Datasets:

tsharish

/

pubmed-summarization-1k

like 0

[ { "content": "You are a medical writer. Summarize the following article: congenital infection by vertical transmission of tb is described by transplacental transmission through umbilical veins to the foetal liver and lungs ; or aspiration and swallowing of infected amniotic fluid in utero or intrapartum causing primary infection of foetal lungs and gut . \n transplacental infection occurs late in pregnancy and aspiration from amniotic fluid occurs in the perinatal period . \n the diagnostic criteria used for congenital tuberculosis were as described by beitzke in 19353 and revised by cantwell et al in 19944 . \n cantwell et al proposed diagnosis of congenital tuberculosis in the presence of proven tuberculous disease and at least one of the following ; ( i ) lesions in the newborn baby during the first week of life ; ( ii ) a primary hepatic complex or caseating hepatic granulomata ; ( iii ) tuberculous infection of the placenta or the maternal genital tract ; and ( iv ) exclusion of the possibility of postnatal transmission by investigation of contacts , including hospital staff . in newborns diagnosed of tb , a horizontal spread in the postpartum period by droplet or ingestion from mother or undiagnosed family member is most commonly suggested . \n infertility , poor reproductive performance , recurrent abortions , stillbirths , premature rupture of membranes and preterm labour are known effects of tuberculosis in pregnancy . \n the foetus may have intrauterine growth retardation , low birth weight , and has increased risk of mortality . the median age of presentation of congenital tb is 24 days ( range , 1 to 84 days)4 . \n clinical manifestations are non specific and include poor feeding ( 100% ) , fever ( 100% ) , irritability ( 100% ) , failure to thrive ( 100% ) , cough ( 88.9% ) , and respiratory distress ( 66.7% ) . \n examination reveals hepatosplenomegaly ( 100% ) , splenomegaly ( 77.8% ) , and abdominal distension ( 77.8%)6 . lymphadenopathy ( 38% ) lethargy ( 21% ) , meningitis , septicaemia , unresolving or recurrent pneumonia , disseminated intravascular coagulation , jaundice , ascitis , otitis media with or without mastoiditis ( 21% ) , parotitis , osteomyelitis , paravertebral abscess , cold abscess , and papular or pustular skin lesions ( 14% ) are other known features7 . \n apnoea , vomiting , cyanosis , jaundice , seizures and petechiae have been reported in less than 10 per cent of cases8 . \n conventional methods : diagnosis of tb in the newborn depends upon detailed history of maternal infection and high index of suspicion . \n antenatal history by gynaecologists and trained nurses is beneficial in early diagnosis and determining neonatal outcome . \n morphological and histological examination of placenta in suspected cases at the time of delivery is helpful . \n clinical manifestations in neonates masquerade sepsis , prematurity , viral infections or other acute or chronic intrauterine infections and hence diagnosis is difficult and may be missed . \n therefore , in the setting of poor response to antibiotics and supportive therapy , and negative results of microbiological evaluation and serological tests for acute and chronic intrauterine infections , tb should be suspected . \n specimens from the neonate suitable for microscopy and culture include gastric aspirates , sputum ( induced ) , tracheal aspirates ( if mechanically ventilated ) , skin lesions , ear discharge , ascitic fluid , cerebrospinal fluid ( csf ) and , pleural fluid ( if present ) for acid fast bacilli and cultured on standard egg based media for 12 wk)8910 . \n bronchoalveolar lavage ( bal ) is an important investigation and detection of mycobacterium tuberculosis dna in bal fluid by polymerase chain reaction ( pcr ) is diagnostic in newborn11 . \n postmortem biopsies ( e.g. liver , lung , nodes , and skin lesions ) can also be done . \n conventional light microscopy ( ziehl - neelsen or kinyoun stain ) or fluorescence microscopy ( auramine stain ) are used for detection of mycobacterium . \n chest radiography and computed tomography may show the presence of scattered infiltrates , bronchopneumonia , consolidation or periportal hypodensity which are non specific . \n mantoux test if positive , is supportive evidence , but negative results do not rule out disease . \n multiple and repeated investigations may be done in view of high suspicion5 \n newer methods : slow and tedious conventional methods have been recently replaced by quicker methods . \n the who has accredited led ( light emitting diode ) flourescence microscopy and liquid based mycobacteria growth indicator tube ( mgit ) in developed countries for fast results12 . \n indirect methods include rapid interferon gamma assays , quantiferon - tb gold assay and t - spot using antigens esat-6 , cfp-10 and tb7 but have shown inconsistent results in newborns1314 . \n large trials using gene xpert ( real time pcr ) in children have been useful for rapid diagnosis in communities with a high burden of tb including multiple drug resistant ( mdr ) tuberculosis15 . \n other mycobacteriophage - based assays like fast plaque tb - rif , molecular line probe assays ( lpas ) such as genotype mtbdr plus assay and the inno - lipa rif tb assay are costly and with only a few studies in newborns1617 . \n when a woman suffering from tuberculosis gives birth , the aim is to ensure tb free survival of her newborn infant . \n it involves diagnosing active tubercular lesion including congenital tuberculosis , and treatment of the neonate or prevention of transmission of tubercular infection to the neonate from the mother . \n there is no uniformity as is evident from the recommendations of the eminent societies of different countries across the globe ( tables i and ii ) . \n comparison of recommendations on prophylaxis , diagnosis and treatment guidelines by different groups comparison of recommendations on isolation , breast - feeding and vaccination by different groups ( a ) maternal disease and therapy- extrapulmonary , miliary and meningeal tb in mother are high risk factors for congenital tb in neonates27 . \n vertical transmission from mothers with tubercular pleural effusion or generalized adenopathy does not occur5 . however , there is a lack of scientific literature regarding increased risk of congenital tb if mothers have resistant tb or concurrent hiv infection . \n mothers who have completed antitubercular treatment ( att ) before delivery or have received att for at least two weeks duration before delivery are less likely to transmit the disease to the newborn as compared to untreated mothers . \n antitubercular drugs are found to be safe in pregnancy except streptomycin in the first trimester . \n no literature is available regarding the safety of second line antitubercular drugs used for resistant tb in pregnancy28 . \n ( b ) prophylaxis - the decision to start isoniazid ( inh ) prophylaxis to the neonate depends on a number of factors including the history of detection and duration of maternal disease ( before or during or after pregnancy ) , type of tuberculosis ( pulmonary or extrapulmonary ) , and maternal compliance of treatment ( regular or irregular ) . \n inh prophylaxis is recommended in the neonate if the mother has received treatment for < 2 wk , or those who are on therapy for > 2 wk but are sputum smear positive . in all other situations \n american academy of pediatrics ( aap ) recommends inh prophylaxis to all neonates of mothers who are diagnosed with tuberculosis in the postpartum period and/or after the commencement of breastfeeding has started as these newborns are considered potentially infected20 . \n duration of prophylaxis is guided by skin testing by mantoux test at three months in new zealand22 and by who21 , merck manual23 and aap20 or at 6 months in malaysia and south africa2425 . if mantoux test is negative , prophylaxis is stopped . however , \n if mantoux test is positive and evidence of disease is found , att is started . \n if there is no evidence of disease in mantoux positive neonates , then inh may be given for six months2022 or 9 months23 . \n iap does not comment on maternal treatment or mantoux test and suggests isoniazid therapy to all newborns for at least 6 - 9 months or a minimum for three months until mother is culture negative18 . \n there is also a variation in the dose recommended for prophylaxis with 5 mg / kg24 , 15 mg / kg25 , and 10 mg / kg2023 . \n ( c ) nutrition and breastfeeding - support for breastfeeding is crucial for the survival of the newborn . \n human milk in addition to providing nutrition has immunological benefits and all efforts to continue breastfeeding in newborns with mothers having tuberculosis should be made . in case of maternal sickness or if mother is smear positive at the time of delivery or mothers with mdr tb , when breastfeeding may not be possible , expressed breast milk feeding is an alternative , with personal hygiene . \n aap recommends continued feeding with expressed milk in mothers with pulmonary tb who are contagious , untreated or treated ( < 3 wk ) with isolation20 . \n who recommends feeding under all circumstances , however , close contact with the baby should be reduced21 . \n malaysian thoracic society recommends that if mother is contagious , efforts should be made to use expressed maternal milk for feeding24 . \n there is a paucity of scientific literature on the increased risk of neonatal transmission by breastfeeding in the presence of factors such as infection with resistant organisms ( multiple or extensive drug resistance or co - infection with human immunodeficiency virus . \n first line att is secreted in milk in small quantity and causes no adverse effect on the child29 . \n isolation is recommended when mother is sick , non adherent to therapy or has resistant tb182021 or received att four less than 2 wk1924 or three weeks before starting att20 . \n barrier nursing using face mask ( 20 - 22 ) and appropriate cough hygiene18 has been advised for the mothers who are breastfeeding . \n hand washing , disinfecting nasal secretions and baby wipes are recommended by aap20 . ( a ) mantoux test - utility of mantoux test in neonates is poor due to low reactogenicity and poor helper t cell responses . in a study by hageman \n et al30 only two of the 14 infants with congenital tb had positive tuberculin tests . \n current recommendations support use of mantoux test after three months192022 or six months24 . exact cut - off ( > 5 , 5 - 10 and > 10 mm ) and strength of purified protein derivative ( ppd ) ( 1 or 5 or 10 tu1831 ) in newborns . \n iap in the recent recommendations has decreased the strength of ppd for skin testing to 2 tu32 . \n treatment includes isoniazid , rifampicin , ethambutol and kanamycin or amikacin for the first two months followed by isoniazid and rifampicin for 6 - 12 months23 or similar to miliary tuberculosis25 or isoniazid , rifampicin and pyrazinamide along with streptomycin and kanamycin for 9 to 12 months20 . \n ( c ) follow up - neonates diagnosed and treated for congenital tuberculosis should be monitored while on therapy21 , but no details regarding the timing or the modes of monitoring exist . \n american academy of pedaitrics suggested that infants receiving prophylaxis should have clinical surveillance20 . in a study \n periodic x - ray and mantoux test have been advised at 6 , 12 and 24 wk28 . \n bacillus calmettee guerin ( bcg ) vaccination protects against the dissemination of tuberculosis and severe disease . in neonates with congenital tuberculosis \n bcg vaccine ( timing not specified ) is recommended1819 . who recommends bcg vaccine until completion of inh therapy21 . \n aap has advised bcg vaccine after completion of chemoprophylaxis at six months or at birth along with isoniazid if follow up can not be ensured20 . \n the new zealand guidelines22 recommend bcg after three months of prophylaxis while in south africa saspid recommends it after six months of prophylaxis . \n mts24 recommends bcg vaccination after ruling out congenital tb and again after the inh prophylaxis if scar is absent . \n indian academy of pedaitrics advises bcg vaccination at birth to all neonates after excluding congenital tuberculosis even if chemoprophylaxis is planned32 . \n hence it is evident that there is no consensus on the number , timing and interpretation of bcg vaccination in infants born to women with tb . in countries with significant number of tb patients in the community children \n are vulnerable to get tb infection early in life : therefore , bcg vaccination as early as possible preferably after stopping of inh prophylaxis should be followed . \n there is an urgent need to conduct more studies to evaluate immunogenicity of bcg vaccine in infants receiving inh prophylaxis . \n ( a ) maternal disease and therapy- extrapulmonary , miliary and meningeal tb in mother are high risk factors for congenital tb in neonates27 . vertical transmission from mothers with tubercular pleural effusion or generalized adenopathy does not occur5 . however , there is a lack of scientific literature regarding increased risk of congenital tb if mothers have resistant tb or concurrent hiv infection . \n mothers who have completed antitubercular treatment ( att ) before delivery or have received att for at least two weeks duration before delivery are less likely to transmit the disease to the newborn as compared to untreated mothers . \n antitubercular drugs are found to be safe in pregnancy except streptomycin in the first trimester . \n no literature is available regarding the safety of second line antitubercular drugs used for resistant tb in pregnancy28 . \n ( b ) prophylaxis - the decision to start isoniazid ( inh ) prophylaxis to the neonate depends on a number of factors including the history of detection and duration of maternal disease ( before or during or after pregnancy ) , type of tuberculosis ( pulmonary or extrapulmonary ) , and maternal compliance of treatment ( regular or irregular ) . \n inh prophylaxis is recommended in the neonate if the mother has received treatment for < 2 wk , or those who are on therapy for > 2 wk but are sputum smear positive . in all other situations \n american academy of pediatrics ( aap ) recommends inh prophylaxis to all neonates of mothers who are diagnosed with tuberculosis in the postpartum period and/or after the commencement of breastfeeding has started as these newborns are considered potentially infected20 . \n duration of prophylaxis is guided by skin testing by mantoux test at three months in new zealand22 and by who21 , merck manual23 and aap20 or at 6 months in malaysia and south africa2425 . if mantoux test is negative , prophylaxis is stopped . however , \n if mantoux test is positive and evidence of disease is found , att is started . \n if there is no evidence of disease in mantoux positive neonates , then inh may be given for six months2022 or 9 months23 . \n iap does not comment on maternal treatment or mantoux test and suggests isoniazid therapy to all newborns for at least 6 - 9 months or a minimum for three months until mother is culture negative18 . \n there is also a variation in the dose recommended for prophylaxis with 5 mg / kg24 , 15 mg / kg25 , and 10 mg / kg2023 . \n ( c ) nutrition and breastfeeding - support for breastfeeding is crucial for the survival of the newborn . \n human milk in addition to providing nutrition has immunological benefits and all efforts to continue breastfeeding in newborns with mothers having tuberculosis should be made . in case of maternal sickness or if mother is smear positive at the time of delivery or mothers with mdr tb , when breastfeeding may not be possible , expressed breast milk feeding is an alternative , with personal hygiene . \n aap recommends continued feeding with expressed milk in mothers with pulmonary tb who are contagious , untreated or treated ( < 3 wk ) with isolation20 . \n who recommends feeding under all circumstances , however , close contact with the baby should be reduced21 . \n malaysian thoracic society recommends that if mother is contagious , efforts should be made to use expressed maternal milk for feeding24 . \n there is a paucity of scientific literature on the increased risk of neonatal transmission by breastfeeding in the presence of factors such as infection with resistant organisms ( multiple or extensive drug resistance or co - infection with human immunodeficiency virus . \n first line att is secreted in milk in small quantity and causes no adverse effect on the child29 . \n isolation is recommended when mother is sick , non adherent to therapy or has resistant tb182021 or received att four less than 2 wk1924 or three weeks before starting att20 . barrier nursing using face mask ( 20 - 22 ) and appropriate cough hygiene18 has been advised for the mothers who are breastfeeding . \n hand washing , disinfecting nasal secretions and baby wipes are recommended by aap20 . ( a ) mantoux test - utility of mantoux test in neonates is poor due to low reactogenicity and poor helper t cell responses . in a study by hageman \n et al30 only two of the 14 infants with congenital tb had positive tuberculin tests . \n exact cut - off ( > 5 , 5 - 10 and > 10 mm ) and strength of purified protein derivative ( ppd ) ( 1 or 5 or 10 tu1831 ) in newborns . \n iap in the recent recommendations has decreased the strength of ppd for skin testing to 2 tu32 . \n treatment includes isoniazid , rifampicin , ethambutol and kanamycin or amikacin for the first two months followed by isoniazid and rifampicin for 6 - 12 months23 or similar to miliary tuberculosis25 or isoniazid , rifampicin and pyrazinamide along with streptomycin and kanamycin for 9 to 12 months20 . \n ( c ) follow up - neonates diagnosed and treated for congenital tuberculosis should be monitored while on therapy21 , but no details regarding the timing or the modes of monitoring exist . \n american academy of pedaitrics suggested that infants receiving prophylaxis should have clinical surveillance20 . in a study \n periodic x - ray and mantoux test have been advised at 6 , 12 and 24 wk28 . \n bacillus calmettee guerin ( bcg ) vaccination protects against the dissemination of tuberculosis and severe disease . in neonates with congenital tuberculosis \n bcg vaccine ( timing not specified ) is recommended1819 . who recommends bcg vaccine until completion of inh therapy21 . \n aap has advised bcg vaccine after completion of chemoprophylaxis at six months or at birth along with isoniazid if follow up can not be ensured20 . \n the new zealand guidelines22 recommend bcg after three months of prophylaxis while in south africa saspid recommends it after six months of prophylaxis . \n mts24 recommends bcg vaccination after ruling out congenital tb and again after the inh prophylaxis if scar is absent . \n indian academy of pedaitrics advises bcg vaccination at birth to all neonates after excluding congenital tuberculosis even if chemoprophylaxis is planned32 . \n hence it is evident that there is no consensus on the number , timing and interpretation of bcg vaccination in infants born to women with tb . in countries with significant number of tb patients in the community children \n are vulnerable to get tb infection early in life : therefore , bcg vaccination as early as possible preferably after stopping of inh prophylaxis should be followed . \n there is an urgent need to conduct more studies to evaluate immunogenicity of bcg vaccine in infants receiving inh prophylaxis . \n ( a ) maternal disease and therapy- extrapulmonary , miliary and meningeal tb in mother are high risk factors for congenital tb in neonates27 . vertical transmission from mothers with tubercular pleural effusion or generalized adenopathy does not occur5 . however , there is a lack of scientific literature regarding increased risk of congenital tb if mothers have resistant tb or concurrent hiv infection . \n mothers who have completed antitubercular treatment ( att ) before delivery or have received att for at least two weeks duration before delivery are less likely to transmit the disease to the newborn as compared to untreated mothers . \n antitubercular drugs are found to be safe in pregnancy except streptomycin in the first trimester . \n no literature is available regarding the safety of second line antitubercular drugs used for resistant tb in pregnancy28 . \n ( b ) prophylaxis - the decision to start isoniazid ( inh ) prophylaxis to the neonate depends on a number of factors including the history of detection and duration of maternal disease ( before or during or after pregnancy ) , type of tuberculosis ( pulmonary or extrapulmonary ) , and maternal compliance of treatment ( regular or irregular ) . \n inh prophylaxis is recommended in the neonate if the mother has received treatment for < 2 wk , or those who are on therapy for > 2 wk but are sputum smear positive . in all other situations \n american academy of pediatrics ( aap ) recommends inh prophylaxis to all neonates of mothers who are diagnosed with tuberculosis in the postpartum period and/or after the commencement of breastfeeding has started as these newborns are considered potentially infected20 . \n duration of prophylaxis is guided by skin testing by mantoux test at three months in new zealand22 and by who21 , merck manual23 and aap20 or at 6 months in malaysia and south africa2425 . if mantoux test is negative , prophylaxis is stopped . however , \n if mantoux test is positive and evidence of disease is found , att is started . \n if there is no evidence of disease in mantoux positive neonates , then inh may be given for six months2022 or 9 months23 . \n iap does not comment on maternal treatment or mantoux test and suggests isoniazid therapy to all newborns for at least 6 - 9 months or a minimum for three months until mother is culture negative18 . \n there is also a variation in the dose recommended for prophylaxis with 5 mg / kg24 , 15 mg / kg25 , and 10 mg / kg2023 . \n ( c ) nutrition and breastfeeding - support for breastfeeding is crucial for the survival of the newborn . \n human milk in addition to providing nutrition has immunological benefits and all efforts to continue breastfeeding in newborns with mothers having tuberculosis should be made . in case of maternal sickness or if mother is smear positive at the time of delivery or mothers with mdr tb , when breastfeeding may not be possible , expressed breast milk feeding is an alternative , with personal hygiene . \n aap recommends continued feeding with expressed milk in mothers with pulmonary tb who are contagious , untreated or treated ( < 3 wk ) with isolation20 . \n who recommends feeding under all circumstances , however , close contact with the baby should be reduced21 . \n malaysian thoracic society recommends that if mother is contagious , efforts should be made to use expressed maternal milk for feeding24 . \n there is a paucity of scientific literature on the increased risk of neonatal transmission by breastfeeding in the presence of factors such as infection with resistant organisms ( multiple or extensive drug resistance or co - infection with human immunodeficiency virus . \n first line att is secreted in milk in small quantity and causes no adverse effect on the child29 . \n isolation is recommended when mother is sick , non adherent to therapy or has resistant tb182021 or received att four less than 2 wk1924 or three weeks before starting att20 . barrier nursing using face mask ( 20 - 22 ) and appropriate cough hygiene18 has been advised for the mothers who are breastfeeding . \n ( a ) mantoux test - utility of mantoux test in neonates is poor due to low reactogenicity and poor helper t cell responses . in a study by hageman \n et al30 only two of the 14 infants with congenital tb had positive tuberculin tests . \n current recommendations support use of mantoux test after three months192022 or six months24 . exact cut - off ( > 5 , 5 - 10 and > 10 mm ) and strength of purified protein derivative ( ppd ) ( 1 or 5 or 10 tu1831 ) in newborns . \n iap in the recent recommendations has decreased the strength of ppd for skin testing to 2 tu32 . \n treatment includes isoniazid , rifampicin , ethambutol and kanamycin or amikacin for the first two months followed by isoniazid and rifampicin for 6 - 12 months23 or similar to miliary tuberculosis25 or isoniazid , rifampicin and pyrazinamide along with streptomycin and kanamycin for 9 to 12 months20 . \n ( c ) follow up - neonates diagnosed and treated for congenital tuberculosis should be monitored while on therapy21 , but no details regarding the timing or the modes of monitoring exist . \n american academy of pedaitrics suggested that infants receiving prophylaxis should have clinical surveillance20 . in a study \n periodic x - ray and mantoux test have been advised at 6 , 12 and 24 wk28 . \n bacillus calmettee guerin ( bcg ) vaccination protects against the dissemination of tuberculosis and severe disease . in neonates with congenital tuberculosis \n bcg vaccine ( timing not specified ) is recommended1819 . who recommends bcg vaccine until completion of inh therapy21 . \n aap has advised bcg vaccine after completion of chemoprophylaxis at six months or at birth along with isoniazid if follow up can not be ensured20 . \n the new zealand guidelines22 recommend bcg after three months of prophylaxis while in south africa saspid recommends it after six months of prophylaxis . \n mts24 recommends bcg vaccination after ruling out congenital tb and again after the inh prophylaxis if scar is absent . \n indian academy of pedaitrics advises bcg vaccination at birth to all neonates after excluding congenital tuberculosis even if chemoprophylaxis is planned32 . \n hence it is evident that there is no consensus on the number , timing and interpretation of bcg vaccination in infants born to women with tb . in countries with significant number of tb patients in the community children \n are vulnerable to get tb infection early in life : therefore , bcg vaccination as early as possible preferably after stopping of inh prophylaxis should be followed . \n there is an urgent need to conduct more studies to evaluate immunogenicity of bcg vaccine in infants receiving inh prophylaxis .", "role": "user" }, { "content": "tuberculosis ( tb ) is a global disease with increase in concern with growing morbidity and mortality after drug resistance and co - infection with hiv . \n mother to neonatal transmission of disease is well known . \n current recommendations regarding management of newborns of mothers with tuberculosis are variable in different countries and have large gaps in the knowledge and practices . \n we compare and summarize here current recommendations on management of infants born to mothers with tuberculosis . \n congenital tuberculosis is diagnosed by cantwell criteria and treatment includes three or four anti - tubercular drug regimen . \n prophylaxis with isoniazid ( 3 - 6 months ) is recommended in neonates born to mother with tb who are infectious . \n breastfeeding should be continued in these neonates and isolation is recommended only till mother is infectious , has multidrug resistant tuberculosis or non adherent to treatment . \n bcg vaccine is recommended at birth or after completion of prophylaxis ( 3 - 6 months ) in all neonates .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: for unruptured anterior circulation aneurysms , a superciliary keyhole approach using a supraorbital mini - craniotomy , rather than a pterional approach , is invariably limited due to the small cranial opening . \n notwithstanding , most anterior circulation aneurysms can still be clipped safely , rapidly , and less invasively using a superciliary approach based on appropriate indications and refined surgical techniques4,5,6,11,12,13,15,16 ) . \n such proper indications and contraindications , along with the detailed surgical technique and its limitations , are presented herein . \n this report is based on the author 's experience in more than 400 cases of a superciliary keyhole approach for unruptured aneurysms . \n the superciliary skin incision is made starting from the midpupillary line , and located within 1 cm of the supraorbital margin , measuring 3.5 cm in length ( fig . \n 1 ) . the underlying muscles are the frontalis , corrugator supercilii , and temporalis ( fig . \n the relevant nerves are the supraorbital nerve and the frontal branch of the facial nerve . according to a previous nerve conduction study by the current author10 ) , the location of the frontal branch of the facial nerve is normally between 1 and 3 cm above the supraorbital margin as follows : 1 ) between 2 and 3 cm in 52% of patients , 2 ) at 1.5 cm in 10% of patients , 3 ) at 1 cm in 12% of patients , and 4 ) exhibits a dual innervation with a high ( 2 - 3 cm ) and low ( 1 - 1.5 cm ) distribution in 27% of patients . \n after the superciliary skin incision , the underlying muscles are cut and widely undermined to facilitate a relatively large craniotomy with only a small skin incision . after drilling a frontobasal lateral burrhole , a supraorbital bone flap with a diameter of < 2 cm \n unidirectional skin retraction preceding the drill movement using a retractor held by an assistant can avoid skin damage and allow sufficient space for a craniotomy . \n six retraction sutures are then placed at the edge of the skin incision ( fig . \n the inner edge of the craniotomy above the orbital rim is drilled and beveled , and the frontal floor prominences are flattened . \n a sphenoid ridge is slightly drilled adjacent to the frontobasal lateral burrhole to expose the sylvian fissure area . \n after the dural incision , a narrow brain spatula is slid over the base of the frontal lobe toward the carotid and optic nerve cisterns with the use of an operating microscope . \n the cisterns are then opened to drain the cerebrospinal fluid , achieve brain relaxation , and obtain an intracranial working space . \n to expose the supraclinoid internal carotid artery ( ica ) aneurysms , dissection of the proximal sylvian fissure allows more frontal lobe retraction and visualization up to the carotid bifurcation . in the case of middle carotid artery ( mca ) \n aneurysms at the mca genu , focal ( < 2 cm ) opening of the sylvian fissure at the pars triangularis is sufficient to expose the aneurysm and its parent artery . the sylvian dissection is carried out along the frontal side of the sylvian veins , yet can be limited by the location of the fronto - sylvian veins . \n sometimes , division of a few small fronto - sylvian veins is inevitable . for mca aneurysms proximal to the mca genu \n furthermore , a superciliary approach can be advocated in the case of inferior- and anterior - directing anterior communicating artery ( acoa ) aneurysms , whereas a pterional - transsylvian approach will be favored for superior - directing or high - positioned anterior communicating artery acoa aneurysms , especially with a large diameter , in order to reduce the brain retraction . in keyhole surgery using a small cranial opening , certain technical pointers are crucial . \n the aneurysm should be accessed by the most direct and straightforward route without unnecessary intraoperative navigation . \n careful and clean surgical dissection is required to minimize cortical woozing and venous bleeding , avoid a dim operative field , and facilitate surgical processes . \n the unidirectional application of a clip through the small cranial opening can be a major limitation . yet \n , this can be overcome by using aneurysm clips with various configurations , along with gentle mobilization of the parent artery and aneurysm using a suction tip . \n if an arterial repair is required beyond simple aneurysm clipping , special surgical techniques used in the small and deep operative field are applied7,9 ) . \n the dural incision is sutured water - tight , and dural tenting sutures , if needed , are placed along the bone edge using an anchor screw technique8 ) . \n the bone flap is then fixed in place using low profile , titanium plates and screws . \n thereafter , the burrhole and bone gaps around the bone flap are filled with biocompatible material3 ) . \n when compared with a pterional approach , the advantages of a superciliary approach are as follows : 1 ) small operative wound , 2 ) short operative duration , 3 ) no intraoperative blood transfusion , 4 ) rare occurrence of a postoperative epidural hematoma , 5 ) negligible damage to the temporalis muscle , 6 ) less wound - related pain , and 7 ) early return to work and normal life . however , the major limitations are narrow viewing angles with reduced intraoperative light and reduced maneuverability of the microinstruments , including unidirectional application and coaxial control of the instruments . \n thus , an aneurysm clip applier , microscissors , and bipolar coagulation forceps with a tubular shaft are useful to overcome these limitations . \n the risk of prolonged or permanent palsy of the frontalis muscle due to injury of the frontal branch of the facial nerve is also related to a superciliary approach14 ) . yet \n , this postoperative risk is minimized when the skin incision is located < 1 cm of the supraorbital margin and only measures 3.5 cm in length11,12,15 ) . plus \n , the operative wound heals well with a good cosmetic appearance , especially in younger patients , although some elderly patients can show a linear dimple at the operative wound and a slightly sagging brow due to loose skin . \n a superciliary approach can be applied for unruptured aneurysms with a maximum diameter < 15 mm arising at or below the level of the horizontal segments of the anterior cerebral artery and mca.12 ) thus , aneurysms at the supraclinoid ica , a1 , acoa , and m1 segment including mca bifurcation are normally favorable for a superciliary approach . however , the aneurysm neck diameter is also a very important consideration to predict the clippability in the case of a superciliary approach . \n table 1 summarizes the effective indications and relative / absolute contraindications of a superciliary approach according to the aneurysm location . \n the catheter angiograms of the aneurysms favorable and unfavorable for a superciliary approach are depicted in fig . 4 , 5 . \n in the case of ica aneurysms , a typical posterior communicating artery ( pcoa ) aneurysm and anterior choroidal artery ( acha ) aneurysm , which arise at the lateral or posterolateral wall of an ica , are the easiest to access and clip using a superciliary approach . \n in particular , for an unruptured pcoa aneurysm inducing oculomotor nerve palsy , a superciliary approach maximizes the symptomatic resolution and minimizes the surgical invasiveness11 ) . \n however , in the case of a posterior wall aneurysm of the ica necessitating an angled fenestrated clip placement , a larger craniotomy is required to allow the appropriate movement and tilting of the aneurysm clip applier . \n in addition , low - lying supraclinoid or paraclinoid ica aneurysms that require drilling of the anterior clinoid process also need a larger cranial opening than a supraorbital mini - craniotomy with a small diameter of < 2 cm . \n in such a case , an orbital osteotomy combined with a supraorbital mini - craniotomy can facilitate the drilling work . for acoa aneurysms , \n a superciliary approach only allows subfrontal access , plus the ipsilateral olfactory nerve is more compressed by the brain retractor than in the case of a pterional approach . \n thus , while inferior- and anterior - directing acoa aneurysms can easily be clipped using a superciliary approach , large superior - directing and high - positioned acoa aneurysms require a pterional - transsylvian approach . \n most mca aneurysms arising at the m1 segment and mca bifurcation can be clipped using a superciliary approach . however , \n if the lesions are located beyond the mca genu , a larger cranial opening is needed to expose them . \n a large wide - necked mca aneurysm requiring aneurysm clip placement in multiple directions will also need a larger craniotomy , along with the case of two adjacent aneurysms requiring clip application in different directions . \n other relative contraindications for a superciliary approach are follows : 1 ) tendency to form keloids and hypertrophic scars , 2 ) asymmetric sagging brows , and 3 ) anticipated emotional stress due to even a small operative wound on the face . \n the risk of the postoperative occurrence of a subdural hygroma is high in elderly patients , as in the cases of conventional craniotomies . \n thus , all subdural hygromas should be monitored with follow - up computed tomography scans until complete resolution due to the possible conversion to a chronic subdural hematoma . \n a superciliary approach can also be applied to some ruptured aneurysms without severe brain swelling . \n an intravenous mannitol infusion and drainage of cerebrospinal fluid using an intraoperative ventriculostomy or lumbar drainage can achieve brain relaxation and facilitate aneurysm surgery for the patients with mild to moderate brain swelling . \n patients with a good clinical grade and small subarachnoid hemorrhage can be treated using this approach without difficulty1,2 ) \n . however , there is still the risk of unexpected brain swelling and an intraoperative rupture of an aneurysm . \n a superciliary keyhole approach allows most unruptured anterior circulation aneurysms to be clipped safely , rapidly , and less invasively when using refined surgical techniques on the basis of appropriate indications .", "role": "user" }, { "content": "neurosurgeons have been trying to reduce surgical invasiveness by applying minimally invasive keyhole approaches . \n therefore , this paper clarifies the detailed surgical technique , its limitations , proper indications , and contraindications for a superciliary keyhole approach as a minimally invasive modification of a pterional approach . \n successful superciliary keyhole surgery for unruptured aneurysms requires an understanding of the limitations and the use of special surgical techniques . \n essentially , this means the effective selection of surgical indications , usage of the appropriate surgical instruments with a tubular shaft , and refined surgical techniques , including straightforward access to the aneurysm , clean surgical dissection , and the application of clips with an appropriate configuration . \n a superciliary keyhole approach allows unruptured anterior circulation aneurysms to be clipped safely , rapidly , and less invasively on the basis of appropriate surgical indications .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: interestingly , the trajectory of a proton in the lumen of \n the so - called m2 channel of the influenza a virus is an example from \n biology . \n the m2 integral membrane protein is a tetramer assembled \n from four identical subunits , each with 97 residues . as a prerequisite for release of genetic material to the cytoplasm , \n the interior of a viral particle must become acidified as a means \n to detect its own entrance in the endosome . \n the m2 protein channel fulfills this acidification function by conducting \n protons through its membrane pore . \n the gating of this essential proton \n transport step in the infection cycle is controlled by ph . among the pore - lining residues , his37 and trp41 \n were identified \n as the most important residues in the proton transfer through the \n m2 channel . \n the proton selective conductance in m2 is achieved by \n the presence of the his37 cluster : substitution of his37 with residues \n such as gly or ala induces a nonselective channel , indicating a mechanistic \n role of his37 in proton relay . \n a transfer cycle \n was proposed where a tautomerization of the his37 side chain occurs \n between the acceptance of a proton from the viral exterior and the \n release of a proton to the viral interior , to reestablish in full \n the original configuration for the next cycle . \n on replacing the imidazole \n ring of the his37 side chain with a 4-thiazolyl group , which has the \n n1 as the only proton acceptor with pka 2.5 , \n this mutant shows inward proton flux resembling the wild type , thus \n demonstrating that tautomerization is not necessarily required for \n proton transport . however , rotation of \n the imidazole ring during proton translocation can not be ruled out . \n besides the functional role in proton selectivity , his37 is associated \n with channel activation : binding of a third proton to the his37 cluster \n under acidic conditions triggers a detectable proton flux , with a \n peak conductance rate of 10 protons per second . \n substitution of trp41 with smaller residues , like gly , ala and phe , \n induces higher proton conductivity compared to the wild - type channel . despite the relatively small size of the \n m2 protein , and several \n high - resolution structures being available , \n the mechanism of proton \n conduction through the channel is not completely understood ( figure 1a ) . \n previously , we \n studied the addition of a proton to the his37 cluster from the extraviral \n side , and compared the energetics and \n dynamics of two configurations of the doubly protonated state at neutral \n ph a 4-fold symmetric histidine - box and a 2-fold \n symmetric dimer - of - dimersand proposed a multiconfiguration \n model where these configurations are in moderately fast equilibrium . here , we focus our analysis on the configuration \n of the his37trp41 cluster in the triply protonated \n state , and its subsequent deprotonation . m2 channel and its two \n configurations of the his37trp41 \n quartet at low ph . \n ( a ) shown is the tm domain of m2 protein imbedded \n in a fully hydrated lipid bilayer . \n his37 and trp41 residues and lipids are colored in green , pink , and \n ice blue , respectively , as space filling spheres . \n waters are shown \n in gray surface . the d - model ( b ) and the h - model ( c ) of the quartet . \n system with the absence of cl ion are shown in \n stick mode with the same color code as in ( a ) , and the system with \n cl ion are shown in white stick . \n ( d ) the principal \n components of the quartet , , in different systems as a function \n of time ; data for the 2 + state are shown for comparison . herein , quantum mechanics / molecular mechanics ( qm / mm ) \n molecular \n dynamics ( md ) simulations reveal insights into the function and mechanism \n of this protein . specifically , molecular simulations complemented \n by crystallographic and nmr ( nuclear magnetic resonance ) determined \n structural data , as well as physiological measurements provide mechanistic \n clues in understanding this rate - limiting step of proton conduction \n in m2 , especially the proton trajectory during the translocation reaction . \n the present study elaborates our previous computational works , and \n explores the free energy profile with the explicit presence of the \n complete transmembrane domain of the protein as well as a fully hydrated \n membrane environment . \n moreover , to explore the effect of the proton \n filter and the channel gate , the entire his37trp41 \n cluster and the nearby water clusters are treated within a quantum \n mechanical methodology . in this manuscript , we document multiple \n calculations : first , we \n studied the structural integrity of the m2 protein with two models \n at low ph with qm / mm md simulations . \n we find that the structures of \n the his37 cluster starting from both models converge at low ph , and \n are stable within the simulation time scale : both models appear ready \n for the subsequent proton release toward the intraviral side . \n then , \n we calculated potentials of mean force ( pmfs ) of the deprotonation \n by constrained qm / mm md simulations : the pmfs of both models have \n barriers 6.5 kcal / mol . compared to previous simulation studies , \n the local electrostatic environment of the hydrated membrane significantly \n lowers the energy cost . \n finally , we explored the possible role of \n a cl anion in the pore at low ph , which was found \n to stabilize the highly charged 3 + histidine cluster , but also to \n impede proton release by stabilizing the hydronium species within \n the channel pore . \n configuration \n at the 2 + state ( with 2 of 4 his37 side chains charged ) at neutral \n ph as the d2-model , and the subsequent 3 + state obtained \n by adding a third proton as the d3-model ( figure 1b ) . \n correspondingly , the histidine - box \n at 2 + state and the subsequent 3 + state structures are designated \n as the h2- and h3-models ( figure 1c ) , respectively \n . the 1.65 resolution \n x - ray structure ( pdb entry : 3lbw , residues \n two and three of the four his37 residues were \n initialized to be charged in the 2 + and 3 + states , respectively . \n the \n protein was then embedded in a previously equilibrated 80 80 \n lipid bilayer containing 171 1-palmytoyl-2-oleoyl - sn - glycero-3-phosphatidylcholine ( popc ) molecules , hydrated \n by 10,031 water molecules . \n potassium and chloride ions were added \n to neutralize the system , and to provide a solution buffer with ionic \n concentration of 150 mm . \n periodic boundary conditions were applied , \n and long - range electrostatic interactions were treated with the particle \n mesh ewald method . \n a time step of 2 fs \n was used , and all of the bonds involving hydrogen atoms were constrained \n with the shake method . after an equilibration \n period with gradually released harmonic restraints , production simulations \n were performed at 310 k and 1 atm using langevin temperature and langevin \n piston pressure coupling schemes . \n the tip3p \n force field was used for water molecules , and charmm force field was used for the protein and lipid atoms . \n simulations were performed with namd , and continued for 200 ns for the 2 + state , and \n 300 ns for the 3 + state . to prepare the his37trp41 \n quartet structures for the subsequent h3- and d3-models at the acidic \n condition with qm \n / mm md simulations , we followed the protocol used \n in our previous work to optimize the his37trp41 \n quartet structure at the 2 + state with the oniom method implemented in gaussian 03 . on the basis of the optimized his37trp41 \n quartet structure in the h2- and d2-models \n , a third proton was added \n to a neutral his37 side chain , and oniom was used to optimize the \n system after this addition . \n then , the h3 and d3-models were constructed \n with the original quartet in the corresponding h2(d2)-model replaced \n with the newly optimized quartet at the 3 + state . \n therefore , the initial \n backbone of the h3(d3)-model is similar to the preceding h2(d2)-model . \n with the quartet structure held fixed , we then relaxed the remaining \n atoms of the h3(d3)-model with classical md simulations for 20 ns . \n we took the last snapshot from the md simulations , and minimized the \n system with the his37trp41 quartet fixed . \n the minimized \n structures were used for the following qm / mm md simulations . in the qm / mm scheme , as in our \n previous study \n , we included in the qm \n region the his37trp41 quartet and thirteen water \n molecules nearby ( corresponding to the three water clusters identified \n in the 3lbw.pdb \n structure : six waters just above the \n his37 tetrad , two in the his37trp41 cavity , and \n five below the trp41 gate ) . \n these atoms were treated at the density \n functional theory ( dft ) level using a mixed gaussian and plane - waves \n treatment , while the rest of the system , \n including the protein , the lipids , and waters , was treated with the \n mm method ( charmm force field and tip3p ) . \n the generalized gradient approximation ( gga ) \n functional blyp with the d2 level dispersion - correction \n ( blyp - d2 ) , the triple- basis set \n with two polarization functions , and \n the goedecker , teter , and hutter type pseudopotentials were used . \n a wavelet - based poisson solver was used to remove \n the spurious interactions of the qm region atoms with the periodic \n images . a box size of 32 32 \n 32 was used for the qm region so that the buffer \n between qm atoms and the box edge is 8 . \n we saturated \n the broken bonds with hydrogen atoms , and combined the qm and mm subsystems \n with the imomm methodology , where the \n scaling factors of 1.355 , 1.384 , and 1.416 were used to relate the \n qm c h bond distance to the mm cc , cn , \n and cc distances , respectively . \n for the \n qm / mm md simulations , after 2 ps equilibration for each model , we \n accumulated 9 ps trajectories for the d3-model with and without cl , and 4 and 7 ps for h3-model with or without cl , respectively . to characterize the free energy \n profile for proton release from \n the his37 cluster in m2 protein \n , we followed the well - tested protocol \n used in the previous work from our group to run constrained \n qm / mm md simulations . \n the starting configuration was adopted from \n the preceding 3 + state qm / mm md simulations . \n the reaction coordinate \n was defined as the distance between the n2 on one his37 \n side chain and its neighboring h2 , in the range of 1.0 \n to 1.6 . with the reaction coordinate fixed in each \n window , constrained qm / \n mm md simulations were carried out for times \n varying between 5 and 8 ps to obtain a converged pmf . \n forces after \n the initial 1 ps of each constrained simulation were collected to \n calculate the mean constraint force . \n free energy profiles for the \n proton release were estimated by thermodynamic integration of the \n mean force along the reaction coordinate . \n all of the qm / mm md \n simulations were carried out with the cp2k \n program with a time step of 0.4 fs . \n nbo was used to \n calculate the partial charge at the mp2/6 - 311++g(d , p ) level , performed \n with gaussian 03 . in those calculations , \n only the side chains of the his37 and trp41 residues \n the conformation \n of the his37 \n cluster in both the d3-model and the h3-model was quantified by a \n single parameter , , defined as the projection of the atomic \n coordinates of his37 along the displacement vector connecting the \n two models , where = 0 represents the dimer - of - dimers \n ( d2-model ) and = 1 the histidine - box ( h2-model ) . upon binding the third proton , as shown \n in figure 1d , \n the -value in the h3-model \n remains at 1 , indicating that the protonation does not change \n the conformation of the his37 cluster significantly . in the d3-model , \n his37 shifts from = 0 to = 0.4 , showing that the d2-model \n and the corresponding d3-model are connected by a ph - dependent transformation . \n furthermore , this transformation appears to form an intermediate state \n of the one leading from the dimer - of - dimers ( \n = 0 ) to the histidine - box \n this conformational \n change has been previously proposed for the dimer - of - dimers \n at acidic conditions , where one dimer is broken upon taking a third \n proton , to avoid electrostatic repulsion . \n the structure of the his37 cluster after this conformational change \n is closer to the histidine - box conformation . in both models , \n the presence of a cl ion in \n the his37trp41 cavity does not have a major impact \n on the protein s conformation ( figure 1b d ) , but has more profound effects on proton conduction , \n which is further described below . \n we monitored the specific structural motifs of \n either model by exploring the rotamer structures of his37 and trp41 . \n as disclosed by experimental determined structures at different conditions , \n these two key residues at both high and low phs adopt rotameric angle \n 1 = 180 , whereas the angle 2 is relatively flexible . \n in particular , the side chain dynamics of the two residues are distinct \n between the d- and the h - models . in the qm / mm md simulations \n at the 2 + state ( figure 2a ) \n , the his37 cluster \n in the d2-model adopts a 2-fold symmetry , where the two dihedral angles \n [ 1 , 2 ] of the charged his37 side \n chains are [ 180 , 360 ] and those of the neutral ones are \n [ 180 , 260 ] . the [ 180 , 360 ] configuration of \n his37 was rarely sampled in the classical md simulations ( figure 2b and 2b ) , largely \n because of the inability of the classical force field to reproduce \n