , r=0.35 ) . \n there was no significant relation between child - pugh and meld / peld scores and parent proxy - reports in case group ( p<0.05 , table 4 ) . finally , based on child self- and parent proxy - reports \n , we found no significant relation between the onset age of cld , types of cld , duration of the disease , and treatment type . \n in recent decades , there has been a rise in concern regarding hrqol for different diseases . to our knowledge , this is the first study to evaluate the hrqol of cld children in iran . in the current study \n , we assessed the hrqol of children with cld using the pedsql 4.0 questionnaire , which is based on child self - report and parent proxy - reports . \n our finding suggested a significantly lower emotional functioning and total hrqol in cld children , based on self - reports . \n nydeggar et al . showed lower physical functioning in children with chronic hepatitis c virus ( hcv ) relative to non - hcv children . in alonso \n et al.s study , pediatric liver transplant recipients also scored significantly lower in physical and general health compared to the normative sample . in agreement with our results , \n several studies have reported that hrqol in children with chronic diseases is lower than in the healthy population . \n these results can be explained by the fact that illness places a heavy burden on different aspects of their health , which changes their attitude towards life . \n as far as children are concerned , parents judgment is of great value . to help define this relationship \n , our investigation revealed a correlation between cld child self- and parent proxy - reports in all five scales . \n this result is in concordance with alonso et al . , which studied liver transplant in children and gulati et al . , where children with autoimmune disease were studied \n a recent cross - sectional study by sundaram ( 2013 ) showed moderate agreement across all scales , except social functioning in children with biliary atresia with their native livers . in our study , \n the strongest agreement was in school functioning that may represent parents higher ability to judge the observable health status in their children . according to a systematic review by upton ( 2008 ) , parents of affected children exhibit a tendency to underestimate child hrqol . \n we also found a negative correlation between severity ( child - pugh and meld / peld scores ) and physical functioning based on child self - reporting . \n this result is supported by younossi and gutteling , who showed that disease severity was related to lower hrqol scores in patients with cld . \n these results differ from huser et al . , which determined severity of disease had no effect on hrqol . \n gender assessment in afendy et al.s study showed more hrqol impairment in female patients with cld . \n in contrast to their result , we found no differences between males and females in both child and parent reports , similar to the zuberi and huser studies . \n this result is in concordance with our own and in contrast to younossi et al . who stated that more advanced age is associated with poorer hrqol . \n our results may originate in the negative health perceptions and emotional statuses that occur during chronic diseases that influence different aspects of life in every age group . \n although the results of this study report lower hrqol in children with cld , a chronic liver disease - specific questionnaire accompanied with the pedsql 4.0 questionnaire can shed light on other particular and negative effects cld has on patients health . a validated cld - specific questionnaire in farsi may be more helpful to reach the desirable goal . \n clinicians , healthcare , and policy makers should be more concerned with the practical value of measuring hrqol . \n furthermore , this study highlights the importance of parents being well acquainted with their child perception of quality of life and illness to help the children consciously adapt to the situation .", "role": "user" }, { "content": "background : health - related quality of life ( hrqol ) is a concept that relates to an individual s perception of health status in relation to the culture and value systems in which they live , in addition to their expectations , goals , concerns , and living standards . considering the size of the population affected by chronic liver diseases ( clds ) and the severity and chronic nature of the symptoms , there is an emerging need to evaluate the quality of life of patients using a standard protocol . \n the aim of this study is to assess the hrqol in children with cld based on child self - report and parent proxy - report forms.methods:a total of 164 children , 55 cld and 109 healthy children ( aged 617 years ) , upon referral from the pediatric department at ghaem hospital in mashhad from 2010 to 2014 were enrolled in this case - control study . \n we used the pedsqltm 4.0 generic score scale to assess the hrqol in children with cld compared to the control group based on child self- and parent proxy reports.results:according to the child self - reports , the total hrqol in the case group ( 89.939.63 ) was significantly lower than control group ( 93.059.28 ) ( p=0.006 ) . \n we found significant differences in emotional functioning based on the cld child self - reports ( p=0.001 ) and their parent proxy - reports ( p=0.002 ) . \n furthermore , there was a statistically significant correlation between the severity and physical functioning as reported by the child - pugh score ( p=0.03 , r= 0.31 ) and the meld / peld scores ( p=0.01 , r= 0.35 ) , based on child self - reports . \n gender , age of onset , cld types , duration of the disease , and treatment showed no significant differences with total hrqol.conclusion:hrqol is significantly lower in children with cld in comparison to the normal population . \n we strongly recommend considering different aspects of quality of life , especially emotional functioning concomitant to the therapy programs .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: human herpesvirus 8 ( hhv-8 ) is a rhadinovirus of the subfamily gammaherpesvirinae , and belonged to herpesviridae family ( 1 ) . \n the association between hhv-8 and aids - related kaposi s sarcoma has been clearly identified ( 1 ) . moreover \n hhv-8 consistently related to lymphoproliferative diseases , like primary effusion lymphoma and multicentric castelman s disease ( 24 ) . \n hhv-8 distribution is very variable and exhibits both geographical and behavioral risk factors as serological investigations reported high seroprevalence rate of 48% in blood donors of tanzania ( 5,6 ) and low prevalence of 2.8% to 7.3% in the united states blood donors ( 7,8 ) . \n the incidence rates of kaposi s sarcoma ( ks ) consider to be increased in regions with a high prevalence rate of hhv-8 . \n immunosuppressed cases , such as patients with end - stage renal disease , solid organ transplant recipients , and hiv patients , are at risk of acquiring hhv-8 associated diseases ( 9 , 10 ) . additionally hiv infection significantly increases the risk of hiv - ks development and worsens its natural course ( 11 , 12 ) . it is considered that 40% of hiv patients may develop cancer and ks is the most common neoplasm seen in patients infected with hiv ( 3 , 13 ) . \n although with the introduction of highly active antiretroviral treatment ( haart ) and its influence on reconstitution of immune system , ks incidence has decreased , the emergence of hiv drug resistant isolates grows the concern for a reemergence of cases with ks . in hiv patients , \n presence of hhv-8 viremia is predictive for future development of ks and used for monitoring of response to treatment ( 14 ) . \n while few iranian studies showed high seroprevalence rate of hhv-8 among hemodialysis patients ( 16.9% ) , renal transplant recipients ( 25% ) and hiv patients ( 45.7% ) ( 15 , 16 ) , there are insufficient data on the prevalence of hhv-8 viremia in iranian population . \n we therefore , aimed to determine the prevalence of hhv-8 viremia in general population and hiv infected patients without ks in tehran . \n in this cross - sectional study , 99 patients with hiv infection referred to iranian research center for hiv / aids in tehran , and 40 healthy controls were consecutively enrolled in the study from jan to apr 2014 . \n the study protocol was approved by pasteur institute of iran ethical committee and informed consent was obtained from subjects prior to their enrollment . whole blood sample from each subject was collected in an edta - containing sterile tube and centrifuged at room temperature at 1500 x g for 15 min to separate leukocyte band ( buffy coat ) , plasma and concentrated red blood cells ( rbcs ) . \n after centrifugation , buffy coat was aspirated with a sampler and collected in a sterile tube . \n for lysing of erythrocytes , one volume of blood was mixed with two volumes of 0.83% nh4cl solution and erythrocytes were lysed . \n the leukocytes were collected after centrifugation at 2500 x g for 10 min and two additional washes with pbs . \n the peripheral blood leukocytes ( pbl ) were re - suspended in 500l of pbs solution and stored at 20 c until testing . \n viral dna was extracted from 200 l of pbl using invisorbspin tissue mini kit ( invitek , berlin , germany ) and invisorb spin blood mini kit following the manufacturer s instructions . \n the suitability of extracted dna was confirmed by -globin gene amplification using pco3 ( 5- acacaactgtgttcactagc -3 ) and pco4 ( 5- caacttcatccacgttcacc -3 ) primers that amplify a 102-bp fragment . \n pcr was performed with a 25l amplicon mixture containing 1l extracted dna , 15 mm tris - hcl ( ph 8.0 ) , 50 mm kcl , 1.5 mm mgcl2 , 200 m dntp , 200 m each of primers , 1x pcr buffer and 1 u taq polymerase ( yta pcr master mix , iran ) . \n the detection of hhv-8 dna was performed by nested pcr using primers specific for the orf 26 primers of hhv-8 , described previously ( 17 ) including primers ks1 ( 5- agccgaaaggattccaccattcc -3 ) and ks2(5- gtgttgtctacgtccag -3 ) for first pcr reaction and primers ks3 ( 5- tattctgcagcagctgttgg -3 ) and ks4 ( 5- tctacgtccagacgatatgtgc -3 ) for second pcr reaction . \n briefly , a 5l sample of dna extract was added to 20l of a same pcr mixture ( above ) with primer ks1 and ks2 , which amplify a 233 bp fragment . \n the second reaction utilized the same mixture ( above ) , but with ks3 and ks4 primers and 5 l of first - round pcr product . \n for both first and second steps , dsdna was initially denatured for 5 min at 95 c , followed by 35 cycles of 95 c for 40 sec , 59 c for 40 sec and 72 c for 40 sec and the final extension step at 72 c for 5 min . \n each batch included negative controls ( distilled water ) and positive samples from previous study ( 20 ) as positive control . \n the pcr products were electrophoresed on a 1.5% agarose gel with the 100-bp dna ladder ( sinaclon , tehran , iran ) and stained with ethidium bromide and visualized by ultraviolet transillumination . \n statistical analyses were conducted using spss statistics software ( version 16 , chicago , il , usa ) . the chi square test or fisher s exact test was used to compare variables . \n data are presented as meansd or , when indicated , as an absolute number and percentage . \n in this cross - sectional study , 99 patients with hiv infection referred to iranian research center for hiv / aids in tehran , and 40 healthy controls were consecutively enrolled in the study from jan to apr 2014 . \n the study protocol was approved by pasteur institute of iran ethical committee and informed consent was obtained from subjects prior to their enrollment . whole blood sample from each subject was collected in an edta - containing sterile tube and centrifuged at room temperature at 1500 x g for 15 min to separate leukocyte band ( buffy coat ) , plasma and concentrated red blood cells ( rbcs ) . \n after centrifugation , buffy coat was aspirated with a sampler and collected in a sterile tube . \n for lysing of erythrocytes , one volume of blood was mixed with two volumes of 0.83% nh4cl solution and erythrocytes were lysed . \n the leukocytes were collected after centrifugation at 2500 x g for 10 min and two additional washes with pbs . \n the peripheral blood leukocytes ( pbl ) were re - suspended in 500l of pbs solution and stored at 20 c until testing . \n viral dna was extracted from 200 l of pbl using invisorbspin tissue mini kit ( invitek , berlin , germany ) and invisorb spin blood mini kit following the manufacturer s instructions . \n the suitability of extracted dna was confirmed by -globin gene amplification using pco3 ( 5- acacaactgtgttcactagc -3 ) and pco4 ( 5- caacttcatccacgttcacc -3 ) primers that amplify a 102-bp fragment . \n pcr was performed with a 25l amplicon mixture containing 1l extracted dna , 15 mm tris - hcl ( ph 8.0 ) , 50 mm kcl , 1.5 mm mgcl2 , 200 m dntp , 200 m each of primers , 1x pcr buffer and 1 u taq polymerase ( yta pcr master mix , iran ) . \n the detection of hhv-8 dna was performed by nested pcr using primers specific for the orf 26 primers of hhv-8 , described previously ( 17 ) including primers ks1 ( 5- agccgaaaggattccaccattcc -3 ) and ks2(5- gtgttgtctacgtccag -3 ) for first pcr reaction and primers ks3 ( 5- tattctgcagcagctgttgg -3 ) and ks4 ( 5- tctacgtccagacgatatgtgc -3 ) for second pcr reaction . \n briefly , a 5l sample of dna extract was added to 20l of a same pcr mixture ( above ) with primer ks1 and ks2 , which amplify a 233 bp fragment . \n the second reaction utilized the same mixture ( above ) , but with ks3 and ks4 primers and 5 l of first - round pcr product . \n for both first and second steps , dsdna was initially denatured for 5 min at 95 c , followed by 35 cycles of 95 c for 40 sec , 59 c for 40 sec and 72 c for 40 sec and the final extension step at 72 c for 5 min . \n each batch included negative controls ( distilled water ) and positive samples from previous study ( 20 ) as positive control . \n the pcr products were electrophoresed on a 1.5% agarose gel with the 100-bp dna ladder ( sinaclon , tehran , iran ) and stained with ethidium bromide and visualized by ultraviolet transillumination . \n statistical analyses were conducted using spss statistics software ( version 16 , chicago , il , usa ) . the chi square test or fisher s exact test was used to compare variables . \n data are presented as meansd or , when indicated , as an absolute number and percentage . \n a total of 99 hiv infected patients with mean age of 37.910 yr and 40 healthy controls with mean age of 3911.5 yr were enrolled in the study . in hiv \n the reported routes of hiv transmission were intravenous drug use ( 54.6% ) , heterosexual contact ( 34.3% ) , infected blood and blood products transfusion ( 2% ) , vertical transmission ( 2% ) , homosexual ( 1% ) and in 6.1% the route of hiv acquisition was not identified . \n dna was detected in none of buffy - coat samples in both healthy control and hiv patient groups ( fig . \n lanes from right to left : dna size marker , negative control , positive control and samples \n this study investigated the prevalence of hhv-8 viremia in hiv infected patients without ks and healthy controls in tehran . \n we showed no evidence of hhv-8 viremia in general population and hiv patients . in the present study , \n lack of hhv-8 detection corroborates findings of prior studies conducted in low prevalence areas for hhv-8 . \n hhv-8 could be reactivated in immunocompromised situations such as patients with end - stage renal disease , transplant recipients , and hiv patients and it is associated with kaposi s sarcoma and some hematological diseases ( 2 , 9 , 10 ) . \n the seroprevalence of hhv-8 is very variable and there is an association between hhv-8 antibodies and the incidence of ks . \n high prevalence of hhv-8 infection found in areas where kaposi s sarcoma is endemic , for instance more than 50% in the general population of central and eastern africa ( 5 ) . while low prevalence of infection detected in the general population of the united states ( < 5% ) and northern europe ( < 10% ; except among homosexual men with aids ) with low incidence of ks ( 18 ) . in southern italy \n where classic ks is relatively frequent , intermediate prevalence rates of hhv-8 infection ( 10%25% ) have been reported ( 19 , 20 ) . \n several investigations were conducted on hhv-8 frequency in blood donors and normal population with variable results . \n for instance , in italy ( 21 ) showed hhv-8 dna in 9% of pbmc samples from blood donors . \n this rate was reported as 16.5% ( 22 ) in pbmcs of hhv-8 seropositive healthy adults . in brazil , \n hhv-8 antibody was detected in 4% of blood donors while only one case showed hhv-8 dna in pbmc and plasma samples ( 23 ) . \n in contrast , several investigations from north america could not find hhv-8 viremia in pbmcs of healthy donors by pcr as - says ( 8 , 24 , 25 ) . \n the negative pcr results in the general population detected in present study are in concordance with the studies from low prevalence areas such as the usa ( 8) , where all tested healthy blood donors were hhv-8 dna negative . \n prior surveys mainly focused on the seroprevalence of hhv-8 in healthy blood donors and data regarding the hhv-8 viremia in hiv infected patients without ks are scarce . situation such as hiv infection can raise the prevalence of hhv-8 especially in developing countries ( 26 ) . \n this issue is important because virus detection in pbmcs of hiv infected individuals can predict future development of ks lesions ( 14 ) . in a study \n ( 27 ) , 8.9% of hiv infected patients in taiwan showed hhv-8 dna in plasma . \n moreover , they observed , higher prevalence of plasma hhv-8 dna among men and patients younger than 40 yr old . in japan \n ( 28 ) , from , hhv-8 viremia evaluated in hiv infected patients with or without ks using real - time pcr . \n dna was detected in 29.6% of individuals and prevalence and load of hhv-8 dna were higher in patients with ks than patients without it ( not significant ) . \n hhv-8 viremia was found in pbmcs of 50%60% of patients with both types of classic and hiv - associated ks ( 29 ) . in india , \n none of 309 treatment - nave hiv cases and 70 normal healthy subjects tested was positive for hhv-8 dna ( 30 ) . \n although , published reports have shown different rate of hhv-8 virus replication among patients from different countries , the low hhv-8 replication detected in this paper could be in agreement with sachithanandham et al . \n ( 30 ) findings from india on hiv patients and compatible with low seroprevalence of this infection in iranian healthy blood donors ( 02% ) ( 15 , 31 ) . \n however , we should consider that haart reduce hhv-8 dna loads like hiv - rna and 76.3% of our cases were under haart treatment . \n the reduction of hiv replication with haart results to restoring of immune system and producing effective immune response against hhv-8 . \n moreover , kaposi s sarcoma is rare in iran and annual age - standardized incidence of ks varying from 0.06 to 0.08 per 100,000 in females to 0.10 to 0.17 per 100,000 in males ( 32 ) . \n therefore , regarding to the low prevalence of hhv-8 in blood donors and low incidence of ks in iran , the lack of hhv-8 detection in our cohort of hiv patients is not unexpected and may indicated that virus is not widespread in this population . \n this study investigated the prevalence of hhv-8 viremia in hiv infected patients without ks and normal population in iran . \n therefore , iran may be considered as a region with low endemicity for hhv-8 , due to low seroprevalence of hhv-8 ( 1.6% ) in blood donors and no evidence of hhv-8 dna in normal population and hiv patients \n . however , further epidemiological studies focusing on different regions of iran appear to be required to reach a more accurate estimation . \n ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .", "role": "user" }, { "content": "background : kaposi s sarcoma is a vascular malignancy , which frequently occurs among immunocompromised individuals such as transplant recipients and patients with acquired immunodeficiency syndrome . human herpesvirus 8 ( hhv-8 ) is considered the etiological agent of all forms of kaposi s sarcoma . \n though some seroepidemiological studies conducted on the prevalence of hhv-8 in iran , there are insufficient data on the prevalence of hhv-8 viremia in hiv infected patients . \n we therefore , aimed to determine the prevalence of hhv-8 viremia in general population and hiv infected patients without kaposi s sarcoma in tehran , iran.methods:we conducted a cross sectional survey on 99 patients with hiv infection referred to iranian research center for hiv / aids and 40 healthy controls in tehran , iran from january to april 2014 . \n the presence of hhv-8 dna was detected in buffy coat samples of enrolled subjects using nested pcr assay.results:a total of 99 hiv infected patients with mean age of 37.910 yr and 40 healthy controls with mean age of 3911.5 yr were enrolled in the study . \n the mean cd4 count was 410.3 211.4 cells / mm3 . \n hhv-8 dna was not detected in both healthy control and hiv patient groups.conclusion:this survey showed low rate of hhv-8 dna in healthy controls and hiv patients . considering our findings \n hhv-8 infection does not seem to be widespread in our population . \n further studies focusing on different regions of iran appear to be required to have a more accurate estimation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: chronic rhinosinusitis ( crs ) is one of the most common diseases in the otolaryngologic field . \n functional endoscopic sinus surgery ( fess ) represents the preferred surgical treatment for crs.1 \n fess was initially driven by messerklinger 's work in the late 1970s.2 it was then popularized and standardized in the beginning of the 1980s , particularly by kennedy et al3 and stammberger4 with their studies regarding the philosophy of clearing the natural ostium of the diseased sinus . due to the close anatomical relationship between the paranasal sinuses and the orbit , involvement or injury of the orbit from procedures the paranasal sinuses may occur.5 \n the ocular complications after fess \n include : nasolacrimal duct injury , extraocular muscle injury ; periorbital , intraorbital , or retrobulbar hematoma ; and even optic nerve injury . \n the risk of injury is correlated to the anatomical variations , the history of previous surgery , the extent of the disease , and the skills of the surgeon.6 \n 7 \n normal intraocular pressure ( iop ) is essential for normal eye structure and function \n . when the balance of aqueous formation and drainage is altered , iop changes . the iop elevation results in corneal edema , \n the common symptoms of increased iop are blurred vision , epiphora , headache , nausea , vomiting , or a sensation of pressure in the eyes.1 \n some studies have described the relationships between conventional sinus surgery and iop.8 \n 9 a previous research1 described the early effect of fess on iop ; however , in the current study , we aimed at detecting whether or not there is a delayed effect for this type of surgery on iop . \n thirty - eight patients were included in this prospective study . all included patients were suffering from nasal polypi refractory to medical treatment ( according to lanza and kennedy10 ) and had been scheduled for fess . \n exclusion criteria included patients that had diabetes mellitus , hypertension , glaucoma , ocular hypertension , previous ocular trauma , history of ocular surgery , defect in lamina paperatia , and patients within two days of using topical corticosteroid eye drops . \n any systemic conditions , such as carotid - cavernous fistula and pulmonary hypertension , which may induce changes in episcleral venous pressure were also excluded because the fluctuation of episcleral venous pressure results in changes in iop . \n all patients underwent medical history analysis , examination , diagnostic nasal endoscopy , and ct . \n we classified nasal polyps following the staging classification proposed by johansson et al11 ; level 0 - absent , level i - polyp in the middle meatus , level ii - polyp going through the middle turbinate with clear nasal floor , level iii - polyp filling up the entire nasal cavity . each nasal cavity was packed ( in middle meatus ) with a piece of gauze soaked with topical vasoconstrictor ( with adrenaline dissolved in saline in a concentration of 1:200,000 . ) \n we performed all surgeries under general anesthesia with oral endotracheal tube with the standard anterior to posterior approach for fess ( middle meatal antrostomy , anterior ethmoidectomy , posterior ethmoidectomy , sphenoidotomy , skull base clearance , and/or frontal sinus clearance ) . \n iop was measured for both eyes in all patients using goldmann applanation tonometry , and dilated funduscopy as baseline data one day before surgery . \n then , we measured iop on day 1 postoperatively and , lastly , at 6 weeks after surgery . \n we used the spss statistical software package ( version 18.0 ; spss , inc . , \n each nasal cavity was packed ( in middle meatus ) with a piece of gauze soaked with topical vasoconstrictor ( with adrenaline dissolved in saline in a concentration of 1:200,000 . ) \n we performed all surgeries under general anesthesia with oral endotracheal tube with the standard anterior to posterior approach for fess ( middle meatal antrostomy , anterior ethmoidectomy , posterior ethmoidectomy , sphenoidotomy , skull base clearance , and/or frontal sinus clearance ) . \n iop was measured for both eyes in all patients using goldmann applanation tonometry , and dilated funduscopy as baseline data one day before surgery . \n then , we measured iop on day 1 postoperatively and , lastly , at 6 weeks after surgery . \n we used the spss statistical software package ( version 18.0 ; spss , inc . , \n this study included 38 patients : 22 males ( 57.9% ) males and 16 females ( 42.1% ) . \n all patients underwent preoperative endoscopic nasal examination ( 76 nasal sides ) and various grades of nasal polyposis were detected . \n grade 0 was detected in 12 nasal sides ( 15.8% ) , grade 1 in 18 sides ( 23.7% ) , grade 2 in 28 sides ( 36.8% ) , and grade 3 in 18 sides ( 23.7% ) ( table 1 ) . \n no major complications were observed in this study ; only minor complications in the form of nasal adhesions between the inferior turbinate and septum ( in two cases ) . \n moreover , we found no significant correlation between the postoperative changes in iop values and the grades of nasal polyposis ( r value = 0.3521 ; r , the coefficient of determination , was 0.124 ) . \n we found that the mean preoperative pressure was 13.1 2.5 mm hg ( range , 10 - 18 mm hg ) in the right eye and 12.89 2.23 mm hg ( range , 10 - 17 mm hg ) in the left eye , and the difference between the mean iop values between the two sides was found to be statistically non - significant ( p = 0.7862 , t = 0.2732 ) ( tables 2 and 3 ) . abbreviations : iop , intraocular pressure ; sd , standard deviation . \n abbreviations : iop , intraocular pressure ; sd , standard deviation ; w , week . \n one day after surgery , the mean postoperative iop in the rt eye was 14.176 1.91 mm hg ( range 10 -17 mm hg ) and the difference between the mean preoperative and postoperative iop values was statistically non - significant ( p = 0.1589 , t = 1.4403 ) , whereas in the left eye mean postoperative iop was 13.79 2.42 mm hg ( range 10 - 19 mm hg ) . \n the difference between the mean preoperative and postoperative iop values was also statistically non - significant ( p = 0.0961 , t = 1.6859 ) . \n also , we observed that the difference in the postoperative iop values between both eyes one day after surgery was statistically non - significant ( p = 0.4428 , t = 0.7718 ) ( table 2 ) . \n six weeks after surgery , the mean postoperative iop in the right eye was 15.14 2.28 mm hg ( range 1018 mm hg ) and the difference between the mean preoperative and postoperative iop values was found to be statistically significant ( p = 0.0012 , t = 3.4027 ) , whereas in the left eye the mean postoperative iop was 15.14286 2.23 \n mm hg ( range 11 - 18 mm hg ) . the difference between the mean preoperative and postoperative iop values was also highly statistically significant ( p value = 0.0005 , t = 3.6808 ) . moreover , the difference in the postoperative iop values between right and left eyes 6 weeks after surgery was statistically non - significant . \n we also performed endoscopic nasal examination during follow - up until 6 weeks after surgery for a second - look evaluation . \n functional endoscopic sinus surgery ( fess ) has gained popularity in the diagnosis and treatment of paranasal sinus diseases.12 however , orbital negative sequels may occur due to its close anatomical relation with the paranasal sinuses.5 \n the incidence of serious complications of endoscopic sinus surgery reportedly reaches 0.5% . \n orbital injuries can range from eye pressure , pain , retrobulbar hemorrhage , and compromised extraocular muscle movement with sequential binocular diplopia to blindness.13 \n 14 \n 15 \n 16 \n intraocular pressure ( iop ) may be defined as the resulting balance between aqueous humor production and removal . \n its increase is considered to be one of the main risk factors leading to the development of glaucoma . \n iop is a variable value affected by multiple factors : age , gender , race , tobacco consumption , local ocular problems , obesity , hormonal changes , and physical exercise , among others.17 \n 18 \n 19 \n no clear line exists between safe and unsafe iops . in general , in cases in which the iop is less than 30 mm hg , the eye can be observed , and in cases in which the iop is more than 40 mm hg , a poor vision result may ensue . \n the iop can be measured clinically by various types of tonometers , including the goldmann applanation tonometer , noncontact tonometer , and tonopen . \n the goldmann applanation tonometer is the most valid and reliable.20 that is why we used it in current study . in the current study , \n the mean preoperative iop rose 1 day postoperatively , but this increase was found to be statistically non - significant . in contrast , six weeks after surgery , we had noticed that the mean iop increased in both eyes and this increase , surprisingly , was statistically significant in both eyes . \n the postoperative results one day after surgery of this study agree with the results of lin et al,1 who found also that the postoperative increase in the average iop values is statistically non - significant , taking into consideration that lin et al1 studied the early effect of fess on iop as they measured iop in three consecutive days after surgery . \n the mechanism by which iop is raised post - fess whether in the early or late postoperative period is not clearly understood . \n the eyeball , orbit , and parts of the sinonasal areas share the same vascular supply from the ophthalmic artery . \n the venous drainage of the orbit and ocular structures is via the central retinal vein ( drains into the superior ophthalmic vein ) and the vortex vein ( drains into the inferior ophthalmic vein ) . \n the vascular supplies of the sinuses are partial from the anterior and posterior ethmoidal arteries those are also derived from the ophthalmic artery , and the anterior and posterior ethmoidal veins drain into the superior ophthalmic vein.21 \n lin et al1 observed that the post - fess symptoms of epiphora and eye pressure were similar to the symptoms of increased iop . given that the eyes and sinonasal region have the same origin of vascular supply , they decided to elucidate whether fess would result in a significant change in the iop before and after surgery . \n they detected increased iop . in the early postoperative period , in agreement with the current study , these changes were statistically insignificant . \n a possible cause of increased iop postoperatively could be excessive gauze packing and overinflated antral balloons of the foley type , after the caldwell - luc operation . \n gelman et al8 reported a case of acute ocular hypertension following the use of an antral balloon after repairing fractures on the floor of the orbit via a caldwell - luc antrostomy . \n another study was done by papangelou and christidis9 to investigate whether there would be any effects on the iop in patients who underwent a caldwell - luc operation for chronic sinusitis or antral polyps . \n they found that some changes of iop occurred whether or not the maxillary sinus walls were denuded of mucous membrane . \n they performed endoscopic grading for nasal polyposis preoperatively and observed various grades ; however , when correlating the postoperative changes in iop values with the grades of nasal polyposis , they found no correlation . \n many researchers studied the effect of endotracheal intubation on iop and found a transient increase in the iop intraoperatively and in the early postoperative period . \n malti and geeta22 reported that endotracheal intubation is associated with tachycardia , hypertension , and increase in intraocular pressure and that the latter may not have any adverse effect in patients with healthy eyes but has deleterious effects on a diseased or an injured eye . \n they also concluded in their study that laryngeal mask airway insertion is a suitable alternative to endotracheal intubation in patients having penetrating eye injuries , glaucoma , and strabismus in whom elevation of intraocular pressure is likely to be detrimental . \n langham et al23 and murphy24 stated that endotracheal intubation can lead to adrenergic stimulation may cause vasoconstriction and an increase in central venous pressure which has a closer relationship to intraocular pressure than systemic pressure . \n it can produce an acute increase in intraocular pressure by increasing the resistance to the outflow of aqueous humor in the trabecular meshwork between the anterior chamber and the schlemm 's canal . \n nonetheless , the cause of delayed increase in iop remains unclear , so further studies are needed to explain the effect in iop post - fess . to the best of our knowledge , \n this the first study to deal with the delayed effect of fees on iop . however , further studies are still needed to study the delayed effect of fess on iop in unilateral cases , as our study only included cases with bilateral sinonasal pathology . \n it is important to note the risk of potential rise of iop after surgery in patients scheduled for fess and that had preoperative increase iop , such as patients of glaucoma . \n thus , preoperative ophthalmological consultation is important to protect the patient from the hazard of possible increased iop . \n delayed significant increase in iop can occur after fess . therefore , special measures are necessary preoperatively to reduce iop and protect the patient 's eye from the hazard of increased iop , especially in patients with glaucoma . \n further studies are still needed to explain the cause of this delayed significant rise in iop post - fess .", "role": "user" }, { "content": "introduction due to the close anatomical relationship between the paranasal sinuses and the orbit , involvement or injury of the orbit from paranasal sinuses procedures may occur . \n objectives we aimed to study the early and delayed effect of endoscopic sinus surgery on intraocular pressure ( iop ) . \n methods we included in the study 38 patients with chronic rhinosinusitis ( crs ) , undergoing fess . \n we performed fess with the standard anterior to posterior approach . \n we measured iop at the same time one day before surgery as well as day 1 and 6 weeks after surgery . \n results one day after surgery , mean iop in the right eye was 14.176 1.91 mm hg and in the left eye was 13.79 2.42 mm hg with statistically non - significant difference from preoperative values . \n six weeks postoperative , the mean iop in the right eye was 15.14 2.28 mm hg . \n the difference between the mean preoperative and postoperative iop values was found to be statistically significant ( p = 0.0012 ) . while in the left eye \n , mean postoperative iop was 15.14 + 2.23 mm hg . \n the difference between the mean preoperative and postoperative iop values was also found to be highly statistically significant ( p = 0.0005 ) . \n conclusion delayed significant increase in iop can occur after fess , thus , special measures must be taken to reduce iop to protect the patients eye from the risk of increased iop , especially in patients with glaucoma .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: after gastric and lung cancer , prostate cancer is now the third most frequent visceral cancer in iranian men and the fifth most common cancer worldwide . \n although its incidence is much lower in iran than in western countries , the number has dramatically increased over the past ten years ( 1 ) . increased public health awareness in iran of measuring total serum prostate specific antigens ( psas ) with the aim of screening and early detection of prostate cancer at earlier stages \n has resulted in increased early diagnoses of prostate cancer in recent years ( 24 ) . these men with a clinically localized disease can be treated with radical prostatectomy , definitive external beam radiation therapy ( ebrt ) with or without brachytherapy , hormonal therapy and active surveillance . choosing the best method of treatment for patients with prostate cancer depends on a number of factors such as initial total serum psa , risk groups , gleason grading score , clinical tnm staging and life expectancy ( 5 ) . \n ebrt ( with or without brachytherapy ) and radical prostatectomy have similar curative and long - term efficacy in the treatment of clinically organ - confined prostate cancer ( 67 ) . \n these types of treatment have acceptable long - term cure rates in clinically localized prostate cancer patients , but unfortunately 30% to 50% of these patients will show evidence of psa failure ten years after treatment with definitive external beam radiation therapy ( 8) . because of the lack of randomized clinical follow - up trials in clinically organ- confined prostate cancer patients treated with brachytherapy , only ebrt has been included in this study . \n after about 24 months of ebrt , most patients might achieve a nadir of total serum psa . \n almost all clinically localized prostate cancer patients who have any type of disease recurrence present the first time with psa elevation of 2 ng / ml above nadir psa ( 911 ) . \n this study aimed to describe the biochemical progression - free survival and related prognostic factors for localized prostate cancer treated with definitive ebrt in iran . \n men diagnosed with pathologically localized prostate cancer from stage t1an0m0 to stage t3n0m0 ( clinical t staging was defined by mri or transrectal ultrasound ) were treated with definitive radiation therapy and followed up in the radiation - oncology ward of shohada - e - tajrish hospital in tehran , iran between 2006 and 2013 . \n the medical records of the patients provided information such as age , initial psa ( pretreatment psa ) , tnm stage , gleason score , radiotherapy dose and technique , and type of radiotherapy machine . \n the risk groups were defined as low - risk ( t1c t2a , gs < 7 and psa 10 ng / ml ) , intermediate - risk ( t1b t2b , gs 7 , or psa 1120 ng / ml ) and high - risk ( t2c t3 , gs > 7 , or psa > 20 ng / ml ) , and further differentiated in terms of hormonal therapy ( in the high - risk group ) and time of biochemical ( psa ) failure . we included all of the prostate cancer patients who met the inclusion criteria at our center from 2006 to 2013 in the study . the inclusion criteria were that they be men with a histopathology diagnosis of prostate cancer without lymph node or distant metastasis that were irradiated by definitive ebrt at our center . \n patients were excluded from the study if they were without a histopathology diagnosis or without initial serum psa , if they had been treated by radical prostatectomy , if they presented with lymph node or distant metastasis , if they had undergone adjuvant treatments such as radiation therapy or brachytherapy initiated by another radiation oncology center and if they were without follow - up . \n all patients had previously been treated with a linear accelerator ( linac ) 9 mv or cobalt 60 with 6476 gray ( gy ) in 3238 fractions with 2 gy per fraction . \n first , 44 to 46-gy whole pelvic radiations were given to patients if they were at a higher risk of lymphatic spread , and then a 30-gy boost dose was delivered to the prostatic fossa with or without seminal vesicle . \n patients received a total dose of less than 70 gy administered by two - dimensional ( 2d ) treatment planning . \n patients received a total radiation dose of 70 gy or above administered by three - dimensional ( 3d ) treatment planning such as three dimensional - conformal radiation therapy ( 3d - crt ) . \n radiation therapy was used 5 days a week from saturday to wednesday ( with the exception of public holidays ) with 2 gy per fraction with 2d or 3d treatment planning . \n all patients were followed up according to standard guidelines and continuously , at least every three months for the first two years and at 6-month intervals thereafter . \n the 5-year bfs was determined per the definition of biochemical failure ( bf ) of psa as rising by 2 ng / ml above the nadir after radiation therapy . \n the ethical regulations dictated in the act provided by shohada - e - tajrish hospital in shahid beheshti university of medical sciences ( reference number of research ethics committee : 301/5375 ) were strictly observed . \n we used the kaplan meier method to calculate 5-year bfs from the first day of radiotherapy and used pairwise log rank tests for comparisons of low - risk , intermediate - risk and high - risk groups . \n for multivariate analysis , the cox proportional hazards model was used to assess the strengths of various factors for 5-year bfs . \n men diagnosed with pathologically localized prostate cancer from stage t1an0m0 to stage t3n0m0 ( clinical t staging was defined by mri or transrectal ultrasound ) were treated with definitive radiation therapy and followed up in the radiation - oncology ward of shohada - e - tajrish hospital in tehran , iran between 2006 and 2013 . \n the medical records of the patients provided information such as age , initial psa ( pretreatment psa ) , tnm stage , gleason score , radiotherapy dose and technique , and type of radiotherapy machine . \n the risk groups were defined as low - risk ( t1c t2a , gs < 7 and psa 10 ng / ml ) , intermediate - risk ( t1b t2b , gs 7 , or psa 1120 ng / ml ) and high - risk ( t2c t3 , gs > 7 , or psa > 20 ng / ml ) , and further differentiated in terms of hormonal therapy ( in the high - risk group ) and time of biochemical ( psa ) failure . \n we included all of the prostate cancer patients who met the inclusion criteria at our center from 2006 to 2013 in the study . \n the inclusion criteria were that they be men with a histopathology diagnosis of prostate cancer without lymph node or distant metastasis that were irradiated by definitive ebrt at our center . \n patients were excluded from the study if they were without a histopathology diagnosis or without initial serum psa , if they had been treated by radical prostatectomy , if they presented with lymph node or distant metastasis , if they had undergone adjuvant treatments such as radiation therapy or brachytherapy initiated by another radiation oncology center and if they were without follow - up . \n all patients had previously been treated with a linear accelerator ( linac ) 9 mv or cobalt 60 with 6476 gray ( gy ) in 3238 fractions with 2 gy per fraction . \n first , 44 to 46-gy whole pelvic radiations were given to patients if they were at a higher risk of lymphatic spread , and then a 30-gy boost dose was delivered to the prostatic fossa with or without seminal vesicle . \n patients received a total dose of less than 70 gy administered by two - dimensional ( 2d ) treatment planning . \n patients received a total radiation dose of 70 gy or above administered by three - dimensional ( 3d ) treatment planning such as three dimensional - conformal radiation therapy ( 3d - crt ) . \n radiation therapy was used 5 days a week from saturday to wednesday ( with the exception of public holidays ) with 2 gy per fraction with 2d or 3d treatment planning . \n all patients were followed up according to standard guidelines and continuously , at least every three months for the first two years and at 6-month intervals thereafter . \n the 5-year bfs was determined per the definition of biochemical failure ( bf ) of psa as rising by 2 ng / ml above the nadir after radiation therapy . \n the ethical regulations dictated in the act provided by shohada - e - tajrish hospital in shahid beheshti university of medical sciences ( reference number of research ethics committee : 301/5375 ) were strictly observed . \n we used the kaplan meier method to calculate 5-year bfs from the first day of radiotherapy and used pairwise log rank tests for comparisons of low - risk , intermediate - risk and high - risk groups . for multivariate analysis , \n the cox proportional hazards model was used to assess the strengths of various factors for 5-year bfs . \n the follow - up period was between 1481 months , with a median of 31 months . \n 131 patients ( 68.2% ) were in stage < t2cn0m0 , and 61 patients ( 31.8% ) were in staget2cn0m0 . \n 124 patients ( 64.6% ) had a combined gleason score between 27 , and 68 patients ( 35.4% ) had a combined gleason score between 8 and 10 . according to the risk group , \n there were 3.6 % low - risk , 27.1% intermediate - risk , and 69.3% high - risk cases . \n clinical t stages were 1% t1a , 17.7% t1b , 21.3% t1c , 21.9% t2a , 6.8 % t2b , 6.3 % t2c , and 25% t3 cases . \n the median pretreatment psa was 22.8 ng / ml ( range : 1.8 to 455 ng / ml ) . \n 53.1% of our patients had initial psa>20 ng / ml , and 46.9% had initial psa20 ng / ml . the median cumulative prostate dosage in our series was 64 gy with a range of 62 to 78 gy ) . for subsequent analysis , radiation dosage was grouped into patients who received less than 70 gy using two - dimensional radiation therapy ( 74.5% ) and those who received 70 gy or more using three- dimensional radiation therapy ( 24.5% ) . \n 44.3% of our patients were treated with cobalt 60 and 55.7% were treated with linac 9mv . \n neoadjuvant hormonal therapy , concomitant hormonal therapy and adjuvant hormonal therapy were used in 81 of high - risk patients ( 60.9% ) . \n the 5-year biochemical progression - free survival ( bfs ) for all patients was 65.1% , and 5-year bfs in the low - risk , intermediate - risk and high - risk groups were 100% , 86.5% and 54.9% respectively . according to the kaplan - meier analysis and pairwise 5-year bfs log - rank comparisons of low - risk to intermediate - risk p=0.311 , low - risk compared to high - risk p=0.170 , intermediate - risk compared to high - risk p=0.014 , overall 5-year bfs comparisons p=0.018 . \n multivariate analysis found a significant correlation between 5-year bfs and initial psa>20 ( compared to initial psa20 ) ( p=0.003 , hr=4.22 , 95% ci=1.318.33 ) , gleason score 810 ( compared to gleason score 27 ) ( p=0.032 , hr=2.04 , 95% ci=2.323.11 ) , high - risk group ( compared to intermediate - risk group ) ( p=0.014 , hr=7.25 , 95% ci=1.2214.17 ) , tnm staget2cn0m0 ( compared to tnm staget2bn0m0 ) ( p=0.001 , hr=8.45 , 95% ci=3.2517.55 ) , radiotherapy dose<70 gy ( compared to radiotherapy dose70 gy ) ( p=0.035 , hr=3.22 , 95% ci=1.24 5.35 ) , radiotherapy with 2d technique ( compared to radiotherapy with 3d technique ) ( p=0.035 , hr=3.22 , 95% ci=1.24 5.35 ) , and hormonal therapy in high - risk group ( compared to no hormonal therapy ) ( p=0.022 , hr=2.55 , 95% ci=1.724.04 ) ( table 2 ) . \n there was no statistically significant relationship between 5-year bfs and age ( p=0.425 , hr=1.27 , 95% ci=1.172.15 ) , and type of radiotherapy machine ( p=0.062 , hr=1.76 , 95% ci=0.523.22 ) . \n the favorable prognostic factors in multivariate analysis were initial psa20 , gleason score 27 , intermediate - risk group , tnm staget2bn0m0 , radiotherapy dose70 gy , radiotherapy with 3d technique and hormonal therapy ( in high - risk group ) . \n measurement of total serum psa has always been identified as one of the strongest predictors of biochemical progression and overall survival for more than twenty years to determine the efficacy of external beam radiation therapy in localized prostate cancer patients ( 9 ) . \n it is clear that in the majority of prostate cancer patients , psa decreases after definitive ebrt , but some prostate cancer patients will have an increasing serum psa after definitive ebrt that indicates recurrence of the disease ( 10 ) . \n many reports have indicated that there is a clear relationship between the psa nadir after definitive ebrt and the subsequent disease course ( 11 ) . \n showed that based on information obtained from patients treated with rtog protocols a level psa of 1.5 ng / ml was the upper limit of normal ( 12 ) . \n other investigators found that prostate cancer patients with a psa nadir of less than 1 ng / ml after definitive ebrt experienced favourable 5-year bfs . \n independent of initial total serum psa , combined gleason grade and t stage , prostate cancer patients who were treated with ebrt with a psa nadir of less than 1 ng / ml had a better 5-year bfs in multivariate analysis . in the present study the 5-year bfs was 65.1% , which is slightly lower than that in an earlier study of the meta - analysis of five large rtog trials , which reported a 5-year bfs of 71.9% ( 13 ) . \n there were several reasons for this difference : in our study , there were 69.3% of cases in the high - risk group with over 50% of them presented with initial psa>20 ng / ml that was higher than in well - developed western countries . \n more than 70% of our patients received a cumulative radiation dose of less than 70 gy with 2d technique , while the rtog trials used radiation doses exceeding 70 gy that explained the high rate ( 32.3% ) of bf in our study compared to 16.7% in their series . in our study , only 24.5% of patients received a cumulative radiation dose 70 gy with 3d radiotherapy technique , while zietman et al . conducted a long - term trial that compared the conventional 2d radiotherapy technique with modern radiotherapy techniques such as 3d - crt and imrt that can deliver higher doses > 72 gy , a significant decrease of 5-year bfs from 32.4% to 16.7% ( 14 ) . in the multivariate analysis a few important predictors of 5-year bfs were identified ( 15 ) . \n independent predictors of unfavorable 5-year bfs in our study were initial psa>20 , gleason score 810 , high - risk group , tnm \n stage t2cn0m0 , radiotherapy dose<70 gy , radiotherapy with 2d technique and no hormonal therapy ( in high - risk group ) . \n first , our study was a retrospective - analytic study such as all those inherent in a retrospective analysis . \n third , the number of patients ( 192 patients ) was considered small for accurate analysis of predictive factors . \n in summary , in this retrospective - analytic study , initial psa20 , gleason score 27 , intermediate - risk group , tnm staget2bn0m0 , radiotherapy dose70 gy , radiotherapy with 3d technique and hormonal therapy ( in high - risk group ) were independent favorable prognostic factors for 5-year bfs in multivariate analysis . there was no statistically significant relationship between 5-year bfs and age and type of radiotherapy machine by multivariate analysis . \n our seven years experience of follow - up with psa showed that psa was the strongest predictor of biochemical progression survival in patients with prostate cancer who were treated with definitive ebrt .", "role": "user" }, { "content": "introductionprostate cancer is now the third most frequent noncutaneous malignancy in iranian men and the fifth most common cancer worldwide . \n measurement of total serum prostate specific antigens ( psas ) has been one of the strongest predictors of biochemical progression and overall survival in determining the efficacy of definitive external beam radiation therapy in patients with localized prostate cancer . \n the aim of this research was to identify the 5-year biochemical progression - free survival ( bfs ) and related prognostic and predictive factors of localized prostate cancer patients who were treated with definitive external beam radiotherapy.methodsthis study analyzed 192 localized prostate cancer patients from stage t1an0m0 to stage t3n0m0 ; they were treated with definitive radiation therapy and followed up in the radiation - oncology ward of shohada - e - tajrish hospital in tehran ( iran ) between 2006 and 2013 . \n the 5-year bfs was analyzed using the kaplan - meier estimate . \n for multivariate analysis , the cox proportional hazards model was used to assess the strengths of various factors for 5-year bfs.resultsthe follow - up period was between 1481 months , with a median of 31 months . \n the median cumulative prostate dose in our series was 64 gray ( gy ) ( range 62 to 78 gy ) . \n the 5-year bfs for all patients was 65.1% , and 5-year bfs in low - risk , intermediate - risk and high - risk groups were 100% , 86.5% , and 54.9% respectively . \n multivariate analysis found statistically significant relation between 5-year bfs and initial psa>20 , gleason score 810 , high risk group , tnm staget2cn0m0 , radiotherapy dose<70 gy , radiotherapy with 2d technique and hormonal therapy in high - risk group ( p=0.003 , p=0.032 , p=0.014 , p=0.001 , p=0.035 , p=0.035 , p=0.022 respectively).conclusionour seven years experience of follow - up with psa showed that psa was the strongest predictor of biochemical progression survival in patients with prostate cancer who were treated with definitive external beam radiation therapy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the bhil tribe is one of the largest tribal communities in india and spread over continuous covering four large indian states , namely gujarat , madhya pradesh , rajasthan , and maharashtra . \n mostly , the bhil tribe resides in the mountains of central western part of india [ map 1 ] . in gujarat \n the aims of study on the bhil tribe in gujarat have still remained isolated and less focused . \n therefore , genetic study will provide a valuable source of information to understand their genetic variability and affiliation . \n green color in map of central western part of india where the bhil tribe highly concentrated \n saliva samples were collected on the indicating fta classic card ( cat # wb120206 , whatman , uk ) by using sterile foam tipped applicators ( cat # wb 100032 , whatman , uk ) from 297 unrelated individuals form the bhil tribe population of the gujarat state , india . \n samples were collected in accordance with the ethical guidelines stipulated by the institutions involved in this study . \n the research study was conducted in accordance with quality control measures as well as successfully participated in the fifth asian american - indonesian cultural and educational foundation dna proficiency test . a positive and negative control as specified in the identifiler kit user 's manual . \n genomic dna was extracted from the saliva samples using saliva fta card application note and qiaamp dna mini kit as per manufacturer 's recommendations ( qiagen , germany ) . \n multiplex polymerase chain reaction ( pcr ) reaction was carried out for each dna sample , and amplified 15 autosomal short tandem repeats ( str ) loci ( d8s1179 , d21s11 , d7s820 , csf1po , d3s1358 , th01 , d13s317 , d16s539 , d2s1338 , d19s433 , vwa , tpox , d18s51 , d5s818 , and fga ) using ampflstr identyfiler pcr amplification kit following the manufacturer 's protocol and geneamp pcr system 9700 ( applied biosystems [ abi ] , foster city , ca , usa ) . \n genotyping was performed by capillary electrophoresis ; 1.5 l of the amplified pcr product was combined with 12 l of formamide and 0.5 l of genescan 500 liz internal size standard . \n detection of pcr products and genotyping were carried out on the abi 3130 genetic analyzer ( abi , foster city , ca , usa ) using the data collection software v3.0 and genemapper i d v3.2 analysis software ( abi , foster city , ca , usa ) . \n an estimation of allele frequencies distribution and other forensic parameters , including power of discrimination ( pd ) , power of exclusion ( pe ) , and matching probability ( mp ) , polymorphism information content ( pic ) , and typical paternity index ( tpi ) , were calculated using powerstats software version 1.2 . \n ( available on http://www.promega.com/geneticidtools/powerstats ) population 's genetic structure deviation from hardy - weinberg equilibrium ( hwe ) , observed heterozygosity ( ho ) and expected heterozygosity ( he ) were calculated using arlequin v3.1 . \n allelic frequencies from samples of the present study and other indian 's as well as international populations shown in table 1 were employed to generate the neighbor - joining ( nj ) phylogeny tree based on fst distances using poptree2 software : naoko takezaki , masatoshi nei , and koichiro tamura ( available on http://www.med.kagawa-u.ac.jp/~genomelb/takezaki/poptree2/index.html ) . \n these fst distance were utilized to generate a nj phylogeny tree using the same software . \n the robustness of the phylogenetic relationship calculated by the nj tree was assessed using 1000 replications bootstrap analysis . \n graphical representation of genetic distance ( fst ) of the population in this study along with seven national and 10 international populations were performed based on principal coordinate analysis ( pca ) plot using genalex software v6.3 . \n the national and international population data used for analysis using nj tree and pca plot from genetic distances \n saliva samples were collected on the indicating fta classic card ( cat # wb120206 , whatman , uk ) by using sterile foam tipped applicators ( cat # wb 100032 , whatman , uk ) from 297 unrelated individuals form the bhil tribe population of the gujarat state , india . \n samples were collected in accordance with the ethical guidelines stipulated by the institutions involved in this study . \n the research study was conducted in accordance with quality control measures as well as successfully participated in the fifth asian american - indonesian cultural and educational foundation dna proficiency test . a positive and negative control as specified in the identifiler kit user 's manual . \n genomic dna was extracted from the saliva samples using saliva fta card application note and qiaamp dna mini kit as per manufacturer 's recommendations ( qiagen , germany ) . \n multiplex polymerase chain reaction ( pcr ) reaction was carried out for each dna sample , and amplified 15 autosomal short tandem repeats ( str ) loci ( d8s1179 , d21s11 , d7s820 , csf1po , d3s1358 , th01 , d13s317 , d16s539 , d2s1338 , d19s433 , vwa , tpox , d18s51 , d5s818 , and fga ) using ampflstr identyfiler pcr amplification kit following the manufacturer 's protocol and geneamp pcr system 9700 ( applied biosystems [ abi ] , foster city , ca , usa ) . \n genotyping was performed by capillary electrophoresis ; 1.5 l of the amplified pcr product was combined with 12 l of formamide and 0.5 l of genescan 500 liz internal size standard . \n detection of pcr products and genotyping were carried out on the abi 3130 genetic analyzer ( abi , foster city , ca , usa ) using the data collection software v3.0 and genemapper i d v3.2 analysis software ( abi , foster city , ca , usa ) . \n an estimation of allele frequencies distribution and other forensic parameters , including power of discrimination ( pd ) , power of exclusion ( pe ) , and matching probability ( mp ) , polymorphism information content ( pic ) , and typical paternity index ( tpi ) , were calculated using powerstats software version 1.2 . \n ( available on http://www.promega.com/geneticidtools/powerstats ) population 's genetic structure deviation from hardy - weinberg equilibrium ( hwe ) , observed heterozygosity ( ho ) and expected heterozygosity ( he ) were calculated using arlequin v3.1 . \n allelic frequencies from samples of the present study and other indian 's as well as international populations shown in table 1 were employed to generate the neighbor - joining ( nj ) phylogeny tree based on fst distances using poptree2 software : naoko takezaki , masatoshi nei , and koichiro tamura ( available on http://www.med.kagawa-u.ac.jp/~genomelb/takezaki/poptree2/index.html ) . \n these fst distance were utilized to generate a nj phylogeny tree using the same software . \n the robustness of the phylogenetic relationship calculated by the nj tree was assessed using 1000 replications bootstrap analysis . \n graphical representation of genetic distance ( fst ) of the population in this study along with seven national and 10 international populations were performed based on principal coordinate analysis ( pca ) plot using genalex software v6.3 . \n the national and international population data used for analysis using nj tree and pca plot from genetic distances \n saliva samples were collected on the indicating fta classic card ( cat # wb120206 , whatman , uk ) by using sterile foam tipped applicators ( cat # wb 100032 , whatman , uk ) from 297 unrelated individuals form the bhil tribe population of the gujarat state , india . \n samples were collected in accordance with the ethical guidelines stipulated by the institutions involved in this study . \n the research study was conducted in accordance with quality control measures as well as successfully participated in the fifth asian american - indonesian cultural and educational foundation dna proficiency test . a positive and negative control as specified in the identifiler kit user 's manual . \n genomic dna was extracted from the saliva samples using saliva fta card application note and qiaamp dna mini kit as per manufacturer 's recommendations ( qiagen , germany ) . \n multiplex polymerase chain reaction ( pcr ) reaction was carried out for each dna sample , and amplified 15 autosomal short tandem repeats ( str ) loci ( d8s1179 , d21s11 , d7s820 , csf1po , d3s1358 , th01 , d13s317 , d16s539 , d2s1338 , d19s433 , vwa , tpox , d18s51 , d5s818 , and fga ) using ampflstr identyfiler pcr amplification kit following the manufacturer 's protocol and geneamp pcr system 9700 ( applied biosystems [ abi ] , foster city , ca , usa ) . \n genotyping was performed by capillary electrophoresis ; 1.5 l of the amplified pcr product was combined with 12 l of formamide and 0.5 l of genescan 500 liz internal size standard . \n detection of pcr products and genotyping were carried out on the abi 3130 genetic analyzer ( abi , foster city , ca , usa ) using the data collection software v3.0 and genemapper i d v3.2 analysis software ( abi , foster city , ca , usa ) . \n an estimation of allele frequencies distribution and other forensic parameters , including power of discrimination ( pd ) , power of exclusion ( pe ) , and matching probability ( mp ) , polymorphism information content ( pic ) , and typical paternity index ( tpi ) , were calculated using powerstats software version 1.2 . \n ( available on http://www.promega.com/geneticidtools/powerstats ) population 's genetic structure deviation from hardy - weinberg equilibrium ( hwe ) , observed heterozygosity ( ho ) and expected heterozygosity ( he ) were calculated using arlequin v3.1 . \n allelic frequencies from samples of the present study and other indian 's as well as international populations shown in table 1 were employed to generate the neighbor - joining ( nj ) phylogeny tree based on fst distances using poptree2 software : naoko takezaki , masatoshi nei , and koichiro tamura ( available on http://www.med.kagawa-u.ac.jp/~genomelb/takezaki/poptree2/index.html ) . \n these fst distance were utilized to generate a nj phylogeny tree using the same software . \n the robustness of the phylogenetic relationship calculated by the nj tree was assessed using 1000 replications bootstrap analysis . \n graphical representation of genetic distance ( fst ) of the population in this study along with seven national and 10 international populations were performed based on principal coordinate analysis ( pca ) plot using genalex software v6.3 . \n the national and international population data used for analysis using nj tree and pca plot from genetic distances \n the observed allele frequencies and statistical parameters based on the 15 autosomal str markers in bhil tribe population are summarized in table 2 . \n a total 155 alleles at these 15 str loci were found with corresponding allelic frequencies ranging 0.002 - 0.441 in the bhil tribe population . \n these str loci were found to be highly polymorphic , and statistical analysis of these data revealed all loci met hwe expectations with the exception of vwa ( 0.019 ) and d18s51 ( 0.016 ) . \n the combined pd and for all loci were > 0.99982 , while the combined mp is 2.53 10 and the average heterozygosity is 0.7720 . \n allele frequencies and associated statistical parameters of ampflstr identifiler kit pcr amplification kit loci in bhil tribe population ( n=297 samples ) fst distance was used to compare the seven national and ten global populations in relation to the allele frequencies of 15 autosomal str loci and generate the nj phylogeny tree shown in figure 1 . \n examination of the nj phylogeny tree shows the cluster of all the south asian population as one group and other middle eastern with african population as other group . \n nearest affinity can be seen among the middle eastern populations , while the three african populations branched away from the middle eastern group . \n south asian populations cluster shows nearest affinities among the indian population with pakistani population ( except dhimal and paliya ) . \n cluster branch of indian population of dhimal and paliya show nearest affinity seen with nepali population . \n a pca plots were constructed [ figure 2 ] , the grouping of the population in the pca plot is consistent with the clustering pattern of the nj phylogeny tree . moreover , the bhil tribe is genetically and linguistic affiliated to indo - european ( ie ) group of india . \n this is in contrast to the findings in the present study , found strong genetic similarities between the bhil tribe of gujarat and dravidian affiliated group of gond tribe and tamil population , whereas closely genetic affinity seen among gujarati and punjabi populations . \n neighbor- joining tree based on fst distances from allele frequencies of the autosomal short tandem repeat loci . \n the population codes and descriptions are given in table 1 principal coordinate analysis of fst distances derived from the population from the present study and national and international populations . \n clustering pattern of nj phylogeny tree , pca plot , genetic study and hypothetical evidence supporting to the ie specking bhil tribe of gujarat is genetically affiliated with dravidian group of south india .", "role": "user" }, { "content": "materials and methods : the genetic diversity and forensic parameters based on 15 autosomal short tandem repeats ( str ) loci ; d8s1179,d21s11 , d7s820 , csf1po , d3s1358 , th01 , d13s317,d16s539 , d2s1338 , d19s433 , vwa , tpox , d18s51,d5s818 , and fga in ampflstr identifiler kit from applied biosystems , foster city , ca , usa were evaluated in saliva samples of 297 unrelated individuals from the bhil tribe population of gujarat state , india to study genetic diversities and relatedness of this population with other national and international populations.results:statistical analysis of the data revealed all loci were within hardy - weinberg equilibrium expectations with the exception of the locus vwa ( 0.019 ) and locus d18s51 ( 0.016 ) . \n the neighbour joining phylogeny tree and principal co - ordinate analysis plot constructed based on fst distances from autosomal strs allele frequencies of the present study and other national as well as international populations show clustering of all the south asian populations in one branch of the tree , while middle eastern and african populations cluster in a separate branch.conclusion:our findings reveal strong genetic affinities seen between the indo - european ( ie ) speaking bhil tribe of gujarat and dravidian groups of south india .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cerebral palsy is a nonprogressive disorder that occurs during early brain development and \n presents with abnormal movement and posture1 , 2 . \n previous studies indicated that 90% of \n patients with cerebral palsy exhibit impaired gait patterns due to excessive muscle \n weakness , altered joint kinetics , and diminished postural reactions3 . \n the impairments cause abnormal gait , including \n developmental disability in the upper and lower extermities4 , a wide base of support , decreased step and stride lengths , reduced \n time in single stance , and a slower walking velocity5 . \n therefore , a common goal of rehabilitation in children with \n cerebral palsy is the recovery of functional gait6 , \n 7 . \n certain aspects of gait control in humans are generated by integration of visual , \n proprioceptive , and vestibular information8 . \n visual information input is essential for detecting and identifying \n sensory information from the surrounding environment , thus enabling appropriate \n spatiotemporal anticipation , before initiating and completing movement9 . \n hence , many studies involving rehabilitation of patients \n demonstrating a hemiplegic gait pattern have employed visual information techniques such as \n visual feedback therapy and virtual reality training methods11,12,13 . \n yang et al . investigated the effects of virtual reality treadmill training on functional \n gait in hemiplegic stroke patients , and the results of this training appeared to demonstrate \n improvement of gait function and patient mobility13 . \n baram et al . reported that visual feedback improved walking speed \n and stride length in patients with hemiplegic cerebral palsy14 . \n optic flow is the pattern of motion perceived at the retina , which specifies the direction \n of locomotion15 and provides vital \n feedback concerning patient regulation of walking velocity16 . \n reported that modulation of optic flow resulted in \n changes in gait parameters such as gait velocity , cadence , and stride length in human \n subjects17 . \n reported \n that a fast optic flow speed resulted in increased walking velocity and cadence in \n hemiplegic stroke patients18 . \n moreover , \n kang et al . reported that treadmill training , along with modulation of optic flow , improved \n gait velocity in hemiplegic patients following a stroke8 . \n several such studies concerning the effects of optic flow alterations on gait parameters \n are found in the literature . \n however , the majority of these studies assessed both hemiplegic \n stroke patients and healthy adults . \n therefore , in the present study , we examined the \n alterations in gait parameters due to modulation of the optic flow speed specifically in \n patients with hemiplegic cerebral palsy . \n in the present study , we examined 10 children with hemiplegic cerebral palsy who visited \n the community rehabilitation welfare center , korea . \n general characteristics of the children with hemiplegic cerebral palsysubjectgenderage ( years , months)height ( cm)paretic limbgmfcs levels1male5 , 5109ris2male6 , 1117ris3female4 , 1084lis4male5 , 8103riis5female4 , 695ris6male5 , 2112ris7male4 , 196lis8male6 , 1124lis9male3 , 997ris10female4 , 299rir , right ; l , left ; gmfcs , gross motor function classification system . \n all subjects and guardians signed an informed consent form after they \n understood the contents of the study . \n the inclusion criteria were as follows : a current \n diagnosis of hemiplegic cerebral palsy , ability to walk unassisted or with only minimal \n assistance for more than 10 m , patient motor function consistent with level i and ii \n according to the gross motor function classification system ( gmfcs ) , and no visual deficit . \n the study was approved by the human research ethics committee of all the participating \n institutions . \n r , right ; l , left ; gmfcs , gross motor function classification system this study design is cross - sectional . \n each subject was evaluated during application of optic \n flow speeds at 3 different levels , as follows : slow ( 0.25 times the normal speed ) , normal , \n and fast ( 2 times the normal speed ) . \n the visual information was projected on a screen via a \n connected notebook with virtual reality software , which mimicked walking in a park . \n patient procedural parameters were established as follows : first , all subjects walked at a \n self - selected speed on the gaitrite system , without visual program input information . \n second , prior to recording flow speed and gait effects , all subjects adapted their gait to \n the visual information during a 10-min trial of the 3 levels of optic flow speed , which were \n randomly applied . \n third , the subjects who had watched the screen playing the visual \n information with one of the 3 optic flow speeds and a self - selected gait speed , walked \n across the walkway of the gaitrite system . the subjects walked 5 times at each optic flow \n speed , and the data was reduced to a mean value for each subject examined . \n a 3-min rest \n period was allowed between each intervention , to minimize the effects of muscular fatigue . \n any subject who required assistance was provided minimal assistance by a therapist who was \n not informed about the purpose of the subject s activity or the purpose of the study . the gaitrite system ( cir systems inc . , \n this device has an electronic walkway measuring approximately 700 90 cm , with \n pressure sensors placed in a horizontal grid along the walking surface ; the device is \n connected via an interface cable to a notebook running the ms windows xp operating system . \n the recording area of the device generally measures 61 cm in width and 732 cm in length . \n sensors are maintained at a distance of 1.27 cm from each other ( totaling 27,648 sensors ) , \n and a recording frequency of 80 hz is used with temporal resolutions of 11 ms . \n the gaitrite \n gold , version 3.2b , software was used for spatiotemporal data analysis . \n the procedure for \n evaluation using the gaitrite system was as follows : each subject stood in front of the mat , \n and when cued by the evaluator , the subject walked onto and along the mat at a self - selected \n walking speed . the collected data consisted of temporal gait characteristics such as \n velocity , cadence , single support time , double support time , and spatial gait \n characteristics including step length and stride length . \n the measurement reliability of this \n system is r = 0.90 , and the icc is 0.9610 , 19 . \n repeated measure \n anova was used to compare spatiotemporal gait parameters for each optic flow speed . \n the fast optic flow speed ( 2 times the normal speed ) significantly increased walking \n velocity , cadence , normalized step length , base of support , and single support cycle of both \n the paretic and non - paretic lower limbs as compared with the other flow conditions applied \n ( p > 0.05 ) . \n moreover , the slow optic flow speed ( 0.25 times the normal speed ) induced \n significantly decreased walking velocity , cadence , normalized step length , base of support , \n and single support cycle of both the paretic and non - paretic lower limbs as compared with \n the other flow speed conditions applied ( p > 0.05 ) ( table 2table 2 . \n comparison of gait parameter among the different optic flow speedsparametersslow ofnormal offast ofvelocity ( cm / sec)48.72.356.92.969.32.8cadence ( step / min)109.22.5122.82.3134.42.5normalized step length ( step length / leg length)affected side0.70.10.70.10.80.2non - affected side0.70.10.70.10.80.1base of support ( cm)affected side 12.50.311.40.510.10.7non - affected side13.20.312.00.49.40.4single support ( % gait cycle)affected side32.70.435.20.437.30.3non - affected side36.11.138.21.340.21.6all variables are presented as meanstandard deviation values . \n statistically significant difference between normal of and \n fast of ( p<0.05 ) . ) . \n this study compared the alteration in spatiotemporal gait parameters according to the \n application of slow , normal , and fast optic flow speeds in patients with hemiplegic cerebral \n palsy . \n after occurrence of an incongruity \n between alteration of the optic flow speed and the resulting proprioceptive information \n observed in the lower extremity , the subjects decreased the incongruity by altering movement \n in the lower extremity8 , 17,18 . \n konczak et al . \n reported that an increased optic flow speed in healthy adults induced an increase in walking \n velocity more quickly than that induced by a reduced optic flow21 . \n reported that alterations of optic flow \n speed in healthy adults resulted in modulation of stride length and walking velocity because \n optic flow interpretation by the brain played a major role in the regular gait pattern and \n gait control17 . \n therefore , changes in the \n gait patterns of healthy adults were induced by altering the optic flow speed . in previous studies involving subjects with several spatiotemporal orientation types , \n schubert et al . reported that patients with parkinson s disease , tested through application \n of various optic flow speeds ranging from 1 to 3 times the normal speed , changed their gait \n speed and cadence more quickly than elderly adults and healthy adults . \n this phenomenon was \n attributed to the fact that patients with parkinson s disease experience excessive reliance \n on visual feedback due to the impairment of proprioceptive guidance during voluntary \n movement and damage noted as sensory scaling associated with altered kinesthesia22 . \n reported that \n poststroke hemiplegic patients demonstrated altered gait speed and cadence when influenced \n by large differences in optic flow speed18 . \n thus , changes in gait control in patients with parkinson s disease \n and patients with hemiplegic stroke were both influenced by alterations in optic flow \n speed . \n this study indicated that the fast optic flow speed in hemiplegic cerebral palsy subjects , \n generated altered temporal parameters in gait speed , cadence , single support time of the \n affected and non - affected side , and double support time of the affected and non - affected \n side more quickly than application of the slow optic flow speed , self - selected gait speed , \n or normal optic flow speed . \n moreover , the fast optic flow speed induced alterations of \n spatial parameters in stride length in the hemiplegic cerebral palsy subjects , on the \n affected and non - affected sides as well as step length on the affected and non - affected \n sides , for an extended period of time when compared with the alterations produced by all the \n other applied optic flow speeds . in a previous study , \n alteration of optic flow speeds in \n hemiplegic stroke patients resulted in gait alterations similar to those found in hemiplegic \n cerebral palsy subjects . \n kang et al . reported that the application of a fast optic flow \n speed in hemiplegic stroke patients induced spatial and temporal parameters more quickly \n than the application of slow and normal optic flow speeds . \n the most prominently observed \n deficits in patients with hemiplegic cerebral palsy were noted in gait velocity , decreased \n step and stride lengths , and reduced time in single stance , although self - selected gait was \n not affected5 . \n therefore , a rehabilitation \n program including alterations of the optic flow speed in children with hemiplegic cerebral \n palsy may improve gait parameters . \n moreover , alterations of gait parameters , as a result of alterations of the optic flow \n speed , in children with hemiplegic cerebral palsy were found to be similar to those produced \n in hemiplegic stroke patients . \n such gait alterations in both patient groups are generated by \n changes in lower limb response patterns due to the patient s intention to decrease the \n incongruity between proprioceptive information of the lower limbs and the optic flow \n speed . \n limitations of the present this study include the relatively small group of eligible \n subjects available and the absence of control group data . \n therefore , further similar studies \n involving a larger subject population and a non - affected control group are needed . \n furthermore , studies documenting the effects of a rehabilitation program using variable \n optic flow speeds in the treatment of children with hemiplegic cerebral palsy , are \n considered to be a necessary prerequisite to the addition of variable optic flow movement \n therapies in rehabilitation hospitals .", "role": "user" }, { "content": "[ purpose ] we investigated the effects of modulation of the optic flow speed on gait \n parameters in children with hemiplegic cerebral palsy . [ methods ] we examined 10 children \n with hemiplegic cerebral palsy . \n the children underwent gait analysis under 3 different \n conditions of optic flow speed : slow , normal , and fast optic flow speed . \n the children \n walked across the walkway of a gaitrite system , while watching a virtual reality screen , \n and walking velocity , cadence , stride length , step length , single support time , and double \n support time were recorded . \n [ results ] compared with the other applied flow speed \n conditions , the fast optic flow speed ( 2 times the normal speed ) significantly increased \n walking velocity , cadence , normalized step length , base of support , and single support \n cycle of both the paretic and non - paretic lower limbs . moreover , compared with the other \n applied flow speed conditions , the slow optic flow speed ( 0.25 times the normal speed ) \n yielded a significantly decreased walking velocity , cadence , normalized step length , base \n of support , and single support cycle for both the paretic and non - paretic lower limbs . \n [ conclusion ] the gait parameters of children with hemiplegic cerebral palsy are altered by \n modulation of the optic flow speed . \n thus , we believe that gait training involving \n modulation of the optic flow speed is feasible and suitable for resolving abnormal gait \n patterns in children with hemiplegic cerebral palsy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: an estimated 3.7 million people in the uk have chronic obstructive pulmonary disease ( copd),1 with acute exacerbations of copd ( aecopd ) being the commonest cause for emergency medical admissions . \n inpatient mortality rates can reach 25% and may be as high as 50% within 12 months of admission for aecopd.2,3 patients with acute hypercapnic respiratory failure ( ahrf ) and acidosis have the highest mortality rate and need for invasive mechanical ventilation ( imv ) . \n several controlled clinical trials have shown that noninvasive ventilation ( niv ) in ahrf significantly reduces both mortality and the need for imv.4 ward - based niv is now standard practice in the management of ahrf in the uk , but mortality rate remains high . \n a recent uk national audit of copd admissions reported inpatient and 90-day mortality rates of 25% and 33% , respectively , for patients receiving niv.5 furthermore , only 5% of patients with respiratory acidosis received imv , and only 4% of those who died following niv administration were given imv . \n this lack of escalation of care suggests that patient selection for niv in clinical practice is problematic and needs improvement . whilst imv may be appropriate for some patients with severe acidosis \n several prognostic indicators for patients admitted to hospital with ahrf due to aecopd have been identified . \n these include age , severity of acidosis ( particularly ph < 7.25 ) , impaired consciousness , a high acute physiology and chronic health evaluation ( apache ) ii score , hyperglycemia , and the development of concurrent nonrespiratory organ failure.2,611 identification of high - risk patients may enable appropriate stratification of treatment , including niv and imv . \n however , identifying patients at the terminal stages of their disease is difficult and is usually a matter of clinical judgment . in a previous study \n , we showed that performance status in combination with bedside physiological measurements from routine clinical assessment were highly predictive of mortality in patients admitted to hospital with aecopd.12 the aim of this study was to identify factors associated with inpatient mortality for ahrf with respiratory acidosis due to copd . \n this prospective cohort study was performed in the respiratory unit at the sunderland royal hospital , uk . \n patients admitted and treated with niv for ahrf due to aecopd , between september 2009 and july 2010 , were included if a diagnosis of copd had been previously confirmed by clinical symptoms and spirometry . \n aecopd was defined by the presence of two or more of the following features : worsening dyspnea , cough , increased sputum production , and change in sputum color . \n exclusion criteria included : ( 1 ) a history of asthma , bronchiectasis or other concomitant respiratory diseases ; ( 2 ) a diagnosis of advanced malignancy ; and ( 3 ) pulmonary edema or pneumonia on admission . \n niv was initiated if there was evidence of ahrf and acidosis ( ph < 7.35 and partial pressure of co2 ( pco2 ) > 45 mmhg ) on arterial blood gases ( abgs ) . \n niv was delivered by nurses experienced in niv , using bilevel positive airway pressure ventilators ( bipap vision ; royal philips electronics , amsterdam , the netherlands ) with full face masks . \n initial settings of inspiratory positive airways pressure ( ipap ) and expiratory positive airways pressure ( epap ) were 12 and 4 cm h20 , respectively . \n ipap was adjusted upwards by 2 cm h2o increments according to the response and patient tolerance . \n oxygen was entrained through the mask to maintain peripheral oxygen saturation ( spo2 ) in the range of 88%92% . \n the response to niv was assessed by abgs between 12 hours after commencing treatment and as clinically indicated thereafter . \n the end points of the study were inpatient mortality and mortality at 30 days and 12 months after admission . \n the severity of copd was determined by the most recent spirometry reading taken when the patient was clinically stable . \n this was graded according to the global initiative for chronic obstructive lung disease ( gold ) staging classification.13 other clinical data collected included the use of long - term oxygen therapy , number of hospital admissions for aecopd in the preceding year , and previous documented episodes of ahrf . \n patients comorbidities were recorded and quantified using the index of charlson et al.14 an assessment of patients functional status was made using the world health organization performance status scale ( who - ps ) ( 0 = asymptomatic with normal activity ; 1 = symptomatic on physically strenuous activity but able to carry out work of a light or sedentary nature ; 2 = symptomatic : some limitation of normal activity but up and about > 50% of time during day , self - caring ; 3 = symptomatic : in bed / chair > 50% of time during the day , requires some help with self - care ; and 4 = chair / bedbound , can not carry out any self - care).15 the glasgow coma scale and a composite score of physiological impairment , the early warning score ( ews ) , were recorded upon admission.16 the ews is derived from heart rate , systolic blood pressure , respiratory rate , temperature , and avpu score ( consciousness level , based on patients being alert , responding to voice , responding to pain , or being unresponsive ) ( table 1 ) . \n laboratory measurements included the worst ( lowest ph ) abgs prior to commencement of niv , full blood count , albumin , urea , and c - reactive protein ( crp ) . \n data was analyzed using spss software ( spss inc , chicago , il , usa ) . \n numeric data are presented as means and standard deviation ( sd ) , unless otherwise stated . \n continuous variables were compared by t - test and analysis of variance ( anova ) . \n receiver operating characteristic ( roc ) analysis was used to identify the cutoff values for continuous variables significantly associated with mortality . \n variables significant on univariate analysis ( p < 0.05 ) were included in a stepwise ( forward conditional ) logistic regression analysis , and association with death was expressed as the odds ratio ( or ) ( 95% confidence interval ) . \n the 12-month survival was analyzed using the kaplan meier method and groups compared by log rank test . \n this prospective cohort study was performed in the respiratory unit at the sunderland royal hospital , uk . \n patients admitted and treated with niv for ahrf due to aecopd , between september 2009 and july 2010 , were included if a diagnosis of copd had been previously confirmed by clinical symptoms and spirometry . \n aecopd was defined by the presence of two or more of the following features : worsening dyspnea , cough , increased sputum production , and change in sputum color . \n exclusion criteria included : ( 1 ) a history of asthma , bronchiectasis or other concomitant respiratory diseases ; ( 2 ) a diagnosis of advanced malignancy ; and ( 3 ) pulmonary edema or pneumonia on admission . \n niv was initiated if there was evidence of ahrf and acidosis ( ph < 7.35 and partial pressure of co2 ( pco2 ) > 45 mmhg ) on arterial blood gases ( abgs ) . \n niv was delivered by nurses experienced in niv , using bilevel positive airway pressure ventilators ( bipap vision ; royal philips electronics , amsterdam , the netherlands ) with full face masks . \n initial settings of inspiratory positive airways pressure ( ipap ) and expiratory positive airways pressure ( epap ) were 12 and 4 cm h20 , respectively . \n ipap was adjusted upwards by 2 cm h2o increments according to the response and patient tolerance . \n oxygen was entrained through the mask to maintain peripheral oxygen saturation ( spo2 ) in the range of 88%92% . \n the response to niv was assessed by abgs between 12 hours after commencing treatment and as clinically indicated thereafter . \n the end points of the study were inpatient mortality and mortality at 30 days and 12 months after admission . \n the severity of copd was determined by the most recent spirometry reading taken when the patient was clinically stable . \n this was graded according to the global initiative for chronic obstructive lung disease ( gold ) staging classification.13 other clinical data collected included the use of long - term oxygen therapy , number of hospital admissions for aecopd in the preceding year , and previous documented episodes of ahrf . \n patients comorbidities were recorded and quantified using the index of charlson et al.14 an assessment of patients functional status was made using the world health organization performance status scale ( who - ps ) ( 0 = asymptomatic with normal activity ; 1 = symptomatic on physically strenuous activity but able to carry out work of a light or sedentary nature ; 2 = symptomatic : some limitation of normal activity but up and about > 50% of time during day , self - caring ; 3 = symptomatic : in bed / chair > 50% of time during the day , requires some help with self - care ; and 4 = chair / bedbound , can not carry out any self - care).15 the glasgow coma scale and a composite score of physiological impairment , the early warning score ( ews ) , were recorded upon admission.16 the ews is derived from heart rate , systolic blood pressure , respiratory rate , temperature , and avpu score ( consciousness level , based on patients being alert , responding to voice , responding to pain , or being unresponsive ) ( table 1 ) . \n laboratory measurements included the worst ( lowest ph ) abgs prior to commencement of niv , full blood count , albumin , urea , and c - reactive protein ( crp ) . \n data was analyzed using spss software ( spss inc , chicago , il , usa ) . \n numeric data are presented as means and standard deviation ( sd ) , unless otherwise stated . \n continuous variables were compared by t - test and analysis of variance ( anova ) . \n receiver operating characteristic ( roc ) analysis was used to identify the cutoff values for continuous variables significantly associated with mortality . \n variables significant on univariate analysis ( p < 0.05 ) were included in a stepwise ( forward conditional ) logistic regression analysis , and association with death was expressed as the odds ratio ( or ) ( 95% confidence interval ) . \n the 12-month survival was analyzed using the kaplan meier method and groups compared by log rank test . \n mortality was greater in males compared with females ( 41.4% versus 27.8% ) but this was not statistically significant ( p = 0.18 ) . \n the mortality rates at 30 days and at 12 months after admission were 38.5% and 58.5% , respectively . \n mortality was associated with the severity of copd , longterm oxygen therapy use , and performance status ( table 2 ) . \n the frequency of hospital admissions for aecopd and previous episodes of ahrf were not associated with an increased risk of death . \n nonsurvivors had significantly greater perturbations of respiratory rate , diastolic blood pressure , and the glasgow coma scale . \n several laboratory variables were associated with increased inpatient mortality , including severity of acidosis and degree of hypercapnia ( table 4 ) . \n dichotomous variables were determined as described above , for the who - ps score , ews score , diastolic blood pressure , and ph . the univariate analysis of variables associated with inpatient death is shown in table 5 . \n anemia was associated with increased in - hospital mortality , particularly in female patients : mortality if anemic was 57.1% vs 9.1% ( p = 0.003 ) for females and was 53.8% vs 31.3% ( p = 0.18 ) for males . \n multivariate analysis of factors associated with inpatient death showed that only who - ps 3 ( or 39.0 [ 6.832 23.6 ] ) ( p < 0.0001 ) and anemia ( or 5.86 [ 1.2826.8 ] ) ( p < 0.03 ) were significant . \n the presence of both predicted 68% of inpatient deaths , with a specificity of 98% . \n figure 1 illustrates the effect of combining the who - ps and anemia on survival up to 12 months after hospital admission ( log rank test p < 0.001 ) . \n in routine clinical practice , the mortality from ahrf with respiratory acidosis due to copd is considerable despite treatment with niv . \n this study shows that patients who are unlikely to respond to niv may be identified by a combination of poor performance status ( who - ps 3 ) and anemia . \n the inpatient mortality rate in this study is comparable to that of the uk national copd audit of patients receiving niv ( which showed an inpatient mortality rate of 25%).5 in another study , comparing intensive care delivered niv with imv , the inpatient mortality was similar ( niv 26%).17 but these compare unfavorably with mortality rates observed in other studies of niv for ahrf.8,9,11 in particular , the inpatient mortality in the yoniv study was only 10% for patients on niv.8 the differences in mortality rates are probably a reflection of patient selection . although the yoniv trial was described as a real world \n study , inclusion required ph in the range of 7.257.34 . in the present study , \n 50.8% of our patients had ph < 7.25 , similar to that of the uk national copd audit.5 patients in the studies of chakrabarti et al9 and confalonieri et al11 were also significantly less acidotic . \n as with previous studies , inpatient mortality was associated with more severe acidosis on admission . \n similar observations were reported by chakrabarti et al.9 one explanation may be that abgs on admission do not necessarily reflect disease severity . \n furthermore , some patients may initially respond to treatment , only to later deteriorate.18 in the uk national copd audit , the highest mortality was seen in patients who were nonacidotic on admission but who became acidotic later.5 in a previous study , we showed that inpatient deaths from copd exhibit a bimodal distribution , with early deaths ( within 7 days of admission ) being related to admission acidosis , whereas later deaths were not.12 combinations of routine physiological observations have been shown to be of value in predicting survival for patients requiring niv . \n one score chart , that includes the glasgow coma scale , apache ii score , respiratory rate , and ph , identified patients at > 50% risk of niv failure.11 in another study , a combination of baseline respiratory rate , random glucose , and admission apache ii score was highly ( 100% ) predictive of niv success.9 however , the apache ii score is rarely used outside the intensive care unit , and a more straightforward assessment tool is required for routine clinical use . \n simple measurements of functional limitation alone may be more useful in this respect . in the present study , \n performance status was highly predictive of inpatient death ( mortality if who - ps 3 was 69% vs 5.6% ) and concurs with our previous observations.12 a uk copd audit of outcomes for aecopd showed that performance status was the best predictor of mortality ( 38% if bed / chairbound vs 2% if normal activity).19 morretti et al demonstrated that late niv failure was associated with worse activities of daily living scores.18 patients with a 6-minute walking distance of < 100 m have a 1-year mortality of up to 60%.20 in the study by chu et al,21 only the mrc dyspnea score was independently predictive of death . \n our observation that anemia is a significantly important predictor of inpatient mortality is also of particular interest . \n although copd is traditionally associated with polycythemia , the prognostic importance of anemia in this population is increasingly recognized . \n cote et al22 demonstrated that anemic copd patients had significantly shorter median survival ( 49 versus 74 months ) compared with nonanemics . in a study of patients requiring imv , \n the overall 90-day mortality among anemic copd patients was 57.1% versus 25% for nonanemics.23 the mechanism of anemia in copd and its impact on survival are unclear , but it has been suggested that the prognostic importance of copd - related anemia may be its association with systemic inflammation in severe disease.24 there is increasing evidence of the importance of systemic inflammation in copd.25 a relationship between mortality and the magnitude of crp rise during exacerbations has been reported.12,26 our findings in the present study , of an association between crp level and death in ahrf due to copd , were similar . \n patients with copd that have frequent exacerbations have an increased risk of death.27 however , the frequency of admissions or previous episodes of ahrf were of no prognostic significance in this study . \n the presence of comorbidities is also of prognostic importance in copd in a study of 71,130 patients admitted to hospital with aecopd , a charlson score of 5 was associated with a fivefold increase in death in hospital . in our previous study , \n the charlson score was significantly higher in patients that died , but it was not an independent predictor of mortality.12 it is therefore likely that the differences in performance status between survivors and those that died reflect copd severity and its systemic effects rather than additional comorbidity . \n follow up of patients surviving an episode of ahrf requiring niv indicates poor long - term prognosis . in this study \n , 37% of patients who survived admission died within 12 months . in a similar study of survivors of ahrf treated with niv , \n 49% had died within 12 months of discharge from hospital.21 thus , the probability of medium - term survival needs to be considered prior to commencing niv . \n the bode index , that comprises markers of disease severity in stable copd , including forced expiratory volume in 1 second ( fev1 ) , body mass index , exercise capacity , and dyspnea , has been found to be helpful in predicting long - term prognosis.28 however a bode score in the upper quartile is associated with a 12-month mortality of only 5% and is therefore of little utility in predicting short- to medium - term survival . \n we have deliberately included only variables that are measured in routine clinical practice and are therefore easily replicable and of potential clinical utility . \n who - ps 3 and anemia are prognostic factors in ahrf with respiratory acidosis due to copd . \n a combination of the two provides a simple method of identifying patients unlikely to benefit from niv . \n this study showed that mortality remained high despite treatment with niv , a reflection of the fact that ahrf with respiratory acidosis can be a manifestation of the terminal stage of disease for patients with copd . whilst niv is undoubtedly effective in the majority of patients with ahrf , a substantial proportion \n are subjected to a futile intervention that may be unpleasant and distressing , when end of life care may be more appropriate . \n our study indicates that patients who are unlikely to respond to niv may be identified by routine clinical assessment , but further studies are required to validate these findings . \n all authors had full access to the original data and take responsibility for the integrity of the data and the accuracy of the analysis .", "role": "user" }, { "content": "backgroundin patients with acute hypercapnic respiratory failure ( ahrf ) during exacerbations of copd , mortality can be high despite noninvasive ventilation ( niv ) . for some \n , ahrf is terminal and niv is inappropriate . \n however there is no definitive method of identifying patients who are unlikely to survive . \n the aim of this study was to identify factors associated with inpatient mortality from ahrf with respiratory acidosis due to copd.methodscopd patients presenting with ahrf and who were treated with niv were studied prospectively . \n the forced expiratory volume in 1 second ( fev1 ) , world health organization performance status ( who - ps ) , clinical observations , a composite physiological score ( early warning score ) , routine hematology and biochemistry , and arterial blood gases prior to commencing niv , were recorded.resultsin total , 65 patients were included for study , 29 males and 36 females , with a mean age of 71 10.5 years . \n inpatient mortality in the group was 33.8% . \n mortality at 30 days and 12 months after admission were 38.5% and 58.5% , respectively . \n on univariate analysis , the variables associated with inpatient death were : who - ps 3 , long - term oxygen therapy , anemia , diastolic blood pressure < 70 mmhg , early warning score 3 , severe acidosis ( ph < 7.20 ) , and serum albumin < 35 g / l . on multivariate analysis , only anemia and who - ps 3 were significant . \n the presence of both predicted 68% of inpatient deaths , with a specificity of 98%.conclusionwho - ps 3 and anemia are prognostic factors in ahrf with respiratory acidosis due to copd . a combination of the two provides a simple method of identifying patients unlikely to benefit from niv .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: multiple transgenic mouse models have been and are being developed in cardiovascular research to study hypertension , diabetes , atherosclerosis , hypertrophic cardiomyopathy , heart failure , and many other diseases . \n these different experimental models are generated and studied in different mouse strains and genetic backgrounds . evaluating these disease models \n can be confounded not only by differences in gender or environment but also by baseline differences associated with their genetic background . \n obtaining the baseline characteristics of different background strains may therefore lead to a better understanding of cardiovascular research with laboratory animals . \n reference values concerning left ventricular contractility parameters allow a more direct comparison and a correct interpretation of obtained results in specific studies . \n we hypothesize that four frequently used mice strains ( c57bl/6j , swiss , balbc , and dba2 mice ) exhibit a significantly different baseline left ventricular contractility and that glucose handling capacity is also different between these 4 strains . as glucose handling capacity could play an important role in the development of diabetes mellitus type 2 , hypertension , atherosclerosis , and heart failure , our findings could contribute to a better understanding of the decrease in left ventricular contractility that accompanies these pathological conditions . \n the c57bl/6j black six mouse is by far the most widely used mouse inbred strain . \n the strain is characterised by a high susceptibility to diet - induced obesity , with a moderate hyperglycemia and hyperinsulinemia [ 13 , 14 ] . \n genetic differences in metabolic response to fat have been suggested to be more important in their development of obesity and diabetes than calory intake . \n furthermore , they appear highly susceptible to the development of atherosclerosis on a semisynthetic high - fat diet , although their plasma cholesterol levels at 12 and 24 weeks are rather low . the swiss mouse strain was originally selected in 1935 for its ease in breading . \n it is an albino mouse strain , used over all the branches of biomedical research , especially in cancer research , toxicity studies , and infective diseases . \n they develop high plasma cholesterol levels and high systolic blood pressures but are resistant to diet - induced atherosclerosis . \n although their mean heart rate is rather low , they show a high heart rate adaptation . \n balbc mice show a high incidence of epicardial mineralisation ( 11% in males and 4% in females ) which increases with age . \n finally the dba2 strain is a widely used strain in cardiovascular , biological , and neurobiological research . \n their susceptibility for developing atherosclerotic lesions is low and therefore are often contrasted with the c57bl/6 strain . \n the strain did not only show to be resistant to the development of atherosclerosis on a semisynthetic high fat diet but also hyporesponsive to diets containing high levels of cholesterol and fat . \n spontaneous calcified heart lesions progressively develop with age , and at 1 year 90% of the mice are expected to be affected . \n brunnert suggested in 1997 that dystrophic cardiac calcification may be related to a disturbed myocyte calcium metabolism . \n although it is thus clear that these 4 strains have different metabolic characteristics , with influence on cardiovascular disease development , no direct comparison of glucose tolerance has been published in these strains , nor was left ventricular contractility systematically compared . \n we therefore performed in vivo intraperitoneal glucose tolerance testing and cardiac pressure - conductance measurements in swiss , c57bl/6j , dba2 , and balbc mice at 24 weeks . \n 19 c57bl/6j , 14 balbc , 14 dba2 , and 18 swiss mice were investigated . \n all animals were purchased form jackson laboratories ( bar harbour , maine , usa ) and housed at 22c on a fixed 12-hour light - dark cycle . \n the investigation conforms with the guide for the care and use of laboratory animals published by the us national institutes of health ( nih publication no . 85 - 23 , revised 1996 ) . \n all experimental protocols were approved by the institutional animal care commission and ethical committee of the k.u.leuven . \n intraperitoneal glucose tolerance testing was performed at 23 weeks with a bolus glucose injection of 2 mg / g body weight and followed by measuring the blood glucose levels at fixed timepoints ( fasting and after 15 , 30 , 60 , 120 , and 240 minutes , resp . ) . at 24 weeks \n , mice were anesthetized with a mixture of urethane ( 1.2 g / kg ) and alpha - chloralose ( 50 mg / kg ) injected intraperitoneally . \n mice were placed on a heating pad , and rectal temperature was kept between 36.0 and 37.5c . \n , a tracheostomy was performed , and mechanical ventilation started with room air ( minivent 845 ; hugo sachs / harvard apparatus , march - hugstetten , germany ) . \n subsequently , a 1.4 fr high - fidelity pressure - conductance catheter ( 1.4-fr , spr-839 ; millar instruments , houston , tx ) was inserted through the right carotid artery into the left ventricle , and left ventricular pressure - conductance measurements were started . \n after stabilization of the hemodynamic situation , baseline pressure - volume ( pv ) loops were recorded ( powerlab/4sp adinstruments , castle hill , australia ) , while the ventilation was momentarily turned off to avoid respiratory fluctuation of cardiac signals . \n the inferior caval vein was compressed between liver and diaphragm with a cotton swab without opening the abdomen , while pv loops were recorded to obtain occlusion loops with progressively lowering preload . afterwards \n a 24 g catheter was introduced in the right jugular vein , and parallel volume was determined by a bolus injection of 3 l of 30% sodium chloride solution while recording pv loops . following baseline measurements , \n an intravenous line was prepared with isoproterenol , and dose was increased gradually from 3 , 9 , 30 to finally 90 ng / kg / min . \n dose - response curves of the load - dependent and load - independent contractility parameters to isoproterenol infusion were obtained finally . \n a laparotomy was performed , and the inferior caval vein was exposed infrahepatically . with a 24 g needle , \n 300 l of blood was retrieved from the inferior caval vein to measure specific conductivity in 3 precalibrated cuvettes . \n analysis after ipgtt testing included calculation of peak glucose levels and area under the curve . \n peak glucose levels were obtained 30 minutes after bolus injection and expressed as mg / dl . \n areas under the curve were calculated as the sum of the measured values , normalized for the time interval , and expressed in mgh / dl . \n analysis of the pressure - conductance data was performed using pvan 3.2 software ( millar instruments , houston , tx ) . \n significant changes were detected by single regression , and normality was assessed by the shapiro - wilk w test . \n baseline differences between groups were compared by breakdown one - way anova , followed by an lsd post hoc test and a repeated measurements anova when data was normally distributed . \n the nonparametric mann - whitney u test and wilcoxon matched pairs test was used when data was not normally distributed , and the kruskal - wallis anova was used to compare survival between strains . statistical software ( statistica 8 , statsoft ) \n between 12 and 24 weeks of age , 1 balbc , 1 dba2 , and 2 swiss mice died a sudden unexplained death . during the experimental procedure , 1 swiss mouse and 2 balbc mice died during the baseline pressure - conductance measurements . under increasing isoproterenol dose , in total , 4 swiss , \n 6 c57bl/6j , 2 dba2 , and 7 balbc mice died before 90 ng / kg / min isoproterenol was reached . \n survival during the experimental protocol was significantly lower in balbc mice versus the other strains and occurred mainly during isoproterenol infusion ( p < .05 ) . \n heart weight ( hw ) , body weight ( bw ) , tibial length ( tl ) , and hw / tl were significantly higher in swiss mice at 24 weeks versus all other strains ( p < .01 for hw and bw , p < .05 for tl and hw / tl ) . \n heart weight over body weight ( hw / bw ) was significantly lower in swiss mice ( p < .001 , versus all ) ; see table 1 . fasting glucose levels at 24 weeks were comparable between the four studied strains . during intraperitoneal glucose tolerance testing \n , all mice showed a strong increase in blood glucose values ( figure 1 ) . in c57bl/6j mice , \n the peak glucose level after 30 minutes ( 418 65 ) was significantly higher than the swiss ( 237 66 mg / dl , p < \n .001 ) , the dba2 ( 113 20 mg / dl , p < \n .001 ) , and the balbc group ( 174 55 mg / dl , p < .001 ) . \n auc in c57bl/6j mice was 813 100 mgh / dl , and this was significantly higher than in the swiss ( 470 126 mgh / dl , p < .01 ) , the dba2 ( 304 49 mgh / dl , p < .01 ) , and the balbc group ( 416 70 mgh / dl , p < .001 ) . at baseline , swiss mice had the fastest heart rate ( p < .01 versus all other strains ) . \n end - systolic pressure ( pes ) was higher in balbc mice versus the swiss , dba2 , and c57bl/6j mice ( p < .05 for all ) . \n end - systolic volume ( ves ) was lower in swiss and dba2 mice versus c57bl/6j and balbc mice ( both p < .01 ) , while end - diastolic volume ( ved ) was only significantly lower in dba2 versus c57bl/6j ( p < .05 ) . the maximal systolic pressure ( pmax ) was higher in swiss versus c57bl/6j ( p < .05 ) but not versus dba2 or balbc . \n ejection fraction ( ef ) was higher in dba2 and swiss mice versus c57bl/6j mice and balbc mice ( both p < \n .001 ) , and stroke volume ( sv ) was higher in swiss versus c57bl/6j and balbc mice ( p < .05 ) but not versus dba2 mice ( p = .22 ) . \n cardiac output ( co ) and maximal rate of pressure development during isovolumetric contraction ( dpdtmax ) were higher in swiss versus c57bl/6j ( p < .01 and p < \n .001 ) , dba2 ( p < .01 and p < 0.05 ) , and balbc mice ( both p < .001 ) \n . tau was higher in balbc and c57bl/6j mice versus swiss and dba2 mice ( both p < .05 ) , but the maximal rate of pressure decay ( dpdtmin ) was comparable between the studied strains . \n arterial elastance ( ea ) was significantly higher in balbc mice versus other strains ( all p < .05 ) . the load - independent preload recruitable stroke work ( prsw ) and the end - systolic elastance ( ees ) were not significantly different between the four studied groups ( p > .05 ) . \n the slope of the end - diastolic pressure - volume relationship ( slope edpvr ) was higher in balbc mice ( p < .05 ) , but the parameter of mechanical efficiency of the left ventricle ( stroke work to pv area ( pva ) ratio , sw / pva ) was lower in balbc mice versus the other groups ( p < .05 ) . \n all species showed an increase in hr during isoproterenol infusion ( figure 2 ) , but the hr increase was significantly larger in balbc versus swiss mice ( p < .05 ) ( mean increase of 34 12% in balbc mice versus 19 12% in swiss , 23 9% in c57bl/6j , and 25 11% in dba2 mice ) . \n under isoproterenol , pes , ped , and ved decreased in all strains ( p < .05 ) . \n ejection fraction increased in c57bl/6j , dba2 , and balbc mice ( p < .05 ) and tended to increase in swiss mice ( p = .06 ) . \n all species show a progressive decrease in tau under increasing isoproterenol dose ( all p < .05 ) . \n end - systolic elastance ( ees ) increased significantly under isoproterenol in dba2 and balbc mice between 0 and 90 ng / kg / min ( p < .05 ) . \n however , the increase in prsw only reached statistical significance in the balbc group and not in the dba2 mice . \n this study shows that left ventricular contractility and glucose handling capacity are significantly different in four mice background strains frequently used in cardiovascular research . \n overall survival under isoproterenol infusion with invasive left ventricular contractility measurements was different between the studied strains . \n body weight , heart weight , and left ventricular weight are significantly higher in swiss versus the other studied strains . \n although swiss mice are at 24 weeks heavier than the other background strains , tibial length did not show an increase to the same extent as the heart weight increase , and this results in a higher hw / tl . \n in contrast , hw / bw was lower in swiss mice , because bw increase was more pronounced than the hw increase . \n when lv hypertrophy is studied , it is probably more safe to report hw / tl , hw / bw , and hw / bsa simultaneously . \n ipgtt in c57bl67/j showed higher peak glucose levels and a higher auc versus the other strains . \n this suggests that capacity for glucose handling at 24 weeks is lower in c57bl/6j , although fasting glucose levels are not increased . \n these findings are in accordance with the findings of gerich and vardeny et al . , and it is therefore beneficial to perform ipgtt testing , especially when transgenic models against a c57bl/6j mice background are studied . \n swiss mice exhibited a higher heart rate than the other strains , despite their higher body weight . an increased cardiac output to meet the metabolic demands of a larger individual is thus obtained by a combination of a higher resting hr and a relatively high sv . \n arterial elastance ( ea ) , a parameter for afterload , was higher in balbc mice . \n afterload is influenced by peripheral vascular resistance , arterial compliance , aortic characteristic impedance , and systolic and diastolic time intervals , and therefore any increase in afterload results in a decreased stroke volume , unless contractility is increased . \n the higher ea can partially be explained by the higher systolic blood pressures described in balbc mice ( schlager and sides ) , and this is in accordance with the higher pes that we found in both balbc and especially c57bl/6j mice versus swiss and dba2 mice . \n differences in dp / dtmax are useful to assess directional changes in inotropic state , but changes in preload are to be evaluated simultaneously . \n we found a significantly higher dp / dtmax in the swiss mice , but , because heart rate was also higher in swiss mice , load - independent contractility parameters should be assessed in order to compare lv contractility safely . \n the relatively high slope edpvr in balbc mice together with the higher tau suggest a reduced compliance of the ventricular wall in balbc mice . \n epicardial mineralisation or cardiac calcinosis , that are frequently found in this strain [ 22 , 23 ] , could contribute to these functional changes . \n sw / pva was lowest in the balbc group , indicating that their contractile efficiency is relatively low . \n isoproterenol affects the 2 receptors of skeletal muscle arterioles , inducing vasodilatation , and interacts with the cardiac 1 receptors , potentially leading to a positive inotropic and chronotropic effect . \n we observed a decrease in both ped and pes in all strains and a strong chronotropic increase under isoproterenol administration . the increase in hr was greater in balbc mice than in swiss mice , and the decrease in slope edpvr \n ees increased in both the dba2 and the balbc group but was accompanied by a remarkable change of the pv loop shape with asymmetric and highly peaking pressure - volume loops . \n prsw , a more robust parameter of lv contractility , did only increase in the balbc group . \n these findings suggest that the cardiac 1 effect in these mice strains leads mainly to a chronotropic increase , although isoproterenol infusion in balbc mice results in an increase in external work and efficiency for an increased preload , as shown by the increasing prsw in the higher doses . \n although cardiac performance parameters were significantly different between the four studied strains , c57bl/6j mice did not show a difference in cardiac performance . \n thus , the contractility changes that have been reported for experimental mice models of diabetes mellitus type 2 do not seem to precede the diabetic state . most likely , pronounced and sustained hyperglycemia is required to clearly influence cardiac performance parameters . \n glucose handling capacity was reduced in c57bl/6j mice , but this did not lead to a pronounced difference in cardiac performance . \n although baseline cardiac performance was different between the 4 studied strains , the load - independent prsw was comparable .", "role": "user" }, { "content": "we investigated glucose tolerance and left ventricular contractile performance in 4 frequently used mouse strains ( swiss , c57bl/6j , dba2 , and balbc ) at 24 weeks . \n glucose tolerance was tested by measuring blood glucose levels in time after intraperitoneal glucose injection ( 2 mg / g body weight ) . left ventricular contractility was assessed by pressure - conductance analysis . \n peak glucose levels and glucose area under the curve were higher ( all p < .05 ) in c57bl/6j ( 418 65 mg / dl and 813 100 mgh / dl ) versus swiss ( 237 66 mg / dl and 470 126 mgh / dl ) , dba2 ( 113 20 mg / dl and 304 49 mgh / dl , p < .01 ) , and balbc mice ( 174 55 mg / dl and 416 70 mgh / dl ) . \n cardiac output was higher ( all p < .05 ) in swiss ( 14038 4530 \n l / min ) versus c57bl/6j ( 10405 2683 l / min ) , dba2 ( 10438 3251 l / min ) , and balbc mice ( 8466 3013 \n l / min ) . \n load - independent left ventricular contractility assessed as recruitable stroke work ( prsw ) was comparable in all strains . in conclusion , glucose tolerance and load - dependent left ventricular performance parameters were different between 4 mice background strains , but prsw was comparable .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: clinical teaching is a critical and indispensable section in medical education ( 1 ) that results in the evolution of knowledge , attitude and skills ( 2 ) ; i.e. , the clinical competency of the students ( 3 ) . \n clinical teaching consists of various fields , one of which is clinical rounds ( 4 ) . \n bedside teaching is a patient - based teaching method in medical education that facilitates acquiring real knowledge , practical skills and professional attitudes ( 5 ) . \n this field of learning includes every situation where learning takes place in the presence of the patient , regardless of the environment in which such education is presented ( 6 ) . \n bedside teaching engages the training physicians with interaction with the patient beside their bed to extract a patient s records , represent the key features of clinical examination and discuss the best approach to diagnosing the disease and treating the patient ( 7 ) . \n bedside teaching provides active learning in real situations , observing students skills , increasing their motivation , professional thinking , clinical integration , communicative skills , problem - solving skills , decision - making and moral skills along with improving the understanding of patients ( 1 , 8) . \n in addition , it transfers the human aspects of patient care to the medical students ( 5 , 9 ) and helps the physician to view the patient as a real person and not merely a summary of the disease ( 4 ) . \n this is why these qualities can not be developed effectively in classrooms ( 1 , 10 ) . in clinical medicine , \n 56% of the patients problems could be well recognized after a complete history taking , and this increases to 72% after physical examination . in some cases , \n in other words , performing a comprehensive physical examination could assist the individual physician to reach a diagnosis faster ( 1 , 8 , 11 , and 12 ) . \n previous studies indicate that real clinical teaching emphasizing the history and physical diagnosis over the last 17 years has decreased from 75 to 16% , and it is even less today ( 4 , 10 , and 13 ) . \n in addition , clinical teaching has withdrawn from the bedside to hospital corridors , nursing stations and finally to the conference hall ( 5 , 11 , and 14 ) . \n claim that only 48% of the trainees have stated that they have had bedside teaching during their study . \n these individuals are 100% sure that bedside learning is the most effective method for learning clinical skills ( 15 ) . \n since the aim of clinical teaching is to provide opportunities for students to link theoretical information with practical realities , promoting its quality could result in training qualified students in different clinical domains ( 16 , 17 ) . \n unfortunately , no experimental evidence indicates that bedside teaching is the most effective strategy ( 6 ) . \n since no official evaluation has been conducted on this important educational field in medical universities , no reliable information shows that bedside teaching objectives , including the increase of concept understanding and personal skills , have been achieved through this strategy . \n this study was planned and conducted with the aim of determining the quality of bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad . \n the present study has been conducted with the general objective of determining bedside teaching quality in internal wards of qaem and imam reza educational hospitals in mashhad in 2014 \n . the specific objectives of this study include : \n determining the quality of patient comfort during bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad in 2014determining the quality of targeted teaching in bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad in 2014determining the quality of group dynamics of bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad in 2014 determining the quality of patient comfort during bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad in 2014 determining the quality of targeted teaching in bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad in 2014 determining the quality of group dynamics of bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad in 2014 \n clinical teaching is a critical and indispensable section in medical education ( 1 ) that results in the evolution of knowledge , attitude and skills ( 2 ) ; i.e. , the clinical competency of the students ( 3 ) . \n clinical teaching consists of various fields , one of which is clinical rounds ( 4 ) . \n bedside teaching is a patient - based teaching method in medical education that facilitates acquiring real knowledge , practical skills and professional attitudes ( 5 ) . \n this field of learning includes every situation where learning takes place in the presence of the patient , regardless of the environment in which such education is presented ( 6 ) . \n bedside teaching engages the training physicians with interaction with the patient beside their bed to extract a patient s records , represent the key features of clinical examination and discuss the best approach to diagnosing the disease and treating the patient ( 7 ) . \n bedside teaching provides active learning in real situations , observing students skills , increasing their motivation , professional thinking , clinical integration , communicative skills , problem - solving skills , decision - making and moral skills along with improving the understanding of patients ( 1 , 8) . \n in addition , it transfers the human aspects of patient care to the medical students ( 5 , 9 ) and helps the physician to view the patient as a real person and not merely a summary of the disease ( 4 ) . \n this is why these qualities can not be developed effectively in classrooms ( 1 , 10 ) . \n in clinical medicine , 56% of the patients problems could be well recognized after a complete history taking , and this increases to 72% after physical examination . in some cases , \n in other words , performing a comprehensive physical examination could assist the individual physician to reach a diagnosis faster ( 1 , 8 , 11 , and 12 ) . \n previous studies indicate that real clinical teaching emphasizing the history and physical diagnosis over the last 17 years has decreased from 75 to 16% , and it is even less today ( 4 , 10 , and 13 ) . \n in addition , clinical teaching has withdrawn from the bedside to hospital corridors , nursing stations and finally to the conference hall ( 5 , 11 , and 14 ) . \n claim that only 48% of the trainees have stated that they have had bedside teaching during their study . \n these individuals are 100% sure that bedside learning is the most effective method for learning clinical skills ( 15 ) . since the aim of clinical teaching is to provide opportunities for students to link theoretical information with practical realities , promoting its quality could result in training qualified students in different clinical domains ( 16 , 17 ) . \n unfortunately , no experimental evidence indicates that bedside teaching is the most effective strategy ( 6 ) . \n since no official evaluation has been conducted on this important educational field in medical universities , no reliable information shows that bedside teaching objectives , including the increase of concept understanding and personal skills , have been achieved through this strategy . \n this study was planned and conducted with the aim of determining the quality of bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad . \n the present study has been conducted with the general objective of determining bedside teaching quality in internal wards of qaem and imam reza educational hospitals in mashhad in 2014 . \n the specific objectives of this study include : \n determining the quality of patient comfort during bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad in 2014determining the quality of targeted teaching in bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad in 2014determining the quality of group dynamics of bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad in 2014 determining the quality of patient comfort during bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad in 2014 determining the quality of targeted teaching in bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad in 2014 determining the quality of group dynamics of bedside teaching in the internal wards of qaem and imam reza educational hospitals in mashhad in 2014 \n the method employed in this research was a qualitative study to design tools and apply them to educational clinical rounds held in the internal wards of qaem and imam reza educational hospitals in mashhad in october 2014 . \n these two hospitals were selected since they are currently regarded as general hospitals and among the largest centers of medical education and health in northeastern iran . \n training of general practitioners as well as specialty and subspecialty levels is mostly done in these two hospitals . \n sample size was calculated as at least 96 rounds using the cochran formula ; in total we investigated 131 educational rounds in both hospitals . \n 59 and 54 educational rounds were held in imam reza and qaem hospitals respectively . to supply the calculated sample size , \n then they were selected randomly and evaluated proportionally to the rank of the holding members of the faculty . to collect data , \n to do so , persian and english keywords of medical education , quality of education , clinical teaching , challenges and strategies in bedside teaching , along with new models in bedside and patient - based teaching . \n the above - mentioned keywords , in combination and separately , were then used as search terms in pubmed , google , scientific information database ( sid ) , eric , web of knowledge , medline , science direct , scopus , magiran , google scholar , proquest , elsevier , and the iranian journal of medical education without considering the time limit . in total , the search yielded 138 articles published from 2003 to 2014 . \n the author investigated the obtained texts based on the titles and abstracts . in this step , \n then the sections related to quality based on variables mentioned in these studies were collected . in the next step , \n the resulting items were investigated and discussed in numerous meetings with experts and professors , and the overlapping cases were cancelled or merged together . \n finally , the contents were classified into three domains : patient comfort , targeted - teaching and group dynamics , in accordance with the three - domain model of janicik and fletcher . \n the resulting checklist was presented to a number of medical education and clinical medicine specialists for content validity . \n the reliability of the checklist was verified using cronbach s alpha coefficient ( 0.74 ) . \n the first part of the author s checklist consisted of demographic information including the name of the hospital , type of internal ward and the rank of the faculty member conducting the educational rounds . \n the second part of the checklist included 30 questions involving the factors of effective bedside teaching , including the domains of patient comfort ( 8 questions ) , targeted teaching ( 14 questions ) and group dynamics ( 8 questions ) ( table 1 ) . \n the students were asked to score the checklist questions from 0 to 10 ( 0= not done , 10= done perfectly ) . \n first , the researcher obtained permission from the department of higher education and the vice - chancellor for medical school . \n the subject of the study was presented to the heads of the internal wards of the mentioned hospitals , and permission was then obtained from the hospitals . in the next step , \n a list of the medical students in the clinical teaching course was provided ; those who were passing the internal ward course and the professors rounds were selected randomly . \n then the content of the checklist was given to the students to familiarize them with its content and data collection method . finally , the students filled out the checklists after attending the selected educational rounds in internal wards , maintaining the confidentiality of their answers . \n this study was conducted under the license of the research ethics committee of mashhad university of medical sciences . \n participation in this study was voluntary , and the names of the members of the faculty who held educational rounds were not entered on the data collection forms to maintain privacy and confidentiality of information . \n data description was conducted using descriptive statistical indices as frequency and mean along with standard deviation . to ensure the normal distribution of data , \n the kolmogorov - smirnov test ( k s test or ks test ) was first conducted . \n then , independent t - test , one - way anova and variance analysis were used , in which ( p<0.05 ) was regarded as statistically significant . \n the method employed in this research was a qualitative study to design tools and apply them to educational clinical rounds held in the internal wards of qaem and imam reza educational hospitals in mashhad in october 2014 . \n these two hospitals were selected since they are currently regarded as general hospitals and among the largest centers of medical education and health in northeastern iran . \n training of general practitioners as well as specialty and subspecialty levels is mostly done in these two hospitals . \n sample size was calculated as at least 96 rounds using the cochran formula ; in total we investigated 131 educational rounds in both hospitals . \n 59 and 54 educational rounds were held in imam reza and qaem hospitals respectively . to supply the calculated sample size , \n then they were selected randomly and evaluated proportionally to the rank of the holding members of the faculty . \n to collect data , first a checklist was designed . to do so , persian and english keywords of medical education , quality of education , clinical teaching , challenges and strategies in bedside teaching , along with new models in bedside and patient - based teaching . \n the above - mentioned keywords , in combination and separately , were then used as search terms in pubmed , google , scientific information database ( sid ) , eric , web of knowledge , medline , science direct , scopus , magiran , google scholar , proquest , elsevier , and the iranian journal of medical education without considering the time limit . in total , the search yielded 138 articles published from 2003 to 2014 . \n the author investigated the obtained texts based on the titles and abstracts . in this step , \n then the sections related to quality based on variables mentioned in these studies were collected . in the next step , \n the resulting items were investigated and discussed in numerous meetings with experts and professors , and the overlapping cases were cancelled or merged together . \n finally , the contents were classified into three domains : patient comfort , targeted - teaching and group dynamics , in accordance with the three - domain model of janicik and fletcher . \n the resulting checklist was presented to a number of medical education and clinical medicine specialists for content validity . \n the reliability of the checklist was verified using cronbach s alpha coefficient ( 0.74 ) . \n the first part of the author s checklist consisted of demographic information including the name of the hospital , type of internal ward and the rank of the faculty member conducting the educational rounds . \n the second part of the checklist included 30 questions involving the factors of effective bedside teaching , including the domains of patient comfort ( 8 questions ) , targeted teaching ( 14 questions ) and group dynamics ( 8 questions ) ( table 1 ) . \n the students were asked to score the checklist questions from 0 to 10 ( 0= not done , 10= done perfectly ) . \n first , the researcher obtained permission from the department of higher education and the vice - chancellor for medical school . \n the subject of the study was presented to the heads of the internal wards of the mentioned hospitals , and permission was then obtained from the hospitals . in the next step , \n a list of the medical students in the clinical teaching course was provided ; those who were passing the internal ward course and the professors rounds were selected randomly . \n then the content of the checklist was given to the students to familiarize them with its content and data collection method . \n finally , the students filled out the checklists after attending the selected educational rounds in internal wards , maintaining the confidentiality of their answers . \n this study was conducted under the license of the research ethics committee of mashhad university of medical sciences . \n participation in this study was voluntary , and the names of the members of the faculty who held educational rounds were not entered on the data collection forms to maintain privacy and confidentiality of information . \n data description was conducted using descriptive statistical indices as frequency and mean along with standard deviation . to ensure the normal distribution of data , \n the kolmogorov - smirnov test ( k s test or ks test ) was first conducted . \n then , independent t - test , one - way anova and variance analysis were used , in which ( p<0.05 ) was regarded as statistically significant . \n in this study , 113 educational rounds in total were investigated ( table 2 ) . among them , 59 ( 52.2% ) and 54 ( 47.8% ) of educational rounds were held in imam reza and qaem hospitals , respectively . among all educational rounds investigated , \n educational rounds held by the members of the faculty with the rank of professor was 19 ( 16.8% ) , assistant professor 63 ( 55.8% ) and associate professor 31 ; this conformed to the real ratio of the members of the faculty . \n in general , the average total quality score of bedside teaching in the internal wards of imam reza and qaem hospitals was 180.8 out of the total score of 300 . \n the lowest score related to the quality of bedside teaching was 0 and the highest score was 300 . in the domains of considering patient comfort and group dynamics , the lowest and highest scores were 0 and 80 , and in the case of targeted teaching the lowest and highest scores were 0 and 140 , respectively . \n the average quality score of bedside teaching in the internal wards of imam reza and qaem hospitals was 163.7 ( 46.4 ) and 197.9 ( 66.4 ) , respectively . \n the average score of bedside teaching was compared for both groups using independent t - test ( table 3 ) , the difference of which was not significant ( p>0.05 ) . \n the average quality score of patient comfort in the internal wards of imam reza and qaem hospitals was 26.5 ( 15.4 ) and 31.1 ( 20.4 ) out of 80 , respectively ( table 3 ) . \n the average score related to patient comfort in both groups was compared using independent t - test , and the difference was not significant ( p>0.05 ) . \n the average quality score of targeted teaching in bedside teaching in the internal wards of imam reza and qaem hospitals was 101.3 ( 25.7 ) and 110.7 ( 33.3 ) out of 140 , respectively ( table 3 ) . \n the average score of targeted teaching in bedside teaching in both groups was compared using independent t - test , and the difference was not significant ( p>0.05 ) . \n the average quality score of group dynamics in bedside teaching in internal ward of imam reza and qaem hospitals was 35.7 ( 15.1 ) and 56.0 ( 21.6 ) out of 80 ( table 3 ) . \n the average score of group dynamics was compared in both groups using independent t - test , and the difference was significant ( p<0.05 ) . \n the average total score of bedside teaching quality in terms of patient comfort , targeted teaching and group dynamics was compared in the two groups using independent t - test . by supposing equal variances \n , the difference was not significant in terms of patient comfort and targeted teaching ( p>0.05 ) . \n however , it was significant in terms of group dynamics ( p<0.05 ) . nevertheless , the quality of bedside teaching was not significantly different in the two hospitals ( p>0.05 ) . \n one - way anova was employed to compare the quality of bedside teaching in terms of the rank of faculty members . \n no significant difference was observed in terms of patient comfort and targeted teaching ( p=0.235 and p=0.121 , respectively ) . \n however , the quality was significantly different in terms of group dynamics considering the rank of faculty members ( p=0.027 ) . in sum , \n bedside teaching quality was not significantly different in the two hospitals in terms of the rank of faculty members ( p=0.129 ) . \n the quality of bedside teaching was significantly different only in terms of group dynamics among assistant to associate ranks of faculty members ( p=0.049 ) in such a way that the average score obtained by assistant professors was higher for 10.7 . \n in general , the results of the study showed that the quality of bedside teaching in internal wards of qaem and imam reza educational hospitals is not acceptable according to the indicators of patient comfort , targeted teaching and group dynamics . in the study by ziaee , \n the percentage of students consent from clinical teaching was 38.8% , which conformed to the results of this study . in the previous study , only a few items including the educational objectives being specified , the number of participating students and having a course plan were investigated ( 18 ) . \n the results of the present study conform to the results of khorasani study in 2007 , which had reported students attitudes toward the current situation of clinical teaching as negative . \n however , in that study , only limited aspects of clinical teaching were addressed , including the educational objectives being specified , the possibility of independent visits by the trainee , the possibility of prescribing medicine independently and criticizing and correcting the trainee s history ( 19 ) . on the other hand , \n another study conducted in the iran university of medical sciences in 2004 showed that the quality of clinical teaching was regarded as relatively favorable , according to medical students . in that study , \n domains of scientific mastery of the professor , educational management and the quality of communication and consulting were considered . \n that study did not consider patient comfort as an independent item , and it conformed to our study only in the domains of targeted teaching and group dynamics ( 20 ) . in his study in 2012 , bagheriyan represented that the situation of clinical teaching is regarded as desirable , according to the students of anesthesiology and operating room in tabriz . in this study , \n the trainer , clarity of educational objectives , and the educational environment were shown to have the highest effect in the quality of clinical teaching ( 21 ) . in the study by mardani in 2010 , the situation of clinical teaching was reported from nursing students perspective . in this study , \n the evaluation method and proper manners of the trainer were regarded as strong points , and the lack of coordination of clinical teachings with theory was regarded as the weak point ( 22 ) . \n it appears that the current study has included aspects that play more important roles in clinical teaching . \n possibly the strong point of the present study in comparison to others is its special attention to patient preferences as one of the factors affecting quality . in a study by lubetkin at cornell university , \n the quality of clinical teaching was regarded as desirable according to the professors and students , although the professors were more satisfied than the student ( 23 ) . \n the results of that study did not conform to the results of our study . in the above - mentioned studies , \n items including educational equipment , mastery of professors of the subjects and the physical environment were considered . \n the results of the present study are devastating in terms of the quality related to patient comfort in bedside teaching , and these conform to the results of the study by dehghani et al . \n this category has been emphasized in numerous studies , and it is regarded as a high - quality component of clinical teaching ( 6 , 2527 ) . \n a study conducted in isfahan in 2006 showed that talking about mental and social issues satisfies only 40% of the patients , and nearly 60% of the patients were satisfied in terms of having emotional connection with their physicians . \n the patient s participation in the treatment process was not satisfying for 50% of the patients in terms of having treatment methods clearly explained , being included in understandable discussions , and feeling that their feedback was valued in terms of performing or not performing a treatment . \n 40% of the patients felt unsafe about scattered talks during clinical teaching and stated that they felt themselves to be regarded as educational tools ( 4 ) . in lehmann s study of educational hospitals of the usa , \n it appears that not allowing the patient to discuss their emotional issues and social conditions , lack of participation and getting feedback from them in discussions , along with medical decisions and low emotional relations of the physician with the patient , have resulted in ignoring human aspects . \n however , in related studies , indicators such as good relations with the patient , patients participation in decisions , considering patients concerns , accelerating the solution of patients problems and answering their questions are considered to be measures of humanitarian behavior of the physician ( 13 , 29 ) . in 2012 \n , a study by adibi in isfahan revealed that repeated examinations and visits , along with crowded and long clinical rounds in which information is presented to the patient in an unclear way , have resulted in patient dissatisfaction . in effect , patients feel that they are employed as educational tools ( 13 ) . \n factors such as a high number of questions and examining individuals in clinical rounds and the main physician not being recognized , scattered and contradictory discussions in the patient s presence , along with the lack of presenting sufficient and understandable explanations of the disease and treatment measures , results in increasing the patient s sense of insecurity . \n in addition , it results in greater uncertainty about being treated by an individual who is not the main physician . \n the necessity of introducing the people present in clinical rounds and identifying the person in charge , along with explaining treatments and procedures clearly , are given serious emphasis ( 4 , 30 ) . \n these results conformed to the results of the present study . in our study , the following cases in the domain of patient comfort have been considered : coordination with the patient , stating educational objectives , introducing people , considering the patients concerns , minimizing possible patient misunderstandings at the end of teaching and the importance of patients preferences . in the section related to the quality of group dynamics in clinical teaching , the results of our study showed that this quality has been lower than average in the internal ward of imam reza hospital , and it was average in that of qaem hospital . \n the results of our study were similar to the results of bazzazi s study ( 31 ) . \n it appears that to achieve desirable conditions , new ways of increasing students participation must be employed . in this regard \n , a more accurate evaluation of the current situation appears essential along with discovering weak and strong points . \n possibly one of the obstacles to achieving this goal is providing students an opportunity to judge professors capabilities . in their discussion of learning environments , \n kroenke and omori ( 2010 ) stated that during educational rounds , physicians are maybe anxious about their abilities in knowledge transmission . \n they claim that this fear may be more prevalent in young lecturers who do not have much clinical teaching experience . therefore , having friendly relations with students at the beginning of teaching would result in a more positive learning environment ( 10 ) . in this \n regard , ramani in his 2013 study states that the professor should challenge the students minds without humiliating them , and he suggests that the professor should involve all learners in teaching process . \n this could be achieved by assuring that all students have an opportunity to answer questions ( 32 ) . \n recommended that before visiting the first patient , it is preferable to set a time for discussion with students . by introducing all the team members from the professors to the residents and the medical students , they will have the opportunity to become familiar with each other . \n the professor should state his objectives and expectations for the students at the beginning as well ( 27 ) . in our study \n , in the domain of quality related to the group dynamics for which an average score was obtained for both hospitals , the following issues were considered : team cooperation , freedom in presenting comments , creating an intimate relationship at the beginning of teaching , giving responsibility to students and creating a safe atmosphere for free discussion . in the section comparing clinical teaching quality in the internal wards of imam reza and qaem hospitals , considering the indicators related to patient comfort , targeted teaching and group dynamics , the results of our study showed that generally the quality of clinical teaching in both hospitals does not differ significantly . \n however , the score related to the quality of group dynamics in qaem hospital was better compared to that of imam reza hospital . \n the quality of clinical teaching according to the rank of the member of the faculty was not different for both hospitals . \n more dynamics were observed in teachers with the rank of professor compared to associate professors . to answer the present ambiguities in this regard , more research \n is required . in this study , we investigated the quality according to the three - domain model of janicik and fletcher , which includes patient comfort , targeted teaching and group dynamics . \n other studies conducted from the perspectives of nursing students and clinical professors have investigated the factors affecting clinical teaching from different points of view ( 22 , 33 , and 34 ) . \n another study in gonabad revealed that the most effective factor in the quality of clinical teaching , according to both students and lecturers , has been the performance of instructors . \n collaborative working environment , educational equipment in clinical environment , amenities in the clinical setting and the ward setting being proportional to the number of students are domains considered in the mentioned study ( 33 ) . in that study , collaborative working environment is regarded as the weakest factor . \n this finding conforms to the results of our study in terms of low collaborative working environment as one of the components of group dynamics . \n a 2010 study by mardani in ahwaz revealed that the interns and trainees views of clinical teaching is average and better than average . in this study , the strongest point of clinical teaching \n students awareness from clinical evaluation method at the beginning of practical course and proper behavioral treatment by the clinical instructor . \n in addition , the weakest points were related to the lack of cooperation of the ward with students and the lack of harmony between theoretical learning and clinical activities ( 22 ) . \n in summary , the results of this study showed that the quality of clinical teaching in the internal wards of qaem and imam reza educational hospitals is weak in the domains related to patient comfort and group dynamics . \n improving and promoting the quality of bedside teaching requires continuous assessment of the current situation , recognizing strong points and correcting weak points , a process in which the comments and ideas of both professors and students could pave the way for later plans . \n it is suggested that mashhad university of medical sciences take some steps to improve the quality of clinical teaching , especially in domains related to the patient s comfort and trainee s participation through holding educational workshops and presenting new teaching methods , along with investigating possible problems .", "role": "user" }, { "content": "background : bedside teaching is a patient - based teaching method in medical education . the present study has been conducted with the aim of investigating the quality of bedside teaching in the internal wards of qaem and imam reza educational hospitals.methods:this study follows a mixed qualitative - quantitative approach using checklists on educational clinical rounds in imam reza and qaem hospitals in mashhad . in the first stage consisting of qualitative study , \n the parts related to the quality of bedside teaching were recognized and a checklist was designed in three domains of patient comfort ( 8 questions ) , targeted teaching ( 14 questions ) and group dynamics ( 8 questions ) , and its reliability and validity were verified . in the next step , data were collected and then analyzed using spss 16 software through statistical techniques of independent t - test , one - way anova and variance analysis.results:in total , 113 educational rounds were investigated in this study . among them , \n 59 ( 52.2% ) and 54 ( 47.8% ) educational rounds have been investigated in imam reza and qaem hospitals , respectively . \n the average total score of bedside teaching was 180.8 out of 300 in the internal wards of both imam reza and qaem hospitals.conclusion:the results of this study showed that generally the quality of bedside teaching in imam reza and qaem hospitals of mashhad is low according to the qualitative standards considered in this study . \n holding educational workshops along with more familiarity of the professors with effective bedside teaching strategies could be effective in improving the quality of educational rounds .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: granulomatosis with polyangiitis ( gpa ) , previously known as wegener 's granulomatosis , is a multi - system autoimmune disease , often associated with anti - neutrophil cytoplasm antibodies ( anca ) , which commonly involves the eye as well as the respiratory tract and kidneys . \n ophthalmic complications occur in 5060% of patients and typically take the form of necrotising scleritis or granulomatous orbital involvement . \n some 90% of patients with necrotising scleritis develop ocular complications and 50% develop significant visual loss . \n cyclophosphamide and corticosteroids have been the cornerstones of treatment for severe gpa but are associated with treatment - related morbidity and mortality . \n more recent treatment options include the biological agent rituximab , which is a monoclonal antibody directed against cd20 , a cell surface antigen expressed by many subtypes of b cells , although not by plasma cells . \n we have recently shown that rituximab can be effective in refractory ophthalmic gpa and induce long - lasting disease remission , but it takes up to 6 months to work , meaning that additional agents may be required to provide disease control in the interim . \n infliximab belongs to a different class of biological agents , being a monoclonal antibody directed against tumour necrosis factor - alpha ( tnf - a ) . \n it is licensed for the treatment of both rheumatoid arthritis and crohn 's disease in the united states and europe and has also demonstrated efficacy in the treatment of the anca - associated vasculitides ( aav ) , such as gpa , although a recent study in which infliximab was added to standard therapy in patients with active aav failed to demonstrate any benefit compared to standard therapy alone . \n infliximab has been used successfully in the treatment of refractory scleritis [ 7 , 8 ] . \n we report here a patient with necrotising scleritis associated with gpa in whom infliximab was used for short - term steroid - sparing while rituximab took effect . \n this enabled disease control without requiring an extended period of high - dose corticosteroid administration or the concurrent use of cyclophosphamide , neither of which was desirable as a result of his comorbidities and previous treatment history . \n a 71-year - old man was referred to the hammersmith hospital multidisciplinary vasculitis clinic with necrotising scleritis in the left eye ( fig . \n he had previously been diagnosed with gpa on the basis of characteristic renal disease associated with a raised anca titre and the presence of anti - pr3 antibodies . \n he had previously been treated with cyclophosphamide , and his cumulative dose of cyclophosphamide was approximately 20 g. he was initially treated with corticosteroids at a dose of 1 mg / kg and a cycle of rituximab ( mabthera , hoffmann - la roche , ltd . ) given as 2 intravenous doses of 1 g two weeks apart . \n after 3 weeks , his necrotising scleritis was still active , despite his b cell count having fallen to 0 cells / mm . \n we were reluctant to continue his high - dose corticosteroids as he had osteoporosis confirmed on dexa scanning , and treatment with cyclophosphamide was not felt desirable in view of his cumulative dose . \n therefore , infusions of infliximab ( remicade , merck & co. ) were arranged and given as doses of 5 mg / kg at baseline , 2 , 6 and 12 weeks . \n 2 ) , and his systemic corticosteroids were reduced to 5 mg prednisolone / day by week 12 . \n he had his final infusion of infliximab at this point and thereafter was maintained on 5 mg prednisolone / day alone for the following 12 months . \n we report a case of necrotising scleritis secondary to gpa , successfully treated with infliximab whilst waiting for rituximab to induce disease remission . importantly , \n this enabled cyclophosphamide to be avoided in the acute phase , as rituximab can take up to 6 months to work [ 4 , 5 ] . \n this was especially important as the patient had had significant previous exposure to cyclophosphamide , increasing his risk of malignancy with further treatment . \n infliximab rather than etanercept was used as the latter has previously been proven not to be effective for the maintenance of remission in patients with gpa [ 5 , 9 ] . \n in addition , retrospective studies of patients with uveitis treated with tnf - a blockade have indicated infliximab to be the more effective treatment in ophthalmic disease . \n there was some concern that the use of two biological agents simultaneously could lead to life - threatening infection or malignancy , but there is little in the literature that addresses this directly . \n one recent registry - based study of patients being treated with biological agents for rheumatoid arthritis showed their rate of hospitalised infection to be 4.6 per 100 person - years , increasing to 7.0 per 100 person - years for the group that had \n switched from a different biological agent , the situation most analogous to the one here . \n interestingly , the rate for rituximab was higher at 10.4 episodes per 100 person - years in this study , falling to 7.1 in switchers ; the authors suggested that this might represent higher - risk patients being channelled towards rituximab therapy . \n encouragingly for the treating clinician , analysis showed that patient characteristics were a more powerful determinant of the rate of serious infections than specific biological drugs or patterns of switching drugs . \n similarly , a meta - analysis of patients treated with tnf - a blockade in rheumatoid arthritis did not demonstrate an increased risk of malignancy . \n nevertheless , this case report illustrates the potential usefulness of infliximab in gaining rapid disease control and allowing time for rituximab to take effect , at least in some patients with necrotising scleritis . \n it also illustrates the increasing treatment options which are available to treat patients with refractory ocular inflammation , and supports the management of such patients in a multidisciplinary setting so that close contact with appropriate specialists can enable these treatments to be taken advantage of by patients in a safe and controlled environment . \n the sponsor or funding organisation had no role in the design or conduct of this research . \n this study was approved by the hammersmith hospital and queen mary 's hospital research ethics committee .", "role": "user" }, { "content": "we report a patient with necrotising scleritis in whom infliximab was used for short - term steroid - sparing while rituximab took effect . \n this enabled disease control without requiring an extended period of high - dose corticosteroid administration or the concurrent use of cyclophosphamide .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: from january 2000 to january 2004 we treated 49 patients with subtrochanteric fractures ( fig . \n nineteen patients ( 38.8% ) had multiple injuries ( three with head trauma , five with thorax trauma , five with blunt abdominal injury and fifteen with various other fractures ) . \n there were 28 males and 21 women with a mean age of 64 years ( range , 31 to 92 years ) . \n eighteen patients younger than 50 years were injured by high energy trauma , and mostly in traffic accidents . \n thirty one elderly patients older than 50 years were injured by low energy trauma , and mostly by falls . \n the fractures were classified according to the ao classification.12 ) eight ( 16.3% ) fractures were type 32-a ( all type a3.1 ) , 16 ( 32.7% ) were type 32-b ( eight type b1.1 , six type b2.1 , and two type b3.1 ) , and 25 ( 51% ) fractures were type 32-c ( seventeen type c1.1 , five type c2.2 , and three type c3.1 ) . \n the average time from injury to operation was four days ( range , 2 to 22 days ) . \n preoperative planning included selecting the appropriate length of the implant ( the length of the implant was either 200 or 250 ml in all the patients ) . \n all the patients received pre and postoperative antibiotics for three days and also low molecular weight heparin ( lovenox , sanofi - aventis , bridgewater , nj , usa ) . \n this sif , which was developed by the senior author ( mbm ) , consists of three components : 1 ) a bar with a trochanteric unit on one end and a dynamic , antirotating unit on the opposite end , 2 ) clamps , and 3 ) screws ( fig . \n the trochanteric unit has three diagonally oriented holes ( at 130 degrees ) for the 7 mm diameter screws for the femoral neck and head . \n one of these holes is just proximal to the fracture site and two are distal to the fracture site . \n all the patients were positioned supine on a radiolucent fracture table and the operation were done with the patients under general anesthesia . \n manual traction and indirect fracture reduction were attempted before the surgery , with checking the length , axial alignment and rotation clinically using radiographs , as well as checking the required implant length . a standard , lateral , five to six centimeters long incision was made just distally from the trochanteric ridge . \n the tip of the sif is positioned on the lateral cortex over the periosteum and then it was pushed distally toward the lateral femoral condyle . \n the tip of the bar easily passes under the vastus and intermedius and over the periosteum . \n if preferable , one or more clamps can be introduced onto the bar near to the trochanteric unit before this step . then a five centimeters long distal incision is made and the tip of the sif should appear in this incision site after the tip appears , two or three clamps are introduced over the tip onto the bar and the sif is pushed further until the proximal end of the trochanteric unit is positioned 1.5 to 2 cm distal from the trochanteric ridge . \n the trochanteric unit has three holes , but two screws need to be introduced into the neck and head of the femur under radiology control . one hole remains empty except in very corpulent patients . through the distal incision , one cortical antirotating screw is placed through the distal end of the dynamic unit and two or three self - incising screws are placed through the clamps after drilling ( fig . \n these screws need to be placed in different positions so that they are orientated to converge one from the other . \n if the fractured area was exposed , lag screws or screws through the clamps can be placed into the fractured bone fragments without detaching the soft tissue ( fig . \n full weight bearing was allowed from the third day after surgery for all the patients . \n radiographic and clinical follow - up were performed monthly for the first 6 months and then at three and six months intervals thereafter . \n the evaluation included time to union ( months ) and the angular and rotational malalignment ( external / internal rotation , varus / valgus , recurvatum / procurvatum , limb length discrepancy ) . \n the complications were recorded , as well as pain , the walking ability and the hip motion . \n this sif , which was developed by the senior author ( mbm ) , consists of three components : 1 ) a bar with a trochanteric unit on one end and a dynamic , antirotating unit on the opposite end , 2 ) clamps , and 3 ) screws ( fig . \n the trochanteric unit has three diagonally oriented holes ( at 130 degrees ) for the 7 mm diameter screws for the femoral neck and head . \n one of these holes is just proximal to the fracture site and two are distal to the fracture site . \n all the patients were positioned supine on a radiolucent fracture table and the operation were done with the patients under general anesthesia . \n manual traction and indirect fracture reduction were attempted before the surgery , with checking the length , axial alignment and rotation clinically using radiographs , as well as checking the required implant length . a standard , lateral , five to six centimeters long incision was made just distally from the trochanteric ridge . \n the tip of the sif is positioned on the lateral cortex over the periosteum and then it was pushed distally toward the lateral femoral condyle . \n the tip of the bar easily passes under the vastus and intermedius and over the periosteum . \n if preferable , one or more clamps can be introduced onto the bar near to the trochanteric unit before this step . then a five centimeters long distal incision is made and the tip of the sif should appear in this incision site after the tip appears , two or three clamps are introduced over the tip onto the bar and the sif is pushed further until the proximal end of the trochanteric unit is positioned 1.5 to 2 cm distal from the trochanteric ridge . \n the trochanteric unit has three holes , but two screws need to be introduced into the neck and head of the femur under radiology control . one hole remains empty except in very corpulent patients . through the distal incision , one cortical antirotating screw is placed through the distal end of the dynamic unit and two or three self - incising screws are placed through the clamps after drilling ( fig . \n these screws need to be placed in different positions so that they are orientated to converge one from the other . \n if the fractured area was exposed , lag screws or screws through the clamps can be placed into the fractured bone fragments without detaching the soft tissue ( fig . \n full weight bearing was allowed from the third day after surgery for all the patients . \n radiographic and clinical follow - up were performed monthly for the first 6 months and then at three and six months intervals thereafter . \n the evaluation included time to union ( months ) and the angular and rotational malalignment ( external / internal rotation , varus / valgus , recurvatum / procurvatum , limb length discrepancy ) . \n the complications were recorded , as well as pain , the walking ability and the hip motion . \n the average operating time was 45 minutes ( range , 32 to 90 minutes ) . \n the average hospital stay was 10 days ( range , 7 to 59 days ) . \n the mean follow - up time was 22.3 months ( range , 15 to 30 months ) . \n the mean union time was 14 weeks ( range , 12 to 20 weeks ) ( fig . 1c and fig . 