the strongly hydrogen bonded \n dimer - of - dimers of the \n d2-model . in the d3-model ( figure 2a ) , \n one of the charged his37 side chain in the broken \n dimer remains at the [ 180 , 60 ] configuration with the \n other one swings at [ 180 , 150 220 ] , and \n the intact histidine - pair resembles those in the d2-model . \n interestingly , \n this [ 180 , 60 ] configuration is the characteristic of \n the low ph structure , which was occasionally \n sampled in the classical md simulations at the 2 + state , but never \n reached in the corresponding qm / mm md simulations . in both the h2- \n and h3-models , all of the four his37 side chains have [ 1 , 2 ] values of [ 180 , 180 ] . \n dihedral \n angle distributions of the his37 and trp41 side chains \n from the d- and h - models are plotted at neutral and acidic ph conditions . \n the top panel shows the plots at neutral conditions ( 2 + state ) , which \n are labeled as a \n f ; the corresponding plots at acidic conditions \n ( 3 + state ) are labeled as af , shown in the \n bottom panel . \n panels a and b show the correlation between 1 \n and 2 on his37 side chain from the qm / mm and classical md simulations , \n respectively . \n panels c and d show the correlation between 1 \n and 2 on trp41 side chains . \n panels e and f show the correlation \n between 2 on his37 and 2 on trp41 . \n the trp41 side chains feature a flip \n variant in the h - models ( the n1-h1 bond of the indole \n group points toward the central pore ) and a flop variant \n in the d - models ( the same bond points away from the central pore ) . \n these variants correspond to 2 angles located at \n 80 ( tp rotamer , the flip \n variant ) and at 280 ( tm rotamer , the \n flop variant ) , which are retained at both high and \n low ph conditions in each model ( figure 2c \n and 2c ) . however , the 2 angle of trp41 at the low ph conditions in the d3-model is more \n diffuse than the congener in the d2-model , indicating a more dynamic \n trp41 gate in the d - model under acidic conditions . \n in contrast , this \n gate seems to be more rigid in the h - models , as evidenced by the similar \n distributions of 2 angle at neutral or acidic ph \n conditions . due to the inward orientation of trp41 in the h3-model , \n the excess \n proton is less easy to be released toward the intraviral \n end of the channel , as further described below . \n however , this orientation \n enables the trp41 side chains to form water - mediated hydrogen bonding \n interactions with asp44 ( figure 3 ) , which was \n proposed to stabilize the trp41 gate , a critical factor for the asymmetric \n proton flux . \n the outward orientation of the \n trp41 in the d3-model , on the other hand , points the amide group toward \n the hydrophobic wall , which seems to be a less favorable factor for \n its gating . \n shown is \n the top view of the channel , in which trp41 , asp44 and water molecules \n are the sticks , and the backbone of the protein is the spiral . \n it should be noted that , in the classical and qm / mm md simulations \n of both d - models , only the tp rotamer of trp41 was \n observed ( figure 2d and 2d ) , as the histidine - box x - ray structure was used as the initial structure and no indole \n ring flipping happened in the submicrosecond time scale simulations . \n the average h2h2 distance of neighboring \n trp41 residues in the d2- and d3-models are 4.7 and 7.2 , respectively , \n which are consistent with the data derived from f nmr \n measurement on f(hnm ) m2tm sample ( 3.2 \n at ph 8.0 and 8.0 at ph 5.3 ) . \n in contrast , the average h3h3 distance \n is 11 in both the h2- and h3-models . \n this is in line \n with a nmr experiment under different conditions , in which the f(h3 ) m2tm sample was found to have the closest distance \n of 11 at both high and low ph conditions . as the m2 protein \n s \n structure is sensitive to the change in the solubilizing environment , the diversity of the his37trp41 \n contact depends on the balance between different rotamers . \n the nature \n of the interaction between his37 and trp41 differs between the d- \n and h - models , as the former is more sensitive to the protonation state \n ( figure 2e , e,f , f ) . \n this difference \n in the his37trp41 packing and its response to the \n environment can be mainly attributed to the higher flexibility of \n the his37 side chain compared to trp41 . in the h - model , \n the orientations \n of the two residues and their coupling are less dependent on ph condition , \n showing only small thermal motions for both the imidazole ring of \n his37 and indole ring of trp41 . due to the different rotameric \n conformations , distances between his37 and trp41 are also distinct \n in the d- and h - models , which can be determined by different techniques . \n as shown in table 1 , the distances measured \n in our md simulations are quantitatively consistent with experimental \n structures or nmr measurements . taking the c(his37)h3(trp41 ) \n distance as an example , at neutral ph condition , the average distances \n ( figure 4a ) in the d2- and h2-models are 6.8 \n and 4.7 , respectively , corresponding to 6.5 in the 2l0j.pdb and 5.0 in the 3lbw.pdb . \n the dashed line connecting h1 on his37 and c on trp41 \n indicates the reaction coordinate used to scan the change of partial \n charge , as shown in panel b. nbo analysis was used to calculate the \n partial charge at the mp2/6 - 311++g(d , p ) level . \n ensemble average of the eight snapshots \n of the nmr structure . among \n the eight snapshots of the \n nmr structures , \n data at ph = 8.5 and ph = 4.5 ( in \n parentheses ) are shown . \n ssnmr : solid - state nmr . to explore the free \n energy cost for the his37 cluster to release a proton at low ph conditions \n , \n we carried out constrained qm / mm md simulations on the d3- and h3-models \n imbedded in the fully hydrated lipid bilayers , in which the geometrical \n parameter of the distance between n2 on one his37 side chain \n and its neighboring h2 was selected as the reaction coordinate \n . among the three charged his37 residues , the one with the \n [ 1 , 2 ] of [ 180 , 60 ] was selected to release \n a proton , as this his37 has an orientation similar to those found \n in the low ph condition x - ray structure . \n the free energy profiles for deprotonation and the representative \n snapshots along the reaction pathways are shown in figure 5 . \n the calculated pmfs was obtained by thermodynamic \n integration of the average force along the deprotonation pathway , \n where all free energy values are shown relative to the value of the \n lowest pmf calculated in each system ( figure 5a ) . \n the deprotonation curves are quite similar between the d3- and \n h3-models , but the presence of cl imposes significant \n perturbation on his37 deprotonation ( describe later ) . in the d3-model \n , \n the minimum of the free energy profile is located at = 1.024 \n , corresponding to the triply charged his37 cluster state ( figure 5a , b ) . along with the increase of the n2h2 \n bond until = 1.30 , the pmf increases , showing that \n the proton moving from his37 to the neighboring water is energetically \n unfavorable ( figure 5a , b ) . at \n = 1.30 , the proton is shared by his37 and the neighboring water , \n with the average n2(his37)o(water ) distance \n of 2.52 , where the proton is closer to the water ( the averaged \n h2o(water ) distance is 1.24 ) . \n the \n newly formed hydronium is stabilized by the surrounding hydrogen - bond \n network , which extends to the waters at the c - terminal side ( figure 5b ) . at high ph conditions , \n these interactions \n are interrupted as the trp41 gate is closed . meanwhile , one proton \n of the hydronium points to the neighboring water , and is ready to \n be released . \n the additional proton on the \n hydronium is expected to release to the c - terminal side of the pore . \n at \n = 1.5 , the proton transfer is complete ( the averaged \n h2o(water ) distance is 1.06 ) , and \n the hydronium group is separated from his37 by three water molecules . \n c ) is very similar to that in the d3-model , \n with the free energy barrier height of 6.63 kcal / mol , located at \n = 1.36 : at this point , a hydronium is formed next to the deprotonated \n his37 ( with the n2(his37)o(water ) and h2o(water ) \n distances of 2.53 and 1.22 , respectively ) . \n ( a ) shown are the free \n energy profiles for proton release under \n different starting configurations . \n both the d3- and h3-models have \n similar deprotonation pathways , while the presence of cl in the h3-model inhibits proton release . \n panels b d show \n the representative snapshots during the proton release in the d3-model \n ( b b ) , the h3-model ( c c ) , and the h3-model \n with cl ( d ) . \n their locations are labeled in panel \n a. taking the d3-model as an example , along its deprotonation pathway , \n one proton originally attached to the n on a charged his37 \n residue gradually moved to the neighboring water cluster at the c - terminal \n side , with the nh distance increased from 1.024 \n ( b ) to 1.20 ( b ) and to 1.30 ( b ) . at \n 1.30 , \n further increase of the nh distance enables the fully \n release of the proton from his37 , as shown on the red dashed line \n in ( a ) . \n previously , we demonstrated that \n two alternative configurations \n ( the d2- and h2-models ) are capable of stabilizing the charges in \n the pore at neutral ph condition . here \n we find that , under acidic conditions , the mechanism of proton release \n from the his37 cluster is much less dependent on its configuration \n ( the d3- or h3-models ) . \n in other words , for a charged his37 side chain , \n which is ready to lose a proton , it is largely unaffected by the configuration \n of the remaining three his37 residues . therefore , the interplay between \n his37 residues , the ph sensor of the channel , is ph dependent during \n the proton relay . \n the trp41 gate and the membrane environment , on \n the other hand , are likely to play a role in modulating the rate of \n deprotonation and thus the conductance . \n different computational \n approaches have previously been used to \n explore the deprotonation from the charged his37 cluster in the m2 \n protein . \n in one recent paper \n from our group , the deprotonation from a single histidine and from \n the histrp motif in water was investigated with \n dft - based md simulations . \n for a single \n histidine , the free energy barriers were calculated to be 10.010.1 \n kcal / mol at the n position , and 10.510.6 kcal / mol at \n the n position . \n a recent study from voth and co - workers combined \n an empirical valence bond and a dft - based qm / mm approach to study \n the proton release at different protonation states , reporting barrier \n heights of 13 and 10 kcal / mol for proton release from \n the triply and quadruply charged his37 cluster , respectively . when a single trp residue is included \n in the calculation with a \n position resembling that in the protein , the barrier for the n \n was found to be 9.1 kcal / mol , 1 kcal / mol lower than that in \n the isolated histidine in water box , suggesting \n a role of the trp41 gate in regulating the proton relay through his37 , \n in addition to its known ability to generate an asymmetric flow . specifically , charge transfer from his37 to \n the bound trp41 through the cation interactions was \n witnessed , as assessed by the partial charge on each group ( figure 4b ) , consistently with the calculated electrostatic \n potential . \n presumably , this charge delocalization \n decreases the energy cost to lose a proton . in the present work , \n the energy cost for deprotonation in the membrane \n environment is 6.5 kcal / mol , significantly lower than the \n one in the histrp motif or the isolated his . \n apparently , the present work provides a more \n realistic model in studying proton transfer , where the backbone of \n the transmembrane domain of the protein , the trp41 gate , and the explicit \n membrane environment have significant effects on modulating the dissociation \n of protons from his37 . for the latter one , to be specific , the confined \n environment of the pore and the low dielectric constant of the membrane \n destabilize the charged cluster , and thus facilitate the deprotonation \n of the charged his37 . by using the following equations and assuming g = 0 for simplicity between his37 and bulk water , \n the upper limit of the pka \n of his37 in the membrane environment is estimated to be 4.7 in the \n d3-model and 5.0 in the h3-model , respectively , based on the major \n barrier heights for deprotonation in both models . \n experimentally , \n the third pka of the his37 cluster when three \n of four residues are protonated was determined as 6.3 and 4.9 0.3 , respectively , by using different protein constructs and lipid membrane \n compositions . \n the backbone conformations \n in both d3- and h3-models are very similar \n to those of the relatively compact protein structure at neutral ph . without significant expansion of the backbone \n , \n we demonstrate that both models are able to release a proton with \n a moderate energy cost . \n the presence of the c - terminal amphipathic \n helix anchoring at the lipid interfacial region is likely to limit \n the dynamic of the c - terminal segment , compared to what seen for the isolated the transmembrane helices \n from electron paramagnetic resonance ( epr ) experiments and the x - ray structure determined at low ph conditions . finally , \n we investigated \n the possibility of a role for cl or other halide \n anions in the proton relay mechanism through the pore . in electrophysiology \n studies , \n the proton conduction rate was found to be unaffected by \n the concentration of cl in both oocytes and liposomes . \n this finding is in apparent \n contrast with the attractive force that a triply charged his37 tetrad \n can exert on a cl ion : assuming for simplicity that the rate of proton transfer is only \n controlled by electrostatics , cl ions should increase \n the proton conduction rate . in a recent study of the calcium - release \n activated calcium channel ( crac ) , a cation - conducing channel with \n a 6 - wide pore and a high density of basic side chains , we observed \n that cl anions in the pore significantly increase \n the rate of permeation of na cations . \n therefore , we extended the proton transfer calculations \n to a model including a cl ion bound to the his37 \n tetrad , to explore its impact on the proton conduction rate . \n as shown in the pmf calculations , the presence of cl makes the free energy cost of deprotonation much higher . following \n the increasing n \n h distance , the pmf keeps rising : at \n = 1.36 , where the major barrier is located in the previous pmfs , \n the free energy value is 10.5 kcal / mol , 3.9 kcal / mol higher than that \n in the h3-model ( figure 5a ) . \n this demonstrates \n that the presence of cl creates an unfavorable \n pathway for a proton to be released . during the simulations , \n the cl ion is located in the highly charged his37 cluster , \n and has stable interactions with the water in the cavity below , which \n is formed by the his37 and trp41 clusters ( figure 5d ) . \n the arrangement of the hydrogen bonding network of water \n molecules in the cavity could compensate in principle the energy cost \n for bond breaking of the proton release . nevertheless , the electrostatic \n attraction between the anion and the proton attenuates the proton \n diffusion out of the cavity to the c - terminal even though the trp41 \n gate is occasionally open . \n therefore , the presence of anions in the \n his37trp41 cavity is an unfavorable factor for proton \n release , which the m2 channel can circumvent by maintaining its pore \n free of cl ions through its asp44 residues , two \n helical turns away from his37 . \n this is confirmed by mutations of asp44 , \n which significantly impact the proton conduction profile in a salt \n solution with a [ cl]/[so4 ] ratio approximately 2:1 . \n in this study , we explored the different configurations of the \n his37trp41 cluster in the m2 protein at low ph conditions , \n and the subsequent deprotonation via qm / mm md simulations . with regard \n to the conformation of the key residues , two alternative models ( d3 \n and h3 ) \n converge to a single deprotonation mechanism , and feature \n similar free energy profiles to release a proton , with a barrier height \n of 6.5 kcal / mol . \n therefore , the multiconfiguration model proposed \n in our previous work , includes deprotonation \n as a mechanism not only for proton conduction , but also for conformational \n exchange connecting the multiple configurations of this protein . \n the \n confined region between his37 and trp41 also appears to significantly \n increase the proton affinity of a water molecule compared to the bulk \n solution . \n calculations with a bound cl ion in the \n pore show that halide anions may contribute to stabilizing the triply \n charged histidine cluster , but at the same time impede the release \n of protons . \n we suggest that only those viral strains capable of maintaining \n halide anions outside the pore can maintain a stable proton conduction \n rate irrespective of the anions bulk concentration .", "role": "user" }, { "content": "the activity of the m2 proton channel \n of the influenza a virus \n is controlled by ph . \n the tautomeric state and conformation of his37 , \n a key residue in the m2 transmembrane four - helix bundle , controls \n the gating of the channel . \n previously , we compared the energetics \n and dynamics of two alternative conformations of the doubly protonated \n state at neutral ph , namely , a 4-fold symmetric histidine - box \n and a 2-fold symmetric dimer - of - dimers , and proposed \n a multiconfiguration model for this charge state . here , we elaborate \n this model by further studying configurations of the his37 tetrad \n in the triply protonated state and its subsequent deprotonation via \n quantum mechanics / molecular mechanics ( qm / mm ) molecular dynamics ( md ) \n simulations , starting with the aforementioned configurations , to gain \n information about proton release in a viral membrane environment . \n interestingly , the two configurations converge under acidic ph conditions . \n protons can be transferred from one charged his37 to a neighboring \n water cluster at the c - terminal side of the channel when the trp41 \n gate is open transiently . with limited backbone expansion , \n the free \n energy barrier for proton release to the viral interior at low ph \n is 6.5 kcal / mol in both models , which is much lower than at \n either neutral ph or for an isolated his37 cluster without a membrane \n environment . \n our calculations also suggest that the m2 protein would \n seem to exclude the entrance of anions into the central channel through \n a special mechanism , due to the latter s potential inhibitory \n effect on proton conduction .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: c1 lateral mass c2 pedicle screw fixation , first described by goel et al.12 has gained acceptance as treatment option of choice in the management of atlantoaxial instability needing posterior fixation . \n this procedure provides excellent stability in 85100% of cases.34 the anomalies of the vertebral artery as well as bony anomalies are contraindication for this technique in a significant percentage of patients . \n in such situation , the operating surgeon is often forced to opt for an occipitocervical fusion which would restrict craniocervical mobility or choose alternative salvage procedures which would provide less rigid fixation , such as the use of translaminar screws or a lateral mass screw . \n the unilateral c1 lateral mass , c2 pedical screw fixation is indicated in unilateral vertebral artery and bony anomaly . in this study , we retrospectively analyzed unilateral c1 lateral mass \n c2 transpedicular fixation in eight patients in whom bilateral fixation could not be done for various reasons and evaluated their functional and radiological outcome for a minimum follow - up of 6 months . \n a retrospective analysis of eight cases of traumatic atlanto - axial instability managed by unilateral c1 lateral mass \n all patients seen in casualty with suspected cervical spine injury , restricted neck movement and neurological deficit ; as well as all cases with concussive head injury were subjected to x - rays of the cervical spine [ figure 1a ] . \n all patients with neurological deficit and those with x - ray evidence of cervical spine injury without neurological deficit were subjected to magnetic resonance imaging ( mri ) cervical spine . \n ( a ) x - ray cervical spine ( lateral view ) showing atlanto - axial subluxation ; ( b ) mr angiogram showing vertebral artery occlusion on the left side ; ( c ) 2-year follow - up x - ray showing good reduction with unilateral fixation and adequate fusion of c1 and c2 a total of 34 cases with the atlanto - axial subluxation were treated using c1 lateral mass c2 transpedicular screw . \n all 34 cases were subjected to preoperative computed tomography ( ct ) scan and ct / mr angiogram [ figures 1b and 2a ] . \n a detailed preoperative neurological examination was done and patients were graded as per the american spinal injury association ( asia ) scale . \n c2 transpedicular screw placement while eight cases ( 7 males and 1 female , mean age : 41.12 years ) in whom preoperative evaluation or on table operative difficulties prevented bilateral fixation were subjected to unilateral fixation [ table 1 ] . \n ( a ) preoperative ct scan ( axial cut ) evaluation of patient ( case iv ) with abnormally large foramen transversarium at c2 with inadequate bone for screw placement ; ( b ) cervical x - ray showing 1-year follow - up with adequate fusion in a well - reduced fixation achieved with unilateral fixation cases which underwent unilateral fixation no attempt at preoperative reduction with skeletal traction was done in any of the patients . on table reduction \n was achieved using articular joint release and on table manipulation.5 reduction was considered optimal if the anterior atlanto - axial distance was less than or equal to 3 mm and suboptimal if the anterior atlanto - dental distance was more than 3 mm ( 4 cases of bilateral fixation and 1 case of unilateral fixation ) . in these cases , \n excision of the c1 posterior arch was performed to achieve adequate decompression . in 19 cases , \n fusion was achieved with a gallie fusion with iliac crest grafts , while in the remaining 15 cases intra articular fusion was performed . in all 8 cases where fixation was unilateral , \n fusion was achieved with unilateral intraarticular grafts reinforced with onlay grafts wedged between the rod and bony surface . \n postoperatively , all eight patients treated unilaterally were subjected to flexion extension x - rays and ct scans to assess reduction and stability as well as for evaluation of screw placement . \n dynamic imaging to check for stability was not done as this facility did not exist in our institute . \n patients were followed up with x rays and neurological evaluation at 6 weeks , 3 months , 6 months , 1 year and thereafter yearly following surgery [ figures 1c , 2b ] . \n the c1c2 complex was considered stable if there was no movement between c1 posterior arch and c2 spinous process on lateral flexion extension films . \n fusion was considered to be achieved if bony trabeculae continuity existed between the posterior arches of c1 and c2 in cases with gallie fusion and in between the inter - articular spaces in cases with the intraarticular graft.6 screw placement was recorded to be good if purchase into the lateral mass or c2 pedicle was achieved without vertical and horizontal breech of cortex . \n grade i violation was defined as screw threads coming in contact and minimally perforating the cortex , grade ii violation was defined as screw penetrating the cortex and coming in contact with dural space or foramen transversarium , and grade iii violation was defined as penetration of the cortex with significant violation of the dural space or foramen transversarium.7 all patients were mobilized to sitting position in a philadelphia collar on the 3 postoperative day . \n patients with no neurological deficit or with minimal neurological deficits who could be ambulated were mobilized after 1 week on a halo brace . \n patients whose neurological deficits prevented early mobilization were managed with a philadelphia collar for 6 weeks . \n postoperatively , neurological and radiological follow - up for a minimum period of 6 months was possible in all the eight cases ( range : 6 months to 4 years , mean follow - up = 2 years 1 month ) optimal reduction was achieved in seven cases ( 87.5% ) operated unilaterally while one patient was fixed unilaterally in suboptimal position with more than 3 mm atlanto - dental distance at fixation . of the 26 patients in whom bilateral fixation was performed , intraoperative reduction was optimal in 22 ( 84.6% ) cases and suboptimal in four cases despite on table reduction maneuver . all eight cases ( 100% ) operated unilaterally \n of the 26 cases fused bilaterally , 2 were noted to have recurrent subluxation . of these , \n one patient underwent reexploration and augmentation of transarticular fixation with intralaminar wires and gallie fusion . \n one patient treated bilaterally expired postoperatively , and the remaining 23 cases ( 88.4% ) showed good stability and fusion at 6 months . \n evaluation of the screw placement in the cases with unilateral fixation revealed two grade i violation and one grade iii violation in the c1 screw and one grade i and one grade ii violation in the c2 screw placement . \n of the 26 patients treated with bilateral fixation , evaluation of the c1 screws revealed 16 violation with grade i violation ( n=11 ) , grade ii violation ( n=3 ) and grade iii violation ( n=2 ) . \n evaluation of the c2 screws revealed 7 grade i violation , 5 grade ii violation and 1 grade iii violation [ table 2 ] . \n evaluation of screw placement an improvement of asia score was seen in two patients ; one patient improved to asia grade e from asia grade b and another improved to asia grade d from asia grade b. there was no neurological deterioration in any of the remaining five patients in whom unilateral fixation was performed [ table 1 ] . \n there was no obvious injury to the vertebral artery in any of the cases treated by bilateral fixation . \n of those treated by unilateral fixation , there were two cases that had severe arterial bleeding following the tapping of the c1 lateral mass screw , which was probably due to vertebral artery injury . in both the cases \n , hemostasis was achieved using bone wax and there were no neurological sequelae following the surgery . \n i developed a right - sided aspiration pneumonia secondary to lower cranial nerve dysfunction and needed a tracheostomy , ventilatory care and prolonged antibiotic therapy . \n of the 26 cases treated with bilateral fixation , one patient with associated polytrauma including thoracic injury expired on the 3 postoperative day , one patient developed an occipital bed sore , iliac graft site infection was noted in three cases , and deep vein thrombosis and chest infection was seen in two cases each . \n of the various treatment options available for posterior stabilization in cases with traumatic atlanto - axial instability , c12 transarticular fixation and c1 lateral mass c2 transpedicular fixation provide a degree of rigidity superior to the other presently available stabilization procedures.3489 the transarticular c12 fixation can be performed percutaneously using specialized equipment ; alternately , it can be performed as an open procedure in thin individuals in whom reduction can be achieved in military truck position . \n approximately 20% of patients will have anatomical anomalies which precludes the safe placement of transarticular screw on one side.61011 in patients with vertebral anomalies of the foramen transversarium and a high riding vertebral artery , this procedure is contraindicated.12 in cases that have already undergone odontoid excision , the lack of the odontoid as a radiological landmark makes correct angulations of the screw difficult . \n this is particularly important as the risk of vertebral artery injury is higher in cases where reduction is suboptimal ; in addition , no further reduction can be achieved once the transarticular screws are passed through the articular point . \n one significant advantage with this procedure is the ability to achieve optimal and near - optimal reduction in so - called irreducible cases by using the retraction effect of the screw rod construct . \n , as proposed by abumi et al.1314 at present , we do not subject patients to prolonged traction or odontoid excision and are able to achieve optimal and near optimal reduction in most cases using a combination of articular joint release , on table manipulation as described by shetty et al.,5 and the retraction effect provided by the c1 lateral mass \n c2 transpedicular screw and rod construct . in a few cases where reduction was felt to be inadequate , we have relied on excision of the posterior c1 arch to provide adequate decompression . \n the risk of vertebral artery injury is said to be less with c1 lateral mass \n c2 transpedicular fixation than with transarticular fixation.15 however , a significant risk of vertebral injury does exist . \n injury during passage of c2 screw is higher in patient with a high riding vertebral artery and in cases where the screw trajectory is lower than normal and also in cases where the reduction is suboptimal as in the cases with transarticular screw fixation.4812 the vertebral artery is most prone to injury during placement of the c2 screws . \n this is because the superior facet of the c2 vertebra is in close proximity to the body itself unlike in other subaxial cervical vertebrae where the superior facet lies closer to the laminae . \n additionally , the vertebral artery lies closely related to the inferior aspect of the superior facet of the c2 vertebra unlike in its relation to other cervical vertebrae where it is primarily related to the transverse process.16 however , the artery does not intrude onto the body or pars intra articularis itself . \n hence , an entry point away from the inferior margin of superior facet of c2 and a medially projected trajectory are advisable.17 the relationship of the vertebral artery to its groove on the inferior surface of the superior articular facet of c2 is variable.1618 the occupancy of the groove by the artery varies from 34 to 100% , hence ct imaging of the groove alone as a guide to the vertebral artery is unreliable and angiographic preoperative evaluation should be done . \n ebrahim et al.19 advocated restriction of dissection to 12 mm from the midline over the posterior surface of c1 lamina and to 8 mm over the superior surface . \n the relationship of the vertebral artery to its groove on the posterior arch of c1 vertebra is also variable . \n the average distance of the vertebral artery from the c2 ganglion is about 7.2 mm and its distance from the dural tube is approximately 15 mm , which would provide adequate space for safe screw placement in most cases where preoperative evaluation has ruled out an aberrant vertebral artery course or an excessively large , medially placed foramen transversarium . \n however , an erroneous lateral entry point and failure to direct the screw medially can lead to vertebral artery injury ( case iii ) . \n injury while placing the c1 screws may occur as the artery loops over the superior surface of c1 posterior arch . hence \n , careful evaluation of the ct angiogram is essential . in cases where the ct shows abnormally large or medially placed c1-c2 foramen transversarium \n in the two cases where vertebral artery injury was suspected on table , the preoperative ct angiogram did not reveal any anomaly of the vertebral artery . \n . the risk of the vertebral artery injury due to inaccurately placed screws could be reduced with the use of intraoperative navigation in centers where this facility exists . \n evaluation of the bone on preoperative ct scan should ensure adequate bone to allow safe passage of screws and to rule out associated fractures in the bone which would prevent screw placement . in a significant number of cases , abnormal vertebral artery anatomy or bony anomalies and fractures preclude the placement of bilateral screws . in cases where vertebral artery injury is suspected at the time of surgery or where a pre - existing vertebral artery occlusion or atresia exists , it is best to avoid placement of screws on the other side as the risks of bilateral vertebral injury are extremely high . in these cases , \n the surgeon is often forced to perform alternative salvage fixation procedures which provide less than favorable outcome . in cases \n where osseous / vertebral artery anomalies or injury prevent the placement of c1 lateral mass screws , salvage operations are restricted to wiring procedures which provide inferior stability or occipitocervical fusion , which restricts mobility significantly . in cases where anomalies preclude placement of c2 pedicle screws , alternative methods of fixation \n of these options , the lateral mass screws provide the least stability and have the poorest pullout strength . \n translaminar screws provide good restriction of flexion extension , but are inferior to transpedicular screws or c1c2 transarticular screws in restricting lateral bending or torsional movement.2022 in addition , studies done in asian patients , especially adolescents , have shown that 3850% of lamina are inadequate to safely perform translaminar screw fixation,2324 though this has been disputed by other studies.25 in these eight cases we found the stability provided by unilateral c1 lateral mass and c2 transpedicular fixation to be as effective as in cases where bilateral fixation was performed and it could be considered an option in patients in whom preoperative evaluation or on - table complication prevents bilateral fixation being performed . \n it must be mentioned that the number of cases studied ( 8) is small , and to draw definitive guidelines for unilateral c1 lateral mass and c2 transpedicular fixation , a larger multicentric study would be required . \n in addition , all these cases were of post - traumatic atlanto - axial dislocation . \n the role for unilateral fixation in non - traumatic atlanto - axial dislocation in whom anomalies which preclude bilateral fixation tend to be higher has not been evaluated by us . \n unilateral c1 lateral mass c2 transpedicular fixation could be considered a viable option in cases of traumatic atlanto - axial instability where vascular and osseous anomalies contradict a bilateral fixation .", "role": "user" }, { "content": "background : c1 lateral mass \n c2 transpedicular fixation is an accepted surgical procedure of choice in a large number of cases with traumatic atlanto - axial instability . \n however , bony and vascular anomalies can predispose to unacceptably high risk with this procedure , and hence are the contraindications for this procedure . \n the purpose of this study is to analyze the clinical and radiological results in such cases for which only unilateral fixation has been performed in cases where bilateral fixation could not be performed due to various reasons.materials and methods : eight patients ( 7 males , 1 female ) with a mean age of 41.12 years ( range 12 - 68 years ) , who presented with traumatic atlanto - axial instability and in whom bilateral fixation could not be performed , were treated with unilateral c1 lateral mass \n c2 transpedicular fixation . of these cases , \n preoperative vertebral artery occlusion was noted in one case , iatrogenic vertebral artery injury in two cases and bony anomalies or fractures in the remaining of five cases . \n all patients were evaluated clinically with the american spinal injury association ( asia ) scale and radiologically with computed tomography scans and serial x - ray using criteria to evaluate stability.results:all cases were evaluated at 6 months followup with mean followup of 2 years and one month ( range 6 months to 4 years ) . \n all eight patients showed adequate stability and fusion at 6 months ; clinically there was no significant restriction of neck movement in any of the patient . \n there was no neurological deterioration in any of the patient at their last follow-up.conclusion:unilateral c1 lateral mass \n c2 transpedicular fixation could be considered a viable option in cases of traumatic atlanto - axial instability where vascular and osseous anomalies contradict a bilateral fixation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: head and neck cancer is a major problem that occurs in asia , especially in the indian subcontinent . more than 2 lakh new cases of head and neck cancers are diagnosed each year . \n india contributes up to 7.8% of the global cancer burden and 8.33% of global cancer deaths . \n lack of improvement in prognosis over the years is due to the fact that a significant proportion of oral squamous cell carcinoma ( oscc ) is not diagnosed or treated until they reach an advanced stage . \n although arising de novo in many instances a significant proportion of oscc develop from premalignant lesions and conditions such as leukoplakia , oral submucous fibrosis and lichen planus . \n the strong association between cancers of the oral cavity and pharynx with use of cigarette smoking , snuff and chewing tobacco is well established . \n alcohol consumption has a synergistic role and dietary factors such as low intake of fruits and vegetables may also be related to an increased cancer risk . \n few studies have also indicated that presence of candidal infection increases the risk of malignant transformation in premalignant lesions . \n identification of these premalignant lesions is very important in order to prevent malignant transformation . in order to do so \n , we must develop criteria which indicate the potential for malignant transformation in individual lesions . \n the role of fungal infections has been studied in this respect and holds much promise as such an indicator . \n certain strains of candida albicans and other yeasts play a causal role in the development of oral cancer by means of endogenous nitrosamine production . \n the association of candida with various precancer and cancer lesions has been reported as a causative agent . \n the association of candida with premalignant states has been studied extensively and many authors have shown an increase in candida colonization in these lesions as compared to controls . \n further , this persistent infection along with other cofactors may also induce epithelial atypia and dysplasia leading to malignant change . \n it appears that the risk of carcinoma developing in these lesions and conditions depends on whether the lesion is homogenous or nonhomogeneous , the presence and degree of epithelial dysplasia and possibly the method of management adopted . \n but , literature shows very few studies linking the association of dysplasia and related lesions with candida . \n hence , we designed a study to evaluate the prevalence of fungal hyphae in most common oral potentially malignant lesions and conditions such as leukoplakia , lichen planus and submucous fibrosis and to find out a correlation , if any with presence or absence of fungal hyphae with epithelial dysplasia . \n the present study was undertaken by retrieving archived records and paraffin - embedded tissue blocks of previously diagnosed cases of 70 potentially malignant lesions and conditions ( 29 leukoplakia , 16 submucous fibrosis and 25 lichen planus ) . \n relevant information of age , sex and histopathological grading of dysplasias was obtained from the records of the patients and was tabulated [ tables 1 and 2 ] . \n comparison of age and sex distribution between three study groups distribution of grading of epithelial dysplasia between three study groups clinically suspected and histopathologically diagnosed cases having hyperkeratosis and different grades of dysplasia . \n three sections of 5 m thickness of each case were stained employing hematoxylin and eosin ( h and e ) , periodic acid \n the tissue section of diagnosed case of mucormycosis served as positive control for staining of hyphae . \n the entire data was entered in ms excel and analyzed using statistical package for social sciences ( spss ) . \n chi - square test of independence of attributes was used to find out the significant differences and linearity trend of proportion was tested using chi - square test to find out association . \n \n three sections of 5 m thickness of each case were stained employing hematoxylin and eosin ( h and e ) , periodic acid schiff 's reagent ( pas ) and grocott 's methenamine silver ( gms ) . \n the tissue section of diagnosed case of mucormycosis served as positive control for staining of hyphae . \n the entire data was entered in ms excel and analyzed using statistical package for social sciences ( spss ) . \n chi - square test of independence of attributes was used to find out the significant differences and linearity trend of proportion was tested using chi - square test to find out association . \n the present study was undertaken to determine the prevalence of fungal hyphae in potentially malignant lesions and conditions such as leukoplakia , lichen planus and oral submucous fibrosis ; and to find out association if any , with presence or absence of fungal hyphae with various grades of dysplasia . \n fungal hyphae stained with pas appeared magenta red and with gms they appeared brownish black [ figure 1a and b ] . \n ( a ) dark brown to black fungal hyphae in tissue section ( gms stain , x400 ) . \n ( b ) magenta red colored fungal hyphae in tissue section ( pas stain , x400 ) . \n pas = periodic acid schiff , gms = grocott 's methenamine silver demographic details of the patients in groups i , \n ii and iii are shown in table 1 . in all the study groups , majority of patients were men and above 50 years [ table 1 ] . \n statistically significant number of cases of leukoplakia ( n = 27/29 ; p = 0.001 ) showed signs of dysplasia , but not in cases of lichen planus and oral submucous fibrosis [ table 2 ] . in leukoplakia group , 12 out of 29 cases showed presence of fungal hyphae , in lichen planus nine out of 25 were positive for hyphae , but in oral submucous fibrosis group only four were positive for fungal hyphae . \n distribution of prevalence of fungal hyphae in each study group with or without dysplasia in total cases distribution of prevalence of fungal hyphae in each study groups in total cases the prevalence of fungal hyphae in cases of leukoplakia with dysplasia was 44.44% , in lichen planus was 66.66% and in oral submucous fibrosis , it was 100% . \n out of 27 dysplastic cases of leukoplakia group , 12 cases showed presence of fungal hyphae . in lichen \n planus group out of six cases with dysplasia , four cases showed presence of fungal hyphae and in oral submucous fibrosis group , two cases with dysplasia also showed presence of hyphae . on comparison of the prevalence , with respect to presence of fungal hyphae between cases with dysplasia and cases without dysplasia , we found that cases of lichen planus and oral submucous fibrosis showed proportionately higher prevalence of fungal hyphae in cases with dysplasia as compared to leukoplakia . \n but the above results were not statistically significant [ table 4 and graph 2 ] . \n distribution of prevalence of fungal hyphae in cases with dysplasia between three study groups distribution of prevalence of fungal hyphae in cases with dysplasia between three study groups in cases of leukoplakia , the degree of epithelial dysplasia was significantly associated with presence of fungal hyphae [ table 5 ] . \n out of twelve cases of mild dysplasia three were positive for fungal hyphae by pas and gms staining . \n [ figure 2a and b ] out of nine cases of moderate dysplasia , five were positive for fungal hyphae by pas and gms staining . \n [ figure 3a and b ] in severe dysplasia ; out of four cases , three were positive for fungal hyphae [ figure 4a and b and table 5 ] . \n ( a ) superficial colonization of fungal hyphae in cornified layer in mild dysplasia ( pas stain , x200 ) . \n ( b ) superficial colonization of fungal hyphae in cornified layer in mild dysplasia ( gms stain , x400 ) ( a ) fungal hyphae in cornified layer in moderate dysplasia ( pas stain , x400 ) . \n ( b ) fungal hyphae in cornified layer in moderate dysplasia ( gms stain , x400 ) ( a ) hyperkeratosis and hyperplasia , superficial colonization of fungal hyphae in severe dysplasia ( pas stain , x400 ) . \n ( b ) fungal hyphae in cornified layer in severe dysplasia ( gms stain , x400 ) association of degree of epithelial dysplasia with presence of fungal hyphae in cases of leukoplakia ( group i ) in lichen planus , the degree of epithelial dysplasia was not significantly associated with presence of fungal hyphae . \n out of three cases each of mild and moderate dysplasia , two each were positive for fungal hyphae by pas and gms [ figure 5a and b and table 6 ] . \n ( a ) invading fungal hyphae in cornified layer in lichen planus a ( pas stain , x100 ) . \n ( b ) invading fungal hyphae in cornified layer in lichen planus ( gms stain , x100 ) association of degree of epithelial dysplasia with presence of fungal hyphae in cases of lichen planus ( group ii ) in oral submucous fibrosis , the degree of epithelial dysplasia was significantly associated with presence of fungal hyphae . \n one case each with mild and moderate dysplasia showed presence of fungal hyphae by pas and gms [ figure 6a and b and table 7 ] . \n ( a ) fungal hyphae in cornified layer in oral submucous fibrosis ( pas stain , x 400 ) . \n ( b ) fungal hyphae in cornified layer in oral submucous fibrosis ( gms stain , x400 ) association of degree of epithelial dysplasia with presence of fungal hyphae in cases of oral submucous fibrosis ( group iii ) the association of degree of epithelial dysplasia with presence or absence of fungal hyphae was statistically significant ( p - value 0.003 ) in all three study groups [ table 8 and graph 3 ] . \n association of degree of epithelial dysplasia with presence or absence of fungal hyphae in all cases association of degree of epithelial dysplasia with presence or absence of fungal hyphae in all cases \n oral cancer is the sixth most common cancer in the world and is largely preventable . \n it accounts for approximately 4% of all cancers and 2% of all cancer deaths worldwide . in india , \n oral cancer is the commonest malignant neoplasm , accounting for 2030% of all cancers with a death : registration ratio of 0.45 . \n more than 80% of oral cancers are squamous cell carcinomas arising from the oral mucosa with the tongue being the commonest site . \n potentially malignant lesions are those in which the oral mucosa locally has undergone sufficient cytological change as to render it more likely than normal tissue to become malignant . the majority , if not all potentially malignant conditions are systemic disorders that result in atrophy of the oral mucosa resulting in increased penetrance of carcinogens . at the present time \n it is not possible to differentiate the lesions that will ultimately progress to invasive carcinoma and as such warrant early aggressive treatment from those that will regress and can safely be left alone . \n reibel in 2003 reviewed the concept of a two - step process of cancer development in the oral mucosa . \n intraepithelial neoplasia and potentially malignant have been used in the international literature to broadly describe clinical presentations that may have a potential to become malignant . \n follow - up studies have shown that between < 1 and 18% of oral premalignant lesions will develop into oral cancer and few clinical subtypes of leukoplakia are at a higher risk for malignant transformation than others . \n the presence of epithelial dysplasia is more important in predicting malignant development than the clinical characteristics . \n sir james paget is credited with the first description of an association between an oral lesion ( which he termed ichthyosis ) and subsequent development of tongue carcinoma . since then , there has been clinical , morphological and experimental evidence of a correlation between certain lesions in the oral cavity and subsequent development of oral cancer . \n conflicting evidence exists for the role of various infectious agents in the etiology of precancer and oral cancer that includes human papillomavirus ( hpv ) and herpes simplex virus ( hsv ) . among the fungi , c. \n albicans is the most common microorganism to pose a possible risk factor for the malignant transformation in premalignant lesions and conditions . \n few studies have also indicated that presence of candidal infection may increase the risk of a premalignant lesion and conditions turning malignant . \n oral lesions probably caused by candida have been reported since the time of hippocrates , as early as 377 bce . \n langenbeck in 1839 is credited as a pioneer in recognizing a fungus , consistent with c. albicans in an oral aphtha ( ulcer ) of a patient with typhoid fever . \n the association of candidal infection with leukoplakia was first reported by cernea et al . , and jepsen and winther in 1965 . \n indeed , it is well - known that candida species are keratophilic and they tend to colonize thick layers of keratin . \n the role played by various candida species in initiating oral epithelial lesions is ill understood . \n cawson and lehner ( 1968 ) first suggested a possible etiological relationship between leukoplakia and candidal infection on finding mycelial elements of c. albicans infiltrating the cornified layer of the epithelium in some cases of human oral leukoplakia . \n but other authors have regarded c. albicans as a secondary invader rather than the cause of the leukoplakia in those cases in which it is found . \n the concept of carcinogenic potential of candida has received support from a study which demonstrated that certain c. albicans biotypes are capable of producing carcinogenic nitrosamine n - nitrosobenzyl methylamine from its precursors . \n they also showed that strains with high nitrosation potential were associated with lesions showing more advanced precancerous changes . \n the present study was carried out in patients with potentially malignant lesions and conditions such as leukoplakia , lichen planus and submucous fibrosis with the aim to compare the prevalence of presence of fungal hyphae ; to find out the association if any , with presence or absence of fungal hyphae and various grades of dysplasia ; and to test the prognostic significance of this information . \n biopsy - based studies have reported candidal hyphae to constitute 750% in leukoplakia . in our study , we found 41.44% prevalence of presence of fungal hyphae in cases of leukoplakia with or without dysplasia [ table 3 and graph 1 ] . \n this finding was in close approximation with the findings of the other studies , such as studies by krogh et al . \n in contrast to our findings , few studies showed much lower prevalence of fungal hyphae in tissue sections ; they are , berret et al . , 1998 ( 7.1% ) ; banoczy and csiba 1976 ( 13.5% ) , silverman et al . , 1984 ( 23% ) . in our study among 29 cases of leukoplakia , 12 ( 44.44% ) \n cases showed presence of fungal hyphae and all the 12 ( 100% ) cases showed dysplasia in various grades [ table 4 ] . \n the prevalence of fungal hyphae in cases of lichen planus in our study was 36% with or without dysplasia [ table 3 and graph 1 ] . in biopsy - based studies , the reported candidal colonization rates ranged from 0to 17.7% , without preference for a particular clinical presentation . \n our study showed substantially greater prevalence of fungal hyphae in lichen planus than that suggested by previous biopsy - based studies by vuekovic et al . , 2004 ( 22.22% ) ; lundstrom et al . , \n 1984 ( 7% ) ; holmstrup and dabelsreen , 1974 ( 2.3% ) ; and hatchuel et al . \n , 1984 could have been caused by prior treatment with amphotercin b before biopsy in six of 39 patients . in a study by krogh et al . \n , 1987 ; only reticular lichen planus was included and possibly this restriction excluded infected cases that could have had an altered clinical presentation , further possibility might be that in study by holmstrup p and dabelsreen 1974 lichen planus cases with candidal infection could have been classified as candidiasis and hence would not have been accessible in retrospective studies . \n comparatively higher prevalence of candidal hyphae in lichen planus biopsies in our study suggests that lichen planus could be predisposing condition to candidal infection . in lichen planus , \n the oral mucosal pathology alters the integrity of the oral epithelium and predisposes the lesion to fungal infection ( lundstrom et al . , 1984 ) . \n similarly , we found 25% prevalence of fungal hyphae in cases of submucous fibrosis with or without dysplasia [ table 3 and graph 1 ] . \n our results are compatible with results obtained by kumar et al . , 2009 ; where they found positive hyphae in eight ( 33.33% ) out of 24 cases . \n lack of published data on the occurrence of fungal hyphae in biopsy - based studies of submucous fibrosis makes comparison of our data with other studies difficult . \n the prevalence of fungal hyphae was studied in cases with signs of dysplasia and we found significantly higher proportion of fungal hyphae in dysplasia cases ( leukoplakia 44.44% , lichen planus 66.66% and submucous fibrosis 100% ) [ table 4 and graph 2 ] . \n we obtained statistically significant association between histopathologically determined fungal hyphae and various grades of epithelial dysplasia in these individual lesions [ tables 58 and graph 3 ] . \n the results of our study were compatible with results obtained by zhang et al . , ( 1994 ) ; berret et al . , ( 1998 ) ; mccullough et al . , ( 2002 ) \n ; spolidorio et al . , ( 2003 ) . the discrepancy in percentage prevalence of fungal hyphae in tissue sections in our study when compared to various studies \n it is possible that overall detection rate of 5% represents an underestimate and there is abundant evidence that values of fungal infection as assessed by pas staining are lower than those obtained by culture and using the pas stain there is 13% chance of missing fungal infection , particularly if hyphae are scarce or only one section is analyzed ( roed - petersen et al . , 1970 ) . \n on the other hand , histopathology is the quickest means of identifying those cases in which microorganisms have invaded the epithelium where they are more likely to be pathogenic . \n non - invasive hyphae and yeasts may be detected in smears or grown in culture , but lost during histological processing ( cawson , 1968 ) , producing a negative result on staining the section with pas . \n despite this possible underestimate , our study has observed a significant association of fungal hyphae with various grades of dysplasia and only in few cases without dysplasia . \n our study confirms an increased frequency of fungal hyphae in some potentially malignant lesions and conditions and these results are in agreement with field et al . , 1989 . \n though the staining pattern of fungal hyphae by pas and gms was similar , we found that the staining intensity was better with gms than pas . \n our study suggests that , routine pas or gms staining should be advised whenever signs of candidal infection such as superficial abscess formation , chronic inflammation in lamina propria , epithelial hyperkeratosis and hyperplasia and presence of weak hematoxyphilic hyphae are observed in h and e stained sections of oral mucosal biopsies . \n it also emphasizes the important role histopathology plays in the diagnosis of fungal infection . on histopathological confirmation of epithelial dysplasia \n a histopathological report of unexpected fungal infection is likely to be acted on clinically and may affect the patient 's management and prognosis ( berret et al . , \n so we suggest future studies involving larger sample size and species isolation in potentially malignant lesions and conditions to bring about a revolution in the early detection , prevention , management and prognosis of these lesions . \n epithelial dysplasia and prevalence of fungal hyphae in leukoplakia was significantly higher as compared to lichen planus and submucous fibrosis . \n the degree of epithelial dysplasia was significantly associated with presence or absence of fungal hyphae in all cases . \n this indicates a significant association between presence of fungal hyphae and various grades of epithelial dysplasia .", "role": "user" }, { "content": "background : oral cancer is a major public health problem in india . a key factor that has led to lack of improvement in prognosis of oral cancer over the years , is delay in diagnosis and treatment . in many instances , \n a significant proportion of oral squamous cell carcinomas develop from premalignant lesions and conditions . \n identification of such lesions and conditions is very important in order to prevent malignant transformation . \n the role of fungal infections has been studied and holds promise as an indicator to predict malignant transformation . \n so we designed a study to analyze the prevalence of fungal hyphae in biopsies of patients with clinically diagnosed cases of premalignant lesions and conditions.aims and objectives : to determine and compare the prevalence of fungal hyphae in biopsies of patients with clinically diagnosed cases of potentially malignant lesions and conditions and to assess the possible association between the degree of epithelial dysplasia and presence or absence of fungal hyphae.materials and methods : clinically suspected and histopathologically diagnosed 70 cases of potentially malignant lesions and conditions ( 29 leukoplakia , 16 submucous fibrosis and 25 lichen planus ) made up the study group . \n three tissue sections ( 5m ) of each were stained with hematoxylin and eosin ( h and e ) , periodic acid schiff 's reagent ( pas ) and grocott 's methenamine silver ( gms ) and evaluated for fungal hyphae . \n the data collected was statistically analyzed by using chi - square test and statistical package for social sciences ( spss ) software.results:the estimated prevalence of fungal hyphae in cases with or without dysplasia in leukoplakia was 41.4% , lichen planus 36% and submucous fibrosis 25% . \n there was a significant association between degree of epithelial dysplasia with presence or absence of fungal hyphae in all the study groups.conclusion:presence of fungal hyphae in potentially malignant lesions and conditions may prove to be a useful indicator in predicting malignant transformation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: phagocytes that express s100a8 and s100a9 proteins belong to the first group of cells that infiltrate in inflammatory sites and play a pivotal role in innate immune responses [ 1 , 2 ] . these proteins have attracted a special interest due to their high cytosolic concentration in phagocytes and their high intracellular calcium - binding capacity [ 3 , 4 ] . increased plasma levels of s100a8/a9 have been found in patients suffering from a number of inflammatory disorders , including rheumatoid arthritis , inflammatory bowel disease , cystic fibrosis , psoriasis , diabetes , systemic lupus erythematosus , multiple sclerosis , and atherosclerosis , making this complex a very useful biomarker of inflammatory diseases [ 58 ] . \n extracellular s100a9 induces neutrophil chemotaxis and adhesion [ 911 ] , macrophage chemotaxis , degranulation , and activation of neutrophils [ 1315 ] and enhances proinflammatory cytokine production by macrophages and peripheral blood mononuclear cells [ 16 , 17 ] . \n s100a9 regulates myeloid cell function by binding to toll - like receptors- ( tlr- ) 4 and the receptor for advanced glycation end products ( rage ) and by modulating microtubule reorganization during transendothelial migration , resulting in proinflammatory effects . \n however , s100a9 expression also has anti - inflammatory effects , by deactivation of activated peritoneal macrophages and suppression of macrophage activation following phagocytosis of apoptotic neutrophils . \n our group has previously demonstrated that human s100a9 and the synthetic peptide corresponding to the c - terminal portion of the murine s100a9 protein ( ms100a9p ) have antinociceptive activity in inflammatory pain models [ 2226 ] . \n further , we showed that ms100a9p inhibits the spreading and phagocytic activity of adherent peritoneal cells stimulated or not with proteinase - activated receptor-1 [ 27 , 28 ] . \n thus , s100a9 has both proinflammatory and anti - inflammatory activities , emphasizing the need to further study its dual roles . \n the peritoneal cavity is a unique compartment within which a variety of immune cells reside , such as different macrophages subsets and b-1 cells . \n b-1 cells represent the main b lymphocyte population in the peritoneal and pleural cavities of mice . \n b-1 cells express high levels of igm , low levels of igd , and cd11b on their cell surface and can be subdivided into b-1a ( cd5 ) and b-1b ( cd5 ) cells , which develop from distinct progenitor cells [ 31 , 32 ] . \n b-1b cells proliferate spontaneously in stationary cultures of adherent mouse peritoneal cells and differentiate into a novel type of mononuclear phagocytes . \n furthermore , b-1b cells leave peritoneal cavity and migrate to inflammatory sites , where they are transformed into a novel type of mononuclear phagocytes , which perform the functions of adhesion , spreading and phagocytosis . \n the egress from the peritoneal cavity occurs by direct signals through toll - like receptors , resulting in downregulation of integrins and cd9 expression on b-1 cells , which are essential for their mobilization and participation in immune responses . \n b-1 cells can also influence the inflammatory milieu once they are pivotal for giant cell formation , wound - healing process via il-10 , and inhibition of macrophage activities , also mediated by il-10 . \n additionally , data support the hypothesis that b-1 cells downregulate the macrophage inflammatory response to eliminate parasites , exert a tolerogenic function in a model of allergic reaction , and modulate the innate immune system in the early phase of endotoxemia [ 41 , 42 ] . considering that peritoneal cavity is constituted by macrophages and b-1 cells , which have phagocytic activity , and that ms100a9p inhibits the activities of adherent peritoneal cells , the aim of the present study was to investigate whether the inhibitory effect induced by the c - terminus of s100a9 protein is dependent on b-1 cells and/or macrophages . \n male balb / c and balb / xid mice ( 1822 g ) and c57bl/6 and c57bl/6 il-10 knockout ( ko ) mice ( 2530 g ) were provided by institutional animal facilities of federal university of so paulo ( cedeme ) . \n male swiss mice ( 1822 g ) were provided by the central animal house of butantan institute . \n five animals were housed per cage , with wood shaving , at a constant ambient room with controlled temperature ( 22c 2c ) and light / dark cycle ( 12/12 hours ) , with free access to water and mice chow pellets , at least two days before the experiments . \n experimental proceedings were in accordance with the guidelines for animal experimentation , and the practices were approved by the institutional animal care committee at the butantan institute ( ceuaib , protocol number 072/2002 ) . \n the peptide h - e - k - l - h - e - n - n - p - r - g - h - g - h - s - h - g - k - g ( h - g ; mw 2128.55 da ) , which is identical to the c - terminus of ms100a9p , was synthesized based on a previously reported sequence . \n the characterization and purification of the peptide were made by hplc , and its mass was evaluated by maldi - tof spectrometry . \n the peptide was diluted in dmso solution ( 15% ) in milli - q water and stored at 20c until the experiments . \n the peptide was used in the concentrations of 0.59 , 1.17 , and 2.35 m ( 0.12 , 0.25 , and 0.5 g , resp . ) , based on previously published results . \n balb / c , balb / xid , c57bl/6 , and c57bl/6 il-10 ko mice were euthanized in a co2 chamber and their peritoneal cavity was washed with 5 ml of cold phosphate - buffered saline ( pbs ) , ph 7.4 . after a gentle massage of the abdominal wall , the peritoneal fluid , containing resident cells , \n total peritoneal cells were counted in a neubauer 's chamber , and differential counts were carried out in smears stained with a panchromatic dye . for all measurements , samples of individual animals were used . \n the assays were always performed in duplicates . bone marrow cells freshly isolated from femora and tibia of swiss mice , euthanized in a co2 chamber were cultured on culture dishes for 7 days in rpmi-1640 medium ( sigma , st . \n louis , mo ) supplemented with 20% heat - inactivated fetal bovine serum and 30% l929 cell - conditioned medium ( lccm ) and used as a source of colony - stimulating factor-1 . \n differentiated macrophages were dispensed into dishes by incubation with pbs supplemented with 2.5 mm edta for 15 min . \n supernatant was removed by centrifugation ( 1.500 rpm/5 min ) , and the cell pellet was resuspended with rpmi medium . \n ms100a9p was incubated for 1 h with adherent macrophages ( 1 10 cells / ml ) during cell spreading . \n phospholipase a2 ( pla2 ) , isolated from crotalus durissus terrificus venom , which inhibits macrophage spreading and phagocytosis , was incubated in the concentrations of 0.85 , 1.78 , and 3.57 m ( 0.12 , 0.25 , and 0.5 g / ml , resp . ) for 1 h with bmdm and used as a positive control to ensure macrophage functionality . \n briefly , peritoneal cells were collected from the abdominal cavity of swiss mice by repeated lavage with 2 ml of rpmi-1640 medium . \n cells ( 2 10/ml ) were dispensed on round glass coverslips ( 13 mm ) in 24-well plates ( costar , tokyo , japan ) and cultures incubated at 37c in 5% co2 for 40 min ; after incubation , nonadherent cells were discarded . \n adherent monolayers were rinsed with rpmi , and subsequently r-10 medium ( rpmi-1640 containing 10% heat - inactivated fetal bovine serum ) was added . \n cultures were then maintained at 37c in 5% co2 for 5 days , without changing the medium , and at that time floating b-1 cells were in large numbers . \n ms100a9p was incubated for 24 h with adherent b-1 cells , during cell spreading . \n bmdm ( 1 10 cells ) were dispensed on round glass coverslips in 24-well plates for 15 min . \n after this period , b-1 cells ( 1 10 cells ) were added directly over adherent macrophages . in another assay \n , b-1 cells were added to the upper compartments of transwell chambers ( costar ) . in both assays , in either the absence or presence of transwell chambers , ms100a9p was incubated concomitantly with b-1 cells for 1 h. the spreading ability of peritoneal cells obtained from balb / c and balb / xid mice , bmdm , or b-1 cells was estimated according to a previously described method . \n briefly , 100 l of cell suspensions in pbs ( 1 10 cells ) was placed onto glass coverslips and left to adhere for 15 min at room temperature . for b-1 cells , \n the adherence was for 3 h. coverslips were washed with pbs and incubated in rpmi medium at 37c for 1 h , in the presence of ms100a9p , during cell spreading . for b-1 cells , \n cells were fixed in a 2.5% glutaraldehyde solution and the index of cell spreading was determined by phase contrast microscopy . \n spread cells were defined as adherent cells which changed their rounded shape to a flattened shape , showing a lower refractilebody and a higher diameter compared to unspread cells . \n coverslips containing adherent and spread cells of the peritoneal cavity of balb / c , balb / xid , c57bl/6 , and c57bl/6 il-10 ko mice or bmdm or b-1 cells were incubated with 1 ml of rpmi medium containing nonopsonized candida albicans in an atmosphere containing 5% co2 for 1 h at 37c . \n the percentage of cells that phagocytosed more than three particles was determined in smears stained with a panchromatic dye , by examination under light microscopy . \n candida albicans ( atcc y-537 ) was cultured in 8% sabouraud 's dextrose broth ( microbiology and mycology laboratories , department of clinical analyses , college of pharmaceutics science , university of so paulo ) at 30c , for one day . \n fungi were suspended in 3 ml of dulbecco 's pbs for determining candida albicans count in neubauer 's chamber , and then the particles were suspended in rpmi medium for the phagocytosis assay . \n candida albicans viability was determined by exclusion of 0.01% methylene blue ( > 98% ) . \n comparisons between experimental and control groups were initially tested by analysis of variance ( anova ) . the alpha level ( significance level related to the probability of rejecting a true hypothesis ) was set at p 0.05 . \n in order to evaluate the involvement of b-1 cells in ms100a9p - induced inhibitory effect on macrophage spreading , we used peritoneal cells obtained from balb / xid mice , which are deficient in b-1 cells . for comparison , \n ms100a9p downregulated spreading of peritoneal cells obtained from balb / c mice in the concentrations of 1.17 and 2.35 m ( 23 and 19% of inhibition , resp . ) \n , when compared with control cells , incubated only with culture medium ( figure 1(a ) ) . on the other hand , ms100a9p , in both concentrations , did not change spreading of peritoneal cells obtained from balb / xid mice ( figure 1(a ) ) . \n in relation to the phagocytic activity of candida albicans particles , ms100a9p did not change the phagocytosis by peritoneal cells obtained from balb / xid mice either ( figure 1(b ) ) . \n ms100a9p inhibited the phagocytosis by peritoneal cells obtained from balb / c mice , in the concentrations of 1.17 and 2.35 m ( 44 and 28% of inhibition , resp . ) \n ( figure 1(b ) ) . to confirm that ms100a9p was unable to downregulate macrophage functions in the absence of b-1 cells , ms100a9p was incubated with bmdm during the spreading assay . \n ms100a9p , in concentrations of 0.59 , 1.17 , and 2.35 m , did not alter bmdm spreading ( figure 2(a ) ) . \n pla2 , the positive control of inhibition of macrophage spreading and phagocytosis , downregulated spreading of bmdm ( 20% to 0.85 m , 24% to 1.78 m , and 24% to 3.57 m ) ( figure 2(a ) ) . \n different concentrations of ms100a9p incubated for 1 h with bmdm during spreading did not downregulate phagocytosis of candida albicans particles ( figure 2(b ) ) . on the other hand , pla2 inhibited phagocytosis by bmdm in all concentrations used ( 32% to 0.85 m , 41% to 1.78 m , and 44% to 3.57 m ) ( figure 2(b ) ) . in an attempt to evaluate if the presence of b-1 cells was primordial to ms100a9p - induced inhibition of macrophage spreading and phagocytosis , we investigated the effect of ms100a9p on bmdm cocultivated directly with b-1 cells . in the presence of the b-1 cells , phagocytosis of candida \n albicans particles by bmdm was inhibited 28 , 31 , and 28% , which corresponded to concentrations of 0.59 , 1.17 , and 2.35 m ms100a9p , respectively ( figure 3(a ) ) . to verify whether the contact between these two cell types was necessary to the inhibitory effect of ms100a9p , cocultures of bmdm and b-1 , in the presence of ms100a9p , \n the absence of direct contact between bmdm and b-1 cells maintained the downregulation of the macrophage phagocytic activity in response to ms100a9p . \n the fall in phagocytosis was 25 , 27 , and 23% , corresponding to concentrations of 0.59 , 1.17 , and 2.35 m ms100a9p , respectively ( figure 3(b ) ) . \n considering the inhibitory effect of ms100a9p in the coculture of bmdm and b-1 , we evaluated whether the peptide also exerted a direct action on b-1 cells . ms100a9p \n induced a statistically significant reduction in spreading of b-1 cells in the concentrations of 0.59 and 1.17 m ( 21 and 26% of inhibition , resp . ) \n in addition , ms100a9p inhibited phagocytosis by b-1 cells , at the concentrations of 0.59 , 1.17 , and 2.25 m ( 34 , 45 , and 36% , resp . ) \n since b-1 cells secrete il-10 , which inhibits murine macrophage phagocytosis in vitro , we evaluated the involvement of il-10 in ms100a9p - induced inhibitory effect on phagocytosis by peritoneal cells obtained from il-10 ko mice . \n peritoneal cells obtained from wild - type mice ( c57bl/6 ) were used as control . \n ms100a9p downregulated phagocytosis by peritoneal cells obtained from wild - type c57bl/6 , in the concentration of 2.35 m ( 25% of inhibition ) , when compared with control cells incubated only with culture medium ( figure 5 ) . \n the peptide , in both concentrations ( 1.17 and 2.35 m ) , did not modify phagocytosis by peritoneal cells from c57bl/6 il-10 ko mice , when compared with control cells ( figure 5 ) . \n the expression of these proteins is restricted to cells of the monocytic / granulocytic lineage , but under certain conditions they may also be expressed by keratinocytes [ 50 , 51 ] . \n it was also demonstrated that newly arrived inflammatory macrophages , but not the resident ones , express s100a8/a9 at inflammatory sites for a short time [ 50 , 52 ] . both proinflammatory and anti - inflammatory functions have been reported for s100a8/a9 , which may depend on several factors , including their concentration , receptors involved in their recognition , their posttranslational modifications , cell types studied , and mediators of the local milieu [ 53 , 54 ] . previous studies of our group demonstrated an inhibitory effect of either s100a9 or its c - terminal portion on an inflammatory nociception model [ 22 , 24 , 26 ] , suggesting that ms100a9p induces a similar effect to that evoked by the complete protein . \n this evidence supports the hypothesis that this peptide has a crucial role in inflammatory events . \n in addition , ms100a9p downregulated the spreading and phagocytosis by adherent peritoneal cells in vivo and ex vivo [ 27 , 28 ] . \n considering the inhibitory effect of ms100a9p on the activities of peritoneal cells and that b-1 cells represent the main b cell population in normal peritoneal cavity of mice , in this study it was investigated whether the inhibitory effect induced by c - terminus of s100a9 protein is related to an action on macrophages and/or b-1 . \n initially , we investigated the effect of ms100a9p on spreading and phagocytosis by peritoneal cells from balb / xid mice , which are deficient in b-1 cells . \n our data showed that ms100a9p did not inhibit the functions of cells obtained from balb / xid mice , suggesting an important role of b-1 cells in ms100a9p - induced inhibitory effect on adherent peritoneal cells . \n these data were supported by other studies showing that absence of b-1 cells in balb / xid mice interfered with the inflammatory response , including the activity and proliferation of peritoneal macrophages [ 38 , 42 ] , control of infection [ 39 , 56 ] , and wound - healing process . to verify that ms100a9p did not act directly on macrophage activity , the effect of ms100a9p on the functional response of bmdm was evaluated . once ms100a9p did not alter the spreading and phagocytosis of bmdm , these data confirm that ms100a9p did not have a direct action on macrophages . \n pla2 , used as a positive control , inhibited spreading and phagocytosis by macrophages , as described elsewhere . \n these results demonstrated that macrophages used in our assays were functioning normally . despite the findings obtained here , suggesting that the inhibitory effect of ms100a9p is not due to a direct action on macrophages , it has been showed that ms100a9p downregulates the phagocytic activity of apoptotic neutrophils by macrophages . \n nevertheless , isolated macrophages have not been used , and the ms100a9p effect was observed on adherent peritoneal cells , which comprise macrophages and b-1 cells . \n this fact could explain the discrepancy between the results presented here and those reported by de lorenzo et al . . \n using coculture assays , it is well established that the function of macrophages is largely regulated by intercellular communication , which influences the development and maintenance of the inflammatory response [ 57 , 58 ] . \n thus , by coculturing b-1 cells with macrophages obtained from balb / xid mice , il-10 secreted by b-1 cells has been demonstrated to modulate murine macrophage phagocytosis . \n considering these data , it was investigated whether b-1 cells treated with ms100a9p could modulate macrophage phagocytosis . \n in addition , in an attempt to show whether the effect of ms100a9p depended on a direct contact between b-1 cells and macrophages , the coculture of these two cell types was performed in the absence or presence of transwell inserts . \n once a downregulatory effect of ms100a9p was observed in both assays , we can suggest that the inhibitory effect of ms100a9p on the adherent peritoneal cells , as previously observed , is mediated by b-1 cells . \n these results also showed that the direct contact between macrophages and b-1 cells is not essential to ms100a9p activity but is related to the secretory activity of b-1 cells . considering that b-1 cells differentiate into a macrophage - like cells , exhibiting the ability to phagocytose either in vitro or in vivo [ 33 , 59 ] \n the data presented here show that ms100a9p downregulated the spreading and phagocytosis by b-1 cells , suggesting that the c - terminus of s100a9 not only modulates the action of b-1 cells , which in turn inhibits the phagocytic activity of macrophages , but also has a direct effect on b-1 cells , probably by a communication via soluble autocrine and paracrine signals . \n also , we did not observe a concentration - dependent effect of ms100a9p on spreading and phagocytosis assays carried out . \n many factors have a regulatory role in macrophage activity , acting as key orchestrators of the inflammatory response . in this sense \n , il-10 has been found to downregulate a number of different macrophage functions , including cytokine production and the respiratory burst [ 60 , 61 ] , acting thereby as an important negative regulator of cell - mediated immunity . \n peritoneal b-1 cells are the major producers of il-10 and they use it to regulate their own development and/or the function of other immunocompetent cells [ 49 , 63 ] . as mentioned earlier , il-10 secreted by b-1 cells downregulates the phagocytic activity of macrophages and modulates the kinetics of wound - healing process . \n further , b-1 cells from il-10 ko mice were not able to inhibit macrophage functions . \n to investigate the il-10 participation in ms100a9p - induced inhibitory effect , we evaluated whether ms100a9p altered the phagocytic activity of peritoneal cells obtained from il-10 ko mice . considering that ms100a9p did not change the activity of these cells , it is plausible to suggest that ms100a9p induces the secretion of il-10 by b-1 cells and consequently inhibits its own functions and the activities of peritoneal macrophages . in this regard , \n it was demonstrated , in vitro and in vivo , that b-1 cells induce macrophage polarization to an m2-like phenotype , which is anti - inflammatory and immunosuppressive in nature , evidencing that il-10 is crucial to modulate macrophage function . \n the mechanism by which ms100a9p regulates il-10 secretion by b-1 cells is not known . however , both b-1 cell activation and il-10 release are regulated by tlr-4 [ 6567 ] , and s100a9 protein acts as an endogenous tlr-4 ligand , regulating thereby myeloid cell function [ 13 , 68 , 69 ] . in this sense , it is plausible to hypothesize that the c - terminus of s100a9 stimulates il-10 secretion by b-1 cells via tlr-4 , suppressing thereby macrophage activities . \n these data emphasize the importance of s100a9 and b-1 cells to orchestrate inflammatory response and its resolution . \n the downregulatory effects of ms100a9p on macrophages are mediated by b-1 cells , possibly via il-10 secretion . taken together \n , our data showed that ms100a9p is a good research tool to understand s100a9 function on the development and maintenance of the inflammatory process and demonstrated a pivotal role of b-1 cells mediating the action of the c - terminus of s100a9 on control of innate immunity .", "role": "user" }, { "content": "the protein s100a9 plays a key role in the control of inflammatory response . \n the c - terminus of the murine s100a9 protein ( ms100a9p ) downregulates the spreading and phagocytic activity of adherent peritoneal cells . \n murine peritoneal cells are constituted by macrophages and b-1 cells , and the latter exert an inhibitory effect on macrophage functions by secreting interleukin- ( il- ) 10 . here , we investigated the influence of b-1 cells on the inhibitory effect evoked by ms100a9p on macrophages \n . ms100a9p did not alter spreading and phagocytosis either by peritoneal macrophages obtained from mice deprived of b-1 cells or by bone marrow - derived macrophages ( bmdm ) . nevertheless , when bmdm were cocultivated by direct or indirect contact with b-1 cells treated with ms100a9p , the phagocytosis by bmdm was decreased , showing that the effect of ms100a9p on macrophages was modulated by b-1 cells and/or their secretory compounds . \n furthermore , the inhibitory action of ms100a9p on phagocytosis by adherent peritoneal cells was abolished in cells obtained from il-10 knockout mice . taken together , \n the results show that ms100a9p has no direct inhibitory effect on macrophages ; however , ms100a9p modulates b-1 cells , which in turn downregulates macrophages , at least in part , via il-10 . \n these data contribute to the characterization of s100a9 functions involving b-1 cells in the regulation of the inflammatory process .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in computer simulation \n studies of protein folding , the folding \n reaction is most often considered under equilibrium conditions ; i.e. , \n one chooses a temperature at which both the unfolded and folded ( native ) \n states of the protein are populated ( shea and brooks ) . under these conditions , provided that the simulated trajectory \n is sufficiently long , the protein experiences many folding / unfolding \n events . \n the results of the equilibrium simulations are typically organized \n in the form of a free energy surface , disconnectivity graph ( becker \n and karplus ) or equilibrium kinetic network \n ( rao and caflisch ) , which describe the \n populations of the characteristic states of the system and the rates \n of transitions between them in the course of repeating folding and \n unfolding . to calculate the time evolution of the system through the \n network , \n the markov process approximation is often employed ( krivov \n et al . , no and fischer , and lane et al . ) . under the usual physiological conditions in the organism , \n then , the folding \n reaction corresponds essentially to first - passage folding \n ( fpf ) , which can be studied with an ensemble of the trajectories that \n are initiated in the unfolded state of the protein ( e.g. , as the polypeptide \n comes of the ribosome ) and are terminated when the native state is \n reached ( chekmarev et al . \n this raises \n the question as to how the equilibrium folding / unfolding results are \n related to fpf . \n in such a comparison , it should be noted that often \n the environment conditions used will be different ; e.g. equilibrium \n folding ( ef ) requires a higher temperature than the fpf , though of \n course , as we do here , it is possible to investigate fpf at the same \n temperature as the ef . \n so far , the fpf simulations have been limited \n to coarse - grained protein models . in an early 125-residue lattice \n protein model study ( dinner and karplus ) , the low - temperature folding pathways resembled the high - temperature \n unfolding pathways , but for the same temperature the pathways were \n different . \n a number of nonequilibrium folding experiments have been \n made , in which a reagent ( e.g. , gdmcl ) stabilizing the unfolded state \n is rapidly diluted and folding ( collapse ) is observed by fret ( lipman \n et al . ) . \n there have been a large \n number of studies of unfolding on the assumption \n that it is the inverse of folding . because unfolding is \n fast at the high temperature usually used , \n unfolding simulations have been found to \n be most meaningful for proteins with two - state kinetics when the unfolded \n states and the native state are separated by a single free energy \n barrier , though two - state kinetics can \n be observed even when there are multiple barriers . \n if the folding kinetics are more complex , e.g. , when a \n range of reaction channels are involved , unfolding is not necessarily \n the reverse of folding . to inquire \n into the relation between the fpf and the ef at a given \n ( elevated ) temperature \n , we examine the antiparallel -sheet \n miniprotein ( called beta3s , figure 1 ) , one \n of the few systems for which the folding reaction under equilibrium \n conditions has been studied in detail with an all - atom representation . \n the published studies are based on a set trajectories of total length \n of 20 s , during which the protein experiences on the order \n of one hundred folding / unfolding events . \n the simulations were performed using the charmm program with an implicit solvent model . to have the \n denatured and native state of the protein both significantly populated , \n the temperature for the simulations was typically chosen to be t = 330 k , which is slightly above the melting temperature \n ( cavalli et al . ) . \n the equilibrium folding \n of this system has been analyzed in many ways , which we do not review \n here ; see ref ( 24 ) for \n a listing of some of the studies . in what follows \n we describe the \n first passage folding and compare it with the ef results obtained \n in our previous work . \n section 2 contains a brief survey of the methods we used \n to perform simulations and analyze the results . \n the lower \n part of the protein corresponds \n to the n - terminal hairpin , and the upper part to the c - terminal hairpin . \n the method used to simulate and analyze \n folding of the beta3s miniprotein \n under first - passage folding ( fpf ) conditions is similar to that employed \n previously for the ef ( kalgin et al . ) . \n the system used is the \n one studied by caflisch and various co - workers . \n the designed \n three - stranded antiparallel 20-residue peptide ( thr1-trp2-ile3-gln4-asn5-gly6-ser7-thr8-lys9-trp10 \n -tyr11-gln12-asn13-gly14-ser15-thr16-lys17-ile18-tyr19-thr20 with \n charged termini ) , shown in figure 1 , was modeled with the charmm program . \n all heavy atoms and the hydrogen atoms bound \n to nitrogen or oxygen atoms were considered explicitly ; param19 force \n field ( neria et al . ) and a default cutoff \n of 7.5 for the nonbonding interactions were used . \n a mean field \n approximation based on the solvent - accessible surface ( sas ) was employed \n to describe the main effects of the aqueous solvent ( ferrara et al . ) . \n the simulations were performed with a time \n step of 2 fs using the berendsen thermostat ( coupling constant of \n 5 ps ) at t = 330 k. for the present protein model , \n this temperature is slightly above the melting temperature . \n two hundred md trajectories started in unfolded \n states of the protein and terminated upon reaching the native - like \n state were generated . \n it is expected that small proteins \n up to size of 1015 kda do not fold until they have left the \n ribosome ( fersht and daggett ) , because , \n as has been shown for barnase fragments and chymotrypsin inhibitor \n 2 ( neira and fersht ) , the last residues \n at the c terminus of the protein have to be free to allow folding . \n consequently , the initial stage of folding is likely to be independent \n of interactions with the ribosome or with chaperones for many proteins . \n this circumstance is used to justify in vitro experimental studies \n of protein folding , where the initial states of the protein are prepared \n by thermal ( temperature - jump experiments ) or chemical ( stopped - flow \n experiments ) denaturation of the native state of a protein . in the present study \n , we used the standard charmm protocol to prepare initial conformations . more specifically , \n an extended conformation of the protein was first minimized ( 200 steps \n of the steepest descent followed by 300 steps of the conjugate gradient \n algorithm ) and then heated to t = 330 k and equilibrated \n for 5 10 time steps . as will be shown below ( section 3 ) , \n the initial conformations thus obtained are similar \n to the most unfolded conformations found under equilibrium folding \n conditions starting with the native state at the temperature of interest \n ( t = 330 k ) . \n the final state where the fpf \n trajectory was terminated is the \n native state of the protein . \n beta3s has a number of native - like conformations \n that differ not only by the hydrogen bond distances , which are used \n below to characterize the protein conformations , but also by orientation \n of the side chains . though the hydrogen bond distances could be used \n to define the native contacts , we employed the side - chain distances . \n specifically , two criteria were tested : one assumed that a native \n contact was formed if the distance between the geometrical centers \n of the side chains of two residues dnat was less than 6.5 , and the other that dnat < 7.5 . \n i| = 1 with i and j the residue \n numbers ) , the numbers of native contacts are nnat = 18 at dnat < 6.5 \n and nnat = 23 at dnat < 7.5 ( figure 2 ) . in the \n latter case , \n five additional contacts appear , which are ( 1,12 ) , ( 4,9 ) , \n ( 5,10 ) , ( 13,18 ) , and ( 18,20 ) contacts . among them , four contacts , \n i.e. , ( 1,12 ) , ( 4,9 ) , ( 13,18 ) , and ( 18,20 ) , were listed in ref ( 18 ) as native contacts . \n therefore , \n we considered dnat < 7.5 to \n be the more suitable criterion , though the effect of the difference \n between the two is not large . with this definition of the final state \n to terminate the trajectory , \n the fraction of the hydrogen bonds in \n the final states was equal to 0.76 on average , i.e. , approximately \n 6 hydrogen bonds among the bonds indicated in figure 1 were present . \n contact maps for two different distances between the geometrical \n centers of the side chains dnat that were \n used to determine native contacts . \n panels a and b are for dnat < 6.5 and dnat < 7.5 , respectively . to characterize \n protein conformations , the hydrogen bond pca ( hb pca ) method was used . in this method , \n the original conformation \n space of the protein in the form of the hydrogen bond distances is \n reduced to a three - dimensional space of collective variables g = ( g1 , g2 , g3 ) space with a specialized \n principal component analysis ( pca ) . \n a \n distinctive feature of this method is that only the formed bonds are \n taken into account to make the folded states more pronounced . \n the \n first three modes corresponding to the largest eigenvalues were chosen \n as the variables g1 , g2 , and g3 . \n because \n the collective variables are linear combinations of the original variables , \n they are measured in the same units as the bond distances , i.e. , in \n angstroms . \n figure 3 also makes clear that the \n variables g1 , g2 , and g3 are different from those for \n the equilibrium folding . \n this difference is due to the fact that the \n set of representative points from which they are calculated in the \n fpf is different from that for the ef . \n triangles and crosses correspond \n to the equilibrium and first - passage folding , respectively . \n the eigenvalues \n are normalized so that their sum is equal to 1 . to divide the representative \n points of the protein states in the g \n = ( g1 , g2 , g3 ) space into clusters , the mclust method by fraley and raftery was used . in this method \n , the collection of \n points is approximated by a set of multidimensional ( in our case 3d ) \n gaussian functions with generally different covariance matrices and \n different weights . \n as \n in the previous studies , protein conformations were discriminated \n according to the secondary \n structure strings ( ssss ) encoded with the dssp alphabet ; i.e. , the letters h , g , i , e , b , t , s , and - \n stand for -helix , 310-helix , -helix , extended , \n isolated -bridge , hydrogen bonded turn , bend , and unstructured \n segments , respectively . with this coding , the native state ( figure 1 ) \n using the first passage \n folding trajectories , the local probability \n flows ( fluxes ) of the transitions j(g ) in \n the space of collective variables g = ( g1 , g2 , g3 ) are determined . \n they are calculated as the 2-fold ( time \n and ensemble ) averages of the local transitions . \n on the basis of these \n fluxes , the folding process is viewed as a steady flow of a folding \n fluid from the unfolded states to the native state , \n with the density of the fluid being proportional to the probability \n for the system to be found at the current point of the g space . \n streamlines of the folding flows can be constructed , \n which are tangent to the local directions of the j(g ) vectors . in the case of two \n dimensions , e.g. , for the projection of the folding flow onto the \n ( g1 , g2 ) plane \n , \n the streamlines can be calculated as the lines corresponding to constant \n values of the stream function , and in the case of \n the three - dimensional space they are visualized with passive tracers \n ( weightless point particles ) . \n to study the first passage folding \n ( fpf ) of beta3s , two hundred \n folding trajectories were initiated at an extended state of the protein \n and terminated upon reaching a native - like state . \n because of some \n looseness in determining the native contacts ( section 2 ) , the native - like state was considered to be reached if the \n number of native contacts was not less than 23 , i.e. , nnat 1 \n . specifically , the criterion dnat < 7.5 was used to determine a native contact . \n the change of this criterion to a more stiff \n one ( dnat < 6.5 ) , which decreased the number \n of native contacts from 23 to 18 , was found to have no significant \n effect . \n in particular , the first passage time distributions for the \n two criteria agree not only between themselves but also with the corresponding \n distribution obtained by krivov et al . \n the temperature at which these \n simulations were performed was the same as in the equilibrium simulations , \n i.e. , t = 330 k. the representative points were taken \n from these trajectories at 20 ps intervals , which resulted in the \n total number of points 1.2 10 ; i.e. , the \n number of points is approximately equal to that for the ef studies \n ( 1 10 ) . \n survival probability distributions of the first \n passage time f(t ) = tp(t ) dt , where p(t ) is the distribution of the first passage \n times . \n empty and solid triangles are , respectively , for dnat < 6.5 and dnat < 7.5 in the present work , and the crosses present the \n distribution of ref ( 21 ) . \n the number of trajectories for dnat < 6.5 ( the empty triangles ) was 4 times smaller than for dnat < 7.5 ( the solid triangles ) . \n the \n circles show the distribution corresponding to the first - passage folding \n segments of the ef trajectory of ref ( 24 ) . \n figure 5a presents the distribution \n of the \n representative points in the 3d space of the collective variables g = ( g1 , g2 , g3 ) obtained with the hb pca \n method for ef , and figure 5b shows the corresponding \n results for the fpf . \n the points are colored according to the clusters \n of characteristic conformations to which they belong . \n they are numbered \n in accord with tables 1 and 2 , respectively ; the orange points without a number correspond \n to other clusters . \n the variables g1 , g2 , and g3 in figure 5a , b , as well as in similar figures below , are measured \n in angstroms . \n we note that these variables are different for the ef \n and fpf calculations because they are calculated from different collections \n of representative points . as in the ef , \n if two points ( 1 and 2 ) in the g space are sufficiently \n distant , so that the protein conformations do not overlap in the hydrogen \n bond space , the distance between them g = [ i=1i=3(gi(2 ) \n gi(1 ) ) ] is proportional to the all - atom \n rmsd between the corresponding protein conformations ( figure 6 ) ; this holds at approximately for g > 3.6 . due to this relation \n , the distribution of the spatially \n separated clusters in the g space can be viewed as a \n distribution in the rmsd space . \n it should be noted that because the \n variables g1 , g2 , and g3 are different for the ef and \n fpf ( figure 3 ) , the scaling is different : in \n the former case one unit in the g space corresponds to \n approximately 0.14 in the rmsd space , and in the latter to \n approximately 0.07 . \n stereoviews of the distribution of the representative \n points of \n beta3s in the 3d spaces of collective variables g = ( g1 , g2 , g3 ) . \n panel a is for the equilibrium folding ( reproduced \n with permission from ref ( 24 ) ) , and panel b is for the first - passage folding . in both \n cases , the g1 , g2 , and g3 variables are in angstroms . \n all - atom rmsd as a function of the distance \n in the g space . \n the solid and empty triangles correspond \n to the equilibrium \n and first - passage folding , respectively . \n the solid and dashed lines \n show the best fits to the data with the slopes of the lines 0.14 \n and 0.07 , respectively . \n cluster weight equal \n to the number \n of representative points in the cluster relative to the total number \n of the points ( in % ) . \n weight of the given conformation \n in the cluster ( in % ) . corresponds \n to figure 4 . \n cluster weight \n equal to the number \n of the representative points in the cluster relative to the total \n number of the points ( in % ) . \n tables 1 and 2 show \n the clustering of the points obtained with the mclust program for ef and fpf , respectively . in each table , \n the first column is the cluster number , and the second column is the \n relative number of points in the cluster ( in percentage of the total \n number of 10 and 1.2 10 points , respectively ) . \n also , these tables contain information about the protein secondary \n structures characteristic of each cluster . \n the third column presents \n the number of conformations that have different ssss , the fourth column \n shows the ssss of the two most populated secondary structures , and \n the fifth column the weight of these structures in the cluster . \n finally , \n the last column indicates the type of representative protein conformation \n with which the cluster is associated according to the ssss . \n the representative \n conformations are labeled as in the previous studies of folding of \n beta3s ; i.e. , native stands for native - like \n structures , ns - or for conformations in which the c - terminal \n hairpin is formed and the n - terminal hairpin is unstructured ( or \n means out of register ) , cs - or for \n conformations with the n - terminal hairpin formed and the c - terminal \n unstructured , ch - curl for conformations that have \n a curl - like structure with the c - terminal hairpin formed , and helical \n for conformations that contain a helical region . \n based on the similarity \n of the ssss , the clusters for the structured conformations are grouped \n into five consolidated clusters , which represented \n locally stable characteristic conformations . for the ef , they consist \n of clusters 1 and 2 ( native ) , cluster 3 ( cs - or ) , clusters 5 and 6 \n ( ns - or ) , clusters 8 and 9 ( helical ) , and clusters 10 and 11 ( ch - curl ) . \n also , two intermediate clusters , 4 and 7 , are observed that present \n mixtures of the native - like conformations with the cs - or and ns - or \n conformations and are positioned between the native cluster and the \n cs - or cluster and the ns - or cluster , respectively . with these intermediate \n clusters joined to the native cluster , the residence probabilities \n of the system in the consolidated clusters is in good agreement with \n the results of the previous studies . \n the clusters \n which present unstructured conformations form a pool of conformations \n ( an entropic basin ) that \n connect the clusters of the structured conformations . \n the main \n difference between fpf and ef is that in the former the \n ch - curl conformations become so rare that they do not form a cluster , \n whereas the weight of the helical conformations drastically increases \n ( tables 1 and 2 and \n figure 5a , b ) . \n this effect appears to be due \n to the fact that the ensemble of initial structures in the fpf consists \n of conformations that readily form helical conformations . \n figure 7a shows the points in the g space at \n which the trajectories were started . \n it is seen that they lie on the \n boundary of the conformation space visited by the system , or more \n specifically , on the part of it that is close to the helical conformations , \n but they do not contain the hydrogen bonds between i and i + 4 residues that are characteristic of helices . \n secondary structure of these conformations \n ( i.e. , a hairpin - like form with distant strands and the presence of \n local chain bends ) suggests that because they involve short - range \n contacts , the formation of helical conformations is dynamically much \n more likely than the formation of ch - curl conformations , because the \n latter require the n- and c - terminal strands to come into contact \n that are distant along the chain . \n according to the criterion we used \n to define the native contacts , dnat < \n 7.5 ( section 2 ) , the average number \n of native contacts in the initial conformations is equal to 8 , i.e. , \n approximately 27% of the total number of native contacts ( nnat = 23 ) . \n in addition , a comparable number \n of non - native contacts ( on average , 11 contacts ) is present in these \n conformations . \n the 200 conformations , which make up the initial states , \n are 200/(1.2 10 ) 0.017% of the total number \n of the recorded conformations . for comparison , \n the number of corresponding \n conformations along the 20 s equilibrium trajectory ( i.e. , the conformations that have the numbers \n of contacts not exceeding 8 native and 11 non - native contacts ) is \n equal to 543 , which is 0.05% of the total number of the conformations \n that were included in the analysis . \n this suggests that the conformations \n from which the fpf trajectories were started approximate the most \n unfolded conformations that occurred in ef . first - passage \n folding . \n panel a depicts the starting points superposed \n on the distribution of the representative points of figure 5b . \n the clusters of the representative points are \n colored according to this figure and , to make the starting points \n visible , are shown as semitransparent objects . \n panel b reproduces \n figure 5b in the same orientation as for ( a ) . \n a closer examination \n of the fpf shows that the ch - curl conformations \n that constitute a considerable fraction of the conformations observed \n in the course of ef are found only in 20 of the 200 trajectories , \n with the total fraction of them ( 1.2 10 \n 0.054 0.014 900 , cluster 14 in table 2 ) being 6.8 times smaller than for the ef ( 1 \n 10 [ 0.033 ( 0.056 + 0.045)+0.044 ( 0.033 \n + 0.032 ) ] 6200 , clusters 10 and 11 in table 1 ) . at the same time , \n the weight of the helical conformations \n increases , from 12.8% to 21.8% , which is comparable \n with the total weight of the cs - or , ns - or , and helical clusters in \n the ef ( tables 1 and 2 ) . \n it is of interest that if the representative points for the fpf \n are projected onto the collective variables g1 , g2 , and g3 for the ef , a cluster for ch - curl conformations emerges and \n has a weight 2.2% . \n the weights of the other clusters also change but \n not greatly , staying within the variations of the weights of these \n clusters that are obtained with