2c ) . \n varus malalignment less then 10 occurred in three ( 6.1% ) patients at the end of follow - up . \n shortening of the limb due to dynamisation was recorded in 17% of the patients with the average shortening being 0.6 cm ( range , 0.2 to 1.0 cm ) ( fig . \n rotational malalignment and deep venous thrombosis were not recorded in any patients . at the time of the review , 35 patients were pain - free and 14 had mild pain and they used medicine . \n ten patients had pain due to arthritic changes in the lumbosacral region of the spine , while four patients had pain because of hip arthrosis . \n all patients under 50 years old returned to their pre - injury residential status except one who had hip motion limitation . \n the goals of subtrochanteric fracture fixation are restoration of the normal neck - shaft angle , reestablishment of leg length - rotation , union and avoidance of abductor weakness . \n the proximal bone fragments of the subtrochanteric area are relatively small and they provide limited area for fixation , and high tensile and compressive stresses cross this region.13 ) these fractures are known to be difficult to treat and various intra- and extramedullary devices have been advocated for this purpose in the past . \n intramedullary devices have been shown to have a minimal failure rate due to its rigid axial and rotational stability.4 - 6,14 ) the central position of the intramedullary nail prevents excessive collapse with immediate weight bearing.5,13,15 ) however , complications such as intraoperative nail protrusion , cephalic screw cutting - out , delayed union , malunion and fractures at the tip of the nail have been reported.9,13 ) as the medial cortex is subjected to compression forces and the lateral cortex is subjected to tensile force , extramedually implants in the lateral cortex have been reported to easily fail.16,17 ) the medoff sliding plate has obvious theoretical biomechanical advantages because it provides biaxial dynamisation and it reduces a rate of failure.17 ) the potential disadvantage of extramedullary implants are the extended soft - tissue damage with the accompanying blood loss , difficulties in reduction , an increased surgical time , nonunion , malunion , implant rupture and pulling - out.18 - 24 ) however , the biological plating technique minimizes some of these disadvantages because this does not damage the medullary blood supply as occurs in reamed intramedullary nailing nor the vascularity of the medial fragment.9 ) using the sif , we were able to achieve acceptable results for the treatment of subtrochanteric fractures . \n there were only three patients ( 6.1% ) with varus malunion ( varus angulation less then 10 ) and this did not require further intervention . \n striping of the soft tissue of the lateral cortex is kept to the minimum so that the vitality of the fragments is not further compromised . \n therefore , the result of the current report is encouraging with no failure and with an excellent union rate ( 100% ) . \n early joint mobilization and ambulation without complications were our goals and we applied this sif for treating all the fractures , and even the type a fracture . \n we do not have the biomechanical data on this implant , yet stability of the implant was achieved by two pins on the trochanteric unit and by screws with clamps fixed on the femoral diaphysis and this provided three - dimensional fixation of each main bone fragment , as each clamp can rotate around the bar and screws can be applied in a convergent configuration ( from different sides of the bar ) . \n the antirotation screw also contributes to the stability of the implant , and not only by preventing rotation . in our clinical series , \n the use of the sif was proven to be safe and successful for treating subtrochanteric fracture . \n it provides a short operative time , low blood loss , spontaneous biaxial dynamisation and healing in an optimal period of time without secondary intervention . \n one of the advantages of our implant is the low cost of our implant because the results we achieved with this implant were similar to those of the other costly implants . \n for all patients full weight bearing can be allowed shortly after surgery without the complications that accompany the other implants .", "role": "user" }, { "content": "backgroundsurgical treatment is the preferred method for treating subtrochanteric femoral fractures and the variety of extramedullary and intramedullary implants continues to evolve . \n the purpose of our study was to retrospectively evaluate the clinical and radiological results of subtrochanteric fractures that are treated with the selfdynamisable internal fixator.methodsfrom january 2000 to january 2004 , we treated 49 consecutive patients who had subtrochanteric fractures . according to the ao classification , \n 8 ( 16.3% ) fractures were type 32-a , 16 ( 32.7% ) were type 32-b and 25 ( 51% ) fractures were type 32-c . \n the mean follow - up time was 22.3 months.resultsthe average operating time was 45 minutes ( range , 32 to 90 minutes ) . \n the average blood loss was 250 ml ( range , 125 to 350 ml ) . \n the average hospital stay was 10 days ( range , 7 to 59 days ) . \n implant failure was not observed and union was achieved in all the patients . \n deep infection occurred in one ( 2% ) patient in the early postoperative period . \n fracture union was achieved at a mean of 14 weeks . \n varus malalignment less then 10 degree was noted in three ( 6.1% ) patients at the end of follow - up . \n thirty - five patients were pain - free and 14 had mild pain.conclusionsthe selfdynamisable internal fixator was successfully used for subtrochanteric fracture . \n it provides a short operative time , low blood loss , spontaneous biaxial dynamisation and healing in an optimal period of time without the need for secondary intervention .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: . specific targeting of the tumor microenvironment may therefore constitute an alternative to cytotoxic therapies . here \n , we show that the expression of pkc-ii in the tumor microenvironment is induced by malignant cells from patients with cll , all , and mantle cell lymphoma and required for the activation of nf-b in bone marrow stromal cells . \n interference with pkc-ii induction critically impairs the survival of cll cells in vitro and in vivo , demonstrating that therapeutic targeting of the pkc-ii - nf-b signaling pathway activated in the tumor microenvironment may be a meaningful treatment option . \n chronic lymphocytic leukemia ( cll ) is one of the most common b cell malignancies in adults , characterized by an accumulation of monoclonal cd5 mature b cells in lymphoid tissues and the peripheral blood . \n the deletion of chromosome 13q14.3 represents the most common genetic alteration in cll , causing autonomous b cell proliferation by affecting the expression of the microrna cluster 15a/16 - 1 ( dhner et al . , 2000 \n whole - genome sequencing recently identified recurrent mutations in notch1 , myd88 , and sf3b1 in cll , opening up insights in the mechanisms of clonal evolution ( fabbri et al . \n increased expression levels of antiapoptotic proteins have reinforced the hypothesis that a cell intrinsic defect of apoptosis is causative for b cell longevity and a steady increase in the number of malignant b cells over time ( cimmino et al . , 2005 ; kitada et al . , \n however , primary cll cells rapidly die ex vivo despite high levels of bcl2 but can be cultured for weeks in the presence of different types of stromal cells ( burger et al . , \n this indicates that the apoptosis defect in cll is not cell autonomous but highly dependent on extrinsic signals derived from their microenvironment . \n notably , this is not a static interaction in which stromal cells constitutively provide prosurvival signals to malignant cells but a dynamic process driven by bidirectional communications between the two . in the present study , we sought to investigate how cll cells activate bone marrow stromal cells ( bmscs ) and to characterize the signaling pathways and their functional consequences underlying this cell - cell communication . \n to study heterotypic cell - cell communications between stromal and cll cells , we established a coculture system using primary leukemic b cells derived from patients blood and the murine cell line el08 - 1d2 ( figure s1a available online ) , which has been carefully characterized as a stromal cell line able to maintain hematopoietic progenitor and stem cells ex vivo ( oostendorp et al . , 2002 ) . \n analysis of apoptotic cll cells after 5 days of coculture demonstrated that they were protected from spontaneous apoptosis . \n this antiapoptotic effect of stromal cells could not be recapitulated with cd19 peripheral blood b cells . \n notably , stromal cells provided little protection from spontaneous apoptosis of cd5 b1 cells derived from blood of healthy donors ( figures 1a and s1b ) . to define cytokines induced in cll - stroma cocultures , supernatants from these cocultures \n of the 62 cytokines measured in this assay , 6 were significantly upregulated in cll - stroma cocultures : sdf-1 , il-6 , g - csf , gm - csf , mip-3 , and cxcl16 ( figure 1b ) . because all the antibodies used in this analysis , with the exception of anti - sdf-1 , were specific to mouse cytokines , the detected cytokines must have been produced by the murine stroma and not the human cll cells . \n the consistent upregulation of proinflammatory cytokines by stromal cells in response to contact with leukemic b cells suggested that el08 - 1d2 cells share properties akin to so - called cancer - associated fibroblasts ( cafs ) . \n cafs are characterized by promoting growth and invasion of epithelial tumors ( kalluri and zeisberg , 2006 ) , but their role in the pathogenesis of cll is less clear . \n immunofluorescence of el08 - 1d2 cells demonstrated that -sma and stress fibers , both of which have been used to identify cafs ( kalluri and zeisberg , 2006 ; tlsty and coussens , 2006 ) , were induced by contact with cll cells ( figure 1c , a \n this remodeling of the actin skeleton depends on the gtp - binding protein rhoa ( ridley and hall , 1992 ) . \n correlating with the formation of stress fibers , rhoa was expressed in el08 - 1d2 cells upon cll contact ( figure 1c , e and f ) . \n for further characterization of el08 - 1d2 cells , we compared transcriptomes of el08 - 1d2 cells before and after 5 days of contact with cll cells , derived from multiple donors . \n we found 474 genes consistently increased ( table s1 ) and 347 decreased ( table s2 ) in stromal cells , of which 129 and 40 genes showed greater than 2-fold change , respectively . subjecting these 821 consistently altered target probe sets to overrepresentation analysis using genetrail \n ( p = 6.0 10 ) and response to wounding ( p = 7.2 10 ) ( figure 1d ) . \n it was recently reported that cafs from skin , mammary , and pancreatic tumors in mice are characterized by a proinflammatory gene signature ( erez et al . , 2010 ) . \n comparison of those genes to our results revealed significant overlap of target genes ( figure 1d , lower panel ) . \n therefore , in coculture , el08 - 1d2 cells support the survival of malignant b cells and undergo genetic and morphologic alterations reminiscent of cafs . \n interactions between fibroblasts and tumor cells can contribute to drug resistance by increasing the expression of antiapoptotic proteins in tumor cells ( meads et al . \n we previously reported that the intrinsic activation of protein kinase c ( pkc)-ii in cll cells mediates apoptosis resistance due to posttranslational modifications of bcl2 and bimel ( zum bschenfelde et al . , 2010 ) . \n therefore , we tested whether the pkc- inhibitor enzastaurin could overcome the protective effect of el08 - 1d2 cells on cll cells . \n cll cells cultured on el08 - 1d2 cells were not protected from the cytotoxic effect of enzastaurin , whereas the cytotoxicity of doxorubicin was mitigated by contact with stromal cells ( figure 2a ) . \n importantly , neither enzastaurin nor doxorubicin significantly influenced the viability of el08 - 1d2 cells ( figure s2a ) . \n these data imply that pkc- plays an important role in stroma - cll interactions . to further analyze this effect , we assessed the expression of classical pkc isoforms in either cell compartment before and after coculture . \n , 2007 ) , but its level of expression was unmodified after contact with el08 - 1d2 cells ( figure 2b ) . \n . however , contact with several different primary leukemic b cells induced the expression of pkc-ii in el08 - 1d2 cells , but not pkc- or pkc-i , that were constitutively expressed in el08 - 1d2 cells . \n the absence of zap70 in stromal cell lysates of coculture experiments with a zap70-positive cll demonstrated that cll contamination of stromal cell lysates is negligible in these experiments ( figures 2b and s2b ) . \n of note , normal peripheral blood b cells from healthy donors did not induce pkc-ii in stromal cells ( figure 2c ) . \n subcellular fractioning of stromal cell proteins before and after cll contact indicated that induced pkc-ii was located in the cytoplasm , but not the nucleus ( figure 2d ) . quantitative rt - pcr using mouse - specific primers showed that upregulation of pkc- in el08 - 1d2 cells was mostly due to transcriptional regulation ( figure 2e ) . to further exclude the possibility of cross - contamination with pkc-ii - positive cll cells \n after 5 days of coculturing cll cells on el08 - 1d2 cells , cll cells were removed and stromal cells analyzed for the expression of pkc-ii . \n stromal cells could be identified by a positive staining for sca-1 ( oostendorp et al . \n stromal pkc-ii was detected with a perinuclear expression pattern , characteristic of activated pkc-ii ( becker and hannun , 2003 ) ( figure s2c , a d and i ) . \n pkc-ii could not be detected in el08 - 1d2 monocultures ( figure s2c , e \n we next examined whether a direct contact between cll cells and stromal cells was required to protect cll cells from apoptosis and to induce the expression of pkc-ii in el08 - 1d2 cells , and we found that both were lost if these cell compartments were separated in a transwell experiment ( figures 2f and 2 g ) . \n furthermore , conditioned medium from el08 - 1d2/cll cocultures failed to support survival of leukemic cells ( figure s2d ) . to eliminate the concern that the results seen so far were limited to coculturing human leukemic b cells on a murine cell line , we cocultured primary human cll cells on primary human bmscs ( hbmscs ) . \n similar to el08 - 1d2 cells , hbmscs supported ex vivo survival of cll cells , and accordingly , pkc-ii was induced ( figures 2h and 2i ) . \n irradiation of el08 - 1d2 cells or hbmscs before coculturing abolished their antiapoptotic effect on cll cells , indicating that only signaling competent stromal cells can protect cll cells from cell death ( figure s2e ) . \n hbmscs are a heterogeneous mixture of different cell types . to further define the subsets of cells that were responsible for these effects \n , we cocultured cll cells on human umbilical vascular endothelial cells ( huvecs ) , primary human osteoblasts ( hobs ) , and a murine osteoblast - cell line ( mc3t3 ) under comparable conditions as used for el08 - 1d2/cll cocultures . \n remarkably , all cell types supported cll survival ( figure 2h ) , accompanied by pkc-ii induction ( figure 2j ) . \n finally , extended cocultures of cll cells and hbmscs for 4 weeks demonstrated that stromal pkc-ii induction was not transient but persistent ( figure 2k ) . \n the strong correlation between pkc-ii upregulation and survival of cll cells suggested that stromal pkc-ii was important for the antiapoptotic signals provided by el08 - 1d2 cells . to test this hypothesis , pkc-ii induction in el08 - 1d2 cells \n sirna transfection of el08 - 1d2 was performed 24 hr before coculturing with cll cells to ensure that the pkc-ii of cll cells was not targeted . \n pkc- and pkc- expression in el08 - 1d2 cells was assessed by immunoblotting after 5 days of coculturing with cll cells and showed that only pkc-ii was effectively targeted ( figure 3a ) . analyzing \n the viability of cll cells cultured on el08 - 1d2 cells proficient or depleted of pkc-ii indicated that stromal pkc-ii was required for the survival of cll cells ( figure 3b ) . \n knockdown of stromal pkc-ii significantly impaired the survival of all samples tested from individual patients with cll . \n this was particularly relevant because cll is a heterogeneous disease with variations in the clinical course . \n the aberrant expression of zap70 in monoclonal b cells can be used as a prognostic marker of a more aggressive variant of cll ( crespo et al . \n , 2003 ) . however , pkc-ii knockdown in stromal cells affected the survival of zap70-positive and -negative cll , similarly ( figure 3c ) . to eliminate the possibility that off - target effects of the pkc-ii sirna accounted for the impaired survival of cll cells , we recapitulated our experiments with primary bmscs from wild - type and pkc- knockout ( prkcb ) mice . \n prkcb mice , which lack both i and ii isoforms , are characterized by an impaired immune response but have no overt phenotype in the bone marrow stromal compartment ( leitges et al . , 1996 ) . \n cll cells were effectively protected from spontaneous apoptosis when cocultured on wild - type bmscs , accompanied by induction of pkc- in stromal cells ( figures 3d and s3a ) . \n this protection effect was significantly impaired on prkcb stromal cells ( figures 3d and 3e ) . \n characterization of the primary cll cells used in these experiments , based on standard cytogenetic analyses and sequencing of tp53 ( exons 411 ) and notch ( exons 2534 ) , did not identify any subset of patients being more dependent on pkc--mediated survival than others ( table s3 ) . \n ectopic expression of the wild - type pkc- in prkcb bmscs rescued their ability to provide survival cues to cll cells ( figure 3f ) , confirming that pkc- expressed in stromal cells is required for the survival of cll cells . \n moreover , expression of a kinase - dead mutant ( k371r ) of pkc- ( feng and hannun , 1998 ) failed to restore the survival functions of prkcb bmscs , indicating that the kinase activity of pkc- is essential for stroma - mediated protection of cll cells from apoptosis ( figures 3f and s3b ) . \n the uniform upregulation of pkc-ii ( figures 2i and 2j ) suggested that the antiapoptotic effect of different types of stromal cells on cll cells was attributed to its expression . \n consistent with this hypothesis , knockdown of pkc-ii in huvecs abolished their prosurvival effects on cll cells ( figure 3 g ) . \n pkc- connects the b cell receptor to canonical activation of nf-b through a signaling complex , including bcl10/malt1 and nemo / ikk ( zhou et al . , 2004 ) . because stromal cells activated by cll cells showed a proinflammatory phenotype ( figure 1 ) , we investigated whether nf-b activation could also occur following induction of pkc-ii in stromal cells and found that activation of nf-b occurred in wild - type , but not in prkcb bmscs in response to cll contact ( figure 4a ) . \n these results were recapitulated in el08 - 1d2 cells and in hbmscs ( figures 4b and s4a ) . to test whether the loss of nf-b activation was primarily dependent on pkc- expression or a secondary event based on the impaired survival of cll cells on pkc--deficient stromal cells , apoptosis of cll cells \n caspase inhibition rescued cll cells cultured on pkc--deficient stromal cells from spontaneous apoptosis but did not result in activation of nf-b in pkc--deficient stromal cells ( figures s4b and s4c ) , suggesting that pkc- is directly involved in the activation of nf-b . \n this activation is regulated by nuclear translocation and dna binding of nf-b subunits ( hayden and ghosh , 2004 ) . \n fractionation of el08 - 1d2 cell lysates showed that the nf-b subunits p50 , p65 , and c - rel accumulated in the nucleus upon contact with monoclonal b cells ( figures 4c and s4d ) . to further elaborate whether bcl10 was linking pkc-ii to nf-b activation in stromal cells , we used bmscs from bcl10 and wild - type mice for coculture experiments . \n primary cll cells survived equally well on bcl10 and wild - type stromal cells ( figure 4d ) . \n accordingly , cll - dependent activation of nf-b was not inhibited in bcl10 stroma ( figure 4e ) . \n notably , stromal pkc-ii was induced upon cll contact regardless of bcl10 ( figure 4f ) , excluding bcl10 as a critical protein for pkc-ii - mediated activation of nf-b in stroma cells . to assess \n whether stromal nf-b was important for the prosurvival effects on malignant b cells , we analyzed the viability of cll cells in cocultures with el08 - 1d2 cells in the presence of an ikk2 inhibitor ( ziegelbauer et al . \n . ikk2 ( ikk ) is a member of the multiprotein ib complex that also contains ikk1 ( ikk ) and the essential regulatory subunit nemo . \n blockage of ikk2 significantly affected survival of cll cells on stromal cells without affecting the viability of el08 - 1d2 cells ( figures 4 g and s2a ) . \n this impaired survival of cll cells was associated with a decreased activation of nf-b in stromal cells ( figure 4h ) . \n however , it was possible that the proapoptotic effect of the ikk2 inhibitor was exclusively related to nf-b inhibition in cll cells . to disentangle stroma from cll - specific effects , we used bmscs derived from conditional nemo - knockout mice ( nemo ) ( schmidt - supprian et al . , 2000 ) and as controls bmscs from yfp reporter mice ( srinivas et al . , 2001 ) . \n nemo was ablated from isolated monocultures of nemo stromal cells by treatment with cre protein ( htnc ) ( figure 4j ) ( peitz et al . \n nemo - proficient and -deficient bmscs were then propagated in the absence of htnc for additional two passages before cll cells were added . \n activation of nf-b in nemo - deficient bmscs was inhibited after cll contact ( figure 4i ) , although pkc-ii was still induced ( figure 4j ) . \n importantly , nemo - deficient bmscs failed to support the survival of primary cll cells ( figure 4k ) , similar to loss of stromal pkc-ii ( figure 3 ) . \n the slightly reduced induction of pkc-ii in nemo - deficient bmscs compared to untreated nemo cells is most likely related to an impaired survival of and therefore reduced induction signal by cll cells on these bmscs ( figure 4j ) . \n these findings provide evidence that induction of pkc-ii in stromal cells precedes the activation of nf-b and that the pkc-ii / nf-b pathway is required for stromal cell - mediated survival of malignant b cells . comparing the transcriptome of htnc - treated and -untreated nemo murine bone marrow stroma cells ( mbmscs ) after 5 days of coculturing with cll revealed that 372 genes were significantly increased ( 2-fold ) in nemo - proficient bmscs ( table s4 ) . \n accordingly , 388 genes were downregulated ( 0.5-fold ) in bmscs expressing nemo ( table s5 ) . notably , \n bmscs from nemo mice were htnc treated at least 8 days before the coculture with cll cells , making it unlikely that changes in gene expression were merely related to the addition of htnc . using the genetrail software and the kegg database to further analyze these genes \n ( p = 0.029 ) and a cluster of cell adhesion molecules ( p = 0.004 ) , which were decreased in nemo - deficient mbmscs ( figure 5a ) . to validate the differential regulation of these genes \n , we analyzed the levels of il-1 and il-15 , both of which have been described to support cll survival in the absence of stromal cells ( de totero et al . \n , 2008 ; jewell et al . , 1995 ) , in supernatants from cll and bmsc cocultures after 5 days . \n cll contact induced the secretion of il-1 by mbmscs , which was completely abolished in nemo - deficient bmscs ( figure 5b ) . \n similar to il-1 , il-15 was induced in a nemo - dependent manner in stromal cells by cll contact , although to greater variations ( figure 5c ) . \n importantly , antibodies used in these elisas were specific for murine il-1 and il-15 and not cross - reactive to human cytokines , excluding the possibility that the detected factors were produced by human cll cells . \n upregulation of il-1 and il-15 mrna in hbmscs upon cll contact ( figure s5a ) indicated that these results were not limited to xenogeneic culture conditions . finally , to test that murine il-1 , il-1 , and il-15 could rescue primary cll cells from apoptosis , increasing doses of these cytokines were supplemented to cll monocultures or cll / nemo - deficient bmsc cocultures . \n the analysis of apoptotic cll cells after 5 days indicated that il-1 and il-15 partially rescued nemo deficiency in bmscs ( figures 5d , 5e , and s5b ) . \n combining il-1 and il-15 demonstrated a stronger prosurvival effect on cll cells ( figure s5c ) . \n notably , cytokine doses required to partly compensate for nemo deficiency in stromal cells exceeded the concentrations of il-1 and il-15 produced by stromal cells after cll contact . \n this antiapoptotic effect was reproducible in cll monocultures , indicating that these cytokines directly supported the survival of cll cells through a paracrine mechanism ( figures 5d , 5e , and s5b ) . \n importantly , mouse and human il-1 and il-15 are not entirely homologous ( il-1 , 61% ; il-1 , 69% ; and il-15 , 71% ) , and therefore , their antiapoptotic effect may be underestimated in our experiment compared to an in vivo scenario . transgenic mice expressing tcl1 under the e promotor ( tcl1tg ) show a clonal expansion of cd5 b cells and die of a cll - like disease ( bichi et al . , 2002 ) . \n about 40% of tcl1tg mice develop a solid malignant tumor unrelated to the expression of tcl1 , mostly soft tissue sarcomas ( zanesi et al . , 2006 ) . \n to test the relevance of pkc- in the microenvironment for the survival of monoclonal b cells in vivo , we transplanted splenic cells from three individual lymphoma - bearing tcl1tg mice into prkcb or wild - type recipient mice . because tcl1tg and prkcb mice were both backcrossed onto a c57bl/6 genetic background , \n no immunosuppression was needed before transplantation ( hofbauer et al . , 2011 ) . \n tumor load was assessed weekly by analyzing the amount of cd19cd5 b cells in the peripheral blood of recipient mice . \n after 5 weeks , an increase of cd19cd5 cells was detected in the blood of pkc- wild - type , but not of prkcb recipient mice ( figure 6a ) . \n all wild - type recipient mice died of a cll - like disease after a mean of 59 days ( range 4884 days ) , whereas prkcb recipient mice stayed healthy and alive during that time ( figure 6b ) . \n we noticed that some of the prkcb recipient mice , all of which were transplanted with tumor 1 , became moribund at much later time points ( mean 125 days , range 80180 days ) ( figure s6a ) . \n prkcb recipients showed a typical tcl1 phenotype , characterized by massive splenomegaly , hepatomegaly , lymphadenopathy , and clonal expansion of cd5 b cells ( figures 6c and s6b ) . \n immunohistochemistry confirmed that these tumors were cd19cd5 b cell lymphomas with a proliferation index ( mib-1 ) of 5%10% ( figure 6d ) . \n strikingly , necrobiopsy revealed that none of the prkcb recipient mice developed a cll - like disease ( figure 6c ) , and spleen and lymph nodes appeared macroscopically normal . \n the few mice that were transplanted with tumor 1 and died showed large tumors in the peritoneal cavity . \n single cells from these tumors lacked surface expression of lymphoid markers ( data not shown ) . \n the presence of tcl1cd19cd5 lymphocytes was assessed from spleens of prkcb and wild - type recipients at the time of sacrifice . increased levels of cd19cd5 lymphocytes were only detectable in wild - type recipient mice , but not in prkcb animals ( figure s6c ) . \n histopathology demonstrated that all tumors grown in prkcb mice were histiocytic soft tissue sarcomas ( figure s6d , a and b ) . \n microscopically , sarcomas could also be detected in the spleen of some prkcb recipient mice transplanted from the same primary tumor ( figure s6d , c and d ) . to test whether cd5 lymphocytes from diseased tcl1tg mice were capable of inducing pkc-ii in bmscs , we cocultured tcl1cd19cd5 lymphocytes on primary murine bmscs derived from wild - type , prkcb , and tcl1tg mice . \n similar to primary cll cells from patients , tcl1cd19cd5 cells induced the expression of pkc-ii in wild - type and tcl1tg bmscs ( figure s6e ) , associated with improved ex vivo survival ( data not shown ) . \n accordingly , nf-b was activated in mbmscs from wild - type mice , but not in prkcb stromal cells ( figure 6e ) . \n these data indicate unambiguously that pkc- induced and expressed in the microenvironment is essential to establish a cll - like disease in vivo , whereas stromal pkc- seems to be dispensable for propagating soft tissue sarcomas . \n to evaluate whether pkc-ii is upregulated in the microenvironment of patients with cll , we assessed its expression in stromal cells in bone marrow trephine biopsies . to overcome the difficulties of a preponderance of malignant b cells that express pkc-ii and the lack of reliable markers for most stromal cells , we used cll samples with a nodular , but not diffuse , infiltration of the bone marrow , allowing analyzing cll - free and infiltrated sections in the same patient . \n in addition , endothelial cells are a subpopulation of stromal cells that can be reliably stained with an antibody against cd34 and can support survival of monoclonal b cells dependent on the expression of pkc-ii ( figures 2h , 2j , and 3 g ) . \n immunofluorescence of bone marrow trephine biopsies revealed that pkc-ii was only expressed in endothelial cells in sections containing cll cell infiltrations ( cd79a ) , but not in those in cll - free sections ( figure 6f ) . to test whether heterotypic interactions between bmscs and the tumor are also important for the survival and propagation of other malignant cells , we cocultured primary human acute lymphoblastic leukemia ( all ) cells and mantle cell lymphoma ( mcl ) b cells for 5 days on el08 - 1d2 cells . \n although all cells died at a significant higher rate than mcl cells in vitro , contact with stromal cells reduced spontaneous apoptosis of both all and mcl cells ( figure 7a ) . \n similar to cll cells , primary all and mcl cells induced the expression of pkc-ii in el08 - 1d2 cells ( figure 7b ) , suggesting that the pkc-ii / nf-b pathway is commonly activated in b cell malignancies . \n indeed , we found activated nf-b in el08 - 1d2 cells after coculture with all and mcl cells , similar to coculture with cll cells ( figure s7 ) . \n the importance of stromal pkc-ii for the survival of all and mcl cells was confirmed by the support of survival of all and mcl cells by the wild - type but not the prkcb bmscs ( figure 7c ) . to evaluate whether pkc-ii was induced in stromal cells in vivo , we analyzed human bone marrow trephine biopsies from patients with a mature all and mcl for the expression of pkc-ii in endothelial cells . \n endothelial cells surrounded by all and mcl cells expressed pkc-ii , whereas those outside did not ( figure 7d ) . \n these data show that stromal pkc-ii is upregulated in a variety of lymphoproliferative malignancies and suggest that activation of the pkc-ii pathway could represent a general response of the tumor microenvironment to support leukemogeneis / lymphomagenesis . \n it has become more appreciated that tumors are not merely an accumulation of monoclonal cells but rather are heterogeneous complex structures , composed of malignant cells and various host cells . \n this cancer - associated microenvironment contributes significantly to tumor progression by supplying prosurvival factors crucial for the propagation of malignant cells . \n therefore , targeting the tumor microenvironment constitutes a treatment option to bypass cancer cells intrinsic drug resistance . here , we report that the induction of pkc-ii in stromal cells is required for the survival of leukemic b cells \n . studies on pkc- knockout mice indicated that its function was restricted to normal b cell physiology by linking the b cell receptor to nf-b activation ( leitges et al . \n reports of pkc- in the context of tumorigenesis are limited to intrinsic high expression levels in b cell malignancies ( decouvelaere et al . , 2007 ) and the promotion of colon carcinogenesis through a mechanism involving the accumulation of -catenin ( fields et al . , 2009 ) . \n the induction of pkc-ii in the microenvironment by cll cells was neither species restricted nor limited to a subtype of stromal cells . \n this suggests that cll cells can communicate with stromal cells through highly conserved and ubiquitously expressed receptors , or the upregulation of pkc-ii is related to metabolic alterations . \n the latter is supported by data showing that a metabolic interplay between stromal cells and cll cells can promote survival of cll cells ( zhang et al . , 2012 ) . \n although it is very reasonable to assume that the functional consequences of pkc-ii activation differ between different subsets of stromal cells , the induced expression of pkc-ii in all cell types marks its potential as a therapeutic target . \n we observed that the expression of pkc-ii in endothelial cells in vivo was restricted to vessels within the infiltrated bone marrow . \n previously , activation of pkc-ii in endothelial cells was observed as a response to hypoxia in a nontumor mouse model and was required for neovascularization ( suzuma et al . \n , 2002 ) . in this regard , the expression of pkc-ii in endothelial cells may also be accountable for the reported increase in bone marrow angiogenesis in patients with cll ( kini et al . , 2000 ) . \n our data demonstrate that pkc-ii , but not pkc-i , is induced in stromal cells activated by contact with monoclonal b cells . \n this raises the important question of what upstream events and signaling cascades are involved in the isoform - specific regulation of pkc-. pkc- activity is modulated by the presence of lipid second messengers , calcium , and protein modifications , but little is known about the regulation of its protein level . \n importantly , both isoforms are encoded by a single gene and arise via alternative splicing ( ono et al . , 1987 ) . \n this suggests that specific stabilization of pkc-ii mrna is accountable for an increase in protein levels , similar to the regulation of pkc- isoforms by glucose ( patel et al . , 1999 ) and insulin ( chalfant et al . , 1995 \n ) . however , soluble factors were eliminated as the only determinants to induce pkc-ii . \n it is important to mention that pkc-ii protein was detectable by immunoblotting at the earliest 3 days after coculture with cll cells ( data not shown ) . \n this delayed upregulation almost certainly excludes that pkc-ii is a direct target gene engaged by an immediately activated signaling pathway . \n long - term cultures of hbmscs and cll cells showed that pkc-ii levels steadily increased over time . \n this ruled out that pkc-ii is subjected to a negative feedback loop as reported for other pkc isoforms ( kang et al . \n we show that nf-b is linked through the canonical pathway to pkc-ii in stromal cells , but bcl10 is dispensable , demonstrating that the mechanism by which pkc-ii activates nf-b in stromal cells is distinct from that utilized in normal b cells . \n alternative pathways linking pkc- to nf-b independently of bcl10 include the pkc - associated kinase ( pkk ) ( muto et al . , 2002 ) and hsp27-mediated interaction with ikk ( park et al . , 2003 ) \n although , to our knowledge , the precise mechanism of nf-b activation remains unsolved , our results indicate that pkc-ii operates upstream of canonical nf-b activation and that its expression is a prerequisite to activate nf-b in stromal cells . \n we have identified that stromal nf-b regulates the expression of cytokines and of adhesion molecules . \n therefore , the reduced expression of icam1 in nemo - deficient cells suggests that impaired survival of cll cells on these stromal cells could also be related to reduced binding . \n conversely nf-b may support the survival of leukemic b cells through enforced expression of adhesion molecules . \n surprisingly , we found genes generally known to play an important role for the interaction between b and t cells expressed in nemo - proficient bmscs after contact with cll cells . \n importantly , primary murine bmscs are a heterogeneous cell population , constituted of nonhematopoietic cells and antigen - presenting cells ( apcs ) . \n decreased expression of cd86 in nemo - deficient bmscs may therefore reflect an exquisite dependence of apcs on functional nf-b . \n in addition , some of these antigens , such as cd28 , can also be expressed in nonlymphoid stromal cells ( gray parkin et al . \n in addition to adhesion molecules , nemo regulated the production and secretion of proinflammatory cytokines . \n as a proof of principle , we have demonstrated that il-1 and il-15 can rescue leukemic b cells from cell death . \n however , we assume that in vivo , numerous cytokines in collaboration with enhanced expression of adhesion molecules on the surface of stromal cells stimulate cll cells in parallel and presumably act synergistically on malignant b cells to block apoptosis . \n the observation that expression of pkc-ii in the microenvironment is essential to promote the survival of cll cells provides a reason to target pkc-ii therapeutically . \n motivated by the observation that specific pkc isoforms are intrinsically overexpressed in numerous different tumors , several pkc inhibitors have already been developed . \n enzastaurin , an orally available pkc- inhibitor , demonstrated clinical activity in a phase ii trial on patients with lymphoma with negligible toxicity ( robertson et al . , 2007 ) . \n numerous clinical studies are currently exploring the usefulness of enzastaurin for the treatment of a broad variety of solid and hematopoietic malignancies ( listed on http://clinicaltrials.gov ) . \n based on our data , we propose a dual function of pkc-ii in the pathogenesis of cll : intrinsic expression and activation of pkc-ii in cll cells augment pkb / akt signaling leading to apoptosis resistance ( barragn et al . , 2006 ) , whereas its induction in stromal cells mediates microenvironment - dependent survival . \n the crucial role of pkc- for the pathogenesis of cll was recently demonstrated by crossing tcl1tg mice with prkcb mice ( holler et al . , \n however , this experiment does not allow deciphering the relative contribution of pkc- expressed in cd19cd5 monoclonal b cells and in stromal cells to the development of the disease . \n the recently reported activation of nf-b in cafs from mammary and pancreatic adenocarcinomas ( erez et al . , \n 2010 ) suggests that stromal pkc-ii could also operate upstream of nf-b in other tumor - associated stromal cells . \n this hypothesis is further supported by the finding of overexpressed pkc- in stromal cells of human basal cell carcinomas ( reynolds et al . , 1997 ) . \n therefore , induced expression of pkc- may be a common mechanism of malignant cells to harness stromal cells for tumor - promoting purposes . \n therapeutic strategies aiming at tumor cell intrinsic oncogenic pathways have been limited in their success due to the genetic instability of tumor cells and the evolution of mutations conferring drug resistance . \n in contrast , cancer - associated stromal cells presumably lack these escape mechanisms and may therefore constitute an alternative therapeutic target . \n further studies are needed to explore whether inhibition of pkc- , expressed in tumor - associated stromal cells , displays clinical significance . \n after informed patients consent and in accordance with the helsinki declaration , peripheral blood was obtained from untreated patients with a diagnosis of cll , all , and mcl . \n hbmscs were collected from individuals who underwent bone marrow aspiration for diagnostic purposes and in whom subsequently a hematological disease was ruled out . our studies on cll , mcl cells , and hbmscs were approved for ex vivo experiments by the local ethical committee of the technical university munich ( project number 1894/07 ) . \n the collection and use of primary all and normal blood samples were approved for ex vivo experiments by the local ethic committee of the university hospital of essen ( project numbers 10 - 4380 and 04 - 2459 ) . \n monoclonal b cells from patients with mcl and all were isolated from peripheral blood at the time of first diagnosis . \n pbmcs were isolated from heparinized blood or bone marrow samples by centrifugation over a ficoll - hypaque layer ( biochrom , berlin ) of 1.077 g / ml density . \n t cells and monocytes were removed with anti - cd2 and anti - cd14 magnetic beads ( dynabeads m450 ; dynal , oslo ) . \n a total of 2 10 bm - mononuclear cells was plated in 24-well tissue plates using the media conditions described in the supplemental information . \n mbmscs were established from femora and tibiae of 4- to 8-week - old mice accordingly . \n each mouse provided about 5 10 bone marrow cells . as previously described by hofbauer et al . \n ( 2011 ) , a massively enlarged spleen was removed from an aged and moribund e-tcl1tg mouse ( provided by c. croce , columbus , ohio , usa ) , and single cells were obtained by homogenizing the tissue and filtering cells through a 100 m nylon cell strainer ( bd falcon , heidelberg , germany ) . \n after separation of pbmcs by centrifugation over a ficoll - hypaque layer , 20 10 cells were injected intraperitoneally into 6- to 8-week - old syngeneic prkcb or prkcb mice . \n mice were housed in a specific pathogen - free facility and followed for signs of illness . \n statistical analyses of the results were performed by one - way anova followed by student s t test . throughout the manuscript , \n < 0.001 ( ) , p < 0.01 ( ) , p < 0.05 ( ) , or ns ( statistically nonsignificant ) .", "role": "user" }, { "content": "summarytumor cell survival critically depends on heterotypic communication with benign cells in the microenvironment . here \n , we describe a survival signaling pathway activated in stromal cells by contact to b cells from patients with chronic lymphocytic leukemia ( cll ) . \n the expression of protein kinase c ( pkc)-ii and the subsequent activation of nf-b in bone marrow stromal cells are prerequisites to support the survival of malignant b cells . \n pkc- knockout mice are insusceptible to cll transplantations , underscoring the in vivo significance of the pkc-ii - nf-b signaling pathway in the tumor microenvironment . \n upregulated stromal pkc-ii in biopsies from patients with cll , acute lymphoblastic leukemia , and mantle cell lymphoma suggests that this pathway may commonly be activated in a variety of hematological malignancies .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: they are a major cause of disfigurement and disability in endemic areas , leading to significant economic and psychosocial impact . \n herein we reported a case of filariasis with recurrent gastrointestinal bleeding and peripheral edema . \n a 56 year - old man was admitted to the hospital for evaluation of recurrent gastrointestinal bleeding and peripheral edema . he had been well until 12 months earlier , when he had mid - epigastric pain and passed black - red stools that were positive for occult blood . \n the patient had nearly constant crampy , nonradiating pain in his epigastrium , right upper quadrant , and periumbilical area ; the pain was exacerbated by eating and accompanied by nausea . \n the patient developed right leg edema which extended up to the knee and was accompanied by two distinct ulcers . \n there was no history of chest pain , headache , nausea or vomiting . at the time of admission , the temperature was 37c , pulse was 82 beats per minute , respiratory rate was 14 breaths per minute and he had a blood pressure of 110/80 mm hg . \n physical examination revealed no abnormalities except for right leg edema which extended up to the knee and was accompanied by two distinct ulcers ( figures 1 and 2 ) . \n right leg edema and ulcer containing a \n worm . \n \n no rash or lymphadenopathy were noted . \n the levels of serum electrolytes , amylase and lipase were normal , as were the results of urinalysis and liver function studies . \n stool cultures were negative for enteric pathogens , protozoa and helminths . \n \n microscopic examination of the stool disclosed an excessive number of undigested muscle fibers and abundant yeasts ; no protozoa or helminthic ova were found . \n upper - gastrointestinal endoscopy showed a normal esophagus , striped erythematous mucosa in the distal esophagus consistent with reflux esophagitis , a normal duodenum and normal stomach . \n colonoscopy showed a soft - tissue mucosal lesion in the rectum which was determined to be a worm that extended into the lumen of the rectum with no bleeding ( figures 3 and 4 ) . \n \n a worm extending into the lumen of the \n rectum . \n after extraction of the worm from the mucosa and biopsy specimen obtaining the pathology was positive for inflammatory infiltration of an intermediate density in the rectum with nonviable microfilaria in the rectal glands . \n the species of the microfilaria could not be exactly identified , but was probably w. bancrofti . upon detailed questioning of the patient s relatives , it was undetermined whether the patient had been outside of iran in recent years . \n an ultrasonographic examination of the abdomen showed a normal texture liver and that the intrahepatic ducts and common bile duct were of normal diameter . \n a two week course of albedazole was prescribed . during the first 48 hours after medication , the patient reported improvement and his right leg edema disappeared . \n they do not lay eggs , but constantly produce enormous numbers of larvae ( microfilariae ) in humans . \n human - to - human transmission occurs via insects : the parasites are thus arthropod - borne . \n animal reservoirs play no role of significance in most places , except in subperiodic brugia malayi . \n the disease produced by a filarial worm depends on the tissue location preferred by adults and microfilariae . \n the adults of the lymphatic filariae inhabit lymph vessels , where blockage and host reaction can result in lymphatic inflammation and dysfunction , and eventually in lymphedema and fibrosis . \n other filariae mature in the skin and subcutaneous tissues , where ey induce nodule formation and dermatitis ; migrating filariae of these species can cause ocular damage . \n \n in this case presentation , \n as with most helminth infections , the adult parasite does not replicate within the human host . \n thus , the adult worm burden ( as opposed to the microfilarial burden ) can not increase once an individual is no longer exposed to infective larvae , such as after leaving an endemic region . \n since mosquito vectors are not efficient transmitters of filariasis , a relatively prolonged stay in an endemic area is usually required for the acquisition of infection . \n travelers and expatriates do not usually have sufficient exposure to filariasis to develop the chronic complications of infection that are seen with high worm burdens . \n rather , these individuals can demonstrate an allergic - type reaction to developing larvae that rarely occurs in endemic persons . \n this is the first case of filariasis reported in a patient with recurrent gastrointestinal bleeding . in the literature \n an allergic proctitis due to microfilaria may have caused the ulceration and bleeding in our case . \n even rare , parasitic diseases should be taken into consideration in the differential diagnosis of recurrent gastrointestinal bleeding conditions in our area . \n ", "role": "user" }, { "content": "a 56 year - old man with recurrent gastrointestinal bleeding is reported . \n the patient had constant crampy pain in his epigastrium , right upper quadrant and periumbilical area . \n upper - gastrointestinal endoscopy was normal . \n colonoscopy showed a soft - tissue mucosal lesion in the rectum which was determined to be a worm that extended into the lumen of the rectum with no bleeding . \n the pathology was microfilaria in the rectal glands . \n filariasis should be taken into consideration in the differential diagnosis of recurrent gastrointestinal bleeding conditions in our area .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: asthma and atopic diseases continue to increase in prevalence in westernized countries ; however , the cause for this rise remains unknown . \n while many hypotheses have been proposed , research continues into the mechanism(s ) that drive the development of atopic disease . \n one potential hypothesis that has been proposed is that viral infections drive the development of atopy and atopic disease \n . this may be somewhat counterintuitive , as antiviral immune responses are primarily interferon mediated and viewed as a prototypical th1 immune response . \n nonetheless , it is well documented that viral infections can aggravate asthma and induce development of asthma and atopic disease , that is , classic th2 diseases . \n dendritic cells ( dcs ) , with their unique position bridging the adaptive and innate immune systems , are key resident immune cells in the interplay between viral infections and atopic disease . \n dcs are crucial to the initiation of the adaptive immune response and are uniquely able to condition th differentiation . \n this paper focuses on data supporting a connection between viruses , ige , and atopy and the critical importance of resident lung dendritic cells in translating a viral illness into atopic disease . \n shortly after the discovery of ige , it was noted that acute viral infections could drive ige production both virus specific and nonspecific [ 36 ] . \n although a correlation was noted , the mechanistic reason for this increase ( or for the role of ige in viral illnesses , for that matter ) remained unknown . \n nonetheless , the association of ige elevation and the similarity of symptoms between a viral upper respiratory tract infection and allergic rhinitis led some investigators to suggest a possible causative link between viral infections and atopic disease . \n the first study to hint at this was published in 1979 , when frick et al . \n studied 13 children from atopic families to see if and when they developed atopic disease . in this small study , 11 of the children \n were noted to have upper respiratory tract infections in the 1 to 2 months prior to initial development of allergic sensitization . because of this association \n several other investigators have also documented associations in humans and mice between viral - induced ige and atopic disease [ 2 , 8 , 9 ] . \n probably the strongest associations connecting viral infections to atopic disease have been found in studies looking at the development and exacerbation of asthma . \n the virus most often associated with atopic disease is respiratory syncytial virus ( rsv ) , a single - stranded rna paramyxovirus that is a major pathogen in the northern hemisphere in the midwinter months and infects nearly all children by 2 years of age [ 11 , 12 ] . \n while most children get this infection early in life , a subset of infants ( primarily in the 2- to 6-month age range ) who become infected with rsv develop a severe bronchiolitis requiring hospitalization . \n . showed that after viral infection these individuals were left with an increased risk for developing asthma ( odds ratio [ or ] , 12.7 ) , as well as allergic sensitization ( or , 2.4 ) . \n more recently , wu et al . reported that a large unselected retrospective cohort of children born 4 months prior to the peak of rsv season had both the greatest risk of hospitalization for lower respiratory tract illness and the greatest risk of asthma between 4 and 5 years of age . \n this study again supports the idea that a severe rsv infection requiring hospitalzation is associated with the development of atopy . \n it has been suggested that the risk of atopy is not from the viral infection but instead is a result of an immune alteration that allows for reduced antiviral immunity . \n in fact , some investigators have shown that individuals with atopic disease have reduced production of ifn- from a subset of their dendritic cells , which may predispose them to a weaker anti - viral immune response [ 1719 ] . \n if the risk of atopic disease was not imparted by the viral infection , then reducing the severity of the infection with an anti - viral would be expected to have no effect on the subsequent development of atopy . \n interestingly , the use of a monoclonal antibody directed against an epitope in the a antigenic site of the f protein of rsv ( palivizumab ) as prophylaxis against rsv in preterm infants , significantly increased the time to the first episode of recurrent wheeze and physician - diagnosed recurrent wheeze ( hazard ratio ( hr ) = 0.46 ) . \n furthermore , in a study of 175 patients who had acute rsv in which some received ribavirin and some did not , the rates of physician - diagnosed wheezing were decreased , as was the rate of allergic sensitization in the group that received the antiviral medication . \n together , these studies suggest that the prevention or early treatment of viral infections may be able to prevent subsequent development of asthma and atopic disease . \n it is important to note that not all studies have shown a risk of rsv infection and atopy . \n for example , the tucson children 's respiratory study includes more than 800 children with documented rsv infection in infancy . \n however , unlike the study by stein et al . , these infections were not severe enough to require hospitalization . \n these children have been followed longitudinally for the development of asthma and other atopic diseases . and while rsv infection was shown to increase the risk of wheezing early in life , it was a transient risk , disappearing between 10 and 13 years of age . \n another virus associated with atopic disease is human rhinovirus ( hrv ) , a nonenveloped , single - stranded rna virus of the family picornaviridae . \n on the basis of the sheer number of viral exposures , hrv is an important pathogen in the development of acute bronchiolitis in infants . \n in contrast to the seasonal nature of rsv , hrv infections occur throughout the year and are the main cause of bronchiolitis leading to hospitalization in infants outside of the winter months . \n children hospitalized with hrv tend to be older than those infected with rsv and are more likely to have a prior history of wheezing . \n these children often have more atopic risk factors , eczema , allergic sensitization , and parental asthma than do the rsv children [ 24 , 25 ] . \n this difference , however , may simply relate to the ages of the infected children rather than to a specific effect of the virus . \n similar to rsv , kotaniemi - syrjnen et al . reported that children that were hospitalized with wheezing from hrv during the first 2 years of life were at increased risk of childhood asthma ( or 4.14 ) when compared to children hospitalized for wheezing with other viruses . \n furthermore , in a tennessee cohort of 90,000 children , an increased risk of asthma was found in children with episodes of bronchiolitis during nonwinter months . additionally , those with bronchiolitis during a month associated with higher rhinovirus exposure had a 25% greater risk of developing childhood asthma than those who developed infections during months where rsv was the primary cause of bronchiolitis . \n two birth cohort studies have identified outpatient hrv wheezing illnesses as important predictors of childhood asthma development as well . \n the childhood origins of asthma ( coast ) study examined a high - risk ( 1 parent with asthma or allergy ) birth cohort of suburban children . \n this study showed that a symptomatic hrv infection was the most important risk factor for development of wheeze by age 3 and asthma by age 6 ( or , 25.6 ) . \n the association of wheezing with prior hrv infection was stronger than that with rsv or any other viral pathogen . \n the coast study involved a multivariate analysis that attempted to correct for other factors , such as pets , older siblings , participation in day care , breastfeeding , atopic dermatitis , and the presence of food - specific ige . \n further analysis of cytokine profiles in this cohort suggested that children with impaired th1 responses ( decreased release of interferon- ( ifn- ) from cord blood monocytes ) had increased numbers of viral infections in the first year of life . \n ( i.e. , type ii ifn ) plays in the development of atopic disease ( as opposed to ifn- ) . in a similar high - risk birth cohort in australia , \n kusel et al . examined the risk of wheezing at 5 years of age in 198 patients who were at high risk of developing asthma . \n these patients were enrolled as infants , monitored for respiratory infections , and had periodic checks for the development of asthma and atopy . at 5 years of age , \n the patients with current wheeze and asthma had a history of higher rates of respiratory infections with hrv or rsv . \n this association between viral infection and asthma was limited to the subgroup of patients who had developed allergic sensitization before 2 years of age suggesting a role between early - life viral infection and development of allergic sensitization . \n indeed , we have previously proposed that the ability of viruses to drive an atopic risk is limited to the first couple of years of life , after which viruses are more prone to exacerbate existing disease rather than lead to the development of new atopy . \n as in studies of rsv and asthma , there is conflicting data concerning the causal role of viral infection and atopy . \n recent statistical modeling of data from the coast cohort claims that sensitization to aeroallergen primarily precedes any rv - associated wheezing , arguing against viral infection being causative in subsequent aeroallergen sensitization . \n it should be noted that the statistical model used for this study assumed continuous monitoring of both wheezing and sensitization . \n however , the cohort was only continuously monitored for wheezing and monitored annually for sensitization to aeroallergens . \n consequently , while this study supports the findings from the australian cohort , it does not fully refute the possibility that viral infection could be causative in initial allergic sensitization . \n the mechanism(s ) that might be responsible for translating these viral infections into atopic disease have only recently begun to be elucidated . \n it is interesting that in a mouse model there is a critical role for anti - viral ige in the translation of the viral immune response into atopic disease , and this route is dependent upon the function of specific resident dendritic cells in the airway [ 2 , 78 ] . \n dendritic cells ( dcs ) represent an important class of resident lung cells that are involved in initiating the immune response . \n while the nomenclature differs slightly between mouse and human , the knowledge and understanding gained from mouse dcs has led to better understanding in the human . in the mouse , \n dcs have been divided into two broad subtypes conventional dendritic cells ( cdcs ) and plasmacytoid dendritic cells ( pdcs ) . \n the cdcs are the major antigen - presenting cells in the body , whereas pdcs are major producers of the cytokine interferon- ( ifn- ; type 1 ifn ) and to a lesser extent il12 [ 35 , 36 ] and have been shown to play an important role in modulating immune responses as opposed to initiating them [ 3742 ] . \n the cdcs express high levels of the integrin cd11c , whereas the pdcs express siglec - h , ly6c , and b220 , but low levels of cd11c . however , there is some confusion in the literature over identification of cdc , since other cell types can express cd11c . \n recently , the zinc finger transcription factor zbtb46 was shown to be specifically expressed in human and mouse cdcs [ 43 , 44 ] . in the future \n conventional dcs can be further subdivided based on expression of the integrins cd103 and cd11b . \n cdcs expressing cd103 ( cd103 cd11b ) , the e integrin , are resident cells found at mucosal sites under homeostatic conditions and are associated with the respiratory epithelium . \n these cells project their dendritic extensions between epithelial cells , allowing them to directly sample content of the airway lumen , and have been termed the intraepithelial subset . \n cd11b expressing cdc ( cd103 cd11b ) , on the other hand , is associated with inflammatory stimuli and is found in the respiratory tract during ongoing activation of the immune response [ 4648 ] . in humans , \n myeloid dendritic cells ( mdcs the equivalent of mouse cdcs : cd11c+cd11b+gr1b220 ) and pdcs ( cd11c+cd11bgr1+b220 + ) . \n lung dcs in humans have been harder to characterize due to a lack of validated markers and the difficulty in obtaining human lung tissues for investigation ; however , as mentioned , the novel transcription factor zbtb46 is a robust marker of human cdc and will likely help clean up the identification of human dc subsets in the future [ 43 , 44 ] . \n dendritic cells are found throughout the lung and the entire respiratory tract epithelium , including the nose , nasopharynx , large conducting airways , bronchi , bronchioles , and alveolar interstitium [ 45 , 50 , 51 ] . \n these cells form an intricate cellular network just below the epithelial cell layer [ 52 , 53 ] . \n their location and number underlie their function as sentinels and primary responders to potential pathogens . \n it has been estimated that there are between 400 and 800 resident dendritic cells per mm of epithelial surface in the rat airway . in the absence of antigen , \n airway cdcs rapidly turnover , with an estimated 85% of the cell population changing every 3648 h ; antigen exposure greatly increases this emigration . in the rat \n , it is estimated that the half - life of lung dendritic cells ranged from 1.52 days in the airway to 3 - 4 days in the periphery of the lung both of which are much less than the 9 days or more in skin [ 55 , 56 ] . \n classically , cdcs ingest foreign proteins primarily through attachment of pattern recognition receptors , such as immunoglobulin ( fcr ) , carbohydrate ( mannose receptor ) , complement ( cr3 ) , and toll - like receptors ( tlrs ) . once bound and ingested by pinocytosis , \n these peptides then merge with a major histocompatibility complex ( mhc ) class ii containing vesicle . \n this allows the peptides to bind to the mhc class ii molecules and be exported to the surface , where they are presented to t cells . \n however , most anti - viral immune responses are cd8 dependent and require presentation of antigen in the context of mhc class i. while some viruses can directly infect dendritic cells ( e.g. , herpes simplex virus , vaccinia virus , and measles virus ) leading to presentation in mhc class i molecules , most do not appear to directly infect the dendritic cell [ 5760 ] . to take up virus without being directly infected and yet express in it terms of mhc class i \n for example , human immunodeficiency virus , cytomegalovirus , ebola virus , dengue virus , and hepatitis c virus are all capable of binding to a c - type lectin , a specific intercellular adhesion molecule nonintegrin on dcs known as dc - sign . since many viruses do not have known receptors and can not directly infect dendritic cells , the cell must also ingest virally infected cells ( and virus ) from the extracellular environment to obtain viral proteins to process . \n then , through a process known as cross - presentation , the cdc is able to place the viral peptides in the context of mhc class i ( rather than just mhc class ii ) . \n it appears that cross - presentation ( i.e. , expressing extracellular peptides in the context of mhc class i ) is a regular occurrence in dcs , even in the absence of an inflammatory insult . \n in fact , in this situation , it often initiates tolerance especially if it occurs in the absence of dendritic cell activation [ 63 , 64 ] . \n however , in viral infections , the inflammatory response rapidly leads to activation of cdcs , and the cross - presentation pathway leads to a productive immune response . in the case of influenza or parainfluenza \n , it has been shown that pulmonary dcs rapidly become activated and migrate to the draining lymph node [ 65 , 66 ] . within 6 hours of exposure to the virus , \n interestingly , this dc response in the lymph node seems limited to the first inflammatory antigen encountered in the lung . \n plasmacytoid dcs are thought to play a major role in the antiviral immune response through production of ifn- and are rapidly recruited to the airway during respiratory tract viral infections [ 66 , 67 ] . \n the airway normally contains a much lower frequency of pdcs , although the numbers of pdcs may be influenced by genetic factors . in a mouse model of viral respiratory infection , few pdcs \n are noted within the lung parenchyma at baseline , but with viral inoculation pdcs are rapidly recruited from the bone marrow and , within several days , comprise a majority of dcs in the virally infected lung [ 66 , 69 ] . through production of ifn- , \n the pdcs are capable of skewing the immune system toward a predominantly th1 antiviral immune response . \n , it was shown that depletion of pdc from rv - stimulated peripheral blood mononuclear cell ( pbmc ) cultures led to markedly inhibited ifn- secretion and to a significant increase in expression and skewing toward production of th2 cytokines . in short , while the pdc population is responding directly to the lung insult , the cdcs that have ingested the invading organism are maturing in the draining lymph node and presenting antigen to t cells . \n despite the fact that most inhaled antigens are transported to the lymph nodes by lung - derived dcs , the usual outcome following the inhalation of harmless protein antigen is the induction of tolerance . \n infected mice with enough influenza virus to cause pneumonia ; the mice were subsequently sensitized to aerosolized ovalbumin ( ova ) associated with aluminum hydroxide adjuvant following the infection . \n influenza infection prior to allergen sensitization resulted in elevated ova - specific ige levels provided that the ova exposure occurred during the acute infection on days 26 after inoculation ( p.i . ) . \n further studies confirmed these observations with additional allergen challenge 3 - 4 weeks after primary sensitization [ 72 , 73 ] . \n moreover , yamamoto et al . reported a transient increase in airway dcs from day 2 to day 5 of influenza infection . in mice sensitized to ova aerosol at the time of infection , the increase in dc number persisted for up to 5 weeks and \n the authors concluded that recruitment of dcs to the airways during influenza infection may have contributed to enhanced sensitization to aeroallergens . \n similar , to influenza , mice infected with rsv which were exposed to non - viral antigens ( ragweed and ova ) with or without alum adjuvant from day 4 to day 8 p.i . were found to produce greater levels of allergen - specific antibodies in serum ( ige and igg ) and bronchoalveolar lavage ( bal ) fluid ( iga and igg ) than mice that were not infected with the virus [ 74 , 75 ] . \n sendai virus ( sev ) , the murine parainfluenza virus type 1 , is a paramyxovirus and natural rodent pathogen . in a strain - dependent fashion , mice which survive a severe sev infection \n develop chronic airway hyperreactivity and il-13-dependent mucous cell metaplasia , similar to human infants infected with rsv . \n we have shown that this translation of viral to atopic disease requires an inf--dependent accumulation of cd49d polymorphonuclear neutrophils in the lung , which in turn induces resident lung cdc to express the high - affinity receptor for ige ( fcri ) . \n expression of fcri on lung cdcs and the subsequent production of anti - sev ige were required for the development of postviral atopic disease . \n in fact , we and others were able to show that crosslinking fcri on the lung cdc led to production of ccl28 and subsequent recruitment of il-13 producing th2 cells in an antigen nonspecific fashion [ 78 , 79 ] . \n further , we have shown that a single exposure to a nonviral antigen ( ova ) during an active anti - viral immune response is sufficient to drive significant and marked ige production against the non - viral antigen . \n unlike previous reports with rsv or influenza , the development of ova - specific ige during an sev infection did not require the use of an adjuvant . a subsequent challenge with the antigen alone led to augmented airway hyperreactivity and mucous cell metaplasia , demonstrating the development of atopic disease , as a result of a severe respiratory viral infection . \n while these initial observations were made in mice , we have documented that the cdc fcri - ccl28 axis appears operative in humans . \n further , it has been shown that expression of fcri on human peripheral blood cdc is increased by respiratory viral infection . however , unlike in the mouse , human cdcs appear to express fcri from birth , although the regulation of its expression does appear to be quite complex with low levels of ige having less of an effect on fcri levels compared to higher ige concentrations . therefore , while not completely validated in the human , critical portions of the cdc fcri - ccl28 pathway appear intact in both mouse and man and begin to provide us with one mechanistic explanation for the translation of viral into atopic disease . \n the process of inhalational tolerance is also influenced by pdcs , and there are good studies to suggest that these cells also play a role in the development of postviral atopic disease . in mice \n in which pdcs were depleted , rsv infection led to greater disease with increased viral titers and airway inflammation , as well as postviral airway hyperresponsiveness [ 69 , 82 ] . \n this outcome is consistent with the need for effective ifn- production to control the infection and the fact that pdcs are a major cellular source of ifn- during a viral infection . \n therefore , a reduction in the ability to release ifn- could be a risk for developing atopic disease . \n in fact , studies of pdcs from peripheral blood and bronchoalveolar lavage ( bal ) have documented that patients with allergic asthma have diminished influenza - induced and rhinovirus - induced ifn- secretion , respectively , from pdcs when compared with healthy control subjects [ 19 , 83 ] . \n . also found a similar impairment of ifn- responses in pdcs from allergic subjects after stimulation with oligodeoxynucleotide - containing unmethylated cpg motifs ( tlr9 agonist ) . \n interestingly , there appears to be a counterbalance in human pdc when it comes to ige- and tlr9-mediated ifn- production . \n cross - linking fcri on human pdc was associated with reduced tlr9 expression and subsequent ifn- production from a tlr9 agonist , while exposure to a tlr9 agonist first led to reduced expression of fcri in the cells . \n furthermore , in an analysis of children from the coast cohort , fcri expression on pdcs was inversely associated with hrv - induced ifn- and ifn-1 production . \n the allergic asthmatic children in this study had higher surface expression of fcri on pdcs , and after fcri cross - linking , they had significantly lower hrv - induced ifn responses than the allergic nonasthmatic children . \n while the exact role viruses play in the overall development of asthma and atopic disease remains controversial , the data are compounding to suggest that resident lung cdc and pdc play a critical role in this process . specifically , as shown in figure 1 , cdcs play a major role in both aeroallergen sensitization and in recruiting th2 cells in an ige - dependent fashion . \n these th2 cells then lead to the development of postviral atopic disease with subsequent ige production leading to spreading of allergic sensitization ( something we have referred to as an atopic cycle ) . \n likely it is the combination of a reduced pdc ifn- response in the presence of an activated cdc - fcri - ige - ccl28 axis that leads to the development of postviral atopic disease . \n of course , it is also quite likely that an individual 's genetic factors contribute to their overall response to the viral infection , further complicating studies exploring the risk of atopic disease and viral infection . \n nonetheless , these studies have provided insights that will help to guide future therapeutic interventions to alter the pulmonary resident dc response and prevent the translation of viral into atopic disease . \n in fact , we hope it will not be long before infants who have severe viral infections will be treated with medications designed to block the development of postviral atopic disease .", "role": "user" }, { "content": "dendritic cells are important residents of the lung environment . they have been associated with asthma and other inflammatory diseases of the airways . in addition to their antigen - presenting functions , \n dendritic cells have the ability to modulate the lung environment to promote atopic disease . while it has long been known that respiratory viral infections associate with the development and exacerbation of atopic diseases , the exact mechanisms have been unclear . \n recent studies have begun to show the critical importance of the dendritic cell in this process . \n this paper focuses on these data demonstrating how different populations of dendritic cells are capable of bridging the adaptive and innate immune systems , ultimately leading to the translation of viral illness into atopic disease .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 60-year - old female presented with gradual , progressive , painless diminution of vision and mild protrusion of the left eye since the last 7 years . on clinical examination , her visual acuity was 20/30 in the right eye and no perception of light in the left eye . \n systemic examination also was within normal limits with no evidence suggestive of neurofibromatosis type 2 . \n left eye esotropia and proptosis of left eye total optic atrophy in left eye post - contrast t1-weighted axial magnetic resonance imaging ( mri ) with fat saturation showed a well - defined mass encasing the orbital portion of the left optic nerve showing bulbous enlargement at the apex with distal tubular enlargement [ fig . 3 ] . \n also , there was intracranial extension through the left optic canal into the suprasellar cistern involving the optic chiasma and the left cavernous sinus . \n there was a similar mass surrounding the intraorbital , intracanalicular , and intracranial part of the right optic nerve in a tubular fashion extending up to the optic chiasma . \n both the masses showed intense heterogeneous enhancement with central relatively lesser enhancement of the optic nerve , producing the tram - track sign . \n non - contrast computed tomography ( ct ) brain and orbit showed areas of calcification around both optic nerves and optic chiasma [ fig . \n ( a ) computed tomography brain and orbit showing calcification around both the optic nerves.b - c ) magnetic resonance imaging brain with orbit showing optic nerve sheath meningioma having intraorbital , intracanalicular , and intracranial involvement on both sides . \n ( d ) mri brain with orbit post - contrast showing suprasellar cistern and left cavernous sinus involvement in our patient , surgical intervention did not appear to be a wise choice because of the extensive nature of involvement . \n since total optic atrophy had already developed in the left eye , preservation of vision of the right eye was of prime importance . \n the patient was hence advised fractionated radiation therapy , that too preferably stereotactic or conformal type as these are better than the conventional form . \n primary onsms arise from meningoepithelial cap cells of the arachnoid villi and can develop at any location along the entire course of the optic nerve sheath . \n secondary onsms may arise from tissues outside the orbit , namely the cavernous sinus , falciform ligament , clinoid processes , sphenoid wing , pituitary fossa , planum sphenoidale , tuberculum sellae , frontotemporal dura , and/or olfactory groove ; and secondarily grow into the optic nerve sheath . \n dutton reported the mean age at presentation of onsm patients to be 40.8 years ( 42.5 years in women and 36.1 years in men ; range 380 years ) , with 61% of the patient population being female . \n only 5% of onsms present bilaterally , and 65% of these bilateral lesions are intracanalicular . \n approximately 50% of the patients who present with bilateral onsms also have tumors along the planum sphenoidale in continuity with these lesions , a finding that raises questions about the true origin of bilateral onsms . \n bilateral and multifocal presentations of onsms are most commonly found in patients with neurofibromatosis type 2 . as onsms progress , it is thought that they compromise optic nerve function mainly by mass effect on the pial vasculature which induces ischemic changes as well as interferes with axonal transport in the nerve . \n patient may present with classic triad of visual loss , optic atrophy , and the presence of opticociliary shunt vessels on the disc . \n fundus examination almost always demonstrates a pathological appearance of the optic disc , which may consist of disc edema suggesting some manifestation of a compressive optic neuropathy or frank optic atrophy . \n once the diagnosis of an onsm is suspected , the diagnosis can usually be established using mri or high - resolution ct scan . \n the characteristic features of onsms include the presence of calcification surrounding the nerve along with different radiographic growth patterns : tubular , globular , fusiform , and focal . \n definitive treatment of onsms is challenging because of the lesions intimate circumferential relationship with the optic nerve and its vascular supply . \n this could be due to excision of the tumor along with the affected optic nerve intraoperatively or damage to the pial vasculature . \n conservative management is indicated if there is no significant progressive visual dysfunction , or intracranial extension of the tumor . \n recently , it has been highlighted by miller that surgery to remove an onsm is rare if ever indicated and radiation is the optimum therapy . also turbin et al . \n , from his comprehensive study of comparison of various treatment options for onsm concluded that fractionated radiation beam therapy was preferable over surgery or conservative approach of management especially when preservation of vision was of prime importance as is the case in our patient . \n the above reported case of secondary onsm involving the left cavernous sinus , optic chiasma and intracranial , intracanalicular as well as intraorbital portions of both the optic nerves is rare because it is bilateral and showed different growth patterns on the two sides , being tubular on the right and fusiform on the left side . \n we recommend considering onsm as one of the differential diagnosis in a case of very slowly progressive unilateral optic neuropathy especially when presenting along with proptosis .", "role": "user" }, { "content": "a 60-year - old female presented with gradual , painless , progressive diminution of vision , and progressive proptosis of left eye since 7 years . \n ophthalmological examination revealed mild proptosis and total optic atrophy in the left eye . \n magnetic resonance imaging ( mri ) and computed tomography ( ct ) brain with orbit showed bilateral optic nerve sheath meningioma ( onsm ) involving the intracranial , intracanalicular , intraorbital part of the optic nerve extending up to optic chiasma and left cavernous sinus .