different methods ( table 2 of ref ( 24 ) ) ; for the native , cs - or , \n and helical clusters they decrease by 2030% , and for the ns - or \n cluster it increases by 35% . \n these changes , and particular the appearance \n of the ch - curl cluster , indicate that the principal coordinates obtained \n with the hb pca method are specific to the manifold of the representative \n points to which the method is applied , and thus to the process that \n produces this manifold . \n we note also that the cluster of native - like \n conformations at which the trajectories were terminated in the fpf \n simulations is as significant as for the ef simulations . \n this is true \n mainly because a variety of conformations corresponding to the condition nnat 1 used to terminate the trajectory \n exists that have different coordinates in the g space . \n the increased contribution of helical conformations also affects \n the hydrogen bond composition of the collective variables ( figure 9 ) . \n the variables g1 and g2 in the fpf have the largest projections onto \n the same eight bonds as they had in the case of the ef , and they thus \n play a similar role as in the ef ; i.e. , g1 serves as a good reaction coordinate for the overall description \n of the folding process , and g2 discriminates \n between the ns - or and cs - or conformations . \n however , the role of the g3 variable \n is essentially different : athough in the ef g3 can not be associated with any secondary structure element , in the case of the fpf , it has the largest projections \n on the bonds characteristic of helical conformations , i.e. , the hydrogen \n bonds between i and i + 4 residues . \n the most important bonds among them are at the n - terminal end , in \n agreement with their ssss in table 2 . \n fractions of \n the hydrogen bonds which make a major contribution \n to the collective variables g1 , g2 , and g3 . \n panel \n a is for the equilibrium folding ( reproduced with permission from \n ref ( 24 ) ) , and panel \n b is for the first - passage folding . the figures at the top of each \n bar denote the bond ; the first figure is the number of the residue \n with the oxygen atom , and the second figure is that with the nitrogen \n atom . \n the empty and solid bars are for the bond contributions to the \n negative and positive directions of the collective variable , respectively . \n the numbers in percentage at the top of each panel are the total contribution \n of the given bonds to the collective variable . \n panels a and b of figure 10 present \n spatial \n kinetic networks for the ef and fpf , which show how the clusters of \n protein conformations are connected in these cases . \n the ball volumes \n are proportional to the number of intracluster transitions , and the \n tube cross sections to the number of intercluster transitions ( the \n latter were calculated as one - half of the total number of the forward \n and backward transitions between two clusters ) . more clearly , the \n difference between the cluster interconnection is seen from the paths \n of passive tracers ( figure 11a , b ) and a directed \n kinetic network for the fpf ( figure 12 ) . in \n figure 11a , b the paths were initiated , respectively , \n at the representative points of figure 5a , b \n with the largest fluxes j(g ) and continued \n for some time ( for details , see ref ( 24 ) ) ; the number of the points is equal to 900 for \n the ef and to 766 for the fpf . \n it is seen that in the fpf , in contrast \n to the ef , there are many tracer paths between the clusters for unstructured \n conformations and the native cluster , whereas the direct paths between \n the ns - or ( 5 ) and cs - or ( 2 and 3 ) clusters and the native cluster \n ( 1 ) are absent . because the intensity of a tracer path is proportional \n to the ( average ) flux j(g ) \n , the absence of the path can be a result of either the lack \n of the transitions or the presence of detailed balance . as is seen \n from figure 10b , the numbers of transitions \n between the ns - or and cr - or clusters and the native cluster ( the cross \n sections of the tubes ) are comparable with those from the clusters \n for unstructured conformations to the native cluster . \n it follows that \n detailed balance between the ns - or and cr - or clusters and the native \n cluster exists . \n this is confirmed by the directed kinetic network , \n depicted in figure 12 , in which the tubes of \n the transitions between the clusters are taken to be proportional \n to the difference between the upward and backward transitions ( to \n make the picture more clear , the tubes with not less than ten transitions , \n among the total number of transition 10 , are not \n shown ) . \n moreover , direct counting of the numbers of transitions between \n the cr - or and ns - or clusters and the native cluster shows that detailed \n balance between them is satisfied exactly . \n thus , the overall flow \n goes from the unfolded states to the native state directly , not passing \n through the structured cs - or and ns - or conformations , which supports \n the conclusion that beta3s is a barrierless / low - barrier folder . \n the most probable pathway is illustrated in \n figure 13 , which presents a two - dimensional \n kinetic network corresponding to the directed three - dimensional kinetic \n network of figure 12 . \n the red line that connects \n clusters 7 , 8 , and 9 , besides which the trajectories were started \n ( figure 7 ) , with cluster 1 for native - like \n conformations shows the shortest pathway , which was calculated using \n the bellman \n panel a is for the \n equilibrium folding ( reproduced with permission from ref ( 24 ) ) , and panel b is for the \n first - passage folding . \n clusters are numbered as indicated in the text \n and colored according to the palette of figure 5 . \n the units of the g1 , g2 , and g3 variables are in \n angstroms . \n panel a is for the equilibrium \n folding ( reproduced with permission from ref ( 24 ) ) , and panel b is for the \n first - passage folding . \n the balls represent the native , cs - or , ns - or , \n ch - curl , and helical clusters shown in the corresponding panels ( a \n and b ) of figure 10 . \n stereoview of the directed kinetic network of beta3s for the first - passage \n folding . \n clusters are numbered as in table 2 are colored according to the palette of figure 5 . \n the red line shows the most probable ( shortest ) pathway calculated \n with the bellman \n figures 14 and 15 show the fes , two - dimensional streamlines \n and tracer paths of folding \n flows for the ef and fpf , respectively . for the fpf \n the stream function \n is normalized such that = 1 corresponds to the total folding \n flow from the unfolded states to the native basin , i.e. , to 200 folding \n trajectories . \n for the ef , where there is no net flow from the unfolded \n states to the native state , the normalization of the stream function \n was performed by assuming that the total number of ( virtual ) trajectories \n would be less than for the fpf as the ratio of the numbers of frames \n in these cases , i.e. , by 10/1.2 10 \n 0.83 times . because in the case of fpf every folding trajectory initiated \n at an extended state reaches and is terminated in the native basin , \n the total folding flow is the same in each ( g2 = constant ) cross - section . as in the ef , local minima corresponding \n to the clusters of characteristic conformations \n are observed ; they \n are the clusters indicated in table 2 and \n figures 5b , \n 10b , 11b , and 12 . however , the \n flow fields are drastically different from those for the ef , in both \n the streamlines and tracer paths . \n although small vortices are still \n present at the minima , similar to the ef , indicating that the system \n spends some time in them , there exists a pronounced overall folding \n flow from the unfolded states to the native state . \n it is represented \n by streamtubes that originate at the unfolded states of the protein \n ( large values of g1 ) and converge at the \n native state ( g1 10 ) . \n such a behavior of the streamtubes and tracer paths has \n been previously observed in the fpf simulations of an -helical \n hairpin and sh3 domain ( streamtubes and tracer \n paths ) . for the ef , in contrast , neither \n the streamtubes or tracer paths that have such properties are present . \n protein \n folding in two - dimensional ( g1 , g2 ) space , the equilibrium folding \n ( reproduced with permission from ref ( 24 ) ) . \n panel a shows the streamlines superimposed \n on the free energy surfaces ( in kcal / mol ) . \n the blue local minima on \n the surfaces correspond to the clusters indicated in table 1 and figures 5a , 10a , and 11a . in panel \n a , \n the white , gray , and black lines correspond to the stream function \n values \n = 0.01 , = 0 , and = 0.01 , respectively . \n the closed white and black streamlines restrict the vortex regions , \n in which the rotation of folding flows is , respectively , clockwise \n and anticlockwise . \n protein folding in two - dimensional ( g1 , g2 ) space , the \n first - passage folding . \n panel a shows the streamlines superimposed on the free energy surfaces \n ( in kcal / mol ) . \n the blue local minima on the surfaces correspond to \n the clusters indicated in table 2 and figures 5b , 10b , and 11b . in panel \n a , the lower and upper black lines correspond \n to approximately the lower and upper bounds of the total folding flow , \n and the white lines to the half of the flow ( the values of the normalized \n stream function at these lines are = 0.01 , = 0.5 , \n and = 0.9 , respectively ) . \n panels a and b of figure 16 show the dependence \n of the transition rate upon the distance between the clusters of conformations \n in the g space . \n although the scattering of the data for \n the fpf is higher than that for the ef , the reduced standard error \n of partial slopes is comparable it is equal to 9% for \n the ef , and to 11% for the fpf . \n therefore , in the fpf case \n the average decrease of the rates with the distance remains roughly \n exponential and is approximately the same as for the ef . \n as has been \n indicated in ref ( 24 ) , this dependence is in accord with the fact that the distance in \n the g space is correlated with the change in hydrogen \n bonding required to go from one cluster to another . \n the robustness \n of this behavior is of interest ; it shows that though the overall \n folding pictures for the fpf and ef are drastically different , the \n elementary rates , i.e. , the rates of transitions between the clusters , \n remain the same at the same temperature . \n rates of transitions \n between the clusters of conformations vs the \n distances between the centers of the clusters in the g space . \n panel a is for the equilibrium folding ( reproduced with permission \n from ref ( 24 ) ) , and \n panel b is for the first - passage folding . in both cases \n the crosses \n and circles are for the transitions from smaller and larger populated \n clusters , respectively . in panel \n a the dashed line corresponds to \n the best fit for the crosses [ r exp(0.55dg ) ] , and the solid line to that for the circles \n [ r exp(0.58dg ) ] . in panel \n b the corresponding fits are r exp(0.48dg ) and r exp(0.55dg ) , respectively . \n it is of interest to \n compare the folding time distribution for \n the fpf with that obtained from the ef . to determine the latter , we selected all segments of the equilibrium \n trajectory of ref ( 24 ) between two successive visits of the native state . if the considered \n segment contained a conformation with eight of less native contacts \n ( similar to those we chosen for the initial conformations to start \n the trajectories in the fpf simulations , figure 7a ) , \n the part of this segment from the point with the lowest number \n of native contacts to the native state was taken as a first - passage \n trajectory . \n the distribution of the first - passage times \n is very close to that for the fpf ( figure 4 ) . \n figure 17 also depicts the representative \n points of the system that fall into these first - passage trajectories \n ( colored from blue to red ) and the points that are outside the trajectories \n ( black ) . \n comparison of this figure with figure 5a shows that the points within the first - passage trajectories are \n mostly related to the conformations that are distant from the native \n state , including the helical- and ch - curl - like conformations and unfolded \n conformations . \n the points that are outside the first - passage trajectories \n are related to the conformations close to the native state , i.e. , \n those within the cs - or or ns - or clusters , the intermediate clusters , \n and the clusters of native - like conformations . \n stereoviews of the distribution \n of the representative points that \n fall into the first - passage segments of the equilibrium trajectory \n ( colored from blue to red ) and which are outside these trajectories \n ( colored black ) . \n figure 11b suggests that the folding flows \n are very far from uniform . to illustrate this , \n figure 18 shows the distribution of the g1-component of the folding flux j(g ) in \n a g1 = const cross - section of the g space close to the native state . \n however , despite all the \n heterogeneity of the fluxes ( figure 19 ) , their distribution possesses a well pronounced property of self - similarity , \n similar to what was previously found for folding of sh3 domain . to estimate the degree of the heterogeneity \n of the fluxes \n , we calculated the function g(l ) = |jg1,l|/jg1 , where |jg1,l| is the absolute \n value of g1 component of the flow through \n the square of linear size l , m is \n the number of elementary squares covered by the square of size \n l , jg1 = ( 1mjg1,i2/m ) is \n the average flux in g1-direction , and \n the angular brackets denote the averaging over the g1-cross sections of the g = ( g1 , g2 , g3 ) space . \n the linear size l is measured in \n units of the elementary square linear size l , which \n was taken to be 1 . \n it is seen that g(l ) l , where d 0.68 . because d is less than 2 , i.e. , the euclidean dimension expected for a homogeneous \n flow , the flows are fractal , with the exponent d being \n the fractal dimension . \n distribution of the \n folding flux component j1 in the cross - section g1 = 3.0 . \n the first - passage folding . \n heterogeneity of folding fluxes , the \n function g(l ) ( see the text ) . \n the \n symbols show the function g(l ) , \n and the dashed line the best fit to the function g(l ) l ; d 0.68 . \n in this paper we compare \n first - passage folding ( fpf ) ( the process \n of going from the unfolded to the folded state ) with folding under \n equilibrium conditions ( ef ) ( i.e. , when there are many folding and \n unfolding events ) . \n a reason why this is of interest is that generally \n in living systems , the conditions are such that after the protein \n is synthesized on the ribosome , the folded ( native ) protein is stable \n and unfolding is a rare event . \n there is considerable uncertainty \n concerning the initial conditions \n from which folding takes place . \n it is \n possible , for example , that in some cases , partial folding to form \n helices takes place before the polypeptide chain leaves the ribosome . \n however , essentially all of the large number of folding simulations \n have been in aqueous solution in the absence of other cellular elements ; \n exceptions are folding / unfolding studies of the role of groel , for \n example . given that , it is reasonable to argue that the first - passage \n folding simulations described here are likely to be more realistic \n than equilibrium folding simulations . \n the initial stage of the \n fpf occurs from nearly fully unfolded \n conformations , which are relatively rare in the ef simulations , even \n at temperatures where the folded and denatured states are both populated . \n when the trajectory starts to fold from an extended conformation , \n it first reaches either a helical conformation , which is readily formed \n due to the short - range contacts involved , or double hairpin cs - or \n or ns - or conformations , which consist of antiparallel -strands . \n formation of a ch - curl conformation is less probable in fpf than in \n ef because it contains a parallel -strand arrangement ; it is , \n thus , less stable because the hydrogen bonds are distorted in comparison \n to those of the parallel -strand arrangement , and it is more difficult to form dynamically because it \n has distant n- and c - terminal strands . \n the ch - curl conformations become \n so rare that they do not form a cluster , while the weight of the helical \n conformations drastically increases , from 12.8% to 21.8% , \n which is comparable with the total weight of the cs - or , ns - or and \n helical clusters . \n the increased contribution of helical conformations \n also affects the hydrogen bond structure of the collective variables , \n changing the role of the g3 variable : \n although the variables g1 and g2 have the largest projections onto the same \n eight bonds as they had in the case of the equilibrium folding . \n thus , \n they preserve their functions as , respectively , the principal reaction \n coordinate and the coordinate that distinguishes between the cs - or \n or ns - or conformations , the largest projections of g3 , which did not relate to a specific conformation in \n ef , correspond in fpf to the bonds characteristic of helical conformations . \n in other words , the variable g3 captures \n the essential difference between the first - passage and equilibrium \n processes . \n it is of interest that when the representative points for \n the first - passage folding are projected onto the collective variables g1 , g2 , and g3 for the equilibrium folding , a cluster for \n ch - curl conformations emerges , though with a low weight ( 2.2% ) . \n this \n indicates that the principal coordinates obtained with the hb pca \n method are specific to the manifold of the representative points to \n which the method is applied , and thus to the process which produces \n this manifold . \n counting the numbers of transitions between the \n clusters , the 3d \n distribution of the representative points has been represented in \n the form of spatial kinetic networks , undirected and directed . \n these \n networks have shown that the folding flows do not go through the cs - or \n and ns - or structures that are conformationally close to the native \n state , which is consistent with the conclusion that beta3s is a barrierless / low - barrier \n folder . \n easy rearrangement of the cs - or \n and ns - or conformations into the native conformation and back leads \n to detailed balance between these structures and thus makes the flow \n through them negligible ( at least , for the temperature close to the \n melting temperature that is used here ) . \n another essential difference \n between the first - passage and equilibrium \n folding is revealed by the hydrodynamic analysis . \n the projection of the passive tracer paths representing the streamlines \n of the folding flows onto the fess depending on two variables shows \n that in the case of equilibrium folding the folding flow field consists \n of a variety of small vortices , not only at the minima corresponding \n to the clusters of protein conformations ( native , cs - or , ns - or , ch - curl , \n and helical ) but also in flat regions of the pes . \n in contrast , \n the streamlines for the first - passage folding are mostly directed \n from the denatured to the native state , although they are complex \n and do not exactly follow the pes landscape . \n it is of interest that \n despite all the complexity of the folding flows , their distribution \n is self - similar and has fractal dimension ( d \n 0.68 ) . \n a similar property of folding flows has been previously observed \n for folding of the sh3 domain , although \n the fractal dimension was different , varying from d 1.5 for the initial ( almost laminar ) stage \n of folding to d 1 for the final ( turbulent ) \n stage . \n this suggests that the self - similarity of folding flows may \n be an inherent property of protein folding . although there are \n significant differences in the general picture \n of the folding process from the equilibrium and first - passage folding \n simulations , some aspects of the two are in agreement . \n the rate of \n transitions between the clusters of characteristic protein conformations \n in both cases decreases approximately exponentially with the distance \n between the clusters in the hydrogen bond distance space of collective \n variables , and the folding time distribution in the first - passage \n segments of the equilibrium trajectory is in good agreement with that \n for the first - passage folding simulations . \n also , the first - passage \n segments of the ef trajectory that start at an unfolded state of the \n protein and converge to the native state are similar to the trajectories \n in the fpf simulations in that they have similar folding time distributions .", "role": "user" }, { "content": "simulations of first - passage folding \n of the antiparallel -sheet \n miniprotein beta3s , which has been intensively studied under equilibrium \n conditions by a. caflisch and co - workers , show that the kinetics and \n dynamics are significantly different from those for equilibrium folding . \n because the folding of a protein in a living system generally corresponds \n to the former ( i.e. , the folded protein is stable and unfolding is \n a rare event ) , the difference is of interest . \n in contrast to equilibrium \n folding , the ch - curl conformations become very rare because they contain \n unfavorable parallel -strand arrangements , which are difficult \n to form dynamically due to the distant n- and c - terminal strands . \n at the same time , the formation of helical conformations becomes much \n easier ( particularly in the early stage of folding ) due to short - range \n contacts . \n the hydrodynamic descriptions of the folding reaction have \n also revealed that while the equilibrium flow field presented a collection \n of local vortices with closed \n streamlines , the first - passage \n folding is characterized by a pronounced overall flow from the unfolded \n states to the native state . \n the flows through the locally stable structures \n cs - or and ns - or , which are conformationally close to the native state , \n are negligible due to detailed balance established between these structures \n and the native state . \n although there are significant differences in \n the general picture of the folding process from the equilibrium and \n first - passage folding simulations , some aspects of the two are in \n agreement . the rate of transitions between the clusters of characteristic \n protein conformations in both cases decreases approximately exponentially \n with the distance between the clusters in the hydrogen bond distance \n space of collective variables , and the folding time distribution in \n the first - passage segments of the equilibrium trajectory is in good \n agreement with that for the first - passage folding simulations .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the accessibility to the nuclear genetic code regulates transcriptional programs , controls genomic integrity , and critically influences proliferation and differentiation of eukaryotic cells . \n the maintenance of chromatin plasticity plays an essential role in stress responses as well as dynamic homeostatic adaptations to environmental cues ( luger et al . , 2012 , ronan et al . , 2013 , \n the fundamental repeating unit of chromatin is the nucleosome , consisting of 147 bp of dna wrapped around an octamer of histone proteins . \n the formation of local chromatin subdomains with a distinct dna accessibility depends on the intrinsic biochemical properties of the nucleosome components ( luger et al . , 2012 ) . \n the replacement of canonical histones with histone variants often alters the dna binding and its compaction around the core particle . \n while canonical histones are highly expressed exclusively during s phase , variant counterparts are expressed throughout the cell cycle and their incorporation occurs in a replication - independent manner ( weber and henikoff , 2014 ) . exciting new insights have uncovered the relevance of histone variants as regulatory elements of local chromatin structure and dynamics ( banaszynski et al . , 2010 , maze et al . , 2013 , weber and henikoff , 2014 , wenderski and maze , 2016 ) . \n histone variants contain unique larger domains or have limited differences in the amino acid sequences compared to their canonical counterparts . \n the histone variant h3.3 is evolutionarily conserved throughout the animal kingdom ( szenker et al . , 2011 ) . compared to canonical h3 , the four aaig residues in positions 87 to 90 define the motif recognition for the specific binding to the histone chaperones hira and daxx ( dran et al . \n , 2010 , elssser et al . , 2012 , ray - gallet et al . , 2002 , \n two genes encode for an identical h3.3 protein . in the nematode caenorhabditis elegans , h3.3 \n is highly expressed and incorporated during embryogenesis , in different larval stages , and in adult animals ( ooi et al . , 2006 ) . \n similar expression profiles are observed in other metazoans ( banaszynski et al . , 2010 ) . \n h3.3-containing nucleosomes may mark transcriptionally active chromatin , influencing a large number of biological processes ( henikoff , 2009 ) . in neurons , \n activity - dependent transcription of selected immediate early genes requires daxx / atrx - mediated loading of h3.3 in a calcium- and calcineurin - dependent manner ( michod et al . , 2012 ) . \n consistently , loss of hira - mediated h3.3 loading critically impairs chromatin homeostasis and transcriptional regulation in postmitotic cells ( nashun et al . , 2015 ) . \n moreover , h3.3 proteins reach saturation levels in postnatal brains of both rodents and humans ( maze et al . , 2015 , pia and suau , 1987 ) . \n as shown recently , the dynamic turnover of h3.3 is considered a novel epigenetic mechanism regulating plasticity in fully differentiated cells ( maze et al . , 2015 , wenderski and maze , 2016 ) . \n because h3.3 accumulates significantly in post - replicative cells , one should expect a critical contribution of h3.3 to age - related changes of chromatin organization and dna accessibility , with important consequences on organismal aging . despite the biological relevance of this intriguing possibility \n , the importance of h3.3 in pro - longevity signaling pathways still remains unaddressed ( saade et al . , 2015 ) . \n here , we use c. elegans to elucidate the importance of the replication - independent histone variant h3.3 in the context of diverse pro - longevity signaling pathways . \n we demonstrate that genetic deletion of h3.3 impairs the lifespan extension of various long - lived mutants . \n notably , insulin / igf-1/daf-2 mutant animals lacking h3.3 exhibit an altered pattern of gene expression , including many daf-16 target genes . taken together \n , our study clearly demonstrates the relevance of h3.3-mediated epigenetic processes that control lifespan - extending signaling pathways . \n in c. elegans , the five annotated genes his-69 , his-70 , his-71 , his-72 , and his-74 encode h3.3-like proteins ( ooi et al . , 2006 ) . \n however , only the his-71 and his-72 proteins are functional histone h3.3 because they contain the evolutionarily conserved aaig motif and the threonine 31 that can be potentially phosphorylated ( figure 1a ) ( ooi et al . , 2006 ) . \n adult nematodes comprise somatic postmitotic cells and the gonadal tissue of dividing germ cells , where the expression of replication - coupled h3 variants is likely to occur throughout the entire lifespan of the organism . \n to determine h3.3 expression , we initially performed single - cell imaging analysis of nematodes carrying the fluorescent reporter his-72p::his-72::gfp ( ooi et al . , 2006 ) . \n in somatic cells , we observed a significant increase in his-72::gfp fluorescence over time ( figure 1b ) . to confirm these data with an alternative strategy \n specifically , glp-1 temperature - sensitive mutations were used to deplete the organism of dividing germ cells ( arantes - oliveira et al . , 2002 , austin and kimble , 1987 ) . under non - permissive temperature \n , germline - defective animals exhibited an age - dependent increased expression of his-72 and his-71 mrna ( figures 1c and 1d ) . \n consistently , immunoblot analysis of glp-1 mutants carrying the his-72p::his-72::gfp transgene showed a time - dependent increase of the his-72::gfp protein ( figures 1e and s1a ) . because the genomic location may influence the expression of randomly integrated transgenes \n , we obtained additional lines in which the two endogenous his-72 and his-71 sequences were substituted with cdna encoding human h3.3 ( hh3.3 ) fused to a ha - tag and a myc - tag , respectively ( figure 1f ) . in agreement with our previous findings and with earlier studies in mammals ( maze et al . \n , 2015 , pia and suau , 1987 ) , hh3.3-ha and hh3.3-myc protein levels increased over time in glp-1 mutants ( figures 1 g and s1b ) . \n overall , we demonstrate an age - dependent increase of histone h3.3 in c. elegans postmitotic cells . \n complete loss of h3.3 results in lethality in mice and sterility in drosophila melanogaster ( hdl and basler , 2009 , tang et al . , \n we set out to determine the impact of his-72;his-71 loss - of - function ( lf ) on c. elegans lifespan . \n however , h3.3 mutants exhibited a significant bagging phenotype , which involves eggs hatching inside the animal body ( figure 2a ) . \n furthermore , we showed that h3.3-deficient animals survived less when exposed to a stressful concentration of paraquat ( figure 2b ; tables 1 and s1 ) , suggesting that h3.3 may play a role in animal stress resistance and response . \n we assessed the lifespan of wild - type ( wt ) , his-72;his-71 double mutant , and hh3.3-expressing nematodes . \n much to our surprise , h3.3-deficient animals had a similar median lifespan to wt ones , while expression of hh3.3 and his-72::gfp had no effect on c. elegans survival ( figures 2c2e ; tables 1 and s1 ) . \n we reasoned that , while h3.3 is dispensable in a wt background , it might play a role in pro - longevity programs that specifically require active transcription and expression of a broad range of genes . \n mutant nematodes for the insulin / igf-1 receptor daf-2 show a dramatic increase in health and lifespan , often even doubling it compared with wt animals ( kenyon et al . , 1993 ) . \n this lifespan extension is mediated by the transcription factor daf-16/foxo , as daf-16 deletion completely abolishes the long - lived phenotype observed in daf-2 single mutant animals ( lin et al . \n consistent with our hypothesis , his-72;his-71(lf ) significantly affected the lifespan extension of daf-2(e1370 ) animals ( figure 2f ; tables 1 and s1 ) , while deletion of his-72 alone did not ( figure s1c ; tables 1 and s1 ) . \n notably , genetic deletion of h3.3 had a negligible effect on survival of short - lived daf-16;daf-2 double mutant nematodes ( figure 2f ; tables 1 and s1 ) . \n these results strongly suggest that h3.3 is necessary for the proper engagement of pro - survival processes present in daf-2(e1370 ) animals . \n 2015 ) , we hypothesized that h3.3 loss may affect the transcription of pro - survival genes in insulin / igf-1-deficient daf-2 mutants . \n we performed mrna next generation sequencing ( ngs ) on wt , his-72;his-71 , daf-2 , and daf-2;his-72;his-71 mutant animals . \n when we analyzed the number of genes that were significantly up- or downregulated , we found that 993 of them were significantly dysregulated in his-72;his-71 double mutants compared to wt animals ( figures 2 g and 2h ) . \n however , when we analyzed gene expression profiles in daf-2;his-72;his-71 and daf-2 mutants ( figures 2 g and 2h ) , we saw that many of them revert back to wt levels . \n specifically , 54% of the genes that were upregulated in daf-2 animals no longer differed significantly with wt levels in daf-2;his-72;his-71 triple mutant nematodes ( 5% false discovery rate [ fdr ] ) . \n thirty - six percent of the genes that were downregulated in daf-2(e1370 ) animals were no longer significantly affected in h3.3-deficient daf-2(e1370 ) mutants , when compared to wt ones ( 5% fdr ) ( data not shown ) . in daf-2 mutants lacking h3.3 , \n the number of dysregulated genes increased dramatically : 8,220 genes were significantly upregulated or downregulated in daf-2;his-72;his-71 triple mutants compared to hypomorphic daf-2 animals ( figures 2 g and 2h ) . \n these results show that his-72;his-71(lf ) severely impacts gene transcription in long - lived daf-2 mutant animals . \n we identified putative daf-16 target genes from previous chromatin immunoprecipitation sequencing ( chip - seq ) analysis ( modencode.org ) . \n a total of 8,001 genes were found to be immediately downstream of binding sites of daf-16 . following cross - reference with our rna sequencing ( rna - seq ) data \n , we found that 1,208 of those genes were also significantly upregulated in daf-2 mutants ( figure 2i ) . \n of these putative daf-16 targets , 722 ( 60% ) were significantly altered in daf-2;his-72;his-71 triple mutants compared to daf-2 mutant animals ( 5% fdr , figures 2j and 2k ) . \n notably , 65% of those were fully downregulated back to wt expression levels ( 5% fdr , figures 2j and 2k ) , indicating the profound effect of h3.3 deficiency on daf-16-mediated transcriptional programs . to further validate our findings , we performed qrt - pcr of sod-3 and gst-4 , two well - known daf-16 targets ( murphy et al . , 2003 ) . \n we showed that his-72;his-71(lf ) dramatically inhibited the expression of sod-3 and gst-4 in daf-2 mutant animals ( figure 2l ) . \n there was no significant difference in expression levels of these two genes in his-72;his-71 double mutant animals compared to wt ones ( figure 2l ) . \n similarly , sod-3 and gst-4 expression was not altered in daf-16;daf-2;his-72;his-71 quadruple mutant compared to daf-16;daf-2 double mutant animals ( figure 2l ) . \n finally , a first chromatin immunoprecipitation analysis indicated his-72::gfp deposition at sod-3 and m01h9.3 promoters , suggesting that h3.3 may directly affect the expression of daf-16 targets ( figure s1d ) . taken together , we conclude that insulin / igf-1/daf-2 deficiency employs h3.3 for the full engagement of the transcription program and for its beneficial effects on organismal aging . to determine whether the effect on survival was specific for insulin / igf-1/daf-2 impaired animals , we measured the lifespan of other long - lived animals lacking h3.3 . \n we first tested the survival of glp-1 mutants grown under non - permissive temperature . at a restrictive temperature of 25c , glp-1(bn18 ) \n animals lack the germline and are long - lived in a daf-16/foxo - dependent manner ( arantes - oliveira et al . \n , 2002 , libina et al . , 2003 ) when compared to wt , which have a much shorter lifespan than when they are grown at 20c . \n complete loss of h3.3 reduced the lifespan extension due to glp-1 mutations ( figures 3a and 3b ; tables 1 and s1 ) , whereas his-72 or his-71 single mutations did not ( figures s1e and s1f ; tables 1 and s1 ) . \n notably , expression of his-72::gfp as well as hh3.3 almost completely rescued the lifespan effect of his-72;his-71(lf ) in a glp-1 background ( figure 3b ; tables 1 and s1 ) . to determine whether h3.3 contributes exclusively to daf-16-mediated programs , we assessed the impact of h3.3 deletion in the survival of complex i - deficient nuo-6 mutants ( yang and hekimi , 2010 ) . \n as in other long - lived mitochondrial mutant nematodes ( dillin et al . , 2002 , feng et al . , 2001 ) \n , mild decrease of mitochondrial activity promotes metabolic changes and induces a beneficial stress response that ultimately results in an increased lifespan of nuo-6 mutant nematodes . \n we showed that h3.3 loss affected the survival of nuo-6 mutant nematodes , with a resulting median lifespan statistically much shorter than wt ( figure 3c ; tables 1 and s1 ) . \n consistent with our previous observations , h3.3 deficiency considerably altered the expression profile of genes in a nuo-6 background . while h3.3 loss results in expression changes of < 1,000 genes in a wt background ( figures 2 g , 2h , 3d , and 3e ) , we observed a much more dramatic dysregulation ( 6,305 genes ) in nuo-6;his-72;his-71 triple mutants compared to nuo-6 single mutant animals ( figures 3d and 3e ) . taken together \n , these data support a more general role of h3.3 in lifespan regulation of pro - longevity transcriptional programs . \n h3.3 is a replication - independent histone variant and is the main h3 variant in postmitotic cells . \n apart from its role in development ( banaszynski et al . , 2010 ) , h3.3 critically influences cellular senescence , mediates tumor suppression and significantly contributes to cognition and neuronal function ( maze et al . \n consistent with previous findings in mammals , we demonstrated that h3.3 expression increased over time in c. elegans . \n our work focused on the positive role of h3.3 in the regulation of commonly studied lifespan - extending paradigms in c. elegans . \n although h3.3-deficient nematodes were more sensitive to stressful conditions , their survival was not different from wt animals . through ngs analysis , qrt - pcr , and lifespan assays , we conclusively demonstrated that the presence of h3.3 was necessary for the proper engagement of survival programs that ultimately delay age - related phenotypes . indeed , \n whether in impaired insulin / igf-1/daf-2 nematodes , long - lived mitochondrial mutants , or germline - deficient animals , h3.3 deficiency suppressed the anti - aging effects of distinct signaling pathways that significantly lengthen c. elegans lifespan . \n clearly , the impact of h3.3 loss - of - function on longevity varied at different levels . in daf-2(e1370 ) mutants , lack of h3.3 reduced the median survival by almost 30% , while it almost completely abrogated the lifespan extension of glp-1(bn18 ) mutants . remarkably , we found that his-72;his-71(lf ) considerably compromised the survival of nuo-6 mutants and resulted even in a much shorter lifespan compared to wt animals . \n it is tempting to speculate that h3.3 deficiency may transform into detrimental those mitochondrial stress signals that are required in development for promoting longevity of mitochondrial mutant animals ( wang and hekimi , 2015 , yun and finkel , 2014 ) . through our ngs data \n , we demonstrated that h3.3 contributed to the correct expression of many pro - longevity genes , which are essential for the proper stress response and metabolic adaptation in long - lived mutants . \n does h3.3 modulate longevity through a preferential set of transcription factors ? because h3.3 deficiency altered various lifespan - extending paradigms , we favor a model where dynamic h3.3-dependent nucleosomal turnover delays global transcriptional silencing and facilitates epigenetic plasticity in response to various signals . \n we suggest that the loss of this h3 variant is more impactful in those contexts in which active gene transcription critically determines longevity . \n aging and cellular senescence are complex multifaceted processes that inevitably affect the health of living organisms . \n the fitness decline , the progressive accumulation of damage , and the increased susceptibility to diseases are the inevitable consequences of time - dependent loss of homeostatic mechanisms that critically contribute to the proper maintenance of tissue structure and function ( lpez - otn et al . , \n many of the pro - longevity signaling pathways require a certain chromatin landscape that allows the access to the genetic material and , therefore , distinct expression signatures . \n along with a wide range of histone modifications ( dang et al . , 2009 , \n greer et al . , 2010 ) as well as local changes of chromatin structure through the activity of the swi / snf / baf complex ( riedel et al . , 2013 ) , the presence of h3.3 is required for a dynamic chromatin structure that stimulates longevity , perhaps through its continuous turnover as occurs in mammals ( maze et al . , 2015 , \n we propose that the replication - independent histone variant h3.3 is a common epigenetic regulator of various lifespan - extending programs in metazoans and contributes to their longevity by shaping transcriptionally active chromatin subdomains . \n c. elegans strains were grown on ngm plates and on op50 bacteria as a food source . \n the following c. elegans strains were used in this work : wild - type n2 ( bristol ) , ban1 daf-2(e1370)iii , ban126 zuis178[his-72p::his-72::gfp ] , ban131 his-72(tm2066)iii;his-71(ok2289)x , ban141 nuo-6(qm200)i;his-72(tm2066)iii;his-71(ok2289)x , ban147 daf-16(mu86)i;daf-2(e1370)iii;his-72(tm2066)iii;his-71(ok2289)x , ban151 daf-2(e1370)iii;his-72(tm2066)iii;his-71(ok2289)x , ban155 daf-16(mu86)i;daf-2(e1370)iii , ban166 glp-1(or178)iii;zuis178[his-72p::his-72::gfp ] , ban173 glp-1(bn18)iii;his-72(tm2066)iii;his-71(ok2289)x , ban195 his-72(eis1[hh3.3::ha + loxp unc-119(+ ) loxp ] ) ; his-71(eis2[hh3.3::myc + loxp unc-119(+ ) loxp ] ) , ban239 glp-1(bn18)iii;his-72(eis1[hh3.3::ha + loxp unc-119(+ ) loxp]);his-71(eis2[hh3.3::myc + loxp unc-119(+ ) loxp ] ) , ban259 glp-1(bn18)iii;his-72(tm2066)iii;his-71(ok2289)x;zuis178[his-72p::his-72::gfp ] , dg2389 glp-1(bn18)iii , eu552 glp-1(or178)iii , fx2066 his-72(tm2066)iii , jj1850 unc-119(ed3)iii ; zuis178[his-72p::his-72::gfp ] , and rb1781 his-71(ok2289)x . \n embryos were fixed in 2% formaldehyde for 30 min and incubated with 125 mm glycine for 5 min . \n embryos were washed with 1 pbs with protease and phosphatase inhibitors , pelleted , and stored at 80c . \n embryos were washed twice in fa buffer ( 50 mm hepes / koh ph 7.5 , 1 mm edta , 1% triton x-100 , 0.1% sodium deoxycholate , 150 mm nacl ) with 0.1% sarkosyl and protease / phosphatase inhibitors and dounced in a glass dounce homogenizer . \n embryos were sonicated 2 for 15 min in a bioruptor sonicator for 15 cycles of 30 s. cell debris were pelleted and discarded , while bradford assay was used to quantify protein content in the supernatant . \n approximately 0.5 mg of protein was incubated with either -gfp ( cell signaling 2555 ) or -igg ( cell signaling 2729 ) at 4c overnight . \n samples were then incubated with 40 l of magnetic beads ( active motif ) at 4c for 6 hr , and the chromatin was eluted as per the manufacturer s instructions . \n protein was digested with proteinase k at 50c for 1 hr and crosslinks reversed at 65c overnight . \n dna was purified with a qiagen pcr purification kit and qpcr was performed with power sybr green master mix ( applied biosystems ) on a one step plus real time pcr system ( applied biosystems ) with the following primers : sod-3 ( 1 kb upstream of gene ) : f 5-ctgcagtgattcagagaggttga-3 r 5-aacattttcatatttgcatagtcactcc-3 ; sod-3 ( 100 bp upstream of gene ) : f \n r 5-ctgctggtccaaatggtagg-3. ct values were normalized to input and represented as fold enrichment compared to igg - precipitated negative controls . \n animals were transferred to fresh plates every second day and examined for touch - provoked movement and/or pharyngeal pumping , until death . \n oxidative stress assay was performed in late l4 larvae transferred to a 96-well plate and containing 40 l of 200 mm paraquat ( sigma ) per well . \n gfp analysis was performed on 4- and 8-day - old nematodes carrying his-72p::his-72::gfp and treated with levamisole for 5 min . \n were taken using a fully inverted motorized nikon microscope , in association with a yokogawa spinning disk connected to one back - illuminated em - ccd cameras ( andor ixon du-897 , 512 512 pixels , 16 bit , 35 frames / s ) . \n the set up was equipped with a 20 ( nikon ) and 100 oil objectives . \n data were normalized to background . c. elegans populations were synchronized by lysing gravid hermaphrodites in a hypochloride solution and incubating the eggs on standard ngm plates seeded with op50 at 20c \n worms were then collected at the late l4 stage and rna was extracted with a qiagen rneasy kit as per the manufacturer s instructions . for each strain , \n five biological replicates were sent to cegat ( tuebingen , germany ) for mrna next generation sequencing . \n rna extracted from synchronized worm populations was retrotranscribed with qscript cdna supermix ( quanta biosciences ) . \n gene expression analysis was conducted with fast sybr green master mix ( applied biosystems ) on a step one plus real time pcr system ( applied biosystems ) . \n primers used for qrt - pcr are as follows : sod-3 : f 5-ccaaccagcgctgaaattcaatg-3 r 5-ggaaccgaagtcgcgcttaatag-3 ; gst-4 : f 5-gatacttggcaagaaaatttggac-3 r 5-ttgatctacaattgaatcagcgtaa-3 ; his-71 : f 5-agctcctcgcaagcagct-3 r 5-gaaacagctcaacgtttat-3 ; his-72 : f 5-cttccagtcggctgccat-3 \n r 5-tcgagaattggtgatggagc-3 ; and actin : f 5-tgtgatgccagatcttctccat-3 r 5-gagcacggtatcgtcaccaa-3. adult hermaphrodites were sonicated in ice - cold ripa buffer ( sigma ) with protease and phosphatase inhibitors , and resolved on a 12%15% acrylamide gel . \n protein detection was performed with the use of the following primary and secondary antibodies : anti - tubulin ( sigma ) , anti - gfp ( roche ) , anti - ha.11 ( covance ) , anti - h3 ( santa cruz ) , anti - myc - tag ( cell signaling technology ) , and hrp - conjugated anti - mouse secondary antibody ( thermo fisher scientific ) . \n log - rank ( mantel - cox ) test was used for kaplan - meier survival curves . \n pairwise comparison was determined using student s t test , while one - way anova ( dunnett s post hoc correction ) was employed for three or more values . \n densitometric values were expressed as means sem and compared using one - way anova followed by post hoc dunnett s multiple comparisons test . \n statistical significance was defined as p < 0.05 . outliers ( 2 sd away from the mean value ) were included in all calculations . \n performed phenotypic characterization of mutants , oxidative stress assays , chip qpcr , statistical analyses , interpretation of rna - seq data , and manuscript editing . \n contributed to scientific discussion and manuscript editing . d.b . supervised the work and wrote the manuscript", "role": "user" }, { "content": "summarychromatin structure orchestrates the accessibility to the genetic material . \n replication - independent histone variants control transcriptional plasticity in postmitotic cells . \n the life - long accumulation of these histones has been described , yet the implications on organismal aging remain elusive . here , we study the importance of the histone variant h3.3 in caenorhabditis elegans longevity pathways . we show that h3.3-deficient nematodes have negligible lifespan differences compared to wild - type animals . \n however , h3.3 is essential for the lifespan extension of c. elegans mutants in which pronounced transcriptional changes control longevity programs . \n notably , h3.3 loss critically affects the expression of a very large number of genes in long - lived nematodes , resulting in transcriptional profiles similar to wild - type animals . \n we conclude that h3.3 positively contributes to diverse lifespan - extending signaling pathways , with potential implications on age - related processes in multicellular organisms .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: adaptive condylar displacement ( cd ) refers to the shift from a seated condylar position or centric relation ( cr ) to a condylar position corresponding to maximum intercuspation ( mi ) . \n consequently , cd may have diagnostic and clinical implications.1,2,3,4 orthodontists who follow the functional occlusion principles published by roth1 accept that when the normal proportional relation of 0.75 between the posterior cranial base ( sella - articulare ) and ramus height ( articulare - gonion ) increases to a value of 1.0 , the risk of an adapted intra - articular condyle shift increases , making the assessment of the mandibular position clinically pertinent . \n this is , however , a controversial subject.5 despite the consensus regarding dual bites as an alternative to surgical treatment in adults , for diagnostic and treatment purposes , evaluation of the orthopedic position of cr is the most physiologically appropriate6 ; in fact , it is recommended as the morphofunctional aim of any orthodontic occlusal treatment.1,7 since cr is the most consistent and reproducible positional reference,8 accurate studies of dental and maxillomandibular relationships are dependent on cr assessment . \n splint therapy allows stabilization of the condyle in cr for therapeutic or diagnostic purposes , prior to orthodontic treatment.9 in patients with a hyperdivergent facial type , cd represents a mechanism of compensation to posterior - anterior facial imbalance . since the mandible articulates with the cranial base , vertical growth of the anterior face should ideally match posterior facial growth.10 however , if this does not occur , the condyle can rotate in the temporomandibular joint or slide vertically or antero - posteriorly in order to adjust to the imbalance.1,2,3,8,11,12 an increased joint space could lead to articular instability since the articular disc can lose its tight apposition between the condyle and cranial base and easily dysfunction.1 previous studies have shown that posterior mandibular displacement leads to temporomandibular disorders ( tmd)6 and morphological changes.13 additionally , studies focusing on the relation between facial configuration and tmd indicate an association of hyperdivergency with tmd.14,15 the assessment of the normal condyle - fossa relationship is also debatable . in normal samples , tomographic imaging reveals a wide variability in condylar position,16,17 and intra - articular joint damage has been detected in asymptomatic patients.18 more recently , a study analyzing clinical data from magnetic resonance imaging and limited cone - beam computed tomography reported that the variability in cd is limited in normal individuals , and quantitative standards for the clinical evaluation of the condylar position were suggested.19 since the condylar axis can be widely influenced by occlusion,2,4 it is of paramount importance to determine its displacement in three - dimensional space.20 conventional radiological examinations do not provide accurate and valuable information in this regard;16,17 consequently , a mandibular position indicator ( mpi ) and other similar tools have been introduced to allow quantification of the three - dimensional displacement of the condylar axis.3,21,22 the significance and clinical relevance of identifying and integrating cd in orthodontic diagnosis and treatment planning , when it surpasses a threshold of 2 mm in the horizontal or vertical axis has been established.2,4,7 in addition , cd of significant magnitude occurs frequently in the asymptomatic population4,23 and represents an attempt to compensate for disproportions . \n accurate diagnosis requires the assessment of occlusal interferences and skeletal relationships , without the influence of the neuromuscular system . despite reasonable evidence of facial configurations being more prone to articular instability , \n girardot12 reported a more significant cd in hyperdivergent facial morphologies , whereas burke et al.24 found diminished upper articular joint spaces in the same facial type . \n in contrast , hidaka et al.11 found no relationship between facial type and condylar position . \n therefore , the aim of this observational study was to clarify the above - mentioned conflicting findings and throw more light on the relationship between facial type and condylar position . therefore , cd was measured in the hyperdivergent facial type and compared with those of the hypodivergent and intermediate types . \n the hypothesis of this study was that cd was greater and more frequent in the hyperdivergent facial type . \n the research protocol was reviewed and approved by the ethical committee of the faculty of dental medicine of university of porto ( # 20071210 ) . \n the study sample comprised 108 caucasian asymptomatic individuals , 81 women and 27 men , aged between 12 and 46.2 years , with a mean age of 20.5 years . \n data used for the study included information from anamnesis and clinical examinations , lateral cephalograms in mi , study casts and clinical records for cr mounting on a sam 2p semi - adjustable articulator ( figure 1 ) , and complete mpi registrations ( sam ; przisionstechnik gmbh , mnchen , germany ) ( figures 2 and 3 ) . \n the subjects were selected based on the clinical records of 742 consecutive first presentations at an orthodontic private practice . based on the study criteria \n , we included individuals , who , during the preceding 5 years , had neither suffered facial trauma nor been subjected to orthodontic treatment . for the selection of asymptomatic individuals , \n the helkimo index25 was used , and only patients with codes di0 or di1 were chosen . to avoid the effect of distortions related to growth on condylar position registration,26 patients in stages 4 , 5 , or 6 of skeletal maturation according to the cervical vertebral maturation method27 \n subjects with a negative vertical cd ( z < 0 ) on the mpi reading were excluded.8 to classify the subjects into groups based on distinct facial patterns , two matched factors of jarabak 's cephalometric analysis were used.28 subjects with the posterior facial height ( pfh ; sella - gonion)/anterior facial height ( afh ; nasion - menton ) ratio 59% and the lower gonial angle ( lga ; nasion - gonion - menton ) 76 were grouped into the hyperdivergent group . \n the hypodivergent group comprised subjects with the pfh / afh 65% and lga 69. in the third intermediate group , the pfh / afh was 59 - 65% and lga was 69-76. thus , based on the skeletal facial features , 3 matched groups containing 36 individuals each , 27 women and 9 men , were generated . \n a single operator with 5 years ' experience was involved in all the clinical and laboratory experiments . a single arbitrary face bow and sam 2p articulator \n were used for mounting the stone casts ( velmix ; kerr manufacturing co. , romulus , mi , usa ) with the cr wax records ( delar bite registration wax ; delar corporation , lake oswego , or , usa ) . \n horizontal and vertical cd were evaluated using a single mpi and mi wax records ( moyco industries inc . , philadelphia , pa , usa ) . \n the mi records were obtained before cr registration , by asking the patient to bite firmly with the teeth in mi . after being chilled in ice water , record accuracy \n roth 's power centric technique8 was performed immediately after neuromuscular deprogramming with the patient relaxed and reclined at 45. two cotton rolls were interposed between the dental arches for a minimum of 10 minutes . \n the anterior section was obtained by guiding the mandible during closure in order to avoid protrusion . \n next , the anterior wax was hardened in ice water and then interposed between the arches simultaneously with the posterior softened wax section in order to accomplish the registration . \n the mandible was guided during closure , and when the anterior teeth fit into the corresponding anterior wax indentations , the patient was asked to bite firmly . with this technique , as the posterior wax section was softened , muscular strength helped to adjust the vertical intra - articular condylar position.29 for wax registration of mi , the corresponding position of the condyle was registered with the mpi , and its accuracy was checked after every 5 registrations . \n a micrometre ( nr.h 114834 ; carl zeiss ag , oberkochen , germany ) was used to measure the horizontal ( xx ' ) and vertical ( zz ' ) cd components , and each measurement was repeated three times . \n the methodology applied in this study had been checked at the beginning of data collection , and the lauritzen technique was used to assess the accuracy of cr records and laboratory procedures.28 to evaluate intra - operator error , the reproducibility of cr records , mounting procedures , accomplishment and measurement of mpi registrations , and cephalometric measurements were performed by the same operator during two different sessions that were one - week apart . \n for these procedures , 5 patients were randomly selected , and the clinical measurements were obtained twice during each session , resulting in the need for two articulator - mounting sets for each subject . during the second session , \n two new cr records were used to remount the mandibular cast to each previously articulator mounting . \n , errors were analyzed using the analysis of variance test . according to the following equation \n , the standard error ( se ) was obtained depending on the sample variance ( sv ) : where n refers to the sample size ; xi , dimension observed for measurement i ; and x , mean value of observations . for indirect measurements , \n the following equation of error propagation was applied : where xj refers to the dimension measured ( j = 1 , , m ) ; sej , standard error associated with xj ; and x = f(x1 , x2 , xm ) , dimension based on dimensions of xj . to determine the direction and magnitude of any condylar shift , \n an initial descriptive study of data was performed , which was followed by a comparative study . a student t - test , with 0.05 level of confidence , \n was used to analyze the differences in cd along the vertical and horizontal planes among the three groups . \n for direct measurements , errors were analyzed using the analysis of variance test . according to the following equation , the standard error ( se ) \n was obtained depending on the sample variance ( sv ) : where n refers to the sample size ; xi , dimension observed for measurement i ; and x , mean value of observations . for indirect measurements , \n the following equation of error propagation was applied : where xj refers to the dimension measured ( j = 1 , , m ) ; sej , standard error associated with xj ; and x = f(x1 , x2 , xm ) , dimension based on dimensions of xj . to determine the direction and magnitude of any condylar shift , \n an initial descriptive study of data was performed , which was followed by a comparative study . a student t - test , with 0.05 level of confidence , \n was used to analyze the differences in cd along the vertical and horizontal planes among the three groups . \n analysis of the measurement errors of the different assessments showed an error margin < 4.5% , which is considered acceptable.28 no negative vertical cd ( z < 0 ) on the mpi readings was registered . in the total sample ( n = 216 condyles , table 1 ) , horizontal displacement cd - xx ' 2 mm and cd - xx ' -2 mm occurred in 14/216 condyles ( 6.49% ) , whereas vertical displacement cd - zz ' 2 mm occurred in 60/216 condyles ( 27.77% ) . \n therefore , cd - xx ' -2 mm occurred in hyperdivergent and intermediate groups in 2.78% and 4.17% of cases , respectively , whereas cd - xx ' 2 mm was more frequent in the hypodivergent group ( 8.33% ) . \n the most frequent displacements were observed in a posterior direction in the hyperdivergent and intermediate groups . along the zz ' axis , the frequency of cd - zz ' 2 mm was high in all the groups , with registered values of 34.72% , 23.61% , and 25.0% , respectively , in the hyperdivergent , hypodivergent , and intermediate groups . \n the values of horizontal displacement ranged from -3.5 mm to 4 mm , whereas vertical displacement ranged from 0 to 4.1 mm ( table 2 ) . to assess the effective magnitude of cd , the displacements along the xx ' axis were summed , and the absolute values were considered ( table 3 ) . \n a comparison of the magnitude of cd among the three groups showed more extensive cd in the hyperdivergent group ( 118.7 mm ) along the zz ' axis and in the hypodivergent group ( 67.53 mm ) along the xx ' axis . \n the magnitude of horizontal displacement was approximately similar in all the groups , varying from 53.5 mm in the intermediate to 67.53 mm in the hypodivergent group . \n results of the t - test showed that vertical displacement was statistically different between hyperdivergent and hypodivergent groups ( p < 0.0002 ) and hyperdivergent and intermediate groups ( p < 0.0005 ) . \n no significant difference in horizontal displacement was noted between the groups ( p < 0.071 ) . \n taking into account the obvious differences between the facial groups , the anatomo - physiological features of hyperdivergent facial types may be the reason that condyle function is prone to articular instability . \n this study aimed to test the hypothesis that cd was greater and more frequent in the hyperdivergent facial type . \n the three groups examined in this study represented individuals with clear hyperdivergent ( dolicofacial ) features , hypodivergent ( brachifacial ) features , and with intermediate qualities . \n the clinically significant cd threshold of 2 mm has diagnostic importance,2,4,7 leading to clinical implications.3 in fact , it is recommended to use this information to convert cephalometric tracings when displacements of 2 mm are found along at least one of the axes \n . a smaller magnitude of cd yields none or no significant changes in traditional cephalometric measurements.2 in the 216 condyles analyzed in this study , cd 2 mm was found in approximately 30% of the cases ( cd - zz ' 2 mm in 27.77 , cd - xx ' 2 mm , and cd - xx ' -2 in 6.49 ; table 1 ) . in general , these results are in agreement with those of previous studies , although some discrepancies in frequencies were found.2,4,11,12,23,26 these differences may be related to the criteria used for sample selection , neuromuscular deprogramming methodology , or cr recording techniques . \n the use of hard anterior stops for cr bite registration can duplicate the frequency of cd 2 mm.4,23 it was suggested that a more efficient deprogramming technique could result in a higher frequency of cd in the three groups . ideally , complete deprogramming should be performed before cr registration ; however , it is not practical in daily orthodontic practice , and the method of interposition of cotton rolls for 10 minutes was used in this study . \n therefore , the registrations obtained represent the most superior and anterior positions of the condyles in the joint the clinician was able to take during the moment of clinical procedure in the asymptomatic patients . \n posterior displacement was slightly more frequent ( 43.52% ) than anterior displacement ( 40.74% ) . \n the higher frequency of posterior condylar shift is consistent with previous studies and is related to posterior occlusal prematurity guiding the mandible in this direction.2,3,11,12,23 the analysis of cd and its comparison between the three groups showed that cd was more frequent in the hyperdivergent group , corroborating the initial hypothesis . \n this group , considering the number of condyles with cd 2 mm , presented a frequency of vertical displacement of 34.72% , which is higher than the 28.8% reported by girardot.12 with respect to the absolute values of horizontal displacement , the hyperdivergent group registered 4.17% in contrast to 24.2% reported by girardot . the great majority of xx ' displacements were between -2 and 2 mm . \n therefore , in the hyperdivergent group , 54.17% of displacements occurred in the posterior direction with magnitudes between -2 and 0 mm . \n in contrast , hidaka et al.11 found vertical and horizontal cd 2 mm of 14% and 2% , respectively . \n however , their study sample was inherently different from that of our study . in the hyperdivergent and intermediate groups , \n high frequencies were recorded in the posterior direction ( 56.95 and 45.84% , respectively ) ; in contrast , in the hypodivergent group , the higher frequency was in anterior direction ( 54.16% ) . \n the frequencies of posterior , anterior , and vertical displacements in the intermediate group were midway between the other two groups . \n these findings may be related to the differences in facial configurations , i.e. , the distinct patterns of muscle activity and behavior facing fulcrums . \n in fact , in the hypodivergent biotype , the elevator muscles are stronger and aligned vertically across the first molars , being positioned more anteriorly than those in the hyperdivergent group . \n the magnitude of means ( absolute values ) along xx ' was 0.84 mm , 0.94 mm , and 0.74 mm ; along zz ' , it was 1.65 mm , 1.05 mm , and 1.61 mm , respectively , in the hyperdivergent , hypodivergent , and intermediate groups ( table 2 ) . \n girardot12 found mean values of 1.21 mm for hyperdivergent and 0.66 mm for hypodivergent along xx ' and 1.7 mm for hyperdivergent and 1.2 mm for hypodivergent along zz ' . \n the mean values that closely matched those of our study were those related to the vertical plane and may be related to the method used to record cr . \n the hard anterior stop used in roth 's power centric technique supports the generation of a more seated condylar position , as it is the internal strength of the masticatory muscles that positions and vertically seats the condyles in the fossae.3,8,29 therefore , the registration of the vertical axis shift is less dependent on individual operator technique . \n previous studies,4,23 with deprogrammed subjects , found greater vertical displacements and established that more efficient deprogramming procedures can allow assessment of greater cd mean values , particularly along the vertical axis.26 however , other studies contradicted these results . \n burke et al.24 studied the association of condyle features of class ii preadolescent patients with facial configurations and found correlations between diminished superior joint spaces and vertical patterns . \n these differences may be related to intrinsic variations in the samples and to a lack of functional examination of the subjects . \n in fact , the neuromuscular system can display two kinds of responses to occlusal fulcrums . \n one displaces the condyle in the joint to achieve maximal occlusal contact , whereas the other is the appearance of an anterior open bite , characterized by only posterior teeth contacts , with the cd being reduced in this situation . \n moreover , hidaka et al.11 did not find any relation between facial patterns and cd . \n their evaluation was performed using the mandibular plane angle and disregarded the individual 's skeletal maturity and functional examination , which are factors that can strongly compromise condylar shifts . in this study \n , greater vertical displacement was observed in the hyperdivergent group : cd was found to be 1.57 and 1.42 times greater than that in the hypodivergent and intermediate groups ( table 3 ) . \n in all the groups , the magnitude of vertical shifts was always higher than that of the horizontal shifts , which is in agreement with the findings of previous studies.2,4,11,12,23,26 this finding shows that , although cd is frequent in all three facial groups , a higher risk of shift is observed in the hyperdivergent group , which is in agreement with girardot 's results.12 it is important to note that both studies reported significant differences in cd along the zz ' axis ( present study : hyperdivergent - hypodivergent groups , p < 0.0002 and hyperdivergent - intermediate groups , p < 0.0005 ; girardot study : hyperdivergent - hypodivergent groups , p < 0.008 ) , but for horizontal displacements only girardot , reported this finding ( hyperdivergent - hypodivergent groups , p < 0.0001 ) . in the present study , for xx ' axis displacements , no significant differences were observed , but a trend could be suggested between the hyperdivergent and intermediate groups ( p < 0.071 ) . \n although referring to asymptomatic samples , both studies indicate that the physical features of the hyperdivergent group predispose it to a higher risk of developing tmd.14,15 however , it is important to note that the transverse shift was not considered , despite being recognized as an etiologic factor of tmd.30 therefore , this potential relationship needs to be investigated further . \n the results of this study suggest that orthodontic treatment planning related to the cr must involve assessment of the condyle shift . \n however , it is not possible to quantify displacement clinically , directly in the mouth4,8,23 or by using mi hand - assembled casts . \n when detected , occlusal discrepancy provides no information regarding the nature of cd.4,17 this study especially emphasizes on the vertical component of cd , which is even more difficult to detect . \n the mpi instrumentation procedure permits easy and accurate3,8,21,22 quantification of cd and allows taking this data into account when planning treatment , introducing diagnostic clinical implications , and reducing misdiagnosis.2,4 in contrast with mi hand - assembled casts , articulator - mounted cast analysis can display cases with different features and with a distinctly difficult level of treatment . \n the discrepancy can be altered not only in the sagittal plane , with differences in overjet and molar relationship , but also in the transverse and vertical planes.2,4 the analysis of the initial occlusal contacts can support differential diagnosis of skeletal and dentoalveolar openbite or crossbite . when approaching transversal problem the consideration of interocclusal type of contacts , the cuspid to cuspid or cuspid to inclined slope contact , can help to discard the skeletal nature of malocclusion . \n additionally , simulation of a true hinge axis ( vertical mandibular autorotation ) can provide information regarding features of the class ii malocclusion . in case of a vertical class ii malocclusion \n , overjet can be corrected when posterior occlusal interferences are eliminated ; however , in case of a sagittal class ii malocclusion , overjet remains , and a different treatment plan is required . \n the method described in this study can reveal important information with regard to vertical malocclusion , which is not provided by other diagnostic techniques , causing frequent failure in occluso - functional orthodontic treatment . \n overall , since a significant magnitude of cd occurs in all the three asymptomatic groups and since it is not possible to predict the condylar position , it is crucial to mount models in cr as a routine diagnostic procedure.2,4 our study clearly shows that in patients with a hyperdivergent facial pattern , the risk of misdiagnosing an orthodontic case is approximately 30% , when condylar position in not assessed . \n the findings of this study show that the hyperdivergent group has a significantly greater cd along the vertical axis than do the two other groups . \n therefore , if cd is not considered during the assessment of orthodontic cases , the risk of misdiagnosis is high for all facial types , being significantly higher in patients with the hyperdivergent facial type .", "role": "user" }, { "content": "objectivefacial - type - associated variations in diagnostic features have several implications in orthodontics . for example , in hyperdivergent craniofacial types , growth imbalances are compensated by displacement of the condyle . \n when diagnosis and treatment planning involves centric relation ( cr ) , detailed knowledge of the condylar position is desirable . \n the present study aimed to measure condylar displacement ( cd ) between cr and maximum intercuspation in three facial types of an asymptomatic orthodontic population.methodsthe study was conducted in 108 patients classified into three groups of 36 individuals each ( 27 women and 9 men ; mean age , 20.5 years ) , based on the following facial patterns : hyperdivergent , hypodivergent , and intermediate . to quantify cd along the horizontal and vertical axes , \n the condylar position was analyzed using mounted casts on a semi - adjustable articulator and a mandibular position indicator . \n the student t - test was used to compare cd between the groups.resultsvertical displacement was found to be significantly different between the hyperdivergent and hypodivergent groups ( p < 0.0002 ) and between the hyperdivergent and intermediate groups ( p < 0.0006 ) . \n the differences in horizontal displacement were not significant between the groups . in each group , \n vertical cd was more evident than horizontal displacement was.conclusionsall facial types , especially the hyperdivergent type , carried a significantly high risk of cd . \n therefore , the possibility of cd should be carefully evaluated and considered in the assessment of all orthodontic cases in order to accurately assess jaw relationships and avoid possible misdiagnosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in the previous issue of critical care , koefeld - nielsen and colleagues provide us with interesting experimental data regarding the question of how to predict response to a recruitment manoeuvre before applying it . \n they conducted an animal study ( lavage - induced experimental lung injury ) to test the hypothesis that parameters derived from the pressure - volume ( pv ) loop recorded before application of the lung recruitment manoeuvre ( lrm ) predict the effects of the lrm on gas exchange , respiratory system compliance ( crs ) and changes in end - expiratory lung volume ( eelv ) . \n the parameter derived from the pv loop was the maximal volume difference between the inspiratory and the expiratory limbs of the pv loop at a given pressure , indicating the maximal hysteresis area . \n this was expressed as a ratio of the total lung capacity , measured as the volume gained on the pv loop at 4 kpa airway pressure . \n furthermore , they hypothesized that the volume difference between the inspiratory and expiratory limbs of the pv curve at a given pressure would correspond to the change in eelv after the lrm at the same pressure . \n both hypotheses were validated in their well controlled experimental study design . specifically , a maximal hysteresis / total lung capacity ratio of 0.3 predicted improvement in crs , eelv and gas exchange after the lrm . \n this easily applicable method provides a means to predict the potential for recruitment , which is of paramount importance to recruitment strategies in acute lung injury . \n however , we do not have any convincing evidence that recruitment strategies improve clinical outcomes of patients with acute lung injury ( ali)/acute respiratory distress syndrome ( ards ) [ 3 - 5 ] , although many physiological studies could demonstrate a recruitment - induced increase in crs , eelv and gas exchange ( see ) . \n recruitment of lung volume is critical in ali / ards , in which loss of aerated lung volume is an important pathophysiological factor that leads to intra - pulmonary shunting of blood , culminating in severe hypoxaemia . \n consequently , the effect of recruitment in the clinical setting is mostly assessed by determining the effect on gas exchange . \n however , computed tomography ( ct ) studies indicate that dissociation between mechanical effects and the gas exchange effect of lrm can occur , rendering gas exchange a rather insensitive parameter with which to assess lrm . \n the reason for this dissociation is that gas exchange only improves when ventilation / perfusion ratios are affected concomitantly ; specifically , ventilation must improve and perfusion must not diminish . however , because lrm might also have effects on the perfusion site , gas exchange merely reflects the functional effect of recruitment , whereas lung mechanics or ct analysis might reflect anatomical changes brought about by the lrm . \n ct analysis may therefore be helpful in identifying the potential for recruitment as well as for assessing anatomical effects on lung ventilation . however , \n clinically , it is not practical to conduct repeated ct analyses in patients with severe ards patients in order to optimize the ventilator settings or guide a recruitment strategy . \n hence , the observation that routine , detailed analysis of a single pv loop might be helpful in predicting the anatomical effect of a lrm is of great interest . \n it is consistent with the finding that analysis of lung mechanics might be more accurate than gas exchange in assessing the effect of lrm , insofar as it emphasizes the effect on respiratory mechanical behaviour rather than functional results . \n it is important to appreciate this because many studies were required to teach us that achievement of optimal gas exchange is not necessarily associated with the best outcomes in patients . \n how could the information provided by koefeld - nielsen and colleagues be used clinically ? \n their method could be used as a diagnostic tool to determine potential for recruitment in individual patients , who could then be stratified as possible responders or nonresponders in a clinical study of a recruitment strategy that applies only to responders . \n this makes perfect sense because it is reasonable to assume that any potential evidence in favour of a recruitment strategy in ali / ards , in terms of clinical outcomes , will only be found if responders are subjected to the manoeuvre . \n we would be able to enter into a strategy of testing ali / ards therapies tailored to individual pathophysiological observations , rather then just randomizing large groups of patients who share only a rather unspecific diagnosis , namely ali / ards as defined by gas exchange and radiographical criteria . \n i am absolutely convinced that this is the way to go for future studies in our field . before doing so \n , however , the experimental observation made by koefeld - nielsen and colleagues must be assessed clinically . \n if the method presented proves to be sufficiently robust to reflect the effect of lrms before they are actually applied , then this could be the basis for a larger clinical trial , in which it is used as a diagnostic tool to stratify patients before randomization . \n i look forward to seeing this work followed ; i consider it the way to go . \n ali = acute lung injury ; ards = acute respiratory distress syndrome ; eelv = end - expiratory lung volume ; crs = respiratory system compliance ; ct = computed tomography ; lrm = lung recruitment manoeuvre ; pv = pressure - volume . \n ", "role": "user" }, { "content": "using recruitment manoeuvres in acute lung injury remains a controversial issue because no convincing outcome data support their general use , although many physiological studies have demonstrated beneficial effects on lung compliance , end - expiratory lung volume and gas exchange . \n one of the reasons why physiologically meaningful observations do not translate into clear clinical benefit could be the heterogeneity of the studied patient population . in patients with consolidated lungs and \n only limited potential for recruitment , manoeuvres might be harmful , whereas in patients with high potential for recruitment they might be helpful . \n however , when those populations are mixed any signal may be lost because of counteracting effects , depending on how the patient population was mixed . \n we do not currently have any simple tool that may readily be applied at the bedside to assess the recruitment potential in an individual patient , which would be a sine qua non for identifying a homogeneous population in a recruitment study . \n therefore , the method presented by jacob koefeld - nielsen and colleagues in the previous issue of critical care provides us with a simple method that could be used at the bedside to assess recruitment potential before the manoeuvre is applied .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cervical cancer ranks among the top three cancer diagnoses in women worldwide . in the united states , \n the seer cancer statistics review identified cervical cancer as the third leading cause ( following childhood cancers and testicular cancer ) of average years of life lost per person dying of cancer for all races and both genders . \n recent strategies to reduce the incidence of cervical cancer have focused on the development of a human papilloma virus ( hpv ) vaccine . \n while hpv vaccine has the potential to significantly reduce de novo hpv infection in women less than 26 years of age , a significant population of women ( older than 26 years and unvaccinated ) is currently at risk for future development of cervical cancer . even assuming 100% compliance with vaccination \n , a recent study estimated that the impact of hpv vaccination would not be appreciated clinically until after 2040 . in the coming years \n , clinicians will continue to face the challenges associated with the treatment and follow - up of patients with cervical cancer . \n approximately one - third of cervical cancer patients develop disease recurrence and the majority of these recurrences occur within the first 2 years after completion of therapy . \n predictors of disease recurrence include stage and lymph node status at the time of initial diagnosis . \n the initial diagnosis and staging of cervical cancer has traditionally been achieved by history and physical examination and by use of selected imaging studies . \n cervical cancer initially spreads regionally and then through lymphatic channels before hematogenous dissemination to distant organs . with locally advanced disease \n , the status of pelvic and para - aortic lymph nodes is an important determinant of prognosis and guides treatment planning decisions . \n computed tomography ( ct ) has been the most widely used imaging method for assessment of nodal involvement and detection of distant metastatic disease . despite its high resolution and excellent depiction of anatomy , \n ct is limited by its inability to detect small - volume metastatic involvement in normal - size lymph nodes and to determine whether enlarged nodes represent metastasis or reactive hyperplasia . \n 1 ) . the functional information about regional glucose metabolism provided by fluorodeoxyglucose ( fdg)-positron emission tomography ( pet ) provides for greater sensitivity and specificity in most cancer imaging applications by comparison with ct and other anatomic imaging methods . \n the development and rapid dissemination of integrated pet / ct scanners that allow functional and anatomical information to be obtained in a single examination represents an important advance in pet imaging technology , resulting in a synergistic improvement in the accuracy of interpretation of both pet and ct images . \n a number of studies have shown that fdg - pet is superior to conventional imaging methods for detecting metastatic disease , particularly lymph node metastasis . \n havrilesky and associates recently reported a systematic review of the published literature up through 2003 . \n they included only those studies involving 12 or more subjects who had pet performed with a dedicated scanner with specified resolution , and with clinical follow - up 6 months or histopathology as the reference standards . \n in patients with newly diagnosed cervical cancer , the pooled sensitivity of pet was 79% ( 95% ci 6590% ) , and the pooled specificity was 99% ( 9699% ) for detection of pelvic lymph nodes metastasis . \n two studies were identified that each compared pet to magnetic resonance imaging ( mri ) and ct . \n mri had a pooled sensitivity of 72% ( 5387% ) and pooled specificity of 96% ( 9298% ) , whereas ct had a pooled sensitivity of 47% ( 2173% ) ( there were insufficient data to calculate a pooled specificity ) . in four prospective studies in which histology after para - aortic lymphadenectomy was used as the reference standard , the pooled sensitivity of pet for the detection of para - aortic nodal metastasis was \n 84% ( 95% ci 6894% ) and the pooled specificity was 95% ( 8998% ) . \n in three of these studies , the inclusion criteria for study entry included a negative ct or mri of the abdomen . \n the sensitivity and specificity of mri in the 12 patients who underwent aortic node sampling were 67% and 100% , respectively . \n our own studies have shown that fdg - pet is superior to ct and lymphangiography in showing unsuspected sites of metastasis in pelvic lymph nodes , extrapelvic lymph nodes , and visceral organs in patients with newly diagnosed advanced cervical cancer . \n fdg - pet showed abnormalities consistent with metastasis more often than did ct in pelvic lymph nodes ( 67% vs. 20% ) and in para - aortic lymph nodes ( 21% vs. 7% ) . \n these initial results have been sustained in subsequent evaluations of data from our prospective registry that now includes over 600 patients . \n based on the results in the literature to date , the united states center for medicare and medicaid services in january 2005 approved coverage for use of fdg - pet in initial staging of patients with cervical cancer who have no evidence of extrapelvic metastatic disease on ct or mri . \n these include patient age , tumor histology , tumor stage , tumor size , lymph node metastasis , and tumor hypoxia . in a study of 101 patients with newly diagnosed cervical cancer , grigsby and \n colleagues demonstrated that the lymph node status determined by fdg - pet is the most significant independent pre - treatment predictor of progression - free and overall survival in patients with cervical cancer . \n the 2-year , disease - free survival was better predicted by pet evidence of lymph node involvement than by ct findings . \n based on the imaging findings in the pelvic lymph nodes , the 2-year , disease - free survival was 84% for ct/pet patients , 64% for ct/pet + patients , and 48% for ct \n based on the imaging findings in the para - aortic nodes , the 2-year , disease - free survival was 78% in ct/pet patients , 31% for ct/pet+ patients , and 14% for ct \n the pet - determined status of the para - aortic nodes was the strongest predictor of survival in a multivariate logistic regression analysis . \n these results suggest an opportunity to cure patients with para - aortic nodal metastasis defined by pet that were not detected by ct . in a recent review of data from 256 patients in our registry \n , we also found that the extent of lymph node involvement is inversely correlated with survival . \n we have also found that fdg - pet demonstrated metastatic involvement in the left supraclavicular lymph nodes in 8% of our patient population . \n this finding had a positive predictive value of 100% and indicates a dismal prognosis , despite aggressive therapy . \n similarly , we found that the cause - specific survival for patients with figo stage iiib carcinoma is highly dependent upon the extent of lymph node metastasis demonstrated by whole - body fdg - pet at initial presentation . \n the three - year estimates of cause - specific survival were 73% for those with no lymph node metastasis , 58% for those with only pelvic lymph node metastasis , 29% for those with pelvic and para - aortic lymph node metastasis , and 0% for those with pelvic , para - aortic , and supraclavicular lymph node metastasis ( p = 0.0005 ) . \n extent of regional lymph node metastases was also found by unger and colleagues to be a significant prognostic factor . \n miller and grigsby evaluated the usefulness of tumor volume measurement with fdg - pet in 57 patients with cervical cancer . \n tumor volume and lymph node status determined by pet and figo stage determined by clinical examination were predictive of progression - free survival ; tumor volume and lymph node involvement by pet predicted overall survival . \n the avidity of fdg uptake in the primary cervical tumor is a predictor of survival outcome . \n patient tumors that have a high maximum standardized uptake value ( suvmax ) have a worse survival outcome than those with a low suvmax . \n approximately 30% of cervical cancer patients with advanced stage disease will ultimately fail after definitive treatment . \n fdg - pet has been shown to have a role in the post - treatment monitoring of patients with cervical cancer . in a large retrospective study by ryu and associates , 249 women with previously treated cervical cancer without overt evidence of \n eighty patients ( 32% ) were found to have abnormal fdg uptake ; 28 ( 11% ) had clinically or histologically confirmed recurrent disease . the sensitivity and specificity of fdg - pet for detection of recurrent disease were 90% and 76% , respectively . \n there was a high false - positive rate associated with fdg uptake in the pulmonary hila , lungs , neck , inguinal , and axillary regions . \n the majority of the recurrences were detected within 618 months after diagnosis . in another series by unger and associates , \n fdg - pet detected recurrences in 31% of asymptomatic patients and recurrences in 67% of symptomatic patients . in symptomatic patients , \n the sensitivity of fdg - pet was 100% , the specificity was 86% , and the positive and negative predictive values were 93% and 100% , respectively . by comparison , in asymptomatic patients \n , the sensitivity of fdg - pet was 80% , the specificity was 100% , and the positive and negative predictive values were 100% and 100% , respectively . in a study by grigsby and associates , 152 patients previously treated with radiotherapy with or without concurrent chemotherapy who were free of fdg - avid sites on pet obtained an average of 3 months post - therapy , had 5-year cause - specific and overall survival of 80% and 92% , respectively . \n persistent abnormal uptake in the cervix or lymph nodes was found in 20 patients , and their cause - specific survival was 32% . \n new areas of increased fdg uptake in previously unirradiated regions were found in 18 patients , none of whom was alive at 5 years . \n post - treatment pet abnormalities were found to be the most significant predictor of death from cervical cancer in this study . \n together these results point to a significant impact of fdg - pet findings on treatment strategy after primary therapy . \n the basis of fdg - pet imaging of tumors is increased glucose metabolism of tumor tissue compared to normal tissue . \n historically , patient- and tumor - related factors such as age , histology , tumor volume and stage have been critical attributes for predicting patient outcome and overall survival for cervical cancer . \n studies for lung and head and neck cancers have suggested that a higher suv correlates with worse prognosis . \n other studies have also shown that patients with a primary tumor suv greater than the median tended to have poorer local control and disease - free survival . \n we have evaluated suv in patients with cervical cancer and found that primary tumor suvmax at diagnosis is correlated with the presence of lymph node involvement at diagnosis , how well the primary tumor responds to treatment , the likelihood of disease recurrence , and overall survival . \n we analyzed data from 287 patients with cervical cancer who underwent fdg - pet and found that the mean suvmax was 11.4 ( range 1.050.4 ) . \n there was no relationship between tumor volume and suvmax ( correlation coefficient r = 0.01 ) . \n the cause - specific survivals at 5 years were 95% for suvmax 5.2 , 70% for suvmax > 5.2 and 13.3 , and 44% for suvmax \n increasing suvmax was associated with persistent abnormal fdg uptake in the cervix on the 3-month fdg - pet in 238 patients treated with curative chemoradiation ( p = 0.04 ) . \n suvmax of the cervical tumor at diagnosis is a sensitive biomarker of treatment response and prognosis ( fig . \n 2 ) . \n figure 2cause - specific survival based on pre - treatment cervix tumor suvmax . \n cause - specific survival based on pre - treatment cervix tumor suvmax . in our study \n , we showed that primary tumor suvmax at diagnosis is predictive of lymph node involvement . for lung cancer \n , others have also found an association between primary tumor suv and presence of lymph node involvement . \n primary tumor suvmax predicting lymph node involvement in cervical cancer is significant because our group has previously shown that lymph node status is significantly related to disease - free and overall survivals . \n we also found that high primary tumor suvmax at diagnosis was predictive of subsequent biopsy - proven local recurrence and correlates with increased risk of persistent cervical disease , in particular as shown by persistent disease on the 3-month post - treatment pet scan . \n previous groups have found that lack of cervical tumor regression is associated with an inferior outcome . \n achieving local control is critical to prognosis and overall survival . as our data show that suv of the primary tumor is an important predictor of prognosis , treatment response , and overall survival , this leads to the question of how glucose metabolism varies among cervical tumors and how that correlates with suv and patient outcome . in an attempt to understand the biologic mechanism causing increased fdg uptake in tumors , \n for example , with breast cancer , one group found a correlation between glut-1 expression and fdg uptake ; another study did not find an association . \n with regard to cervical cancer , mendez et al . found a correlation between glut-1 expression and tumor grade , but airley et al . \n did not find an association between glut-1 expression and disease - free or recurrence - free survival . \n yen et al . found a correlation between glut-1 expression and suv in cervical cancer , but tian et al . \n did not find a relationship between fdg suv and glut-1 or glut-3 expression for oral squamous cell carcinoma . \n as more groups investigate this topic , more types of glucose transporters are being discovered and different methods of measuring expression are also being used , suggesting that this is a complex issue that might involve multiple factors . \n additional research is needed to investigate the biologic mechanism leading to varying degrees of increased glucose uptake in tumors . in summary \n , our research has clearly demonstrated the prognostic significance of maximum fdg uptake in patients with cervical cancer . \n our unpublished preliminary data suggest that patients with a high suvmax have an excellent clinical outcome if they are treated with either surgery or radiation alone . \n if these patients receive concurrent chemoradiation ( weekly cisplatin ) then their survival is much worse than their survival when treated with either single modality therapy alone . \n these intriguing findings , if validated , may provide a guide to individualizing therapy for these patients . \n evaluation of tumor microenvironments has demonstrated heterogeneity relating to variation in tumor responsiveness to treatment , degree of vascularity , hypoxia , proliferation rates , energy metabolites , and gene expression . \n although tumor heterogeneity has been shown within these tumor microenvironments , intra - tumoral heterogeneity across the entire volume of primary tumors in humans has not been quantified or analyzed for its association with outcome measures . \n cervical cancer , in particular , is a tumor that has been suggested to have heterogeneity relating to hypoxia , variation in response to treatment , risk of metastatic spread , and gene expression . \n additionally , the response of primary cervical cancer to treatment has been shown to be a much more complex issue than simply relating outcome to clinical stage , tumor volume , or tumor hypoxia . \n specifically , our previous research has shown that primary cervix tumor maximal standardized uptake value ( suvmax ) on fdg - pet is predictive of disease prognosis and outcome irrespective of tumor stage or tumor volume . \n we have observed that this primary cervix tumor glucose metabolism from the fdg - pet image can vary greatly across the volume of individual cervical tumors . the variation in tumor microenvironment with small changes in local heterogeneity has been demonstrated . \n however , in terms of evaluating the clinical significance of intra - tumoral heterogeneity and outcome measures , only a limited amount of small studies have been published . \n our preliminary data suggests that cervix tumors with high levels of heterogeneity have a worse clinical outcome than do tumors that are less heterogeneous . \n [ f]misonidazole ( miso ) pet is an agent utilized to discriminate areas of hypoxia within tumors . for head and neck and \n non - small cell lung cancer , some preliminary data suggests radiation treatment outcome can be associated with kinetic behavior of [ f]miso pet . \n o'sullivan et al . noticed that fdg heterogeneity of sarcoma tumors was associated with time to patient death , but no one has investigated the prognostic significance of cervical intra - tumor heterogeneity on fdg - pet . supporting this argument that tumor heterogeneity is related to hypoxia , walenta and \n colleagues have shown that cervical cancers with higher lactate concentrations are more likely to have metastatic spread , just as our study showed that tumors with greater heterogeneity were more likely to have metastatic spread to lymph nodes . \n animal modeling studies by walenta and associates have demonstrated the presence of oxygen gradients in r3230ac tumors grown in window chambers . \n they found that lactate content , hypoxic fraction , atp , glucose , redox potential , and vessel density vary across the tumor in their model . \n this suggests the variation in tumor microenvironment and possible causes of the intra - tumoral heterogeneity . for head and neck cancers , \n it has also been shown that high lactate levels correlated with worse survival and increased risk of metastasis . \n it has also been demonstrated that tissue lactate content in head and neck squamous cell carcinoma correlates with radiosensitivity just as tumors with greater differential metabolic heterogeneity in our study were more likely to have an incomplete metabolic response on the 3-month post - treatment pet . for head and neck cancers , high lactate levels correlated with worse survival and increased risk of metastasis . at the same time \n , some studies have shown a lack of correlation between fdg uptake and hypoxia , as evidenced on fmiso scans . \n therefore , more investigation is needed to determine the biologic basis for cervical tumor differential heterogeneity as evidenced on fdg - pet . \n gerlee and anderson have explored an evolutionary hybrid cellular automation model of solid tumor growth . \n the results of their modeling study show that with a low tissue oxygen concentration and a switch to anaerobic glycolysis ( high glucose utilization ) that tumors develop with a more aggressive phenotype with a low apoptotic potential compared to tumors with high oxygen concentrations , aerobic glycolysis and containing less aggressive phenotypes . \n perhaps it can be argued that large tumors develop because of the dynamics of clonal evolution of cells in response to their microenvironmental supply of the nutrients oxygen and glucose . \n bentzen and thames have reviewed the data regarding the general notion that there is a relationship between increasing tumor volume and a decreasing probability of tumor control . \n they conclude from their review of published clinical data that , because of heterogeneity in patient and tumor characteristics , the volume effect is less pronounced than would be expected from a simple proportionality between number of clonogens and volume . \n their hypothesis is supported by our previously published data and data from other institutions for patients with cervical cancer . we have demonstrated a radiation dose \n response relationship for patients with cervical cancer by tumor stage ( tumor volume ) . however , this dose response relationship plateaus at about 85 gy irrespective of tumor volume implying that the radiation dose response curve is not uniquely affected by the number of tumor cells but also by mechanisms that are as yet unexplained . \n it appears intra - tumoral heterogeneity provides additional information beyond volume that helps clarify tumor behavior . \n the concept of utilizing fdg - pet to assess tumor response to therapy is based on in vitro studies that associate decreases in tumor cell glucose uptake with decreases in the fraction of viable tumor cells . \n clinically , the association between decreased tumor glucose uptake and treatment response has been documented in several small series for tumors of the breast , head and neck , gastrointestinal tract , and lymphoma . \n there are two settings in which fdg - pet can be used to evaluate treatment response . \n fdg - pet can be utilized after the completion of therapy to evaluate the tumor response to a given treatment regimen utilizing the endpoint of complete versus incomplete metabolic response . in this setting , a complete metabolic response implies that no further therapy is indicated and an incomplete metabolic response implies that further therapy is warranted . \n the other setting is to utilize fdg - pet after a partial course of therapy to evaluate the effectiveness of that therapy and to change therapy if the tumor is unresponsive to the initial treatment . in the majority of these studies , fdg - pet \n was performed after 12 cycles of chemotherapy rather than after completion of the entire course of planned therapy . \n most of these studies have linked initial response to chemotherapy , as measured by fdg - pet , to clinical outcome . \n however , few studies have specifically addressed the impact of fdg - pet response on patient management in the post - therapy setting . in the post - treatment setting , \n fdg - pet has been used to identify response to a complete course of therapy ( chemotherapy or chemoradiotherapy ) for lymphoma . \n the goal for this is to identify patients for appropriate immediate salvage therapy ( e.g. , more intensive chemotherapy or stem cell transplant ) . \n notably , the international working group response criteria in lymphoma have recently been modified to include routine use of post - therapy fdg - pet for assessing response in patients with these tumors . in these guidelines , \n visual assessment alone of the fdg - pet images was sufficient to determine therapeutic response . \n fdg - pet has been used in a more limited fashion to assess response to a complete course of therapy for malignant disease in other sites , including lung and head and neck cancer . the hesitation to use fdg - pet to evaluate treatment response is based on the assumption that local inflammation due to radiation may result in false - positive pet scans . on the contrary , recent evidence has shown that post - radiation normal tissue fdg uptake does not interfere with the prognostic information provided by the fdg response in the tumor itself . \n in fact , normal tissue fdg uptake has been positively correlated with tumor metabolic response and superior survival outcomes after radiation therapy for lung cancer . \n the rationale for using post - therapy fdg - pet in cervical cancer is twofold . \n first , the post - therapy fdg - pet provides information that may affect the approach to salvage therapy . historically , reported outcomes from salvage therapy for cervical carcinoma were poor . \n locally recurrent cervical cancer was most often detected as the presence of gross tumor on pelvic examination . \n total pelvic exenteration , while potentially curative , was associated with significant patient morbidity and limited long - term survival ( 16% in one study ) . for patients with distant failures , \n not surprisingly , this resulted in poor rates of success for salvage therapy . in 1994 , \n grigsby and colleagues reported no survivors at 2 years for patients with isolated recurrences in the para - aortic lymph node chain . \n the current treatment strategy for locally advanced cervical cancer ( definitive radiation with concurrently administered cisplatin chemotherapy ) achieves local control in approximately 75% of patients . \n however , as is the case with malignant diseases in other sites , some tumors do not respond completely to standard therapy . \n clinicians are then faced with the challenge of early identification of non - responders to decrease treatment failures and avoid the toxicity of futile treatment . \n our initial use of fdg - pet for patients with cervical cancer was focused on the use of the initial diagnostic fdg - pet image to identify sites of disease and to evaluate prognostic factors for treatment outcome . \n we then began performing post - therapy fdg - pet on our patients with cervical cancer at 3 months after the completion of their therapy . \n initially we found on our diagnostic studies that lymph node stage ( region of lymph node involvement identified by fdg - pet at the time of diagnosis ) was more predictive of outcome than traditional prognostic factors such as figo stage , patient age , or tumor histology . in our studies of 3-month post - therapy fdg - pet imaging \n we have found that progressive metastatic disease and an incomplete metabolic response by post - therapy fdg - pet are more predictive of clinical outcome than the pretreatment tumor characteristics including clinical stage and pretreatment lymph node status and the treatment - related variables , overall radiation treatment time and number of cycles of chemotherapy . \n we have also demonstrated that the post - therapy fdg - pet in cervical cancer provides valuable long - term prognostic information only 3 months after the completion of therapy ( fig . \n 3b ) the use of post - therapy fdg - pet as a metabolic biomarker of tumor response in cervical cancer . \n complete metabolic response is associated with excellent survival outcome ( 3-year cause - specific survival 100% ) . \n partial metabolic response is associated with intermediate survival outcome ( 3-year cause - specific survival 51% ) and decreased progression - free survival ( 3-year progression - free survival 35% ) . \n new sites of metabolic activity on post - therapy fdg - pet are associated with very poor survival outcome ( 3-year cause - specific survival 17% ) . \n figure 3(a ) long - term survival based on 3-months post - therapy fdg - pet , ( b ) prospective study of survival based on 3-month post - therapy fdg - pet / ct . \n ( a ) long - term survival based on 3-months post - therapy fdg - pet , ( b ) prospective study of survival based on 3-month post - therapy fdg - pet / ct . \n over the last decade , positron emission tomography with the glucose analogue fdg has become an established oncological imaging tool for many forms of cancers . the functional information about regional glucose metabolism provided by fdg - pet provides for greater sensitivity and specificity in most cancer imaging applications by comparison with ct and other anatomic imaging methods . \n the role of pet in gynecological cancers is evolving , but the current literature suggests that pet is superior to conventional imaging modalities for evaluating patients with cervical and ovarian cancers . \n the recent development and rapid dissemination of integrated pet / ct scanners that allow functional and anatomical information to be obtained in a single examination represents an important advance in pet imaging technology , resulting in a synergistic improvement in the accuracy of interpretation of both pet and ct images . \n fdg - pet / ct performed in patients with cervical cancer provides much important information . \n the diagnostic fdg - pet / ct determines the extent of disease at the time of diagnosis which is used to direct therapy . \n prognostic information from the diagnostic fdg - pet / ct derives from the extent of the disease and from metabolic information such as degree of glucose uptake . \n routine screening of patients with fdg - pet / ct will allow for early diagnosis of recurrent disease and guide therapy .", "role": "user" }, { "content": "abstractcervical cancer ranks among the top three cancer diagnoses in women worldwide . in the united states , \n the seer cancer statistics review identified cervical cancer as the third leading cause ( following childhood cancers and testicular cancer ) of average years of life lost per person dying of cancer for all races and both genders . \n approximately one - third of cervical cancer patients develop disease recurrence and the majority of these recurrences occur within the first 2 years after completion of therapy . \n predictors of disease recurrence include stage and lymph node status at the time of initial diagnosis . \n the initial diagnosis and staging of cervical cancer has traditionally been achieved by history and physical examination and by use of selected imaging studies . \n accurate staging is important both for selecting appropriate therapy and for prognosis . \n computed tomography ( ct ) has been the most widely used imaging method for assessment of nodal involvement and detection of distant metastatic disease . \n positron emission tomography ( pet ) has become an established imaging tool for cervical cancer . \n the functional information about regional glucose metabolism provided by fluorodeoxyglucose ( fdg)-pet provides for greater sensitivity and specificity in most cancer imaging applications by comparison with ct and other anatomic imaging methods . pet is superior to conventional imaging modalities for evaluating patients with cervical cancer .