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: ionotropic glutamate receptors \n ( iglurs ) are a family of ligand - gated ion channels located on the postsynaptic \n neural membrane which open in response to extracellular binding of the neurotransmitter glutamate . \n these \n receptors play an important role in memory , learning , development , and neu - ral \n plasticity . as such , \n their misregulation has been implicated in a number of \n disease states such as the ischaemic stroke cascade , schizophrenia , epilepsy , \n and alzheimer 's , huntington 's , and parkinson 's disease . the functional unit of each member \n of the iglurfamily ( nmda , ampa , and kainate receptors ) is a tetramer ; \n homotetramer for ampa and kainate receptors and heterotetramer , composed of nr1 \n ( one of eight alternatively spliced versions ) and nr2 subunits ( one of four \n versions encoded by four different genes ) for nmda receptors . \n subunits from any \n of these family members are modular in nature , containing seven domains : an \n amino terminal domain ( atd ) important for the interaction between subunits , a \n nonsequential extracellular s1s2 neurotransmitter binding do main , three \n membrane spanning domains , a re - entrant loop which forms the pore of the ion \n channel when the tetramer is assembled , and an intracellular c - terminal tail . soluble extracellular glur2 ( ampa ) and nr1 - 1b ( nmda ) s1s2 domains have \n been constructed \n by eliminating all three transmembrane \n spanning regions plus the re - entrant loop and linking the s1 and s2 domains by two \n amino acids ( gt ) [ 14 ] . \n these s1s2 domains have been shown to possess \n near native binding affinities for both agonists and antagonists and their \n structures have been studied by x - ray crystallography ( figure 1 ) [ 14 ] . in the \n past twenty years , there has been an accumulation of data suggesting that \n iglurs are also involved in the mechanism of action of antidepressants . \n this is \n a de - parture from the idea that antidepressants function solelyby either \n inhibiting monoamine oxidase ( maois ) or the serotonin or norepinephrine \n transport proteins ( tcas , ssris , or snris ) . \n data linking iglurs to \n antidepressant activities include experiments demonstrating direct binding of tricyclic \n antidepressants to the extracellular s1s2 region of ampa receptors [ 5 , 6 ] , open channel block of nmda receptors \n by antidepressants [ 7 , 8 ] , and altered expression and phosphorylation of ampa \n receptors by antidepressants [ 9 , 10 ] . in \n addition \n , ampa receptor potentiators and nmda receptor antagonists have been \n shown to have antidepressant - like effects [ 9 , 1113 ] . \n this data has led to the suggestion that \n increased activity of ampa receptors leads to an increase in the expression of \n brain derived neurotrophic factor ( bdnf ) , which in turn promotes \n neurogenesis in the hippocampus , leading to antidepressant activities . \n the intrinsic and \n extrinsic fluorescence studies presented here add to the body of knowledge suggesting \n a role for nmda receptors in antidepressant activities . \n specifically , they demonstrate \n that five tricyclic antidepressants ( tcas ) ( desipramine , trimipramine , \n maprotiline , nortriptyline , and imipramine ) , four selective serotonin reuptake \n inhibitors ( ssris ) ( fluvoxamine , paroxetine , sertraline , and fluoxetine ) , and \n one selective norepinephrine reuptake inhibitor ( snri ) ( venlafaxine ) , see \n figure 2 , bind to the s1s2 domain of the nr1 - 1b subunit of the nmda receptor . \n the only antidepressant that showed no binding in any of our studies , at \n concentrations as high as 5.21 mm , was the ssri citalopram . \n the cloning \n plasmid for the nmda nr1 - 1b s1s2 domain , provided by eric gouaux ( oregon health \n and scienceuniversity ) , was chemically transformed \n into e. coli origami b(de3 ) cells . \n the expression system was designed as follows : ( his)8-tsg - lvprg(thrombin \n cut site)-s1(394 - 544)-gt - s2(663 - 800 ) . expression and purification of nmda \n all \n emission scans were acquired from 300 to 400 nm upon excitation at 290 nm , with \n 10 nm excitation and emission slit widths in a 10 mm - path - length cell . \n excitation \n was performed at 290 nm to minimize interference from both tyrosine residues in \n the nmda nr1 - 1b s1s2 domain as well as the aromatic antidepressants being \n studied . before data acquisition \n analysis of the buffer emission signal showed that \n it contributed less than half a percent to the fluorescence intensity of the \n nr1 - 1b s1s2 domain . \n protein samples \n were at a final concentration of 5.29 m in buffer 3 ( 10 mm mes , ph 6.5 , 25 mm \n nacl , 1 mm glycine ) . \n all antidepressants were solubilized in 100% methanol to \n the highest attainable concentrations . to account for any effects methanol had \n on fluorescence intensity , protein spectra with methanol were collected , \n allowing direct comparison between samples with and without antidepressant . \n each data set consisted of at least three independent emission spectra of \n identically prepared samples . \n the fluorescence intensity of the nr1 - 1b s1s2 domain was determined in the presence \n and absence of eachantidepressant with the appropriate blank subtraction . \n the \n final concentrations of each tca - desipramine , imipramine , trimipramine , \n nortriptyline , and maprotiline were 136.9 m , 136.9 m , 136.9 m , 2.08 mm , and 3.18 mm , \n respectively . \n the final concentrations of each ssri - paroxetine , citalopram , and \n sertraline were 3.75 mm , \n 1.88 m , and 1.88 mm , respectively . \n antidepressants were added to final concentrations as follows : nortriptyline : \n 1.243.61 mm , \n imipramine or desipramine : 8570 m , \n trimipramine : 130570 m , \n sertraline : 0.741.84 mm , fluvoxamine : 0.742.37 mm . \n a double reciprocal plot was used to determine kd , \n which derives from the benesi - hildebrand relationship , provided there is a 1 : 1 \n binding stoichiometry . \n the equation is : 1/f = 1/((f fo)kd[l ] ) + 1/(f fo ) , where fo is the fluorescence intensity in the \n absence of ligand , f is \n the fluorescence intensity with saturating concentration of ligand , f is thefluorescence intensity at some particular [ ligand ] , f is ( f fo ) , and kd is the \n dissociation constant . \n note , this method to determine kd is based on the formation of \n ground state nmda nr1 - 1b s1s2 domain : antidepressant complexes , and could be \n altered by dynamic quenching . \n acrylamide \n ( sigma ) ranging in final concentration from 16.3 to 113.9 mm was added to 5.29 m nr1 - 1b s1s2 premixed with antidepressant ( at final concentrations as above \n for intrinsic quenching studies , with the exception of sertraline which was at \n 0.94 mm ) . \n extrinsic fluorescence studies were performed in a cary \n ec - lipse fluorometer at 25c . \n all emission scans were acquired from 400 to 600 nm after excitation at 380 nm with 20 nm slit widths for emission and \n excitation in a 10 mm - path - length cell . before data acquisition \n blanks were collected both for \n the antidepressants and the nr1 - 1b s1s2 domain . \n 8-anilino-1-naphthalenesulfonic \n acid ( ans , tci america ) , in a 1 : 1 molar ratio , was added to 5.29 m of the \n nr1 - 1b s1s2 domain premixed with antidepressant ( at final concentrations as \n above for intrinsic quenching studies in addition to the ssris fluoxetine ( 8.62 m ) and fluvoxamine ( 2.81 mm ) \n and the snri venlafaxine ( 29.07 m ) ) . as with all intrinsic assays , \n antidepressants ( at final concentrations as above for the \n extrinsic assays , with the exception of sertraline which was added to a final \n concentration of 940 m ) were added to 60 l aliquots of the nr1 - 1b s1s2 domain \n at a final concentration of 5.29 m . \n the nr1 - 1b s1s2 domain / antidepressant complexes \n were allowed to incubate on ice for 5 minutes before trypsin ( sigma : 13500 u / mg ) \n was added to a final concentration of 5.29 m , yielding a 1 : 1 molar ratio of \n protein to trypsin . \n digestion was stopped by the addition of sample loading dye , dtt \n ( 50 mm ) , and incubation at 100c for 10 minutes . \n the environment of the four tryptophan residues in the nmda nr1 - 1b s1s2 domain , \n w498 , w731 , w768 , w792 , can be monitored by fluorescence spectroscopy . \n uponexcitation , the emission maximum ( max ) and fluorescence \n intensity of a tryptophan residue depends upon the polarity of its environment . \n by comparing the emission spectrum ( max and fluorescence \n intensity ) of the apo nmda nr1 - 1b s1s2 domain to antidepressant bound \n complexes , \n it is possible to determine if the antidepressant has bound to the \n s1s2 domain and caused a change in the environment of the nr1 - 1b s1s2 \n tryptophan residues . \n an increase in the polarity of the environment surrounding \n a tryptophan causes an increase in the max of emission and a \n decrease in the fluorescence intensity . the data in figure 3(a ) , which monitors \n the intensity of the tryptophan emission from the nmda nr1 - 1b s1s2 domain shows \n binding of the tcas desipramine ( kd : 730 150 m \n ; for kd data see supplemental \n figures 1s and 2s ) , trimipramine ( kd : 1.09 0.24 mm ) , \n maprotiline , nortriptyline ( kd : 7.36 2.06 mm ) , and \n imipramine ( kd : 830 150 m ) . \n the data in figure 3(b ) \n demonstrates the binding of the ssris paroxetine , \n sertraline ( kd : 240 90 m ) , \n and fluvoxamine ( kd : 6.54 3.48 mm ) . \n these intrinsic fluorescence studies are \n complicated by the fact that paroxetine , sertraline , citalopram , and \n venlafaxine , the former two that showed evidence of binding to the nr1 - 1b s1s2 \n domain , and the latter two that did not , all had relatively high intrinsic fluorescence \n signals in the emission range of tryptophan . to compensate for this , \n lower drug \n concentrations had to be used which reduced the range of workable \n concentrations , proving problematic for kd determination . \n low drug solubility in methanol ( one of the only organics \n compatible with a folded s1s2 domain ) further complicated kd determination for maprotiline and sertraline . based on this intrinsic \n fluorescence quenching data , the only antidepressant which either binds in a unique \n location on the s1s2 domain or causes a unique conformational change upon \n binding is maprotiline , the binding of which increases , rather than quenches , \n the tryptophan fluorescence emission \n . the unique mode of binding of maprotiline \n is further supported by the shift in the maximum wavelength of emission of the maprotiline \n bound s1s2 complex , from 326.24 1.54 nm ( apo ) to 322.04 1.83 nm ( bound ) , \n table 1 . \n this decrease in max and increase in fluorescence emission \n upon binding of maprotiline are consistent with the tryptophan residues being \n in a more nonpolar environment upon complex formation , either due to direct \n contact with maprotiline or to a conformational change upon maprotiline binding \n that places them in a more nonpolar portion of the protein . \n the only other \n ligand which caused a statisticallysignificant shift in max of the \n s1s2 domain is sertraline , which upon complex formation is shifted to 329.07 \n 0 nm ( table 1 ) . \n this increase in max and decrease in fluorescence emission upon binding of sertraline , the tightest \n binding antidepressant used in these studies , are consistent with the \n tryptophan residues being in a more polar environment upon complex formation , \n either due to direct contact with sertraline or to a conformational change upon \n sertraline binding that places them in a more polar or solvent exposed portion \n of the protein . if an antidepressant \n bound to the s1s2 domain of the nr1 - 1b subunit of the nmda receptor , but did \n not change the polarity surrounding the tryptophans or changed them in such a \n way that the results canceled each other out , it would not be possible to \n determine binding from the intrinsic fluorescence studies described above . to \n address this , \n the extrinsic fluor ans was used to probe antidepressant \n binding . upon binding to hydrophobic \n patches on the surface of proteins , the max of ans decreases and its \n emission intensity increases . \n as can be \n seen in figures 4(a ) and 4(b ) , the emission spectrum of ans bound to nr1 - 1b s1s2 \n complexes of desipramine , trimipramine , maprotiline , or nortriptyline was \n significantly different from ans bound to the apo s1s2 domain , confirming the \n binding of these antidepressants . \n again , the uniqueness of maprotiline binding \n is confirmed by the shift in max of the complex . \n no data is \n presented for the ans bound nr1 - 1b s1s2-imipramine complex . in this case , a \n strong , shifted fluorescence signal from the ans , imipramine , buffer blank \n suggested a direct binding of ans to imipramine . \n the three ssris \n that showed binding by intrinsic fluorescence quenching , sertraline , \n paroxetine , and fluvoxamine , all had spectra that were significantly different \n from the apo spectrum , confirming their binding ( figure 4(d ) ) . \n in addition , ans emission spectra confirmed \n the binding of both the snri venlafaxine ( figure 4(c ) ) and the ssri fluoxetine \n ( figure 4(e ) ) , neither of which showed binding in the intrinsic fluorescence \n assays . \n citalopram is the only antidepressant studied which showed no evidence \n of bindingin either the intrinsic or extrinsic assays at concentrations as \n high as 5.21 mm . to probe the \n conformational change elicited upon binding of each of the antidepressants , \n the ability of an external molecule , in this case \n acrylamide , to quench tryptophan fluorescence is monitored in both the apo \n nr1 - 1b s1s2 and in the antidepressant bound nr1 - 1b s1s2 domains . \n the \n stern - volmer constant , ksv , \n defined as the product of the bimolecular collisional constant , kq , and the lifetime of the \n tryptophan residues in the absence of quencher , 0 , is measured . \n the bimolecular collisional constant is \n a measure of the accessibility of acrylamide to the tryptophans with an \n increase in kq equating to an increase in \n accessibility to the fluorophore . if it is assumed that the lifetime of the \n tryptophans do not change upon antidepressant binding [ 1517 ] , then changes in ksv are due to changes in kq and therefore reflect the \n change in accessibility of the tryptophan residues to acrylamide upon antidepressant \n binding . \n the data in table 2 shows that upon binding to any of the \n antidepressants , the accessibility of the tryptophan residues in the s1s2 \n domain to acrylamide increased when compared to the apo protein . within the tcaclass of antidepressants , the conformational change upon \n imipramine / trimipramine bindingappears distinct from that of \n desipramine / nortriptyline binding , whichappears distinct from maprotiline \n binding . in these assays \n , the binding of \n imipramine could not be distinguished from trimipramine , and the binding of \n desipramine could not be distinguished from nortriptyline . within the ssri \n class of antidepressants , \n all conformational changes elicited upon binding to \n the nr1 - 1b s1s2 domain were found to alter the accessibility of the tryptophan \n residues in statistically significant ways . to differentiate the binding of desipramine and \n nortriptyline as well as trimipramine and imipramine to the s1s2 domain of the nr1 - 1b \n subunit \n figure 5 shows that this method was unsuccessful in differentiating \n the conformational changes associated with imipramine ( lane 2 ) and trimipramine \n ( lane 6 ) binding . \n however , it was successful in differentiating the \n conformational changes associated with nortriptyline ( lane 4 ) and desipramine \n ( lane 1 ) binding with the conformational change associated with nortriptyline \n affording much less protection to proteolysis than the desipramine bound \n complex or the apo s1s2 do - main . \n a combination of intrinsic and \n extrinsic fluorescence binding studies , stern - volmer analysis , and protease \n protection assays provides evidence for the binding of five tcas , four ssris , \n and one snri to the nmda nr1 - 1b s1s2 domain . \n data from the ssri class of \n antidepressants supports the hypothesis that the conformational changes \n elicited upon binding to the s1s2 domain are unique . within the tca class of antidepressants , the \n conformational changes of the s1s2 domain upon binding to each drug also appear \n to be unique , with the exception of binding to imipramine and trimipramine . \n structurally , \n the difference between imipramine and trimipramine ( figure 2 ) is the branched \n aliphatic side chain present in trimipramine . \n while it is possible that this \n additional steric hindrance in trimipramine causes it either to bind to a \n unique site or in a unique way to the same site within the s1s2 domain , it is \n also possible that these two drugs have very similar binding to the s1s2 domain \n of the nr1 - 1b subunit . \n none of the studies performed provide evidence of binding of this iglur \n domain to the ssri citalopram . \n perhaps the presence of the nitrile group , \n present in none of the other antidepressants studied , prevents binding to the \n nr1 - 1b s1s2 domain . \n based upon the \n ways in which iglurs have been proposed to interact with antidepressants , this \n direct binding to the extracellular s1s2 domain of the nmda nr1 - 1b subunit may \n fit into the previously observed category of nmda antagonists having \n antidepressant activities [ 9 , 1113 ] . as \n the tcas have been shown to produce open channel block of the nmda receptors , \n however , differentiating antagonist effects from external s1s2 binding and \n open \n channel block will be difficult [ 7 , 8 ] . as \n is the case for open channel block , for direct binding of antidepressants to \n the nmda nr1 - 1b s1s2 domain to play a major role in the mode of action of these \n drugs , the differences in their binding affinities ( kd range \n 0.247.36 mm ) , and typical therapeutic plasma concentrations ( 0.171 m ) , \n will need to be resolved [ 7 , 8 , 18 , 19 ] . part \n of this solution may lie in the fact that while these isolated iglur s1s2 \n domains have been shown to possess near native binding \n affinities for both agonists and antagonists in vitro , their in vivo interactions \n with antidepressants could be quite different [ 13 , 2022 ] .", "role": "user" }, { "content": "the targets for tricyclic antidepressants ( tcas ) , selective serotonin reuptake inhibitors ( ssris ) , and selective norepinephrine reuptake inhibitors ( snris ) are known to be the serotonin and norepinephrine transport ( reuptake ) proteins which are embedded in presynaptic nerve terminals and function to bring these neurotransmitters from the synaptic cleft back into the presynaptic neuron . using a combination of intrinsic and extrinsic fluorescence quenching , stern - volmer analysis , and protease protection assays \n , we have shown that therapeutics from each of these three classes of antidepressants bind to the extracellular s1s2 domain of the nr1 - 1b subunit of the nmda receptor . \n these results are in agreement with recent work from our lab demonstrating the interaction of antidepressants with the s1s2 domain of the glur2 subunit of the ampa receptor , another member of the ionotropic glutamate receptor subfamily , as well as work from other labs , and continue the discussion of the involvement of ionotropic glutamate receptors in depression .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: common stressors in the workplace include long work hours , workload pressure , feelings of lack of control , and poor workplace support . \n failure to cope with work - related stressors causes a broad range of distressing consequences , such as abnormal heart rate , substance dependence , and depressive mood , which are in turn associated with cardiovascular disease and mental illness . \n additionally , work stress contributes to increased sick leave and lowered work performance resulting in a considerable economic burden . \n undertaking psychotherapy , which includes behavioral therapy , cognitive behavioral therapy , psychoanalysis , and psychodynamic psychotherapy , has proved to be an effective strategy to cure psychological symptoms . \n furthermore , it has been shown that mental health interventions are significantly effective in reducing economic burdens resulting from work stress , even when we take into account the cost of the psychological treatment . \n thus , seeking help from mental health services and getting professional support could be an effective way of dealing with work stress . \n however , the majority of those who suffer psychological problems do not utilize mental health services despite the increasing awareness and improvement of mental healthcare in the workplace in recent years . \n moreover , the utilization of mental health services among employees has been found to be even lower when compared to non - employees , including unemployed individuals , students , and retired individuals . \n previous studies show that only 20% of employees who suffer from major depressive disorder receive adequate treatment in the u.s . , and similar results were obtained in european studies and asian populations . \n similarly , very few employees utilize adequate medical services in japan , while more than 50% of them suffer from severe work stress . \n moreover , neither the rate of employees who suffer from work stress nor the usage of mental health services has improved , in spite of an increase in mental healthcare access in working environments in recent years . in other words \n , there seems to be a gap between service improvement and continued underutilization , which needs to be filled by facilitating help - seeking toward mental health services by employees . in investigating help - seeking toward mental health services , \n numerous studies have examined attitudes toward seeking professional psychological help , the major predictors of help - seeking behavior . \n attitudes toward seeking professional psychological help : a shortened form ( atspph - sf ) is a well standardized and most widely used scale , which consists of ten items and one factor . on the other hand , \n the recent study has indicated the scale with a two - factor structure , atspph - sf consists of \" openness to seeking treatment for emotional problems \" and \" value and need in seeking treatment \" . \n studies have shown that employees ' emotional openness is influenced by the support climate of workplace , and personal values are interrelated with organizational values . \n these findings imply that perceived support or workplace climate , rather than the availability of services , has great influence on seeking psychological help . \n workplace mental health climate ( wmhc ) or \" shared social attitudes and norms towards mental health among organization members , \" is a scale that measures mental health care and climate in the workplace from the employees ' viewpoint , based on the theory that an organizational climate is composed of the aggregation of individual psychological climates . \n wmhc consists of three factors : evaluation of services , risk for career disadvantage , and understanding mental health . \n of those three , evaluation of services : \" cognition and evaluation of mental health care effort in the workplace , \" and risk for career disadvantage : \" perceived risk and concern about damage of one 's career or losing face and future opportunities because of suffering from mental illness \" represent perceived support climate and value for mental health at the workplace . on the other hand , understanding mental health represents \" employee 's personal values regarding mental health , \" and previous study have indicated qualitative differences based on biased distribution and low correlations between this scale and the other two subscales . \n although evaluation of services and risk for career disadvantage may link to attitudes toward psychological help , the association among them has not been revealed in previous studies . \n moreover , the studies have found that physical and psychological distress , which is a prior condition to seeking help , is associated with less perception of available support . \n other studies have found that increased prior stress symptoms had a negative influence on the perception of an organizations ' support ( e.g. , ) . \n these studies imply that distress may lead to a failure in cognitive appraisal of available resources , such as underestimating evaluation of services or overestimating risk for career disadvantage , leading to underutilization of services . taken together \n , it is assumed that positive wmhc ( high evaluation of services and low risk for career disadvantage ) is associated with positive attitudes toward psychological help , although the association may be moderated by individual distress levels . regarding gender differences , previous studies have revealed that perception of social support and help - seeking is lower in males compared to females . \n moreover , male help - seeking behavior relies more on organizational norms when compared to female help - seeking . \n the purpose of this study was to investigate the interaction effects of wmhc and distress on attitudes toward professional psychological help , and elucidate the reasons for the underutilization of mental health services among distressed employees . understanding \n the hypotheses were : ( h1 ) in employees with low distress levels , positive wmhc ( high evaluation of services and low risk for career disadvantage ) is associated with positive attitudes toward professional psychological help , ( h2 ) in employees with high distress levels , positive wmhc ( high evaluation of services and low risk for career disadvantage ) is not associated with positive attitudes toward professional psychological help . \n questionnaires were distributed to 1,100 japanese working males . of those 757 were returned , which means that the response rate was 68.8% . by excluding part - time employees and \n not fully answered questionnaires , of these 650 full - time employees were used for the subsequent analysis . \n the participants ' ages ranged from 20 to 65 years ( m = 42.04 , sd = 9.66 ) , 44.5% were employed in manufacturing , and 55.5% were employed in other industries . regarding job title and role , \n 29.4% were entry - level , 13.7% were assistant managers , 13.4% were subsection chiefs , 22.2% were managers , 13.4% were general managers , 4.9% were presidents , and 13.5% were \" other . \" \n company size was indicated by the total number of employees : 17.2% worked in a company with less than 30 employees , 30.9% worked with 30 - 99 employees , 24% worked with 100 - 999 employees , and 27.8% worked in a company with more than 1,000 employees . \n attitudes toward seeking professional psychological help help - seeking towards mental health services was assessed via the japanese version of atspph - sf . \n the original scale consists of ten items ( rated on a 6-point likert scale from 1 = absolutely disagree to 6 = strongly agree ) and a single factor , while two - factor structure has also been revealed . \n since the factor structure depends on religion , illness attribution , and culture , the present study assumed one or two factors , and analyzed exploratory . \n confirmatory factor analysis with one factor showed a rather low fit ( gfi = 0.863 , agfi = 0.785 , cfi = 0.785 , rmsea = 0.133 ) , thus exploratory factor analysis , employing maximum likelihood estimation with promax rotation was conducted . \n the analysis yielded a two - factor structure ( gfi = 0.933 , agfi = 0.892 , cfi = 0.902 , rmsea = 0.091 ) , which is congruent with elhai et al .. therefore , the factors were named openness to seeking treatment ( ost ) and negative value for seeking treatment ( nvst ) in accordance with the previous study . \n ost represents \" openness to seeking treatment for emotional problems , \" and consists of five positive statements such as \" if i believed i was having a mental breakdown , my first inclination would be to get professional attention . \" \n nvst represents \" negative values and lack of needs in seeking treatment \" and consists of five negative statements such as \" a person should work out his or her own problems ; getting psychological counseling would be a last resort . \" \n workplace mental health climate the workplace mental health climate scale was used to measure wmhc . \n the scale originally consisted of 16 items ( rated on a 5-point likert scale from 1 = disagree to 5 = agree ) , and 11 items of evaluation of services and risk for career disadvantage were used in the present study . \n however , confirmatory factor analysis showed a rather low fit ( gfi = 0.870 , agfi = 0.825 , cfi = 0.840 , rmsea = 0.095 ) , possibly because the present study targeted only males . \n therefore , exploratory factor analysis , employing unweighted least squares estimation with promax rotation was conducted . \n the result showed a two - factor structure , while one item which had factor loadings under 0.350 , and another item which was cross - loading onto two factors were excluded ( gfi = 0.920 , agfi = 0.886 , cfi = 0.899 , rmsea = 0.081 ) . because only one item was altered besides the excluded factors , the original names of the subscales were maintained . \n the cronbach 's alpha was 0.867 for evaluation of services and 0.724 for risk for career disadvantage . \n hopkins symptom checklist the japanese version of the hopkins symptom checklist ( hsc ; ) was used to measure distress levels . \n the japanese version adopted the psychosomatic score , depressive score , and anxiety score , which had high reliability among the original five subscales . \n the scale consists of 30 items ( rated on a 5-point likert scale from 1 = never to 5 = frequent ) . \n in order to investigate the effect of distress comprehensively , subsequent analysis used 30 items , integrating psychosomatic , depressive , and anxiety scores . \n the proportion of variance explained for one factor was 38.8% , and the cronbach 's alpha was 0.947 . \n the data were collected in may - june of 2013 at the following two locations : 1 ) classes on a campus at a junior high school and a high school , and 2 ) 41 companies in central japan . at the schools , \n the students were asked to hand the questionnaire to a working male friend or family member who was aged 20 to 65 years and ask them to complete it . at the different companies , delegates distributed the questionnaires , and employees \n the study design was approved by the ethical review board , graduate school of education and human development , nagoya university . \n firstly , pearson 's correlation coefficients were calculated between the total score of atspph - sf , wmhc , distress , and demographic variables in order to select factors to be controlled . \n the total scores were adopted in order to unify the control factors between the analyses . \n the results showed that age , title , and company size were significantly correlated with the total score of atspph - sf and wmhc . \n therefore , age , title , and company size were included in the analysis to control confounding effects . \n secondly , independent variables were converted into a z - score , and hierarchical multiple regression analysis was conducted separately on ost and nvst . in order to confirm the adequacy of the model by examining the change of coefficient of determination ( r ) , age , title , company size , evaluation of services , risk for career disadvantage , and distress \n were entered as independent variables at step 1 , and the multiplied variables of evaluation of services , risk for career disadvantage , and distress were entered at step 2 . \n when the result showed significant interaction effects , further analyses were conducted to draw the regression lines by plugging the values of 1sd . \n questionnaires were distributed to 1,100 japanese working males . of those 757 were returned , which means that the response rate was 68.8% . by excluding part - time employees and \n not fully answered questionnaires , of these 650 full - time employees were used for the subsequent analysis . \n the participants ' ages ranged from 20 to 65 years ( m = 42.04 , sd = 9.66 ) , 44.5% were employed in manufacturing , and 55.5% were employed in other industries . regarding job title and role , \n 29.4% were entry - level , 13.7% were assistant managers , 13.4% were subsection chiefs , 22.2% were managers , 13.4% were general managers , 4.9% were presidents , and 13.5% were \" other . \" \n company size was indicated by the total number of employees : 17.2% worked in a company with less than 30 employees , 30.9% worked with 30 - 99 employees , 24% worked with 100 - 999 employees , and 27.8% worked in a company with more than 1,000 employees . \n attitudes toward seeking professional psychological help help - seeking towards mental health services was assessed via the japanese version of atspph - sf . \n the original scale consists of ten items ( rated on a 6-point likert scale from 1 = absolutely disagree to 6 = strongly agree ) and a single factor , while two - factor structure has also been revealed . \n since the factor structure depends on religion , illness attribution , and culture , the present study assumed one or two factors , and analyzed exploratory . \n confirmatory factor analysis with one factor showed a rather low fit ( gfi = 0.863 , agfi = 0.785 , cfi = 0.785 , rmsea = 0.133 ) , thus exploratory factor analysis , employing maximum likelihood estimation with promax rotation was conducted . \n the analysis yielded a two - factor structure ( gfi = 0.933 , agfi = 0.892 , cfi = 0.902 , rmsea = 0.091 ) , which is congruent with elhai et al .. therefore , the factors were named openness to seeking treatment ( ost ) and negative value for seeking treatment ( nvst ) in accordance with the previous study . \n ost represents \" openness to seeking treatment for emotional problems , \" and consists of five positive statements such as \" if i believed i was having a mental breakdown , my first inclination would be to get professional attention . \" \n nvst represents \" negative values and lack of needs in seeking treatment \" and consists of five negative statements such as \" a person should work out his or her own problems ; getting psychological counseling would be a last resort . \" \n workplace mental health climate the workplace mental health climate scale was used to measure wmhc . \n the scale originally consisted of 16 items ( rated on a 5-point likert scale from 1 = disagree to 5 = agree ) , and 11 items of evaluation of services and risk for career disadvantage were used in the present study . \n however , confirmatory factor analysis showed a rather low fit ( gfi = 0.870 , agfi = 0.825 , cfi = 0.840 , rmsea = 0.095 ) , possibly because the present study targeted only males . \n therefore , exploratory factor analysis , employing unweighted least squares estimation with promax rotation was conducted . \n the result showed a two - factor structure , while one item which had factor loadings under 0.350 , and another item which was cross - loading onto two factors were excluded ( gfi = 0.920 , agfi = 0.886 , cfi = 0.899 , rmsea = 0.081 ) . because only one item was altered besides the excluded factors , the original names of the subscales were maintained . \n the cronbach 's alpha was 0.867 for evaluation of services and 0.724 for risk for career disadvantage . \n hopkins symptom checklist the japanese version of the hopkins symptom checklist ( hsc ; ) was used to measure distress levels . \n the japanese version adopted the psychosomatic score , depressive score , and anxiety score , which had high reliability among the original five subscales . \n the scale consists of 30 items ( rated on a 5-point likert scale from 1 = never to 5 = frequent ) . \n in order to investigate the effect of distress comprehensively , subsequent analysis used 30 items , integrating psychosomatic , depressive , and anxiety scores . \n the proportion of variance explained for one factor was 38.8% , and the cronbach 's alpha was 0.947 . \n the data were collected in may - june of 2013 at the following two locations : 1 ) classes on a campus at a junior high school and a high school , and 2 ) 41 companies in central japan . at the schools , \n the students were asked to hand the questionnaire to a working male friend or family member who was aged 20 to 65 years and ask them to complete it . at the different companies , delegates distributed the questionnaires , and employees \n the study design was approved by the ethical review board , graduate school of education and human development , nagoya university . \n firstly , pearson 's correlation coefficients were calculated between the total score of atspph - sf , wmhc , distress , and demographic variables in order to select factors to be controlled . \n the total scores were adopted in order to unify the control factors between the analyses . \n the results showed that age , title , and company size were significantly correlated with the total score of atspph - sf and wmhc . \n therefore , age , title , and company size were included in the analysis to control confounding effects . \n secondly , independent variables were converted into a z - score , and hierarchical multiple regression analysis was conducted separately on ost and nvst . in order to confirm the adequacy of the model by examining the change of coefficient of determination ( r ) , age , title , company size , evaluation of services , risk for career disadvantage , and distress were entered as independent variables at step 1 , and the multiplied variables of evaluation of services , risk for career disadvantage , and distress were entered at step 2 . \n when the result showed significant interaction effects , further analyses were conducted to draw the regression lines by plugging the values of 1sd . \n correlations between the variables pearson 's correlation coefficients were calculated to investigate correlations between the variables ( table 1 ) . \n the results showed significant negative correlations between subscales of help - seeking attitude ( r = -0.396 , p < 0.001 ) and wmhc ( r = -0.427 , p < 0.001 ) . additionally , distress showed significant positive correlations with ost ( r = 0.152 , p < 0.001 ) and risk for career disadvantage ( r = 0.273 , p < 0.001 ) , and a negative correlation with evaluation of services ( r = -0.225 , p < 0.001 ) . \n correlation between the variables interaction effects on ost the results showed a significant two - way interaction effect for evaluation of services distress ( = -0.116 , p < 0.01 ; fig . 1 ) and risk for career disadvantage distress ( = -0.088 , p < 0.05 ; fig . \n the change of coefficient of determination between step 1 and step 2 was significant ( r = 0.011 , p < 0.05 ) and multicollinearity was not present ( table 2 ) . \n further analysis showed regression coefficients differ by level of distress : high distress ( + 1sd ) and low distress ( -1sd ) . the adjusted coefficient of determination was r ' = 0.060 . \n two - way interaction of \" evaluation of services \" \" distress \" on \" ost \" two - way interaction of \" risk for career disadvantage \" \" distress \" on \" ost \" multiple regression analysis on ost interaction effects on nvst the results showed a significant three - way interaction effect for evaluation of services risk for career disadvantage distress ( = -0.113 , p < 0.01 ; fig . \n the change of coefficient of determination between step 1 and step 2 was significant ( r = 0.019 , p < 0.01 ) , and multicollinearity was not present ( table 3 ) . \n further analysis showed regression coefficients differed by level of distress and risk for career disadvantage ; high distress ( + 1sd ) combined with high / low risk for career disadvantage ( 1sd ) , and low distress ( -1sd ) combined with high / low risk for career disadvantage ( 1sd ) . \n the adjusted coefficient of determination was r ' = 0.056 . three - way interaction of \" evaluation of services \" \" risk for career disadvantage \" \" distress \" on \" nvst \" multiple regression analysis on nvst \n interaction effects on ost the results showed a significant two - way interaction effect for evaluation of services distress ( = -0.116 , p < 0.01 ; fig . 1 ) and risk for career disadvantage distress ( = -0.088 , p < 0.05 ; fig . \n 2 ) . the change of coefficient of determination between step 1 and step 2 was significant ( r = 0.011 , p < 0.05 ) and multicollinearity was not present ( table 2 ) . \n further analysis showed regression coefficients differ by level of distress : high distress ( + 1sd ) and low distress ( -1sd ) . the adjusted coefficient of determination was r ' = 0.060 . \n two - way interaction of \" evaluation of services \" \" distress \" on \" ost \" two - way interaction of \" risk for career disadvantage \" \" distress \" on \" ost \" multiple regression analysis on ost interaction effects on nvst the results showed a significant three - way interaction effect for evaluation of services risk for career disadvantage distress ( = -0.113 , p < 0.01 ; fig . \n the change of coefficient of determination between step 1 and step 2 was significant ( r = 0.019 , p < 0.01 ) , and multicollinearity was not present ( table 3 ) . \n further analysis showed regression coefficients differed by level of distress and risk for career disadvantage ; high distress ( + 1sd ) combined with high / low risk for career disadvantage ( 1sd ) , and low distress ( -1sd ) combined with high / low risk for career disadvantage ( 1sd ) . \n three - way interaction of \" evaluation of services \" \" risk for career disadvantage \" \" distress \" on \" nvst \" multiple regression analysis on nvst \n the aim of the present study was to investigate the reasons for the underutilization of mental health services among male employees in japan . \n the main results showed that the relationship between wmhc and help - seeking attitudes differed depending on distress level . \n as perception of available support facilitates psychological service use , we hypothesize that employees are more likely to seek help if they hold the available services in high regard . by contrast \n , ost of the high distress group did not improve regardless of their evaluation of services . \n it is known that depressed individuals tend to a have a negative perception of their environment and future , resulting in a negative view of social situations and a belief that their current situation will not improve , even with effort to change it . \n other studies have found that depressive symptoms are associated with subjective cognitive complaints and actual cognitive impairments ( e.g. , ) . \n baumeister and colleagues explained that cognitive processes will be impaired when individuals have to manage negative emotion because executive resources will be monopolized by regulating affect . \n thus , it is possible that distress inhibits either recognizing available support or evaluating coping options , leading to no improvement in ost . on the other hand , \n ost was relatively high with the high distress group and a positive correlation was shown between distress and ost , which corresponds to what other previous studies found ( e.g. , ) . \n taken together , these results imply that highly distressed individuals retain a potential need for professional psychological help \n . however , current mental health care usage implies that high levels of distress will not necessarily lead to help - seeking behavior in real - life situations . \n ost rose only with the high distress group , as risk for career disadvantage decreased . \n as it positively correlates with risk for career disadvantage , distress makes people particularly sensitive to social exclusion or rejection . \n concerns about treatment or evaluation in the social group present a significant barrier to utilization of mental health services . \n on the other hand , highly distressed individuals are most in need of professional psychological help . \n thus , they would be willing to open their emotional problems when the workplace climate was supportive and free from risk of social exclusion . however , ost remained low with the low distress group . \n this result implies that risk for career disadvantage is a significant factor only when employees have a need for mental health care , and the concern becomes a pressing issue with newfound reality . \n nvst declined only when evaluation of services was high and risk for career disadvantage was low with the high distress group , whereas the other three groups remained at a high level . \n this implies that negative values for seeking professional help is widely shared at least among male employees . \n walton revealed that employees are concerned with negative judgments from their managers or colleagues for seeking mental health services . \n in addition , previous studies have found that seeking psychological help tends to create a conflict with traditional male stereotyped roles . \n for these reasons , male employees , especially those with high perceived risk for their career , may hesitate when seeking mental health services . on the other hand \n , results showed that employees who experience high distress do not refuse services that are perceived as valuable and when the risk of social judgment is low . \n this implies that potential need for help may take priority over resistance arising from negative affect and cognition if the workplace environment is favorable . piecing our results together \n , the mechanism of mental health service underutilization by employees could be described as follows : with the low distress group , negative perspective and value for seeking professional psychological help seem deep - rooted and persists even with highly evaluated services and low risk to one 's career . \n although inclination to open emotional problems to psychological help rose with evaluation of workplace mental health care , it remained relatively low compared to the high distress group . \n thus , employees with low distress are likely to have a conflict when seeking professional psychological help , which inhibits them from seeking help in the early stages of distress . \n however , when employees have help needs such as high distress , service evaluation is no longer a facilitator of service use . \n openness to seeking psychological help is suppressed by perceived risk for career disadvantage , and negative value for help - seeking do not decline until perceived risk for career is low and service evaluation is high . as a result , \n these findings indicate that distress impairs accurate perception of available support and activates excessive sensitivity to fears of negative evaluation for seeking professional psychological help . \n this distorted cognition may lead to a negative spiral of failure of coping and worsened outcomes . as a result of these findings , the different associations between workplace support and help - seeking point to the necessity for interventions tailored to each individual 's distress levels . \n an approach for employees with low distress should include improving service evaluation , which would facilitate intention to seek help . moreover , it is important to find a solution to reduce feelings of resistance towards mental health services . for employees with high distress , \n the workplace should endeavor to reduce concerns about career disadvantage while enhancing standards of mental health services . \n for instance , showing managers ' or chiefs ' positive attitudes toward mental health care may be effective , as it has been shown that employees are more likely to use counseling services if their workplace managers are more supportive of the service . \n in addition , the results indicate the importance of early service use , since appropriate appraisal and selection of coping strategies will be difficult in later stages of distress . \n therefore , informing employees of the importance of early help - seeking behavior and describing the negative spiral mechanism that may occur because of distress , may be an effective means to prevent further deterioration of employee mental health . in spite of these findings , \n first , the causal relationships of workplace climate , distress , and help - seeking attitudes can not be determined , since the present study was a cross - sectional design . \n although it was a meaningful step to investigate our hypothesis with a large sample , other study designs or analytical methods that can clarify precise relationships of the factors should be conducted in the future . \n second , the workplace mental health services were evaluated by the employees ' subjective views , and the actual effort of the workplace healthcare support systems were not measured . \n since wmhc is said to correlate with the actual degree of implementation of mental health services in the workplace , actual conditions may influence wmhc and , therefore , help - seeking . \n third , although results were statistically significant , the multiple regression coefficient and coefficient of determination were low . \n as previous studies have pointed out , help - seeking is influenced by a number of factors , such as stigma , past experiences with help - seeking , and knowledge etc .. based on this complexity , the present study focused on the interaction effects of workplace climate and distress in particular . \n additionally , cronbach 's alpha for atspph - sf was not very high ; thus , reliability and validity among male employees may not be adequate . \n therefore , it is necessary to consider the smallness of the value and limitations of the measurement when the findings in this study are utilized . forth , distress states may have biased responses and results . \n given that high distress impairs accurate perception , it may impair the validity of the responses of highly distressed individuals . \n in contrast , individuals experiencing low distress may not need help or ever experience conflict relating to seeking help . \n therefore , the results must be interpreted carefully , and further study is needed to clarify the impact of distress . \n the present study aimed to investigate the interaction effects of workplace climate and distress on help - seeking attitudes , and elucidate the reasons for underutilization of mental health service by employees . \n the results indicate that the associations between workplace climate and attitudes toward professional psychological help differ , depending on individuals ' distress levels . \n moreover , the findings imply that individuals who experience low levels of distress are inhibited by negative value for seeking help , while high distress individuals have difficulty in perceiving available support . \n developing interventions tailored to individuals ' distress levels may be effective in facilitating seeking out support from mental health services . \n acknowledgments : this research was supported , in part , by a grant from the japan society for the promotion of science under grant 11317 .", "role": "user" }, { "content": "objectives : although using mental health services is an effective way to cope with work - related stressors and diseases , many employees do not utilize these services despite service improvements in recent years . the present study aimed to investigate the interaction effects of workplace climate and distress on help - seeking attitudes , and elucidate the reasons for mental health service underutilization in japan.methods : \n a questionnaire was distributed to 650 full - time male japanese employees . \n hierarchical multiple regression analysis was used to investigate interaction effects of workplace climate and distress on help - seeking . \n results : results showed that the association between workplace climate and help - seeking attitudes differed depending on employee distress level \n . for employees experiencing low levels of distress , openness to seeking treatment increased with a higher evaluation of the mental health services available at the workplace . \n however , the same did not hold true for employees experiencing high levels of distress . \n instead , openness to seeking treatment decreased with perceived risk for career disadvantage for high distress employees . \n additionally , negative values for seeking treatment in highly distressed employees decreased only when services were perceived as valuable , and the risk to their career was perceived as low.conclusions : overall , these findings indicate that distress distorts the perception of social support , which may lead to underutilization of available services . \n assessing employees ' distress levels and tailoring adequate interventions could facilitate help - seeking in male employees .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the chlorine compounds used to suppress bacterial growth in the potable water supply are removed when the water is treated for hemodialysis . \n it is almost impossible to completely prevent bacterial proliferation in the treated water and the dialysate . as a result , even though conventional dialysate meets the required quality standards , it usually contains some low level of microbiological contamination , including fragments of endotoxin and peptidoglycans and bacterial fragments [ 13 ] . \n these contaminants , sometimes collectively referred to as cytokine - inducing substances , cross both low - flux and high - flux hemodialysis membranes [ 2 , 4 ] and stimulate cytokine production by inflammatory cells . \n the use of dialysate of much higher microbiological purity improved this state of inflammation [ 6 , 7 ] . \n general markers of inflammation such as serum c - reactive protein ( crp ) , ferritin , or fibrinogen are commonly used , but the oxidative stress referred to excessive production of reactive oxygen species ( ros ) and inadequate antioxidant protection , is more sensitive , specific , and precocious of inflammation state . \n this condition leads to structural and/or functional deterioration in cell components including dna , proteins , carbohydrates , and lipids . \n the presence of ros can cause damage in many molecules , such as lipids , leading to the production of malondialdehyde ( mda ) , an indicator of lipid peroxidation [ 911 ] . in chronic renal failure ( crf ) \n patients under hemodialysis ( hd ) treatment , the formation of ros is amplified , therefore beyond uremic toxins [ 12 , 13 ] . \n the aim of this study was to evaluate the oxidative stress using quantification of mda in the crf patients after changing quality of dialysate with ultrapure dialysis fluid . \n concerned patients were with end - stage renal disease ( esrd ) on maintenance hemodialysis . \n exclusion criteria were ( i ) chronic infection ; ( ii ) chronic inflammatory disorders ; ( iii ) primary or secondary hyperlipidemia ( other than uremic ) ; ( iv ) major comorbid conditions such as severe heart failure , severe chronic obstructive lung disease , liver cirrhosis , or malignancy ; and ( v ) unwillingness to participate in the study . \n this prospective unicenter study was conducted according to the principles of the declaration of helsinki and was approved by the local ethical committee from the faculty of medicine and pharmacy in rabat , morocco . \n patients were in the first step treated with conventional dialysate ( double osmosis , deionization , and carbon filtration ) ; in the second step ( three months later ) they were treated with online produced ultrapure dialysis fluid ( diasafe and heat disinfection with hotfeed fresenius medical care , with reverse osmosis , deionization , and carbon filtration ) during three months . before starting , we analyzed the microbiological quality of dialysis fluid in the two water treatments . \n all patients received single - use biocompatible synthetic low - flux membranes ( polyamide , polyflux renal products gambro ) . \n blood flow rates were chosen between 300 and 350 ml / min , and ultrafiltration rates were set according to individual needs . \n for all treatments , heparinization of the individual patient did not differ throughout the study period . \n hemodialysis was prescribed and monitored using a single pool urea kinetic model to ensure a delivered dialysis dose of at least 1.2 per dialysis for thrice weekly sessions . for mda analysis , \n samples were collected in edta - containing tubes just before commencing dialysis ( pre - hd ) and at the termination of dialysis procedure ( post - hd ) . \n blood venous samples ( 10 ml ) were centrifuged at 1500 g for 10 min just after being collected . \n serums were used to perform analysis of crp , total cholesterol , tg , high - density lipoprotein ( hdl ) , low - density lipoprotein ( ldl ) , fibrinogen , and albumin before the two steps . \n we applied a membrane filtration technique for the ultrapure dialysis fluid cultures , using a microfilter with pore size 45 m ( 2245 ) . \n limulus amebocyte lysate ( lal ) assay was used for determination of endotoxins ( chromogenic method ) according to the manufacturer . \n serum total cholesterol , triglyceride , hdl , ldl , and crp levels were determined using dimension rxl analyser ( dade behring , inc ) . \n all chemicals and reagents used ( from merck ) were of analytical grade , and milli - q water was used for each dilution . \n the analysis was performed according to published procedures for preparing mda adduct [ 15 , 16 ] . \n briefly , a plasma sample ( 100 l ) was mixed to 300 l of a 42 mm thiobarbituric acid ( 42 mm ) solution and 700 l of a phosphoric acid solution ( 1% ) . \n the reaction was then stopped at ice cold temperature , and an equal volume of n - butanol was added to the reaction mixture . \n samples were then centrifuged and an aliquot of the supernatant was read at 532 nm . \n a calibration curve was prepared with tep ( 1,1,3,3-tetramethoxypropane ) as standard mda of 0.38 up to 100 mol / l . \n a linear regression between tep concentration and absorbance was constructed using the microsoft excel software for widows , and the regression equation was used to calculate the mda concentration in each sample . in our study , we have taken into account only the calibration curves which had a coefficient of determination ( r ) more than 0.99 ( figure 1 ) . \n recovery values of 97% indicated adequate accuracy of the method . during the measurement , each sample \n these analyses were performed on the same patients in similar conditions and manner when using conventional dialysate and three months later after switching to ultrapure dialysate . \n data are presented as mean standard deviation ( sd ) , median and interquartile , or as a percentage . according to normal or nonnormal distribution of data , comparison between variables \n is performed using the t - test , mann - whitney u test , wilcoxon 's test , chi square or fisher 's exact test . \n all analyses were performed using the spss 13.0 for windows ( spss , inc . , chicago , il , usa ) . \n two patients were excluded for chronic inflammatory ( one had malignancy disease , and the other had chronic infection on his foot ) . \n the causes of esrd were diabetic nephropathy ( 15% ) , chronic glomerulonephritis ( 20% ) , chronic interstitial nephritis ( 17.5% ) , and unknown ( 32.5% ) . \n the microbiological parameters of dialysis fluid in the two water treatments of our center are presented in table 2 . \n blood lipid analyses of patients were performed before and three months after that switching from conventional to ultrapure dialysis fluid . \n our data show significant changes in blood lipid have occurred upon the above switching ( table 3 ) . \n there was a significant decrease of tg ( 1.38 0.62 versus 1.13 0.37 ; p = 0.006 ) , total cholesterol ( 1.72 0.44 versus 1.38 0.13 ; p = 0.001 ) , and hdl ( 0.39 0.10 versus 0.32 0.12 ; p = 0.02 ) in patients ' blood . instead , the level of ldl , fibrinogen , albumin , and crp did not change significantly . the use of ultrapure dialysis fluid reduced but not significantly the oxidative stress as evidenced by reduction in mda concentrations ( tables 4 and 5 ) . \n both dialysis fluids were associated with improvement of the mda level before and after hd session with p < 0.001 ( table 4 ) . in multivariate study \n we found no statistically significant correlation between the value of mda and other parameters ( crp , tg , total cholesterol , ldl , hdl , fibrinogen , and albumin ) . \n we found also that causes of esrd did not affect changes in values of mda . \n in this study , we confirm that mda increases in blood 's patient following hd session , and we found that the conventional dialysate increased mda levels more than ultrapure dialysate but the differences were not statistically significant . in multivariate study , it was shown that the mda is a good marker for assessing oxidative stress generated by the water quality in hd because there is no influence of other inflammatory parameters . \n effectively the european best practice guidelines for hemodialysis set the maximum allowable level for bacteria and endotoxin concentrations at 100 cfu / ml and 0.25 eu / ml , respectively . for ultrapure dialysate , it is commonly defined as having a bacterial count less than 100 cfu / l and an endotoxin content less than 0.03 seu / ml measured by the limulus amebocyte lysate assay . \n hd patients are particularly vulnerable to contaminants in the water used to prepare concentrate and dialysate or in water used for reprocessing dialyzers . compared to healthy individuals \n , hd patients are exposed to extremely large volumes of water having inadequate barriers to such toxins and can not easily eliminate contaminants . \n the estimated water intake of a healthy individual is 2 liters per day or 14 liters per week . by comparison \n , hd patients may be exposed to 350 to 500 liters of water per week , depending on their treatment time and dialysate flow rate [ 19 , 20 ] . with normal individuals , \n the barrier between blood and water in hd patients is a thin membrane through which the transfer of contaminants is limited only by the size of the contaminant . \n schiffl and lang demonstrate that inflammation , oxidative stress , and dyslipidemia are biologically linked . \n this is the limit of our work since it is of short duration , which does not allow us to assess the impact of cardiovascular long term.the use of ultrapure dialysate produces a lesser degree of oxidative stress . \n the lipid peroxidation is hallmark of oxidative stress , which disrupts the structural integrity of cell membranes and can also lead to the formation of aldehydes , which in turn by time damage lipids , proteins , and nucleic acid . \n in addition , this state is involved in many pathophysiological processes , particularly within accelerated atherosclerosis , which is , at least in part , resistant to conventional pharmacotherapy , inflammation , and cancer [ 25 , 26 ] . \n switching from conventional dialysis fluid to ultrapure dialysis fluid has been shown repeatedly to be associated with a decrease in the circulating concentrations of biomarkers of inflammation [ 27 , 28 ] . \n but not all studies report a reduction in inflammatory markers after the introduction of ultrapure dialysate [ 29 , 30 ] . \n there are clearly many stimuli to inflammation in hemodialysis patients , such as the presence of synthetic grafts for blood access and the practice of dialyzer reuse . \n thus , a failure to find a reduction in the level of inflammatory markers with ultrapure dialysate may reflect the presence of multiple inflammatory stimuli . \n find that contaminants in the bicarbonate and salt mixture used for preparation of dialysate are important factors for increased apoptosis in monocyte- like cell ; in this study , the authors provide evidence of the association between an increased monocyte apoptosis rate and impurity of dialysate . \n the oxidative stress could play a key role in this increased apoptosis rate as it participates in both the initiation and maintenance of the apoptotic process in monocytes stimulated by oxidants and proinflammatory cytokines . \n suggest that mda levels suffer influence room time of hd treatment , as shown in our data . \n quantification of mda allowed us to evaluate oxidative stress in hemodialysis patient . in this study , \n we confirm that mda increases in blood 's patient following hemodialysis session on one hand and on the other hand we found that the conventional dialysate increased mda levels more than ultrapure dialysis but the differences were not statistically significant .", "role": "user" }, { "content": "the aim of this study was to evaluate the levels of malondialdehyde as an oxidative stress marker in the same hemodialysis patients after changing the quality of dialysate with ultrapure dialysis fluid . \n methods . \n this prospective study concerns hemodialysis patients ; all patients were in the first step treated with conventional dialysate , and in the second step ( three months later ) the same patients were treated with online produced ultrapure dialysis fluid . \n the malondialdehyde , c - reactive protein , total cholesterol , triglycerides , high - density lipoprotein , low - density lipoprotein , fibrinogen , and albumin were quantified before the two steps . results . \n thirty - seven patients completed the study . \n ultrapure dialysis fluid reduced but not significantly the malondialdehyde concentrations . \n both dialysis fluids were associated with improvement in the malondialdehyde level before and after the hemodialysis session . in lipid parameters \n , there was a significant decrease with conventional dialysis fluid versus ultrapure dialysis fluid of triglycerides , total cholesterol , and high - density lipoprotein in patients ' blood . \n instead , the level of low - density lipoprotein , fibrinogen , albumin , and c - reactive protein does not change significantly . \n conclusion . \n the lipid parameters were improved for triglycerides and total cholesterol . \n malondialdehyde increases following the hemodialysis session , and the conventional dialysate increased malondialdehyde levels more than the ultrapure dialysis but the differences were not statistically significant .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: statistics are widely accepted tools for analyzing data and drawing appropriate conclusions but use of inappropriate statistical methods leads to an inappropriate or false conclusion . it has been observed that qualities of statistics used in articles published in various indian medical journals are inappropriate . a serious doubt \n is expressed on the validity of the results published and there generalization to patient population because in absence of use of appropriate statistical methods . \n clinical trials are considered to have one of the highest evidences in terms of efficacy of any intervention and hence results reported in these clinical trials helps for decision making in clinical practice \n . however , clinical trials published in various medical journals in india also presents with inappropriate use of statistical tests and drawing false conclusions . \n there is a definite lack of such studies narrating inappropriate use of statistic in clinical trials published in indian medical journals . \n the present review is an attempt to highlight issues related to inappropriate use of statistics in clinical trials published in various indian medical journals . \n we describe various types of inappropriate statistical methods used by authors under the following subheadings : \n study design in clinical trial is an important phase as type of study not only affects the smooth conduction of trial but also has an impact on validity and reliability of clinical trial conducted . \n a qualified statistician or an appropriate knowledge and orientation about basic statistics is required to avoid few statistical flaws . during this phase of clinical trial , aim of the study , \n however , it is observed that division between primary and secondary endpoints are not reported in many of the clinical trials published in indian medical journals . \n division between primary and secondary endpoint is very important to prevent type 1 error ( false positivity ) which arises because of multiple endpoints . \n equally important is that aims and objectives of the trial should be clearly framed in an unambiguous language . \n reporting of methods for calculation of sample size and non reporting of sample size estimation is an important issues . \n many of the clinical trials published in indian and western medical journals are deficient in reporting of sample size calculation . \n help of statistician or readymade computer software can be taken for the calculation of appropriate sample size . \n power of study should be adjusted so that any worthwhile effect if present can be detected . \n small sample sizes are associated with type - ii errors and hence raise serious questions on validity of study . \n it is observed that many negative clinical trials published in indian medical journals on analysis found to be underpowered because of less sample size . during calculation of the desired sample size , appropriate wattage for components like type - i error , type - ii error , effect size . \n such parameters should also be considered and mentioned in detail so that it can be a guiding tool for readers to emulate and reader can calculate the sample size on the basis of information provided in the article . \n it is equally important to understand and perceive that formula of sample size calculation is different for different type of study designs . during designing the trial , \n all care should be taken to fulfill these assumptions during collection of data itself . in clinical trials \n statistical tests loose its validity if applied in a non randomized sample . adequate information related to randomization procedure and sampling method should be included in the manuscript . \n baseline statistical comparison between groups ( treatment and control ) is commonly used in randomized controlled trial published in different medical journals . \n inappropriate comparison of baseline parameters including demographical factors just to avoid partially or inherently heterogeneous group is very frequently done by researchers which in truth can not be compared . \n if the group is heterogeneous , then difference in the treatment outcome can not be considered because of intervention unless confounding factors are adjusted using sophisticated multivariate analysis . \n so knowledge about baseline parameters should be clear so as to see the imbalance which may affect the result but there is no need to compare the baseline parameters by statistical tests and there is no need to report p values . in a true randomized trial \n each patient has equal probability of being assigned to either the treatment group or control group therefore any difference obtained at the baseline can be because of chance variation . \n it should also be perceived that unlike other research methods in randomized trials difference in the baseline parameters does not indicate bias . \n equally true is that just by showing that there are no statistically significant differences between groups at baseline , it can not be concluded that groups are equivalent , particularly in studies with small sample size which lack statistical power . \n one of the fallacies during clinical trials is use of inappropriate or wrong statistical tests.[15 ] number of reasons cited for considering a test to be inappropriate . as mentioned earlier before using the particular statistical tests , all the assumptions for that statistical test \n it is observed that distribution of data was not checked which is an important prerequisite before applying parametric statistical tests . \n biological variables are usually more prone to fall in skewed distribution , hence checking of distribution become very important . \n it is also observed that parametric tests were used for data related to rank and scores ( ordinal data ) , which is also wrong , in this type of data nonparametric tests should be used . \n so goal of analysis should be very clear and paired test should be used for paired data and vice versa . \n even most simple tests like chi square and t test are found to be used inappropriately . in most of the clinical trials published in indian medical journals \n multiple end points are measured and hence multiple statistical tests are used to measure the difference between groups . \n the p value is based on principal of probability , if with one statistical test the chance of having a significant result is 5% , then after 20 statistical tests it may be more than 40% . \n inflation of type 1 error can be prevented dividing the endpoints at the design phase itself into primary and secondary endpoints . \n most important endpoint should be considered as primary endpoint and other endpoints should be considered as secondary endpoints . if the primary endpoint can not be restricted to one then multiple endpoints should be adjusted with the help of various adjustment methods like bonferroni method , least significant difference test , composite endpoint method etc . in a study done by tom \n it was found that out of 16 positive randomized controlled trials published in british medical journal in 2004 only 8 clinical trials remain significant after the adjustment of multiple end points . in a similar study done for clinical trials published in indian medical journals \n it was found that about one third of the clinical trials published in four indian journals were false positive and statistical methods used to adjust this error was not mentioned in even a single trial . \n it is difficult to decide a single best method out of all method for adjustment of multiple endpoints . as each method has its unique advantage and disadvantage . according to international conference on harmonization e 9 guideline \n if in a clinical trial adjustment of multiple endpoints is not reported then the reason for this should be mentioned clearly in the manuscript . \n consolidated standards of reporting trials ( consort ) statement also favors adjustment of multiple endpoints . \n post hoc subgroup analysis too can only be justified if decision regarding analysis is taken in design phase of the study itself . \n subgroup analysis should not be done just to find significant difference in some specific group . that will lead to fishing of significant results and will cause inflation of type i error . \n it is also a common practice during analysis of data continuous data to divide it into ordinal categories . \n authors should mention the reason for this transformation and how boundaries of ordinal categories were decided . sometime \n cut off boundaries are chosen in so as to favor some results . during analysis of data \n all subjects who were randomized should be included in the analysis this is called intent to treat ( itt ) principle . \n itt is done to avoid the effect of crossover or dropouts of study subjects which lead to braking of randomization to the treatment groups in a trial . \n aim of itt is to analyze the study subjects in the same in group in which they were randomized at the start of study and to prevent bias caused by unequal dropouts from both the groups . \n reasons for withdrawal should be documented according to the group in which subjects were randomized . \n itt principle is very important for pragmatic clinical trials where subjects are observed in real life situation and results are used to make policy decisions . \n findings related lost to follow up subjects should not be discarded as such and various methods for adjustment of missing data should be used to include these subjects in analysis . \n a flow chart should be given with manuscript so that patient randomization , recruitment , lost of follow up , withdrawal , no . of subjects included in final analysis can be seen visually . \n all statistical methods should be decided in advance in design phase of study and data dredging should be avoided just to get significant p values . \n use of all the statistical method in a trial needs to be documented with relevant description to facilitate the readers to validate and recalculate the finding as narrated by the authors . \n common statistical methods can be described in brief but some less common or obscure tests should be explained in detail . \n if more than one statistical tests are used it should be clearly mentioned and specified with reference to the which endpoint and data . \n many clinical trials that are being published are found with nonspecific statements for describing statistical tests for example chi - square test is used for categorical data or student t test is used for quantitative data or appropriate statistical tests were used for analysis of data . \n such inappropriate statements create lots of confusion in the mind of readers , particularly those from non - statistical backgrounds . \n authors should also take due precautions in narrating the version of test like paired or unpaired . \n ratio and interval data which follows the normal distribution should be described as mean ( sd ) . \n ratio and interval data not following the normal distribution should be described as median or range , as range is affected much by outliers so median should be considered as better method . \n as mentioned earlier in clinical trials usually the endpoints are biological variables and biological variables usually follows non normal or skewed distribution so median should be more frequently found in published literature . \n standard error of mean ( sem ) is not a descriptive statistics , sem indicates probability of falling of population mean around the range of sample mean . it does not show variability within the sample . \n value of sem is always less than sd so if group is described as meansem it can be falsely concluded that variability within the sample is less . \n so sd should be used in the place of sem . even for prediction for population \n meansd better method of presentation is mean ( sd ) as with this presentation confusion with confidence interval can be avoided . \n confidence interval should be given for the main outcome or important outcome measured in the study . \n this confidence interval should be the confidence interval of difference between two means not of individual group means . \n 95% confidence interval shows the probability of population mean value around a range in sample mean with 95% probability . \n probability in terms of p values has several shortcomings and can not be relied completely for decision making . \n p value may be significant but the difference between two groups for endpoints may not be as large to have some clinical significance . \n small differences between large groups can be statistically significant but clinically meaningless and large differences between small groups can be clinically important but not statistically significant . \n so confidence interval should be mentioned with the p value or instead of p value alone . in many of the clinical trials published in indian medical journals confidence interval is not narrated . \n < 0.05 or = ns , but exact p values should be mentioned . as per review of instruction to authors section of most of the indian medical journals , authors are instructed to write exact p value but still finding exact p value is not common in clinical trials . \n equally important is to remember that the reporting should not be done with unnecessary precision for both test statistic and p value . \n interpretation of the data obtained is very important for arriving to a valid conclusion . if there is no significant difference between two study groups it \n can not be concluded that there is no effect or no difference . \n non significant results may be because of any of the two reasons : either there is no actual effect of intervention or the study is underpowered to show that any worthwhile effect exists . \n one of the important reasons for less power of study is inadequate sample size . so during interpretation of results of clinical trial , sample size \n this issue becomes more important in the case of negative clinical trials as the non - significance may be a result of less power . \n so sample size should be calculated in design phase and in the case of negative clinical trials post hoc power calculation should be done . if multiple tests are used in the trials sufficient information regarding type 1 error should be mentioned in the manuscript . if some confounding factors are present than whether they are adjusted or not , should also be mentioned in the manuscript . \n below mentioned are few tips that are to be considered while reading , analyzing , interpreting or planning a clinical trial : \n endpoints in clinical trials should be divided into primary and secondary endpointssample size should be calculated before starting of clinical trial and all components of sample size calculation should be reported in manuscriptbefore applying any statistical test all the assumptions for that statistical test should be fulfilled and information regarding the same should be mentioned in the manuscriptbaseline demographic data of study groups should be compared to see if any heterogeneity is there but statistical tests should not be used . \n any heterogeneity should be corrected by adjusting the results through multivariate analysisappropriate statistical tests should be selected on the basis of aim of the study , type of data and distribution of datamultiple endpoints should be adjusted by methods like bonferroni , composite endpoint method etc.post hoc subgroup analysis should be avoidedmissing data analysis should be done . in pragmatic clinical trials intent to treat \n principle should be utilizedconsort statement should be followed during reporting of clinical trialsreference should be given for the less common or obscure statistical testsstatistical tests should be mentioned in enough detail so they can be replicated by readermean ( sd ) should be used in the place of meansemconfidence interval should be given for difference between the means for primary or important endpoints and should be given with or instead of p valueexact p values should be mentioned in the manuscript . \n endpoints in clinical trials should be divided into primary and secondary endpoints sample size should be calculated before starting of clinical trial and all components of sample size calculation should be reported in manuscript before applying any statistical test all the assumptions for that statistical test should be fulfilled and information regarding the same should be mentioned in the manuscript baseline demographic data of study groups should be compared to see if any heterogeneity is there but statistical tests should not be used . \n any heterogeneity should be corrected by adjusting the results through multivariate analysis appropriate statistical tests should be selected on the basis of aim of the study , type of data and distribution of data multiple endpoints should be adjusted by methods like bonferroni , composite endpoint method etc . \n post hoc subgroup analysis should be avoided missing data analysis should be done . in pragmatic clinical trials intent to treat \n principle should be utilized consort statement should be followed during reporting of clinical trials reference should be given for the less common or obscure statistical tests statistical tests should be mentioned in enough detail so they can be replicated by reader \n meansem confidence interval should be given for difference between the means for primary or important endpoints and should be given with or instead of p value exact p values should be mentioned in the manuscript .", "role": "user" }, { "content": "statistical methods are widely accepted tools for analyzing data and drawing appropriate conclusions . \n however , inappropriate statistical methods may lead to unsuitable or false conclusions . \n statistical quality of articles published in indian medical journals presents with statistical fallacies and very few attempts have been done to document it till date . \n issues related to inappropriate use of statistic in interpreting clinical trial raises serious doubt about the validity of the results published and there generalization to patient population . \n clinical trials are considered to have one of the highest evidences in terms of efficacy of any intervention and hence results reported in these clinical trials help in appropriate decision making in clinical practices . \n present manuscript is an attempt to have an insight into issues related to inappropriate use of statistic during clinical trials and suggests possible methods by which such fallacies can be averted .