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: systemic lupus erythematosus ( sle ) is a common autoimmune disease , which is characterized by the abnormal activation of self - reactive t and b cells and production of self - antibodies and immune complex , and can lead to irreversible damage to organ systems . \n complications such as osteoporosis , urinary system diseases , and pseudo obstruction that resulted from sle have brought huge damage for patients ' life [ 2 , 3 ] . even though several diagnostic criteria have been made for sle diagnosis in clinical and played certain significant roles in sle treatment and diagnosis \n , the results for sle diagnosis still remain unsatisfactory due to the diversity and hidden characteristics , serology indexes , and complicate pathogen mechanism [ 4 , 5 ] . \n therefore , it will be of great significance to investigate the mechanism for sle treatment . \n previous viewpoint shows that b - cell activation in sle patients is mainly assisted by t cells , but recent reports indicate that b - cell activation in sle development depends on the activation of toll - like receptors ( tlrs ) pathway instead of t cell . \n tlrs are some signal transduction receptors for pattern recognition receptors which can recognize various kinds of ligands and specific molecular patterns and can induce some fight infection and innate immunity and then play pivotal roles during innate immunity [ 8 , 9 ] . \n tlr9 is a member of the tlr family which plays a fundamental role in pathogen recognition and activation of innate immunity . \n recent papers show that several tlr members play certain roles in sle progression and pathogen , including tlr9 and tlr7 . \n ligands for tlr9 are some nonmethylate or low methylate dpg dnas and play certain recognition roles in endoplasmic reticulum , which is different from other receptors . meanwhile \n , increasing evidence shows that many tlrs - induced cytokines play crucial toxic actions in the development of sle , and the combination of tlr9 and ligand could activate variety of immune cells to produce cytokines . \n for instance , when pdc from female b6 129f2 rats was stimulated by hsv-2 dna , ifn- secreted by tle9/ cell was significantly declined compared with that in wild type rats . \n also , mrna expression of tlr9 in active stage sle is high , as well as the il-10 level in sle pbmcs , which suggests the correlation between tlr9 level and il-10 expression in sle . \n although many studies have been devoted to the mechanism exploration of tlrs in sle development or diagnosis , roles of tlr9 in clinical sle diagnosis still remain controversial . in this study , we used comprehensive experimental methods to detect the expression of tlr9 and to analyze the correlation between tlr9 expression and cytokines secretion level in sle patients . \n our study may provide basis for tlr9 application in the clinical diagnosis and treatment for sle . \n a total of 39 patients who were diagnosed as sle in the third xiangya hospital central south university and with at least 2 years of follow - up were enrolled in this study . \n thereto , 9 are male and 30 are female , 26 patients were complicated with nephritis , 9 cases were complicated with pulmonary lesions , 12 cases were complicated with heart damage , and 15 patients were complicated with skin lesion . also , 27 cases were in active stage while 12 were in remittent stage . \n the characteristics of the total enrolled sle patients and healthy controls are summarized in table 1 . \n patients who suffered from sle were diagnosed based on the american college of rheumatology ( acr ) 1997 revised criteria . \n all the experimental procedures in this study were approved by the ethics committee from the third xiangya hospital central south university , and informed consent and approval of patients were obtained from all the enrolled patients . \n the sle tissue samples were collected at the time of surgery , snap - frozen in liquid nitrogen , and then stored at 80c . for peripheral blood b - cell isolation , 5 ml of peripheral blood was labeled with 50 l of anti - human cd20 antibody supplemented with colloidal paramagnetic microbeads ( miltenyi bio , germany ) . \n tlr9 mrna expression in b cells from sle patients or healthy persons was detected as previously described . \n briefly , b cells isolated from different human skin tissues were grinded in cell lysis buffer and then washed with pbs buffer for 3 times . total rna from b cells \n was extracted using trizol extraction reagent ( invitrogen , usa ) according to manufacturer 's protocol , and then rnase - free dnase i ( sangon , shanghai , china ) was added to mixtures to remove dna . \n the concentration and purity of isolated rna were measured using sma4000 uv - vis ( merinton , shanghai , china ) at the wavelength of 260 nm . the purified rna ( 0.5 g/l ) \n was used for cdna synthesis with the primerscript 1st strand cdna synthesis kit ( invitrogen , usa ) . \n expressions of mrnas were detected using sybr green - based quantitative rt - pcr ( invitrogen , usa ) . \n the total reaction system ( 20 l volume ) containing 1 l cdna from the above pcr , 10 l sybr premix ex taq , 1 l each of the primers ( 10 m ) , and 7 l ddh2o . \n pcr reaction was carried out at 50c for 2 min and 95c for 10 min followed by 40 cycles of 95c for 15 s and 60c for 1 min . \n melting curve analysis of amplification products was performed at the end of each pcr to confirm that only one product was amplified and detected . \n primers used for targets amplification were shown as follows : tlr9 sense primer : 5-atgggtttctgccgc-3 , antisense primer : 5-ggacgccgtagagaag-3 ; foxp3 sense primer : ctcaagcactgccaggcggac , and antisense primer : cagcggatgagcgtggcgtagg ; -actin sense primer : 5-ggacttcgagcaagagatg-3 , antisense primer : 5-acatgcggttgtgtcacga-3. in addition , tlr9 antibody ( invitrogen , usa ) was labeled with fluorescein isothiocyanate ( fitc ) , and cd20 antibody labeled b cells were used to determine the expression of tlr9 in b cells as previously described . \n ten ml of peripheral blood isolated from sle patients and healthy donors was centrifuged at 12,000 rpm at 4c to obtain serum . \n serum anti - ds - dna antibody and serum il-6 were detected using elisa kit ( rd , usa ) as previously described [ 20 , 21 ] . \n briefly , pretreated microtitre plates were coated with 50 g / ml of calf thymus dsdna ( sigma , usa ) for 2 h at 37c and then placed overnight at 4c . \n after that , plates were washed with pbs buffer containing 0.05% tween-20 ( pbst ) for three times and then blocked with 5% goat serum in pbst for 1 h. then serum samples ( diluted at 1 : 100 in pbst containing 10% calf serum and 5% goat serum ) were incubated with horseradish peroxidase- ( hrp- ) conjugated goat anti - mouse igg ( sigma , usa ) for 2 h at 37c . \n finally , reaction was blocked with 2 n h2so4 and absorbance was measured using a microplate reader ( biorad ) at 492 nm . \n sirna - tlr9 ( invitrogen , usa ) plasma was transfected into cd20 + labeled b cells for 24 h. b cells transfected with scrambled sirna plasma were considered as the controls . \n total rna was isolated from the b cells in each group based on the trizol extraction reagent ( invitrogen , usa ) according to manufacturer 's protocol . \n consequently , relative tlr9 mrna expression in b cells transfected with sirna - tlr9 plasma was measured based on the rt - pcr analysis which was described in the above method . \n primers used for silencing tlr9 were sense primer : 5-gaaagcatcaaccacaccaa-3 , antisense primer : 5-acaagtccacaaag cgaagg-3. pcr was conducted using the protocol of 30 cycles of 94c for 30 s , 56c for 30 s , and 72c for 30 s. d - glyceraldehyde-3-phosphate dehydrogenase ( gadph ) was used as internal control . \n additionally , expressions of il-6 and ds - dna antibody in b cells transfected with sirna - tlr9 were detected using elisa as described in section 3 ( part three of methods ) . \n b cells were stimulated in vitro with cpg 2006 oligonucleotide ( cpg ) ( tib molbiol synthese labor gmbh , berlin , germany ) . \n the cells were resuspended in rpmi 1640 glutamax supplemented with 10% fbs , 5% penicillin / streptomycin , and 0.05 mm 2-mercaptoethanol ( gibco life technologies gmbh , darmstadt , germany ) . \n b cells at 1 10 were seeded and stimulated with 2.5 g / ml cpg for 48 h at 37c . \n after 2 days of culture , the supernatants were harvested and frozen at 70c prior to analysis . \n the total presented data were firstly tested for the normal distribution using one - sample k - s test and were expressed as mean standard error of mean ( sem ) . \n difference of the data was analyzed using the graph prism 5.0 software ( graphpad prism , san diego , ca ) . \n anova ( analysis of variance ) was used to calculate the difference for more than 3 groups . \n rt - pcr analysis was used to detect the expression level of tlr9 in b cells from sle patients ( figure 1 ) . tlr9 mrna level in sle patients \n was significantly increased compared with that in healthy patients ( p < 0.05 , figures 1(a ) and 1(b ) ) . additionally , flow cytometry analysis indicated that tlr9 level in cd20 + b cells from sle patients was significantly higher than that in control b cells ( p < 0.05 , figures 1(c ) and 1(d ) ) . th2 \n cytokines such as il-6 and il-10 have been demonstrated to be involved in sle development [ 22 , 23 ] . \n flow cytometry was used to assess the correlation between tlr9 expression and cytokines secretion in b cells isolated from sle patients ( figure 2 ) . \n compared with the controls , il-6 expression and ds - dna antibody level in sle patients were significantly increased ( p < 0.05 , figures 2(a ) and 2(b ) ) . however , when we analyzed the correlations between tlr9 expression and il-6 and ds - dna antibody levels in sle patients , the results showed that tlr9 overexpression was positively correlated to il-6 or ds - dna antibody level during sle development ( for il-6 , r = 0.768 , for ds - dna , r = 0.730 , figures 2(c ) and 2(d ) ) . after being transfected with sirna - tlr9 vector , tlr9 expression in sle - isolated b cells \n was significantly declined compared with that in positive and negative controls ( p < 0.05 , figure 3(a ) ) . on the other hand , \n expressions of il-6 and ds - dna produced by b cells were also analyzed based on the rt - pcr ; the results showed that il-6 and ds - dna levels in sirna - tlr9 group were both significantly declined compared with the controls ( p < 0.05 , figures 3(b ) and 3(c ) ) , indicating that silencing tlr9 may be positively correlated with il-6 and ds - dna levels in b cells . \n we further analyzed the cytokines including il-6 , il-10 , and il-1r levels for the identification of tlr9 expression on other cytokines secretion in sle - isolated b cells ( figure 4 ) . \n after being stimulated by cpg , secretion levels of il-6 , il-10 , and il-1r were all significantly increased compared to the control ( blank group ; p < 0.05 ) . since tlr9 is the specific recognized receptor for dna cpg in sle cells , the results further showed that levels of the three factors were significantly decreased by the silenced tlr9 ( p < 0.05 ) , which suggests that silencing tlr9 was negatively correlated with the three - factor secretion in cpg stimulated b cells . the tlr9 downstream signal - related proteins expression including foxp3 and icos was measured to further analyze the mechanism ( figure 5 ) . \n compared to the controls , relative mrna levels of foxp3 and icos ( inducible costimulator ) were both significantly decreased by the silenced tlr9 in vitro b cells , suggesting that silenced tlr9 may lead to the downregulation of pathway signals of foxp3 and icos . \n previous articles have reported the potential roles of tlr9 in sle of animal body 's development and progression ; however , the results remain controversial . in this study , we used sirna - mediated gene method to investigate the correlation of tlr9 expression cytokines secretion in sle isolated in b cells . in agreement with former study \n , our data showed that tlr9 mrna expression was higher in sle patients than that in healthy persons ( p < 0.05 ) . \n moreover , we firstly discovered that there was significant correlation between tlr9 expression and cytokines level including il-6 and ds - dna ( p < 0.01 ) . \n furthermore , silencing tlr9 significantly decreased the secretion of il-6 , il-10 , and il-1r in sle - isolated b cells , as well as the pathway - associated protein expression , including foxp3 and icos . \n foregoing evidences have shown that tlr9 was involved in sle through several manners such as mediating b - cell activation , mediating dc cells activation , and inducing cytokines secretion . \n for example , with the addition of il-2 and il-10 in cd27 labeled b cells , tlr9 expression in initial b cells was declined compared with that in memory b cells , which indicated the immune role of tlr9 in b - cell response . \n paper showed that that the structure change of dendritic cells ( dc ) may result in self - reactive b cells in sle , and means et al . \n described that tlr9 mrna level was significantly increased when dc cells were stimulated by autoantibody - dna complexes isolated from human sle serum . \n also , tlr9 was correlated to induce cytokines production including tnf- and il-10 involved in sle through activating pdc [ 13 , 26 ] . \n all of these evidences showed that tlr9 was involved in maintaining the tolerance of b cell to sle antibody and played a protective role for sle patients . in this study , \n secretions of il-6 and ds - dna antibody levels were declined by silencing tlr9 , indicating that tlr9 expression was positively correlated to il-6 and ds - dna antibody secretion in b cells from sle patients . \n il-6 plays pivotal roles in inflammation and the maturation of b cells and has been proved to be closely related to sle development and progression [ 27 , 28 ] , while ds - dna antibody is a specific index for sle diagnosis . \n influences of tlr9 expression on il-6 and ds - dna antibody levels in sle have not been fully described . \n however , anti - ds - dna antibody level was positively correlated with sle disease activity , and radioimmunoassay had shown that anti - ds - dna antibody in sle patients at active stage was significantly high compared with that in sle at resting stage . \n on the other side , il-6 mrna level was high in sle patients serum and can act as a biomarker in sle development . \n based on our data , we speculated that tlr9 expression was positively correlated to sle pathogen , and tlr9 expression could induce the b - cell secreted il-6 and ds - dna antibody to sle serum . \n subsequently , our study showed that icos and foxp3 expressions were decreased by silencing tlr9 in b cells , suggesting that silencing tlr9 was negatively correlated icos and foxp3 expressions in b cells . \n icos is a cd28 and ctla-4 cell - surface receptor family protein , which functions in immunodeficiency biological processes . \n icos was overexpressed in peripheral blood from sle patients and performed certain significant influence on th2 type cytokine secretion , such as il-10 and il-4 . \n it has been said that foxp3 plays significant roles in sle pathogen through being involved in the treg cells at the transcriptional level . based on our data , we speculated that silencing tlr9 may be involved in sle via downregulating the icos and foxp3 signal pathway . \n meanwhile , capolunghi and his colleagues have successfully blocked the self - antibodies produced in b cells from sle patients using tlr9 inhibitor . \n contrary to capolunghi 's study , we used gene silenced method to investigate the associations between tlr9 expression and sle development in human patients . besides \n , chen had demonstrated the understanding of tlr9 immune recognition in sle development through gene knockdown method in sle mice model . \n however , our study has successfully illustrated the immune role of tlr9 in human sle b cells using gene silenced method . in conclusion , \n the data presented in this study suggests that tlr9 may play pivotal roles in sle diagnosis through positively correlating with il-6 and ds - dna antibody secretion via being involved in the icos and foxp3 signal pathway . \n the successful application of silencing tlr9 in human sle b cells may loan theatrical basis for the possibility of tlr9 genetic therapy in sle diagnosis and treatment .", "role": "user" }, { "content": "to investigate the correlation between tlr9 and cytokine secretion in sle diagnosis and treatment . \n a total of 66 cases ( 39 sle and 27 healthy donors ) were enrolled in this study . \n the cd20 + labeled b cells were isolated from sle patients . \n tlr9 mrna expression from sle tissues and b cells was detected using rt - pcr . \n the cytokine secretion in b cells were measured using elisa . \n correlation between tlr9 expression and cytokines secretion was analyzed using gene silencing method . \n compared with the controls , tlr9 expression was significantly high in sle patients tissues , as well as in b cells . \n expressions of il-6 and ds - dna antibody were high in sle patients serum and were positively correlated with tlr9 level in sle patients ( il-6 , r2 = 0.768 ; ds - dna antibody , r2 = 0.730 ) . \n the il-6 and ds - dna expression were significantly decreased by silencing tlr9 compared to the controls . \n moreover , silencing tlr9 significantly decreased cytokines secretion including il-6 , il-10 , and il-1r , as well as the pathway - associated protein expression , including icos and foxp3 . \n the successful application of tlr9 silencing method in human sle b cells may loan theatrical basis for the possibility of tlr9 genetic therapy in sle diagnosis and treatment .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: researchers have identified a child behavior checklist ( cbcl ) profile for children with high levels of comorbid aggressive behavior , anxiety / depression , and attention problems , the dysregulation profile ( dp ) . \n this profile , first identified by biederman et al . , was initially considered junior or pediatric bipolar disorder and was labeled cbcl - pbd . \n more recently , however , the phenotype has been characterized as disruptive behavior disorders and/or severe mood dysregulation and labeled dp . \n dp appears to be highly genetic and relatively stable across childhood [ 4 , 5 ] . \n the results of recent longitudinal studies suggest that children with dp are at greater risk of developing comorbid mood and substance use disorders by young adulthood [ 69 ] . \n the effect appears to be unidirectional , with cannabis use preceding the onset of depressive symptoms . in several longitudinal studies , \n fergusson and horwood reported that early use of cannabis ( by age 16 ) predicted major depression by age 18 in a new zealand birth cohort , even after controlling for adolescent mood disorder . \n patton and colleagues found that daily adolescent cannabis use predicted the development of depression and anxiety in the next 7 years . \n in contrast , adolescent depression and anxiety did not predict cannabis use in this cohort . \n the results of these investigations suggest that early cannabis use may precede and even trigger depression in vulnerable individuals . \n data on depressive symptoms that precede cannabis use have provided evidence that cannabis use may increase risk for depression , even and perhaps especially in adolescents predisposed to depression . \n . demonstrated that girls from the pittsburgh girls study in the high depressive symptom trajectory were more likely to suffer increases in depressive symptoms after initiating cannabis use . in the raising healthy children project , \n fleming and colleagues found that adolescents who increased substance use more rapidly than their peers were also more likely to experience increases in depressive symptoms . based on this literature , cannabis use may be a precipitating factor for adolescent depression in vulnerable youth . \n therefore , it is crucial to measure depressive symptoms in at - risk children prior to substance use to help elucidate the role of childhood and concurrent mood disorder on adolescent cannabis use . \n they may also be more predisposed to using cannabis during this period because of early association with deviant peers , problems with parents , and less attachment to academic achievement . \n the results of longitudinal studies on depression and cannabis use suggest that individuals are at increased risk of worsening their depressive symptoms if they initiate cannabis use during this key developmental period . \n however , it is not clear if childhood dp is associated with greater risk for cannabis use , above and beyond the risk for adolescent depression . \n more research is warranted on depression and early cannabis use in adolescents with and without a history of dp . \n it is important to consider other possible covariates of early cannabis initiation , some of which may also be associated with childhood dp and adolescent mood disorder . \n for example , demographic factors such as race [ 18 , 19 ] and socioeconomic status [ 20 , 21 ] have been associated with different patterns of cannabis initiation . \n early puberty has been linked to early drug use [ 22 , 23 ] and depressive symptoms [ 24 , 25 ] . \n race , ses , and early maturation may influence cannabis initiation via association with substance - using peers , because peer substance use is a reliable predictor of early cannabis use [ 2628 ] . \n results from the virginia adult twin study of psychiatric and substance use disorders suggest that familial environmental factors have a powerful influence on substance use during early adolescence so parental characteristics may also be an important component in cannabis initiation . \n in particular , there is good evidence that authoritative parenting can provide a buffer against adolescent substance use [ 28 , 30 , 31 ] . \n the offspring of teenage mothers are at greater risk of behavior problems , including substance use , than the offspring of older mothers [ 3235 ] . \n however , no studies to date have examined dp in the offspring of teenage mothers . \n compared siblings from mothers of different ages in a nationally representative sample , concluding that children born to younger mothers were at greater risk of conduct problems such as cheating , telling lies , and destroying property . \n harden et al . similarly found that having a teenage mother predicted internalizing and externalizing behavior problems , using sibling and children - of - twins analyses . in both of these studies , \n the investigators were able to control for genetic and environmental confounds associated with having a young mother , to isolate the effect of younger maternal age from the effects of lower maternal education and being raised in a disadvantaged environment . \n however , it is unknown if there is a greater risk of dp in these offspring , and if childhood dp is a risk factor for their early cannabis use . \n higher rates of substance use have been documented in the offspring of teenage mothers compared to the children of older mothers , even after controlling for socioeconomic status ( ses ) and other factors associated with teenage motherhood . \n fergusson and woodward found that 20% of the offspring of teenage mothers in the christchurch health and development study had a cannabis use disorder by age 18 . \n after adjusting for ses , child rearing , child abuse , family functioning , and parental adjustment , this risk remained significantly higher for the offspring of younger mothers . \n for example , pogarsky and his colleagues reported that the sons of teenage mothers in the rochester youth development study were at greater risk of drug use , but not the daughters . \n many offspring of teenage mothers are resilient , however , and do not develop substance abuse problems [ 39 , 40 ] . more research is needed to identify early determinants of risk for adolescent substance use in these high - risk offspring , including childhood dp . \n the data for this study are from the teen mother study , a prospective study of teenage mothers and their children . \n the teenage mothers and their children were seen at delivery and at ages 6 , 10 , and 14 . \n we hypothesized that dp measured at ages 6 and 10 would be associated with cannabis use by age 14 , above and beyond the effects of depressive symptoms and other covariates identified in the literature on early substance use . \n these covariates included maternal characteristics such as the mother 's age at the child 's birth , family income , and parenting style . \n we also included child characteristics such as gender , depressive symptoms , early puberty , and early peer substance use . \n the goal of this study was to determine if childhood dp predicted cannabis use at age 14 in these high - risk children , even after controlling for depressive symptoms . \n pregnant adolescents were recruited from the magee - womens hospital prenatal clinic from 1990 to 1995 . they were interviewed after a prenatal medical examination during their second trimester , and again at delivery with their newborn infants . \n follow - up visits were conducted in our laboratory when the offspring were 6 ( 19952000 ) , 10 ( 20002005 ) , and 14 years old ( 20052010 ) . \n the institutional review boards of the magee - womens hospital and the university of pittsburgh approved each phase of this study . \n participants were informed about confidentiality and assured that their information was protected by a certificate of confidentiality issued by the national institute on drug abuse ( nida ) . the first contact with the teenage mothers occurred before their fifth month prenatal visit . \n they were interviewed about their reproductive history and substance use in a private room at the prenatal clinic . at the 6- , 10- , and 14-year follow - up visits at our offices , \n children were asked about peer substance use and reported on their own substance use at ages 10 and 14 . \n information from birth and offspring outcomes at ages 6 and 10 has been provided in previous reports ( e.g. , [ 33 , 4144 ] ) . \n the present study focuses on recent cannabis use in the 318 offspring seen at age 14 . \n all pregnant 12 to 18 year olds attending the prenatal clinic were eligible for the study . \n of the 448 girls who were originally approached to participate , 3 girls refused . of the remaining 445 pregnant teenagers , 15 moved out of the area prior to delivery , and 1 refused the delivery interview . \n additional losses included six twin births , five spontaneous abortions , two still - born infants , and three live - born premature infants who died . \n thus , 413 live - born singletons and their teenage mothers were assessed at delivery . \n a total of 318 women and their offspring were assessed at the 14-year follow - up phase , 77% of the birth cohort . \n twenty - three mothers refused to participate , 54 were lost to follow - up , 9 had moved out of the state , 2 children were adopted , and 7 children had died . out of the 318 completers , data for all measures in the current study were available for 254 mother - child dyads . \n missing data were examined using little 's test and determined to be missing completely at random ( mcar ) . \n this test compares participants with and without missing data using t - tests to determine if they are significantly different with an alpha = .05 . \n prenatal substance use and ses did not differ significantly between the mothers and offspring who completed the age 14 followup and those from the original birth cohort who were not assessed during this wave . \n the mothers , on average , were 16.3 years old ( range = 1218 years old ) at study recruitment : 75% were at least 16 years old , and 25% were 1215 years old . \n seventy - one percent are african - american , 29% are white , and 99% of them were unmarried at delivery . at the 14-year followup , \n the average monthly family income was $ 2,253 ( range = $ 0$9,990 ) , and mean maternal education was 12.8 years ( range = 718 years ) . \n most of the mothers ( 73% ) had completed high school or received a general equivalency diploma ( ged ) , 5% completed college . \n the offspring , on average , were 14.5 years old ( sd = 0.6 : range = 1316 years old ) at the last wave of testing . \n most of the children ( 84% ) lived with their biological mothers at the age 14-year followup ; the remaining 16% of the children lived with a custodian . \n the current custodian was interviewed for the study , so in these cases maternal responses reflect the responses of the current maternal figure for the child . \n a variable indicating that the child was not in his or her biological mother 's custody at the age 14 follow - up visit was not significantly associated with behavioral dysregulation at ages 6 or 10 ( = .04 and .03 , resp . ) , adolescent depression ( = .08 ) , or recent adolescent cannabis use ( = .07 ) and was dropped from further analysis . caregivers completed the child behavior checklist ( cbcl : ) during the age 6 and age 10 assessments . \n t - scores equal to or higher than 60 on the attention problems , anxious / depressed , and the aggressive behavior subscales were used to calculate the behavioral dysregulation profiles at ages 6 and 10 , resulting in a dichotomous measure indicating that the child met criteria for dp . \n the results of longitudinal studies on dp suggest that it remains relatively stable across childhood [ 4 , 5 ] . \n in the current study , dp at age 6 was significantly correlated with dp at age 10 . \n four percent of the offspring met criteria for dp at the age 6 assessment , and 6% of the sample met dp criteria at age 10 . \n meyer and her colleagues examined long - term sequelae of these subthreshold levels of comorbidity on the 3 subscales in children from a high - risk community sample . \n the authors report that children with the behavioral dysregulation profile using this cutoff were significantly more likely to suffer from comorbid psychopathology by young adulthood . \n adolescent depression was measured using the child depression inventory ( cdi : ) , a self - report measure with 27 items . \n total t - scores for the sample from 3594 ( m = 46.21 , sd = 9.33 ) at age 10 and 3493 ( m = 44.44 , sd = 8.53 ) at age 14 . \n based on the guidelines provided in the cdi manual , 8% of the offspring at age 10 and 10% of the offspring at age 14 had depressive symptom t - scores that could be considered above average . \n the t - scores at ages 10 and 14 were only modestly correlated ( r = .12 , p < .05 ) , and therefore , both variables were included in the multivariate analysis . \n adolescents were asked in the past year , on the days when you used cannabis , about how many joints did you usually smoke ? this was used to calculate average daily joints . \n the outcome measure in this study is any cannabis use in the past year ( 0 : average daily joints = 0 , 1 : average daily joints > 0 ) . \n fifty - one offspring ( 16% of the sample ) used cannabis in the past year . \n the offspring were asked what proportion of their friends used each substance : none , some , most , or all . \n these variables were then dichotomized ( 0 = none , 1 = some / most / all ) . \n thirty - six percent of the offspring reported that their peers were smoking cigarettes by age 10 . \n a similar percentage of the offspring ( 37% ) reported that their peers used alcohol by age 10 , but this variable was not significantly associated with behavioral dysregulation at age 6 ( = .05 ) or age 10 ( = .05 ) or with cannabis use at age 14 ( = .09 ) . \n only 4% of the offspring reported that their peers had ever used cannabis by age 10 . \n peer cannabis use at age 10 was not significantly associated with behavioral dysregulation at age 6 ( = .05 ) or age 10 ( = .08 ) or with recent cannabis use at age 14 ( = .05 ) . \n hence , peer alcohol and cannabis use by age 10 were not included in the multivariate analysis . \n adolescents were asked to compare their pubertal development to same - sex and same - age peers by answering this question from the petersen development scale : do you think your development is any earlier or later than most other boys / girls your age ? the possible responses were as follows : ( 1 ) much earlier than others your age , ( 2 ) a little earlier than others your age , ( 3 ) about the same as others your age , ( 4 ) a little later than others your age , ( 5 ) and much later than others your age . \n this ordinal measure was trichotomized into early for children responding 1 - 2 , on time for children who responded 3 , and \n half the offspring ( 51% ) that answered this question ( n = 310 ) rated themselves as about the same as others their age , with 22% rating themselves as a little earlier , and 7% rating themselves as much earlier than others their age . \n for example , 29% of girls and 30% of boys reported that they were a little or much earlier than their same - age peers . \n authoritative parenting was assessed with the my parents questionnaire , which has 27 items measuring 3 dimensions of parenting : parental acceptance and involvement , autonomy - granting , and strictness - supervision . \n the parental involvement scale ( alpha = .72 ) included 15 questions asking adolescents how strongly they agreed or disagreed with items such as i can count on my parent(s ) to help me out , if i have some kind of problem and my parent(s ) know who my friends are . \n the autonomy - granting scale ( alpha = .82 ) includes 12 items such as my parent(s ) let me make my own plans for things i want to do and my parent(s ) tell me that their ideas are correct , and that i should not question them . \n the strictness - supervision scale ( alpha = .76 ) includes 9 items such as in a typical week , what is the latest that you can stay out on week nights ( sunday thursday ) ? and how much do your parents really know about where you go at night ? scores from these 3 parenting scales were summed to create composite scores . an ordinal authoritative parenting score ( range = 03 , m = 1.4 , sd = 0.9 ) \n scores above the sample median on the involvement , autonomy , and strictness - supervision scales were coded 3 for authoritative parenting . \n scores below the sample median on all 3 dimensions of parenting were assigned an authoritative parenting score of 0 . \n scores above the sample median on one or two dimensions received authoritative parenting scores of 1 or 2 . \n several demographic variables were included in the multivariate analysis on recent cannabis use , including race of mother , age of mother during the index pregnancy , sex of adolescent , current age of adolescent , and family income . \n mothers reported their age and race at the time of entry into the teen mother study . \n the child 's birth month and year was used to calculate age at the 14-year assessment . \n child age was included in the multivariate analyses to control for the age range among offspring and the effect of chronological age on risk for recent cannabis use . \n monthly family income during childhood was measured by maternal report when the offspring were 6 and 10 years old . \n average monthly family income was $ 1356 at age 6 ( sd = 1,138 ) and $ 1,789 at age 10 ( sd = 1,454 ) . \n family income from the age 6 and age 10 assessments was averaged to create childhood family income scores ( m = 1,570 , sd = 1,154 ) . \n descriptive statistics were conducted on the variables of interest in the study . a hierarchical logistic regression analysis \n was then used to determine if childhood dp predicted recent cannabis use in 14-year - old offspring , after controlling for covariates of early cannabis initiation that have been previously identified in the literature . \n there was sufficient power to include 13 predictors in the final model with this sample size . \n the following steps were peer substance use at age 10 and depression scores at age 10 . \n age 14 covariates in the next step included depression scores , authoritative parenting , and pubertal timing . in the last step , we tested for interaction effects between race and each predictor , because of evidence that there may be different risk factors for health - risk behavior in white and african - american children ( e.g. , [ 5153 ] ) . \n descriptive statistics for the predictors of recent cannabis use are presented in table 1 , including the mean , standard deviation , and range of continuous variables . \n intercorrelations among dp at ages 6 and 10 , the other predictors , and cannabis use at age 14 are presented in table 2 . \n the behavioral dysregulation profiles at ages 6 and 10 were not highly correlated ( = .24 ) , and their coefficients in the regression analysis were not correlated highly enough to indicate multicollinearity ( = .47 ) . \n therefore , both variables were used in the multivariate analysis predicting adolescent recent cannabis use . \n younger maternal age , older adolescent age , lower childhood family income , less authoritative parenting , and concurrent adolescent depressive symptoms were significantly correlated with cannabis use at age 14 . \n the results of the hierarchical logistic regression analysis predicting recent cannabis use in the 14-year - old offspring are presented in table 3 , which illustrates the final step of the equation ( = 49.5 , p < .001 , cox & snell r = .19 ) . \n dp at age 6 , older adolescent age , and higher depression scores were significant predictors of recent cannabis use . \n there was also a significant interaction of race and pubertal timing ( figure 1 ) . \n there was a linear effect of pubertal timing on recent cannabis use for the white offspring , such that those who matured earlier were more likely to have recently used cannabis . \n by contrast , the african - american offspring who matured later appeared to be at greater risk of recent cannabis use than african - american offspring who matured earlier than their peers . \n this was the first study to examine dp in offspring of teenage mothers and to associate childhood dp with early cannabis use in these vulnerable adolescents . \n dp at age 6 was a significant predictor of cannabis use at age 14 , suggesting that it may be possible to identify children at risk of substance abuse at an early age within this vulnerable group . \n dp was correlated across middle childhood in this cohort , consistent with althoff et al . . \n however , dp at age 10 did not predict cannabis use by age 14 , contrary to our hypotheses . \n it is possible that behavioral dysregulation at age 6 may be especially detrimental for behavioral risk , at age of entry into the school system . \n this is a developmental period when children become independent from their families and spend their entire day at school , learning to concentrate on new cognitive tasks and avoid disrupting the classroom . \n they must also learn to form and nurture peer relationships that are less managed by their families while at school . \n children who fail to meet these challenges at a young age may be especially vulnerable to early cannabis use compared to children who only become extremely dysregulated by age 10 . \n age 6 , dp was also associated with having more peers who used cigarettes by age 10 , suggesting that one potential pathway from early dysregulation to early cannabis use is association with deviant peers . \n however , there was a separate independent effect of age 6 dp on cannabis use at age 14 , after controlling for the effects of age 10 peer cigarette use and age 14 depressive symptoms , indicating an additive effect of childhood dp on risk for adolescent cannabis use . \n this is an important finding and provides converging evidence that dp is a risk factor for substance use in high - risk community samples , and not just clinical samples of children and adolescents . \n future work will examine the effect of dp on early tobacco and alcohol use , to determine if childhood dp predicts other substance use in this vulnerable group of adolescents . \n there is evidence that early cannabis use predisposes individuals to developing a substance use disorder by young adulthood in general , and not just a cannabis use disorder specifically . \n additionally , we will examine the effects of childhood dp on these substances at age 16 , testing to determine if dp continues to predict cannabis and other substance use a more normative age . \n this study contributes to the literature on long - term behavioral risk in the adolescent children of teenage mothers . \n there are several reasons to expect a higher prevalence of dp in the offspring of teenage mothers than in the general population , including evidence of a strong genetic component . aside from genetic loading \n , the children of teenage mothers may experience different rearing environments than children of older mothers , which may also contribute to behavioral dysregulation . \n for example , they are more likely to be reared in poverty [ 56 , 57 ] and in less optimal home environments [ 58 , 59 ] . \n although 48 children were no longer in maternal custody at age 14 , custody was not associated with dp at ages 6 and 10 . \n reports of children 's behavior problems may also be influenced by maternal psychopathology , and teenage mothers may experience more mental health problems than women who delay childbearing [ 61 , 62 ] . \n the present findings suggest that a subsample of children of teenage mothers at extremely high risk of early cannabis use may be identified by elementary school . \n it is difficult to compare dp across studies because different criteria are used to characterize dp , and samples vary considerably with respect to mental health and age range . \n volk and todd found dp in 2.5% of children from a twin study of adhd . in both of these studies , the investigators used t - scores greater than 70 as the cutoff for dp . \n we used the more liberal cutoff score of 60 proposed by meyer and colleagues for nonclinical samples and found that 4% and 6% of our cohort met criteria for dp at ages 6 and 10 , respectively . \n although meyer et al . reported that 16% of their sample was classified with dp using t - scores 60 ; two - thirds of the mothers of these children had a mood disorder . \n sample whose mothers did not have a mood disorder ( n = 1 ) met criteria for dp . \n based on these comparisons , it is impossible to conclude that the offspring of teenage mothers are at greater risk of dp . \n although this study was unique and contributes to our knowledge of risk for cannabis use in offspring of teenage mothers , there were some limitations . \n however , althoff and colleagues found that agreement across informants such as parents , youths , and teachers is only mild to fair . \n another limitation was the relatively small sample size , with only 12 children meeting criteria for dp at age 6 , and 17 children meeting criteria at age 10 . \n another limitation shared with meyer et al . was our use of the less stringent community sample dp criteria . \n thus , our results may not generalize to clinical samples , where the more stringent cutoffs are applied . \n finally , we did not include a biological measure for cannabis use . however , use at age 14 is likely to be sporadic and the half - life for thc is only 1224 hours . \n biological measures may miss a significant amount of use . to increase the accuracy of the reported data , we constructed detailed questions , thoroughly tested our measures , carefully selected interviewers , and extensively trained our staff in interview techniques . \n this is the first study to examine dp in the offspring of teenage mothers and to consider childhood dp as a predictor of cannabis use during adolescence . \n it is not yet clear if dp is more prevalent in the offspring of teenage mothers . \n our finding that this phenotype is associated with cannabis use by age 14 in this sample adds to a converging line of evidence that dp is a risk factor for substance abuse [ 6 , 7 , 9 ] . \n dp at age 6 remained a significant predictor of recent cannabis use at age 14 after adjusting for depressive symptoms at age 10 and concurrent depressive symptoms , suggesting that dp has predictive validity for early cannabis use above and beyond its association with depression . \n one of the implications of this study is that early identification of children with dp may help target interventions to prevent early cannabis use in this vulnerable population , thereby obstructing one pathway to dual diagnosis by adulthood . \n these children should be monitored for a long - term for risky behavior and association with deviant peers , even if they display less depressive and other behavioral symptoms as they enter adolescent . \n another clinical implication is that early puberty may be an important risk factor for early use in white but not african - american children .", "role": "user" }, { "content": "background . \n offspring of teenage mothers are at greater risk of early drug use . \n research has identified a child behavior checklist ( cbcl ) profile for children with high levels of comorbid behavior problems , the dysregulation profile ( dp ) , as another risk factor for drug use . method . \n teenage girls ( 1218 years old ; 71% african - american , 29% white ) were recruited during pregnancy . \n data were collected during pregnancy and when offspring were 6 , 10 , and 14 years old ( n = 318 ) . \n mothers completed the cbcl when children were at ages 6 and 10 , and children who scored 60 or higher on all 3 dp subscales ( aggression , anxiety / depression , and attention problems ) were categorized as dysregulated . at ages 10 and 14 , the offspring ( 50% male , 50% female ) reported on their cannabis use and completed the childhood depression inventory ( cdi ) . \n results . \n dp at age 6 and depressive symptoms at age 14 predicted recent cannabis use in the offspring . \n there was a significant interaction between race and pubertal timing such that white offspring who matured earlier were at greater risk of recent cannabis use . \n conclusions . \n the results of this study suggest that it may be possible to identify a subset of children at risk of dual diagnosis as early as age 6 .