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: tumors are in permanent state of chronic inflammation , and lymphoproliferative syndromes are not only a collection of tumoral cells or a simple genetic disease . \n tumoral cells may give and receive instructions from other structural components , the tumor microenvironment , which is composed by extracellular matrix , stromal cells , neoangiogenic vessels and overall , the cells and cytokines that constitute the tumoral immune response . \n these elements constitute a complex signalling network where a delicate balance exists between microenvironment and tumoral cells . \n the products of mutated or deregulated genes contribute to the growth and invasion of tumoral cells , as well as to the expression of proteins with the ability to stimulate the immune response . \n the immunogenic capacity of the tumor can be evaluated by means of the study of the reactive infiltration , which is mainly composed by innate immune cells , especially macrophages , also granulocytes , eosinophils and mast cells , and adaptive immune cells , especially cytotoxic t cells \n ctls- , the most important suppressor of tumoral growth and target for vaccine approaches . \n the hypothesis of immunesurveillance postulates that one of the principal functions of the immune system would be recognizing neoplastic cells and eliminating them before they form tumors . \n this affirmation implies that in the absence of an effective immune system there is a high risk of developing cancer . \n truly , there is evidence involving the immune system in the protection from certain tumors , especially those associated with viral infections , tumors related with elderly , transplanted and immunosuppressed patients , and those lymphomas associated with epstein - barr virus ( ebv ) , kaposi 's sarcoma , and human immunodeficiency virus ( hiv ) . \n immune system is a nonlinear complex system , and its main function in cancer is acting as an effective suppressive system of tumors . \n however , as it occurs in the immunology of infectious diseases , an adequate immune response with enough magnitude to eradicate the microorganism or harmful pathogen is necessary . \n nevertheless , the system can behave in an ineffective manner , as the appearance of tumors in immunocompetent population shows . \n so , along with the concept of immunosurveillance as immune defensive process , the concept of immunostimulation also arises , meaning that the immune response might not only be ineffective but it might contribute actively to tumoral progression . among different molecular distinctive alterations of the lymphoproliferative syndromes , \n the role of the microenvironment has been studied extensively , and lymphocytes ( cytotoxic t cells ctl- and native killer \n nk- ) , macrophages , dendritic cells , and neutrophils constitute potential effectors of the antitumoral immunity . \n nevertheless , in the last few years a huge amount of evidence has emerged suggesting that these cells can also promote the growth and the development of the neoplasia , and that the immune system not only can affect the tumor , but the tumor itself may also alter the host immune system . \n the ability of the immune system to act as a double - edge weapon , protective or stimulating , indicates that tumoral clearance requires the effective coordination of the different elements of the immune system in an appropriate balance in quantity and quality . \n therefore , current cancer research in lymphoproliferative syndromes and other tumors aims to develop methods to increase the effectiveness of host antitumor immune response . \n this inevitably leads to consider tumors as more than an accumulation of neoplastic cells ; they might be more properly considered as a functional tissue immunologically mediated and formed by a complex tissue network in which neoangiogenesis , infiltrating immune competent cells , stromal cells , and a differentiated and specific extracellular matrix constitute the tumor microenvironment with the capacity of regulating cancer development . \n the interplay between the host immune system , malignant cells , and all other components of tumoral stroma determine proliferation , invasion , angiogenesis , and remodelling of extracellular matrix and metastasis . \n lymphoid neoplasms are functionally connected tissues dependent on the microenvironment , determining morphology and tumor classification , clinical behaviour , prognosis , and immune response to the tumor . \n perhaps one of the greatest exponents of the maxim that tumors constitute caricatures of normal tissues from which they arise might be the lymphoproliferative syndromes . in physiological conditions \n , the production of cellular elements corresponding to the immune system is an elaborated process , into which a series of main cells evolve in a sequential way , in a process of differentiation of each of the hematopoietic series . \n its shortcomings are implied in the pathogenesis of hematological malignancies . the hematopoietic microenvironment is constituted by a three - dimensional complex and highly organized structure , which serves to regulate the location , proliferation , and function of the hematopoietic cells . \n this is established by stromal cells , extracellular matrix ( ecm ) , cytokines , and chemokines . among stromal cells \n , there are macrophages derived from hematopoietic stem cells , fibroblasts , adipocytes , and osteoblasts . \n all of them are derived from mesenchymal stem cells in the bone marrow and from immature myeloid cells in the stromal tumor , along with the endothelia of the neoangiogenic tumor microvessels . \n the hematopoietic microenvironment not only has great importance in the physiology of hematopoiesis and the physiopathology of some leukaemia , but also in the formation of the intratumoral cell microenvironment , which structure corresponds to the ecm . \n ecm represents a biophysical filter that offers protection , nutrition , and cell innervation , giving way for immune response , angiogenesis , fibrosis , and tisular regeneration . \n its disruption supposes a functional loss for nutrition , elimination , cell denervation , regenerative capacity , and wound healing . \n this also causes the loss of the immune response to pathogens , tumor cells , and toxins . \n stromal tumor cells derive from progenitors of the bone marrow , which are mobilized across the circulation until joining the tumor microenvironment , where they will develop across different cellular lines in endotelia , fibroblasts , histiocytes , and macrophages and finally constitute the tumoral stroma . \n tumoral microenvironment is involved in the regulation of tumoral cell growth and the metastatic potential of the tumor , so it is determinant in the response to treatment . \n the collaboration of one of these cells in particular , the macrophage , turns out to be essential in the process of migration , invasion , and tumor metastasis . \n it seems that stem cells derived from the bone marrow represent the precursors of metastasis in distant sites , being those in charge to activate a suitable microenvironment , preparing an ideal niche to receive the tumoral cells . \n myeloid cells , with ctl suppressive activity , have a special importance because they are recruited by the soluble factors liberated by the proper tumor . there , and in the shape of intratumoral inflammatory monocytes , cd11b exert their powerful immunosuppressive action in a multistep process that could be interfered in each single step with the subsequent restoration of immune reactivity . \n tumor cells can express strange molecules recognized by the immune system and the expression patterns of these antigens vary among different tumors . these tumor antigens can be tumor - specific antigens ( tsa ) , which are exclusively expressed in tumor cells and easily evoke immune responses ; characteristic tumor antigens are tsa expressed only in one or a few tumor clones , harbouring peculiar typical mutations of these tumors ; tumor - associated antigens ( taa ) expressed both in normal and tumoral cells are often unable to induce immune response owed to tolerance mechanisms . finally viral antigens represent viral strange tumor proteins produced by oncogenic virus . \n tumor antigens recognized by t cells ( generally cd8 lymphocytes ) represent the principal target of antitumoral immunity and are presented by mhc class i molecules ; that is to say , that tumoral cells behave as antigen presenting cells ( apc ) , presenting their own antigens to t cells . \n naturally , professional apc can also present antigens to cd4 lymphocytes through mhc class ii molecules . \n tumors can be destroyed by means of specific ctl and an increase in tumoral immunogenicity is accompanied by the specific rejection of the tumor . \n most tumor antigens identified by specific ctl are products of aberrant gene expression and , surprisingly , are not mutated . \n products of oncogenes and mutated tumor suppressor genes may also be presented in association with mhc class i and/or class ii . \n both cd4 and cd8 t cells can respond to the products of these genes such as mutated ras gene , p53 and bcr - abl ; however , it appears that these responses are poorly protective . \n other tumor antigens are encoded by both rna and dna viruses that are implicated in tumor development . \n tumor cells synthesize and process viral peptide complexes that are presented bound to mhc class i , and therefore stimulate specific t cell responses . \n these antigens encoded by viruses are not tumor specific but are shared by all tumors induced by the same type of virus . in particular , the protective function of the immune system in controlling virus - induced tumor dna is given by the high frequency of these tumors in immunosuppressed patients , such as ebv - associated lymphoma . \n the main elements are t cells and especially cd8 cytotoxic t lymphocytes ( ctls ) that destroy tumor cells via the triggering of apoptosis , and providing effective antitumor immunity in vivo . \n they are predominantly cd8 and carry out their function of surveillance by means of the recognition and destruction of potentially malignant cells , which express peptids derived from mutated cellular proteins or oncogenic viral proteins , presented in affiliation to mhc class i molecules . \n the cd4 helper t cells are traditionally considered as noncytotoxic , although new evidence is emerging against this concept . actually , at least four distinct cd4 t - cells subsets have been described : th1 , th2 , th17 , and treg cells , each one with a unique cytokine secretion pattern and function . \n of course one of their primary roles is providing cytokines for the development of ctl , in addition to being able to secrete tnf and ifn - gamma , which can increase the expression of mhc class i by the tumor cell and therefore increase its sensitivity to ctl lysis . \n immunoregulatory cytokines such as il-10 and tgf - beta play an important role in immune tolerance , and it seems that suppressor effect of t cd4cd25 is independent of cytokines . among natural cytotoxic cells , natural killer cells ( nk cells ) can be activated directly by contact with the tumor or as a result of the stimulus provided by cytokines such as interferons , tnf , il-2 , and il-12 , released by tumor - specific t lymphocytes and macrophages ; therefore , their activity is endowed with some degree of specificity . in addition , lymphokine - activated killer cells ( lak ) are a group of nk cells derived from peripheral blood cells or til in patients with high concentrations of il-2 and show a high capacity , nonspecific in this case , to lyse tumor cells . \n macrophages are cellular mediators capable of lysing tumor cells by releasing a large amount of lysosomal enzymes and reactive oxygen metabolites . once activated they also produce cytokines such as tumor necrosis factor ( tnf ) that exerts its cytotoxic activity triggering apoptosis in a similar way to that mediated by fas ; it has indirect effects on tumor vasculature and vascular thrombosis and produces free radicals from which normal cells are protected by the secretion of superoxide dismutase , but not tumoral cells . \n dendritic cells ( dc ) and other antigen presenting cells ( apc ) are dispersed between tissues as sentinels or alarm systems ready to detect the presence of foreign antigens . while in the tumor microenvironment il-12 production tends to be suppressed , resulting in a decrease in th1 activity , \n dcs represent probably the most important regulators of nave t cells , with a great capacity to produce and release il-12 . in their process of polarization , \n dcs are under the influence of inflammatory mediators such as prostaglandins produced by macrophages , fibroblasts , and tumor cells . \n a new route of junction between innate and adaptive immunity through the interaction between dc and nk cells has been suggested . \n finally , it is believed that antibodies are less important than the t cells to mediate antitumor immune response . however , there are ab responses specifically against viral ag , as in patients with ebv - associated lymphomas . \n the tumor microenvironment consists of a specific mixture of immune cells that express a distinctive profile for each tumor type , from which the efficacy of the immune response against the tumor is eventually derived . \n especially polynuclear neutrophils , dendritic cells , macrophages , nk cells , and mast cells play an important functional role in preneoplastic and tumoral tissues . \n differences in gene expression profiles of malignant cells in lymphoproliferative syndromes do not always determine the aggressiveness of the lymphoma , while recent contributions determine the increasing importance role of cellular microenvironment in prognosis and disease progression . \n so , while the activation of the immune response in advanced stages may be beneficial to the host , its activation during early stages can stimulate tumor development . \n although lymphoid cells infiltrating the tumors are often considered as cytotoxic to tumor cells , these cells often contribute to the oncogenic process , tumor growth , and dissemination . \n specific cells are responsible for activating specific processes within the tumor tissue , as occurs with mast cells and tumor neovascularization . \n dendritic cells and macrophages may provide growth factors to malignant cells , sometimes instigated by viral sequences from stromal cells and not tumor cells themselves . \n the same cell in different microenvironments can act differently , as befits its power of dialogue and dynamic response to stimuli from the stromal environment . \n lymphoproliferative syndromes are mainly distinguished by specific clinical factors and characteristic molecular alterations of low- and high - growth fraction lymphomas . \n lymphomas with smaller fraction of growth include follicular lymphoma ( fl ) , marginal zone lymphoma ( mzls ) , mantle cell lymphoma ( mcl ) , and chronic lymphocytic leukaemia b ( b - cll ) , which as a group share a paradoxical combination of advanced clinical stages associated with a low clinical aggressiveness . \n by contrast , lymphomas with high - growth fraction , including diffuse large b cell lymphoma ( dlbcl ) and burkitt lymphoma ( bl ) , are frequently associated with clinically localized stage but a high clinical aggressiveness . \n each of these groups appears to accumulate specific molecular proliferative and apoptotic changes , but differences in gene expression profiles of malignant cells do not always determine the aggressiveness of the lymphoma . \n a wide repertoire of specific cell subpopulations constitutes the tumor microenvironment of each lymphoproliferative syndrome , with important diagnostic , prognostic , and therapeutic implications ( table 1 ) . \n the nature , role , and specificity of effector cells that are capable of inhibiting the growth of t and b - cell lymphomas in vitro and in vivo in immunocompetent individuals have been studied extensively . \n the number and especially the activation status of infiltrating cells appear to be independent of the degree of malignancy in hodgkin 's lymphoma and various b and t cell non - hodgkin 's lymphomas . \n the reactive microenvironment determines not only histological morphology and immune phenotype , but also the clinical outcome of lymphoproliferative syndromes . \n some of them , such as hl , slow growing tumor as fl , fast growing tumor as dlbcl or t cell lymphomas , are going to be revised briefly in the next paragraphs ( table 1 ) . \n as if tumoral entities were sculpted by the immune system , the presence of a characteristic inflammatory background not only distinguishes hodgkin lymphoma ( hl ) from other lymphomas , but even more , this is the main characteristic that makes hl a separate entity itself allowing its diagnosis . \n tumor cells of hl - pln and the tcrbcl are the same or very similar , nevertheless we classify these two diseases differently depending on the accompanying tumor microenvironment . thus , hl and other germinal centre - derived lymphomas can be differentiated through their cellular microenvironment . \n regardless of the classic clinical and pathological features , some studies have shown that the presence of activated ctls ( granzyme b ) is associated with an unfavourable follow up of hl patients . \n there is a predominance of activated cd4 t cells in the background of the tumor and a high number of cytotoxic t lymphocytes around the hodgkin / reed sternberg cells ( h / rs ) . \n cd4 t cells produce th2 cytokines that could contribute to local suppression of the cellular immune response mediated by th1 . \n however , the categorization of cd4 t cells in th1 and/or th2 is an oversimplification as regulatory t cells with cd4cd25 phenotype not only play a regulatory role of autoimmunity , but also have suppressive effects on the development of antigen - reactive lymphocytes associated with the tumor . \n functional and molecular characterization of these cells has been facilitated by the identification of markers such as foxp3 , which acts by converting nave t cells cd4cd25 into the regulatory phenotype cd4cd25 . \n these regulatory t cells can inhibit the production of il-2 as well as upregulating the expression of il-2ra ( cd25 ) , delaying or blocking the activation of cd8 cells and nk cells against tumor antigens . in hl , \n the immunosuppressive properties of regulatory t cells appear to be particularly important because of its large effect on cellular cytotoxicity represented by ctls and nk cells . \n the presence of low numbers of foxp3 cells and a consequent high rate of tia-1 cells in the infiltrate represents an independent prognostic factor negatively affecting the survival of the disease . \n furthermore , when the disease relapses and progresses , larger number of tia-1 cells and lower proportion of foxp3 on the reactive background of the tumor are also prone to be seen . there is a significant loss of intratumoral cd4 t cells ( an inversion of cd4/cd8 ratio ) and a decrease of intratumoral activated ctls in hiv - infected hl patients . \n all these data are of interest due to the possibility to significantly expand tumor - induced cd4 tregs by the application of therapeutic cancer vaccines \n . a plausible explanation of the extensive inflammatory infiltrate present in hl could be the secretion of a variety of cytokines produced by both tumor cells and the surrounding stromal tissue . \n h / rs cells produce and secrete high amounts of chemokines , including tarc and mdc , which attract lymphocytes expressing the ccr4 receptor . \n in addition , immune cells themselves can produce cytokines responsible for proliferation and tumor survival . within the complexity of the interactions between the inflammatory reaction and hl tumor cells , immune cells present in the infiltrate can modulate apoptosis and proliferation of tumor cells . the antiapoptotic profile observed in h / rs cells \n is associated with a general increase in infiltrating cd4 t cells and a general decrease in infiltrating cd8 t lymphocytes , nk cells , and dendritic cells . \n the progression of g1/s tumoral phase and the high rate of proliferation are also strongly associated with higher infiltration of the overall immune response against the tumor . \n these results point to the regulation of proteins involved in apoptosis and proliferation of tumor cells by direct interactions between these cells and the surrounding inflammatory microenvironment . \n this opens up new approaches for research and treatment of hl through the modulation of host immune response . \n fl is recognized as a disease of functional b cells , in which t - cell costimulation is essential in the maintenance and ongoing development of b - cell secondary follicles [ 33 , 34 ] . \n since the fl represents the tumoral counterpart of germinal centre b cells and resembles its follicular architecture , the development of this lymphoma may be closely linked to interactions with cellular components of the microenvironment , including dendritic and t cells inside the follicle . \n it is said that the relationships between tumoral cells and microenvironment can follow three distinct patterns : a loss of interconnection with the immune response to the tumor , a dysfunctional environment , and a friendly , regulated coexistence of the malignant and immune cells . \n fl seems a good example of the latter pattern , a disease usually indolent and with a long median survival in which at least 15% or greater may experience spontaneous remission , sometimes after acute viral illness and with rapid responses after vaccine therapy . \n in addition , tumor microenvironment but not tumor cells could be the fundamental key to choosing the most appropriate chemotherapeutic regimen for these patients . at molecular level , \n survival of patients with fl appears to correlate with the characteristics of nonmalignant immune cells present in the tumor at diagnosis through two patterns of gene expression . \n type 1 immune response pattern is associated with longer survival and includes a complex mixture of t cells and other immune cells , while type 2 pattern is associated with shorter survival and includes genes that encode no markers of innate immune cells , primarily macrophages . \n the differences in the biology of the host immune response determine the clinical course and prognosis of patients with lf , and not the genetic alterations of the tumor cells themselves . at cellular level \n , the relationship between cellular elements of specific and nonspecific cell - mediated immunity implies that fl is an immunologically functional disease in which an interaction between the tumor cells and the functional composition of the microenvironment determines their clinical behaviour . \n the general mechanisms involved in fl tumor immunity have been principally attributed to cd4 t helper lymphocytes , cd8 cytotoxic t - cells ( ctls ) , nk cells , and macrophages . \n the presence of modulating foxp3 t - cells has also proved to have an important role in the host immune response . taken as a whole , the results of these studies have highlighted the existence of two principal immune facts in which the presence of t lymphocytes and regulatory t cells is related to a favorable outcome , whereas the presence of tumor - associated macrophages ( tam ) and nk cells is more usually associated with a poor prognosis . \n dysfunctional immune profiles in the tumor microenvironment of fl seem to be attributed to the state of functionality of regulatory t cells , the presence of a particular subset of cd57 cells , and the reprogrammed immune cells such as tams [ 37 , 38 ] \n . the favorable clinical impact of the high number of tregs in fl may be due to a direct inhibitory effect on neoplastic b - cells and the inhibition of tumor - infiltrating leukocytes that can facilitate tumor progression by secreting various growth factors and proteases . \n however , in epithelial carcinomas these cells correlated inversely with clinical outcome , representing the dominant immune escape mechanism early in the tumor progression but not in late phases . \n these different behaviors seem to be secondary to different mechanisms of immune response regulation from tregs in fl and in solid tumors . \n tregs have numerous lymphoid targets , including cd8 t cells , b cells , nk cells , and dendritic cells . \n when the control of the immune response is misguided , tregs cells can induce immunosuppressive mechanisms through the attenuation of tumor - specific cd8 t - cell killing and restricted nkt cells . \n in addition to foxp3 tregs cells , cd57 cells appear to represent another marker of general immune dysfunction in fl . \n unlike t cells and macrophages , a higher infiltration of cd57 cells appears to be related to unfavorable clinicobiological factors in fl patients . \n cd57 is expressed on nk cells , one of the major effector cells in cellular cytotoxicity together with ctls . \n the nonspecific inflammatory infiltrate ( cd57 cells and cd68 macrophages ) seems to be mainly involved in the control of growth and expansion of tumoral cells whereas the specific immune infiltrate ( cd4 and cd8 t lymphocytes ) seems to be mainly involved in the host immune response against the tumor and the main clinical features . \n both systems seem to emerge directly associated with the capacity to disseminate tumoral cells , as shown by the greater infiltration of t lymphocytes observed in low - grade fl with spontaneous regression , the relatively low absolute number of t cells observed on transformation , and the role of nave and memory t cells in downregulating tumor proliferation rate . \n although in a non - restrictive cohort of fl patients was considered , the presence of cd68 tam tended to be associated with an indolent clinical behavior and longer survival , cd68 tam appeared to be associated with an unfavorable outcome for fl patients . \n the specific subsets of activated macrophages evaluated by the expression of stat1 may be considered as prototypic type 2 polarized macrophages reprogrammed to induce in situ immune suppression . \n tams seem to have a dual nature that appears to be specific to the tumor type . depending on the microenvironment \n , they may either exhibit antitumor cytotoxic activity or facilitated tumor growth and progression while reinforcing the th2-biased immune response . \n polarized m1 and m2 ( or alternatively activated ) macrophages differ in terms of receptor expression , effector function , and cytokine and chemokines production . \n regardless of functional defects or absence of activation , in most of the cases tam do not exhibit cytotoxic activity and facilitate tumor growth , angiogenesis , and metastasis , that is , th1 immunosuppressive response . \n tam products act in two manners to support tumor progression , on one hand , they support tumor growth angiogenicity and extracellular matrix degradation , and on the other hand , they suppress potential antitumor activities . \n recent molecular studies show that survival of patients with dlbcl is influenced by immune cells , fibrosis , and angiogenesis of tumor microenvironment . \n stromal-1 signature genes encode components of the extracellular matrix and antiangiogenic factors , while stromal-2 signature genes encode markers of endothelial cells and key regulators of angiogenesis . \n this survival model reflects the character of nonmalignant cells in dlbcl , including tams and myeloid - derived suppressor cells . at immunophenotypical level \n , the component of nonmalignant infiltrate can vary among the different subtypes of dlbcl , with the greatest exponent provided by the t cell / histiocyte rich b - cell lymphoma . \n the presence of an increased number of activated cd4 t cells as well as dendritic cells and macrophages seems to predict a better prognosis of dlbcl . \n the dlbcl negative for gene expression of mhc ii have few cd8 t cells infiltrating the tumor and a high percentage of activated ctls , both of them representing a powerful adverse prognostic factor . \n a specific subgroup of patients with dlbcl defined in terms of host response has been identified ; in this type of response , an increased expression of nk / t cell , monocyte - macrophages , and dendritic cells ( dcs ) markers as well as inflammatory mediators can be observed . \n moreover , those cases with an infiltrate greater than 20% of cd4 cells , including cd45ro , show a trend towards better survival . although it is possible that the role of the microenvironment as a whole can be dual , depending on the tumor , the patient , and the functional status of the host immune system . an effective cytotoxic response represented by a dense ctl infiltrate and numerous accompanying reactive cells including a high number of foxp3 treg cells seems to be accompanied by better prognosis in dlbcl . \n the presence of interdigitating dendritic cells associated with infiltrating t cells is involved in coordinating the immune response . \n however , tumor cells also seem able to modulate the maturation of dendritic cells so they can remove the ability of these cells to process and present tumor antigens . \n a higher expression of th1 than th2 response has also been observed in patients who achieved complete remission , and a significant decrease in il-6 ( th2 response ) during the first weeks after therapy in patients with aggressive nhl seems to predict complete remission . in these patients , a germinal center phenotype ( bcl-6/cd10 ) \n frequently , in t - nhl , the microenvironment cellularity represents the bulk of the tumor , and the clinicobiological manifestations of disease reflect a deregulated immune response rather than the effect of tumoral cells . in ptcl as well as in aitl , a follicular helper t cell tumor , once again , there is not an association between gene clusters and their histological subtypes . \n t cell lymphomas characteristically present a great number of monocytes that promote survival of malignant cells . \n another lymphoma characterized by the significant presence of reactive lymphocytes around tumor cells is anaplastic large cell lymphoma ( alcl ) , where infiltration of a high percentage of activated cytotoxic cells ( granzyme b ) is an unfavorable prognostic marker , especially when combined with the lack of expression of alk . \n the mechanisms by which tumor cells escape the ctl attack have been scarcely investigated , although among the postulated mechanisms , the downregulation of mhc i molecules , the expression of il-10 , the expression of fas - l in tumor cells , overexpression of bcl-2 , and also the expression of pi9 , an inhibitor of proteolytic activity of granzyme b , have been considered . \n the foxp3 tregs cells predicted improved clinical outcome in extranodal nk / t lymphomas , whereas a decreased number of these cells are more common in patients with poor performance status . \n therapeutic applications of immune responsethe immune system appears to be essential for therapeutic success if we consider that it can eliminate definitively residual cancer cells that remain after chemotherapy . in this sense , therapy applied during tumor escape phase can inhibit suppressive mechanisms of tumor - induced tolerance , boost t and/or b cells , or stress tumor cells in such a way that tumor cells become immunogenic and sensitive to lysis . the simple reduction of the tumor mass by chemotherapy or surgical removal may also reduce its immunosuppressive properties , reversing tumor - induced immune tolerance and restoring the antibody- and cell - mediated immune responses . on the relationship between the tumor and the immune system , \n a bidirectional interaction between tumor and inflammatory / immune cells is ultimately responsible for orchestrating the immunosuppressive network at the tumor site . \n the manipulation of one of these partners may consistently influence the other . looking for new modalities of cancer treatment , \n the induction of a potent and specific immune system has been described as a logical and reasonable strategy for controlling tumor evolution . \n the different strategies that have been used to improve immunity against tumors include vaccination to provide antigens to the patients ' immune system , providing costimulatory signals on tumor cells , induction of cell death with cytotoxic drugs , sustaining immune effectors with nk , nkt , or dc adjuvant , and improving efficiency of cross - priming . \n if anticancer immune responses dictate long - term therapeutic success , then local signs of antigen priming ( dcs ) or nk and t cell responses would correlate with favorable responses.in conclusion , different entities of lymphoproliferative syndromes , independently whether they are hl or nhl , b or t cell lymphomas , and fast or slow growing tumours , have specific patterns of immune responses associated with their morphologic aspect , their immunophenotype , their clinicobiologic course , outcome and the probable response to the therapeutic drug used in their clinical management . among the nonspecific immune response , a clear distinction can be made between activated and nonactivated ctl , with different significance in various lymphomas . \n there is a specific machinery to control the tumor microenvironment , represented fundamentally by treg cells , foxp3 , cd57 t cells , and tams . \n chemotherapy can inhibit a tumor - promoting immune reaction but may in fact be an example of immunotherapy depressing mast cells and macrophages that secrete factors with the ability of promoting tumor growth . in the search of new modalities of lymphoma treatment , the induction of a specific immune response through effective immunotherapy appears to be a promising route of help for these patients and their clinicians . \n the immune system appears to be essential for therapeutic success if we consider that it can eliminate definitively residual cancer cells that remain after chemotherapy . in this sense , \n therapy applied during tumor escape phase can inhibit suppressive mechanisms of tumor - induced tolerance , boost t and/or b cells , or stress tumor cells in such a way that tumor cells become immunogenic and sensitive to lysis . \n the simple reduction of the tumor mass by chemotherapy or surgical removal may also reduce its immunosuppressive properties , reversing tumor - induced immune tolerance and restoring the antibody- and cell - mediated immune responses . on the relationship between the tumor and the immune system , \n a bidirectional interaction between tumor and inflammatory / immune cells is ultimately responsible for orchestrating the immunosuppressive network at the tumor site . \n looking for new modalities of cancer treatment , the induction of a potent and specific immune system has been described as a logical and reasonable strategy for controlling tumor evolution . \n the different strategies that have been used to improve immunity against tumors include vaccination to provide antigens to the patients ' immune system , providing costimulatory signals on tumor cells , induction of cell death with cytotoxic drugs , sustaining immune effectors with nk , nkt , or dc adjuvant , and improving efficiency of cross - priming . \n if anticancer immune responses dictate long - term therapeutic success , then local signs of antigen priming ( dcs ) or nk and t cell responses would correlate with favorable responses . in conclusion , \n different entities of lymphoproliferative syndromes , independently whether they are hl or nhl , b or t cell lymphomas , and fast or slow growing tumours , have specific patterns of immune responses associated with their morphologic aspect , their immunophenotype , their clinicobiologic course , outcome and the probable response to the therapeutic drug used in their clinical management . among the nonspecific immune response \n , a clear distinction can be made between activated and nonactivated ctl , with different significance in various lymphomas . \n there is a specific machinery to control the tumor microenvironment , represented fundamentally by treg cells , foxp3 , cd57 t cells , and tams . \n chemotherapy can inhibit a tumor - promoting immune reaction but may in fact be an example of immunotherapy depressing mast cells and macrophages that secrete factors with the ability of promoting tumor growth . in the search of new modalities of lymphoma treatment , the induction of a specific immune response through effective immunotherapy appears to be a promising route of help for these patients and their clinicians . \n lymphomas represent a wide group of heterogenic diseases with different clinical behaviours , and nowadays , the three main options in lymphoma 's armamentarium remain to be chemotherapy , radiotherapy , and passive immunotherapy ( monoclonal antibodies ) . \n chemotherapy remains the treatment modality of choice for most lymphomas , especially in advanced stages . \n different cytotoxic drugs destroy tumor cells by apoptosis , a process mediated by the activation of caspases and exposure of phosphatidylserine residues in the outer leaflet of the cell . \n apoptosis destroys billions of cells in an adult lifetime as a consequence of physiologic tissue renewal and cell turnover without leading to any adverse inflammatory or autoimmune phenomena . \n thus , programmed cell death has been traditionally considered as immunologically bland or nonimmunogenic . however \n rather , it seems that apoptosis is a heterogeneous process , that under some circumstances may lead to immunogenic effects . \n recent studies focus on apoptosis and tumor suppressor pathways in cancer and suggest that some chemotherapeutics may induce tumoral destruction which improves cancer cell recognition by the immune system [ 68 , 69 ] . \n anthracyclines remain one of the drugs of choice against lymphoproliferative diseases for hodgkin 's and non - hodgkin 's lymphomas and is included in most of the first line chemotherapy schedules . \n there is now clear evidence that anthracyclines may promote apoptosis in cancer cells with immunogenic effects through several mechanisms ( figure 1 ) . \n ( 1 ) calreticulinanthracyclines facilitate the translocation of intracytoplasmic protein calreticulin ( crt ) to the cell surface , inducing the apoptotic cell antigen presentation to antigen presenting cells ( apcs ) , in particular dendritic cells ( dc ) , and stimulating specific antitumor t cell responses . \n anthracyclines facilitate the translocation of intracytoplasmic protein calreticulin ( crt ) to the cell surface , inducing the apoptotic cell antigen presentation to antigen presenting cells ( apcs ) , in particular dendritic cells ( dc ) , and stimulating specific antitumor t cell responses . \n ( 2 ) high - mobility group box 1 ( hmgb1)another immunogenic determinant of cell death is the pro - inflammatory factor hmgb1 . \n hmgb1 is a nuclear protein that is released after necrotic cell death and , as recently reported , from dying cells during late stage apoptosis . \n after cell death induced by anthracyclines and alkylating agents , hmgb1 may be released in the stroma and act as a neo - antigen representing an immunogenic endogenous \n danger signal , initiating an inflammatory response through binding toll - like receptor 4 ( tlr4 ) on dc ( but not other dc receptors , such as rage or tlr2 ) . \n myd88 is one downstream effector of tlr4 , and nowadays there is clear evidence which supports that immunogenicity triggered by anthracyclines is exclusively dependent on an intact tlr4-myd88 signalling pathway . \n hmgb1 is a nuclear protein that is released after necrotic cell death and , as recently reported , from dying cells during late stage apoptosis . \n after cell death induced by anthracyclines and alkylating agents , hmgb1 may be released in the stroma and act as a neo - antigen representing an immunogenic endogenous \n danger signal , initiating an inflammatory response through binding toll - like receptor 4 ( tlr4 ) on dc ( but not other dc receptors , such as rage or tlr2 ) . \n myd88 is one downstream effector of tlr4 , and nowadays there is clear evidence which supports that immunogenicity triggered by anthracyclines is exclusively dependent on an intact tlr4-myd88 signalling pathway . \n ( 3 ) dna damaging agentsalkylating chemotherapeutic agents , such as cyclophosphamide , induce the expression of nkg2d ligands . \n nkg2d acts as an activating receptor on nk cells , t cells , nkt cells , and memory cd8 t cells , giving raise to the possibility that dna damage response may induce immune system activation [ 68 , 73 ] . \n nkg2d acts as an activating receptor on nk cells , t cells , nkt cells , and memory cd8 t cells , giving raise to the possibility that dna damage response may induce immune system activation [ 68 , 73 ] . \n ( 4 ) secondary necrosisalthough not specific for anthracyclines , when massive chemotherapy cell destruction occurs , the mechanisms of controlled apoptosis are overwhelmed and a secondary necrosis occurs triggering an inflammatory response mediated by the intracellular inflammation mediators release , as uric acid , heat shock proteins ( hsp ) , and il-12 . \n although not specific for anthracyclines , when massive chemotherapy cell destruction occurs , the mechanisms of controlled apoptosis are overwhelmed and a secondary necrosis occurs triggering an inflammatory response mediated by the intracellular inflammation mediators release , as uric acid , heat shock proteins ( hsp ) , and il-12 . \n ( 5 ) cross - presentationcross - presentation is a mechanism favoured by some antineoplastic drugs such as anthracyclines or gemcitabine . \n these drugs allow tumor antigens to be presented to mhc class i pathway through apcs , a pathway previously thought to be restricted to class ii pathway . \n this mechanism allows tumor antigen presentation to both cd4 t and cd8 t cells which will subsequently identify and destroy the remaining tumour cells , but paradoxically apoptotic cells lead to secretion of vegf that promote the proliferation of endothelial cells and other survival factors that stimulate extracellular matrix with many other implications . \n cross - presentation is a mechanism favoured by some antineoplastic drugs such as anthracyclines or gemcitabine . \n these drugs allow tumor antigens to be presented to mhc class i pathway through apcs , a pathway previously thought to be restricted to class ii pathway . \n this mechanism allows tumor antigen presentation to both cd4 t and cd8 t cells which will subsequently identify and destroy the remaining tumour cells , but paradoxically apoptotic cells lead to secretion of vegf that promote the proliferation of endothelial cells and other survival factors that stimulate extracellular matrix with many other implications . \n ( 6 ) eradication of tumor cells by chemotherapyimmune - inhibitory molecules released by tumor cells , such as interleukin-10 ( il-10 ) or tumor growth factor- ( tgf- ) which inhibit t cell activation , or il-10 , \n il-6 , and vascular endothelial growth factor ( vegf ) , involved in the maturation and differentiation of dendritic cells ( dcs ) , are downregulated as a result of the use of chemotherapy after an effective cell destruction . \n immune - inhibitory molecules released by tumor cells , such as interleukin-10 ( il-10 ) or tumor growth factor- ( tgf- ) which inhibit t cell activation , or il-10 , il-6 , and vascular endothelial growth factor ( vegf ) , involved in the maturation and differentiation of dendritic cells ( dcs ) , are downregulated as a result of the use of chemotherapy after an effective cell destruction . \n therefore , emerging evidence led lake and robinson to announce a paradigm shift in the way of understanding the effects of chemotherapy on the surrounding stroma [ 76 , 77 ] . \n ct can induce a highly potent immune response by increasing antigen ( neoantigens ) threshold and presentation ( via apcs ) , with enhancement of t - cell response and generation of memory t cells . \n other chemotherapeutics like cyclophosphamide , etoposide , and taxanes ( docetaxel and paclitaxel ) have also proved to have an immunogenic effect in preclinical models [ 78 , 79 ] ; however , evidence is scarce and further investigation is required . \n these new concepts may serve to consider chemotherapeutics like anthracyclines as less empirical and more specific drugs , and then customizing treatments taking into account its potential effects on microenvironment . among different molecules and cells activated as a result of immunogenic cancer cell death mediated by chemotherapy , antigen presenting cells ( apcs ) , in particular dendritic cells ( dc ) , seem to play an essential role . \n this is particularly true because tumor reactive t cells are often anergic because of inappropriate antigen exposure or owed to self - recognition . on the contrary , immunogenic tumor cell death mediated by some chemotherapies \n is characterized by a temporal sequence of events including early translocation of calreticulin to the cell surface , and thereafter interaction of crt with multiple receptors on dc with apoptotic bodies phagocytosis , release and exposure of heat shock proteins , and late release of hmgb1 . \n hmgb1 is able to bind to the tlr4 receptor on dc , which allows tumor derived antigens to be processed and presented along with mhc and costimulatory molecules on the surface of dc [ 68 , 69 ] . \n these mechanisms altogether serve to trigger dc - mediated specific antitumor response , which may be enhanced by the use of costimulatory molecules . \n costimulatory molecules provide additional or second signals for lymphocyte activation beyond those provided through the antigen receptor . \n gm - csf has pleiotropic properties , including the mobilisation , differentiation , and function of dendritic cells , possibly by reversing the host 's immune tolerance to its own tumor associated antigens , and by initiating ( priming ) immune responses for which immunologic memory has not been established , that is , activating the so - called nave t cells . \n the proliferation of nave lymphocytes during the first encounter with an antigen ( primary immune response ) generates both effector t and b cells and memory t and b cells . \n memory cells enable a quantitatively and qualitatively superior secondary immune response to be mounted after a subsequent encounter with the same antigen . \n gm - csf has been studied in the clinical setting in relapsed follicular lymphoma , along with rituximab , showing promising results . in a phase 2 trial , combination of rituximab with gm - csf attained 70% overall response rate ( orr ) and 39% complete response rate ( crr ) , which compares favourably with rituximab as single therapy against relapsed follicular lymphoma ( crr of 6% ) . \n this synergism can be explained , at least in part , by the antibody - dependent cellular cytotoxicity ( adcc ) of rituximab , which is enhanced by gm - csf . \n interestingly , a molecular substudy was executed , demonstrating that this immunotherapy schedule increases the counts of numerous immune cells , particularly monocytes and granulocytes . \n however , there were no differences between cr and non - cr patients in the mean and ratio pre- or postimmunotherapy counts . \n some groups argue that maybe a better way of analyzing the impact of these therapeutic approaches would be determining the magnitude of accumulation of the effector cells at tumor sites , and not only blood levels , with semiquantitative measures through radiolabeling autologous granulocytes or mononuclear white blood cells with indium-111 labeled oxine . \n the latter would be a highly interesting approach to monitor immune response in vivo , especially if it correlates with clinical efficacy . \n though indications have diminished in the last years , radiotherapy still remains the treatment of choice for curative purposes in localized low - grade non - hodgkin 's lymphomas and hodgkin 's lymphoma , and even in high grade non - hodgkin 's lymphomas as a consolidation treatment after ct in sites of initial bulky disease . \n intrinsic radiosensitivity of malignant lymphocytes is extremely high ; however , the underlying mechanisms which explain it are not fully elucidated . \n recently , new evidence is emerging about some changes induced by radiation at a molecular level , which may provoke a type of cell death highly immunogenic . outside the field of treatment \n , radiation therapy can activate cells of the immune system to produce proinflammatory mediators of genomic instability . \n curiously , outcome of the inflammatory response triggered by radiation can be beneficial or detrimental depending upon the context , which is related with the type of macrophages activated ( m1-proinflammatory or m2-woundhealing ) . \n moreover , ionising radiation has different immune effects regarding the dose administered , so in the case of low doses , the final effect is mostly protumorigenic . on the contrary , at higher doses with cytotoxic activity \n , cell death may induce tumoral neoantigens which can be embraced by dendritic cells , and thus activate an effective adaptive immune response . \n as with anthracyclines , the two critical mediators of this process seem to be translocation of calreticulin to the cell surface and release of hmgb1 by the dying cells ( figure 1 ) . \n in addition , surviving cancer cells after radiation show increased expression of death receptors , adhesion molecules ( icam-1 ) , and major histocompatibility complex class i ( mhc - i ) , which activate apcs [ 90 , 91 ] . once apcs are activated , essentially dendritic cells ( dcs ) , they migrate to the tumor - draining lymph nodes , where nave t cells can be activated through interaction with tumor - derived antigens presented by dcs . \n preclinical studies have also revealed that irradiation of the tumour site may induce release of chemotactic cytokines , that regulate the transit of leukocytes , especially effector t cells , from blood into tumors . \n sequence of immune events generated by radiotherapy is critically important , since radiation of loco - regional lymph nodes , which is a common procedure in daily practice , may alter and disrupt the possibility of an effective immune response by depleting nave t cells . \n theoretically , molecules like anti - ctla4 monoclonal antibodies , or costimulators such as gm - csf , interferons , or il-2 , may serve as boosters , amplifying immune effectors triggered by radiotherapy . \n so , if these new concepts are finally confirmed in the clinical setting , it will probably translate into a new way of administering radiotherapy in the coming future . \n more than any other discovery , widespread use of monoclonal antibodies ( mabs ) in daily practice has dramatically improved clinical results in terms of disease - free survival and overall survival in many types of lymphomas . \n this is especially true for rituximab , a chimeric monoclonal antibody targeting the cd20 antigen found on both normal b cells and on most low - grade and some high grade b - cell lymphomas . \n it is effective as a single agent in induction and maintenance therapy , though it is primarily used in combination with standard chemotherapies in the treatment of patients with non - hodgkin 's b - cell lymphomas and chronic lymphocytic leukemia . \n although its mechanisms of action are not fully elucidated , rituximab can induce killing of cd20 cells ( 95% of malignant b lymphocytes ) via multiple mechanisms . \n direct effects of rituximab encompass complement - dependent cytotoxicy ( cdc ) and antibody - dependent cell - mediated cytotoxicity ( adcc ) , which are retained as the major mechanisms of action of rituximab on b - cell lymphomas . \n the indirect effects include structural changes , b - cell apoptosis , and sensitization of cancer cells to chemotherapy [ 83 , 93 ] . \n the complement system can trigger three protease cascades known as the classical , mannose binding lectin ( mbl ) and alternative pathways . \n all three pathways converge at the c3 and c5 levels , leading to the formation of a membrane attack complex ( mac ) that , if remains open , will directly induce targeted cell lysis by osmotic mechanisms . \n specifically , rituximab activates the classical complement cascade by interacting with c1q through its fc region , exposed after binding with cd20 on the b - cell surface , forming macs and subsequent cytolysis . \n along with cdc , rituximab - mediated adcc is important for the elimination of malignant b lymphocytes . \n adcc triggers tumor cell killing through interaction between the fc region of cd20 binding rituximab and fcrs . \n the final effect is releasing of inflammatory and cytotoxic immune modulators , which lead to phagocytosis of targeted cancer cells by monocytes / macrophages and granulocytes / neutrophils , or lysis mediated by nk cells using the granzyme - perforin system [ 83 , 96 , 97 ] . \n some cytokines may aid adcc to enhance cytotoxicity and avoid antibody - targeted tumor resistance to innate immune cells . \n again , gm - csf has demonstrated in vitro enhancement of cytotoxicity upon lymphoma cells through upregulation of monocyte fcrs . \n interleukin-2 ( il-2 ) activates selective immune effector cell responses associated with antitumor activity , since il-2-activated nk cells strongly enhance activity of rituximab through adcc in primary b - cell nhl . \n moreover , il-2 acts as a chemokine , inducing activation and traffic of monocytes and nk cells to tumors . \n other cytokines as il-12 also synergize the rituximab effect by upregulating -interferon and other immune mediators , increasing nk cell lytic activity in vitro . \n cdc - resistant cells may be sensitive to adcc , and the same occurs with adcc - resistant cells , that can be destroyed by cdc activation . \n nowadays , it is widely accepted that adcc and cdc , the main mechanisms of action of rituximab against lymphoid cells , act synergistically by enhancing cytotoxicity in cancer cells through the ability of complement to promote inflammation and induce activation of innate immune effectors . besides the pure immunogenic effects of rituximab , \n other cytotoxic effects have been studied , in particular apoptosis induction and direct growth arrest . \n cd-20-rituximab crosstalk can redistribute lipid grafts of the cytoplasmic membrane and subsequently transactivate the src family tyrosine kinase and the fas - pathway , which results in initiation of downstream signaling pathways leading to a caspase - dependent apoptosis [ 18 , 35 , 101 ] . moreover , rituximab downregulates the p38 mitogen - activated protein kinase ( mapk ) , nuclear factor ( nf)- , erk-1/2 , and akt survival pathways , thus inhibiting the expression of antiapoptotic gene products ( bcl-2/bcl - xl , and others ) [ 102 , 103 ] . \n inhibition of antiapoptosis related pathways sensitizes b - cell nhl to undergo apoptosis and facilitates the proapoptotic effect induced by chemotherapy [ 105 , 106 ] . \n the combination of rituximab and chop chemotherapy ( cyclophosphamide , doxorubicin , vincristine , and prednisone ) is proving a highly effective combination in the treatment of nhl , with better clinical results of each treatment modality alone . \n it seems that synergism of this chemoimmunotherapy schedule relies , at least in part , in chemosensitization of drug - resistant nhl cells mediated by rituximab via selective downregulation of antiapoptotic factors through the type ii mitochondrial apoptotic pathway [ 105 , 106 ] . \n moreover , new concepts about immunogenic apoptosis induced by chemotherapy may also contribute to explain the success of chemoimmunotherapy combinations . \n concept of vaccination is based on the fact that deliberate exposure to a harmless version of a pathogen generates memory cells , but not the pathologic sequelae of the harmful agent itself . in this way , \n the immune system is primed to mount a secondary immune response with strong and immediate protection against a new encounter with the pathogen in the future . \n active immunotherapy has been traditionally considered a promising approach in lymphoproliferative diseases , especially in low - grade lymphomas . in this sense \n , follicular lymphomas have demonstrated a high sensitivity to passive immunotherapy with rituximab and interferons , either alone or combined with chemotherapy . \n also , the indolent course of these diseases , with prolonged spontaneous remissions in up to 23% of patients , seems to be ascribed to immune regulation . \n finally , survival of patients with fl appears to correlate with gene expression signatures of tumor infiltrating lymphocytes ( tils ) . \n vaccine strategies targeting lf have largely focused on using the tumor immunoglobulin molecule expressed on the surface of malignant b cells as an antigen . \n the latter type has a hydrophobic transmembrane sequence that anchors the molecule in the b - cell membrane , where it functions as the b - cell receptor . \n antibodies consist of two identical heavy chains and two identical light chains that are held together by disulfide bonds . \n the variable regions of the heavy and light chains of the tumor immunoglobulin contain unique determinants known as idiotype ( i d ) that are a collection of antigenic determinants selectively expressed in tumor cells and serve as tumor - specific antigens [ 110 , 111 ] . \n thus , idiotype vaccination can potentially induce effective polyclonal antibody and t - cell responses against malignant clonal b cells . \n induction of clinically relevant tumour - specific immunity was less frequent in animals with sizable tumour burden . \n therefore , probably the best clinical setting for optimizing immunogenicity and achieving meaningful clinical results comes after a complete response after antineoplastic treatment . \n this is consistent with the way vaccines work in infectious diseases , without the harmful agent present at vaccination . \n preclinical studies revealed that the tumour - specific i d is a weak self - antigen [ 110 , 111 ] . to enhance immunogenicity , \n i d vaccine formulations require conjugation to a strongly immunogenic carrier protein , such as keyhole - limpet hemocyanin ( klh ) . \n in addition , using an immunological adjuvant as gm - csf facilitates activation and recruitment of mature dendritic cells and induction of tumor - specific cd8 t cells . thus , most of the following clinical trials use klh gm - csf to overcome immune tolerance . \n it was a pilot study in which 41 fl patients , in complete response or minimal residual disease after chemotherapy , were immunized with subcutaneous injections of autologous purified tumor - derived immunoglobulin conjugated to klh along with a standard emulsion adjuvant ( syntex adjuvant formulation 1 ) . \n results were successful in terms of biological efficacy , with a demonstrated 41% of specific anti - id antibody , and clinical efficacy with 17% of cellular proliferative responses . these promising data led the biological resources branch , development therapeutics program of the national cancer institute to initiate phase 2 trials to confirm safety , clinical efficacy , and good manufacturing practices ( gmp ) in order to start an eventual commercialization [ 114 , 115 ] . \n most phase 2 studies confirmed that vaccines were well tolerated and induced humoral and cellular immune responses with some clinical effects ( clinical and molecular remissions ) . \n results of phase 1 and 2 trials also suggested that biological and clinical efficacy may induce a clinical benefit , which is the capacity to influence on disease - free and overall survival . \n inogs and coworkers showed that patients with fl in second cr after chemotherapy ( not containing rituximab ) and being successfully vaccinated in biological terms had longer cr ( more than 13 months ) than the duration of the same patient 's first cr obtained with standard chemotherapy with or without rituximab . \n these data , though achieved in a limited number of patients , are critically important because they suggest once again that the best clinical setting to employ vaccination is when there is minimal or no residual disease . \n hence , these encouraging results achieved with the id - klh gm - csf led to the initiation of three phase 3 trials to clarify its eventual clinical benefit in fl patients ( table 2 ) . \n ( i ) first study sponsored by genitope included fl patients treated with 8 cycles of first line ct with cvp schedule . \n patients who achieved a complete or partial response were randomized in a 2 : 1 fashion to seven i d vaccine doses or a control arm with klh and gm - csf . finally 192 patients were vaccinated and 95 received control treatment . regarding the main endpoint , statistical significance was not found in terms of progression - free survival among both arms . \n however , it was observed that patients failing to mount an id - specific humoral response had significantly worse results [ 117 , 118 ] . \n communicated the final results of another phase 3 trial sponsored by favrille 's in which patients treated with four doses of rituximab who entered in cr , pr , or sd were randomized to an i d vaccine group ( n = 174 patients ) and a control group treated with gm - csf ( n = 175 patients ) . \n this trial not only failed in showing a better disease - free survival for vaccinated patients , but even demonstrated a statistically significant difference in favour of the control group treated with gm - csf . \n ( iii ) in the 2009 american society of clinical oncology ( asco ) annual meeting , schuster et al . presented phase 3 results on vaccine biovaxid . \n this trial , sponsored by biovest , included patients in cr or cr unconfirmed after 6 cycles of ct with pace or rituximab plus chop . \n again , randomization was done in two groups , i d vaccine ( experimental ) and klh plus gm - csf ( control ) . \n unfortunately , this study was halted in april 2008 with only 31,2% of patients included , owed to rituximab irruption and dominance in fl guidelines and clinical trials . of 177 patients included in this trial , 60 relapsed while waiting for their vaccine , so conclusions were drawn from only 117 patients , 76 in the experimental and 41 in the control group . \n median survival was statistically significant favouring treatment arm ( 44,2 versus 30,6 months ; p = .047 ) and the main endpoint showed a 13,6-month increase in median disease - free survival for i d vaccine group . \n though soluble protein idiotypic vaccination has provided proof of principle of biological and clinical efficacy , and even clinical benefit in some small clinical studies in fl , results of the three phase 3 trials mentioned above are disappointing and failed . however , there are many circumstances that may alter final results of these randomized trials . \n ( i ) two of the trials included patients irrespective of the quality of the response after ct . \n as suggested in preclinical models , disease 's situation at vaccination seems to be crucial . when there is a sizable tumour burden , vaccines are less likely to be effective maybe because , among other mechanisms , remaining malignant cells still have the ability to secrete cytokines to evade immune recognition . \n accordingly , it must be underscored that better clinical results have been obtained in clinical trials where a cr was previously achieved . \n ( ii ) the favrille 's phase 3 trial employed four doses of rituximab before vaccination . nowadays , in daily clinical practice , it is preferred using chemoimmunotherapy schedules at first line in fit patients . \n hence , four doses of rituximab may be considered as a suboptimal schedule with few complete responses . besides this \n , rituximab causes b cell depletion in normal and malignant cells , hence interfering in the initiation of humoral response . \n final results of this phase iii trial suggest poorer results for the experimental arm and probably this is the consequence of an early vaccination , before b - cell counts after rituximab treatment were recovered . however , there is still scarce evidence in vaccination after rituximab - containing immunochemotherapy schedules . \n communicated data of a pilot trial in 26 patients with mantle cell lymphoma treated with epoch - r , followed 12 weeks later with five monthly vaccinations of autologous tumor - derived id - klhgm - csf . \n as expected , after chemoimmunotherapy , peripheral blood b cells were completely depleted in all patients . \n cd4 t cell counts decreased only slightly after ct and recovered 3 months later , by the start of vaccination . \n cd8 t cell counts did not change substantially . curiously , after rituximab administration , antibody responses against klh and i d were detected in 74% ( 17 out of 23 ) and 30% ( 7 out 23 ) of patients , respectively . \n humoral responses were delayed and correlated with the recovery of b cells following the administration of rituximab , especially after the fourth or fifth vaccination . \n the results of this pilot study are extremely important , because it demonstrates that vaccination after rituximab treatment is feasible and can induce delayed humoral responses . \n taking into account that i d vaccine production takes some months , it would be interesting to design clinical trials in which id - vaccine was administered between 6 and 12 months after a chemoimmunotherapy schedule containing rituximab . \n ( iii ) control group in the three phase 3 trials used klhgm - csf or gm - csf . \n it is uncertain whether these compounds may induce an immune response against lymphoid cells by themselves . in particular , gm - csf is a cytokine with highly immunogenic properties that has even demonstrated clinical efficacy in the clinical setting in fl , in combination with rituximab , and in other solid neoplasms . \n so , it is arguable if klhgm - csf or gm - csf alone represents an ideal control group with neutral immune effects . \n moreover , host 's immune response to vaccines is also heterogeneous in every single patient . \n therefore , there are many sources of uncontrollable variability that make idiotypic vaccination in fl such a difficult strategy to reach success in randomized clinical trials , where the methodology remains rigorously dictated by statistics and clinical benefit in the overall population . \n ( v ) as previously mentioned , several mechanisms may explain the low clinical effectiveness reported . \n one of the main reasons lies in the inability of immune cells to infiltrate and become activated after an encounter with tumor antigen in vivo . \n moreover , it seems that tumors do not express costimulatory molecules or produce the inflammatory microenvironment necessary to activate effector cells with the ability to eradicate tumors [ 123 , 124 ] . \n therefore , the development of methods to activate antitumor immune cells by stimulating apcs and generate long - term memory cells , probably with the aid of costimulators , is one of the future challenges for definitively integrating tumor vaccines into the antineoplastic arsenal . in this sense \n , gm - csf has demonstrated clinical activity when used alone ( melanoma ) and in combination with other agents ( follicular lymphoma , colorectal and breast cancer [ 82 , 126 , 127 ] ) . among these protocols , \n gm - csf administration is prolonged , ranging from 5 to 14 days , yet in vaccine trials gm - csf is commonly used in a short course of three or four doses . \n so , safety and efficacy data encourage the prolonged administration of maintenance boosters ( gm - csf , interleukin-2 , etc . ) , especially once there is biological evidence of an immune response successfully triggered . \n ( vi ) regardless of the method used , i d vaccine production is expensive and time consuming . in fact , the nci / biovest study loosed more than 30% of patients included because of a relapse while waiting for the vaccine production . \n this is especially worrying because it predicts serious difficulties in an eventual extensive clinical use . \n other sources of vaccination are under development with membrane proteoliposomes , or tumor cell - based vaccines transduced with gm - csf , cd40-activated or hsp-96 . \n these new formulations are under clinical investigation , mostly in phase 1 trials and have the advantage of targeting multiple tumor antigens with a shorter production time . \n ( vii ) therapeutic armamentarium in lf is changing , and knowledge of the immune effects of the new therapies employed may be of critical importance for clinical trials with id - vaccines . \n recently , yttrium-90 tositumomab tiuxetan ( zevalin ) has been approved by the fda in first line of lf , as consolidation after ct . \n zevalin is a cd-20-directed radiotherapeutic antibody with several mechanisms of action . in addition , in the 2009 annual meeting of the american society of hematology ( ash ) , results of a phase iii trial in low - grade lymphomas , comparing chop - r and bendamustine - r , have been communicated , providing better progression - free survival ( median pfs 54,9 versus 34,8 months ; hr 0.57 , p = .00012 ) and a better toxicity profile for the experimental arm . \n these data could oust the standard chop - r regimen in brief , so anthracyclines could be out of first line treatment in the coming future . \n even though clinical results in many types of lymphomas , including lf , that have improved over the years owed to introduction of rituximab and chemoimmunotherapy schedules , there is still room for improvement ; yet many patients relapse and finally die as a consequence of their disease . \n thus , once confirmed proof of principle of biological and clinical efficacy of vaccine - therapy , these results might not be overlooked nor neglected by physicians , since it may translate into a prolonged disease - free survival , and eventually the recovery of some lf populations . \n although history of vaccines in oncology has been extremely disappointing , reminding the myth of minotaurus , with every little step forward followed by a new frustration , new insights into this strategy may hopefully obtain better and surprising results , and so finding out the ariadne 's thread which eventually leads to see the end of this complex and challenging labyrinth . \n tumorigenesis is a multistep process leading to the progressive transformation of normal human cells into highly malignant derivatives . \n thus , mechanisms of oncological diseases are extremely complex , with several alterations at multiple sites . \n hanahan and weinberg , in an effort to synthesize the huge body of knowledge in cancer research , postulated six essential alterations in cell physiology . among them , the insensitivity to antigrowth signals , evasion of apoptosis , sustained angiogenesis , and tissue invasion and metastasis seem to be intrinsically related to microenvironment dysregulations . \n these tumors might be considered as a functional tissue immunologically mediated and formed by a complex tissue network in which the imbalance of homeostasis between the host immune system , malignant cells , and all other components of tumoral stroma determine proliferation , invasion , angiogenesis , and remodelling of extracellular matrix and metastasis . moreover , the distinctive profile of immune cells in the surrounding stroma leads to a wide repertoire of specific cell subpopulations which constitute the specific tumor microenvironment of each lymphoproliferative syndrome . in the last few years , the critical importance of these findings and correlation with prognosis and clinical results has been recognized . \n recent evidence has emerged that confers new properties to antineoplastic treatments against lymphomas , in relation with microenvironment changes . \n this is the case of some chemotherapeutics like anthracyclines or radiotherapy that may induce tumoral destruction with the ability of improving cancer cell recognition by the immune system , and thus enhancing the possibility of a successful immune response . \n in addition , these new discoveries in the mechanisms of action of classic antineoplastic treatments might be the basis of the synergism of the new combined chemoimmunotherapy strategies in lymphomas that include passive immunotherapy with the monoclonal antibody rituximab . finally , active immunotherapy with anti - idiotype vaccines , though still far from daily practice integration , has demonstrated clinical efficacy in some subpopulations of patients . \n fine tune approaches in vaccine development and a better design of vaccine clinical trials are needed to definitely elucidate the role of active immunotherapy in lymphoproliferative syndromes . \n ", "role": "user" }, { "content": "lymphomas represent a wide group of heterogenic diseases with different biological and clinical behavior . \n the underlying microenvironment - specific composition seems to play an essential role in this scenario , harboring the ability to develop successful immune responses or , on the contrary , leading to immune evasion and even promotion of tumor growth . \n depending on surrounding lymphoid infiltrates , lymphomas may have different prognosis . \n moreover , recent evidences have emerged that confer a significant impact of main lymphoma 's treatment over microenvironment , with clinical consequences . in this review , we summarize these concepts from a pathological and clinical perspective . \n also , the state of the art of lymphoma 's anti - idiotype vaccine development is revised , highlighting the situations where this strategy has proven to be successful and eventual clues to obtain better results in the future .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: turner s syndrome ( ts ) was first detected by ullrich in an 8-year - old german girl and then described by henry turner in 1938 [ 1 , 2 ] . \n ts is the most common sex chromosome abnormality in female gender and occurs approximately in 50 per 100,000 live births [ 3 , 4 ] . \n ts is defined by a complete or partial ( includes the tip of its short arm ) omission of one x chromosome in females [ 5 , 6 ] . \n abnormalities in glucose metabolism , lipid metabolism , liver enzymes , and thyroid function tests have been reported in patients with ts and should be checked out at 2-year intervals [ 8 - 13 ] . \n elevation of liver enzymes was reported in adults with a fivefold increase in the risk of cirrhosis [ 14 - 16 ] . \n liver enzymes abnormalities have been suggested to have relationships with hormone therapy , autoimmunity or obesity [ 17 , 18 ] . \n ts patients are predisposed to obesity [ 4 , 19 ] , partly because of low physical fitness and a sedentary lifestyle [ 14 , 20 ] . \n therefore , the objective of this study was to assess relationship between obesity and liver enzymes level in ts patients . \n all 41 karyotype - proven participants of this cross - sectional study were selected from ts patients who were referred to the endocrinology and metabolism research center of iran university of medical sciences . after taking detailed history about hepatic disease symptoms , cigarette smoking , alcohol drinking , and drug history , the patients with known hepatic disease and/or history of taking medications with hepatotoxic effects were excluded . \n demographic profiles including age , weight , height and body mass index ( bmi = weight ( kg)/height ( m ) ) were gathered . \n the heights of all patients were measured by harpenter stadiometer and for measuring their weight , we used a digital scale . \n the subjects were divided into two groups including overweight ( patients with bmi > 85th percentile for sex and age ) and normal weight ( patients with bmi < 85th percentile for sex and age ) . a 1.5 ml venous fasting blood sample was taken and kept in the sterile edta containing test tubes at -70 c . \n all samples were transferred to laboratory of endocrine research center for measuring serum concentration of liver enzymes , including aspartate transaminase ( ast ) , alanine transaminase ( alt ) and alkaline phosphatase ( alkph ) . \n iu / l for ast , alt and alkph , respectively [ 21 , 22 ] . in patients with elevated liver enzymes , \n the tests were done for the second time . for subjects that the second test confirmed elevated levels of liver enzymes , liver ultrasonography , serologic test for viral hepatitis ( hbsag , anti - hcv antibody ) , autoantibodies ( anti - smooth muscle antibody ( anti - sma ) , anti - nuclear antibody ( ana ) , and anti - liver - kidney microsome ( lkm ) antibody ) , 1-antitrypsin , anti - endomysial antibody , triglyceride , cholesterol , glucose , urine copper and urine ceruloplasmin were done . \n this study was approved by the ethics committee of endocrine research center ( firuzgar ) . \n the data were analyzed using spss software version 13.0 for windows ( spss inc . , \n comparison of liver enzyme values between normal and overweight patients was performed using the independent t - test . \n the p - values less than 0.05 were considered significant and a power of 80% was considered in the analysis . \n also for multivariable analysis , linear regression was performed between liver enzymes and bmi , age , age of diagnosis weight and height . \n all 41 karyotype - proven participants of this cross - sectional study were selected from ts patients who were referred to the endocrinology and metabolism research center of iran university of medical sciences . after taking detailed history about hepatic disease symptoms , cigarette smoking , alcohol drinking , and drug history , the patients with known hepatic disease and/or history of taking medications with hepatotoxic effects were excluded . \n demographic profiles including age , weight , height and body mass index ( bmi = weight ( kg)/height ( m ) ) were gathered . \n the heights of all patients were measured by harpenter stadiometer and for measuring their weight , we used a digital scale . \n the subjects were divided into two groups including overweight ( patients with bmi > 85th percentile for sex and age ) and normal weight ( patients with bmi < 85th percentile for sex and age ) . a 1.5 ml venous fasting blood sample was taken and kept in the sterile edta containing test tubes at -70 c . \n all samples were transferred to laboratory of endocrine research center for measuring serum concentration of liver enzymes , including aspartate transaminase ( ast ) , alanine transaminase ( alt ) and alkaline phosphatase ( alkph ) . \n iu / l for ast , alt and alkph , respectively [ 21 , 22 ] . in patients with elevated liver enzymes , \n the tests were done for the second time . for subjects that the second test confirmed elevated levels of liver enzymes , liver ultrasonography , serologic test for viral hepatitis ( hbsag , anti - hcv antibody ) , autoantibodies ( anti - smooth muscle antibody ( anti - sma ) , anti - nuclear antibody ( ana ) , and anti - liver - kidney microsome ( lkm ) antibody ) , 1-antitrypsin , anti - endomysial antibody , triglyceride , cholesterol , glucose , \n this study was approved by the ethics committee of endocrine research center ( firuzgar ) . \n the data were analyzed using spss software version 13.0 for windows ( spss inc . , \n comparison of liver enzyme values between normal and overweight patients was performed using the independent t - test . \n the p - values less than 0.05 were considered significant and a power of 80% was considered in the analysis . \n , linear regression was performed between liver enzymes and bmi , age , age of diagnosis weight and height . \n mean ( sd ) age , height and weight were 16.69 6.86 years , 129.21 24.16 cm and 37.73 13.94 kg , respectively . \n mean ( sd ) age at the time of diagnosis was 12.09 6.44 years . \n data are presented as mean sd . mean ( sd ) bmi was 21.20 4.05 \n distribution of bmi is shown in figure 1 . according to age and sex - matched standard bmi curve , \n the patients were divided into two groups as control group including 27 subjects ( 65.8% ) with normal bmi ( i.e. , bmi < 85th percentile ) and case group including 14 subjects ( 34.2% ) who were overweight ( bmi > 85th percentile ) . of those , 28 cases ( 68.2% ) had monosomic pattern ( 45xo ) according to their karyotype while others karyotypes were mosaicism or isochromosome ( 45xo/46xx in six subjects ( 13.6% ) , 45xo/46xy in three subjects ( 6.6% ) , 46xi(x ) ( q10 ) in three subjects ( 6.6% ) , and 45xo/44 in one patient ( 2.2% ) ) . \n one of them had extrahepatic biliary atresia and after therapeutic surgery , the enzymes level returned to the normal range . \n another patient was a 14-year - old girl with a height of 136.5 cm and a weight of 49 kg . \n the enzyme elevation showed a progressive pattern over 8 months ( ast = 77 u / l139 u / l and alt = 126 u / l201 \n the patient s bmi in the time of liver enzyme elevation was 26.3 which increased to 28.4 when the enzymes level returned to normal range . \n distribution of bmi in study population . the two above mentioned patients were excluded . \n mean ( sd ) liver enzyme levels in overweight patients were ast = 27 5.4 u / l , alt = 20.1 4.9 u / l , and alkph = 583.4 269 \n u / l . in those with normal bmi , the figures were ast = 29.6 \n 11.7 u / l , alt = 22.2 11.7 u / l , and alkph = 472.8 323 u / l . \n there were no significant differences between patients with normal bmi and those who were overweight regarding serum liver enzymes levels . \n p values were 0.34 for ast , 0.52 for alt and 0.28 for alkph . in linear regression model for ast , alt and alkph with age , bmi , height , weight and age of diagnosis , \n the significance for all variables were higher than 0.05 except for age at the time of diagnosis and serum level of alkph ( sig . \n = 0.002 ) . on the other hand , our multivariable analysis showed that in the relationship of other variables , the age of diagnoses was the only variable that was associated with higher level of alkph . \n the bmi and weight had not significant association with liver enzymes ( for ast , p = 0.521 and 0.492 ; alt , p = 0.955 and 0.659 and alkph , p = 0.964 and 0.697 , respectively ) . \n our study about association of obesity and liver enzymes level in ts showed no significant relation between obesity and serum liver enzymes level . \n ts actually is a multi - organ disease and the affected patients have various complications as the result of their illness and need very exact follow - up and good management . \n one of the organs which might be involved is the liver . in our ts patients , \n one case had extrahepatic biliary atresia ( a rare condition ) , and one overweight patient ( bmi = 26.3 ) had steatohepatitis . the causes suggested for liver enzymes abnormalities in ts include hormone therapy and autoimmunity [ 17 , 18 , 23 ] . \n obesity , which is a characteristic feature of girls with ts , is discussed as one of the causes of liver involvement [ 24 - 27 ] in ts which could be presented by elevated liver enzyme levels . \n based on our study , no relationship was seen between obesity and liver enzyme levels . \n this finding is in accordance with earlier studies in this field [ 17 , 28 , 29 ] . \n seventy - nine ( 36% ) of their patients showed elevated levels in one or more liver enzymes at start , and another 23% of patients had developed elevated liver enzymes during a 5-year follow - up . in their study , the patients who had enzymes elevation had higher bmi , triglyceride , cholesterol level compared to those with normal liver enzymes level . \n but only the total cholesterol level could play as a significant predictor for liver enzymes elevation . in their study , \n elevated liver enzymes were more common in patients with age between 26 and 45 years old . \n our study showed low frequency of abnormal liver function in young ts patients which is in contrast to the high incidence of liver function abnormality in adult ts patients ( like el - mansoury et al s study ) , suggesting that long - term hormone therapy or worsening or long - term obesity may be related to the development of abnormal liver function in some ts patients . in another study , \n larizza et al followed two groups of turner s patients , 22 patients with raised liver enzymes ( group a ) and 48 patients with normal enzymes level ( group b ) for a period of 0.8 - 21.9 years . \n they found hepatitis c and autoimmunity as the causes of liver enzyme elevation in some cases of group a patients . \n weight excess standard deviation scores ( sds ) were significantly higher in turner patients with liver enzyme elevation . \n so authors concluded , although an autoimmune pathogenesis might be considered in some cases , weight excess seems the most frequent cause of increased liver enzymes in ts . in wasniewska \n et al s study of 214 ts patients younger than 20 years , only 19 ( 8.9% ) had elevated liver enzymes in 2 years follow - up . according to results of this study \n , authors concluded that both obesity and autoimmunity are not frequently involved in the etiology of ts liver abnormality . \n salerno et al monitored liver enzymes level in 70 patients with ts for a mean period of 7.6 4.2 years . \n they observed increased liver enzyme in 14 out of 70 patients ( 20% ) . in the majority of cases ( 10/14 ) , it was drug - related , in two cases it was autoimmunity - related , and in one case it was cryptogenic . although obesity was a frequent finding , it was considered the cause of liver abnormality only in one patient . \n the small sample size could be as a limitation in our study , so we suggest a larger cohort study for determining the exact role of obesity in the changes of liver enzymes level in ts patients . \n there was no statistically significant difference regarding liver enzyme levels ( ast , alt , and alkph ) between normal bmi and overweight ts teenagers . \n in other words , obesity may not be a cause for difference in terms of serum liver enzyme levels abnormalities . \n there was no statistically significant difference regarding liver enzyme levels ( ast , alt , and alkph ) between normal bmi and overweight ts teenagers . \n in other words , obesity may not be a cause for difference in terms of serum liver enzyme levels abnormalities . \n this work was also supported by grant no . 202 from endocrinology and metabolism research center affiliated to iums .", "role": "user" }, { "content": "backgroundliver enzyme abnormalities have been reported in turner s syndrome ( ts ) . \n there are some studies about possible causes of abnormal levels of liver enzymes . \n one of the main suggestions is obesity . \n the study aimed to determine the relationship between obesity and liver enzymes levels in patients with ts.methodsforty-one karyotype - proven ts patients referred to endocrinology and metabolism research center were included in this cross - sectional study . \n height and weight of patients were measured and their body mass index ( bmi ) was calculated . \n the patients were divided into two groups as the control group including 27 cases ( 65.8% ) with normal bmi ( defined as < 85th percentile for age and gender ) , and the overweight group including 14 cases ( 34.2% ) ( defined as bmi > 85th percentile for age and gender ) . \n serum levels of aspartate transaminase ( ast ) , alanine transaminase ( alt ) and alkaline phosphatase ( alkph ) were measured.resultsthere were no statistically significant differences regarding ast ( 27 2.7 vs. 29.6 5.85 u / l ; p = 0.3 ) , alt ( 20.1 2.45 vs. 22.2 5.85 u / l ; p = 0.5 ) , and alkph ( 583.4 2.45 vs. 472.8 161.5 u / l ; p = 0.28 ) between overweight ts patients and those with normal bmi.conclusionthere was no significant difference in liver enzyme levels between ts patients with normal bmi and those who were overweight .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: dental measurements are important in anthropology for the study of sexual dimorphism , the trend toward tooth and jaw size reduction in late pleistocene / early holocene humans and differences between past human populations . \n teeth are very resistant to post - mortem destruction and fragmentation in comparison to other hard tissues of the human body . \n this characteristic of teeth gives them an advantage for sex determination in forensic cases and mass graves , where bones are frequently fragmentary . sexual dimorphism refers to those differences in size , stature and appearance between male and female that can be applied to dental identification because no two mouths are alike . \n the mesiodistal ( md ) and buccolingual ( bl ) measurements of teeth are used in sex determination studies . \n kieser has researched into sex determination by odontometric measurements and found significant differences between male and female teeth using md and bl dimensions . \n crown diameters and combinations of root lengths are also used for measurements in sex determination . \n it is possible to find a higher rate of discriminatory capability between sexes by using these measurements regardless of the differences existing among populations . \n . nevertheless , these dimensions are affected by attrition , cervical abrasions , interproximal wear facets , crowding , presence of dental calculus in the cervical third and it is difficult to take measurements when the teeth are still held in the tooth socket . as a result alternative dental measurements were developed because they are less affected by these problems . \n these measurements are the crown and cervical diagonal diameters and md and bl cervical diameters of teeth . \n the aim of this study was to assess the degree of sexual dimorphism in teeth of a north indian population using crown diagonal diameters and to evaluate the applicability of diagonal measurements in sex determination by means of discriminant functional analysis . \n the study sample comprised of 200 upper and lower jaw dental models , belonging to 100 males and 100 females of an age group ranging from 18 to 57 years in a north indian population . \n the inclusion criteria were as follows : fully erupted teeth from right permanent central incisor to right second molar , no fillings or extractions , no crowns , crowding of teeth , fractured teeth or orthodontic apparatuses and no developmental or orthodontic anomalies that could affect odontometric measurements . upon their approval of the procedure by an informed consent \n , the subjects upper and lower jaw impressions were taken with alginate material , which was followed by the preparation of their models by dental stone . using these models , mesiobuccal - distolingual ( mbdl ) and distobuccal \n all the measurements were taken from the same side , which was usually the right side in these cases . in case of absence of the right tooth \n when placing the caliper parallel to the occlusal surface , the following points were accepted as a guide during the measurements as defined by hillson et al . \n mbdl crown diameter : the maximum distance from the mesiobuccal corner of the crown to the distolingual corner . \n dbml crown diameter : the maximum distance from the distobuccal corner of the crown to the mesiolingual corner . \n the measurements were performed by one person and all values were rounded to two decimal places . in order to assess the reliability of the measurements , intra - observer error was tested . \n the same measurements were obtained from 50 randomly selected casts from the original sample at a different time by the same observer to assess intra - observer error . \n another observer measured the same randomly selected teeth in order to test the inter - observer error . \n statistically significant sexual dimorphisms in male and female odontometric features were tested by the unpaired t - test . \n the mean values of mbdl and dbml dimensions of males and females were subjected to the following formula to calculate percentage of sexual dimorphism . \n the percentage of dimorphism is defined as the percent by which the tooth size of males exceeds that of females . \n percentage of sexual dimorphism = ( [ xm / xf ] 1 ) 100 where xm = mean male tooth dimension ; xf = mean female tooth dimension . data obtained from various measurements was further analyzed using stepwise discriminant function statistics using spss version 10 , ( ibm ) and epi - info 6.04 d software ( cdc , atlanta , us ) . \n a total of 28 measurements were taken on 14 teeth of each individual included in this study : seven teeth from the upper jaw and seven from the lower . \n a total of 5600 measurements on the teeth of 200 individuals were accomplished and analyzed by spss program . \n an independent two sample t - test was used to test whether males ' means are significantly different from females ' . \n tables 1 and 2 show descriptive statistics , percentage sexual dimorphism , t values and p values for mbdl and dbml crown diameters respectively for the seven teeth of all males and females included in this study . in the mbdl crown diameter [ table 1 ] , \n both maxillary and mandibular central incisor , canine , first molar and second molar showed a statistically significant difference between males and females ( p < 0.05 ) . \n percentage sexual dimorphism was maximum for maxillary central incisor ( 7.4% ) followed by maxillary and mandibular second molar ( 6.1% ) and maxillary canine ( 5.8% ) in mbdl crown diameters . \n descriptive statistics , % sexual dimorphism and t values of mbdl crown dimensions descriptive statistics , % sexual dimorphism and t values of dbml crown dimensions in the dbml crown diameter [ table 2 ] , maxillary central incisor , maxillary and mandibular canine , first molar and second molar showed a statistically significant difference between males and females ( p < 0.05 ) . \n percentage sexual dimorphism was maximum for maxillary central incisor ( 6.4% ) followed by mandibular first molar ( 5.8% ) and mandibular second molar ( 5.1% ) in dbml crown diameters . \n the most dimorphic teeth amongst all for crown diagonal diameters are the maxillary central incisors and the least dimorphic are the maxillary second premolars . \n the mean diagonal crown dimensions in all but one tooth ( dbml of maxillary lateral incisor ) of males exceeded that of females . \n tables 3 and 4 depict standard coefficient , structure matrix , unstandardized coefficients , raw coefficient , group centroids and sectioning point for mbdl and dbml crown diagonal dimension respectively . \n canonical discriminant function coefficients for mbdl crown dimensions canonical discriminant function coefficients for dbml crown dimensions the standard coefficient shows the contribution of the respective variable to the discrimination between the two sexes . \n these means can be used to determine the degree of separation between the two sexes . \n unstandardized coefficient is used in the calculation of discriminant function score ( y ) . to assess the sex , tooth dimensions \n are multiplied with the respective unstandardized coefficients ( b ) and added to the constant ( a ) . \n if the values ( y ) thus obtained were greater than the sectioning point the individual was considered a male and if less than the sectioning point the individual was considered female . where x is dimension of the tooth in centimeters . with the help of the stepwise method , \n the crown diagonal measurements of the maxillary and mandibular teeth in the samples were analyzed separately . since , the mbdl crown dimensions of maxillary and mandibular lateral incisor , first premolar and second premolar and dbml crown dimensions of mandibular central incisor , maxillary and mandibular lateral incisor , first premolar and second premolar did not show any statistically significant dimorphism , they were not subjected to further analysis . table 5 shows the results of the analyses of crown diagonal diameters and accuracy rates . in this study , \n the accuracy of determination of sex by mbdl crown dimension ranges from 55% to 75% in males and 47 - 84% in females , while by dbml crown dimension ranges from 55% to 80% in males and 65 - 80% in females . \n in the maxillary teeth accuracy for sex determination was highest ( 80% ) for dbml crown dimension of central incisor and lowest ( 57.5% ) for dbml crown dimension of first molar . in the mandibular teeth accuracy for sex determination was highest ( 72.5% ) for dbml crown dimension of the first molar and lowest ( 51% ) for mbdl crown dimension of central incisor . \n an independent two sample t - test was used to test whether males ' means are significantly different from females ' . \n tables 1 and 2 show descriptive statistics , percentage sexual dimorphism , t values and p values for mbdl and dbml crown diameters respectively for the seven teeth of all males and females included in this study . in the mbdl crown diameter [ table 1 ] , \n both maxillary and mandibular central incisor , canine , first molar and second molar showed a statistically significant difference between males and females ( p < 0.05 ) . \n percentage sexual dimorphism was maximum for maxillary central incisor ( 7.4% ) followed by maxillary and mandibular second molar ( 6.1% ) and maxillary canine ( 5.8% ) in mbdl crown diameters . \n descriptive statistics , % sexual dimorphism and t values of mbdl crown dimensions descriptive statistics , % sexual dimorphism and t values of dbml crown dimensions in the dbml crown diameter [ table 2 ] , maxillary central incisor , maxillary and mandibular canine , first molar and second molar showed a statistically significant difference between males and females ( p < 0.05 ) . \n percentage sexual dimorphism was maximum for maxillary central incisor ( 6.4% ) followed by mandibular first molar ( 5.8% ) and mandibular second molar ( 5.1% ) in dbml crown diameters . \n the most dimorphic teeth amongst all for crown diagonal diameters are the maxillary central incisors and the least dimorphic are the maxillary second premolars . \n the mean diagonal crown dimensions in all but one tooth ( dbml of maxillary lateral incisor ) of males exceeded that of females . \n tables 3 and 4 depict standard coefficient , structure matrix , unstandardized coefficients , raw coefficient , group centroids and sectioning point for mbdl and dbml crown diagonal dimension respectively . \n canonical discriminant function coefficients for mbdl crown dimensions canonical discriminant function coefficients for dbml crown dimensions the standard coefficient shows the contribution of the respective variable to the discrimination between the two sexes . \n these means can be used to determine the degree of separation between the two sexes . \n unstandardized coefficient is used in the calculation of discriminant function score ( y ) . to assess the sex , tooth dimensions \n are multiplied with the respective unstandardized coefficients ( b ) and added to the constant ( a ) . \n if the values ( y ) thus obtained were greater than the sectioning point the individual was considered a male and if less than the sectioning point the individual was considered female . where x is dimension of the tooth in centimeters . with the help of the stepwise method , \n the crown diagonal measurements of the maxillary and mandibular teeth in the samples were analyzed separately . since , the mbdl crown dimensions of maxillary and mandibular lateral incisor , first premolar and second premolar and dbml crown dimensions of mandibular central incisor , maxillary and mandibular lateral incisor , first premolar and second premolar did not show any statistically significant dimorphism , they were not subjected to further analysis \n . table 5 shows the results of the analyses of crown diagonal diameters and accuracy rates . in this study , \n the accuracy of determination of sex by mbdl crown dimension ranges from 55% to 75% in males and 47 - 84% in females , while by dbml crown dimension ranges from 55% to 80% in males and 65 - 80% in females . \n the overall accuracy of sex determination ranged from 51% to 80% respectively . in the maxillary teeth accuracy for sex determination was highest ( 80% ) for dbml crown dimension of central incisor and lowest ( 57.5% ) for dbml crown dimension of first molar . in the mandibular teeth accuracy for sex determination was highest ( 72.5% ) for dbml crown dimension of the first molar and lowest ( 51% ) for mbdl crown dimension of central incisor . \n teeth have been the focus of much research in the past because they are the most durable tissue in the human body . \n a number of studies have examined dental pathology , morphology and odontometric variation . however , in the forensic context , many researchers have focused on age estimation and sex determination . \n teeth are usually retained in skeletal specimens and hence , can be used in sex differentiation . \n the dentition takes precedence particularly when preferred parameters such as the pelvis are unavailable and cranial and long bones fragmentary . \n however , since linear tooth measurements usually give moderate levels of accuracy in sex identification , alternative means of assessing sex within the realm of linear measurements needs investigation . \n several studies of sexual dimorphism in teeth have shown that there are differences in tooth size between the two sexes . \n the results obtained from crown diagonal diameters taken during the course of this study , showed that diagonal crown dimensions in all but one tooth ( dbml of maxillary lateral incisor ) of males exceeded that of females . \n the difference was statistically significant in mbdl dimensions of maxillary and mandibular central incisor , canine , first and second molar and dbml dimensions of maxillary central incisor and maxillary and mandibular canine , first molar and second molar . \n karaman in his study on diagonal teeth measurements in predicting gender in a turkish population , found that seven of the fourteen measurements in the maxilla and ten of the fourteen measurements in the mandible showed significantly greater results in the males . \n zorba et al . in their study on sex determination in modern greeks using diagonal measurements of molar teeth found that male molars are larger than female molars , which is in accordance with our study . \n the lateral incisor and premolars did not show any significant sexual dimorphism in the present study . in the current study percentage sexual dimorphism was maximum for mbdl crown diameter of maxillary central incisor ( 7.4% ) followed by dbml crown diameter of the same ( 6.4% ) and minimum for dbml crown diameter of maxillary second premolar ( 0.2% ) followed by dbml crown diameter of maxillary first premolar ( 0.3% ) . \n zorba et al . in their study amongst maxillary and mandibular molars found that crown dbml dimensions show more sexual dimorphism than crown mbdl dimensions . in the present study , crown diagonal diameters of both maxillary and mandibular second molars showed more dimorphism than first molars except dbml dimension of mandibular molar . \n since the crown diagonal dimensions of maxillary and mandibular premolars , lateral incisors and dbml crown dimension of mandibular central incisor did not show any sexual dimorphism , thus this method is not reliable for sex determination using crown diagonal diameters for these teeth . \n however , the most studied dimensions for sexual dimorphism in teeth are crown md and bl diameters . \n although , these diameters present a high degree of sexual dimorphism , diagonal diameters have also been found to present higher or equal sexual dimorphism and can thus be considered a reliable method for sex determination . \n hence , the alternative diagonal measurements can be used for sex determination along with or / and instead of crown md and bl diameters where these can not be taken . \n hillson et al . mentioned that the alternative measurements can be recorded at least as consistently and they are acceptable by the standards normally applied to dental measurements . amongst the teeth which were analyzed by discriminant functional analysis during the course of the study \n , the highest rate of accuracy was observed in dbml crown dimension of maxillary central incisor . \n the accuracy rates of canines and molars in diagonal measurements were not as high as that of maxillary central incisors . \n these results were in contrast to the study done by karaman who found canines to show the highest rate of accuracy amongst all the teeth . in the current study , \n accuracy rate of sex determination was higher in females ( 9 of 15 ) than in males ( 2 of 15 ) , while 2 crown diagonal dimensions showed equal accuracy for both females and males . \n these results were in concordance with the study conducted by karaman in turkish population and iscan and kedici who observed more dimorphism in female subjects . \n the maxillary teeth and mandibular teeth in the present study were found to be equally dimorphic , which was in contrast to previous studies which found mandibular teeth to be more dimorphic . \n the difference in accuracy of sex determination between different populations is due to the fact that sexual dimorphism is population specific . on comparison of accuracy rate of determining sex amongst molars \n , it was observed that mandibular molars were more dimorphic than maxillary molars which was in unison with the study conducted by zorba et al . \n previous studies indicate that md and bl dimensions are more accurate in determining sexual dimorphism . in situations in which it is difficult to take correct measurements of md and bl dimensions of teeth , \n the present study has described sexual dimorphism in crown diagonal diameters using univariate statistics and stepwise discriminant functional analyses . \n it was found that mbdl and dbml crown dimensions are reliable indicators and can be used along with or / and instead of linear measurements in sex determination . \n these can be useful in archeological , odontologic , genetic , forensic and crime investigations , as ethnicity / race , culture and environment are known to affect odontometrics .", "role": "user" }, { "content": "background : sexual dimorphism has been of great interest to anthropologists and odontologists . dental measurements are important in anthropology for the study of sexual dimorphism with most common being the traditional linear odontometric measurements . apart from these , \n alternative dental measurements have been developed such as the crown and cervical diagonal diameters and mesiodistal and buccolingual cervical diameters of teeth.aims and objective : the primary objective of the following study is to assess the degree of sexual dimorphism in teeth of a north indian population using the crown diagonal diameters and secondary is to evaluate the applicability of diagonal measurements in sex determination by means of discriminant functional analysis.materials and methods : the study sample comprised 200 individuals ( 100 males and 100 females ) of an age group ranging from 18 to 57 years , in a north indian population . \n the mesiobuccal - distolingual ( mbdl ) and distobuccal - mesiolingual ( dbml ) crown diameters of seven maxillary and seven mandibular teeth on the study models were measured using digital vernier calipers.results:the most dimorphic teeth amongst all for crown diagonal diameters are the maxillary central incisors and the least dimorphic are the maxillary second premolars . \n the mean diagonal crown dimensions in all but one tooth ( dbml of maxillary lateral incisor ) of males exceeded that of females . \n the difference was statistically significant in mbdl dimensions of maxillary and mandibular central incisor , canine , first and second molar and dbml dimensions of maxillary central incisor and maxillary and mandibular canine , first molar and second molar ( p < 0.05 ) . \n the accuracy of determination of sex by mbdl crown dimension ranges from 55% to 75% in males and 47 - 84% in females , while by dbml crown dimension ranges from 55% to 80% in males and 65 - 80% in females with the overall accuracy of sex determination ranging from 51% to 80% respectively.conclusion:mbdl and dbml crown dimensions are reliable indicators and can be used along with or / and instead of linear measurements in sex determination . in situations in which it is difficult to take correct measurements of linear dimensions of teeth , \n these alternative odontometric measurements can be used consistently to determine sex .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: as the functional organelle for protein synthesis , ribosomes bound to the endoplasmic reticulum ( er ) perform complex surveillance of various pathologic stresses [ 13 ] . \n ribosomal alteration by endogenous and external insults can trigger a variety of pathogenic processes , including inflammatory responses [ 46 ] . \n ribosomal inactivation can be induced by a large family of ribonucleolytic proteins that cleave 28s ribosomal rna at single phosphodiester bonds within a universally conserved sequence known as the sarcin - ricin loop , which leads to the dysfunction of peptidyltransferase and subsequent global translational arrest [ 7 , 8 ] . these ribosome - inactivating proteins ( rips ) \n are enzymes isolated mostly from plants and some of rips such as ricins and shiga toxins are potent cytotoxic biological weapons causing tissue injuries and inflammatory diseases [ 9 , 10 ] . \n similar ribosomal rna injuries have been observed during nonprotein ribosome - inactivating stress triggered by physical and chemical insults such as ultraviolet ( uv ) irradiation , trichothecene mycotoxins ( mostly cereal contaminants produced by molds such fusarium species ) , palytoxin ( an intense vasoconstrictor produced by marine species including dinoflagellate ostreopsis ovata ) , and anisomycin ( an antibiotic produced by streptomyces griseolus ) , which also interfere with peptidyltransferase activity by directly or indirectly modifying 28s rrna [ 11 , 12 ] . \n the primary action of most ribosome - inactivating stress is the functional inhibition of global protein synthesis ; therefore , highly dividing tissues such as lymphoid tissue and mucosal epithelium are the most susceptible targets of the stress [ 1315 ] . \n although acute high levels of toxic insults lead to sepsis - like symptoms including hemolytic uremic syndrome [ 16 , 17 ] , several epidemiological studies have suggested that there are also links between ribosome - inactivating stress and human mucosal epithelial illnesses ranging from acute mucosal inflammatory disease to chronic illness , including epithelial malignancy [ 1820 ] . \n ribosome - inactivating stress has been investigated in various experimental models as an etiological factor of inflammatory diseases such as ulcerative colitis and hemolytic uremic syndrome [ 17 , 21 , 22 ] . moreover , \n upper airway inflammation such as intranasal neutrophilic rhinitis , which is characterized by mucus hypersecretion , atrophy , and exfoliation of transitional epithelium , is also triggered by some of ribosome - inactivating trichothecenes [ 2326 ] . among a variety of mediators of the ribosomal inactivation - associated pathogenesis , \n proinflammatory cytokines play key roles in both mucosal and systemic inflammatory responses to ribosome - inactivating stress [ 2730 ] . \n although the primary outcome of the insulted cells is the global protein synthesis inhibition due to the ribosomal rna cleavage and modification , the insult leads to some exceptional production of proteins such as cytokines important for cellular homeostasis as well as a variety of pathogenic processes involved in cell survival modulation , proliferation , and stress response [ 32 , 33 ] . \n the present review described the mechanistic patterns of exceptional cytokine upregulation during the ribosomal dysfunction at various levels of gene regulation , including transcriptional signaling activation triggered by organellar distress , posttranscriptional upregulation , and favorable posttranslational processing of cytokines . \n investigations of the molecular patterns of cytokine induction by ribosomal inactivation will improve our understanding of typical stress - induced processes of inflammatory signals and provide new insight into therapeutic targets for ribosome - related inflammatory diseases . \n ribosomal inactivation by factors such as uv irradiation increases phosphorylation of the cytoplasmic membrane receptor , epidermal growth factor receptor ( egfr ) , on tyrosine residues to above basal levels , leading to activation of protein kinase b ( pkb / akt1 ) and downregulation of the ras - extracellular signal - regulated kinase ( erk ) signaling cascade . \n ribosome - inactivating palytoxin interacts with high affinity cell - surface receptors , including the na , k - atpase , or na / h antiporter [ 3537 ] . \n these ribosomal inactivation - linked surface receptors ( egfr and na , k - atpase ) can also trigger their downstream kinase signaling pathways , leading to proinflammatory cytokine production [ 38 , 39 ] . \n although surface receptors may be activated by ribosomal inactivation , most signaling sentinels that respond to ribosome - inactivating stressors are associated with organelles themselves , including the ribosome and endoplasmic reticulum ( er ) . \n early responses to ribosome - inactivating stress activate the ribosome - based scaffold signaling protein network , resulting in diverse biological patterns including apoptosis and cytokine induction [ 4042 ] . \n in addition to the modification or cleavage of ribosomal rna , a variety of ribosome - inactivating stresses lead to phosphorylation of serine 51 on the alpha subunit of eukaryotic translation initiation factor 2 ( eif2 ) , leading to global translational arrest . \n the subunit of eif2 in the ribosome - based scaffold protein complex is the target of different stress - related mammalian protein kinases including double - stranded rna - dependent protein kinase r ( pkr ) and protein kinase rna - like endoplasmic reticulum kinase ( perk ) . \n ribosome - inactivating stressors trigger an eif2 kinase pkr which is recruited into ribosomal protein complex during cellular pathogenic stresses in response to the inflammatory stimulation [ 41 , 43 , 44 ] . \n pkr is an interferon - induced serine / threonine protein kinase activated by double - stranded rna ( dsrna ) that plays important roles in the antiviral defense by interferon , particularly during cell growth control and differentiation [ 46 , 47 ] . \n mainly , dsrna mediates pkr activation upon viral infection , which blocks the synthesis of new viral particle proteins . \n ribosome - inactivating stress is another inflammatory trigger known to activate pkr - linked signaling pathways in the ribosome [ 41 , 49 , 50 ] . since activated pkr mediates proinflammatory chemokine induction in response to viral infection \n , it increases infiltration of inflammatory cells including neutrophils which promotes tissue injuries in response to viral infection [ 41 , 51 ] . \n proinflammatory chemokines such as mcp-1 and il-8 induced by ribosomal inactivation thus exacerbated viral bronchopneumonia induced by respiratory reovirus infection . \n mechanistically , ribosomal inactivation damages the loops in the ribosome , which facilitates ribosomal binding to one or both dsrna - binding domains of pkr and induces enzymatic activation . \n while acute exposure to high levels of ribosomal stress , activated pkr plays important roles in activating stress responses like cell death via mitogen - activated protein kinases ( mapks ) such as p54 , p46 , and c - jun n - terminal kinase 1 and 2 ( jnk1/2 ) , milder exposure to ribosomal inactivation can trigger mucosal and systemic inflammation via the production of proinflammatory chemokines by epithelial and other immune - related cells [ 27 , 29 , 30 , 52 ] . \n low levels of ribosomal insults promote proinflammatory cytokine induction via a different set of mapks such as p38 [ 40 , 41 ] . \n one upstream activator of p38 that responds to ribosomal stress is pkr , which is critical to ribosomal recruitment of p38 , its subsequent phosphorylation , and p38-mediated transcriptional activation of proinflammatory cytokines . in response to ribosomal inactivation by deoxynivalenol , \n ribosome recruits the hematopoietic cell kinase that also activates p38 map kinase cascade in macrophages . \n therefore , ribosomal 40s subunit serves as a scaffold for pkr and other recruited signaling molecules , facilitating mapk mobilization and subsequent cytokine induction . \n however , more definite molecular mechanisms should be addressed to identify the link between ribosome - specific activation of pkr and ribosomal inactivation in future studies . \n ribosomes that synthesize proteins become bound to er membrane , after which the two organelles engage in crosstalk related to various stress signals and the protein synthesis process [ 2 , 3 ] . \n activated ribosomal proteins thus may induce er stress - related responses , which are attenuated by deletion of ribosomes in yeast and human cells such as monocyte - derived cells and epithelial cells [ 2 , 3 , 53 ] . \n er - disrupting environmental and genetic factors cause accumulation of misfolded and unfolded proteins in the er lumen , a condition termed er stress . \n ribosomal inactivation can also alter er functions , and some chemical ribosomal inactivators such as trichothecenes , verotoxins , or ricin enhance unfolded protein responses that contribute to proinflammatory cytokine production and apoptosis - linked tissue injuries [ 5456 ] . \n in particular , er stress is a risk factor of inflammatory bowel diseases ( ibds ) including crohn 's disease and uc , which are triggered by genetic or environmental factors such as smoking , stress , diet , and microbial components that can induce excessive inflammation [ 6063 ] . \n mechanistically , proinflammatory cytokines play central roles in mediating er stress - linked inflammatory diseases [ 6466 ] . \n moreover , unlike canonical nuclear factor kappa b ( nf-b ) activation , the upstream activator ib kinase ( ikk ) is not activated during er stress . instead , the level of basal ikk activity maintained via an er stress sensor inositol - requiring er - to - nucleus signal kinase 1 ( ire1 ) is essential to regulation of nf-b activation . \n phosphorylated eif2 by perk in combination with ire1 action then leads to repressed synthesis of ib and subsequent maximum nf-b activation during er stress in monocyte - derived cells [ 66 , 67 ] . \n although macrophage nf-b is activated by ribosomal insults , epithelial nf-b expression and activity are strictly regulated to prevent overstimulation of proinflammatory responses following exposure to commensal bacteria [ 68 , 69 ] . \n however , suppressed nf-b in gut epithelial cells is not beneficial during pathogen infection since the production of many antibacterial mediators such as defensins is dependent on nf-b signaling pathways for their induction in gut barrier . in spite of nf-b suppression \n some of epithelial proinflammatory chemokines such as il-8 are upregulated by ribosomal inactivation [ 27 , 70 , 71 ] . \n moreover , ribosomal inactivation can trigger the expression of er stress - linked transcriptional regulators such as ccaat / enhancer - binding protein homologous protein ( chop ) , which can mediate toxic inflammatory responses in human intestinal mucosa , lung , and pancreas [ 72 , 73 ] . \n although chop is a key apoptotic signal inducer , it can also modulate different types of inflammatory responses . \n specifically , chop is a dominant negative form of c / ebp family members that lacks dna binding activity and can form heterodimer complexes with other c / ebp members , thereby inhibiting their functions as transcription factors . since c / ebp mediates expression of anti - inflammatory peroxisome proliferator - activated receptor gamma ( ppar ) by forming homodimers and binding to the ppar promoter [ 74 , 75 ] , chop - c / ebp complex thus interferes with basal ppar expression and facilitates nf-b activation by er stress . \n overall , ribosomal inactivation - induced er stress enhances proinflammatory cytokine production via nf-b activation in monocyte - derived cells , which can be also facilitated by chop - mediated regulation of anti - inflammatory ppar. by contrast , ribosomal inactivation may suppress epithelial nf-b expression and activity while some of epithelial proinflammatory chemokines are enhanced in nf-b - independent ways . \n once activated by early sentinels from ribosomal recruitment of signaling mediators or the provoked er stress sentinels , the downstream mapk cascade accelerates the induction of proinflammatory cytokines through activation of transcription factors such as nf-b , activating protein 1 ( ap-1 ) , ccaat enhancer binding protein ( c / ebp ) , cyclic amp response element binding protein ( creb ) , and early growth response 1 ( egr-1 ) gene product [ 27 , 33 , 7779 ] . \n ribosomal inactivation activates nf-b - linked proinflammatory signals for cytokine induction in monocyte - derived cells , while extended exposure to the toxic stress can suppress the signals in epithelia as commented [ 80 , 81 ] . \n moreover , induction of epithelial proinflammatory cytokines by ribosomal inactivation occurs independently of the nf-b signaling pathway [ 27 , 28 ] . instead of nf-b , egr-1 can be involved in proinflammatory chemokine gene expression in ribosomal inactivation - insulted intestinal epithelial cells . \n while egr-1 positively mediates epithelial chemokine induction by ribosomal inactivation , egr-1 also contributes to negative regulation of proinflammatory nf-b signaling via ppar induction in intestinal epithelial cells . \n egr-1 is known to specifically bind and transactivate ppar promoter [ 82 , 83 ] although it can also be involved in inhibition of ppar gene expression in some cell types . \n ribosomal inactivation disrupts the balance between ppar and nf-b - linked signaling in the mucosal epithelia by enhancing egr-1 gene expression and subsequently ppar levels , leading to greater suppression of proinflammatory nf-b signaling in response to infectious agents including endotoxins . \n clinical investigations demonstrated that the commensal microflora can enhance the expression of ppar that is impaired in ulcerative colitis ( uc ) patients , particularly in the enterocytes [ 8587 ] . \n since epithelial ppar plays protective roles against the colonic inflammatory responses to both commensal and pathogenic bacteria [ 8890 ] , its attenuation by ribosomal insults would be detrimental as implicated in uc patients . \n although ppar generally attenuates epithelial inflammatory responses by triggering nuclear export of p65 protein in complex with ppar , it can also regulate proinflammatory cytokine production via nf-b - independent activation of signaling mediators such as protein kinase c alpha , which induces cellular desensitization to proinflammatory stimulation in monocyte - derived cells . \n overall , ribosomal inactivation triggers chemokine gene induction through nf-b or alternate proinflammatory transcription factors including egr-1 , while negatively regulating ppar-directed anti - inflammatory actions . \n in addition to transcriptional regulation , posttranscriptional modifications such as mrna stabilization may lead to cytokine superinduction via ribosomal inactivation in leukocytes and gut epithelial cells [ 69 , 93 , 94 ] . \n moreover , epithelial er stress that can be triggered by ribosomal inactivation also enhances cytokine mrna stability . in response to \n er stress , eukaryotic cells selectively shut down the global protein translation via eif2 phosphorylation , which results in a limited availability of the eif2-gtp - trna complex . \n however , mrna of some early stress responsive genes is rapidly recruited from translating ribosomes into stress granules ( sgs ) as untranslated form [ 95 , 97 ] . \n independently of eif2 phosphorylation , blocking of ribosome recruitment also induces stress granule formation by interfering with eif4b activity , an rna helicase required for the ribosome recruitment phase of translation initiation [ 98 , 99 ] . \n therefore , disruption of ribosomal integrity as an alternate pathway would induce the formation of sgs without regard to stress - induced eif2 phosphorylation . \n the temporal storage in stress granules provides mrna with shelter from degradation and maintain silenced mrnas to resume protein translation upon stress release . \n the untranslated mrnas in sgs under stress are protected via sg - recruited mrna - stabilizing proteins such as hur / elav - like rna binding protein 1 ( elavl1 ) that positively regulates the stability of mrna transcripts containing au - rich elements ( ares ) , including those for proinflammatory cytokines [ 100102 ] . \n hur protein binds to ares in the 3 untranslated region ( 3utr ) of target mrna molecules in the nucleus and then translocates into the cytoplasm for translation . \n cytosolic translocation of the hur protein is also initiated by mucosal ribosome - inactivating stress and ultimately stabilizes cytokine mrna in the cytoplasm and sgs [ 71 , 93 ] . as an hur modulator , \n chop plays key roles in maintenance of the mrna stability of cytokine genes in response to ribosome - inactivating stress . \n similar to er stress , ribosome - inactivating stress induces chop expression , which also suppresses ppar expression as indicated in section 2 . as a target of chop induced by ribosomal inactivation \n , ppar is not involved in epithelial chemokine regulation at the transcriptional level . instead , chop is a positive regulator of cytokine mrna transcript stability that occurs via hur protein [ 71 , 76 ] . in response to mucosal \n ribosomal inactivation , enhanced mucosal ppar regulates epithelial chemokine gene induction , which is posttranscriptionally modulated by hur independently of nf-b - linked signals [ 71 , 103 ] . \n mechanistically , induction of chop by ribosomal inactivation enhances the cytosolic translocation of hur protein by suppressing ppar expression . \n because ppar inhibits the cytosolic translocation of hur , suppression of ppar by chop protein facilitates hur movement into the cytoplasm and subsequent cytokine mrna stabilization . \n ribosome inactivation - triggered translocation of hur protein also enhances expression of activating transcription factor 3 ( atf3 ) , which plays a central role in the regulation of proinflammatory nf-b signals in human gut epithelial cells . \n therefore , hur contributes to cytokine superinduction by ribosome - inactivating stress while retarding nf-b activation via atf3 . \n further studies are needed to assess the effects of altered ppar on the stability of chemokine transcripts in addition to the regulatory action of ppar on transcriptional activity of chemokine genes in response to mucosal ribosomal inactivation . taken together , ribosomal inactivation leads to chemokine superinduction via mrna stabilization by rna - binding proteins such as hur whose cytosolic translocation is facilitated by chop protein . \n moreover , hur can mediate atf3 superinduction as well , leading to suppression of nf-b signals in enterocytes . \n following transcriptional induction , some proinflammatory cytokines such as interleukin 1 ( il-1 ) and interleukin 18 ( il-18 ) undergo maturation triggered by the inflammasome - linked sentinel [ 104106 ] . \n ribosome - inactivating stress also triggers some inflammasome - linked processes that promote the maturation of inflammatory cytokines in monocyte - derived cells [ 107109 ] . \n ricin , a potent ribosomal toxin , leads to acute lung injury and symptoms resembling acute respiratory distress syndrome via the il-1-activated signaling pathway in alveolar macrophages . \n mechanistically , the nod - like receptor ( nlr ) family member , nlrp3 , stimulates il-1 processing via nlrp3 inflammasome , which is triggered by ribosome - inactivating stress in pulmonary macrophages [ 107 , 108 ] . \n although the detailed molecular modes are still unknown , ribosomal inactivation may mediate a drop in cellular potassium , leading to protein translation and subsequent activation of the nlrp3 inflammasome . \n a recent study suggested that , as another mechanism of inflammasome activation by ribosomal inactivation , the activation of p38 mapk by ribosome - inactivating stress triggers formation of a pyrin inflammasome complex with asc : apoptosis - associated speck - like protein containing a caspase recruitment domain and procaspase-1 , leading to asc oligomerization , caspase-1 activation , and pro - il-1 processing in macrophages . in both cases , \n ribosomal inactivation is considered to provoke latent inflammatory storms via inflammasome activation in the monocyte - derived cells . \n ribosomal inactivation stimulates map kinase signaling via direct modulation of a broad spectrum of physiological stimuli including appropriate growth factors and cytokines [ 10 , 32 , 111 ] . \n activated map kinase triggers phosphorylation of tnf--converting enzyme ( tace ) , which is also known as a disintegrin and cell - surface metalloproteinase 17 ( adam17 ) , which is then translocated to the cell surface for its action . \n tace - dependent ectodomain shedding of cell - surface proteins is increased by erk and p38 map kinase , which phosphorylate threonine 735 in the cytoplasmic tail of tace [ 112 , 113 ] . \n ligands of the epidermal growth factor receptor ( egf ) need to be cleaved by tace and shed as soluble proteins in order to become systemically available and many proinflammatory cytokines or receptors of the tumor necrosis factor alpha ( tnf ) family are also cleaved by tace [ 113115 ] . \n consistent with these findings , ribosomal inactivation activates tace - mediated ectodomain shedding of tnf receptor 1 via activated map kinases in pneumocytes [ 116 , 117 ] . in this case , \n ribosomal inactivation attenuated cellular responses to proinflammatory cytokines via tace - mediated shedding of cytokine receptor , which regulates the storm of proinflammatory cytokines in the body that occurs under the ribosomal - inactivating stress . \n however , tace is also needed for the generation of soluble tnf , an important therapeutic target of inflammatory diseases such as arthritis , sepsis and colitis and thus the inhibition of tace leads to protection from the diseases in animals although many physiologic activities of tace make blockade of this enzyme problematic . \n since tace - associated cytokine regulation could be thus beneficial or detrimental , more careful investigations are needed for the ultimate actions of the ribosomal inactivation in the tace - related pathogenesis . \n although the primary effects of ribosomal inactivation on cells are linked to global protein synthesis , some early responsive gene products including proinflammatory cytokines are exclusively enhanced in lymphoid tissue and epithelia . although surface receptors triggering cytokine induction are activated by some ribosomal inactivation , \n the ribosomal subunit serves as a scaffold for pkr , while other signaling mediators help promote their activation , which then facilitates mapk mobilization and subsequent cytokine induction . \n ribosomal inactivation - induced er stress also can mediate proinflammatory cytokine production via nf-b activation , which is facilitated by chop - mediated regulation of anti - inflammatory ppar. in addition to nf-b - linked signals , cytokine expressions are transcriptionally promoted by alternate proinflammatory transcription factors such as egr-1 but paradoxically egr-1 enhances ppar expression , which suppresses proinflammatory nf-b signaling in gut epithelial cells . \n in addition to transcriptional regulation , posttranscriptional modifications such as mrna stabilization contribute to cytokine superinduction via various rna - binding stabilizers such as hur for stabilization of mrna transcripts with cytokine transcript ares . \n moreover , cytokine mrna stability is enhanced by chop protein , which facilitates cytosolic translocation of hur by limiting ppar expression in cells under ribosome - inactivating stress . \n some proforms of cytokines such as il-1 and il-18 are cleaved to mature active forms by inflammasome - triggered caspases , which are also activated by ribosomal inactivation in macrophages . \n however , since ribosomal inactivation causes shedding of the ectodomain of several cytokine receptors via mapk - activated cell - surface metalloproteinase tace , additional information is needed to understand whether the ribosomal inactivation would attenuate or exacerbate the stress - associated inflammatory diseases .", "role": "user" }, { "content": "ribosomal inactivation damages 28s ribosomal rna by interfering with its functioning during gene translation , leading to stress responses linked to a variety of inflammatory disease processes . \n although the primary effect of ribosomal inactivation in cells is the functional inhibition of global protein synthesis , early responsive gene products including proinflammatory cytokines are exclusively induced by toxic stress in highly dividing tissues such as lymphoid tissue and epithelia . in the present study , \n ribosomal inactivation - related modulation of cytokine production was reviewed in leukocyte and epithelial pathogenesis models to characterize mechanistic evidence of ribosome - derived cytokine induction and its implications for potent therapeutic targets of mucosal and systemic inflammatory illness , particularly those triggered by organellar dysfunctions .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: plants convert assimilated carbon into a range of monosaccharide sugars , many of which serve as precursors for the synthesis of more complex oligo- and polysaccharides . \n these complex carbohydrates fulfill very diverse functions in plants and are , for example , used as long - term energy storage or constitute important structural components of plant cells . \n in addition to their metabolic and structural roles , carbohydrates can also influence plant growth and development by acting as elicitors or growth regulators ( creelman and mullet , 1997 ) . \n the regulation of plant development by carbohydrates has attracted a lot of interest over the last few years and several signaling pathways that integrate sugar responses have been identified . \n one such pathway involves the synthesis , perception , and response to the non - reducing disaccharide trehalose and its precursor trehalose-6-phosphate ( t6p ) . \n trehalose is widely distributed in actinomycetes , fungi , insects , and other invertebrates ( veluthambi et al . , 1981 ; elbein et al . , \n 2003 ) , where it reduces protein aggregation during stress conditions ( jain and roy , 2010 ) . \n however , the majority of land plants contain only low quantities of trehalose , making its role in stress protection seem unlikely ( zentella et al . \n exceptions to this rule are resurrection plants , in which trehalose is found at higher quantities and has an apparent function in protecting the plants against abiotic stresses by preventing the denaturation of cellular proteins ( mrquez - escalante et al . , 2006 ) . \n the biosynthesis of trehalose in plants involves the generation of trehalose-6-phosphate ( t6p ) from glucose-6-phosphate and udp - glucose by trehalose-6-phosphate synthase ( tps ) , and the subsequent dephosphorylation of t6p to trehalose by trehalose-6-phosphate phosphatase ( tpp ; cabib and leloir , 1958 ) . \n the a. thaliana genome contains 11 tps ( attps111 ) genes and 10 tpp ( attppa j ) genes ( table 1 ; leyman et al . , 2001 ) . \n the attps proteins carry both tps- and tpp - like domains and have been classified into two distinct subfamilies based on their homology with the yeast ( saccharomyces cerevisiae ) sctps . \n attps1 to attps4 , which constitute the class i subfamily of tpss , show the highest overall similarity to sctps1 and in them , the tpp - like domain is only weakly conserved . \n attps1 differs from the other class i tpss in that it contains an auto - inhibitory n - terminal extension that restricts its activity in vivo ( van dijck et al . , \n the class ii subfamily tpss ( attps5 to attps11 ) display more similarity to sctps2 and contain conserved tpp motifs . \n ( 2008 ) , and both forms of nomenclature are used in the literature . among the arabidopsis tpss , only tps1 shows a demonstrable tps activity ( blzquez et al . , 1998 ) . \n however , two active isoforms of tps1 , ostps1a , and ostps1b , have been identified in rice ( zang et al . , 2011 ) . \n other tpss including class ii tpss lack both tps and tpp activities ( vogel et al . , 2001 ; harthill et al . , 2006 ; ramon et al . , 2009 ) \n attps1 expression has been detected by qrt - pcr in flower buds , ripening siliques , small rosette leaves , and in embryos using a tps1-gus reporter ( van dijken et al . \n however , since this reporter mostly comprises the first intron , which is located in the 5 untranslated region of tps1 , these results need to be verified . similar to tps1 , class ii tpss are expressed widely throughout the plant ( paul et al . , 2008 ; ramon et al . , 2009 ) . \n in contrast , the other class i tps genes , attps24 , have been reported to be specifically expressed in siliques and seeds ( paul et al . , 2008 ) . \n all tpps lack the n - terminal tps - like domain found in the tps proteins and contain only the conserved tpp domain , which shows significant similarity to the highly conserved phosphatase box in the c - terminal part of sctps2 ( lunn , 2007b ) . out of the 10 tpps in arabidopsis , attppa and \n attppb genes have been shown to complement yeast tpp mutant ( tps2 ) and thus encode active tpp enzymes ( vogel et al . , 1998 ) . \n outside arabidopsis , tpp2a from rice ( habibur rahman pramanik and imai , 2005 ; shima et al . , 2007 ) and ramosa3 of maize ( satoh - nagasawa et al . , 2006 ) have been shown to encode active tpps . \n in contrast to the tps and tpp gene families , trehalase , which cleaves trehalose into two glucose molecules , appears to be encoded by a single gene ( attre1 ; leyman et al . \n sugars , including trehalose and , more importantly , t6p have been proposed to act as signaling molecules that modulate many important metabolic and developmental processes in plants ( reviewed in paul et al . , 2008 ) and there is growing evidence that t6p plays a central role in regulating carbohydrate metabolism ( figure 1 ) . \n trehalose-6-phosphate ( t6p ) is synthesized from udp - glucose ( udpg ) and glucose-6-p ( g6p ) by the activity of trehalose-6-phosphate synthase ( tps ) and subsequently converted to trehalose by trehalose-6-phosphate phosphatase ( tpp ) . \n it has been suggested that t6p is transported by an unknown mechanism into plastids where it induces starch synthesis via thioredoxin - mediated activation of agpase . \n t6p might be converted into trehalose , which has been shown to regulate starch breakdown in plastids . \n several tpps ( marked with an asterisk ) have been predicted to localize to plastids , but this still needs to be confirmed experimentally . \n snrk1 , which represses plant growth , is inhibited by t6p . a regulatory loop , which involves t6p , snrk1 , and bzip11 , and that is thought to control sucrose availability and utilization , has been proposed . more specifically , t6p has been shown to regulate sucrose utilization in plants . \n transgenic arabidopsis lines expressing e. coli tps ( otsa ) or tpp ( otsb ) genes displayed differences in t6p accumulation and responded differently to exogenous sucrose . in general , the ability of these plants to utilize sucrose , increased with rising concentration of t6p ( schluepmann et al . , 2004 ) . \n conversely it was found that the amount of t6p strongly corresponds to sucrose availability in arabidopsis wild - type plants . \n ( 2006 ) showed that sucrose feeding rapidly induced t6p in carbon - starved seedlings . \n the rapid increase of t6p in response to exogenous sucrose may be due to an increase in the amount of available glucose-6-phosphate ( g6p ) and udp - glucose ( udpg ) , which have been shown to be important in determining plant growth and biomass accumulation ( meyer et al . , 2007 ) . \n thus t6p indirectly reflects sucrose concentrations and has now been widely accepted as an indicator of sucrose status in plants ( lunn et al . , 2006 ; reviewed in paul et al . , 2008 ) . \n the importance of t6p was also made apparent in arabidopsis and tobacco plants over - expressing e. coli \n tps ( otsa ) and e. coli \n tpp ( otsb ; schluepmann et al . \n interestingly , the tobacco plants over - expressing otsa exhibited large increase in photosynthetic capacity per unit leaf area and dry weight . \n this boost in photosynthetic capacity was shown to be in part as a result of increased expression of abi4 , a known regulator of rubisco genes ( acevedo - hernndez et al . , 2005 ) . \n an opposite effect was observed in e. coli \n tpp ( otsb ) over - expressing plants ( pellny et al . , 2004 ) . \n the observed changes in the photosynthetic capacity in plants with altered t6p levels reflect the combined effects of t6p on leaf development , in particular on cell division and cell wall biosynthesis , and a more direct effect on the regulation of factors involved in regulating photosynthesis such as abi4 . \n however , the details of how t6p imparts such a dramatic regulation in photosynthesis are not yet fully understood . \n exogenous application of trehalose induces accumulation of starch by increasing the activity of adp - glucose pyrophosphorylase ( agpase ) , a major enzyme controlling starch synthesis ( wingler et al . , 2000 ) . \n it has also been shown that t6p , synthesized by tps1 , which has been predicted to be mainly localized in the cytoplasm , promotes agpase activation in chloroplasts via a thioredoxin - mediated redox reaction ( kolbe et al . , 2005 ) . \n rising sucrose levels , which are accompanied by an increase in the level of t6p , also resulted in increased starch synthesis via agpase activation ( lunn et al . , 2006 ) . \n as agpase is localized in chloroplasts , t6p mediated agpase activation suggests a link between cytosolic carbon status and plastidic starch storage . \n accumulation of sucrose in the leaf has been shown to increase the t6p content , leading to activation of agpase in the chloroplasts , without apparent change in the rate of photosynthesis . in this way \n , t6p might act as a signal between the cytosol and the chloroplast ( lunn , 2007a ) . whether t6p is transported into the chloroplast \n apart from its role in regulating starch metabolism , t6p has recently been shown to inhibit the sucrose non - fermenting 1-related protein kinase1 ( snrk1 ) complex of the snf-1-related group of protein kinases in arabidopsis ( zhang et al . , 2009 ) , which acts as a metabolite sensor to constantly adapt metabolism to the supply and demand of energy ( polge and thomas , 2007 ) . \n more recently , inhibition of snrk1 by t6p has also been demonstrated in a transgenic sugarcane suspension cell line expressing a vacuole - targeted sucrose isomerase ( wu and birch , 2010 ) , in wheat grain extracts ( martnez - barajas et al . , 2011 ) , and in potato tubers ( debast et al . , 2011 ) \n snrk1 is a hetero - trimeric protein complex composed of an akin10 or akin11 catalytic -subunit , - , and -subunits , which together form the active kinase complex ( polge and thomas , 2007 ) . over - expression of snrk1 \n , promotes plant survival under low light and starvation conditions , in additions to altering inflorescence development and delaying senescence . \n in contrast , akin10 \n akin11 virus - induced gene silencing double mutant plants showed growth arrest coupled with premature senescence . \n the akin10/akin11 signaling cascade seems to be crucial for plant survival under stress , e.g. , darkness and sugar deprivation ( baena - gonzlez et al . , 2007 ) . \n microarray analysis showed that most of the up - regulated genes in e. coli tps ( otsa ) over - expressing plants were down - regulated in akin10 over - expressors \n in addition , snrk1 has also been implicated in sugar and aba signaling pathways in an independent study ( jossier et al . , 2009 ) . \n importantly , the effects on snrk1 activity seem to be specific to t6p , as none of the other tested sugars or sugar phosphates inhibited snrk1 ( zhang et al . , 2009 ) . \n taken together , these experiments provide strong evidence that t6p inhibits snrk1 to activate biosynthetic processes in growing tissues . \n these results suggest a regulatory loop in which sucrose - induced t6p inhibits snrk1 when sucrose is plentiful . when the sucrose content decreases , with t6p decreasing as well , snrk1 is released from repression , which leads to the induction of genes involved in photosynthesis related processes , so that more carbon is made available to the growing cells , to replenish a carbon deficit ( delatte et al . , 2011 ) . \n more recently the arabidopsis basic region leucine zipper transcription factor 11 ( bzip11 ) has been implicated in t6p signaling . in particular , over - expression of bzip11 , which is repressed by sucrose through a translational inhibition mechanism ( hanson et al . , \n 2008 ) , has been shown to result in reduced t6p levels ( ma et al . , \n bzip11 over - expressing plants also exhibited resistance to exogenously applied trehalose and accumulation of t6p , with concomitant reduction of snrk1 activity ( delatte et al . \n the authors propose that bzip11 acts as a powerful regulator of carbohydrate metabolism and is part of a growth regulatory network that includes t6p and the snrk1 ( delatte et al . , 2011 ) . \n the importance of t6p in metabolic processes has also been recently demonstrated in potato , where t6p has been shown to influence tuber growth ( debast et al . , 2011 ) . \n transgenic potato lines over - expressing e.coli \n tps ( otsa ) displayed reduced starch content , decreased amounts of atp coupled with an increased respiration rate ( indicating high metabolic activity ) , and delayed sprouting . \n conversely , lines that over - expressed the e. coli \n tpp gene otsb , displayed significantly reduced t6p levels , and accumulated soluble carbohydrates , hexose - phosphates , and atp . these plants no longer displayed any changes in starch content or early sprouting ( debast et al . , 2011 ) . \n taken together , these results indicate that t6p functions as a key regulator of plant growth in response to environmental stimuli by regulating the central carbon metabolism . \n apart from its role in regulating carbohydrate metabolism , t6p has also been shown to be important for normal plant development . \n this was first noticed in plants over - expressing trehalose biosynthesis genes , which displayed a wide range of developmental defects . \n in addition , tps1 loss of function mutations in arabidopsis demonstrated that tps1 was required for successful embryo maturation . \n homozygous tps1 mutant embryos were shown to initially develop normally , but further development was found to be progressively retarded , and eventually stalled completely at torpedo stage , when cell expansion and storage reserve accumulation occurs ( eastmond et al . , 2002 ) . \n later studies revealed that cell cycle activity was perturbed in maturing mutant embryos and that the cell walls of these embryos were thicker than those of wild - type embryos ( gmez et al . , 2006 ) . \n taken together these results indicate that t6p plays an important role in orchestrating cell cycle activity and cell wall biosynthesis with cellular metabolism during embryo development ( gmez et al . , \n the function of tps1 in regulating plant development is , however , not limited to embryogenesis . \n when embryo - lethal tps1 mutant plants were rescued by dexamethasone - inducible transient expression of attps1 during embryo maturation , the resulting plants showed phenotypic abnormalities throughout vegetative growth and floral transition ( van dijken et al . , 2004 ) . \n in particular , the rescued plants exhibited delayed germination , slow development , perturbed root growth , and a stunted stature . \n in addition , the plants displayed reduced apical dominance and aerial rosettes even under long day conditions . \n the abnormal growth patterns in rescued tps1 mutants , which can be almost recovered by inducing expression of tps1 , clearly show the role of t6p in plant vegetative growth and development in arabidopsis . in a more recent study , expression of tps1 from the seed - specific abi3 promoter \n was used to rescue tps1 embryo - lethal phenotype ( gmez et al . , 2010 ) . \n the rescued plants displayed a severe growth arrest , accumulated soluble sugars and starch and resulted in up - regulation of several genes involved in aba signaling . \n in addition , non - embryo - lethal weak alleles of tps1 isolated from a tilling population showed reduced growth and delayed flowering when compared to wild - type plants . \n these plants were also found to be aba hypersensitive , and accordingly displayed reduced stomatal aperture size ( gmez et al . , 2010 ) . taken together , these results suggest that t6p might act through a mechanism involving aba and sugar metabolism to coordinate embryo maturation and vegetative growth . later in development , tps1 is required for the timely induction of flowering . \n this was first demonstrated in tps1 mutant plants that had been rescued through embryogenesis by means of dexamethasone - inducible tps1 expression ( van dijken et al . , 2004 ) . \n interestingly , these plants completely failed to flower , unless tps1 expression was induced ( figure 2 ) . delayed flowering has also been observed in non - embryo - lethal weak alleles of tps1 isolated from a tilling population ( gmez et al . , 2010 ) . \n induction of flowering is known to be associated with starch mobilization , a transient increase in leaf carbohydrates and finally the export of sugars to the shoot apical meristem , suggesting that phloem - mobile carbohydrates are a critical factor in controlling the transition to flowering ( corbesier et al . , 1998 , 2002 ) . \n the finding that exogenous supply of sucrose is sufficient to promote morphogenesis and flowering in arabidopsis in the dark further emphasizes the importance of carbohydrates in flowering ( roldn et al . , 1999 ) . \n in addition , supplementation with 1% exogenous sucrose was shown to rescue the late flowering phenotype of several flowering time mutants ( roldn et al . \n . the molecular mechanisms by which sugars control the transition to flowering are largely unknown . \n however , it seems likely that t6p as a signal of sucrose status plays an important role in floral transition . \n are wild - type ( col-0 ) plants and homozygous tps1 mutants that carry a chemically inducible tps1 rescue construct ( gvg::tps1 ) , which flower late when compared to wild - type control . \n plants were grown under long day photoperiod at 23c and the images were taken on 20 and 50 days after sowing , for wild - type and homozygous tps1 mutant , respectively . \n tps1 is not the only arabidopsis tps gene for which a function in plant development has been reported . \n the cell shape phenotype-1 ( csp-1 ) mutant , which has been mapped to a point mutation in attps6 , a class ii tps gene , displayed an absence of lobes in pavement cells , reduced trichome branching , altered leaf serration and stem branching , and increased stomatal density ( chary et al . , 2008 ) . \n however , since none of these alterations except for the cell shape defects could be observed in a tps6 t - dna insertion line ( chary et al . , 2008 ) , these findings need to be confirmed . \n the evidence for this largely comes from the ramosa3 ( ra3 ) mutant in maize . in ra3 plants \n the tassel or the male inflorescence of wild - type maize plants has elongated branches at the base and also possesses a central spike consisting of short branches with spikelet pairs . \n in contrast , the laterally placed ears or the female inflorescences have short branches , which aids in better packaging of seeds . however , the tassels of ra3 plants have additional long branches and the ears produce abnormally shaped long branches at their bases . the ra3 gene , which is expressed in distinct domains delineating axillary inflorescence meristems , has been shown to encode a tpp ( satoh - nagasawa et al . , 2006 ) . \n genetic and molecular data indicate that ra3 regulates inflorescence branching by modification of sugar signals possibly coordinated by t6p . \n ra3 is a functional tpp enzyme which acts upstream of ra1 transcription factor in the ramosa pathway , thereby regulating inflorescence development ( satoh - nagasawa et al . \n this study nicely indicates that t6p metabolism can influence a specific developmental pathway in plants such as inflorescence architecture . \n the last few years have seen considerable progress in our understanding of t6p signaling as a central player in coordinating metabolism with growth and development . \n however , compared to other plant signaling pathways , our knowledge of t6p signaling is still relatively sparse . \n one reason for this has been the intricate and tight connection between t6p signaling and other developmental signaling pathways . \n furthermore , uncovering the exact functions of t6p with respect to specific physiological processes has proven difficult , as it is present in plant cells only in low amounts . \n another obstacle has been that t6p is essential for plant development , making the genetic analysis of the t6p signaling pathway rather difficult . \n however , lately most of these technical hurdles have been overcome and we can now expect new approaches to unravel the remaining mysteries behind t6p as a central regulator of plant growth and development . \n the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .", "role": "user" }, { "content": "beyond their metabolic roles , sugars can also act as messengers in signal transduction . \n trehalose , a sugar found in many species of plants and animals , is a non - reducing disaccharide composed of two glucose moieties . \n its synthesis in plants is a two - step process , involving the production of trehalose-6-phosphate ( t6p ) catalyzed by trehalose-6-phosphate synthase ( tps ) and its consecutive dephosphorylation to trehalose , catalyzed by trehalose-6-phosphate phosphatase ( tpp ) . \n t6p has recently emerged as an important signaling metabolite , regulating carbon assimilation and sugar status in plants . \n in addition , t6p has also been demonstrated to play an essential role in plant development . \n this review recapitulates the recent advances we have made in understanding the role of t6p in coordinating diverse metabolic and developmental processes .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the esthetic treatment of anterior teeth has always presented a challenge in clinical practice . with the improvement of dental materials , \n many restorative options such as resin composites , all - ceramic crowns , and ceramic veneers became available . \n in these circumstances , dentists and patients must choose the best alternative to improve oral condition and esthetic results . \n ceramic laminate veneers may be indicated when there is anterior dental wear and enough remaining sound dental structure . \n this treatment option has been used due to ceramics color stability , biocompatibility , mechanical properties , and esthetic outcome . \n such esthetic treatments , however , must not be conducted without an appropriate restorative planning . \n the preparation design and the amount of remaining dental structure have significant effects on load to failure of ceramic veneers . \n this concept of planning may be used to assist the cosmetic intervention and develop esthetically beautiful smiles . \n therefore , the dentist and laboratory technician must follow a proper protocol to achieve higher clinical success rates . \n it is important to emphasize that the clinician should have a good understanding of the ceramic type to establish the appropriate cementation procedure that will contribute to long - lasting restorations . \n hence , the aim of this paper is to describe minimum thickness ceramic laminate veneers as a restorative solution to improve the esthetics of the smile . \n a 34-year - old female patient with enamel hypoplasia on anterior upper incisors was referred to treatment . \n radiographic images and clinical exam were conducted . clinically , enamel hypoplasia and discrepancies in shape , form , and color were observed [ figure 1a c ] . \n diagnostic casts and waxed - up restorations to define shape and form were previously obtained to assist the treatment planning . due to the case characteristics , \n note the compromised esthetics due to enamel hypoplasia and anatomic discrepancies of form , shape , and color . \n ( c ) close - up view of the right maxillary anterior teeth dental preparation consisted of slightly grinding the incisal edges of the lateral incisors and left central incisor with a # 2135-diamond bur ( kg sorensen , barueri , sp , brazil ) [ figure 2 ] . \n enamel surfaces were then polished with sequential aluminum oxide discs from coarse to ultrafine ( 3 m sof - lex , 3 m espe , seefeld , germany ) . at the same appointment , \n in - office bleaching was performed with 35% hydrogen peroxide ( mix one , villevie , joinville , sc , brazil ) following the manufacturer 's instructions [ figure 3 ] . \n the teeth preparation was limited to enamel application of 35% hydrogen peroxide gel on the surface of the anterior teeth no provisionals were required due to the minimal preparation performed , with no dentin exposure . on a subsequent appointment after 2 weeks , shade selection was performed and impression taken using retraction cords ( ultrapak cord # 000 , ultradent products inc . , \n this technique was selected to provide gingival sulcus enlargement without using impregnated cords with hemostatic or astringent solutions . \n the impressions were taken using a vinyl polysiloxane material ( express xt , 3 m espe , seefeld , germany ) . \n the trays were loaded with the heavy - bodied impression material , while the light - bodied impression materials were simultaneously spread on the teeth . \n retraction cords in position previously to the impression technique ceramic laminate veneer restorations were fabricated with a lithium disilicate - reinforced glass ceramic material ( ips e.max press , ivoclar - vivadent , liechtenstein ) , using the heat press technique . a layering ceramic ( ips e.max ceram , ivoclar - vivadent ) was further applied to improve the incisal edge optical characteristics [ figure 5a ] . \n ( a ) completed minimum thickness anterior porcelain laminate veneers restorations on the working cast . \n ( b ) application of the bonding system the veneers internal surfaces to be bonded were etched with hydrofluoric acid ( porcelain etchant 9,5% , bisco inc . , schaumburg , il , usa ) for 20 seconds , washed under running water , dried with an air syringe , and primed ( porcelain primer , bisco inc . \n , schaumburg , il , usa ) . a try - in paste ( relyx veneer try - in , 3 m espe , seefeld , germany ) was used to select the proper color of the luting cement . \n the laminate veneers were then washed to remove try - in paste and excess of silane and carefully air - dried . \n one coat of the bonding resin of adper scotchbond ( 3 m espe , seefeld , germany ) was applied and light - cured [ figure 5b ] . during the cementation \n , veneers were cemented separately one - by - one by conditioning with phosphoric acid and applying the same bonding resin on the tooth surface . \n the laminate veneer restoration was bonded with a light - curable resin - based luting agent ( relyx veneer , 3m / espe , seefeld , germany ) . \n the light polymerization was performed with a led - curing unit ( radii - cal sdi , bayswater , victoria , australia ) for 30 s from buccal , incisal , mesial , and distal aspects of each tooth . \n the final restorative phase was achieved by polishing the marginal areas with a silicone instrument ( rubber point jiffy , ultradent products inc . , \n ( a and b ) frontal and close - up views of the anterior teeth after placing the veneers . \n ( c and d ) frontal and lateral views of the smile ( a ) palatal view of the seated restorations after 10 months . \n when ceramic veneers are considered , different restorative approaches have been proposed , depending on the thickness of the veneer and the color of the remaining dental structure . in the case of improving esthetics by changing the form and texture of teeth with no severe discoloration , veneers of smaller thickness may be indicated . after being informed about advantages and disadvantages of each restorative option , the patient opted for the conservative ceramic veneers of minimum thickness . the long - lasting esthetics and little preparation of the underlying dental structure were among main reasons for this decision . \n thus , in the presented clinical situation , the dental preparation was restricted to the enamel . besides the optical characteristic similar to the dental structure , glass - ceramic materials have good bonding characteristics to the dental structure . \n this increased retention is mainly related to the use hydrofluoric acid to etch their internal surfaces , associated with the use of silane - coupling agents . moreover , when the dental preparation is restricted to the enamel , improved and more reliable bonding may be obtained . in the present case report , the dental bleaching was conducted at the same appointment of the dental preparation . \n this procedure , however , could be considered controversial due to the fact that bleaching may influence the extent of dental preparation . \n the decision of bleaching at the same clinical was based on the idea that ultrathin veneers were planned from the beginning . \n dental bleaching may be considered a safe treatment and may be associated with other therapies as demonstrated in the present case . \n since practically no dental preparation was conducted , the patient reported no post - treatment pain . \n it is important to note that the color selection should be delayed , as bleached teeth usually appear whiter and chalky immediately after bleaching . \n the try - in paste was used to select the cement color only after the application of the silane - coupling agent . \n the try - in paste was removed by rinsing with water spray , followed by air - drying . \n this protocol of using and rinsing the try - in paste after the application of the silane coupling agent has been proposed to improve the bond strength of the resin - based cement to the ceramics . while rinsing , the excess of unreacted silane was removed . \n this excess has been reported to be washable with water at room temperature , and , if not removed , could compromise the coupling of the luting material to the ceramic by hydrolysis . \n the inner layer attached to the glass - ceramic is considered hydrolytically stable due to its covalent links to the silica and is not removable by the rinsing procedure . \n this type of cement is an appropriate choice for luting indirect veneers in terms of bond strength and increased working time . \n the use of light - cured materials for the cementation of veneers , however , is based on the idea that the light could easily pass through the indirect restoration due its translucency and reduced thickness . a concern related to light transmittance through ceramic materials and its influence on cement degree of conversion and \n it should be noted that even when dual - cured resin cements are employed , the light activation plays an important role on material 's degree of conversion . \n another aspect to be considered when cementing veneers with materials that relies on the ability of light transmission through the ceramics is that not all light - curing devices are equal and that different curing properties may be achieved for the same curing unit if used with a fiber optic or a polymer light guide tip . \n for this reason , light - cured resin cements should be light activated carefully , both at cervical , medium and incisal areas of the veneer . \n the ultimate success of esthetic treatments is only achieved when the patient is educated and motivated to maintain good oral health . \n the patient contribution and periodic control by the dentist is imperative to the long - term success of the treatment . \n the minimum thickness anterior ceramic laminate veneers may be a conservative and esthetic alternative to reestablish the form , shape , and color of anterior teeth .", "role": "user" }, { "content": "the aim of this article is to describe the possibility of improving dental esthetics with low - thickness glass ceramics without major tooth preparation for patients with small to moderate anterior dental wear and little discoloration . for this purpose , a carefully defined treatment planning and a good communication between the clinician and the dental technician helped to maximize enamel preservation , and offered a good treatment option . \n moreover , besides restoring esthetics , the restorative treatment also improved the function of the anterior guidance . \n it can be concluded that the conservative use of minimum thickness ceramic laminate veneers may provide satisfactory esthetic outcomes while preserving the dental structure .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in recent years , astrocytes have attracted great interest for their capacity to release neuroactive molecules , among which are neurotransmitters like glutamate , because these molecules could modulate neural activity and lead to a possible role for astrocytes in neural information processing [ 13 ] . \n indeed , astrocyte - derived neurotransmitters , also called gliotransmitters for their astrocytic origin , have been shown to act on neurons and to regulate synaptic transmission and plasticity through a variety of mechanisms . \n the binding of receptors located on either pre- or postsynaptic terminals by astrocyte - released glutamate has historically been the first pathway for gliotransmission to be discovered and , arguably , the most studied one experimentally for its several possible functional implications . \n activation of extrasynaptic receptors on presynaptic terminals by astrocytic glutamate modulates the probability of neurotransmitter release from those terminals \n . in particular , depending on receptor type , such modulation may be either toward an increase or toward a decrease of the frequency of spontaneous [ 711 ] and evoked neurotransmitter release in both excitatory [ 2 , 8 , 10 , 12 ] and inhibitory synapses [ 1315 ] . because synaptic release probability characterizes how a synapse filters or , in other words , processes presynaptic action potentials [ 16 , 17 ] , modulations of synaptic release probability by astrocytic glutamate are suggested to alter the computational properties of neural circuits . \n glutamate released by astrocytes may also bind to extrasynaptically located postsynaptic nmda receptors , evoking slow inward currents ( sics ) in nearby neurons [ 11 , 1926 ] . \n the depolarizing action of these currents modulates neural excitability with the potential to affect neuronal action potential firing . moreover , because single astrocytes are in close proximity to a large number ( ~100 ) of neurons , it has been suggested that an inward current can be generated in many adjacent neurons , thereby promoting synchrony of neuronal firing [ 1921 ] . \n although modulations of both synaptic release and sics mediated by glutamatergic gliotransmission have been recorded in the cortex and the hippocampus , as well as in several other brain regions , their physiological relevance remains elusive . \n in particular , beyond regulation of synaptic filtering and neuronal firing , theoretical arguments support a further possible role for both pathways in the regulation of nmdar - mediated spike - timing - dependent plasticity ( stdp ) . \n both pathways have the potential to regulate activation of postsynaptic nmda receptors and , in doing so , glutamatergic gliotransmission could ultimately regulate the stdp outcome , that is , either potentiation ( ltp ) or depression ( ltd ) [ 30 , 31 ] . consistent with this hypothesis , experiments have reported a lower threshold for ltp induction at hippocampal synapses when synaptic release is increased by astrocytic glutamate . moreover , \n long - term potentiation responses of neurons in the primary visual cortex by cholinergic activation of surrounding astrocytes has also been reported to be correlated with an increase of sic frequency in those neurons . \n while the potential impact on stdp of pre- or postsynaptic activity - dependent modulations of synaptic efficacy has widely been addressed both experimentally and theoretically [ 34 , 35 ] , the possible effect on plasticity of the regulation of these modulations by glutamatergic gliotransmission ( and by gliotransmission in general ) has been investigated by very few theoretical studies . \n these studies suggest a potential role in ltp induction both for large increases of synaptic release and for large sics mediated by astrocytic glutamate [ 36 , 37 ] . \n this scenario seems however at odds with the majority of recent experimental observations that report modest signaling magnitudes for these two routes of gliotransmission . \n it is thus not clear under what biophysical conditions modulations of synaptic release or sics mediated by glutamatergic gliotransmission could affect stdp . \n astrocyte - mediated sics , for example , are known to occur sporadically , being recorded in single neurons only as often as < 5/min [ 26 , 32 ] , raising the question of whether and how , by occurring at such low rates , they could effectively play a role in stdp . \n we thus set to investigating what conditions are required for glutamatergic gliotransmission to affect stdp by presynaptic modulations of neurotransmitter release or through postsynaptic sics . \n we extend the model of an astrocyte - regulated synapse originally introduced by de pitt et al . to include a biophysically realistic description of synaptically evoked gliotransmitter release by the astrocyte as well as a mechanism for the generation of postsynaptic sics and stdp . \n first , glutamatergic gliotransmission could change the nature of stdp by modifying the parameter ranges for ltp and ltd induction . \n second , this effect crucially depends on the nature of gliotransmission , that is , whether it is release - increasing or release - decreasing , its strength , and its rate of occurrence and when it occurs with respect to pre / post pairs . \n thus , while glutamatergic gliotransmission could potentially play a role in stdp and learning , in practice this effect must satisfy several biophysical and activity - dependent constraints , supporting the existence of specialized dynamic interactions between astrocytes and neurons . \n although there may be several possible routes by which astrocytes release glutamate [ 3840 ] , ca - dependent glutamate release is likely the main one in physiological conditions [ 41 , 42 ] . from a modeling perspective , as illustrated in figure 1 , ca - dependent glutamatergic gliotransmission consists of three distinct signaling pathways . \n one pathway ( black arrows ) initiates the release - triggering ca signal in the astrocyte and may be either exogenous or heterosynaptic or be triggered by the very synapses that are modulated by glutamatergic gliotransmission in a homosynaptic fashion . the other two pathways are instead represented by the two recognized routes for the action of glutamatergic gliotransmission on synaptic terminals : the presynaptic pathway whereby astrocytic glutamate modulates synaptic release ( magenta arrows ) and the postsynaptic pathway which mediates sics in nearby neurons ( orange arrows ) . \n although both pathways could coexist at the same synapse in principle , their functional regulation is probably through different ca - dependent pathways , both in terms of spatiotemporal ca - dynamics and in terms of pools of releasable glutamate resources and/or mechanism of release for these latter . \n thus , in the following , we set to investigating the effect of synaptic transmission of each pathway independently of the other . \n we begin our study by a description of a biophysically realistic model of synaptically evoked ca - dependent glutamate release from an astrocyte . at excitatory and inhibitory synapses \n , astrocytes can respond to synaptically released neurotransmitters by intracellular ca elevations and release glutamate in turn . \n although morphological and functional details of the coupling between synaptic terminals and the surrounding astrocytic processes remain to be fully elucidated , the current hypothesis is that synaptically evoked glutamate - releasing astrocytic ca signaling is mainly by spillover of synaptic neurotransmitters and/or other factors , which bind to high - affinity astrocytic g protein - coupled receptors ( gpcrs ) and thereby trigger inositol 1,4,5-trisphosphate ( ip3 ) production and ca release from the endoplasmic reticulum ( er ) [ 4648 ] . while early work mainly monitored somatic ca increases concluding that astrocytes respond only to intense neuronal firing patterns , recent experiments in astrocytic processes revealed that astrocytes may also respond to low levels of synaptic activity by ca elevations confined in subcellular regions of their processes [ 10 , 48 , 50 ] , suggesting that the profile of astrocytic ca signaling and thus glutamate release could span the whole spectrum of neuronal ( synaptic ) activity . to realistically describe synaptic release in the whole spectrum of neuronal firing , we consider the model of an activity - dependent synapse first introduced by tsodyks and markram . \n this model captures the dependence of synaptic release on past activity , that is , presynaptic short - term plasticity , which substantially influences synaptic transmission at high enough rates of neuronal firing . \n in particular , synaptic release results from the product of two quantities : ( i ) the probability of neurotransmiter - containing vesicles to be available for release and ( ii ) the probability of such vesicles to be effectively released by an action potential , which correlates with intrasynaptic ca . at rest \n , it is assumed that all vesicles are available for release . the arrival of an action potential opens presynaptic voltage - dependent ca channels that trigger a transient increase of intrasynaptic ca which promotes release of a fraction us of available vesicles . following release , \n the emptied vesicles are refilled in some characteristic time d , while intrasynaptic ca and thus vesicle release probability decay to zero with a different time constant f . for multiple action potentials incoming at time intervals of the order of these two time constants , neither vesicle replenishment nor intrasynaptic ca are restored to their resting values , so that the resulting synaptic release depends on the history of synaptic activity . \n we illustrate the response of the synapse model to a train of action potentials in figures 2(a)2(c ) . \n the low rate of stimulation of the first four action potentials ( figure 2(a ) ) allows for the reintegration of most of the released neurotransmitter in between action potentials thereby keeping vesicle depletion limited ( figure 2(b ) , orange trace ) . in parallel , \n intrasynaptic ca grows , and so does vesicle release probability ( figure 2(b ) , blue trace ) , resulting in progressively larger release of neurotransmitter per action potential or , in other words , in short - term facilitation of synaptic release ( figure 2(c ) , t < 500 ms ) . on the contrary , the presentation of a series of action potentials in rapid succession at t = 500 ms results in a sharp increase of vesicle release probability to a value close to saturation ( i.e. , nt . \n pr.0 ) . in this scenario , therefore , from one spike to the next one , progressively fewer neurotransmitter resources are available for release and the amount of released resources decreases with incoming action potentials , leading to depression of synaptic transmission . \n such depression is short - lived , since synaptic release tends to recover after a sufficiently long period in which no action potentials occur , that is , the case , for example , of the last action potential at t = 800 ms . \n once released into the synaptic cleft , synaptic neurotransmitter is rapidly cleared by diffusion as well as by other mechanisms , including uptake by transporters and/or enzymatic degradation [ 56 , 57 ] . in the simplest approximation , the contribution of these mechanisms can be modeled by a first - order reaction which accounts for the exponentially decaying profile of neurotransmitter concentration in figure 2(c ) after synaptic release at each action potential . \n a fraction of released neurotransmitter molecules also spills out of the synaptic cleft to the perisynaptic space ( figure 2(d ) ) where it binds to gpcrs on the astrocyte ( figure 2(e ) ) , therein triggering ca signaling ( figure 2(f ) ) . to quantitatively describe this process , we modify the model of gpcr - mediated ca signaling originally introduced by de pitt et al . to account for dynamic regulation of astrocytic receptors by synaptic activity ( see appendix a , section a.1 ) . \n accordingly , as illustrated in figure 2(f ) , gpcr - mediated ca signaling is a result of the nonlinear interplay of three processes : ( i ) ip3 production by gpcrs bound by synaptic neurotransmitter ( magenta trace ) , ( ii ) ca release from the er into the cytosol , which is triggered by ip3-bound ca channels ( ip3rs ) and also modulates cytosolic ip3 ( black trace ) , and ( iii ) the effective fraction of available or , more exactly , deinactivated \n ip3rs that can take part in ca release from the er ( yellow trace ) . \n depending on the choice of parameter values , the astrocyte model may display both large , long - lasting somatic ca elevations and smaller and shorter ca increases , akin to those reported in astrocytic processes ( see appendix b ) . \n glutamate release from the astrocyte is then assumed to occur every time that ca increases beyond a threshold concentration ( figure 2(g ) , cyan dotted line ) , in agreement with experimental observations [ 60 , 61 ] . \n although different mechanisms for glutamate release by the astrocyte could be possible , a large amount of evidence points to vesicular exocytosis as the main one to likely occur on a physiological basis . because astrocytic glutamate exocytosis bears several similarities with its synaptic homologue ( reviewed in de pitt et al . ) , we model it in the same fashion . thus , in line with experimental observations [ 63 , 64 ] , we postulate the existence of an astrocytic vesicular compartment that is competent for regulated glutamate exocytosis . \n then , upon a suprathreshold ca elevation , a fixed fraction of astrocytic glutamate - containing vesicles releases glutamate into the extracellular space . \n glutamate is then reintegrated into the astrocyte with some characteristic time constant ( figure 2(h ) ) . in this fashion , \n glutamate concentration in the extracellular space abruptly increases by exocytosis from the astrocyte and then exponentially decays akin to neurotransmitter concentration in the synaptic cleft , yet , in general , at a different rate ( figure 2(h ) ) ( appendix b ) . \n the description of gliotransmitter release hitherto introduced ignores the possible stochastic nature of astrocytic glutamate release and reproduces the total amount of glutamate released , on average , by a single ca elevation beyond the release threshold . \n this description provides a simplified general framework to realistically capture synaptically evoked glutamate release by the astrocyte independently of the underlying mechanism of astrocytic exocytosis , which may either be in the form of a burst of synchronous vesicle fusion events that peaks within the first 50500 ms from the ca rise underneath the plasma membrane [ 61 , 65 , 66 ] or occur at slower fusion rates in an asynchronous fashion [ 67 , 68 ] \n . once released , astrocyte - derived glutamate can diffuse in the extracellular space and bind extrasynaptic receptors located on presynaptic terminals . \n in particular , ultrastructural evidence suggests colocalization of glutamate - containing vesicles in perisynaptic astrocytic processes with those receptors , hinting a focal action of astrocytic glutamate on these latter . \n such action is likely spatially confined and temporally precise , akin to that of a neurotransmitter on postsynaptic receptors , and is not affected by synaptic neurotransmitters . \n both ionotropic and metabotropic presynaptic receptors may be activated by astrocytic glutamate , yet their differential recruitment likely depends on developmental , regional , physiological , and cellular ( synaptic ) factors ( reviewed in ) . \n the details of the biochemical mechanisms of action of these receptors on synaptic physiology are not fully understood , but the simplest explanation is that they all modulate intrasynaptic ca levels , eventually increasing or decreasing synaptic release probability , although in a receptor - specific fashion [ 52 , 69 , 70 ] . from a modeling perspective , as originally proposed by de pitt et al . , the common effect on synaptic release shared by different receptors allows expressing , in the simplest approximation , the synapse 's resting release probability proportionally to the fraction of presynaptic receptors activated by astrocytic glutamate ( appendix a , section a.1 ) . in this fashion , \n as illustrated in figure 3 , the time evolution of the fraction of activated presynaptic receptors ensuing from a series of glutamate release events by the astrocyte ( figures 3(a ) and 3(b ) ) is reflected by the dynamics of synaptic release probability at rest averaged across different trials ( figures 3(c ) and 3(e ) ) . \n the value of the coefficient of proportionality for the dependence of synaptic release probability on receptor activation sets the type of modulation of synaptic release by astrocytic glutamate which can be either release - decreasing ( figure 3(c ) ) , such as in the case of astrocytic glutamate - binding presynaptic kainate receptors or group ii / iii metabotropic receptors ( mglurs ) [ 13 , 14 , 71 ] , or release - increasing ( figure 3(e ) ) , when astrocytic glutamate binds nmdars or group \n the functional implications of these modulations of synaptic release by glutamatergic gliotransmission on synaptic transmission have been widely addressed in a series of previous studies [ 18 , 29 , 73 ] , and the remainder of this section reviews and extends the main results from those studies about short - term synaptic plastic and synaptic filtering . \n figure 3(d ) ( left panel ) shows how postsynaptic currents ( pscs ) change in the presence of release - decreasing glutamatergic gliotransmission when elicited by two consecutive action potentials arriving to the resting synapse 20 ms after the onset of gliotransmission at t = 5 s ( figure 3(c ) ) . \n two differences with respect to the case without gliotransmission ( black trace ) may be observed . \n first the psc amplitude overall decreases ( red trace ) , consistent with a decrease of synaptic efficacy caused by the reduction of synaptic release by astrocytic glutamate . \n then , the second psc is larger than the first one , which is the opposite of what would be measured in the absence of gliotransmission . in other words , in agreement with experimental observations , the release - decreasing effect of astrocytic glutamate results in an increased pair pulse ratio ( ppr ) with respect to the case without gliotransmission ( ppr0 ) . \n notably , as shown in figure 3(d ) ( right panel ) , this change in the ppr ratio is only transient and vanishes together with the effect of gliotransmission on synaptic release . \n similar considerations also hold in the case of a release - increasing effect of astrocytic glutamate on synaptic transmission : while psc amplitude increases ( figure 3(f ) , left panel , green trace ) , this occurs to the detriment of ppr , which decreases instead ( figure 3(f ) , right panel ) . \n thus , synapses whose release probability is increased by glutamatergic gliotransmission are likely to run out of neurotransmitter faster , exhibiting rapid onset of short - term depression , consistent with lower ppr values . on the contrary , synapses \n whose release probability is reduced by astrocyte - released glutamate deplete their neurotransmitter resources slower and may exhibit progressive facilitation ( i.e. , potentiation ) of their efficacy to transmit action potentials and so larger ppr values . \n that is , the plasticity mode of a synapse , namely , whether it is depressing or facilitating , may not be fixed but rather be modulated by glutamatergic gliotransmission by surrounding astrocytes in an activity - dependent fashion [ 29 , 73 ] . \n an important consequence of short - term synaptic dynamics is that synapses can act as filters [ 16 , 17 , 75 ] . \n hence , modulations of synaptic dynamics by glutamatergic gliotransmission are also expected to affect the synapse 's filtering characteristics . \n this scenario is illustrated in figure 4 where the effect of release - decreasing versus release - increasing glutamatergic gliotransmission , respectively , on depressing and facilitating synapses , is shown in terms of changes of the filtering characteristics of these synapses , that is , their steady - state release as a function of the frequency of presynaptic stimulation . in the absence of gliotransmission , depressing synapses , which are characterized by intermediate - to - high initial probability of release ( figure 4(a ) , black circles ) , predominantly act as low - pass filters ( figure 4(b ) , black circles ) that are most effective at transmitting low frequency presynaptic spike trains ( figure 4(c ) , black traces ) . \n on the contrary , facilitating synapses , with a low - to - intermediate initial probability of neurotransmitter release ( figure 4(a ) , black circles ) , function as high - pass or band - pass filters ( figure 4(b ) , black circles ) ; that is , they are mostly effective at transmitting action potentials in an intermediate range of presynaptic activity ( figure 4(c ) , black trace ) . in the presence of glutamate release by the astrocyte , these two scenarios could be reversed . consider indeed the simple heterosynaptic case where glutamatergic gliotransmission is stimulated by other means compared to by the very synapses it impinges on . \n it may be noted that release - decreasing gliotransmission flattens the synaptic steady - state release towards zero for all frequencies of stimulation ( figure 4(b ) , red circles ) , ensuing in synaptic transmission that resembles the one of a facilitating , band - pass synapse ( compare the red psc trace in figure 4(c ) with the black psc trace in figure 4(f ) ) . \n vice versa , release - increasing gliotransmission could turn band - pass features of transmission by a facilitating synapse ( figure 4(e ) , green circles ) into low - pass , reminiscent of a more depressing synapse ( compare the green psc trace in figure 4(f ) with the black psc trace in figure 4(c ) ) . on the other hand , when gliotransmission is stimulated by the same synapses that it modulates \n , that is , in the homosynaptic scenario of gliotransmission , inspection of the ensuing synaptic filtering characteristics ( figures 4(b ) and 4(e ) , cyan circles ) reveals that these latter coincide with those obtained in the absence of gliotransmission for low frequencies of presynaptic activity , while they tend to equal those observed with heterosynaptic gliotransmission as the frequency of stimulation increases . \n this coexistence of mixed features from apparently opposite scenarios , that is , no gliotransmission versus heterosynaptic gliotransmission , can be explained by the fact that the release of glutamate from the astrocyte requires intracellular ca to cross a threshold concentration . \n hence , in the homosynaptic scenario , synapses that impinge on the astrocyte must be stimulated at rate sufficiently high to allow astrocytic ca to increase beyond such a threshold . \n the modulation of synaptic filtering by glutamatergic gliotransmission offers the possibility that the same stimulus could be differently filtered ( i.e. , processed ) and transmitted by a synapse in the presence ( or not ) of glutamate release by surrounding astrocytic processes , ultimately endowing that synapse with processing versatility with respect to incoming action potentials . \n moreover , to the extent that synaptic dynamics critically shape the computations performed by the neural circuitry , such versatility could also be reflected at the network level , leading to the possibility that the same neuron - glia network could be involved in different computational tasks defined , time by time , by activity - dependent gliotransmitter release by astrocytes in the network . \n induction of slow inward ( i.e. , depolarizing ) currents ( sics ) by activation of extrasynaptically located postsynaptic nmda receptors is the other mechanism considered in this study whereby glutamatergic gliotransmission could affect synaptic information transfer . \n while astrocyte - mediated sics have been reported in several brain regions , the pathway underlying glutamate release by astrocytes has not been fully elucidated [ 76 , 77 ] . \n it is likely that , similar to the presynaptic route for glutamatergic gliotransmission discussed above , multiple pathways for glutamate release could be used by the same astrocyte , but their deployment depends on developmental , regional , and physiological factors . \n astrocytic ca activity seems to be a crucial factor in the regulation of astrocyte - mediated sics [ 1923 , 25 , 78 ] . in particular , \n sic frequency and amplitude have been shown to increase upon ca elevations mediated by gpcrs on astrocytes such as mglurs [ 1923 , 72 , 79 ] , the metabotropic purinergic p2y1 receptor , the endocannabinoid cb1 receptor , or the protease - activated receptor 1 ( par1 ) . \n remarkably , stimulation of par1s on hippocampal astrocytes was shown to trigger , under physiological conditions , ca - dependent glutamate release from these cells through bestrophin-1 anion channel [ 81 , 82 ] , and this pathway of glutamate release has been suggested as a candidate mechanism for sics . \n channel - mediated glutamate release is expected to account for prolonged ( > 10 s ) release of transmitter but in small amounts per unit time thus ensuing in modest , very slow rising and decaying inward currents . while similar sics have indeed been recorded [ 71 , 84 ] , most experiments reported sics within a wide range of amplitudes to last only few seconds at most and rise in correlation with astrocytic ca increases , with rise time much shorter than their decay [ 2022 , 24 , 26 , 32 , 85 , 86 ] akin to currents that would ensue from a quantal mechanism of gliotransmitter release . based on these arguments , \n we assume glutamate exocytosis as the candidate mechanism for glutamate release by astrocytes that mediates sics . \n accordingly , we adopt the description of astrocytic glutamate exocytosis previously introduced ( figures 2(g)2(i ) ) to also model astrocyte - mediated sics . in this fashion , \n glutamate exocytosis by the astrocyte into the extracellular space ( figure 5(a ) ) results in activation of extrasynaptically located nmdars on nearby neuronal dendrites which trigger sics ( figure 5(b ) ) that cause slow depolarizing postsynaptic potentials ( psp , figure 5(c ) ) . \n an important functional consequence of sic - mediated depolarizations is that they can modulate neuronal excitability [ 2123 , 85 ] . as illustrated in figures 5(d ) and 5(e ) , astrocyte - mediated sics ( cyan trace ) may add to regular synaptic currents ( black trace ) resulting in depolarizations of postsynaptic neurons closer to their firing threshold . in turn , these larger depolarizations could dramatically change generation and timing of action potentials by those neurons in response to incoming synaptic stimuli ( figure 5(f ) ) . \n this could ultimately affect several neurons within the reach of glutamate released by an astrocyte , leading to synchronous transient increases of their firing activity . \n remarkably , this concerted increase of neuronal excitability has often been observed in correspondence with large amplitude ( i.e. , > 100 pa ) sics [ 21 , 25 , 85 , 87 ] , but experiments report the majority of sics to be generally smaller , with amplitudes < 80 pa [ 11 , 21 , 22 , 26 , 32 , 87 ] . \n it is therefore unclear whether sic - mediated increase of neuronal excitability could occur or not [ 87 , 89 , 90 ] in physiological conditions . in figure 5(g ) , we consider postsynaptic firing in a standard leaky integrate - and - fire neuron model [ 91 , 92 ] as a function of presynaptic activity for sics of different amplitudes ( 3045 pa , see appendix b ) randomly occurring at an average rate of 1 hz based on a binomial process for glutamate release from astrocytes as suggested by experiments ( see appendix a ) . in line with experimental evidence , the input - output transfer function in the absence of gliotransmission has a typical sigmoidal shape ( black dots ) which reflects the following : ( i ) gradual emergence of firing for low ( > 10 hz ) fluctuating synaptic inputs ; ( ii ) the progressive , quasi - linear increase of the firing rate for presynaptic activity beyond ~30 hz ; and finally , ( iii ) saturation of the firing rate for sufficiently strong synaptic inputs such that timing of action potential generation approaches the neuron 's refractory period ( which was fixed at 2 ms in the simulations , appendix b ) . \n the addition of astrocyte - mediated sics alters the firing characteristics of the neuron due to the ensuing larger depolarization . \n in particular the neuron could generate action potentials for lower rates of presynaptic activity ( cyan / blue dots ) . \n clearly , the larger the sic is , the more the postsynaptic firing increases with respect to the case without sics , for a given level of presynaptic activity . \n as previously mentioned , these results assume an average 1 hz rate for astrocyte - mediated sics . while such a rate can not be excluded , it seems unlikely for the following reasons . \n the weak correlation of sic amplitude with somatic ca elevations observed in experiments favors indeed the idea that glutamate - mediated sics are highly localized events , occurring within subcellular domains at astrocytic processes . in turn , ca elevations in astrocytic processes could be as short - lived as ~0.5 s [ 10 , 50 ] , thus in principle allowing for glutamate release rates of the order of 1 hz . \n however , in practice , reported sic frequency is much lower , that is , < 5/min ( i.e. , ~0.08 hz ) [ 11 , 22 ] . \n hence , it may be expected that the effect of sics on neuronal firing could be considerably reduced with respect to the case in figure 5(g ) . \n we consider this possibility more closely in figure 5(h ) , where we analyze postsynaptic firing in function of the average frequency of astrocyte - mediated sics , both in the absence of synaptic activity ( black and dark blue dots ) and in the case of presynaptic activity at an average rate ~ 1 hz , which corresponds to typical levels of spontaneous activity in vivo ( grey and light blue dots ) . it may be noted that the effect of sics of typical amplitudes on postsynaptic firing rate is generally small , that is , < 0.5 hz , except for unrealistic ( > 0.1 hz ) sic rates , while it gets stronger in association with synaptic activity . in this latter case however the possible increase in postsynaptic firing by astrocyte - mediated sics is limited by the rate of reintegration of released glutamate resources in the astrocyte ( fixed at ~1 hz , appendix b ) . \n analogously to short - term synaptic depression in fact , our description of gliotransmitter release predicts that , for release rates that exceed the rate of reintegration of released glutamate by the astrocyte , exhaustion of astrocytic glutamate resources available for further release will result in sics of smaller amplitude . in this fashion , due to depletion of astrocytic glutamate , the effect of large rates of glutamate release and thus of sics on neuronal firing tends to be equivalent to that of considerably lower ones . taken together \n , the above results do not exclude a possible role of sics in modulation of neuronal excitability and firing but suggest that such modulation could effectively occur only in coincidence with proper levels of synaptic activity . in this fashion \n , astrocyte - mediated sics could be regarded to operate a sort of coincidence detection between synaptic activity and astrocytic glutamate release , whose readout would then be a temporally precise , cell - specific increase of neuronal firing ( figure 5(f ) ) . \n the strength of a synaptic connection between two neurons can be modified by activity , in a way that depends on the timing of neuronal firing on both sides of the synapse , through a series of processes collectively known as spike - timing - dependent plasticity ( stdp ) . as both pre- and postsynaptic pathways of glutamatergic gliotransmission potentially change epsc magnitude , thereby affecting postsynaptic firing \n although the molecular mechanisms of stdp remain debated , and different mechanisms could be possible depending on type of synapse , age , and induction protocol , at several central excitatory synapses postsynaptic calcium concentration has been pointed out as a necessary factor in induction of synaptic changes by stdp [ 31 , 9699 ] . remarkably , amplitude and , likely , time course of postsynaptic ca could control the direction of plasticity : smaller , slower increases of postsynaptic ca give rise to spike - timing - dependent long - term depression ( ltd ) , whereas larger , more rapid increases cause spike - timing - dependent long - term potentiation ( ltp ) [ 31 , 96 , 97 ] . in calcium - based stdp models , \n this is also known as the ca - control hypothesis [ 35 , 100 , 101 ] . according to this hypothesis \n , no modification of synaptic strength occurs when ca is below a threshold d that is larger than the resting ca concentration . \n if calcium resides in an intermediate concentration range , between d and a second threshold p > d , the synaptic strength is decreased . finally , if calcium increases above the second threshold , p , the synaptic strength is potentiated . \n figures 6(a1 ) and 6(b1 ) exemplify the operational mechanism of the ca - control hypothesis within the framework of a nonlinear ca - based model for stdp at glutamatergic synapses originally introduced by graupner and brunel . at most glutamatergic synapses , \n postsynaptic ca is mainly regulated by two processes : ( i ) postsynaptic ca entry mediated by nmdars and ( ii ) ca influx by voltage - dependent ca channels ( vdccs ) [ 31 , 33 , 99 , 104 ] . in this fashion \n , each presynaptic action potential generates a long - lasting ca transient by opening nmdar channels , while postsynaptic firing results in a short - lasting ca transient due to opening of vdccs by dendritic depolarization through back - propagating action potentials ( baps ) . \n presynaptic action potentials alone do not trigger changes in synaptic strength , but they do so in correlation with postsynaptic baps . \n notably , in a typical stdp induction pairing protocol , ltd is induced if the postsynaptic neuron fires before the presynaptic one , that is , post pre pairing at negative spike - timing intervals t ( figure 6(a1 ) ) . \n contrarily , ltp is induced when the presynaptic cell fires before the postsynaptic cell , that is , for pre post pairing at positive t intervals ( figure 6(a1 ) ) . \n this is possible because , when a presynaptic action potential is followed shortly after by a postsynaptic bap , the strong depolarization by this latter drastically increases the voltage - dependent nmdar - mediated ca current due to removal of the nmdar magnesium block [ 107 , 108 ] , thereby resulting in supralinear superposition of the nmdar- and vdcc - mediated ca influxes . in the framework of the ca - control hypothesis , \n pre- and postsynaptic ca transients do not interact , and the contributions from potentiation and depression by pre / post pairs ( or vice versa ) cancel each other , leading to no synaptic changes on average ( figure 6(c ) , black curves ) . for short , negative t , \n the presynaptically evoked ca transient rises instead above the depression threshold ( d ) but not beyond the potentiation threshold ( p ) . \n consequently , depression increases whereas potentiation remains constant , which leads to ltd induction . for short , positive t \n however the postsynaptically evoked calcium transient rises on top of the presynaptic transient by the nmdar nonlinearity and increases activation of both depression and potentiation . because the rate of potentiation is larger than the rate of depression ( appendix c ) , this results in ltp induction . for the same number of pre / post pairs ( or vice versa ) , mapping of the average synaptic modification as a function of the spike - timing interval \n t ultimately provides an stdp curve that qualitatively resembles the classic curve originally described by bi and poo ( figure 6(c ) , right panel , black curve ) . in the following \n , we will focus on parameters that lead to such a stdp curve and investigate how this curve is affected in the presence of glutamatergic gliotransmission , through the pre- and postsynaptic pathways of regulation discussed above . \n the very nature of synaptic transmission crucially depends on the synapse 's initial probability of neurotransmitter release , insofar as this latter sets both the tone of synaptic transmission , that is , how much neurotransmitter is released per action potential by the synapse on average , and whether the synapse displays short - term depression or facilitation . \n synapses with low - to - intermediate values of initial neurotransmitter release probability , for example , schaffer collateral synapses , or some cortical synapses , are indeed prone to display facilitation , whereas synapses that are characterized by large release probability are generally depressing . because synaptic release probability also dictates the degree of activation of nmdars and consequently the magnitude of postsynaptic ca influx , \n it is expected that both the tone of synaptic transmission and its short - term dynamics could affect stdp . \n the relative weight of these two factors in shaping synaptic changes however likely depends on the protocol for stdp induction . \n short - term plasticity could indeed sensibly regulate stdp induction only for rates of presynaptic action potentials high enough to allow facilitation or depression of synaptic release from one ap to the following one [ 109 , 110 ] . in this study \n , we consider low pre / post frequencies of 1 hz . at such frequencies we expect short - term plasticity to have a negligible effect , and \n thus we only focus on how changes in the tone of synaptic transmission by glutamatergic gliotransmission affect stdp . \n figures 6(a2 ) and 6(b2 ) , respectively , show the outcome of ltd and ltp induction for two consecutive pre post and pre post pairings preceded by the onset of release - decreasing gliotransmission at 0.1 s ( top panels , black marks ) . \n a comparison of the ensuing postsynaptic ca dynamics with respect to the case without gliotransmission ( figures 6(a1 ) and 6(b1 ) ) reveals that the strong decrease of synaptic release probability ( srp , top panels , red curves ) caused by gliotransmission remarkably reduces the nmdar - mediated contribution to postsynaptic ca influx ( middle panels ) , resulting in smaller variations of synaptic strength ( bottom panels ) . in this fashion , at the end of the pairing protocol , release - decreasing gliotransmission accounts for less time spent by ca above both ltd and ltp thresholds ( figure 6(c ) , left panel , red traces ) . \n the resulting stdp curve thus displays strongly attenuated ltd and ltp ( figure 6(c ) , right panel , red curve ) , with ltp windows spanning a considerably smaller range of ts values than in the curve obtained without gliotransmission ( black curve ) . \n similar considerations apply to the case of release - increasing gliotransmission ( figures 6(a3 ) and 6(b3 ) ) . in this case , the nmdar component of postsynaptic ca could increase by gliotransmission even beyond the d threshold ( dashed blue line ) , thus favoring depression while reducing potentiation ( bottom panels ) . in particular , for short positive t , \n the maximal ltp does not change but the t range for ltp induction shrinks . for t \n > 40 ms in fact , the time that ca spends above the ltd threshold increases with respect to the time spent by ca above the ltp threshold , thereby resulting in ltd induction ( figure 6(c ) , left panel , green traces ) . \n in this fashion , the stdp curve in the presence of release - increasing gliotransmission displays a narrow 040 ms ltp window outside which ltd occurs instead ( figure 6(c ) , right panel , green curve ) . \n figure 6(d ) summarizes how the stdp curve changes for the whole spectrum of glutamatergic gliotransmission . in this figure , a y - axis value of gliotransmission type \n equal to 0 corresponds to maximum release - decreasing gliotransmission ( red curve in figure 3(c ) ) ; a value equal to 1 stands instead for maximum release - increasing gliotransmission ( as in the case of the green curve in figure 3(c ) ) ; finally , a value of 0.5 corresponds to no effect of gliotransmission on synaptic release ( black curve in figure 3(c ) ) . \n it may be noted that gliotransmission may affect the stdp curve in several ways , changing both strength of plastic changes ( color code ) and shape and areas of ltp and ltd windows . in particular , as revealed by figure 6(e ) , maxima of ltp ( cyan circles ) and ltd ( yellow circles ) decrease with decreasing values of gliotransmission type , consistently with smaller postsynaptic ca influx for larger decreases of synaptic release by gliotransmission . \n this suggests that release - decreasing gliotransmission ( red - shaded area ) could attenuate stdp yet in a peculiar fashion , counteracting ltd more than ltp induction , as reflected by increasing values of ltp / ltd area ratio ( magenta curve ) . on the contrary \n , the effect of release - increasing gliotransmission ( figure 6(e ) , green - shaded area ) could be dramatically different . \n for sufficiently strong increases of synaptic release by gliotransmission in fact , the ltp / ltd area ratio drops to zero ( hatched area ) in correspondence with the appearance of two open ltd windows , one for t < 0 and the other for sufficiently large positive spike - timing intervals . in parallel , consistently with the fact that release - increasing gliotransmission tends to increase the fraction of time spent by postsynaptic ca above the threshold for ltd thereby promoting this latter ( figure 6(c ) ) , the range for ltp induction also tends to shrink to lower t values as release - increasing gliotransmission grows stronger ( figure 6(d ) , red color - coded areas for gliotransmission type > 0.5 ) . in summary \n , our analysis reveals that modulation of synaptic release by glutamatergic gliotransmission could change stdp both quantitatively and qualitatively , from hindering its induction for release - decreasing modulations to altering both shape and existence of ltd windows for release - increasing modulations . \n however , whether and how this could effectively be observed in experiments remain to be investigated . supported both by experimental evidence and theoretical arguments \n is the notion that regulations of the tone of synaptic transmission by glutamatergic gliotransmission likely require specific morphological and functional constraints to be fulfilled by the nature of astrocyte - synapse coupling [ 5 , 18 ] . \n similar arguments may ultimately hold true also for modulation of stdp ; insofar as for this modulation to be measured in our simulations , we required both a sufficiently strong increase / decrease of synaptic release by gliotransmission and a decay time of such increase / decrease long enough for this latter to be present during the induction protocol . \n should these two aspects not have been fulfilled in our simulations , then modulation of stdp by gliotransmitter - mediated changes of synaptic release would likely have been negligible or even undetectable . \n we now turn our analysis to the possible impact of astrocyte - mediated sics on stdp . because sics are through extrasynaptic nmda receptors and these receptors are mainly permeable to ca ions , then sics could contribute to postsynaptic ca thereby affecting stdp \n nevertheless , we should note that it is unclear whether and how extrasynaptic nmdars contribute to plasticity , independently of the occurrence of sics . \n for example , theta - burst ltp induction in ca1 neurons of rat hippocampal slices is turned into ltd when extracellular nmdars are selectively stimulated , but it is unknown whether these receptors have a role in stdp . \n in general , for a given stdp induction protocol , two factors that could crucially regulate how ca transients mediated by extrasynaptic nmdars are involved in stdp are the location of these receptors on the spine and the morphology of this latter in terms of spine head and neck [ 114 , 115 ] . \n unfortunately both these factors remain unknown in the current knowledge of sic - mediating extrasynaptic nmdars and , for the remainder of this study , we assume that , in spite of their possible location away from the postsynaptic density along the spine neck or the dendritic shaft , sic - mediating extrasynaptic nmdars could still regulate spine ca dynamics . based on the above rationale \n , we thus model sics as slow postsynaptic ca transients that will add to presynaptically and postsynaptically triggered ones and study their effect on the induction of sdtp by classic pairing protocols . for the sake of generality , we express the peak of sic - mediated ca transients in units of nmdar - mediated epscs . \n however , since in our stdp description individual epscs do not trigger any synaptic modification , then we may expect that only sics sufficiently larger than epscs could effectively affect stdp . on the other hand \n , smaller sics could also combine with ca transients by pre / post pairings , resulting in ca elevations beyond either ltd or ltp thresholds that would ultimately cause synaptic changes ( figures 7(a ) and 7(b ) ) . \n hence , based on these considerations , we deem amplitude and timing of sics , in terms of both frequency of occurrence and onset with respect to stdp - inducing stimuli , to be crucial factors in shaping how sics affect stdp , and thus we set to analyzing these three factors separately . \n figure 7(c ) summarizes the results of our simulations for sics as large as 0.5 , 1 , or 1.5 times typical epscs , occurring at a fixed rate of 0.1 hz and starting 100 ms before the delivery of 60 stdp - inducing pre / post pairings at 1 hz . as illustrated in figures 7(a ) and 7(b ) , for the same sic kinetics , these simulations guarantee superposition between ca influxes mediated by sics and pre / post pairings such that the extension of the ensuing ca transient beyond ltd and ltp thresholds ( dashed lines ) merely depends on sic amplitude . in this fashion , it may be noted that sics of amplitude smaller than or equal to typical epscs ( figure 7(c ) , turquoise circles and black circles , resp . ) , which alone would not produce any synaptic modification , do not sensibly change the stdp curve with respect to the previously considered case of an alike synapse in the absence of gliotransmission ( figure 6(c ) , black circles ) . \n conversely , large sics could dramatically affect stdp , shifting the stdp curve towards negative synaptic changes ( blue circles ) , and this negative shift increases the larger sics grow beyond the d threshold ( results not shown ) . in this case \n , stdp generally results in ltd with the exception of a ltp window that is comprised between ~0 ms and positive t values that are smaller than those in the absence of gliotransmission ( figure 6(c ) , green circles ) . \n this resembles what was previously observed for stdp curves in the presence of release - increasing gliotransmission , with the only difference that , for large |t| values , ltd strength in the presence of astrocyte - mediated sics is found to be the same , regardless of t ( compare the blue curve in figure 7(c ) with the green curve in figure 6(c ) ) . in figure 7(d ) we consider the alternative scenario where only sics as large as typical epscs impinge on the postsynaptic neuron at different rates , yet always 100 ms before stdp - inducing pairings . \n akin to what happens for sic amplitudes , the larger the sic frequency is , the more the stdp curve changes . indeed , as sic frequency increases above sic decay rate ( i.e. , 1/a , appendix a , section a.1.4 ) , sic - mediated \n ca transients start adding up , so that the fraction of time spent by ca beyond the ltd threshold increases favoring ltd induction . in this fashion , the ensuing stdp curve , once again , consists of a narrow ltp window for t 0 , outside which only ltd is observed ( red curve ) . in practice \n however , because sics occur at rates that are much slower than their typical decay ( appendix b ) , they likely affect stdp in a more subtle fashion . \n this may be readily understood considering the pink stdp curve obtained for sics at 0.1 hz , that is , the maximum rate experimentally recorded for these currents . \n inspection of this curve indeed suggests that sics could effectively modulate ltd and ltp maxima as well as the outer sides of the ltd / ltp windows , which dictate how fast depression / potentiation decay for large |t| , but overall the qualitative features of the stdp curve are preserved with respect to the case without gliotransmission ( black curve ) . \n clearly , the extent of the impact of sic amplitude and frequency on stdp discussed in figures 7(c ) and 7(d ) ultimately depends on when sics occur with respect to ongoing stdp - inducing pairings . \n had we set sics to occur ~200 ms after pre / post ca transients in our simulations , then , as illustrated in figures 8(a ) and 8(b ) , we would have not detected any sensible alteration of stdp , unless sics were larger than typical epscs and/or occurred at sufficiently high rate to generate ca transients beyond the plasticity thresholds ( results not shown ) . to seek understanding of how timing of sics versus pre / post pairings could alter ltd and/or ltp , we simulated stdp induction by pairing as the time interval ( ) between sic and pre / post pairs was systematically varied ( with sic rate fixed at 0.2 hz ) ( figures 8(c)8(e ) ) . \n in doing so , we adopted the convention that negative values stand for sics preceding pre / post ( or post / pre ) pairings while positive values refer to the opposite scenario of sics that follow pairings ( figure 8(c ) , top schematics ) . \n then , it may be observed that , for approximately in between 300 ms and 0 ms , ltd could be induced for any negative t as well as for large positive t ( figure 8(c ) , blue tones ) , in this latter case to the detriment of the ltp window , whose upper bound moves to lower t values ( figure 8(c ) , red tones ) . \n this results in stdp curves ( e.g. , figure 8(f ) , yellow curve for = 75 ms ) that bear strong analogy with the blue and red curves in figures 7(c ) and 7(d ) , respectively , obtained for sics of large amplitude and frequency and suggest that depression grows as sics tend to concur with pre / post pairings . \n an inspection of postsynaptic ca transients ( figures 8(d ) and 8(e ) ) indeed reveals that coincidence of sics and pre / post pairings , which occurs at negative of the order of sic rise time ( see appendix b ) , corresponds to the longest time spent by ca above the ltd threshold , thereby resulting in maximum ltd ( figure 8(g ) ) and thus minimum ltp ( figure 8(h ) ) . \n clearly , the range for which coincidence of sics with pre / post pairings enhances ltd induction ultimately depends on kinetics of sics , as reflected by their rise ( s ) and/or decay time constants ( s ) , and spans values approximately comprised within sic duration ( i.e. , s + s ) . as sic duration increases in fact , because of either larger s or larger s or both , so does the range for ltd enhancement , as reflected by the orange and blue curves in figures 8(f)8(h ) . \n in conclusion the simulations in figures 8(c)8(h ) point to both timing and duration of sics with respect to pre / post pairing - mediated ca transients as a further , potentially crucial factor in setting strength and polarity of stdp at glutamatergic synapses . \n it is noteworthy to emphasize that , however , to appreciate some effect on stdp , we had to assume in those simulations sics occurring at 0.2 hz , that is , twofold the maximum sic rate ( i.e. , ~0.1 hz ) experimentally observed . indeed , analogous simulations run with realistic sic rates 0.1 hz did produce only marginal changes to stdp curves , akin to those previously observed for the pink stdp curve in figure 7(d ) . \n the potential functional implications ( or lack thereof ) of this perhaps puzzling result are addressed in discussion . \n a large body of evidence has accumulated over the last years suggesting an active role of astrocytes in many brain functions . \n collectively , these data fuelled the concept that synapses could be tripartite rather than bipartite , since in addition to the pre- and postsynaptic terminals , the astrocyte could be an active element in synaptic transmission [ 1 , 49 , 117 ] . using a computational modeling approach \n , we showed here that glutamatergic gliotransmission could indeed play several roles in synaptic information transfer , either modulating synaptic filtering or controlling postsynaptic neuronal firing , as well as regulating both short- and long - term forms of synaptic plasticity . \n supported by experimental observations [ 8 , 9 , 13 , 23 , 118 ] , these results complement and extend previous theoretical work on astrocyte - mediated regulations of synaptic transmission and plasticity [ 18 , 29 ] and pinpoint biophysical conditions for a possible role of glutamatergic gliotransmission in spike - timing - dependent plasticity . \n an important prediction of our model indeed is that both pathways of regulation of synaptic transmission by astrocytic glutamate considered in this study , presynaptic modulation of transmitter release and postsynaptic sics , could affect stdp , potentially altering induction of ltp and ltd . \n this alteration could encompass changes in the timing between pre- and postsynaptic firing that is required for plasticity induction , as well as different variations of synaptic strength in response to the same stimulus . with this regard , \n the increase of ltp observed in our simulations , when moving from release - decreasing to release - increasing gliotransmission ( figure 6(e ) ) , agrees with the experimental observation that ltp induction at hippocampal synapses requires weaker stimuli in the presence of endogenous glutamatergic gliotransmission rather than when gliotransmission is inhibited thereby decreasing synaptic release probability . \n notably , spike - timing - dependent plasticity in the hippocampus is not fully understood insofar as stdp induction by pairing protocols has produced a variety of seemingly contradicting observations for this brain region . \n recordings in hippocampal slices , for example , showed that pairing of single pre- and postsynaptic action potentials at positive spike - timing intervals could trigger ltp [ 120122 ] , as effectively expected by the classic stdp curve , but also induce either ltd or no plasticity at all . \n although different experimental and physiological factors could account for these diverse observations [ 119 , 125 ] , we may speculate that glutamatergic gliotransmission by astrocytes , which in those experiments was not explicitly taken into account , could also provide an alternative explanation . \n for example , the prediction of our model that release - increasing glutamatergic gliotransmission could account for multiple ltd windows , at either positive or negative spike - timing intervals ( figure 6 ) , indeed supports the possibility that ltd in the hippocampus could also be induced by proper presentations of pre post pairings sequences . on the same line of reasoning \n , the possibility that astrocyte - mediated sics could transiently increase postsynaptic firing ( figure 5(f ) ) could explain why , in some experiments , precise spike timing in the induction of synaptic plasticity in the hippocampus could exist only when single epsps are paired with postsynaptic bursts [ 124 , 126 ] . \n moreover , it was also shown that postsynaptic firing is relatively less important than epsp amplitude for the induction of stdp in the immature hippocampus compared to the mature network , possibly due to a reduced backpropagation of somatic aps in juvenile animals . \n remarkably , these diverse modes of plasticity induction could also ensue from different dynamics of glutamatergic gliotransmission , as likely mirrored by the developmental profile of somatic ca signals in hippocampal astrocytes , which have been reported to be much more frequent in young mice . \n insofar as somatic ca signals may result in robust astrocytic glutamate release that could trigger , in turn , similar increases of synaptic release and/or sics [ 5 , 62 ] , the frequent occurrence of these latter could then ultimately guarantee a level of dendritic depolarization sufficient to produce ltp in mice pups . \n high amplitude / rate sics , or large increases of synaptic release mediated by glutamatergic gliotransmission , result , in our simulations , in ltd induction for any spike - timing interval except for a narrow ltp window at small - to - intermediate t > 0 . \n this is in stark contrast with stdp experiments , where the observed plasticity always depends , to some extent , on the coincidence of pre- and postsynaptic activity , as epsps or postsynaptic action potentials fail to induce plasticity by their own [ 95 , 105 ] . \n apart from the consideration that large sic amplitudes / rates and large increases of synaptic release by astrocytic glutamate may not reflect physiological conditions [ 76 , 90 ] , this contrast may be further resolved on the basis of the following arguments . \n a first consideration is that we simulated plasticity induction assuming either persistent occurrence of sics or continuous modulations of synaptic release during the whole induction protocol . \n while this rationale proved useful to identify the possible mechanisms of regulation of stdp by glutamatergic gliotransmission , it may likely not reflect what occurs in reality . \n indeed , modulations of synaptic release by glutamatergic gliotransmission could last only few tens of seconds [ 7 , 8 ] and thus be short - lived with respect to typical induction protocols which are of the order of minutes [ 33 , 105 , 129 ] . \n moreover , the morphology of astrocytic perisynaptic processes is not fixed but likely undergoes dynamical reshaping in an activity - dependent fashion during plasticity induction [ 118 , 130 ] , thereby potentially setting time and spatial range of action of gliotransmission on nearby synaptic terminals . in this fashion , ltd for large spike - timing intervals \n could be induced only transiently and at selected synapses , focally targeted by glutamatergic gliotransmission , while leaving unchanged the qualitative features of the classic stdp curve obtained by somatic recordings in the postsynaptic neuron . \n a further aspect that we did not take into account in our simulations is also the possible voltage dependence of astrocyte - triggered sics . \n the exact nature of this dependence remains to be elucidated and likely changes with subunit composition of nmda receptors that mediate sics in different brain regions and at different developmental stages . \n regardless , it may be generally assumed that slow inward currents through nmda receptors become substantial only for intermediate postsynaptic depolarizations when the voltage - dependent mg block of these receptors is released . in this fashion , the possible effect of sics on stdp \n would be confined in a time window around t 0 for which coincidence with pre- and postsynaptic spikes allows for robust depolarization of postsynaptic spines . outside this window instead , sics would be negligible , and plasticity induction would essentially depend on mere pre- and postsynaptic spiking rescuing the experimental observation of no synaptic modification for large spike - timing intervals [ 95 , 105 ] . on the other hand , even without considering voltage dependence of sic - mediating nmdars , the precise timing of sics with respect to pre / post pairs is predicted by our analysis , to be potentially critical to determine strength and sign of plasticity . \n similar considerations could also hold for the onset time and duration of modulations of synaptic release triggered by gliotransmission with respect to the temporal features of plasticity - inducing stimuli . \n this ultimately points to timing of glutamate release by the astrocyte ( and its downstream effects on synaptic transmission ) as a potential additional factor for associative ( hebbian ) learning , besides sole correlation between pre- and postsynaptic activities [ 131 , 132 ] . \n remarkably , this could also provide a framework to conciliate the possibility that modest , sporadic sics that we predict would not substantially affect stdp ( figure 7 ) could do so instead . \n indeed our predictions are based on the average number of sics within a given time window , as documented in literature , rather than on the precise timing of those sics in that time window . in this fashion , for example , there is no distinction in terms of effect on stdp in our simulations , between a hypothetical scenario of three sics randomly occurring on average every ~10 s in a 30 s time frame and the alternative scenario of three sics taking place within the same time frame but in rapid succession ( figure 5b in ) , as could happen following an exocytic burst of glutamate release by the astrocyte [ 61 , 62 , 65 ] . yet \n the latter case could result in a dramatically different plasticity outcome with respect to the former . while individual sics likely fail to induce synaptic modification alone in fact \n , their occurrence in rapid succession would instead allow postsynaptic ca levels to quickly increase beyond one of the thresholds for plasticity induction . \n furthermore , this increase could further be boosted by coincidence of sics with pre- and postsynaptic activity , ultimately accounting for robust ltp , as indeed predicted by other theoretical investigations . \n however , to complicate this intriguing scenario is the observation that glutamatergic gliotransmission and even more so astrocyte - mediated sics [ 19 , 25 ] are likely not deterministic but rather stochastic processes . \n therefore , it would ultimately be interesting to understand how this stochasticity could affect neuronal activity and shape learning . \n to conclude , our analysis provides theoretical arguments in support of the hypothesis that , beyond neuronal firing , astrocytic gliotransmission could represent an additional factor in the regulation of activity - dependent plasticity and learning [ 18 , 134 , 135 ] . \n this could occur in a variegated fashion by both presynaptic and postsynaptic elements targeted by glutamatergic gliotransmission , with possibly diverse functional consequences . \n nonetheless , the practical observation in future experiments of a possible mechanism of action of glutamatergic gliotransmission on activity - dependent plasticity will depend on the implementation of novel specific plasticity - inducing protocols that match possible stringent temporal and spatial dynamical constraints defining the complex nature of neuron - astrocyte interactions .", "role": "user" }, { "content": "glutamatergic gliotransmission , that is , the release of glutamate from perisynaptic astrocyte processes in an activity - dependent manner , has emerged as a potentially crucial signaling pathway for regulation of synaptic plasticity , yet its modes of expression and function in vivo remain unclear . here , we focus on two experimentally well - identified gliotransmitter pathways , ( i ) modulations of synaptic release and ( ii ) postsynaptic slow inward currents mediated by glutamate released from astrocytes , and investigate their possible functional relevance on synaptic plasticity in a biophysical model of an astrocyte - regulated synapse . our model predicts that both pathways could profoundly affect both short- and long - term plasticity . \n in particular , activity - dependent glutamate release from astrocytes could dramatically change spike - timing - dependent plasticity , turning potentiation into depression ( and vice versa ) for the same induction protocol .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: congenital duodenal obstruction is one of the more common intestinal anomalies encountered by pediatric surgeons , occurring in 1 in 25005000 live births . in 2540% of patients , \n it is associated with trisomy 21 , and 5% of patients with trisomy 21 have duodenal atresia [ 1 , 2 ] . \n about two - thirds of all congenital duodenal obstructions are congenital intrinsic duodenal obstructions ( cido ) [ 2 , 3 ] , a condition characterized by the onset of bilious vomiting within 24 h of birth . \n cido accompanied by acute gastrointestinal bleeding is very uncommon and may lead to suspicion of malrotation with mid - gut volvulus . \n we describe a patient with cido associated with down 's syndrome , who presented with hematemesis on day 2 of life . to our knowledge \n , only seven patients with this condition have been described previously in the english language literature . \n a 2-day - old girl was referred to our service with sudden onset of severe hematemesis . \n she was born at the gestational age of 37/40 with a birth weight of 2.1 kg . on examination \n she was found to have dysmorphic features suggestive of down 's syndrome , along with hypotonia , intercostal muscle retraction and a mildly distended epigastric region . \n her initial investigations revealed wbc of 20 100 l , hb of 16.8 g / dl , platelets of 114 000/l and crp of 10 md / l . \n after intravenous antibiotics , she remained stable but on day 2 of life , she was noted to have high levels of orogastric aspirates mixed with blood . \n a plain x - ray revealed a dilated stomach and duodenum , with air in the distal small bowel ( fig . 1 ) . \n repeat laboratory evaluation revealed wbc of 23 200 l , hb of 10.1 g / dl and platelets of 140 000/l . \n she was started on ranitidine 10 mg daily but she continued to have fresh blood in her orogastric tube and her hemoglobin level dropped to 8.0 g / dl with inr 10 , pt 120 and aptt 180. she was managed accordingly and after resuscitation , an upper gi contrast study was performed to rule out malrotation or mid - gut volvulus . \n her upper gi contrast suggested an incomplete duodenal obstruction ( fig . 2 ) . \n to look for a source of bleeding , an upper gi endoscopy was not performed due to duodenal obstruction and a risk of perforation . \n the baby was taken to the operating theater for exploration to determine the cause of her ongoing hematemesis and to correct her duodenal obstruction . on exploration , her stomach and proximal duodenum \n there was no malrotation of her gut and the rest of the bowel and solid viscera were normal . \n a duodenotomy of her proximal dilated duodenum revealed a complete diaphragm with a hole allowing passage of a small probe down into the distal duodenum . \n she was started on gradual nasogastric to oral feeding , which she tolerated very well . \n her chromosomal analysis showed a karyotype of 47 , xx , + 21 consistent with down 's syndrome . \n figure 1:plain x - ray abdomen on day 3 of life showing a dilated stomach and duodenum with gas in the distal small bowel . \n figure 2:(a ) upper gastrointestinal contrast study showing a markedly distended stomach and duodenal bulb , with narrowed second part of duodenum suggesting congenital duodenal obstruction . \n ( b ) delayed film of upper gastrointestinal contrast study showing dye passing distally suggestive of incomplete obstruction plain x - ray abdomen on day 3 of life showing a dilated stomach and duodenum with gas in the distal small bowel . \n ( a ) upper gastrointestinal contrast study showing a markedly distended stomach and duodenal bulb , with narrowed second part of duodenum suggesting congenital duodenal obstruction . ( b ) \n duodenal atresia / stenosis is a common gastrointestinal anomaly , with more than half of affected patients having associated congenital anomalies . \n twenty - five to 30% of cases of duodenal atresia occur in babies with down 's syndrome . \n conversely , duodenal atresia is the most common gastrointestinal defect seen in children with down 's syndrome , occurring in 15% , with no reported association with maternal age , ethnicity or sex of the neonate . \n babies born with complete duodenal obstruction usually present with vomiting within the first 2448 h of life , whereas babies with incomplete duodenal obstruction may present months later . \n the vomiting is usually bilious , but may be non - bilious if the lesion is preampullary , which occurs in one of five cases . \n the presentation of incomplete duodenal obstruction with hematemesis in early life is unusual ; to date , only seven such cases have been reported in the english literature . \n hematemesis was observed during the first few days of life in three neonates , whereas one child presented at 12 years of age . \n the causes of duodenal obstruction in most of these patients were internal narrowing / atresia , but obstruction in one baby was caused by extra - luminal duodenal compression from an annular pancreas ( table 1 ) . \n table 1description of patients with hematemesis and congenital duodenal obstruction associated with down syndromestudyyearno / ga / sexonset of bleedingclinical featuressite of obstructionoperative findingsassociated anomaliesmadden et al . \n 19731/?/m12 yearsdown 's syndromestenosis of second part of duodenumduodenal ulcers due to retained foreign materialnot describedbajaj et al . \n 19751/term / m1 daydown 's syndrome , polyhydramniosstenosis of 2nd part of duodenum , annular pancreasnot describednot describedchhabra et al . \n 19921/30 weeks / f1 daydown 's syndromefirst part of duodenumdilated duodenal bulb , incomplete rotation , isolated duodenal erosionscongenital cardiac defect , bilateral lenticular cataractsnoora et al . \n ( current case)20131/term / f2 daysdown 's syndromesecond part of duodenumnarrowed duodenum with web and edematous , friable duodenal mucosa proximallyectopic right kidney , congenital cardiac defects ( minor ) description of patients with hematemesis and congenital duodenal obstruction associated with down syndrome the etiology of acute bleeding in cido patients is not clear . \n it has been suggested that repeated vomiting , mechanical factors , the absence of buffering of gastric acidity and stasis of food in the dilated antrum and duodenum may contribute to hematemesis in duodenal obstruction [ 46 ] . in the absence of swallowed maternal blood , repeated vomiting , abnormal coagulation factors or hematemesis in our patient was likely due to duodenitis , which was noted during surgery . \n duodenitis in our patient may have been caused by the stasis of gastric secretion in the duodenum due to obstruction leading to erosions ; the anatomical configuration of the duodenal diaphragm , which may also have prevented the regurgitation of the neutralizing alkaline duodenal secretions and early sepsis . \n the management of hematemesis secondary to gastritis / duodenitis starts by correcting hypervolemia , treatment with histamine 2 ( h2 ) receptor blockers and fixing the underlying cause \n . antacids may be dangerous to newborns , resulting in hypermagnesemia with or without hypocalcemia , antacid bezoar and intestinal perforation . \n the hematemesis usually resolves once the primary underlying cause ( duodenal obstruction ) has been corrected and gastric contents can freely flow towards the duodenum , as in our patient . \n the long - term risk of peptic ulceration has been assessed in children who undergo surgery for duodenal obstruction . \n a long - term follow - up of 169 children with duodenal atresia and stenosis found that 4 ( 2.4% ) had peptic ulceration , with 2 of these requiring further surgical intervention . \n these findings imply that these patients may need follow - up throughout childhood and adolescence . in summary , \n congenital duodenal obstruction carries a risk of duodenitis in newborns , and they may present with acute hematemesis . \n ", "role": "user" }, { "content": "congenital duodenal obstruction is usually characterized by onset of early vomiting due to high bowel obstruction . \n presentation of congenital duodenal obstruction with acute gastrointestinal bleeding is very uncommon . \n we present an unusual case of congenital intrinsic duodenal obstruction associated with the down 's syndrome presenting with hematemesis secondary to duodenitis . \n this is a rare presentation of congenital duodenal obstruction associated with down 's syndrome in addition to seven cases previously reported in the english literature .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: for early detection of arteriosclerotic disease , several parameters for assessing vascular nature have been used . \n the pulse wave velocity ( pwv ) is one of these parameters and has been widely used mainly in the field of internal medicine , especially in the prediction of cardiovascular events . \n however , carotid - femoral pwv requires somewhat complicated technique to obtain an accurate waveform . \n brachial - ankle pwv has been developed , which is reported to be correlated with carotid - femoral pwv and can be measured with a simpler technique . \n however , it was pointed out that both carotid - femoral pwv and bapwv were strongly affected by the changes in blood pressure during measurements . for the purpose of using pwv as an indicator of vascular vessel wall stiffness , \n recently , a new index of vascular stiffness , the cardio ankle vascular index ( cavi ) , was developed . \n considered to be an index independent of blood pressure , cavi is a parameter of adjusted pwv for blood pressure , based on a stiffness parameter using bramwell - hill 's formula . \n cavi is calculated as follows : \n ( 1)cavi = a(2p)ln ( pspd)pwv2+b , \n\t\t\t\t\t where ps indicates systolic pressure in brachial artery ; pd , diastolic pressure in brachial artery ; , density of blood ; a , b , correction coefficient . the usefulness of cavi in the management of patients with hypertensive , diabetic or renal disorders was previously reported in [ 58 ] , but we found no reports on cavi in pregnancy . in our current study , we assessed cavi in normotensive and hypertensive pregnant women . we believe that this is the world 's first report on cavi in pregnancy . \n the subjects of this study were 109 japanese women consisting of 23 nonpregnant healthy women ( group a ) , 45 normotensive pregnant women ( group b ) , 28 pregnant women complicated with established preeclampsia ( group c ) , and 13 pregnant women with chronic hypertension ( group d ) . eighty - six pregnant women ( groups b , c , and d ) were patients who visited mie university hospital . \n twenty - three nonpregnant women ( group a ) were volunteers including nurses and midwives in mie university hospital . \n the diagnosis of preeclampsia was made according to the criteria of the international society for the study of hypertension in pregnancy , which includes a blood pressure > 140/90 mmhg and > 300 mg of protein in a 24-hour urine collection . \n chronic hypertension was defined as hypertension diagnosed prior to conception or within the first 20 weeks of pregnancy . \n the women in group d did not have superimposed preeclampsia . in some cases , the blood pressure recorded during the cavi examination was lower than the criteria value . \n the women in group c were normotensive in the first trimester of pregnancy and the blood pressure returned to normal by 12 weeks postpartum . \n no significant differences were noted in the gestational week and maternal age among the four groups . \n all the subjects in group a were uncomplicated and uneventful throughout the course of pregnancy and puerperium . the cavi is based on the stiffness parameter ( ) , which expressed blood pressure independent vascular stiffness . \n stiffness parameter ( ) is calculated as follows : \n ( a)= [ ln ( pspd ) ] (dd ) . \n ln indicates natural log ; ps , systolic pressure ; pd , diastolic pressure ; d , vascular diameter ; d , change of vascular diameter . \n the relationship between volume elastic modulus and pwv is expressed by bramwell - hill 's formula , and the relationship between vessel volume and diameter is given when a cylindrical model is used : \n ( b)z2=(p)(vv ) ( bramwell - hills formula ) , \n ( c)vv = d2d . \n z indicates cardioankle pwv ( m / sec ) ; p , pulse puressure ; , blood density ( 1.03 10 kg / m ) ; v , volume of blood vessel ; v , change of v. the previous 3 formulas ( a , b , and c ) give the following equation : \n ( 2)=(2p)[in ( pspd)]z2 . \n thus , the stiffness parameter ( ) can be easily calculated by measures of bp and cardioankle pwv . \n the new index cavi is expressed as follows : \n ( 3)cavi = a+b . \n a and b indicate the constants to convert to a value that is approximate to conventional aortic pwv for each patient compatibility . \n cavi is easily measured using vasera vs-1000 ( fukuda denshi , tokyo , japan ) , which is now becoming popular . \n the cavi is automatically calculated by the instrument and reflects the stiffness parameter ( ) . \n the cavi has the great merit that it is not influenced by bp , whereas conventional pwv is strongly influenced by bp . \n however , cavi might have an error because of the variety of blood density in each case , where in the formula for calculation of cavi , a standard value of blood density was used . \n the subject was placed in the supine position and blood pressure : bapwv and cavi were recorded using a vascular screening system vasera vs-1000 ( fukuda denshi , tokyo , japan ) . in all cases , no symptomatic adverse effects \n mann - whitney 's u - test was used for statistical analysis of comparing values between the two groups . probability ( p ) values less than .05 were considered as significant . \n the values of blood pressure shown in table 1 were those recorded during the cavi examination and in some cases the values were lower than the criteria values . \n mean gestational age of group b was lower than those in groups c and d , but no significant differences were noted among groups a , b , c , and d in the maternal age , and no significant differences were noted among groups b , c , and d in the gestational age . \n significant differences were noted between groups a and c , a and d , b and c , b and d in systolic , diastolic and mean blood pressures . as shown in figure 2 , bapwvs in groups a , b , c , and d were 1087 132 cm / sec , 1119 183 cm / sec , 1446 224 cm / sec , and 1614 225 cm / sec , respectively . \n significant differences were noted between groups a and c , a and d , b and c , b and d in bapwv . \n cavi in groups a , b , c , and d were 7.1 0.4 , 7.1 0.5 , 8.4 1.0 , and 9.8 1.8 , respectively . \n similar to bapwv , significant differences were noted between groups a and c , a and d , b and c , b and d in cavi . \n to assess the vascular stiffness , several parameters have been used such as carotid - femoral pwv , bapwv , sp , and augmentation index ( ai ) . \n carotid - femoral pwv is affected by blood pressure and can be adjusted using a compensating nomogram for blood pressure . \n however , carotid - femoral pwv requires somewhat complicated technique to obtain an accurate waveform . \n it is also time - consuming , and it takes approximately 15 to 20 minutes for one measurement . \n bapwv has been developed , which can be assessed with a simpler technique in a short time using a measurement system but it is strongly affected by the changes in blood pressure during measurement . \n ai is strongly influenced by heart rate , and it is necessary to correct ai by heart rate for the comparison among subjects . \n sp is a parameter which is independent of blood pressure but requires a long time for the measurement , and the measuring equipment for sp ( sonographic vessel tracking system ) is expensive . \n moreover , sp is a parameter of the local vessel ( usually the abdominal aorta or common carotid artery is used for the measurement ) and not a systemic vessel parameter . \n cavi is thought to be an index which eliminates these defects in the conventional vascular parameters . \n it is a noninvasive method and the repeated measurement during pregnancy is possible . in our current study \n , we found no complications in the subjects related to cavi measurements , including pregnant women themselves . \n in preeclamptic women , no atherosclerotic change of the vessel wall was produced , which is different from the vessel wall in chronic hypertensive women . in our current study , both in preeclamptic and chronic hypertensive groups , bapwv was elevated and no significant difference was noted between the two groups . on the other hand , \n cavi was also elevated both in preeclamptic and chronic hypertensive groups , but the elevation was milder in the former group . \n blood pressure was elevated and ( at least partially ) structural change in the vessel wall may have been produced , resulting in both bapwv and cavi elevations . in preeclamptic women , \n blood pressure was elevated and thus bapwv was elevated . in preeclamptic women , lesser vessel \n wall structural change was produced , and lesser elevation of cavi was seen , which is lesser influenced by blood pressure elevation than bapwv . from our results , we believe that we can distinguish the vessel structural change between chronic hypertension and preeclampsia through bapwv and simultaneous cavi measurements \n . however , if cavi could be completely independent of blood pressure and could completely reflect the atherosclerotic change of the vessel wall , it might be difficult to explain the reason of significant elevation of cavi in preeclampsia from normotensive pregnancy . \n brodszki and colleagues reported that there were no differences in vessel wall stiffness between women with preeclampsia and healthy controls , through the assessment of common carotid artery , abdominal aorta , and popliteal artery by using ultrasonic echo - tracking system . on the other hand , ong and colleagues reported that structural change was observed in myometrial radial arteries in women with preeclampsia . \n thus , we hypothesize that cavi might reflect the minimal change of the vessel wall , which caused the elevation of cavi in preeclamptic women . \n further work is in progress to evaluate the usefulness of cavi in the management of preeclampsia . \n recently , cavi , a new index of vascular stiffness , was developed , which is thought to be an index independent of blood pressure . \n we assessed cavi in normotensive and hypertensive pregnant women as the world 's first report on cavi in pregnancy . \n we believe that we can distinguish the vessel structural change between chronic hypertension and preeclampsia through simultaneous bapwv and cavi measurements .", "role": "user" }, { "content": "it was previously reported that the brachial - ankle pulse wave velocity ( bapwv ) is elevated in preeclamptic women . however , bapwv is strongly affected by blood pressure . recently , \n a new index of vascular stiffness , the cardioankle vascular index ( cavi ) , was developed . \n cavi is thought to be an index independent of blood pressure . \n we assessed cavi in normotensive and hypertensive pregnant women . \n we studied a total of 109 japanese women consisting of 23 nonpregnant healthy women ( group a ) , 45 normotensive pregnant women ( group b ) , 28 pregnant women complicated with established preeclampsia ( group c ) , and 13 pregnant women with chronic hypertension ( group d ) . \n the subject remained supine while the blood pressure , bapwv , and cavi were recorded . \n no significant difference in bapwv was present between groups c and d , but the difference in cavi was significantly high in group d. we believe that we can distinguish the vessel structural change between chronic hypertension and preeclampsia through simultaneous bapwv and cavi measurements .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: dna , which carries the genetic information , is liable to alterations by various agents of endogenous and environmental origin . in order to prevent the deleterious effects yielded by such dna lesions and to maintain the integrity of the genome and cellular functions , \n cells are equipped with several dna repair systems , such as base excision repair ( ber ) , nucleotide excision repair ( ner ) , and mismatch repair ( for review , see ) . \n ber is one of the most versatile repair pathways that can deal with base lesions resulting mainly from alkylation , oxidation , deamination , and replication errors . \n this pathway is initiated by damage - specific dna glycosylases that release the altered or inappropriate bases by cleavage of the n - glycosylic bond from the phosphate - sugar backbone , thereby resulting in production of the apurinic / apyrimidinic ( ap ) sites ( reviewed in [ 2 , 3 ] ) . \n a class of dna glycosylases , designated bifunctional dna glycosylases , possess additional ap lyase activity that further cleaves the phosphodiester bond 3 to the ap site generated by its own glycosylase activity . \n when ber is initiated by such bifunctional dna glycosylases , ap endonuclease removes 3-unsaturated aldehyde left behind by the ap lyase activity . as a consequence of either pathways , \n unlike ber that mainly repairs base lesions , ner deals with a wide variety of helix - distorting lesions , including ultraviolet ( uv ) light - induced pyrimidine photodimers as well as intrastrand crosslinks and bulky adducts induced by numerous chemical compounds . \n xeroderma pigmentosum ( xp ) is one of the autosomal recessive disorders that are associated with defective ner and clinically characterized by severe photosensitivity against uv exposure and a high risk of skin cancer . to date , seven ner - deficient xp genetic complementation groups have been identified ( xp - a through -g ) , for each of which the responsible gene has been cloned . unlike most of the other xp groups , xp - c patients show defects only in one of the two ner subpathways , that is , global genome ner that covers the entire genome . \n the other subpathway is referred to as transcription - coupled ner , which repairs transcription - blocking lesions on the transcribed strand of active genes . the xpc protein \n , the responsible gene product for the xp group c , plays an essential role in dna damage recognition and the following initiation of global genome ner [ 57 ] . \n it forms in vivo a stable heterotrimeric complex with either rad23a or rad23b , one of the two mammalian homologues of saccharomyces cerevisiae rad23p , and centrin 2 , which is known also as a component of the centrosome [ 810 ] . \n rad23 stabilizes the xpc protein in vivo [ 11 , 12 ] , and the xpc - rad23 heterodimer is sufficient to reconstitute the cell - free ner reaction [ 13 , 14 ] , whereas centrin 2 appears to potentiate the damage - specific dna binding activity of the xpc complex . \n biochemical and structural analyses revealed that this complex recognizes a specific dna secondary structure containing a junction between double - stranded dna and a single - stranded 3-overhang [ 1618 ] . \n after the dna binding by xpc , atpase / helicase activities of tfiih ( exerted by the xpb and xpd subunits ) open dna duplex and demarcate damage , probably with the aid of xpg , xpa , and replication protein a ( rpa ) . \n the damaged strand is then cleaved in both sides of the lesion by two structure - specific ner endonucleases , ercc1-xpf and xpg , and the resulting gap is refilled with the dna repair synthesis . \n we have previously shown that xpc interacts directly with one of the dna glycosylases , thymine dna glycosylase ( tdg ) . \n tdg removes thymine or uracil residues from g / t or g / u mismatches , which are mainly derived from hydrolytic deamination of 5-methylcytosines or cytosines , respectively ( for review , see ) . \n tdg is unique in that it can not dissociate from the substrate dna by itself after accomplishing its enzymatic activity [ 22 , 23 ] . \n crystal structure of the e. coli homolog of tdg , the mismatch - specific uracil dna glycosylase ( ecmug ) , demonstrated that the inability to turnover is due to its tight interaction with the guanine opposite the ap site [ 24 , 25 ] . \n extensive biochemical analyses have suggested that this feature may be applicable also to the human tdg [ 22 , 23 , 26 ] . since continuous attachment of tdg to ap sites \n must interfere with the following ber process , it has been conceivable that there should be certain factors that promote dissociation of tdg from the processed dna . \n one candidate for such factors relieving tdg of the product inhibition is ap endonuclease 1 ( ape1 ) , which acts in the ber pathway immediately after the dna glycosylases [ 22 , 2729 ] . \n another factor would be sumoylation of tdg , which occurs at a single specific site ( lys330 in human tdg ) . \n the x - ray crystal structure of sumoylated tdg revealed that this modification induces a significant conformational change in the c - terminal domain of tdg , which seems to sterically prevent its interaction with dna . \n thus , it has been proposed that the sumoylation following base excision may promote the enzymatic turnover of tdg , although precise timing and regulation of the modification in vivo still remain to be elucidated . \n in addition , we have previously shown that xpc - rad23b forms a ternary complex with tdg bound to the substrate dna and promote dissociation of tdg from the ap site . \n like tdg and ape1 , xpc can recognize and bind to ap sites , although the observed affinity is relatively low if opposite base is guanine . \n therefore , two notions have been conceivable concerning molecular mechanisms underlying the stimulation of tdg turnover by xpc : direct physical interaction and competition for the ap site . \n more recently , it has been reported that xpc interacts with and stimulates the activity of ogg1 , a major dna glycosylase that removes various oxidative base lesions including 8-oxoguanine . here \n we further investigate possible involvement of the xpc protein complex in ber by using various dna glycosylases as well as a sumoylated form of tdg , which gives further insights to the molecular mechanisms for the tdg stimulation . \n purification of recombinant human xpc and his - tagged rad23b ( rad23b - his ) was carried out [ 34 , 35 ] , and the xpc - rad23b - his heterodimer was reconstituted in vitro as described previously . his - tdg , gst - tdg , gst , and his - smug1 were also purified as described elsewhere [ 20 , 36 ] . \n ecmug and ung2 , both fused to the n - terminal his - tag , were expressed in e. coli strain bl21 ( de3 ) using the pet-28a vector ( novagen ) . \n expression of his - ecmug was induced with 1 mm isopropyl--d - thiogalactopyranoside ( iptg ) at 37c for 3 hours . \n the bacterial cell pellets were sonicated in buffer a [ 25 mm sodium phosphate ( ph 7.5 ) , 1 mm edta , 25 mm nacl , 0.01% nonidet p-40 , 1 mm dithiothreitol ( dtt ) , 0.25 mm phenylmethylsulfonyl fluoride ( pmsf ) , protease inhibitor cocktail ( complete ; roche diagnostics ) ] and centrifuged for 30 minutes at 100,000 g. the supernatant was loaded onto a phosphocellulose column ( p-11 ; whatman ) equilibrated with buffer b [ 20 mm sodium phosphate ( ph 7.5 ) , 10% glycerol , 0.01% triton x-100 , 0.25 mm pmsf ] containing 0.1 m nacl . after the resin was washed thoroughly with the same buffer , bound proteins were eluted stepwise with buffer b containing 0.2 and 1 m nacl . \n proteins recovered in the 1 m nacl fraction were then applied to a column packed with talon resin ( clontech ) equilibrated with buffer c [ 20 mm tris - hcl ( ph 7.5 ) , 10% glycerol , 0.1 m nacl , 0.01% triton x-100 , 0.25 mm pmsf ] containing 5 mm imidazole . the column was then washed extensively with the same buffer , followed by stepwise elution of the bound proteins with buffer c containing 20 , 100 , and 250 mm imidazole . \n finally , the 100 mm imidazole fraction containing his - ecmug was dialyzed against buffer d [ 20 mm sodium phosphate ( ph 7.5 ) , 1 mm edta , 10% glycerol , 0.01% triton x-100 , 1 mm dtt , 0.25 mm pmsf ] containing 0.2 m nacl . expression of his - ung2 was induced with 1 mm iptg at 30c for 3 hours . \n the bacterial cell extract was prepared as described above and loaded onto a hiload 16/10 sp sepharose hp column ( ge healthcare biosciences ) equilibrated with buffer b containing 0.1 m nacl . \n after washing the resin with the same buffer , bound proteins were eluted stepwise with buffer b containing 0.5 and 1 m nacl . \n his - ung2 recovered in the 0.5 m nacl fraction was further purified with talon resin , exactly as described above for his - ecmug . \n the 250 mm imidazole fraction was then loaded onto a mono s pc 1.6/5 column equilibrated with buffer d containing 0.1 m nacl . \n the column was developed with a linear gradient of 0.10.7 m nacl in buffer d and his - ung2 was eluted around 0.4 m nacl . \n finally , the sample was subjected to gel filtration chromatography using a superdex 75 pc 3.2/30 column ( ge healthcare biosciences ) equilibrated with buffer d containing 0.2 m nacl . \n sumoylation of his - tdg was conducted in e. coli strain bl21 ( de3 ) as described . \n after induction of protein expression with 1 mm iptg at 30c for 3 hours , bacterial cell extract was prepared and fractionated on sp sepharose and talon columns exactly as described above for his - ung2 . \n the 250 mm imidazole fraction from the talon column containing sumo-1-his - tdg was subsequently loaded onto a mono q hr 5/5 column ( ge healthcare biosciences ) equilibrated with buffer e [ 20 mm tris - hcl ( ph 7.5 ) , 1 mm edta , 10% glycerol , 0.01% triton x-100 , 1 mm dtt , 0.25 mm pmsf ] containing 0.1 m nacl . \n the column was developed with a linear gradient of 0.10.5 m nacl in buffer e and sumo-1-his - tdg was eluted around 0.2 m nacl . \n finally , proteins were loaded onto a mono s pc 1.6/5 column equilibrated with buffer d containing 0.1 m nacl and then eluted with a linear gradient of 0.10.5 m nacl in buffer d. sumo-1-his - tdg was collected from the fractions around 0.2 m nacl . \n gst - fusion proteins were expressed in e. coli strain bl21 ( de3 ) using the expression vector pgex4t3 and purified through two successive chromatography procedures using a gstrap column ( ge healthcare biosciences ) and then a mono s pc 1.6/5 column . \n flag - tagged mbd4 ( flag - mbd4 ) was expressed in insect cells using the bac - to - bac baculovirus expression system ( invitrogen ) . \n high five cells were infected with the recombinant baculovirus , and proteins were extracted from the cells with buffer f [ 25 mm tris - hcl ( ph 8.0 ) , 1 mm edta , 0.3 m nacl , 10% glycerol , 1% nonidet p-40 , 1 mm dtt , 0.25 mm pmsf , protease inhibitor cocktail ( complete ) ] and dialyzed against buffer d containing 0.1 m nacl . \n samples were then loaded onto a hiload 16/10 sp sepharose hp column ( ge healthcare biosciences ) equilibrated with buffer d containing 0.1 m nacl . after washing the column with the same buffer , \n bound proteins were eluted stepwise with buffer d containing 0.5 and 1 m nacl . \n the 0.5 m nacl fraction was subsequently loaded to an anti - flag m2-agarose column ( sigma - aldrich ) and eluted with buffer d plus 1 m nacl and 0.1 mg / ml 3 x flag - peptide ( sigma - aldrich ) . \n the eluate was adjusted at 0.3 m nacl by dilution with buffer b and then loaded to a hitrap heparin hp column ( ge healthcare biosciences ) equilibrated with buffer d containing 0.3 m nacl . \n bound proteins were eluted stepwise with buffer d containing 0.5 and 1 m nacl , and flag - mbd4 appeared in the 1 m nacl fraction . \n finally , the fraction was diluted by buffer d in order to decrease the nacl concentration to 0.3 m again and subjected to a mono s pc 1.6/5 column equilibrated with buffer d containing 0.3 m nacl . \n the elution of the bound protein was conducted with a linear gradient of 0.31 m nacl in buffer d , where flag - mbd4 was collected from the fractions around 0.5 m nacl . \n the enzymatic activities of dna glycosylases in the presence or absence of xpc - rad23b were measured as described previously . \n substrates used ( g / t , g / u , and ss - u ) are shown in figure 1 . \n glutathione - sepharose 4 fast flow ( ge healthcare biosciences : 20 l ) was mixed with recombinant proteins as indicated in 100 l of the binding buffer 20 mm sodium phosphate ( ph 7.4 ) , 1 mm edta , 150 mm nacl , 1 mm dtt , 5% glycerol , 0.01% triton x-100 , 100 g / ml bovine serum albumin . \n after incubation on ice for 1 hour with occasional agitation , the beads were washed eight times with 500 l of the binding buffer and the proteins retained on the beads were eluted using 20 l of the binding buffer containing 10 mm glutathione . \n since purified xpc has a tendency to aggregate when boiled in the presence of sds , each eluate was mixed before denaturation with the whole cell extract ( 0.4 g protein ) from xp4pasv cells that do not express endogenous xpc . \n an aliquote of each eluate mixed with xp4pasv cell extract was subjected to 8% sds - page and analyzed by immunoblotting using polyclonal anti - xpc or anti - gst antibodies . \n the polyclonal antibodies against xpc and tdg were raised as described previously [ 20 , 35 ] . \n the polyclonal anti - gst ( ge healthcare biosciences ) and anti - sumo-1 ( santa cruz biotechnology ) antibodies were purchased . \n we first examined whether xpc can stimulate the enzymatic activity of tdg that removes uracils from the g / u mismatches by the conventional dna glycosylase assay involving the substrate shown in figure 1(a ) . \n we have previously shown by using the dna substrate containing a single g / t mismatch that xpc - rad23b stimulates the activity of tdg by promoting dissociation of the enzyme from the ap site . \n although tdg has been shown to exhibit significantly higher activity with g / u than g / t mismatches , the severe product inhibition has been also observed with the g / u substrate . in this point of view \n , the effect of xpc on tdg may be similar regardless of which substrate is used , because the ap site opposite guanine is in any way produced as a result of the enzymatic action . \n compared with the reaction kinetics of tdg alone , addition of xpc - rad23b stimulated the activity of tdg on g / u mismatches up to 5-fold in a dose - dependent manner ( figure 2 ) , exactly as expected . in order to test the significance of protein - protein interaction between xpc and tdg for the stimulation , we purified an e. coli homolog of tdg , the mismatch - specific uracil - dna glycosylase ( ecmug ) . \n unlike tdg , which is involved in correction of both g / t and g / u mismatches , ecmug is primarily g / u - specific , with very low activity toward g / t mismatches . \n however , ecmug resembles human tdg in that , after cleavage of the particular bases , it remains tightly bound to the ap site generated after exhibiting the glycosylase activity [ 2225 ] . \n we first tested the presence or absence of physical interaction between xpc and ecmug fused to glutathione s - transferase ( gst - ecmug ) . \n ten nanomolar each of gst - ecmug , gst - tdg as a positive control , or gst alone as a negative control was mixed with the equal concentration of xpc - rad23b , and proteins were pulled down with glutathione - sepharose beads . \n immunoblot analyses revealed that a significant amount of xpc was bound to gst - tdg whereas only little amount of xpc was bound to gst alone as expected ( figure 3 , compare lanes 1 and 2 ; see also ) . it should be noted that the amount of gst - tdg recovered in the bound fraction was only ~20% of gst . meanwhile , the binding between xpc and ecmug was as much as the background level ( figure 3 , \n compare lanes 1 to 3 ) , indicating that xpc - rad23b does not interact with ecmug in vitro under the conditions tested . \n we next added xpc into the nicking assay using the g / u substrate in order to see whether it influences the activity of ecmug . \n although significant physical interaction could not be detected ( figure 3 ) , it was possible that xpc - rad23b may still stimulate the activity of ecmug by displacing the glycosylase from the ap site , since xpc itself also seems to have a binding affinity toward the ap site . as shown in figure 4 , however , \n xpc hardly affected the enzymatic activity of ecmug ; while 0.8 nm ecmug processed about 6% of the substrate dna ( 1.6 nm ) within 120 minutes , ~9% of the uracil was removed from the g / u mismatched - dna in the presence of 4 nm xpc - rad23b . \n although there might be thus a very weak stimulation , the effect of xpc on ecmug activity was much less pronounced than that on tdg . \n a covalent modification of tdg by sumo-1 was shown to dramatically affect its dna binding properties [ 30 , 32 ] . \n consequently , tdg appears to lose its activity on g / t mismatches , whereas the excision of uracils from g / u substrates is even enhanced upon sumoylation . \n the stimulation of the uracil cleavage seemed to be due to relief of tdg from the product inhibition via sumo-1 conjugation . given that the sumoylated tdg may not be bound to the ap site so stably , it was of our great interest to know whether xpc can interact with and stimulate the activity of the modified enzyme . \n to test this idea , we prepared sumo-1-conjugated tdg by expressing e1 ( aos1-uba2 ) , e2 ( ubc9 ) , sumo-1 , and tdg ( his- or gst - tagged ) in e. coli simultaneously , which enables efficient sumoylation of tdg within bacteria . \n the sumoylated his - tdg ( figure 5(a ) ) and gst - tdg ( data not shown ) were purified to near homogeneity . \n we confirmed that the purified protein specifically reacts with both anti - tdg and anti - sumo-1 antibodies ( figure 5(b ) ) . \n analysis of the protease - digested fragments with mass spectrometry and peptide sequencing further demonstrated that sumo-1 is conjugated exactly to the predicted site ( lys330 of tdg ; data not shown ) . at \n first , we tested a protein - protein interaction between xpc and the sumoylated tdg by gst pull - down assay . \n as shown in figure 3 , a significant amount of xpc was coprecipitated with sumo-1-gst - tdg if compared to gst alone , and approximately 2-fold more xpc appeared to bind to sumo-1-gst - tdg than to nonmodified gst - tdg . \n this indicates that xpc can bind to tdg regardless of the presence or absence of modification by sumo-1 . \n as reported by hardeland et al . , the purified recombinant sumo-1-tdg had only marginal activity for g / t mismatches ( data not shown ) . \n on the other hand , sumo-1-tdg showed nearly linear kinetics of uracil removal from g / u mismatches up to 120-minute incubation , suggesting that the product inhibition was much less pronounced as described previously ( figure 5(c ) ; ) . \n interestingly , this activity of sumo-1-tdg was further stimulated by the addition of xpc in a dose - dependent manner ( figure 5(c ) ) . \n incubation of 4 nm xpc - rad23b resulted in ~5-fold processing of the g / u mismatch in 120 minutes , and this ratio was comparable to the stimulation of nonmodified tdg cleaving the same substrate ( figure 5(c ) ) . \n thus , these results demonstrate that xpc can upregulate the activity of not only nonmodified tdg but also sumo-1-modified tdg in vitro . since it has been reported that xpc stimulates ogg1 in addition to tdg , we next investigated the effect of xpc on various dna glycosylases , especially the monofunctional dna glycosylases that are involved in g / t and/or g / u mismatch repair , including ung2 , mbd4 ( also referred to as med1 ) , and smug1 . \n ung2 and smug1 mainly remove uracils not only from double - stranded dna but also from single - stranded dna , whereas mbd4 as well as tdg is more or less specialized toward correction of g / t and g / u mismatches particularly in the cpg context . \n as shown in figure 6 , xpc showed no obvious effect on the activity of ung2 against g / u mismatch ( figure 6(a ) ) , that of mbd4 against g / t mismatch ( figure 6(b ) ) , or that of mbd4 against g / u mismatch ( data not shown ) . \n although the activities of both ung2 and mbd4 were somewhat reduced in the presence of xpc , this may be due to the nonspecific binding of xpc to dna . \n on the contrary , xpc showed a striking stimulation on the activity of smug1 against g / u mismatch in a dose - dependent manner ( figure 6(c ) ) . in the absence of xpc , \n 2.5 pm smug1 processed about 5% of 1.6 nm g / u - mismatched dna in 120 minutes under the conditions tested . meanwhile , the presence of 2 nm xpc - rad23b boosted the smug1 activity up to 4-fold under the equivalent conditions . \n this stimulation was also observed when a single - stranded 30-mer oligonucleotide containing a single uracil residue was used as a substrate ( figures 1 and 6(d ) ) . \n while 62.4 pm smug1 cleaved about 2% of the substrate ( 1.6 nm ) in 120 minutes , addition of 1 nm xpc - rad23b stimulated the cleavage up to 8% under the same conditions . \n although smug1 is known to remove uracils more efficiently from single - stranded dna than from double - stranded dna , our results showed the opposite pattern . \n this might be due to the difference in length of the substrate dna between g / u - mismatched double - stranded dna ( 60 bp ) and single - stranded dna ( 30 mer ) . \n these results suggest that xpc functionally interacts not only with tdg but also with smug1 . since our results indicate that xpc could stimulate the activity of smug1 in vitro , we tested the existence of the protein - protein interaction between xpc and smug1 by using the gst - pull down assay ( figure 7 ) . \n ten nanomolar each of gst or gst - fused smug1 was incubated with an equimolar amount of xpc - rad23b , and then bound to the glutathione - sepharose beads . \n after eluting the bound protein with glutathione , the presence of gst and gst - smug1 or xpc was visualized by immunoblotting using anti - gst or anti - xpc antibody , respectively . \n while equivalent molar amounts of gst and gst - smug1 were observed within the eluates , only little amount of xpc was bound to the control gst . on the other hand , \n although this protein - protein interaction seems to be relatively weak ( only ~0.4% of the input was bound to xpc ) , these results indicate presence of a direct interaction between xpc and smug1 . \n in this study , we have further examined the molecular mechanisms of interaction between xpc and tdg that facilitate the enzymatic turnover of tdg . in our previous studies \n , xpc appeared to promote dissociation of tdg from the ap site that is generated by its own glycosylase activity on g / t mismatch . \n at least two possible mechanisms have been considered , which could contribute to the displacement of tdg from the abasic reaction product : ( 1 ) protein - protein interaction between xpc and tdg weakens the binding affinity of tdg to the substrate dna , and ( 2 ) xpc and tdg compete for the same ap site , and thus tdg is pushed out . in order to examine which factor \n is more critical for the enhanced enzymatic turnover , ecmug , an e. coli homolog of mammalian tdg , was utilized as a model that can bind to the ap site as well as tdg [ 24 , 25 ] but can not interact with xpc ( figure 3 ) . \n our results indicate that the stimulation of ecmug by xpc is almost negligible when compared to human tdg ( figure 4 ) . \n although there might be very weak stimulation of ecmug , which could be due to competitive displacement of the enzyme from the ap site by xpc - rad23b , these results point to importance of the protein - protein interaction for the stimulation of tdg by xpc . in agreement with this idea , \n we show here that xpc also stimulates the activities of sumoylated tdg and smug1 , both of which interact physically with xpc ( figures 3 and 7 ) . \n our present data also indicate that very stable association of dna glycosylase with the produced ap site is not a prerequisite for stimulation by xpc . \n it has been reported that modification of tdg by sumo alters its structure in the c - terminal domain , which leads to the release of tdg from the ap site and therefore induces accelerated enzymatic turnover [ 3032 ] . \n in fact , in contrast to the immediately saturating reaction patterns of unmodified tdg , the sumoylated enzyme exhibited a nearly linear kinetics of uracil removal from g / u mismatches . even under these conditions \n it is possible that , like the reported case for ogg1 , xpc may stimulate loading of certain dna glycosylases to substrate dna . \n although competition with xpc for the ap site may not be sufficient by itself to displace the tightly bound dna glycosylase , our data do not exclude that the binding affinity of xpc to the ap site may still contribute to promotion of the enzymatic turnover . \n considering the fact that xpc and ape1 stimulate the activity of tdg in an additive fashion and that ape1 also further stimulates the activity of sumo-1-tdg , xpc , sumoylation , and ape1 might be collaborating to control the repair of g / t and g / u mismatches positively in vivo . to understand the relationship between these three factors in detail , in vivo regulation of the tdg sumoylation should be clarified in the future experiments . \n in addition , it has been shown that xpc undergoes in vivo posttranslational modifications , such as ubiquitylation [ 40 , 41 ] , sumoylation , and phosphorylation [ 42 , 43 ] . \n although the observed stimulation of dna glycosylases seemed to occur in the absence of these modifications , it is still possible that one or more of these modifications may affect interaction with and/or stimulation of some dna glycosylases . \n mammalian cells contain at least four nuclear dna glycosylases that can correct g / u and/or g / t mismatches , that is , tdg , ung2 , mbd4 , and smug1 . \n although precise niche for each of these dna glycosylases remains to be clarified , their biological roles have been suggested through observations of in vivo behaviors and through interacting partners . \n ung2 seems to be specialized in counteracting u : a base pairs formed by misincorporation of dutp during dna replication . among the uracil - dna glycosylases , only ung2 specifically accumulates in the replication foci during the s phase , thereby colocalizing with proliferating cell nuclear antigen ( pcna ) and rpa . on the other hand , \n smug1 was first identified by in vitro expression cloning and also independently found to be a backup enzyme for ung2 [ 45 , 46 ] . unlike ung2 , smug1 may account for the repair of replication - independent premutagenic g / u mispairs resulting from cytosine deamination in vivo , since it is expressed similarly in nonproliferating and proliferating cells and it does not colocalize with pcna during the s phase . tdg and mbd4 \n apparently have very similar substrate specificities : g / t and g / u mispairs that are spontaneously generated by deamination of cytosines in cpg dinucleotides . besides its function in ber \n , tdg is also known to interact with and regulate several transcription factors [ 4851 ] . \n mbd4 interacts with a mismatch repair protein mlh1 , which may be involved in regulation of some dna damage response pathways . \n interestingly , human ung , tdg , and smug1 genes are closely located within the long arm of chromosome 12 , and these genes are believed to be the derivatives from an identical ancestral gene . \n in fact , structural studies revealed that they contain several common folds despite rather low ( ~10% ) amino acid sequence homology [ 55 , 56 ] . in these points of view , tdg and smug1 might still possess the common surface that might be the remnant of the ancestor to interact with xpc . \n it has been reported that tdg is able to process certain oxidative pyrimidine lesions , such as thymine glycol , 5-hydroxyuracil , and 5-hydroxymethyluracil , when paired with guanine . \n in addition , smug1 was shown to be a primary repair enzyme for a subset of oxidized uracil derivatives such as 5-formyluracil , 5-hydroxymethyluracil , and 5-hydroxyuracil in both single- and double - stranded dna [ 57 , 58 ] \n . taken together with the recent report showing that xpc stimulates the activity of ogg1 , these findings suggest that xpc might be involved in repair of diverse oxidative dna lesions . \n in fact , lack of endogenous xpc seems to result in inefficient repair of spontaneous oxidative dna damage . \n interestingly , while a significant amount of h2o2 is produced upon uv irradiation in most of the complementation groups of the xp cells including xp - c compared to normal cells , plasmid reactivation assays revealed that only xp - c cells exhibited markedly reduced repair capacity for some singlet oxygen - induced dna lesions . \n furthermore , extensive mutational analyses of the trp53 of uvb - induced skin tumors in xpc mice revealed a mutational hotspot at a nondipyrimidinic cpg site in codon 122 [ 61 , 62 ] . at this site , \n c to t transition has been frequently detected specifically in xpc mice ( not in xpa or csa mice ) , which is plausibly explained by reduced tdg activity in the absence of functional xpc protein . \n however , the tandem mutations ac > tt and ac > ct have been also found at the same site , which can not be attributed either to uv - induced dipyrimidinic photolesions or to deamination of the cytosine alone . in addition , it has been reported that age - dependent spontaneous mutations significantly accumulate in xpc mice even without uv exposure , and p53 gene mutations were identified in internal tumors of xp - c patients . many of these mutations are less likely to be the result of defects in correction of g / t and/or g / u mismatches \n . it could be possible that impaired repair of certain types of oxidative damage may be involved in occurrence of these mutations . \n here we show that xpc stimulates activities of a certain spectrum of dna glycosylases , for which protein - protein interactions seem to be important , rather than competition for ap sites . in order to clarify the significance of interaction between xpc and tdg or smug1 in vivo \n , it should be necessary to understand the precise physiological roles of the different thymine- and uracil - dna glycosylases . \n further studies would reveal novel and important aspects in understanding the mutagenesis and carcinogenesis in xp - c patients .", "role": "user" }, { "content": "we showed that xpc complex , which is a dna damage detector for nucleotide excision repair , stimulates activity of thymine dna glycosylase ( tdg ) that initiates base excision repair . \n xpc appeared to facilitate the enzymatic turnover of tdg by promoting displacement from its own product abasic site , although the precise mechanism underlying this stimulation has not been clarified . here \n we show that xpc has only marginal effects on the activity of e. coli tdg homolog ( ecmug ) , which remains bound to the abasic site like human tdg but does not significantly interacts with xpc . on the contrary \n , xpc significantly stimulates the activities of sumoylated tdg and smug1 , both of which exhibit quite different enzymatic kinetics from unmodified tdg but interact with xpc . \n these results point to importance of physical interactions for stimulation of dna glycosylases by xpc and have implications in the molecular mechanisms underlying mutagenesis and carcinogenesis in xp - c patients .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the general organization and distribution of nervous tissue ( the third basic tissue ) are to a large extent determined by its course of evolution . \n the specialized cells that constitute the functional units of nervous system called neurons supported by their connective tissue neuroglia constitute the main bulk of the nervous tissue in the body . \n they are terminally differentiated cells that do not regenerate in the event of cell death . \n any disorder to these , leads to devastating benign or malignant tumors of the nerves in the oral cavity . \n virchow 's original classification emphasized the relationship of the nerve tumors to the neuron proper by dividing the tumors into true and false neuromas . \n this group has been accepted as the more common and significant group of tumors of peripheral nerves and it is this group that forms the principal focus . despite the common nature of peripheral tumors , they continue to pose problems in classification and nomenclature . \n neurilemmoma also referred to as schwannoma , neurinoma , and perineural fibroblastoma is an encapsulated nerve sheath tumor . \n eversole and howell reported the first intraoral case of ancient schwannoma , although cherrick and eversole presented two additional cases in the same year but detailed clinical information was not given . \n although the occurrence of schwannomas in the head and neck area is relatively high , an intraosseous schwannoma is rare , presenting in less than 1% of benign primary bone tumors . \n schwannoma is usually a solitary soft tissue or intrabony lesion that is slow growing , encapsulated and is often associated with the associated nerve attached peripherally . \n the common type is the submucosal module , which is encapsulated , well defined , firm in consistency , thus resembling a cyst . \n the second type is the nonencapsulated , where the tumor is found below the basal layer of the mucous membrane . \n the preoperative diagnosis is often difficult and is made by computed tomography and/or magnetic resonance imaging to evaluate the extent and determine infiltration of the surrounding structures . if the nerve of origin is identified , as in the case described by yamazaki et al . \n of schwannoma associated with the mental nerve , it is possible to diagnose a peripheral nerve sheath tumor , which at least allows the patient to be given appropriate information regarding the risk of nerve lesion during surgery . \n kun et al . , were able to make a correct preoperative diagnosis in only four cases located in the neck of the 49 cases studied , they concluded that it is very difficult to make the diagnosis based on diagnostic imaging techniques . \n kawakami et al . , in the case of a tumor in the floor of the mouth , with computed tomography and magnetic resonance a malignant tumor of the sublingual gland . \n a differential diagnosis is needed with other neurogenic tumors such as neurofibroma , neuroma , myoblastoma of granular cells , neurogenic sarcoma , malignant schwannoma , neuroepithelioma , and melanoma . in this article a rare clinical case of intraosseous schwannoma is reported whose diagnosis was established upon clinical , histological , and imunohistochemical findings . \n an 8-year - old male child patient named binod murmu reported to the department of oral and maxillofacial pathology with a chief complaint of swelling in the lower left region of the face since 1 year . \n no contributory medical , family , or personal history was elucidated . on extra - oral examination , \n patient presented a diffuse , firm , nontender , nonpulsatile , nonreducible , noncompressible , nonfluctuant swelling in the lower left one third of face [ figure 1 ] . \n photomicrograph showing swelling in the lower left region of the face intra - oral examination revealed a smooth , firm , nontender , nonpulsatile , nonreducible , noncompressible , nonfluctuant swelling with ulcerated surface ( due to trauma from antagonist teeth ) extending from lower left lateral incisor to first permanent molar . \n expansion of both buccal and lingual cortical plates and mobility of regional teeth was also present [ figure 2 ] . \n photograph showing swelling from lower left lateral incisor to first permanent molar the following investigations were performed : aspiration , routine hemogram , radiology , light microscopy , and immunohistochemistry . \n an x - ray opg of jaws revealed mixed dentition with teeth in various stages of development and eruption and root resorption of 73 , 74 , 75 , displacement of permanent tooth buds 33 , 34 , 35 , extrusion of 73 , 74 , 75 and increased vertical height of lower left side of mandible . \n the radiograph presented a large round unilocular radiolucent area with moderately defined borders [ figure 3 ] . \n an orthopantomograph revealing a large round unilocular radiolucent area with moderately defined borders all routine blood examination was conducted before the surgical procedure . \n an incisional biopsy was performed under la followed by the primary closure of the wound with 30 silk suture . the excised tissue submitted to the department of oral pathology for histopathological examination . a differential diagnosis of neurofibroma , benign fibrous histiocytoma , fibro sarcoma , leiomyoma . \n the histopathology of the submitted h and e stained sections showed a thin fibrous capsule with antoni a type and antoni b type tissue arrangements . \n antoni a type being characterized by schwann cells that are closely packed , arranged in bundles or rows with palisading nuclei . \n while in the antoni b type , there is less number of cells and disorganization of fusiform cells dispersed in a loose and random fashion . \n the vasculature is not that prominent . considering the nonorganization of the tumoral schwann cells forming the verocay bodies , \n immunohistochemical analysis was done using s-100 and glial fibrillar acidic protein ( gfap ) that stained intensely positive [ figures 49 ] . \n photomicrograph showing a well circumscribed tumor showing a thin well - defined fibrous connective tissue capsule and proliferating schwann cells ( h and e , 4 ) photomicrograph showing proliferating schwann cells arranged in a palisading pattern ( h and e , 10 ) photomicrograph showing antoni type a cells interspersed with some verocay bodies ( h and e , 40 ) photomicrograph showing antoni type b loosely arranged tumor tissue with no characteristic palisading appearance tumor cells shows positive stain for s-100 protein tumor cells shows positive stain for glial fibrillary acidic protein on the basis of clinical , radiological , and histological features a provisional diagnosis of schwannoma was given . \n immunohistochemistry was done s-100 : positive , glial fibrillary acidic protein : positive , smooth muscle actin : negative , desmin : negative . \n management of the lesion was done by surgical resection along with preservation of nerve and on follow up no malignant transformation was reported . \n it is a rare , benign neural tumor arising from the neural sheath schwann cells of the peripheral , cranial , or autonomic nerves . \n it can also arise from any nerve covered with a schwann cell sheath , which include the cranial nerves ( except for the optic and olfactory ) , the spinal nerves and the autonomic nervous system . \n some say that they arise directly from the neural tube whereas others insist their origin from the neural crest , ( a group of cells that lie lateral to the neural tube and beneath the ectoderm of the developing embryo ) . \n some put its etiology to originate from a proliferation of schwann cells in the perineurium causing displacement and compression of the adjacent nerve . in the parapharyngeal space \n it does not arise from cranial nerves i and ii because they lack schwann cells . \n the tumor is solitary , with a smooth surface and slow asymptomatic growth although the clinical symptomatology depends on the nerve of origin . \n two types are distinguished ( central and peripheral schwannoma ) located in bone or in soft tissues respectively . \n approximately 25% of the reported cases originate from the head and neck region . of these \n the intrabony lesion accounts for less than 1% of the central neoplasms . in our case , the tumor was intraosseous suspected to have a close association of its origin with the mental nerve . \n in the past reviews , very few cases of intraosseous schwannomas in the oral cavity have been reported [ table 1 ] . reported cases on intraosseous schwannoma in the oral cavity according to the literature , there have been reports of 44 cases of intrabony neurilemmomas that occurred in either of the jaws . \n neurilemmomas of the jaw occurred in the age range of 872 years , with the average age of 34 years and a definite female predilection . \n contrary to the above literature , ours is one such unusual case cited in the first decade in very young male patient of 8 years . \n the radiographic appearance of a well - defined unilocular nonspecific radiolucent lesion , with root divergence ( expansive growth ) and root resorption only in teeth contacting the lesion , was suggestive of a benign process and thus making a preoperative diagnosis was difficult . \n the possibility of an intraosseous schwannoma was not considered at first because of the extreme rarity of this location . along with this , \n radiographic finding from four different sites may suggest three mechanisms by which schwannomas may involve bone : 1 ) a tumor may arise centrally within the bone , 2 ) a tumor may arise within the nutrient canal and produce canal enlargement , or 3 ) a soft tissue or periosteal tumor may cause secondary erosion and penetration into bone . in the case \n we hereby report , the third mechanism can be excluded because there was no cortical bone perforation of intraosseous schwannomas . \n imaging of the lesion comprises of computed tomography ( ct ) and magnetic resonance imaging ( mri ) as it not only determines the extent of the lesion and assesses its resectability but delineates its relationship to the artery , nerve , skull base , or intracranial involvement also . if the nerve of origin is identified , as in the case described by yamazaki et al . \n of schwannoma associated with the mental nerve , it is possible to diagnose a peripheral nerve sheath tumor , which at least allows the patient to be given appropriate information regarding the risk of nerve lesion during surgery . \n however , a definite diagnosis is difficult to make on the basis of radiography alone ; a biopsy is usually necessary . \n schwannomas only rarely arise in the inferior alveolar canal , but when they do , such lesions become rounded and the wall of the mandibular canal is preserved . on the other hand , neurofibromas tend to grow specifically in the canal , which typically becomes ovoid shaped . \n the differentiation between these two neoplasms is imperative because neurofibromas have the potential for malignant transformation . in our case , \n differential diagnosis was made with neurofibroma , benign fibrous histiocytoma , fibro sarcoma , leiomyoma . \n the histological findings of the present case are similar to those reported previously , consisting of a thin fibrous capsule and a tumoral proliferation formed by two types of tissue arrangements : antoni type a and antoni type b. this histological picture is dominated by an encapsulated lesion arising from a nerve end composed of an intimate mixture of spindle cells forming highly cellular antoni a and less cellular , myoxid antoni b areas . \n histopathologically , five schwannoma variants have been described : common , plexiform , cellular , epithelioid , and ancient schwannomas . in the antoni a region , nuclear palisading and homogeneous acellular zones known as verocay bodies are sometimes noted . \n although verocay body and nuclear palisading have traditionally been linked to neural differentiation , they have been described in association with many other lesions and neoplasms , some of them involving the skin . hence , to confirm the histogenesis of this lesion we went ahead with the immunohistochemical analysis for the same which revealed the schwannoma cells to be positive for the protein s-100 , a marker for the nervous system . however , the histological differential diagnosis is made with other neural origin lesions , which could be neurofibroma and neuroma or muscular or fibroblastic origin tumor . \n the differentiation between schwannoma and neurofibroma is essential because an apparently solitary neurofibroma may be a manifestation of neurofibromatosis . because it is a well - encapsulated lesion , the treatment of choice for schwannomas is the conservative surgical enucleation with periodic follow - up . \n recurrence is uncommon . in this case , the patient has been followed up for four years with no clinical or radiographic signs of lesion recurrence . \n the slow ( 3 years ) and expansive growth ( root divergence was more accentuated than resorption ) , the well - delimited borders , the encapsulation and the lack of invasion signs , significant atypia , necrosis and recurrence after 4 years suggest benignity from both clinical and histopathological standpoints . \n it can have far reaching immense complications if it involves a nerve or malignant transformation may take place on leaving untreated . \n definitive preoperative diagnosis should be carried out with a biopsy and anatomopathologic study . since a rare case of intraosseous schwannoma of the mandible \n is reported here with radiographical features suggestive of markedly enhanced solid mass with no cystic parts , hence , a culmination of clinical , radiographic and histopathologic examination was imperative in cases so as to initiate the right approach and correct treatment plan for the patient .", "role": "user" }, { "content": "schwannoma is a benign , encapsulated , perineural tumor that arises from the schwann cells . \n approximately 25% of the reported cases originate from the head and neck region . of these \n , approximately 112% occurs intraorally . \n the intrabony lesion accounts for less than 1% of the central neoplasms . \n we report a rare case of intraosseous schwannoma in an 8-year - old male patient characteristically originating from the mental nerve . \n radiographic examination followed by histopathological evaluation was further confirmed by immunohistochemical markers , s-100 protein , and gfap that stained intensely positive for the tumor . \n thus , confirming the diagnosis of intraosseous schwannoma .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: as an emerging biomedical imaging technique , photoacoustic imaging ( pai ) has experienced considerable growth in the past decade . it has been explored for molecular imaging of biomarkers , functional imaging of physiological parameters [ 3 , 4 ] and the imaging of tumor angiogenesis [ 57 ] in both preclinical and clinical studies . \n photoacoustic tomography ( pat ) provides speckle - free imaging with high contrast and high resolution which is one form of pai . \n when biological tissues are irradiated by short laser pulses , some optical energy is absorbed and converted into heat . \n the resultant thermoplastic expansion leads to the emission of ultrasonic waves which are acquired by a single - element focused ultrasonic transducer with mechanical scanning or an ultrasonic transducer array from a full view [ 8 , 9 ] . \n then the information of the tissue 's optical absorption properties can be recovered using a reconstruction algorithm . \n many algorithms have been developed to exactly or approximately reconstruct the image with a full view of data . a limiting factor for the traditional filtered back - projection ( fbp ) \n algorithm is the great number of measurements made with transducers , implying long acquisition times . \n in addition , it is almost impossible to cover the entire surface of the tissues in many practices . to the best of our knowledge \n , there is no exact formula reported for limited - view pat yet . to resolve such limiting factors , based on the compressive sensing ( cs ) theory can be used to achieve artifact - free imaging from limited - view acquisition . \n an image can be reconstructed from far fewer measurements than what the shannon sampling theory requires if the image is sparse or can be compressed . by using data from a small number of angles and an l1magic convex optimization algorithm , provost et al . introduced the cs theory into the field of pat [ 13 , 14 ] . \n the issue of artifacts and loss of resolution in limited - view imaging can be addressed by using random optical illuminations for fast data acquisition via the spgl1 algorithm [ 15 , 16 ] . \n sun et al . have developed an arc - direction compressed - sensing pat algorithm with numerical phantoms . \n both phantom and in vivo results showed that the cs method can effectively reduce undersampling artifacts via the nonlinear conjugate gradient descent algorithm [ 18 , 19 ] . \n all of these studies have shown that cs - based reconstruction techniques can reduce the number of ultrasonic transducers of the pat system significantly and obtain high - resolution results with limited - view photoacoustic data . however , one of the critical issues that used to hinder the application of cs in pat is the computational cost of the underlying image reconstruction process . in this paper \n , we proposed a fast cs reconstruction algorithm to overcome this difficulty , leading to acceptable computational times . \n we studied the use of the alternating direction method ( adm ) for l1-norm minimization compressive sensing problems arising from sparse pat reconstruction . \n the proposed algorithm was used to improve the speed of the reconstruction from highly incomplete data [ 21 , 22 ] . \n in particular , the adm can generally reduce relative errors faster than all of the other tested algorithms . \n according to the photoacoustic signal generation theory , the acoustic pressure p(r , t ) at location r and time t in an acoustically homogeneous medium obeys the following wave equation : \n ( 1)(21c22t2)p(r , t)=cpth(r , t ) , \n where c is the sound speed , p is pressure , is the isobaric volume expansion coefficient , cp is the specific heat , and h(r , t ) is the heating function that can be written as the product of the initial absorbed optical energy density a(r ) and a temporal function of illumination i(t ) . if the pulse pumping can be regarded as a dirac delta function i(t ) = (t ) , the following problem can be solved using the green 's functions to obtain the pressure : \n ( 2)p(r , t)=4cpa(r)(t|rr|c)d3r|rr| . \n taking the fourier \n transform on variable t of ( 2 ) and denoting k = /c , the forward problem in the temporal - frequency domain is expressed as \n ( 3)p(r , k)=ick4cpa(r)exp(ik|rr|)|rr|d3r. \n to numerically model the previously mentioned problem we used a vector x to represent a(r ) and a vector y to represent the detected acoustic pressure p(r , k ) . \n then ( 3 ) can be expressed as y = x , and the forward projection matrix in the temporal - frequency domain can be written as \n ( 4)(m , n)(i , j)=ickneikn|rmrij||rmrij| , \n where m indicates the position of the transducer , n represents the sampling point in the frequency domain , and rij indicates the cartesian coordinates of the image pixels . \n fortunately , the cs theory tells us that a sparse signal can be exactly reconstructed from incomplete datasets if satisfying some requirements . \n it has been proven that photoacoustic image is sparse or compressed enough in a certain domain [ 13 , 15 ] . by finding an appropriate sparse transform : \n x = , the photoacoustic image can be reconstructed by solving a convex optimization problem in the following form : \n ( 5)min||||1 s.t . \n y=1. \n when y contains noise , or x is not exactly sparse but only compressible , as in most practical applications , the constraint in y = must be relaxed , resulting in the constrained basis pursuit denoising problem \n ( 6)min||||1 s.t . \n ||y1||22< , \n where is the noise level . from the optimization theory , problem ( 6 ) is equivalent to the following problem with a suitable parameter : \n ( 7)min||||1 + 12||y1||22 . \n as and approach zero , \n both problem ( 6 ) and ( 7 ) converge to problem ( 5 ) . based on the classical adm technique , \n the first - order primal - dual algorithm that updates both primal and dual variables at each iteration was used . with an auxiliary variable r problem ( 7 ) \n y=1+r . \n equation ( 8) has an augmented lagrange subproblem of the form \n ( 9)min,r||||1 + 12||r||22t(1+ry ) + 2||1+ry||2 , \n where is a lagrange multiplier and > 0 is a penalty parameter . given ( , ) , the minimization of ( 9 ) with respect to r is given by \n ( 10)rk+1=1+(k(1y ) ) . \n for r = r and = \n are fixed , the minimization of ( 9 ) with respect to is equivalent to \n ( 11)min||||1+2||1+rk+1yk||22 . \n the solution of ( 11 ) can be given explicitly by one - dimensional shrinkage \n ( 12)k+1=shink(kgk,)=max{|kgk|,0}kgk|kgk| . \n finally , with a constant > 0 we updated the multiplier by \n ( 13)k+1=k(1k+1+rk+1y ) . \n in short , adm applied to ( 7 ) produces the iteration : \n ( 14)rk+1=1+(k(1y)),k+1=shink(kgk,),k+1=k(1k+1+rk+1y ) , \n where both the primal and the dual variables are updated at each and every iteration . \n to demonstrate the efficiency and superiority of the adm algorithm in pai reconstruction with limited angle observations , computer simulations were conducted in 2d where the imaged sources are approximately located within the transducer focal plane . \n all of the experiments were performed using matlab ( mathworks , natick , ma , usa ) . \n although the existing cs algorithms provided accuracy results , the computational cost of the optimization process was significantly higher , hindering practical application . by using the adm algorithm , in the following section \n , the problem with the computational cost of the image reconstruction could be overcome , leading to acceptable reconstruction computational times . in this section , \n based on both the symmlet wavelet with an order of 4 and l1-regularization , the numerical experiments have been conducted on a sparse 30 mm 30 mm phantom ( shown in figure 1(a ) ) with a 128 128 resolution . in each experiment , \n to model the transducer response , the domains of kn and n were restricted to certain values kn/2c [ 0.2,2.5 ] and n . at every detection angle , \n 64 randomly chosen kn/2c 's inside the [ 0.2,2.5 ] mhz window were used to completely define (m , n)(i , j ) . by rescaling the intensity values of the phantom to , we generated measurements y using (m , n)(i , j ) in the frequency domain . \n the results reconstructed by the fbp and adm algorithms based on the multiangles observation with a different detection position are shown in figures 1(b)-1(c ) and figures 1(d)-1(e ) , respectively . \n figures 1(b ) and 1(c ) show image reconstruction using the fbp algorithm with measurements along a horizontal circle , stopping at the 200 and 80 positions . \n figures 1(d ) and 1(e ) show the reconstruction results using the adm algorithm with 80 and 40 transducers uniformly covering the 90-degree view . \n it is shown that the results of the cs method are clearly superior to those of the fbp method . \n this can be seen by extracting and comparing lines from the reconstructed images in figure 1(f ) . \n for all of the experiments , the same number of transducers and fourier samples per angle uniformly covering the 90-degree view was used . in order to compare these three algorithms in a way that is as independent as possible , the same iteration stopping criteria = ||x x||/||x|| < 0.005 were used . the quality of the reconstructed image including the number of iterations , the cpu times , and the signal - to - noise ( snr ) achieved by each of the algorithms is presented in table 1 ; all of which are the average values over 10 runs for each experiment . \n we can conclude from table 1 that there are large differences between the algorithm execution times : adm can be roughly 6 times faster than spgl1 , which itself is about 20 times faster than l1magic . \n the proposed algorithm is not only faster , but also maintains the best snr ratio . in order to demonstrate the data fidelity of the adm algorithm , \n figure 2 shows the reconstruction results obtained with these three minimization schemes with measurements from 56 detection angles polluted by average snrs of 40 . in terms of reconstruction quality , \n the denoising effect of the cs can be observed on the residual images . for a computed solution x , its relative error to x \n it has been demonstrated that 90 degrees is sufficient for high - quality reconstruction . to study the effects of white gaussian noise polluted measurements on the reconstruction performance for the adm algorithm , acquisitions were simulated of different snrs . \n [ 12 , 21 ] , the proposed algorithm based on the cs scheme is robust to inaccurate measurements . by contrasting the influence of different noise levels on the reconstruction results , \n figure 4 shows the tendency chart of relative errors in reconstructed photoacoustic images obtained with these three cs algorithms . \n , the proposed algorithm can not only use fewer measurements to obtain better performance , but also reduce relative errors faster than other tested algorithms . \n however , while keeping the noise level at snr = 20 db , the adm algorithm sometimes reduced relative errors slower than the other two algorithms . \n numerical simulations showed that our algorithm produced better images than fbp and other state - of - the - art cs algorithms . \n moreover , the proposed algorithm has been shown to be robust to noise in limited - view imaging .", "role": "user" }, { "content": "photoacoustic imaging ( pai ) has been employed to reconstruct endogenous optical contrast present in tissues . at the cost of longer calculations , \n a compressive sensing reconstruction scheme can achieve artifact - free imaging with fewer measurements . in this paper , an effective acceleration framework using the alternating direction method ( adm ) was proposed for recovering images from limited - view and noisy observations . \n results of the simulation demonstrated that the proposed algorithm could perform favorably in comparison to two recently introduced algorithms in computational efficiency and data fidelity . in particular , it ran considerably faster than these two methods . \n pai with adm can improve convergence speed with fewer ultrasonic transducers , enabling a high - performance and cost - effective pai system for biomedical applications .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: primary tumors of the mediastinum are generally seen in the anterior mediastinum , whereas metastatic tumors usually occur in the posterior mediastinum . particularly in young males , this is due to the fact that retroperitoneal lymphatic drainage of the testis occurs along the descending thoracic aorta towards the posterior mediastinum . \n the role of clinical and radiological findings in the differential diagnosis of tumors located in the mediastinum is highly limited and fine needle aspiration cytology ( fnac ) is accepted as the standard diagnostic procedure . \n however , the proximity of this area to the heart and major vessels decreases the usefulness of fnac and leads to a failure to adequately describe cytomorphological characteristics of the tumors . \n our case , a 33 year - old male patient presented with the complaints of swelling on the right side of the neck that had been gradually growing for one month , as well as shortness of breath and cough . \n his thoracic computed tomography ( ct ) showed a 1.5 cm lymph node on the anterior mediastinum and a mass of about 11 10 8 cm , extending from the right lung apex to the right hilus , with regular contours and without contrast enhancement . \n his abdominal ct revealed a hypodense , heterogeneous , and cystic necrotic mass of about 10 7 5 cm that was para - aortic at the infrarenal level . \n the patient was given a preliminary diagnosis of a central bronchus tumor and the lymphoma was then subjected to transthoracic fnac . \n cytopathological examination demonstrated pleomorphic epithelial cells , either individually or in groups , having cytoplasm with vacuoles . \n it was noted that these cells had eccentric located nuclei containing one or more nucleoli . in light of these findings , the patient was diagnosed with a nontypeable , malignant , epithelial tumor and was directed to undergo a genitourinary examination [ figure 1 ] . upon finding a high alpha fetoprotein ( afp ) value ( 5724 iu / ml ) , \n scrotal ultra sonography ( usg ) was performed and showed a mass filling the whole testis on the right side . \n the patient was diagnosed with a mixed germ cell tumor ( 60% mature teratoma and 40% yolk sac tumor ) by histopathological examination of the orchiectomy material . \n microscopic appearance of pleomorphic epithelial cells from testis with yolk sac tumor characterised with microvacuolar cytoplasm ( mgg , 1000 ) \n most ( almost 70% ) of the nonseminomatous germ cell tumors contain two or more germ cell components and are thus classified as mixed germ cell tumors . although pure germ cell tumors are extremely rare in adulthood , mixed tumors comprise about 33% of all germ cell tumors . \n , described nonseminomatous germ cell tumors as well known , aggressive , malignant tumors of the testis . \n the usual mode of presentation in a testicular mixed germ cell tumor is testicular enlargement which is usually associated with pain . \n this may change depending on the tumor components , with a greater propensity for distant metastases in tumors with high - risk histology ( e.g. , choriocarcinoma ) . \n pulmonary metastasis is associated with secondary hemoptysis , retroperitoneal metastasis associated with back pain , gastrointestinal system metastasis with gastrointestinal bleeding , and brain metastasis with neurological symptoms . our case presented with complaints of dyspnoea and cough associated with mediastinal metastasis . \n as lung and oesophageal tumors metastasise more commonly to the mediastinum , germ cell tumors of the testis are generally not considered in the differential diagnosis of mediastinal masses . \n a central metastatic bronchial tumor and lymphoma were initially considered in our case as well . \n depending on the sampling , it may not be possible to see all components of the mixed germ cell tumors with fine needle aspiration biopsy . in a study by shabb et al . \n , although cystic , necrotic , and fibrotic characteristics were seen in most of the mediastinal lesions by fnac , specimen adequacy was found to be 83% to diagnosis and diagnostic accuracy was 86% . \n it was reported in another study that cytological examination along with immunohistochemical analysis is quite reliable in the diagnosis of germ cell tumors . \n the cytological picture of yolk sac tumors shows pleomorphic epithelial cells with vacuolar cytoplasm , individually or in groups . \n however , the presence of these globules is seen in many different neoplasms , and is therefore not diagnostic . \n metachromatic basal membrane material with extracellular accumulation may help the diagnosis of yolk sac tumor . \n schiller - duval bodies which are a characteristic finding in histological investigations are rarely found in cytological examinations . \n cytological diagnoses is difficult due to detection of a few number of cells by aspirations of mature teratoma ; however , cytologically diagnosed few cases have been reported , previously . as cyst \n f luid is generally not diagnostic , repeated aspiration after evacuation may show epithelial structures , fibroblasts , or pieces of cartilage . \n however , signs indicating a germ cell tumor , which is the dominant component , are seen in fnac taken from the teratoma , which is usually co - existent with other germ cell tumors of the testis . \n chemotherapy brings about an 80% cure in cases in which nonseminomatous germ cell tumors of the testis metastasise . \n it has been argued that removal of residual masses after chemotherapy will increase the efficacy of treatment as well as life expectancy . \n fnac was taken from our cases after the administration of six cures of bleomycin , etoposide , and cisplatin . \n a mature teratoma was diagnosed upon seeing an abundance of flat epithelial cells , some of which had lost their nuclei , on a floor of inflammatory cells in the cytopathological examination [ figure 2 ] . \n histopathological examination of the mass removed thereafter , showed alterations associated with a mature teratoma and chemotherapy . a cytological picture of a teratoma , as in our case , might be helpful to guide surgery . \n recurrence or metastasis was not found in the follow - up of our case to date ( one year follow - up ) . \n multiple of flat epithelial cells belonging to teratoma component of the mixed germ cell tumor taken from the mass after chemotherapy ( a - mgg , 200 , b - pap , 200 ) in conclusion , even though metastatic lesions are mostly seen in the posterior mediastinum , our findings reveal that specimens obtained with fnab from the anterior mediastinum bear discohesive , pleomorphic , small nuclei in epithelial cells with microvacoules in the cytoplasm . \n these cytopathological changes in specimens from the anterior mediastinum may be responsible in promoting germ cell and yolk sac tumors .", "role": "user" }, { "content": "nonseminomatous germ cell tumors of the testis are common and are very aggressive malignant tumors . \n most of the cases have metastases at the time of diagnosis , and involvement of the posterior mediastinum in particular is well known . a 33 year - old male patient presented with complaints of a swelling on the right side of the neck that had been growing for the last month , as well as shortness of breath and cough . \n his thoracic computed tomography ( ct ) showed a 1.5 cm lymph node on the anterior mediastinum and a mass of about 11 10 8 cm extending from the right lung apex to the right hilus , with regular contours and without contrast enhancement . \n the patient , who was given the preliminary diagnosis of a mixture metastatic bronchial tumor plus lymphoma , was subjected to transthoracic fine needle aspiration cytology ( fnac ) . \n his abdominal ct revealed a hypodense , heterogeneous and cystic necrotic mass of about 10 7 5 cm that was para - aortic at the infrarenal level ( initially predicted as a lymphoma ) . \n the patient , who could not be typed in his cytopathological examination , was diagnosed with malignant epithelial tumor and was recommended to undergo a genitourinary system examination . upon finding a high alpha fetoprotein ( afp ) value , a scrotal ultra sonography was performed which showed a mass filling the right testis . \n histopathological examination of the orchiectomy material resulted in the diagnosis of mixed germ cell tumor ( 60% mature teratoma and 40% yolk sac tumor ) . even though metastatic lesions are mostly seen in the posterior mediastinum \n , our findings reveal that specimens obtained with fnac from the anterior mediastinum bear discohesive , pleomorphic , small nuclei in epithelial cells with microvacoules in the cytoplasm . \n these cytopathological alterations in specimens from the anterior mediastinum might promote germ cell and yolk sac tumors .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: india has approximately 2.4 millions of people living with hiv and two thirds live in rural areas . \n however , most of the studies on hiv in india have been performed in research centres or tertiary hospitals situated in urban areas . \n studies in rural areas are difficult to perform due to isolation , poor communications , poverty and lack of institutions interested on doing research in rural regions . in this study , we describe risk factors associated with hiv infection in patients who were tested for hiv in a rural hospital of india . \n the findings of this study provide new information for understanding the hiv epidemic in rural india . knowing the risk factors associated with hiv is essential for designing effective health programs aimed to achieve early diagnosis of hiv and prevent the transmission in the population . \n with 2.4 millions of people living with hiv , india carries the largest burden of hiv in asia and is the third country of the world in terms of hiv infected people . except for some northern states with high rates of injection drug use in the population , \n preventive measures of the government of india for fighting against the spread of hiv have been based on the assumption that the primary drivers of the epidemic are high risk groups , commercial sex workers and men who have sex with men , who transmit the virus to a male bridge population . \n this bridge population , mainly migrants and truckers , extend the transmission to their female sexual partner and from them to their children . \n preventive interventions focused on high risk groups have attained impressive results reducing the incidence of hiv . \n however , new data are suggesting that the hiv epidemic in india is evolving into a more generalized distribution in the population . in order to keep the current decline of hiv incidence in india \n , we need a better understanding of the mechanisms of transmission and risk factors associated with hiv in the general population . \n although it is estimated that 67% of hiv infected people in india are rural residents , risk factors associated with hiv infection in rural areas are not well known because most of the studies on hiv in india have been performed by institutions located in urban areas and there has been an underrepresentation of the rural population in previous epidemiological investigations . \n hiv infected patients who do not know to be infected consult health workers because of their medical problems . \n this is an optimal situation for performing a rapid hiv test and , if positive , for giving a proper counseling to the patient in order to prevent hiv transmission to others . \n the aim of this study is to investigate socio - demographic risk factors associated with hiv infection in a population of patients who were tested for hiv in a rural area of india . \n the hospital is situated in a rural area of anantapur district in andhra pradesh , which is the state with highest burden of hiv in india . \n patients do not pay for medical consultations and the cost of medicines is partially waived to people belonging to scheduled castes ( sc ) and scheduled tribes ( st ) . sc community is the lowest caste in the traditional hindu caste hierarchy and , therefore , suffers social and economic exclusion and disadvantage . \n st community is generally geographically isolated with limited economic and social contact with the rest of the population . \n both sc and st communities have significant higher levels of poverty than other non - scheduled communities . other backward castes ( obc ) are a collection of intermediate castes that were considered low in the traditional caste hierarchy , but above sc . \n other castes ( oc ) , also called general class or forward castes , were considered above previous mentioned castes in the traditional hindu hierarchy and do not qualify for any of the current positive discrimination schemes operated by the government of india . between august 2 2007 and december 31 2010 , patients aged above 15 years who attended the outpatient clinics of the hospital and were tested for hiv infection as part of their routine care were counseled before and after the test and socio - demographic details were systematically collected . following who recommendations for diagnosing hiv infection , \n if the test was reactive , two other hiv assays were performed for confirmation of hiv infection . \n logistic regression was used for the multivariable analysis of factors associated with having hiv infection using stata statistical software ( stata corporation , rel . \n several interactions were found between gender and communities in the initial logistic regression model so the models were run separately by these variables . \n the study was approved by the ethical committee of the institutional review board of rural development trust . \n the study included 6406 patients who were tested for hiv during the period of the study . \n st and sc communities had lower level of education and higher proportion of agricultural workers than other communities . \n multivariable analysis of risk factors associated with hiv infection separated by gender and community is presented in table 2 . as a predictor of hiv infection , age was more important for males than for females . \n it was observed higher odds ratios in people aged 25 to 45 years in males from all communities . \n working in a field not related to agriculture was significantly related to having hiv in sc and in males from st . in general , people with lower levels of education had higher odds ratios for hiv infection . \n being single was a protective factor for having hiv infection in all communities except in males from oc , although this was not statistically significant . by far , the most important factor associated with hiv infection in women was being a widow . in all cases , \n compared to non - widowed women , odds ratios for hiv infection of widows aged 15 - 25 years , 25 - 35 years , 35 - 45 years and above 45 years were 7.09 ( 95% confidence interval , 2.40 - 20.94 ) , 6.60 ( 95% confidence interval , 3.66 - 11.91 ) , 6.62 ( 95% confidence interval , 3.82 - 11.47 ) and 2.03 ( 95% confidence interval , 1.07 - 3.86 ) respectively in multivariable logistic regression models adjusted by community , occupation and education . \n our results show that widows who seek medical advice in a rural area with high hiv prevalence have a high risk of being hiv infected and the risk is inversely related to the age of the widow . \n female widowhood has been recognized as one of the most important risk factors for hiv infection in india in at least two previous population - based studies . \n the most important route of hiv transmission in india is through sexual contacts and more than 90% of infected women acquire the infection from their husbands . \n it has been observed that hiv is an important cause of death among young men in indian states with higher prevalence of hiv . \n the reduction of the hiv prevalence in these states was followed by a reduction of all - cause mortality in men aged 25 - 34 years . \n since husbands acquire hiv earlier , they are likely to die before their wives , even if both members of the couple are infected . in many cases , \n these hiv positive widows are left in deplorable situations due to illiteracy and lack of emotional and economical support . \n it has been observed that these poor conditions induce them to engage in sexual activity in exchange for emotional and financial help and , therefore , continuing the spread of the disease . \n specific programs focused on hiv screening and providing economical and psychological support of hiv positive widows are urgently needed in india . as seen in other cross sectional studies , \n hiv infection was more common in young adults in both sexes but age was more important for men than for women . \n people from sc and males from st who worked in the agriculture sector had lower risk of having a positive hiv test , perhaps because they are less likely to have high risk sexual contacts than men whose job involves higher regular mobility . \n previous studies have shown an association between lower education level and hiv infection . however , in our study the highest risk for hiv infection was observed in those who only completed primary education . in general , these patients abandoned the school for working . \n new studies on the sexual behavior , sexual vulnerability and migration patterns in this group may clarify this finding . \n hiv test was requested when the treating clinician suspected that the patient could be hiv infected . \n this explains the high hiv prevalence found in our study , which should not extrapolated to the general population . \n population based well designed studies are needed to confirm our findings , although these types of studies are expensive and difficult to perform in rural areas . \n moreover , we do not have information about the hiv status of the husbands of the hiv infected widows \n . we can not know whether these widows acquired hiv from their husbands or after their husbands death . in conclusion , \n the findings of this study indicate the complexity of the hiv epidemic in india . there were important differences in hiv associated risk factors between men and women and between the different indian communities . \n young widows who seek medical advice in rural areas of india with high prevalence of hiv have high risk of being hiv infected . \n we also found that lower education levels and working in a field not related to agriculture were factors associated with higher risk of hiv infection in this rural setting . \n the results of this study can help to design health programs aimed to achieve early diagnosis of hiv in rural health facilities of indian states with high hiv prevalence .", "role": "user" }, { "content": "despite the fact that two thirds of hiv infected people in india are rural residents , risk factors associated with hiv infection in rural areas are not well known . \n in this study we have collected socio - demographic data of 6406 patients who were tested for hiv infection in a rural hospital of india and we have investigated risk factors associated with hiv . in women the most important risk factor was being a widow and the risk was higher in younger than in older widows . \n other variables found to be associated with hiv infection were age between 25 and 45 years in men , low education level ( especially those who only completed primary education ) and working in a field not related to agriculture in scheduled castes and men from scheduled tribes . \n the results of this study express the need for hiv screening of widows who live in rural areas of indian states with high hiv prevalence .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: reaching maximum possible knee range of motion ( rom ) and attaining certain functional \n milestones remain the mainstay of rehabilitation following total knee arthroplasty ( tka ) . \n rom constitutes one of the most important outcomes following tka since patients with less \n than 105 knee rom have difficulty going up and down the stairs or getting out of a low \n chair1 . \n restricted postoperative knee \n flexion is one of the most frequent postoperative complications and is an indicator of \n patient dissatisfaction2 . \n after salter et al.3 demonstrated the \n beneficial effects of continuous passive motion ( cpm ) on articular cartilage defect healing \n in rabbits , various studies have investigated the effectiveness of cpm . despite \n controversies it has been regarded as a standard postoperative management tool , since cpm \n offers short - term benefits4 , 5 \n postel et al . suggested the comparison of alternative intermittent mobilization techniques \n with cpm6 ; however , few studies have \n addressed this issue . \n chow et al . have assessed the effects of active , passive and \n proprioceptive neuromuscular facilitation ( pnf ) stretching for patients with tka on rom in \n the early postoperative period7 , but the \n long term effectiveness or benefits of mobilization techniques on functional parameters has \n not been investigated . \n pnf exercises involving agonist and antagonist muscles are designed to promote the \n neuromuscular responses of the proprioceptors and are frequently used in the clinics to \n relieve pain and increase rom for various ailments . \n it is an attractive method for \n increasing strength and proprioception in elderly individuals8 ; and may have additional benefits in addition to increasing rom . in \n this study , \n the long term functional effectiveness of pnf was investigated from various \n aspects with a special emphasis on the functional point of view . \n thirty subjects who underwent tka in the department of orthopaedic surgery , marmara \n university for a diagnosis of osteoarthritis were included in this study . \n patients with \n infection of the affected knee , neuromuscular problems , psychiatric disorders or cardiac \n problems were excluded . \n after surgery patients were randomly assigned to either pnf ( group \n 1 ) or cpm ( group 2 ) treatment groups . patients were treated everyday during their hospital \n stay , 3 times / week after discharge for 2 months , 1/week in the following 2 months , and \n performed home exercises in the remaining days . \n in addition to the standard tka rehabilitation program9 including pain control , knee mobilization , exercises , transfer , \n mobility , the pnf group received pnf therapy and the cpm group received cpm therapy lasting \n 1 hour similar to the intervention of denis et al10 . \n after detailed instruction of the procedure , patients in the pnf group were placed supine \n and were asked to follow the exercises with visual feedback . \n they performed 3 sets of 5 \n repetitions of the rhythmic initiation technique11 starting from the first postoperative day . after a patient became \n competent in performing in exercises in both directions , leg patterns in the sitting \n position were commenced . \n a combination of isotonics ( described by gregg johnson and vicky \n saliba)11 and 3 sets of 5 repetitions \n of the rhythmic stabilisation technique were performed . \n each contraction was held for 6 \n seconds with alternation between the agonist and antagonist muscles12 . for the cpm group after 5 minutes warm - up , rom was set as tolerated by the patient . \n the cpm \n protocol was started with 0 to the maximum tolerated flexion angle , depending on the \n tolerance of the patient . \n participants were instructed not to interfere with the movement of \n the cpm device . for each participant , \n anthropometric , personal , and clinical characteristics were recorded , \n including gender , age , weight , height , social status , comorbid conditions , previous disease \n or surgeries , and time from the onset of symptoms . \n its center of \n rotation was placed in line with the center of the knee , the fixed arm was aligned with the \n greater trochanter , and the mobile arm aligned with the lateral malleolus . \n measurements were \n recorded with respect to full extension being 0 degree with positive numbers indicating a \n more flexed position and negative numbers indicating hyperextension . \n the criterion validity \n and the intra- and inter - rater reliabilities of data obtained with the goniometer have been \n demonstrated to be high13 . \n in addition to \n the baseline values , we noted the days to reach rom benchmarks of 45 , 60 , 90 and 100 degrees \n of flexion ( active and passive ) , and extension deficits of 20 and 5 degrees . \n pain scores were measured using a numeric pain rating scale ( nprs ) similar to chow et al . , \n with 0 indicating no pain and 10 indicating the worst imaginable pain7 . the patient was asked to answer the following question : \n how intense is the pain in your knee now ? the patients selected the number that best \n reflected the intensity of the pain . \n knee \n circumference was measured at the center of patella and noted at the ends of weeks 1 , 2 , 8 \n and 167 . \n the days to reach functional \n benchmarks such as : pain free use of a walker , double and single canadian use and walking \n 100 meters without using an aid were recorded , and assessments using the beck depression \n scale at baseline and at the end of the study period were also performed . \n four months after the surgery , isokinetic torque and isometric strength measurements were \n performed using a cybex 350 isokinetic dynamometer . the bilateral quadriceps and \n hamstring \n muscle strengths were measured at 4 months after surgery ; our time frame was similar to \n lauermann et al14 . \n patients were seated \n on the dynamometer chair ( cybex 350 ) with a trunk - thigh angle of 90. body , pelvis and \n thighs were secured with straps . \n ( 1 ) for the isometric strength measurement , the patients were asked to contract the \n quadriceps and hamstring muscle as forcefully as possible for 5 seconds separated by 20 \n seconds of rest for 4 times . \n muscle strength was measured isometrically at 30 and 60. the \n highest mvc torque from four trials was evaluated . \n ( 2 ) isokinetic concentric peak torque was \n evaluated at an angular velocity of 60/s , for 4 times separated by 20 seconds of rest . \n the \n peak torque from each of four consecutive trials was used in the analysis . \n the study was reviewed and approved by the ethical committee of marmara university and the \n patients provided informed consent . \n there were no significant differences between the two groups in terms of baseline \n demographic data and clinical findings ( table 1 , \n ptable 1.demographic data of the patients recruited for the study ( n=30)group 1 ( n=15)group 2 ( n=15)female / male14/112/3mean age ( sd ) ( years)68.67 ( 7.27)68.07 ( 6.89)range : 5375range : 5876mean bmi ( sd)28.87 ( 3.74)31.13 ( 5.18)range : 2337range : 2140side of surgery left / right5/108/7baseline active flexion ( sd ) ( degrees)38 ( 12.93)47 ( 14.12)baseline passive flexion ( sd ) ( degrees)46 ( 13.4)54 ( 13.56)baseline nprs ( sd)6.07 ( 1.28)7 ( 1.07)baseline beck score ( sd)16.4 ( 6.7)13.4 ( 3.14)baseline knee circumference ( sd ) ( cm)43.74 ( 2.15)44.6 ( 2.13)bmi : body mass index , nprs : numeric pain rating scale0.05 ) . mean length of stay ( los ) of the patients was 14.172.46 days , and it \n was similar in the two treatment groups ( p=0.54 ) . the numbers of patients who could gain 90 \n degrees of flexion at discharge were the same in both groups ; 4 patients in each group were \n able to attain this goal ( p>0.05 ) . \n however , when the patients who could gain 90 degrees \n knee flexion earlier were compared with those who could not , their bmi was found to be \n statistically significantly less ( p=0.03 ) . \n bmi : body mass index , nprs : numeric pain rating scale days to reach rom benchmarks were similar in the two groups ( p>0.05 ) , except for that of \n 90 degrees of active flexion . \n the pnf group reached the 90 degree benchmark in 16.677.06 \n days , whereas the cpm group reached it in 23.739.26 days ( p=0.04 ) . \n days to reach important \n rom benchmarks are summarized in table \n 2table 2.days to reach important rom benchmarksrom benchmarkgroup 1 ( pnf)(degrees)group 2 ( cpm)(degrees)active flexionbaseline3812.934714.12days to reach 45 degrees4.331.633.81.97days to reach 60 degress8.202.869.533.48days to reach 90 degrees16.677.06 * 23.739.26*passive flexionbaseline4613.454.6713.56days to reach 45 degrees3.930.884.130.83days to reach 60 degress5.931.536.81.26days to reach 90 degrees14.64.4717.534.91extensiondays to reach 20 degrees1.270.82.272.12days to reach 5 degrees16.69.4920.810*p<0.05 , statistically significant . in the pnf group , \n 12 patients were able to reach 100 degrees , and 3 did not ; \n in the cpm group , 11 patients were able to reach 100 degrees , and 4 did not ( p>0.05 ) . \n * p<0.05 , statistically significant in terms of pain , nprs at the 8th week was slightly higher in the pnf group ; the mean nprs \n of pnf patients was 1.071.58 and that of the cpm group was 0.670.26 ( p=0.025 ) . with the exception of walking with a walker , days to reach functional benchmarks \n were \n statistically significantly earlier in patients of the pnf group ( p=0.01 ) ( table 3table 3.days to reach functional benchmarksfunctional benchmarksgroup 1 ( pnf)(days)group 2 ( cpm)(days)walker3.930.594.40.63double canadian13.072.94 * 16.533.4*single canadian27.23.57 * 41.674.88*aid free walking45.336.94 * 59.535.9 * * p<0.05 , statistically significant ) . \n * p<0.05 , statistically significant the beck depression scores , circumferential measurements of the knee and isokinetic \n measurements were similar in the two groups ( p>0.05 ) . \n in addition to rom improvements , the patients treated with pnf showed earlier functional \n gains after tka . \n these functional accomplishments were more pronounced in the pnf group \n despite similar isokinetic torque measurements . also , earlier recovery was demonstrated by \n patients with lower bmi values independent of the treatment . \n our findings are in \n agreement with jarvenpaa et al.16 , who \n has demonstrated that obesity may delay the recovery from tka . despite controversies ; cpm remains widely used in rehabilitation following tka surgery , to \n accelerate recovery . \n various protocols for cpm have been described in the literature ; \n however , using cpm for long hours is not practical in clinical practice . in the present \n study \n , cpm was administered following denis et al.10 , and similar to their findings , los was similar in the two \n treatment groups . \n cpm has been argued against since it is a passive mobilization and does not encourage \n patients to actively participate in their rehabilitation17 . in a study involving 132 subjects with knee osteoarthritis , it was \n demonstrated that pnf techniques were more effective than static stretching18 . \n have demonstrated that \n pnf is as equally efficious for flexibility conditioning as compared to passive stretching , \n and they suggested it should be used in preference to passive stretching to preserve dynamic \n joint stability19 . \n studies have noted out the close relationship between rom , function , and quality of life in \n older patients . \n have examined the effects of an 8 week active - assisted \n stretching program on functionality , mobility , power and rom in elderly residents of a \n residential retirement community and concluded that this type of exercise is beneficial for \n the elderly who have insufficient physical reserves to perform higher - intensity \n exercises20 . \n pnf has been used with \n caution for the elderly since it involves close - to - maximal loads and isometric contractions ; \n however , pereira et al . \n have studied the effect of pnf on the diastolic and systolic blood \n pressures of the elderly and concluded that this technique is safe8 . \n the pnf group was able to reach functional benchmarks earlier than the cpm group ; however , \n isokinetic measurements were similar in the two groups . \n a 6 week pnf stretching program for \n 49 volunteers has been demonstrated that it increased rom and decreased tendon stiffness , \n despite the absence of change in passive resistive torque21 . \n similarly konrad et al . and higgs et al . reported that a 4 week \n quadriceps flexibility training program improved knee rom without altering muscle isokinetic \n strength characteristics21 , 22 . according to these findings , elderly patients benefit \n from active - assisted stretching , which is a form of pnf , in terms of both rom and \n performance measures . \n thus pnf improves the functional performance of elderly patients with \n insufficient reserves to perform higher - intensity exercises20 . \n gonzalez - rave have compared passive versus proprioceptive \n stretching using elderly subjects and concluded that the rom gain was similar for both \n techniques however , they did nt perform functional measures23 . \n asserted that open chain mono - articular testing may not reflect functional \n activities of living14 . in agreement with \n this , the results of the present study demonstrate increased rom and accelerated functional \n recovery without change in peak isokinetic torque . \n the short term effects of neuromuscular joint facilitation treatment , which integrates a \n facilitation component of pnf , have previously been demonstrated . \n this treatment have led to \n increased walking velocity , step length and decreased cadence as well as decreased pain in \n patients with osteoarthritis of the knee24 . \n the advantage of our study is that patients were followed for a \n long period of time , they were evaluated from the various standing points of rom , functional \n gains , isokinetic measurements and psychological variables . \n the number of subjects included \n in this study were limited by the demands of pnf and the workload of the physiotherapist . \n additionally , we were unable to include a control group since cpm is widely known in our \n country and was requested by the patients . \n the present study is the first study to demonstrate the beneficial effects of pnf from a \n functional point of view in a prospective long term setting . \n further studies of the effects \n of pnf using larger patient groups may help to optimize the postoperative rehabilitation of \n the tka patients .", "role": "user" }, { "content": "[ purpose ] the aim of this longitudinal study was to examine the long term functional \n effectiveness of proprioceptive neuromuscular facilitation ( pnf ) after total knee \n arthroplasty . [ subjects and methods ] we included 30 patients and they were randomly \n assigned to two groups . \n in addition to the standard rehabilitation program the pnf group \n received proprioceptive neuromuscular facilitation therapy and the cpm group received \n continuous passive motion therapy . \n the outcome measures included range of motion using a \n goniometer , pain scores using a numeric pain rating scale , days to reach functional \n benchmarks , the beck depression scale and isokinetic torque and isometric strength \n measurements . \n [ results ] there were no significant differences between the two groups in \n terms of baseline demographic data , clinical findings and length of stay . \n days to reach \n range of motion benchmarks were similar in the two groups . \n pain at the 8th week was \n slightly higher in the pnf group . with the exception of walking with a walker , days to \n reach functional benchmarks \n were statistically significantly fewer in patients of the pnf \n group despite similar isokinetic measurements . \n administration of pnf resulted in earlier \n functional gains in patients after total knee arthroplasty . \n these functional \n accomplishments were more pronounced in the pnf group despite it having isokinetic torque \n measurements similar to those of the cpm group . \n [ conclusion ] pnf techniques can positively \n affect functional outcomes over the long term .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: sct is a carrier state of sickle cell disease with one copy of normal beta globulin gene and one copy of sickle variant gene - producing heterozygous hbas ( 1 ) . \n sct is estimated to have prevalence of 300 million worldwide , mostly concentrated in africa , middle east , and mediterranean region ( 2 ) . in the united states , \n although sct is considered a benign condition with no increased mortality in individuals ( 4 ) , it has been associated with several complications ( 2 ) . \n a number of abnormalities have been reported in sct , including renal medullary carcinoma , papillary necrosis , thromboembolic events , and hyposthenuria ( 5 , 6 ) . \n renal complications of sickle cell trait renal papillary necrosis is frequently associated with sickle cell disease , but it is not uncommon in sct as well . \n it has been usually associated with diabetes , analgesic nephropathy , chronic pyelonephritis , and renal tuberculosis . \n renal papillary necrosis is usually precipitated by some factors such as intense exercise , dehydration , and taking nsaids . in our patient , \n to date no comparative data exist with regard to the distribution and frequency of occurrence of renal papillary necrosis among persons with sct , hemoglobin sc , and thalassemias ( 5 , 9 ) ; however , there have been case reports on hemoglobin sc ( 9 , 10 ) but none to date on thalassemia unless associated with a sickling hemoglobin ( s ) ( 11 ) . \n papillary necrosis results from obstruction of the vasa recta producing ischemia and micro infarction of medullary region of the kidneys ( 12 ) . \n polymerization of the rbcs in the vasa recta of the renal medulla is the main trigger for renal papillary necrosis . \n numerous factors are involved in initiating the sickling of rbcs including hypoxia , hypertonicity , and acidosis ( 13 ) . \n once sickling starts it leads to increased blood viscosity and decreased blood flow to medulla , which ultimately results in micro infarction of vasa recta causing papillary necrosis . \n the extent of polymerization of rbcs depends upon the concentration of hbs ( 11 ) . \n the clinical presentation varies from painless gross hematuria to acute condition with pain , fever , and obstructive urinary symptoms ( 14 , 15 ) . \n it usually manifests in the age group between 3040 years and there seems to be no sex predominance ( 16 ) . \n any patient with sct , who presents with hematuria , needs a thorough clinical investigation especially in young patients because renal medullary carcinoma can also presents in a similar fashion . \n renal medullary carcinoma is a rare , aggressive fatal tumor , which presents in young patients with sct ( 6 ) . because renal medullary cancer is very rare \n , there is no epidemiological data available , but according to one report in 2003 , there are 55 cases of renal medullary cancer that were reported in literature ( 6 ) . \n renal papillary necrosis should be in the differential diagnosis in any sct patient who comes in with hematuria . \n intravenous pyelogram has been traditionally used for establishing the diagnosis but it is now largely replaced with ct urography because of its high sensitivity and specificity ( 17 , 18 ) . \n ct urography is also superior to other imaging studies because of its ability to diagnose papillary necrosis in early stages ( 19 ) but more studies are required for comparison between ivp , ultrasound , and ct urography . in all reported cases , there was no biopsy performed and renal angiogram is not required for diagnosis . in sct , \n the most common findings on urinalysis of patients with sickle cell disease is proteinuria as this proteinuria occurs in 2030% of patients with sickle cell disease . \n additionally , there is decreased concentrating ability with urine osmolarity of 400450 mosm / kg under water deprivation ( 12 ) . \n although there are no large studies done to standardize the treatment of papillary necrosis secondary to sct , the underlying pathophysiology guides the treatment modalities . as mentioned earlier , papillary necrosis starts with sickling of rbcs , which is itself affected by factors like acidosis , hypertonicity , and hypoxia . \n treatment options that have been utilized are listed in the table 2 , ( 7 , 15 , 16 ) . \n initial management involves conservative measures , as most of the cases of hematuria are self - limiting . \n patient should be started on hypotonic fluids along with diuretics to increase the urine flow and reduce the tonicity in the medullary interstitial area . \n sodium bicarbonate is also used to alkalinize the urine , which reduces the acidosis , but whether it prevents further necrosis is uncertain . in some reports desmopressin ( \n increases clotting by dose - dependent increase in plasma factor viii , and vwf ) and epsilon - amino caproic acid ( inhibits fibrinolysis by inhibiting plasmin activity ) can be used to treat hematuria in resistant patients ( 7 , 2022 ) . \n if all the aforementioned measures fail , then invasive measures can be taken which involve renal artery embolization and nephrectomy . \n it should be considered in the differential diagnosis of gross hematuria , especially in sickle cell patients , because if it is not caught earlier it can lead to devastating complications . \n the authors have not received any funding or benefits from industry or elsewhere to conduct this study .", "role": "user" }, { "content": "we describe a case of renal papillary necrosis in a middle - aged female with sickle cell trait who presented with gross hematuria . \n we wish to highlight this case for several reasons . \n sickle cell trait is often viewed as a benign condition despite the fact that it is associated with significant morbidity such as renal papillary necrosis and renal medullary carcinoma . \n appropriate evaluation needs to be undertaken to promptly diagnose renal papillary necrosis and differentiate it from renal medullary carcinoma as this can result in deadly consequences for patients . \n ct urography has emerged as a diagnostic study to evaluate hematuria in such patients . \n we review the pathophysiology , diagnosis , and management of renal papillary necrosis in patients with sickle cell trait .", "role": "assistant" } ]