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: muscle cramps are painful , local , tangible , and involuntary skeletal muscular contractions that usually affect leg muscles . \n muscle cramps are one of the common symptoms of pregnancy , especially during the third trimester that are often unidirectional . \n leg cramps mostly happen twice a week or less frequently , usually at night , last a few seconds to a few minutes , and mostly disappear by themselves . \n the mechanism for cramping is not known yet and is likely to be idiopathic , but it could be due to physiological changes in neuromuscular performance , weight gain , joint laxity in the final stages of pregnancy , impaired blood supply to lower body organs , and increased pressure on leg muscles during pregnancy . \n pressure on blood vessels and nerves resulting from the enlarged uterus , imbalances between the intake and output of electrolytes and vitamins , and insufficient minerals intake might be other reasons for cramping . hence , could increase glomerular filtration and greater needs of the fetus for receiving minerals from the mother ( which reduces her serum calcium and magnesium levels ) . \n cramps during pregnancy are not related to pregnancy complications and are not accompanied by undesirable consequences for the fetus , but the american sleep association considers leg cramps as one of the reasons for sleep disorders during pregnancy . \n sleep disorder resulting from cramps influences performance of daily activities and may lengthen the duration of pregnancy and the type of childbirth . \n moreover , the findings of studies have suggested that women with snoring in pregnancy have a higher risk for growth retardation of the fetus ; and women with sleep deprivation have a higher risk for preterm births . \n various treatments have been suggested for preventing and curing leg cramps during pregnancy including taking vitamins b1 , b6 , e , and c and magnesium . \n the effects of the calcium supplement on improving leg cramps during pregnancy were investigated in many studies . \n some of these studies reported relative or complete improvements of symptoms when calcium supplements were taken while others stated these supplements were ineffective . \n vitamin d is a fat - soluble vitamin found in very small quantities in natural food materials . \n taking calcium supplement in food materials is necessary during pregnancy to prevent depletion of calcium in the mother 's body . \n leg cramps are very prevalent in pregnant women and have negative influences on pregnant women 's sleep performance and quality . \n moreover , the mechanism of the effects of vitamin d on calcium is not known and no study has been conducted on the effects of vitamin d on leg cramps . furthermore , vitamin d is present in very quantities in food materials , vitamins are cheap , and pregnant women are very willing to take vitamins . \n that is why we decided to conduct a study on the therapeutic effects of vitamin d and calcium plus vitamin d supplement on leg cramps during pregnancy . \n this study was conducted as a double - blind randomized controlled clinical trial on pregnant women who were referred to health - care centers in tabriz - iran , 2013 . a 1835-year - old , being in 2530 week of pregnancy and having minimum of two cramps during the week . \n exclusion criteria included history of chronic diseases , kidney problems , osteomalacia , active thyroid or parathyroid diseases , endocrine disorders , hypertension , use of diuretics , calcium - blockers intake , chronic hypertension , and history of allergy to the study supplements . \n since = 0.05 , = 0.02 , m1 = 49.17 ( the overall mean score of cramp intensity before prevention ) , m2 = 35 ( the overall mean score of cramp intensity after the intervention ) , sd1 = 20.6 , and sd2 = 23 , the calculated number of participants for each group was 38 . however , 42 participants were placed in each group to allow for dropouts . \n the tools used for collecting data included sociodemographic and midwifery questionnaires and checklists to record weekly information on leg cramps in the 3 and 6 week of the intervention . \n the participants marked information on the frequency , intensity ( in the visual analog scale [ vas ] , graded from 0 to 10 with zero for lack of pain and ten for very severe pain , for each cramping event ) , length ( in minutes ) , and the time leg cramps happened in the checklists during the 3 and 6 week of the intervention . at the end of the 3 and 6 week of the intervention \n , the participants marked the checklist table related to side effects of taking the vitamin d and vitamin d plus calcium supplements . \n furthermore , to control for the potentially confounding factor of diet , a dietary record questionnaire including foods containing calcium and vitamin d was also completed by the participants during 1 week before intervention . \n sociodemographic and midwifery questionnaire as well as checklists for recording number and length of leg cramps were designed by research team and the content and face validity of them were confirmed by ten faculty members of tabriz university of medical sciences . \n sampling started after obtaining ethical code from the ethics committee of research and technology deputy of tabriz university of medical sciences under the number 91230 and registering the trial in the irct website under the code irct2013040810324n12 . \n thirty - three health centers from various areas in tabriz , with different sociocultural situations that were visited by the largest numbers of women were first selected from the total of eighty health centers in the city . \n health centers in the country are public , nonreferral , and governmental that all primary care services , including prenatal care , are provided free of charge . \n a list of all pregnant women in their 2530 week of pregnancy who visited the selected centers was prepared . \n they were then contacted by telephone and invited to take part in the study . during their first visit to the center , \n the goals and method of the study were explained and the checklists for recording characteristics of leg cramps including the frequency , length , and intensity of leg cramps were given to them to record these during the week before the intervention started . at the end of this week , those who had recorded two and more cramps during the week and had other eligibility criteria entered the study and completed their informed written consent to participate in the research . \n the participants were allocated to three groups using a randomized block design with block sizes of three and six with the allocation ratio 1:1:1 . to hide the allocation , each participant received two small envelopes , each with enough medicine for 3 weeks , inside a large matte - colored envelope of the same shape that were serially numbered . \n pills containing vitamin d ( 1000 units ) or vitamin d plus calcium complements ( 300 mg of calcium carbonate and 1000 units of vitamin d ) were of the same shape , size , and weight as the placebo pills . the pills were prepared by the faculty of pharmacy in tabriz university of medical sciences , iran . at the start of the intervention , \n each participant received a small envelope containing calcium plus vitamin d or vitamin d or the placebo , a checklist for recording leg cramp characteristics , and a checklist for recording daily multivitamins and pills taken during 3 weeks . \n they were asked to mark the checklists every time they took the pills . at the end of the 2 week of the study , \n the participants were called and asked to record the characteristics of leg cramps during the third week in the related checklists . \n they were reminded to bring the medicine envelope and the checklist for leg cramps during the 3 week and the checklist of medicines taken with them at the next follow - up that was at the end of the 3 week . during this visit , \n each of the participants received a second envelope with the same content as the first , together with the checklists for the second 3-week period . at the end of the 5 week , the participants were called and reminded to record the characteristics of the leg cramps that happened during the 6 week in the related checklists . \n they were asked to bring these checklists and the checklists related to the medicines taken , together with the second envelopes , with them to the second follow - up visit at the end of the 6 week . \n chicago ) . the k - s test was used to investigate the normality of the quantitative data . \n the variables of the length of cramps before the intervention , during the 3 week of the intervention , and during the 6 week of the intervention were not normal . \n the chi - square , chi - square for trend , fisher exact test , and one - way anova were used to examine the consistency of study groups . to compare the average pain severity of leg cramps between three groups , \n the baseline ( preintervention ) value of pain severity as possible confounder factor was entered to repeated measures anova model as covariate . \n kruskal wallis and friedman tests were used , respectively , for inter- and intra - groups comparisons of the number and the length of leg cramps before , during the 3 , and 6 after the start of the intervention . \n this study was conducted as a double - blind randomized controlled clinical trial on pregnant women who were referred to health - care centers in tabriz - iran , 2013 . a 1835-year - old , being in 2530 week of pregnancy and having minimum of two cramps during the week . \n exclusion criteria included history of chronic diseases , kidney problems , osteomalacia , active thyroid or parathyroid diseases , endocrine disorders , hypertension , use of diuretics , calcium - blockers intake , chronic hypertension , and history of allergy to the study supplements . \n since = 0.05 , = 0.02 , m1 = 49.17 ( the overall mean score of cramp intensity before prevention ) , m2 = 35 ( the overall mean score of cramp intensity after the intervention ) , sd1 = 20.6 , and sd2 = 23 , the calculated number of participants for each group was 38 . however , 42 participants were placed in each group to allow for dropouts . \n a 1835-year - old , being in 2530 week of pregnancy and having minimum of two cramps during the week . \n exclusion criteria included history of chronic diseases , kidney problems , osteomalacia , active thyroid or parathyroid diseases , endocrine disorders , hypertension , use of diuretics , calcium - blockers intake , chronic hypertension , and history of allergy to the study supplements . considering research carried out by yaghmaei et al . and since = 0.05 , = 0.02 , m1 = 49.17 ( the overall mean score of cramp intensity before prevention ) , m2 = 35 ( the overall mean score of cramp intensity after the intervention ) , sd1 = 20.6 , and sd2 = 23 , the calculated number of participants for each group was 38 . \n the tools used for collecting data included sociodemographic and midwifery questionnaires and checklists to record weekly information on leg cramps in the 3 and 6 week of the intervention . \n the participants marked information on the frequency , intensity ( in the visual analog scale [ vas ] , graded from 0 to 10 with zero for lack of pain and ten for very severe pain , for each cramping event ) , length ( in minutes ) , and the time leg cramps happened in the checklists during the 3 and 6 week of the intervention . at the end of the 3 and 6 week of the intervention \n , the participants marked the checklist table related to side effects of taking the vitamin d and vitamin d plus calcium supplements . \n furthermore , to control for the potentially confounding factor of diet , a dietary record questionnaire including foods containing calcium and vitamin d was also completed by the participants during 1 week before intervention . \n sociodemographic and midwifery questionnaire as well as checklists for recording number and length of leg cramps were designed by research team and the content and face validity of them were confirmed by ten faculty members of tabriz university of medical sciences . \n sampling started after obtaining ethical code from the ethics committee of research and technology deputy of tabriz university of medical sciences under the number 91230 and registering the trial in the irct website under the code irct2013040810324n12 . \n thirty - three health centers from various areas in tabriz , with different sociocultural situations that were visited by the largest numbers of women were first selected from the total of eighty health centers in the city . \n health centers in the country are public , nonreferral , and governmental that all primary care services , including prenatal care , are provided free of charge . \n a list of all pregnant women in their 2530 week of pregnancy who visited the selected centers was prepared . \n they were then contacted by telephone and invited to take part in the study . during their first visit to the center , \n the goals and method of the study were explained and the checklists for recording characteristics of leg cramps including the frequency , length , and intensity of leg cramps were given to them to record these during the week before the intervention started . at the end of this week , those who had recorded two and more cramps during the week and had other eligibility criteria entered the study and completed their informed written consent to participate in the research . \n the participants were allocated to three groups using a randomized block design with block sizes of three and six with the allocation ratio 1:1:1 . to hide the allocation , each participant received two small envelopes , each with enough medicine for 3 weeks , inside a large matte - colored envelope of the same shape that were serially numbered . \n pills containing vitamin d ( 1000 units ) or vitamin d plus calcium complements ( 300 mg of calcium carbonate and 1000 units of vitamin d ) were of the same shape , size , and weight as the placebo pills . \n the pills were prepared by the faculty of pharmacy in tabriz university of medical sciences , iran . at the start of the intervention , \n each participant received a small envelope containing calcium plus vitamin d or vitamin d or the placebo , a checklist for recording leg cramp characteristics , and a checklist for recording daily multivitamins and pills taken during 3 weeks . \n they were asked to mark the checklists every time they took the pills . at the end of the 2 week of the study , \n the participants were called and asked to record the characteristics of leg cramps during the third week in the related checklists . \n they were reminded to bring the medicine envelope and the checklist for leg cramps during the 3 week and the checklist of medicines taken with them at the next follow - up that was at the end of the 3 week . during this visit , \n each of the participants received a second envelope with the same content as the first , together with the checklists for the second 3-week period . at the end of the 5 week , the participants were called and reminded to record the characteristics of the leg cramps that happened during the 6 week in the related checklists . \n they were asked to bring these checklists and the checklists related to the medicines taken , together with the second envelopes , with them to the second follow - up visit at the end of the 6 week . \n chicago ) . the k - s test was used to investigate the normality of the quantitative data . \n the variables of the length of cramps before the intervention , during the 3 week of the intervention , and during the 6 week of the intervention were not normal . \n the chi - square , chi - square for trend , fisher exact test , and one - way anova were used to examine the consistency of study groups . to compare the average pain severity of leg cramps between three groups , \n the baseline ( preintervention ) value of pain severity as possible confounder factor was entered to repeated measures anova model as covariate . \n kruskal wallis and friedman tests were used , respectively , for inter- and intra - groups comparisons of the number and the length of leg cramps before , during the 3 , and 6 after the start of the intervention . \n in this study , 126 pregnant women with leg cramps from july 2013 to january 2014 entered the study and their conditions were followed up to april 2014 . \n flowchart of the study there were no statistical differences between groups regarding consuming of foods containing calcium and vitamin d during 1 week before intervention ( p = 0.204 ) and sociodemographic characteristics ( p > 0.05 ) except of prepregnancy body mass index ( bmi ) ( p = 0.024 ) and bmi during pregnancy ( p = 0.008 ) [ table 1 ] . demographic and obstetrical characteristics of the participants by study groups before the intervention , there was no statistically significant difference between the groups in terms of length ( p = 0.160 ) and pain severity of leg cramps ( p = 0.990 ) , but there was statistically significant difference between the groups in terms of weekly number of leg cramps ( p = 0.012 ) [ tables 24 ] . \n comparison of the leg cramps number in pregnancy in three groups of study comparison of the leg cramps length ( min ) in pregnancy in three groups of study comparison of the severity of leg cramps pain ( visual analog scale ) in pregnancy in three groups of study according to kruskal \n wallis test , there was significant difference between the groups in terms of the weekly number of leg cramp during the 3 week after the start of the intervention ( p = 0.033 ) and the number of leg cramp was less in the control group . however , there was no significant difference between the groups during 6 week after the start of the intervention ( p = 0.098 ) [ table 2 ] . \n furthermore , there was no significant difference between the groups in terms of the length of leg cramps during the 3 week ( p = 0.308 ) and 6 week after the start of the intervention ( p = 0.079 ) [ table 3 ] . \n in addition , the weekly number of leg cramp and the length of leg cramps were significantly decreased in each three groups according based on intra - groups comparison by friedman test ( p < 0.05 ) [ tables 2 and 3 ] . \n based on the repeated measure anova test with adjusting for baseline value , there was no statistically significant difference between the vitamin d and control groups ( p = 0.814 ) , calcium - vitamin d and control groups ( p = 0.931 ) , and also between two treatment groups ( p = 0.993 ) [ table 4 ] . at the end of the 6 weeks , two participants in the group receiving calcium - vitamin d , 13 in the group receiving vitamin d , and six in the group receiving placebo reported itching . \n furthermore , six participants in the group receiving calcium - vitamin d , 14 in the group receiving vitamin d , and six in the group receiving placebo reported they experienced dry mouth . \n results of this research showed that the calcium - vitamin d and vitamin d supplements had no effect on the number , length , and pain severity in leg cramps during the 6 weeks of the study . \n danesh shahrakiconducted a study on three groups of pregnant women with leg cramps ( who received calcium , vitamin e , or magnesium milk ) with no control group . \n they found that prescribing calcium carbonate at 500 mg / day for 45 days reduced the number , length , and pain intensity on the 45 day , but that on the 90 day after the first visit , these figures returned to their previous values . \n observed that prescription of calcium at 500 mg / day for 40 days reduced the number of leg cramps but had no effect on pain intensity . \n ( 1987 ) , prescription of one gram of calcium for 2 weeks clinically improved leg cramps . \n results of these two studies do not conform to those found in the present study , probably due to the difference in the doses of the prescribed medicines , and because calcium was used together with vitamin d in our research . \n we suggest that future studies be carried out using higher doses to determine the effective one . according to the study by zhou et al . , there was no difference in the frequency of leg cramps after treatment with calcium versus vitamin c. since the control group received ascorbic acid in their study , and cramps improved relatively or completely in most participants . \n the results of systematic review by young et al . showed that calcium can decrease pain in a leg cramps and it has positive effect on treatment . \n furthermore , the results of cochrane systematic review showed that a greater proportion of women receiving calcium supplements experienced no leg cramps after treatment than those receiving no treatment . \n this review suggested that large well - conducted randomized controlled trials are needed in this regard due to poor study design and small sample size of trials . \n the above - mentioned studies have assessed the effects of calcium on leg cramps but no studies have been conducted so far on the effect of vitamin d supplement on cramps . \n however , calcium and bone metabolisms greatly depend on vitamin d concentration and on its metabolically active form , 1,25(oh)2d , and the human body can not absorb sufficient ca and p without the help of 1,25(oh)2d . \n moreover , the 1,25(oh)2d produced in the kidneys stimulate the calcium reserve in bone tissues and in the intestines and helps ca and p absorption ; and finally , the combination of these activities increases serum ca and p. increased levels of serum ca and p cause improvements in metabolic performances , bone health , and neuromuscular functions . \n as vitamin d and ca had no effect on leg cramps in our study , and because the main reason for , and the mechanism of leg cramps in pregnancy are not clear yet , leg cramps during pregnancy may not be due to calcium deficiency and could have other causes . \n lack of visual observation to investigate pain intensity in leg cramps was one of the limitations of this study . \n furthermore , the impossibility of measuring blood calcium and vitamin d levels was another limitation . \n it is recommended that future clinical trials should investigate the effects of vitamin d and calcium - vitamin d supplements with different doses of these materials , intervention should take place using a larger sample , and serum calcium and vitamin d levels ought to be assessed to obtain results that are more accurate . \n results of this study indicated that taking 1000 iu vitamin d and 300 mg calcium plus 1000 iu vitamin d every day for 6 weeks has no effect on leg cramps . \n one of the limitations in this study was the short follow - up period , so that a follow - up period longer than 6 weeks in the future researches was suggested . \n furthermore , the serum levels of calcium and vitamin d did not determined in this study due to cost restrictions . \n therefore , these supplements should be administrated by assessing their serum levels before and after the intervention . \n \n \n am contributed in the conception of the work , conducting the study , drafting , and agreed for all aspects of the work . \n mm contributed in the conception of the work , conducting the study , analyzing the data , revising the draft , and agreed for all aspects of the work . \n sm contributed in the conception of the work , conducting the study , revising the draft , and agreed for all aspects of the work . \n mn contributed in the conception of the work , synthesis of drugs , revising the draft , and agreed for all aspects of the work .", "role": "user" }, { "content": "background : this study intended to determine the effects of vitamin d and calcium - vitamin d in treating leg cramps in pregnant women.materials and methods : this study was conducted as a double - blind randomized controlled clinical trial on 126 participants , 1835-year - old pregnant women with a minimum of two leg cramps per week who were referred to health - care centers in tabriz - iran in 2013 . \n the participants were allocated to three 42 member groups using a randomized block design . for 42 days , \n the intervention groups took a 1000 unit vitamin d pill or 300 mg calcium carbonate plus a 1000 unit vitamin d pill , and the control group received a placebo pill every day . \n the participants were evaluated with regard to the frequency , length , and pain intensity of leg cramps during the week before and during the 3rd and 6th week of the intervention . \n the ancova and repeated measurement test were used to analyze the data.results:results showed that controlling for the effects before the intervention , calcium - vitamin d , and vitamin d supplements had no effect on the frequency , length , and pain intensity of leg cramps.conclusion:the results of this study showed that the calcium - vitamin d and the vitamin d supplements have no effect on the frequency , length , and pain intensity of leg cramps during the 6 weeks of the study .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: hereditary hemorrhagic teleangiectasia ( hht ) also known as rendu - osler - weber 's disease , is an autosomal - dominant vascular dysplasia , characterized by multi - focal widenings of distal arteries and a high prevalence of vascular malformations . \n cerebral vascular malformations in hht are most frequently low - grade avms ( spitzer martin grade 2 ) . \n hht may be complicated by a number of cerebral diseases , such as ischemic stroke , intra - cerebral bleeding , central nervous system infection , cerebral abscess , or epilepsy in case of a cerebral vascular malformation . \n the risk of intra - cerebral hemorrhage is low in hht , particularly if a pulmonary avm is present . among those who experience intra - cerebral hemorrhage \n furthermore , cerebral abscess is not unusual in hht and develops in about 1% of the patients . \n epilepsy in hht is most frequently due to the presence of cerebral vascular malformations . in the absence of a cerebral vascular malformation , \n even more rare is the association of hht with hypercoagulability , although it has been recently shown that , sideropenia due to hemorrhagic iron losses is associated with elevated plasma levels of coagulation factor - viii , as in the following case . \n the patient is a 64-year - old ( april 2012 ) serbian gipsy , height 175 cm , weight 55 kg , with a history of arterial hypertension , hyperlipidemia requiring statin therapy , nicotine abuse , peripheral arterial occluding disease , and recurrent epistaxis since several years . \n in 2007 he experienced thrombosis of the mesenteric veins , requiring partial resection of the small intestines . in january 2009 \n portal venous thrombosis occurred , which is why phenprocoumon was started . in may and june 2009 he underwent osteoplastic trepanation for a cerebral , fronto - parietal abscess with a left cerebellar stroke periprocedurally . since at least february 2010 sideropenic anemia was recognized , requiring iron substitution . \n since at least april 2010 he experienced recurrent cloni of the right lower leg . in april 2010 , during a phenprocoumon pause for gastro - intestinal bleeding , a further ischemic stroke in the left occipital region and one day later in the left temporal area occurred . \n diagnostic work - up for suspected thrombophilia in february and march 2010 revealed a markedly increased factor - viii [ table 1 ] . \n there was no indication for severe ventricular rhythm abnormalities , pauses or atrial fibrillation or flutter . \n computed tomography ( ct)-scans of the cerebrum , thorax , and abdomen revealed pulmonary and renal avms exclusively . in april \n diabetes mellitus was first diagnosed in may 2009 and required permanent treatment since october 2011 . in july 2011 polyneuropathy was diagnosed . \n the family history was positive for epistaxis in his father , uncle , daughter , and grandchild . \n results of blood tests in the described patient neurological investigations at age 63 and 64 years revealed discrete hemiparesis on the right side ( m5- ) with distal predominance on the lower limb ( m2 ) , and an exaggerated right patella reflex but otherwise reduced tendon reflexes . \n cerebral ct in july 2011 showed old ischemic lesions in the cerebellum bilaterally , and hyperdensities of the putamina bilaterally . \n cerebral magnetic resonance imaging ( mri ) ( december 2011 ) showed generalized diffuse atrophy , extensive subcortical gliosis with left - sided predominance , and multiple , spot - like lesions in the frontal white matter bilaterally . \n cerebral mri ( march 2012 ) showed old ischemic lesions in the cerebellum bilaterally and in the left parieto - occipital region . \n nerve conduction studies ( december 2011 ) revealed reduced nerve conduction velocity of the right peroneal nerve and the median nerves bilaterally and a nonexcitable sural nerve . \n polyneuropathy was diagnosed . in the absence of documented paroxysmal activity on electroencephalogram ( eeg ) , cloni of the right leg \n were interpreted as focal seizures , which is why levetiracetam was started in march 2011 and increased to a maximal dosage of 3000 mg / d . in july 2011 \n gabapentin was added and increased to a maximal dosage of 1800 mg / d . under this regimen \n focal seizures , which predominantly occurred during the night , stopped for about 2 months , but recurred in november 2011 , which is why gabapentin was increased to 2400 mg / d . despite this increase , seizures persisted , and levetiracetam was intended to be replaced by carbamazepine . \n unfortunately , he did not tolerate carbamazepine and developed tremor of the upper limbs and unsteadiness . in march \n 2012 eeg , for the 1 time , showed spikes and spike - wave complexes in the left centro - parieto - temporal regions , which is why carbamazepine was replaced by lacosamide . at his last visit he was on a medication with levetirazetam ( 2000 mg / d ) , lacosamide ( 100 mg ) , metformin ( 2500 mg / d ) , glimepirid ( 1 mg / d ) , and iron - sulfate , but \n the presented patient is interesting for the co - occurrence of hht and recurrent venous thrombosis due to increased factor - viii hypercoagulability . \n the patient had a history of recurrent epistaxis , teleangiectasias on the lips , avms in the kidneys and lungs , and a positive family history for the disease . \n hypercoagulability was diagnosed on the history with recurrent , multi - focal venous thromboses and blood coagulation tests . \n thrombosis has been occasionally reported in hht , the co - occurrence of hht and hypercoagulability due to an elevation of factor - viii , as in the presented case , is rare . \n to which degree both abnormalities influenced each other and contributed to the clinical presentation , remains speculative . since other plausible causes of venous thrombosis \n were absent in the presented patient , recurrent thromboses were attributed to the elevation of factor - viii . that thrombosis occurred despite oral anticoagulation is unusual but \n can be explained by the recurrent sub - therapeutic international normalized ratio - values , by impaired intestinal resorption of phenprocoumon , or generally by too low reference values . whether patients with hht , venous thrombosis and atherosclerosis should generally receive oral anticoagulation , \n antithrombotic agents alone or in combination or none of them , is questionable , particularly in the light of their increased bleeding risk due to their vascular dysplasia . \n however , those with hypercoagulability might profit from oral anticoagulation and those with atherosclerosis from antithrombotic treatment as long as their iron levels remain normal , and no acute or chronic bleedings occur . recurrent ischemic strokes in the presented patient presumably occurred because of poor risk factor control or abandoned antithrombotic treatment . following the experience with this patient it has to be guaranteed that patients with hht have normal serum iron levels to prevent hypercoagulability and to provide antithrombotic treatment if indicated . \n this case shows that hht may be associated with elevated factor - viii - induced hypercoagulability due to low serum iron levels from recurrent bleeding and that epilepsy may be a feature of hht even in the absence of a cerebral avm .", "role": "user" }, { "content": "recent data indicate that in patients with hereditary hemorrhagic teleangiectasia ( hht ) , low iron levels due to inadequate replacement after hemorrhagic iron losses are associated with elevated factor - viii plasma levels and consecutively increased risk of venous thrombo - embolism . here , we report a patient with hht , low iron levels , elevated factor - viii , and recurrent venous thrombo - embolism . \n a 64-year - old multimorbid serbian gipsy was diagnosed with hht at age 62 years . \n he had a history of recurrent epistaxis , teleangiectasias on the lips , renal and pulmonary arterio - venous malformations , and a family history positive for hht . \n he had experienced recurrent venous thrombosis ( mesenteric vein thrombosis , portal venous thrombosis , deep venous thrombosis ) , insufficiently treated with phenprocoumon during 16 months and gastro - intestinal bleeding . \n blood tests revealed sideropenia and elevated plasma levels of coagulation factor - viii . \n his history was positive for diabetes , arterial hypertension , hyperlipidemia , smoking , cerebral abscess , recurrent ischemic stroke , recurrent ileus , peripheral arterial occluding disease , polyneuropathy , mild renal insufficiency , and epilepsy . \n following recent findings , hypercoagulability was attributed to the sideropenia - induced elevation of coagulation factor - viii . in conclusion , hht may be associated with hypercoagulability due to elevated factor - viii associated with low serum iron levels from recurrent bleeding . \n iron substitution may prevent hht patients from hypercoagulability .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: it can coexist with gastroesophageal reflux disease , inflammatory diseases of the esophagus ( including candidiasis ) , esophageal stenosis , as well as diabetes , alcohol dependence syndrome , achalasia , mallory - weiss syndrome , crohn s disease , or tuberculosis [ 14 ] . \n structurally , the diverticula develop due to widening of the secretory ducts of the submucosal glands , which is why they are not true diverticula . \n the most commonly used diagnostic procedures in this context include endoscopy , which demonstrates the presence of small round cavities in the esophageal wall , and contrast radiography , which shows a specific symptom in the form of small bottle / flask - shaped protrusions in the mucous membrane [ 3 , 5 ] . \n combined with the patient s clinical presentation , computed tomography and endoscopic ultrasonography may also be useful in diagnosing eip . \n the treatment includes the use of anti - inflammatory agents in combination with therapy for diseases coexisting with eip . \n a 68-year - old male smoker , suffering from alcohol abuse and alcoholic cirrhosis , was transferred to the surgery clinic of the institute of tuberculosis and lung diseases with the diagnosis of nontransmural esophageal injury of unclear etiology . \n the obtained medical records of the patient included esophagoscopy results , which indicated the presence of openings suggesting the existence of an esophagobronchial fistula 30 cm from the incisors . \n however , computed tomography ( ct ) did not confirm the presence of a fistula . \n the examination did reveal concentric thickening of the whole length of the esophageal wall ( up to 9 mm ) and air - filled vesicles within the wall ( figs . 1 a , b ) . \n furthermore , liver cirrhosis and cecal wall thickening were revealed . a , b. computed tomography scans of the thickening the esophageal wall and air - filled vesicles within the wall the results of an x - ray examination with non - barium contrast included in the records demonstrated the presence of a reservoir filling with contrast ( 18 mm in length ) at the level of the gas vesicles in the esophageal wall that were visualized by ct ( fig . \n 2 ) . thoracic x - ray of a reservoir filling with contrast on admission to the clinic , the patient s condition was severe . \n laboratory investigation revealed anemia , thrombocytopenia , hyponatremia , hypokalemia , hypocalcemia , hypomagnesemia , hypo - albuminemia , prolonged coagulation time , and increased c - reactive protein ( crp ) concentration . \n the initial diagnosis considered non - transmural esophageal wall injury caused by a foreign body . \n however , the patient did not report swallowing any foreign bodies , making this diagnosis unlikely . \n esophagogastroscopy revealed small protrusions of the mucosa approximately 35 cm from the incisors ( fig . \n 3 ) . when a section of one of the lesions was acquired , white fluid effused from within , leaving behind a small cavity in the mucosa , which suggested that an intramural fluid - filled reservoir was emptied . \n additionally , in the segment from 30 cm to 37 cm , shallow oval cavities were found in the mucosa ( approximate dimensions of the largest one : 16 8 mm ) ; they were most likely the remains of reservoirs which had emptied spontaneously in the past ( figs . \n small protrusions of the esophageal mucosa a , b. small cavities in the esophageal mucosa the patient was treated conservatively ; he received antibiotic therapy and treatment for electrolyte disorders . \n on the 4 day of hospitalization , after control esophagogastroscopy was performed , showing that the esophageal lesions were stable , a decision was made to gradually introduce oral feeding ( liquids and mashed food ) . \n on the 8 day of hospitalization , the patient s general condition began to gradually deteriorate , with oxygen saturation falling to 60% . \n diagnosed with respiratory failure , the patient was transferred to the intensive care unit , where he received mechanical ventilation ( mode : bilevel fio2 0.8 , increased over the subsequent days to fio2 1.0 ) . \n control ct did not show signs of transmural esophageal perforation ; the esophageal walls were concentrically thickened , but to a lesser degree than that showed by the previous examination . \n bilaterally , areas of increased parenchymal density overlapped with emphysematous lung parenchyma , and ascites was diagnosed ( figs . 5 a , b ) . \n concentric thickening of the esophageal wall investigation of bronchial aspirate cultures revealed the presence of enterococcus faecalis and mold fungi . \n targeted antibiotic treatment was started , and the left pleural cavity was drained . despite the treatment , \n the general condition of the patient continued to gradually deteriorate . on the 14 day of his stay at the intensive care unit ( icu ) , \n esophageal intramural pseudodiverticulosis is a rare condition which was first described by mendl in 1960 . \n the eip has been reported to be associated with gastroesophageal reflux disease , inflammatory diseases of the esophagus ( including candidiasis ) , and esophageal stenosis . \n patients with diabetes , alcohol dependence syndrome , achalasia , mallory - weiss syndrome , crohn s disease , tuberculosis , and esophageal injuries caused by caustic agents are also at an increased risk of eip [ 36 ] . although eip is often associated with benign conditions , several cases of its coexistence with esophageal cancer have also been reported . \n structurally , the diverticula develop due to dilatation of the secretory ducts of the submucosal glands , which is why they are not true diverticula . \n many authors suggest that the obstruction and subsequent dilatation of the secretory ducts is caused by inflammatory infiltrates from epithelial and mucous cells developing around the ducts and/or by submucosal fibrosis [ 14 ] . \n others underscore that , in cases in which esophageal stenosis and eip are concomitant , the dilatation of the ducts results from increased intramural pressure in areas proximal to the stenoses . \n the patients most often complain of dysphagia and other symptoms characteristic of motor disorders , esophageal stenosis , or esophageal reflux . \n radiological examinations reveal a specific symptom in the form of small bottle / flask - shaped protrusions of the mucous membrane . \n endoscopy may visualize small openings or depressions in the esophageal wall , although , according to the literature , this image is observed in only 2025% of eip cases [ 1 , 3 ] . \n computed tomography examinations reveal characteristic thickening of the esophageal wall with the presence of intramural gas - filled vesicles . \n transesophageal ultrasonography may reveal hyperechogenic changes in the wall of the esophagus , corresponding to intramural gas vesicles , as well as thickening of the mucous and submucous membranes ( while the lamina muscularis of the esophageal wall remains normal ) [ 3 , 9 ] . \n the following conditions should be considered in eip differentiation : esophageal wall injury by a foreign body , esophageal intramural abscess in the course of gastrointestinal tuberculosis , esophageal intramural hematomas of various etiology , esophageal perforation , esophageal fistula , and esophageal varices . in the case of esophageal wall injury by a foreign body , \n the patient s medical history usually includes the swallowing of a foreign body , and cavities in the esophageal mucosa are usually observed after the foreign body is removed \n microbiological results and clinical data are key when diagnosing a tuberculous abscess in the wall of the esophagus . \n concomitant coagulation disorders and , possibly , anticoagulative treatment in the medical history may suggest an intramural hematoma of the esophagus . \n perforation may be idiopathic , e.g. , as part of the boerhaave syndrome , or traumatic , e.g. iatrogenic ( related to medical procedures ) . \n in contrast to changes associated with eip , perforation is transmural and typically presents as a linear rupture and not an oval opening in the mucosa ( as is the case in eip ) . in the case of tracheoesophageal or bronchoesophageal fistulas , \n endoscopic examinations of the esophagus and the bronchial tree are key in confirming the diagnosis . when esophagomediastinal , esophagopulmonary , or esophagopleural fistulas are diagnosed , esophagoscopy is supplemented with imaging examinations such as ct and contrast x - ray examinations of the esophagus . \n the presentation of eip may be similar to that associated with esophageal varices . in the case of both conditions \n , imaging examinations may show protrusions in the esophageal mucosa ; however , in endoscopic examinations , varices have a characteristic livid color , and their rupture results in bleeding . in the case of eip , \n the rupture of a submucosal gland duct distended with secretion results in effusion of whitish fluid . \n therapy most often consists in the treatment of esophageal inflammation and conditions concomitant with eip , including antibiotic treatment . \n some authors report that , in patients with concomitant esophageal stenosis , endoscopic dilatation reduces the symptoms of eip . \n however , long - term observations show no regression of diverticulosis despite appropriate treatment and improvements in the general condition of the patients [ 3 , 10 ] . \n ", "role": "user" }, { "content": "the article presents the case of a 68-year - old patient with alcohol dependence syndrome , who was admitted , in serious condition , to the department of surgery due to esophageal intramural lesions of unclear etiology . \n the imaging studies showed no signs of transmural perforation of the esophageal wall . \n esophagogastroscopy revealed intramural fluid reservoirs and small oval cavities with smooth edges in the esophageal mucosa . \n the patient was treated conservatively with parenteral nutrition and rehabilitation . \n subsequently , the patient was transferred to the intensive care unit because of cardiorespiratory failure . despite adequate pharmacological treatment , \n the patient died .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: realizar a traduo e adaptao transcultural do questionrio snoring , tiredness , observed apnea , high blood pressure , body mass index , age , neck circumference , and gender ( stop - bang ) para a lngua portuguesa falada no brasil , de forma a possibilitar sua aplicao como instrumento de triagem para o diagnstico da apneia obstrutiva do sono . \n embasado nos princpios de boas prticas para a traduo e adaptao transcultural desses instrumentos , o protocolo incluiu os seguintes passos : obteno de autorizao da autora principal do questionrio original ; traduo , realizada por dois tradutores ; reconciliao ; traduo retrgrada realizada por dois professores de ingls procedentes de pases de lngua inglesa e fluentes na lngua portuguesa ; reviso da traduo retrgrada ; harmonizao ; reviso e aprovao do questionrio pela autora original ; desdobramento cognitivo com 14 pacientes que responderam ao questionrio ; anlise dos resultados ; e reviso e preparao da verso final do instrumento pelo comit revisor . \n a verso final do questionrio stop - bang traduzida para a lngua portuguesa falada no brasil apresentou uma mdia de clareza > 9 ( em uma escala de 1 - 10 ) em todas as questes . \n o coeficiente alfa de cronbach foi de 0,62 , demonstrando a consistncia interna do instrumento . as mdias e desvios - padro da idade , do ndice de massa corprea e da circunferncia de pescoo dos pacientes foram de , respectivamente , 46,8 11,2 anos , 43,7 8,5 \n houve consistncia na equivalncia do questionrio original com o traduzido e adaptado para uso no brasil , podendo esse se tornar um instrumento de triagem amplamente utilizado para pacientes com suspeita de apneia obstrutiva do sono . \n obstructive sleep apnea ( osa ) is a sleep disorder characterized by repeated interruption of ventilation during sleep caused by upper airway closure . \n studies have shown that , even when asymptomatic , osa is independently associated with increased morbidity and mortality . \n it has been estimated that moderate to severe osa goes undiagnosed in approximately 80% of males and 93% of females . \n a major obstacle to the diagnosis of osa is that polysomnography , which is the gold standard for diagnosis , is time - consuming and expensive , and there are not enough sleep medicine specialists . \n such tests are aimed at identifying patients at high risk for osa - all of whom should undergo sleep studies - and low - risk patients , thus avoiding unnecessary tests . \n questionnaires have been shown to be adequate screening instruments , given that they are easily applied and are part of routine medical practice . \n various questionnaires have been developed / validated for that purpose , including the wisconsin sleep questionnaire , the apnea score , a questionnaire developed by haraldsson et al . , the sleep apnea of sleep disorders questionnaire , the american society of anesthesiologists checklist , the berlin questionnaire ( bq ) , the snoring , tiredness , observed apnea , and high blood pressure ( stop ) questionnaire , and the stop - body mass index , age , neck circumference , and gender ( bang ) questionnaire . \n\n for predicting the presence of moderate to severe osa \n , the bq and the stop - bang questionnaire have been found to have the highest sensitivity and specificity , respectively . \n the bq , however , has a large number of questions and a complicated scoring system . \n the stop questionnaire and the stop - bang questionnaire have greater methodological validity , with reasonable accuracy , and features that are easy to use and remember . because it is more comprehensive , the stop - bang questionnaire is the preferred instrument , \n having been developed and validated as an english - language screening tool for osa in surgical patients . \n the stop - bang questionnaire is a very practical instrument because it is concise , is apparently easy to memorize , has a simple scoring system , and requires only a few minutes to be completed . \n it consists of eight questions regarding snoring , tiredness / fatigue / sleepiness , observed apnea during sleep , blood pressure , body mass index ( bmi ) , age , neck circumference , and gender . \n the questions can be answered affirmatively ( \" yes \" , 1 point ) or negatively ( \" no \" , 0 points ) , the total score ranging from 0 to 8 . the present study is relevant because the stop - bang questionnaire had yet to be translated to portuguese and culturally adapted for use in brazil . \n therefore , the objective of the present study was to translate and perform a cross - cultural adaptation of the stop - bang questionnaire so that it can be used as a screening tool for the diagnosis of osa in brazil . \n the present study was approved by the research ethics committee of hospital alberto rassi -hospital geral de goinia , located in the city of goinia , brazil . before completing the questionnaire , \n based on the principles of good practice for the translation and cross - cultural adaptation of such instruments established by wild et al . \n , \n guillemin et al . , \n and beaton et al . , \n the protocol included the following steps ( figure 1 ) : \n figure 1flowchart of the translation and cross - cultural adaptation of the stop - bang questionnaire for use in brazil . \n the university health network , which owns the copyright of the stop - bang questionnaire , granted a license for use of the instrument . \n translation : the original , english - language version of the stop - bang questionnaire was translated to brazilian portuguese by two pulmonologists residing in brazil and fluent in english . \n they translated the questionnaire independently . both sought to translate it conceptually rather than literally . \n reconciliation : the review committee , which consisted of four pulmonologists ( including the two translators , the project coordinator , and a sleep medicine specialist ) , compared the two translations . \n the most appropriate version was arrived at by consensus , being designated version 1 of the stop - bang questionnaire for use in brazil . \n back - translation to english : version 1 of the stop - bang questionnaire for use in brazil was back - translated to english , which is the language in which the stop - bang questionnaire was originally written . \n version 1 of the stop - bang questionnaire for use in brazil was back - translated to english by two english teachers originally from english - speaking countries and fluent in portuguese . \n neither had access to the original version of the stop - bang questionnaire , and both were instructed to perform a literal translation . \n review of the back - translation : the review committee compared the two back - translations to ensure their conceptual equivalence . \n harmonization : the review committee compared the two back - translations to english with the original questionnaire to determine whether there were any discrepancies and thus ensure that the translated version was consistent with the original instrument . \n version 2 of the stop - bang questionnaire for use in brazil was thus arrived at . \n review and approval of the questionnaire by the original author : after harmonization , the brazilian portuguese version of the stop - bang questionnaire and the back - translation to english were submitted to the original author for consideration , as initially requested by the author . \n the back - translation was fully approved , no modifications being required . cognitive debriefing : the objective of this step was to determine the clarity , understandability , and acceptability of the translated questionnaire in the target population . \n an attempt was made to identify problematic questions in order to improve understanding and reduce uncertainty among respondents . \n the brazilian portuguese version of the stop - bang questionnaire was administered to a group of 14 patients by the principal investigator . of those 14 patients , \n 7 were selected from among those treated at a private clinic in the city of goinia ( clnica do aparelho respiratrio ) and 7 were selected from among those treated at a public outpatient clinic ( hospital alberto rassi -hospital geral de goinia pulmonology outpatient clinic ) , also in the city of goinia . during medical visits at each facility , patients were invited to participate in the study , and , for each facility , a decision was made to include the first 7 patients who agreed to participate . \n based on the principles of good practice for the translation and cross - cultural adaptation of such instruments established by wild et al . \n , \n according to whom cognitive debriefing is satisfactory when 5 - 8 individuals are involved , we decided to include 7 patients from each facility , a total of 14 patients having therefore participated in the cognitive debriefing step of the protocol . \n patients were eligible to participate in the cognitive debriefing step of the cross - cultural adaptation protocol if they were 18 years of age or older and had clinical complaints suggestive of osa , including excessive daytime sleepiness , nonrestorative sleep , fatigue , insomnia , gasping or choking during sleep , snoring , and witnessed apneas . \n patients were excluded if they were unable to read , sign , or understand the informed consent form . \n questions related to categorical data were read and answered by the participants , whereas numerical data ( i.e. , age , weight , and height for calculating the bmi and neck circumference ) were recorded by the examiner after measurement . \n all items were read by all participants so that they were able to determine how clear each item was . body weight ( in kg ) \n , santa brbara do oeste , brazil ) , the capacity and precision of which were 200 kg and 100 g , respectively . \n height ( in m ) was measured with a stadiometer attached to the scale ( capacity of 2 m , graduated in cm ) . \n participants stood erect , barefoot and wearing light clothing , with their arms relaxed at their sides and their heels together . \n the bmi was calculated as weight in kilograms divided by height in meters squared . \n neck circumference was measured to the nearest 0.01 cm with an inelastic tape measure of 150 cm in length . \n the laryngeal prominence is popularly known as \" adam 's apple \" and is a protrusion of the thyroid cartilage , which lies below the hyoid bone and nearly encircles the larynx . \n this was chosen as a point of reference on the basis of the measurements used in the original stop - bang questionnaire . \n a clarity questionnaire was used in order to evaluate patient understanding and acceptance of each question . \n an interval scale , with scores ranging from 1 to 10 , was used in order to assess the clarity of each question . \n scores ranging from 1 to 4 indicated that the question was confusing ; scores ranging from 5 to 7 indicated that the question was unclear ; and scores ranging from 8 to 10 indicated that the question was clear . \n the clarity score was calculated as the arithmetic mean of the scores given by patients . \n a clarity score of < 4 indicated that the question had to be replaced ; a clarity score of < 8 indicated that the question had to be reworded ; and a clarity score 8 indicated that the question was sufficiently clear . \n participants were allowed to write , below each question , a comment on the interpretation and clarity of the question if they so wished . \n the clarity scores and comments from patients showed that there was no need to modify the questionnaire . \n cronbach 's alpha coefficient was used in order to assess the reliability of the brazilian portuguese version of the stop - bang questionnaire . \n analysis of the results of cognitive debriefing and conclusion : patient interpretation was compared with the original version of the questionnaire to determine whether there were any discrepancies . \n data analysis was performed with the stata statistical software package , version 12.0 ( statacorp lp , college station , tx , usa ) . \n the translated questionnaire was carefully reviewed by two of the pulmonologists in the review committee and a portuguese teacher , their objectives being to perform a final evaluation of the translation and correct any misspellings or grammatical errors . \n version 3 of the stop - bang questionnaire for use in brazil was thus arrived at . \n final report : a final report was written in order to document the process of translation and cross - cultural adaptation of the stop - bang questionnaire and disseminate the final version of the questionnaire for use in brazil . \n the university health network , which owns the copyright of the stop - bang questionnaire , granted a license for use of the instrument . \n translation : the original , english - language version of the stop - bang questionnaire was translated to brazilian portuguese by two pulmonologists residing in brazil and fluent in english . \n they translated the questionnaire independently . both sought to translate it conceptually rather than literally . \n reconciliation : the review committee , which consisted of four pulmonologists ( including the two translators , the project coordinator , and a sleep medicine specialist ) , compared the two translations . \n the most appropriate version was arrived at by consensus , being designated version 1 of the stop - bang questionnaire for use in brazil . \n back - translation to english : version 1 of the stop - bang questionnaire for use in brazil was back - translated to english , which is the language in which the stop - bang questionnaire was originally written . \n version 1 of the stop - bang questionnaire for use in brazil was back - translated to english by two english teachers originally from english - speaking countries and fluent in portuguese . \n neither had access to the original version of the stop - bang questionnaire , and both were instructed to perform a literal translation . \n review of the back - translation : the review committee compared the two back - translations to ensure their conceptual equivalence . \n harmonization : the review committee compared the two back - translations to english with the original questionnaire to determine whether there were any discrepancies and thus ensure that the translated version was consistent with the original instrument . \n version 2 of the stop - bang questionnaire for use in brazil was thus arrived at . \n review and approval of the questionnaire by the original author : after harmonization , the brazilian portuguese version of the stop - bang questionnaire and the back - translation to english were submitted to the original author for consideration , as initially requested by the author . \n the back - translation was fully approved , no modifications being required . cognitive debriefing : the objective of this step was to determine the clarity , understandability , and acceptability of the translated questionnaire in the target population . \n an attempt was made to identify problematic questions in order to improve understanding and reduce uncertainty among respondents . \n the brazilian portuguese version of the stop - bang questionnaire was administered to a group of 14 patients by the principal investigator . of those 14 patients , \n 7 were selected from among those treated at a private clinic in the city of goinia ( clnica do aparelho respiratrio ) and 7 were selected from among those treated at a public outpatient clinic ( hospital alberto rassi -hospital geral de goinia pulmonology outpatient clinic ) , also in the city of goinia . during medical visits at each facility , patients were invited to participate in the study , and , for each facility , a decision was made to include the first 7 patients who agreed to participate . \n based on the principles of good practice for the translation and cross - cultural adaptation of such instruments established by wild et al . \n , \n according to whom cognitive debriefing is satisfactory when 5 - 8 individuals are involved , we decided to include 7 patients from each facility , a total of 14 patients having therefore participated in the cognitive debriefing step of the protocol . patients were eligible to participate in the cognitive debriefing step of the cross - cultural adaptation protocol if they were 18 years of age or older and had clinical complaints suggestive of osa , including excessive daytime sleepiness , nonrestorative sleep , fatigue , insomnia , gasping or choking during sleep , snoring , and witnessed apneas . \n patients were excluded if they were unable to read , sign , or understand the informed consent form . \n questions related to categorical data were read and answered by the participants , whereas numerical data ( i.e. , age , weight , and height for calculating the bmi and neck circumference ) were recorded by the examiner after measurement . \n all items were read by all participants so that they were able to determine how clear each item was . body weight ( in kg ) was measured with a digital scale ( welmy s.a . , \n santa brbara do oeste , brazil ) , the capacity and precision of which were 200 kg and 100 g , respectively . \n height ( in m ) was measured with a stadiometer attached to the scale ( capacity of 2 m , graduated in cm ) . \n participants stood erect , barefoot and wearing light clothing , with their arms relaxed at their sides and their heels together . \n the bmi was calculated as weight in kilograms divided by height in meters squared . \n neck circumference was measured to the nearest 0.01 cm with an inelastic tape measure of 150 cm in length . \n the laryngeal prominence is popularly known as \" adam 's apple \" and is a protrusion of the thyroid cartilage , which lies below the hyoid bone and nearly encircles the larynx . \n this was chosen as a point of reference on the basis of the measurements used in the original stop - bang questionnaire . \n a clarity questionnaire was used in order to evaluate patient understanding and acceptance of each question . \n an interval scale , with scores ranging from 1 to 10 , was used in order to assess the clarity of each question . \n scores ranging from 1 to 4 indicated that the question was confusing ; scores ranging from 5 to 7 indicated that the question was unclear ; and scores ranging from 8 to 10 indicated that the question was clear . \n the clarity score was calculated as the arithmetic mean of the scores given by patients . \n a clarity score of < 4 indicated that the question had to be replaced ; a clarity score of < 8 indicated that the question had to be reworded ; and a clarity score 8 indicated that the question was sufficiently clear . \n participants were allowed to write , below each question , a comment on the interpretation and clarity of the question if they so wished . \n the clarity scores and comments from patients showed that there was no need to modify the questionnaire . \n cronbach 's alpha coefficient was used in order to assess the reliability of the brazilian portuguese version of the stop - bang questionnaire . \n analysis of the results of cognitive debriefing and conclusion : patient interpretation was compared with the original version of the questionnaire to determine whether there were any discrepancies . \n data analysis was performed with the stata statistical software package , version 12.0 ( statacorp lp , college station , tx , usa ) . \n the translated questionnaire was carefully reviewed by two of the pulmonologists in the review committee and a portuguese teacher , their objectives being to perform a final evaluation of the translation and correct any misspellings or grammatical errors . \n version 3 of the stop - bang questionnaire for use in brazil was thus arrived at . \n final report : a final report was written in order to document the process of translation and cross - cultural adaptation of the stop - bang questionnaire and disseminate the final version of the questionnaire for use in brazil . \n in the reconciliation step of the translation of the stop - bang questionnaire , the review committee decided to make two adjustments . \n although the word \" tired \" in the second question in the original questionnaire was translated as \" cansado \" by both translators , the review committee decided to use the term \" fa tigado \" instead , which also appears in the question . \n this allowed us to maintain the acronym stop - bang , by which the questionnaire is known worldwide . \n for the same reason , a decision was made to use the term \" circu nferncia de pescoo \" instead of \" tamanho grande de pescoo \" in the seventh question , the former also being deemed more appropriate than the latter . \n the same was true for the term \" circunferncia cervical \" , which appears in the seventh question as well and was deemed more appropriate than \" colarinho de camisa \" . in the harmonization step of the protocol , \n the review committee reached a consensus that it would be clearer for patients if response options \" yes \" and \" no \" appeared after rather than before the question ( i.e. , at the end of the sentence rather than at the beginning ) . \n the lead author of the stop - bang questionnaire , who represented the group of authors of the original questionnaire , made no objections and fully approved the aforementioned adaptations . in the cognitive debriefing step of the protocol \n , 7 were selected from among those treated at a public pulmonology outpatient clinic and 7 were selected from among those treated at a private pulmonology clinic . \n all patients interviewed were literate . of those who had been selected from among those treated at a public outpatient clinic , none had a college degree . of those who had been selected from among those treated at a private clinic , \n a decision was made to interview the first 14 patients ( 7 at each clinic ) who presented with complaints of osa and agreed to participate in the study . \n the mean age of the patients was 46.8 11.2 years ( range , 30 - 71 years ) . \n only 2 were over 65 years of age , and they had good judgment and good cognitive function . \n the mean bmi was 43.7 8.5 kg / m ( range , 29.6 - 60.0 kg / m , and the mean neck circumference was 41.3 3.6 cm ( range , 37 - 47 cm ; table 1 ) . all patients interviewed completed all evaluation items . \n table 1characteristics of the sample of patients ( n = 14 ) who participated in the cognitive debriefing of the brazilian portuguese version of the stop - bang questionnaire at a public hospital and a private clinic in the city of goinia , brazil . \n characteristicresultgender \n male2 ( 14.3)female12 ( 85.7)place of treatment \n private clinic7 ( 50.0)public hospital7 ( 50.0)level of education \n elementary school7 ( 50.0)high school5 ( 35.7)college2 ( 14.3)age , years46.8 11.2body mass index , kg / m \n 43.7 8.5neck circumference , cm41.3 3.6avalues expressed as n ( % ) or mean sd . \n none of the patients wrote any comments on the interpretation and clarity of the questions ; this constitutes evidence that the questions were deemed clear by most of the patients ( table 2 ) . \n table 2clarity of the questions in the brazilian portuguese version of the stop - bang questionnaire , according to the study participants ( n = 14 ) . \n questionclearunclearconfusing1 ( roncos ) 14 ( 100.0)0 ( 0.0)0 ( 0.0)2 ( fatigado ) 14 ( 100.0)0 ( 0.0)0 ( 0.0)3 ( observado ) 14 ( 100.0)0 ( 0.0)0 ( 0.0)4 ( presso ) 14 ( 100.0)0 ( 0.0)0 ( 0.0)5 ( obesidade ) 13 ( 92.9)0 ( 0.0)1 ( 7.1)6 ( idade ) 13 ( 92.9)1 ( 7.1)0 ( 0.0)7(circunferncia do pescoo ) 14 ( 100.00)0 ( 0.0)0 ( 0.0)8 ( gnero ) 14 ( 100.00)0 ( 0.0)0 ( 0.0)avalues expressed as n ( % ) \n . \n values expressed as n ( % ) . in the final review step of the protocol , \n the review committee and a portuguese teacher found some minor grammatical errors , all of which were corrected . the final version of the stop - bang questionnaire for use in brazil incorporated all of the aforementioned modifications ( figure 2 ) . \n figure 2final version of the stop - bang questionnaire for use in brazil . \n among the 14 patients who completed the stop - bang questionnaire in the cognitive debriefing step of the cross - cultural adaptation process \n , the highest numbers of affirmative answers were related to the presence of high blood pressure ( in 11 patients ) and loud snoring ( also in 11 ) , followed by observed apnea ( in 9 ) and fatigue ( in 8 ; table 3 ) . \n table 3affirmative answers to the questions in the brazilian portuguese version of the stop - bang questionnaire ( n = 14 ) . \n questionaffirmative answerss : voc ronca alto ? 11 ( 78.6)t : voc frequentemente sente - se cansado , fatigado ou sonolento durante o dia ? 8 ( 57.1)o : algum j observou voc parar de respirar ou engasgando /sufocando durante o sono ? 9 ( 64.3)p : voc tem , ou est sendo tratado por presso alta ? 11 ( 78.6)b : imc > 35 kg / m?12 ( 85.7)a : idade > 50 anos ? 3 ( 21.4)n : circunferncia cervical \n 43 cm em homens ou 41 cm em mulheres ? 6 ( 42.9)g : sexo masculino ? 2 ( 14.3 ) \n the cronbach 's alpha coefficient was 0.62 , demonstrating the internal consistency of the instrument . \n values between 0.60 and 0.80 are considered good for an exploratory study , showing that the data are reliable and that the instrument is of good quality for interpretation . \n in the present study , the stop - bang questionnaire , an instrument used in order to assess the risk of developing osa , was translated to portuguese and adapted for use in brazil . in the present study \n , we followed the principles of good practice for the translation and cross - cultural adaptation of such instruments . \n the process of cross - cultural adaptation of an instrument is complex and involves more than just a simple translation . \n we followed all of the procedures required in order to achieve semantic , experimental , and conceptual equivalence between the original questionnaire and the translated version , thus ensuring that the resulting instrument is fully adapted to the local culture . \n we thus sought to ensure that the psychometric properties of the questionnaire were maintained for subsequent instrument validation . \n the process of cross - culturally adapting an existing instrument is faster , cheaper , and more efficient than is that of developing a new instrument . \n in addition , the data obtained locally can be compared with international data . \n\n because of the relatively high prevalence of undiagnosed osa and its short- and long - term complications , \n\n\n a reliable screening tool is needed for rapid prediction of osa . \n the stop - bang questionnaire was developed and validated for that purpose , being initially aimed at surgical patients . \n the stop - bang questionnaire was based on the bq , which , after being condensed and modified , resulted in the stop questionnaire . \n the stop - bang questionnaire is currently used worldwide in order to screen patients for osa . \n it has been translated in several countries , including portugal , \n china , \n denmark , \n iran , \n and saudi arabia . \n it is known that there are long waiting lists for polysomnography in most sleep medicine clinics in brazil . \n therefore , the use of screening tools , such as the stop - bang questionnaire , appears to be an interesting approach to determine which patients should undergo this screening test for osa on the basis of the probability of a positive result . \n analysis of the data obtained by using the stop - bang questionnaire can provide physicians with a set of predictive parameters to determine the severity of osa , serving as a valuable guide for diagnostic or therapeutic decisions . \n the stop - bang questionnaire for use in brazil is also important for future clinical studies conducted in the country , allowing comparisons between the results obtained and those of studies conducted in other countries . \n one of the limitations of the present study is that most of the patients were female ; this was due to the fact that there were many preoperative evaluations for bariatric surgery at the two clinics included in the present study . in the present study , \n the stop - bang questionnaire was translated to portuguese and adapted for use in brazil . \n the brazilian portuguese version of the stop - bang questionnaire proved to be easy to understand , clear , and applicable , the original instrument and the translated version being consistently equivalent . \n it is therefore recommended that the brazilian portuguese version of the stop - bang questionnaire be used in order to screen patients for osa so as to optimize diagnosis and reduce waiting lists for polysomnography . \n after this initial step , the brazilian portuguese version of the stop - bang questionnaire can be validated and be quite useful in public health care facilities and private clinics , as well as contributing to clinical research into osa .", "role": "user" }, { "content": "abstractobjective : to translate and perform a cross - cultural adaptation of the snoring , tiredness , observed apnea , high blood pressure , body mass index , age , neck circumference , and gender ( stop - bang ) questionnaire so that it can be used as a screening tool for the diagnosis of obstructive sleep apnea in brazil . \n methods : based on the principles of good practice for the translation and cross - cultural adaptation of such instruments , the protocol included the following steps : acquisition of authorization from the lead author of the original questionnaire ; translation of the instrument to brazilian portuguese , carried out by two translators ; reconciliation ; back - translation to english , carried out by two english teachers who are fluent in portuguese ; review of the back - translation ; harmonization ; review and approval of the questionnaire by the original author ; cognitive debriefing involving 14 patients who completed the questionnaire ; analysis of the results ; and review and preparation of the final version of the instrument approved by the review committee . \n results : the final version of the stop - bang questionnaire for use in brazil showed a clarity score > 9 ( on a scale of 1 - 10 ) for all of the questions . \n the cronbach 's alpha coefficient was 0.62 , demonstrating the internal consistency of the instrument . \n the means and standard deviations of the age , body mass index , and neck circumference of the patients studied were 46.8 11.2 years , 43.7 8.5 kg / m2 , and 41.3 3.6 cm , respectively . \n conclusions : the stop - bang questionnaire proved to be understandable , clear , and applicable . the original instrument and the translated version , \n cross - culturally adapted for use in brazil , were consistently equivalent . \n therefore , it can become a widely used screening tool for patients with suspected obstructive sleep apnea .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: foramen magnum meningiomas ( fmms ) are undoubtfully challenging lesions due to their location , to their close relation with the neuraxis and lower cranial nerves as well as with the vertebral artery ( va ) and branches . \n moreover , when discovered , these tumors are often large due to their slow - growing rate , their indolent development , and the difficulty of the diagnosis leading to a long interval since the first symptom as well as the wide subarachnoid space at this level . \n several other factors are well known to be associated with a higher morbidity rate such as anterior tumor location , tumor invasiveness , extradural extension , va encasement , absence of arachnoidal sheath,[68 ] and adherences in recurrent lesions . \n they represent 70% of all benign tumors.[3481113 ] most of the time , these are strictly intradural . in the literature , \n 10% have an extradural extension : most are intra- and extradural and a few may be entirely extradural.[31116 ] basically , two surgical approaches are mainly used for resecting anterior and lateral lesions : the postero - lateral approach , also called the far - lateral approach , and the antero - lateral approach , also named the extreme - lateral approach . a third approach , \n the midline posterior approach , has also been recommended by goel to approach anterior and anterolaterally placed tumors . based on our experience of 107 fmms treated surgically , \n we have developed a classification system aimed at choosing what we consider the adequate approach and at lowering the surgical morbidity . \n first of all , it is important to define the limits of the fm . by definition \n afterward , some important points on the fm anatomy will be reviewed because perfect anatomy understanding of neurovascular structures is a mandatory prerequisite . \n the landmarks we used to define the fm limits are : anteriorly , the lower third of the clivus and upper edge of the body of c2 ; laterally , the jugular tubercles and upper aspect of c2 laminas ; and posteriorly , the anterior edge of the squamous occipital bone and c2 spinous process . \n the glossopharyngeal ( cn ix ) , the vagus ( cn x ) , and the spinal accessory ( cn xi ) nerves arise from rootlets of the post - olivary sulcus and join the jugular foramen , passing ventral to the choroids plexus protruding from the foramen of luschka and dorsal to the va . \n the hypoglossal nerve ( cn xii ) arises from rootlets of the pre - olivary sulcus . \n this nerve runs anterolateral in the subarachnoid space and pass behind the va to reach the hypoglossal canal . \n the accessory nerve is composed of rootlets originating from the medulla and the spinal cord . \n a main trunk is formed by spinal rootlets which join together ; it ascends through the fm running behind the dentate ligament and unites with the upper medullary rootlets . anastomoses with the dorsal roots of the upper cervical nerves \n are frequent , that with the c1 nerve root being the most common and largest one . \n surgery of fmms is unseparable from va surgery . indeed , the surgical approach is closely related to the va v3 segment and the resection of the lesion itself is linked with the va v4 segment . \n the va v3 segment , also called the suboccipital segment , extends from the c2 transverse process toward the dura mater of the fm where it becomes the v4 segment when passing through it . \n the second one is horizontal , after the va turns medially at the level of the c1 transverse foramen and courses along the superior border of the posterior arch of atlas . \n the third portion is oblique due to a step formed by the bone of the posterior arch of atlas , just before entering the dura mater . \n it is of crucial importance to remember that the anatomical relations between the vertical and horizontal portions changes according to head position . \n but , when the head turns to one side , the contralateral c1 transverse process moves anteriorly ; it implies that the vertical and horizontal portions of the contralateral vertebral artery become stretched and finally run almost parallel , only separated by the bone of the c1 posterior arch . \n this point must be perfectly understood because head positioning for an antero - lateral approach is directly related to the surgical anatomy . \n the va v3 segment is surrounded by a periosteal sheath constituted by an extension of the transverse foramen periosteum . inside the periosteal sheath , \n the periosteal layer is anatomically in continuity with the outer layer of the dura mater and invaginates into it . at this level \n , the va is attached to the periosteal sheath and the adventitia is adherent to the double furrow forming the distal fibrous ring . by this way , despite being the most mobile va segment , the va v3 segment is fixed at its upper extremities . \n along its course , this va v3 segment gives off small collateral branches . in the middle of the posterolateral aspect of the vertical portion starts the c2 radicular artery . \n there also exists a small muscular branch coursing posteriorly at the upper exit of the c1 transverse foramen and the posterior meningeal artery . \n finally , the posterior spinal artery begins most of the time just before the dural penetration and enters the dural foramen where the c1 nerve root exits the spinal canal but it may also arise from the initial intradural part of the va v4 segment , or from the posteroinferior cerebellar artery ( pica).[2023 ] this branch runs medially behind the most rostral attachment of the dentate ligament and divides into ascending and descending branches , when reaching the lower medulla , providing respectively the vascular supply to a part of the medulla oblongata and the spinal cord . \n anatomical variations of the va v3 segment are crucial to know and identify preoperatively , remembering them participate at lowering the surgical morbidity : in 40% of the people , the vas are of different sizes : one side is dominant and the other one is hypoplastic or atretic.the va v3 segment can end at the pica or at the occipital artery.as frequently as 20% of the cases , the pica originates extracranially , arising from the va above c1 , between c1 and c2 , or even in the v2 segment . ignoring this condition could result in an inadvertent injury and a posterior fossa infarct already during the surgical exposure.more anecdotic , the va v3 segment can be duplicated : one atretic portion follows the normal course but the main portion pierces the dura between c1 and c2.[2731]a proatlantal artery is exceptional and consists of a persistent congenital anastomosis between the carotid artery and the va ; it is often associated with an atretic proximal va and an extracranial origin of the pica . in 40% of the people , \n the vas are of different sizes : one side is dominant and the other one is hypoplastic or atretic . \n the va v3 segment can end at the pica or at the occipital artery . as frequently as 20% of the cases , the pica originates extracranially , arising from the va above c1 , between c1 and c2 , or even in the v2 segment . ignoring this condition could result in an inadvertent injury and a posterior fossa infarct already during the surgical exposure . \n more anecdotic , the va v3 segment can be duplicated : one atretic portion follows the normal course but the main portion pierces the dura between c1 and c2.[2731 ] a proatlantal artery is exceptional and consists of a persistent congenital anastomosis between the carotid artery and the va ; it is often associated with an atretic proximal va and an extracranial origin of the pica . \n finally , the groove of the arch of atlas can be turned into a tunnel if the occipitoatlantal membrane is calcified or ossified , raising some difficulties to expose the horizontal portion at this level . after passing through the lateral aspect of the occipitoatlantal dura mater , \n the va v4 segment ascends from the dura mater up to the anterior aspect of the pontomedullary sulcus where it fuses with the controlateral one . \n initially the va v4 segment courses posteriorly and medially to the occipital condyle , the hypoglossal canal , and the jugular tubercle . \n later , it lies on the clivus and runs in front of the hypoglossal and the lower cranial nerves rootlets . \n the va v4 segment is at the origin of several important branches , especially the pica and the anterior spinal artery . \n most of the time , the anterior spinal arteries of both sides joins together above the fm level near the lower end of the olives , then the artery descends through the fm and runs on the anterior midline . \n in some cases , one artery is dominant . if no fusion exists between both arteries , only one of these arteries forms . \n this concept is especially important at the level of the cranial base where the working area is limited and vital structures are numerous . \n four meningeal vessels participate to the vascular supply of the fm dura mater : the anterior and posterior va meningeal arteries , and meningeal branches of the ascending pharyngeal and occipital arteries . infrequently \n , meningeal branches arise from the pica , the posterior spinal artery , and the va v4 segment . \n the anterior meningeal branch , the most important branch , arises from the va at the c2-c3 level . \n the posterior meningeal artery originates from the posterosuperior aspect of the va when it turns around the lateral mass of the atlas , above the posterior arch of the atlas , just before it penetrates the dura , or just at the beginning of the v4 segment.[1921 ] the ascending pharyngeal artery is a branch of the external carotid artery ; it gives meningeal branches penetrating into the hypoglossal canal and the jugular foramen . \n the meningeal branch of the occipital artery is inconstant and passes through the mastoid emissary foramen . \n this maneuver allows for enlarging the surgical corridor and for reducing compression of the neuraxis . \n the ligament is a white fibrous sheet extending from the pia mater , medially , to the dura mater , laterally . \n the first arch gives passage to the va and the second arch to the second cervical nerve root . \n basically , three surgical approaches are commonly used for resecting fmms : the midline posterior approach , the postero - lateral approach , and the antero - lateral approach . as detailed by rhoton , the postero - lateral approach , or far lateral approach , \n is a lateral suboccipital approach directed behind the sternocleidomastoid muscle and the va and just medial to the occipital and atlantal condyles and the atlanto - occipital joint . \n the antero - lateral approach , or extreme lateral approach , is a direct lateral approach deep to the anterior part of the sternocleidomastoid muscle and behind the internal jugular vein along the front of the va . \n in fact , both approaches permit drilling of the occipital condyle but provide a different exposure because of the differences in the approach direction . during the postero - lateral approach , \n the va v3 segment is controlled in its horizontal portion , meaning above the c1 posterior arch . \n the fmm lateral wall can be drilled in a variable way , in fact directly proportional to the tumor extension to the contralateral side . \n recently , bassiouni classified judiciously postero - lateral approaches in 2 groups : transcondylar or retrocondylar if the occipital condyle is or is not drilled . \n the extreme - lateral transcondylar approach in cases of fmms was first reported by sen and sekhar in 1990 . \n it requires va transposition to reach and drill the occipital condyle.[9103841 ] several variations were described by salas et al . , the most common one being the partial transcondylar approach and more rarely the transfacetal , retrocondylar , and extreme transjugular approaches . with the partial transcondylar approach , the posterior one - third of occipital condyle and superior facet of c1 \n some authors describe condyle drilling ranging approximately from one - third to one - half of the condyle , without causing craniocervical instability . \n the classification system that we have developed is based on the lesion characteristics observed on preoperative imaging . \n it has the objectives to define preoperatively the adequate surgical approach and to help for anticipating the position of vital neurovascular structures thereby decreasing the surgical morbidity . \n three mains criteria are used in the classification system : the compartment of development , the dural insertion , and to the relation to the va [ figure 1 ] . classification system of foramen magnum meningiomas . reprinted with permission from bruneau m and george b. foramen magnum meningiomas : detailed surgical approaches and technical aspects at lariboisire hospital and review of the literature . according to the compartment of development \n the use of the antero - lateral approach can be restricted to some cases with an extradural extension . \n like at any other site , an extradural location or extension of an intradural lesion means that the lesion is very invasive into the bone , the nerves , and soft tissues . \n this situation is especially problematic and explains the higher incidence of incomplete removal and higher morbidity as compared to intradural meningiomas . according to the dural insertion , fmm can be subdivided depending on their location in the antero - posterior plane into posterior , lateral , or anterior . \n the lesion is considered posterior if its insertion is posterior to the dentate ligament ; lateral , if its insertion is between the midline and the dentate ligament ; or anterior , if its insertion is on both sides of the anterior midline . in posterior fmms \n the midline posterior approach is dedicated for removing them whatever their intra- and extra - dural extension . \n lateral fmms push the neuraxis posterolaterally and thus widely open the lateral surgical corridor ; therefore , bone resection has never to be extended to the fm lateral wall consisting of the lateral mass of the atlas or the occipital condyle [ figure 2 ] . \n ( a - c ) preoperative mri in axial ( a ) , coronal ( b ) and sagittal ( c ) planes . \n ( a ) the meningioma inserted on the right side but not across the midline . \n ( d - f ) postoperative ct - scans , after complete resection of the tumor through a postero - lateral approach . \n ( d ) the extension of the c1 laminectomy . the white arrow indicates the lateral limit with a c1 lateral mass left intact . \n the access is obtained on the base of insertion as demonstrated by the arrow direction . \n the laminectomy has been extended over the midline ( black arrow ) for preventing stretching of the neuraxis on the bone edge during the resection . \n ( f ) shows the vertebral artery v3 and v4 segments courses on a 3d reconstruction . \n analyzing preoperatively the relation of the lesion with the va is crucial because it allows in some circumstances for anticipating the position of the lower cranial nerves ; this is definitively in direct relation with the surgical morbidity . \n in fact , fmms have the possibility to develop above , below , or on both sides of the va . more often \n , meningiomas grow below the va . in this condition , the lower cranial nerves are always displaced cranially and posteriorly and there is thus no need to look for them until the end of the resection which starts at the lower pole of the lesion . \n in contrast , if the lesion develops above the va , the position of the lower cranial nerves can not be anticipated ; indeed the nerves may be displaced separately in any direction . \n after partial debulking of the tumor , great care must be taken to look for them so as to identify and protect them during the tumor resection . in case of tumoral extension on both sides of the va , \n a similar problem is encountered with the position of the lower cranial nerves but an additional problem exists : the dura mater around the va penetration may be infiltrated by the tumor . \n as previously mentioned the dura is normally adherent to the adventitia and then complete resection of the tumor at this level can be hazardous . in this rare condition , we advise for safety reasons to leave a cuff of infiltrated dura around the va and to coagulate only this zone . \n therefore , the surgical space between the neuraxis and the fm lateral wall to access the lesion is narrow . \n indeed , for some authors the antero - lateral is the most appropriate . in our opinion \n , we consider that all these lesions can be resected successfully with minimal morbidity through a postero - lateral approach [ figure 3 ] . \n the tumor access implies the resection of the laminae and a suboccipital craniotomy extended to the medial part of the fm lateral wall . \n nevertheless , in almost every case no drilling of the lateral mass of atlas and occipital condyle is necessary . only exceptionally , some anterior fmms require an extended enlargement by drilling of at maximum the medial fifth of the fm lateral wall ; this is encountered with small - sized lesions without anterior compartment enlargement . \n the tumor ( t ) inserts on both sides of the midline ( dotted line ) . \n ( d ) the lower cranial nerves are identified at the superior aspect of the tumor . \n avoid drilling of a significant part of the fm lateral is associated with preservation of the craniovertebral junction stability which participates in the low morbidity rate and the maintenance of a better quality of live by avoiding a debilitating craniovertebral osteoarthrodesis . \n moreover , in contrast to the antero - lateral approach , the postero - lateral requires less va manipulations which finally only need to be controlled but not transposed . \n the extent of bone resection in this case can be more important than for intradural lesion but is in fact only dictated by the tumoral invasion and must be limited to the destroyed or invaded bone . by this way , postoperative instability is only a preoperative concern since the extent of bone resection is determined at that time . as far as less than half of the c0-c1 and c1-c2 joints are resected , we have not encountered craniovertebral instability . \n most of these meningiomas were operated on at first presentation but six patients were recurrent cases previously treated elsewhere . \n overall , 97.2% of the patients were operated on through a postero - lateral approach . \n only three cases of entirely extradural lesions were operated on through an anterolateral approach with va transposition . \n of intradural lesions , 5.8% ( 6/104 ) , 54.8% ( 57/104 ) , and 39.4% ( 41/104 ) were respectively classified as posterior , lateral , and anterior according to their dural insertion . \n of anterior and lateral intradural lesions , 78.6% ( 77/98 ) grew below , 16.3% ( 16/98 ) above , and 5.1% ( 5/98 ) on both sides of the va . \n the rate of complete removal increased up to 94% when selecting only intradural lesions treated at first presentation . \n postoperative deterioration has been noted in three patients , all of them due to swallowing disturbances in tumors located above the va . \n we deplore two postoperative deaths in the first years of this series due to pulmonary and air embolisms , respectively . \n most patients were followed up with mri at 1 , 3 , 6 and 10 years . \n we are aware of only one recurrence 9 years after surgery in the group of primary cases . in this case , the meningioma had an usual ( muschroom ) type at the first surgery and becomes en plaque type at recurrence , involving half of the circumference of the fm dura and bone . \n fmms are undoubtfully challenging tumors in the vicinity of the brainstem , the va , and lower cranial nerves . \n these lesions can be classified according to their compartment of development , their dural insertion , and their relation with the vertebral artery . \n the first two criteria help for choosing the most appropriate surgical approach . in our experience , \n only purely extradural fmms anterior to the va necessitate to be operated on through an antero - lateral approach ; the vast majority of lesions were resected successfully through a postero - lateral approach . in the intradural group , \n the relation of the tumor with the va was crucial and allows for anticipating the position of the lower cranial nerves and therefore for reducing the postoperative morbidity . in all cases of tumor growing below the va , \n the lower cranial nerves were displaced at the superior pole of the tumor , while in the other cases , their displacement was discovered in all directions .", "role": "user" }, { "content": "background : foramen magnum meningiomas ( fmms ) are challenging tumors . \n we report a classification system based on our experience of 107 tumors.materials and methods : the three main algorithm criteria included the compartment of development of the tumor , its dural insertion , and its relation to the vertebral artery.results:the compartment of development was most of the time intradural ( 101/107 , 94.4% ) and less frequently extradural ( 3/107 , 2.8% ) or both intra - extradural . \n ( 3/107 , 2.8% ) . \n when developed inside the intradural compartment , fmms were subdivided into posterior ( 6/104 , 5.8% ) , lateral ( 57/104 , 54.8% ) , and anterior ( 41/104 , 39.4% ) , if their insertion was respectively posterior to the dentate ligament , anterior to the dentate ligament without or with extension over the midline . \n anterior and lateral intradural lesions grew below ( 77/98 , 78.6% ) , above ( 16/98 , 16.3% ) , or on both sides ( 5/98 , 5.1% ) of the va . \n only three cases of extraduralfmms ( 3/107 , 2.8% ) were resected by an antero - lateral approach while all the other ones ( 104/107 , 97.2% ) were removed successfully by a postero - lateral approach . \n lower cranial nerves were displaced superiorly in fmm growing below the va but their position can not be anticipated in other situations.conclusions:this classification system helps for defining the best surgical approach but also for anticipating the position of the lower cranial nerves and therefore for reducing the surgical morbidity .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in this issue of critical care , textoris and colleagues report that high levels of central venous oxygen saturation ( scvo2 ) are associated with mortality in patients with septic shock . \n scvo2 is easily measured in most icu patients and thus represents a convenient therapeutic marker in the resuscitation of the critically ill patient . \n low scvo2 is a valid therapeutic target in early septic shock and a diagnostic marker for low cardiac output . \n scvo2 itself is a surrogate marker of mixed venous oxygen saturation , which in theory reflects the balance between global oxygen delivery and consumption , so that low scvo2 is a marker of inadequate oxygen delivery . \n so far , the focus has mostly been on low levels of scvo2 , but textoris and co - workers have focused on higher levels of scvo2 in septic shock patients . \n they hypothesise that levels of scvo2 above 80% correlate with increased mortality and that this correlation is likely due to impaired ability to extract oxygen . in a retrospective design , they identified all adult icu patients with septic shock in a 2-year period and registered lowest and highest scvo2 measurements during the first 3 days in the icu . \n they found that the maximum scvo2 was significantly higher in the patients that died in hospital than in those who survived ( 85% versus 79% , p = 0.009 ) . \n the association between maximum scvo2 and mortality persisted in a multivariate analysis adjusting for other variables that differed between the survivors and non - survivors . \n this is of obvious interest , but the study has several limitations , as the authors point out . the retrospective design carries an inherent risk of selection bias since patients with mild disease or early death might not have had any scvo2 measurements and were then excluded from the study . \n furthermore , scvo2 might have been measured more frequently in the most severely ill patients , increasing the chance for a high scvo2 measurement , especially as scvo2 varies over time . \n scvo2 depends on arterial oxygen saturation , cardiac output , oxygen consumption , haemoglobin levels and shunting . \n the ability of scvo2 to reflect systemic oxygen delivery / consumption is not constant in time as it depends on many conditions , including sedation , ventilator treatment , redistribution of blood as seen in shock and thus shock severity , the position of the catheter tip , which depends on the body position , and so on . \n textoris and co - workers hypothesise that the high scvo2 in the non - survivor group is likely due to impaired oxygen extraction , but there may be other explanations . \n it is likely that very aggressive resuscitation with high doses of fluid , vasopressors , inotropes and blood resulting in supranormal oxygen delivery , and thus high scvo2 , negatively impacts on survival . alternatively \n , impaired regulation of the microcirculation might have resulted in shunting and thus high scvo2 . \n the current data can not distinguish between these alternative hypotheses as discussed by the authors . if high scvo2 associates with increased mortality in sepsis , it may have clinical implications . but \n the hypothesis should be evaluated in a prospective , multicentre study with protocolized scvo2 measurements and detailed registration of potentially confounding factors , including use of fluid , vasopressors , inotropes and blood , to reduce the risk of bias . \n results from such a study have the potential to influence the design of further clinical trials evaluating scvo2 as a target for shock therapy . \n \n ", "role": "user" }, { "content": "shock therapy aims at increasing central venous oxygen saturation ( scvo2 ) , which is a marker of inadequate oxygen delivery . in this issue of critical care , textoris and \n colleagues challenge this notion by reporting that high levels of scvo2 are associated with mortality in patients with septic shock . \n this is of obvious interest , but as their retrospective design has inherent limitations , the association should be confirmed in a prospective , multicenter study with protocolized scvo2 measurements and detailed registration of potentially confounding factors .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: since the emergence of electroporation ( ep ) in the early 1980s , it has received appreciable attention in both chemotherapy and gene therapy . with this method , reversible perturbation of the lipid membrane \n the ep could be induced by a large variety of pulses : high - voltage pulses which are typically short , low - voltage pulses which are typically longer , or a combination of high- and low - voltage pulses.1,2 electrochemotherapy involves ep of intratumorally or intravenously ( iv ) administered cytotoxic drugs , and serves as an excellent alternative for the therapy of cutaneous and subcutaneous metastases.36 furthermore , the delivery of gene - based drugs and dna vaccines by ep enhances the transgene expression in the muscle by two to three orders of magnitude.7 ep also seems to be suitable for extended transdermal drug delivery , modifying the multilamellar lipid bilayers of the stratum corneum.810 the morphology and the special composition of the stratum corneum make it an impermeable barrier for water - soluble compounds . \n the stratum corneum consists of keratin - rich enucleate nonviable cells ( corneocytes ) embedded in an intercellular matrix of multilamellar lipid bilayers . \n only a few drugs are able to pass through the skin without the aid of a penetration enhancer.11 transdermal delivery of drugs by ep was first suggested by prausnitz et al12 to enhance their bioavailability . \n drugs administered transdermally have higher bioavailability than when they are used orally , thanks to their avoidance of the hepatic first - pass metabolism and gastric acid . on the other hand \n transdermal ep is currently one of the most promising modes of physical enhancement for the noninvasive transdermal delivery of lipophilic , hydrophilic , and charged or neutral molecules or macromolecules . \n the transdermal transport of drugs with molecular weight up to 40 kda across the skin can thereby be increased by several orders of magnitude.8,13 appropriate transdermal transport necessitates the adjustment of the voltage , pulse duration , and number of series of impulses.14 in the present study , the model drug chosen for ep was neostigmine methylsulfate , a reversible acetylcholinesterase inhibitor and an inducer of gastrointestinal motility . \n neostigmine has only poor bioavailability after oral administration ; its effective parenteral dose for humans is 0.5 to 2.0 mg , while the equivalent oral dose should be 30 mg or more , but large oral doses may cause toxic effects.15 neostigmine methylsulfate ( molecular weight : 334.39 g / mol , log p : 2.2 ) is not able to permeate through the skin because of its low penetration through the stratum corneum . \n we set out to investigate the gastrointestinal effects of repeated transdermal administration of neostigmine by ep and compare the systemic effects of ep - delivered and iv - administered neostigmine . \n all animals were treated in full accordance with the european communities council directives ( 86/609/ecc ) and the hungarian act for the protection of animals in research ( xxviii.tv.32. ) . \n all experiments involving animal subjects were carried out under sterile conditions with the approval of the hungarian ethical committee for animal research ( registration number : iv/198/2013 ) . \n all animal - handling procedures were performed according to the guide for the care and use of laboratory animals of the national institutes of health and followed the guidelines of the animal welfare act . \n sprague - dawley rats ( charles - river laboratories , budapest , hungary ) were housed at 22c3c in a relative humidity of 30%70% under a 12-hour light / dark cycle . \n pellet food ( charles - river laboratories ) and tap water were provided ad libitum . the experimental design is represented in figure 1 . \n male sprague - dawley rats ( 67 weeks old , body weight : 190220 g ) participated either in repeated iv ( n=10 ) or transdermal ep treatment ( n=8 ) with neostigmine methylsulfate ( teva pharmaceutical industries ltd . , gdll , hungary ) . throughout the experiment , \n the animals were kept under deep anesthesia with a combination of intraperitoneal ketamine and xylazine ( 36 and 4 mg / kg , respectively ) . \n the jugular vein was cannulated for drug administration and the carotid artery for blood collection . \n the abdominal cavity was opened and an implantable force / displacement transducer or strain gauge ( egg-01 sg ; experimetria , budapest , hungary ) was sutured onto the surface of the cecum . the animals were then placed onto a 37c heated operating table ( exp - d - tc / ma-02 ; experimetria ) in order to maintain the body temperature . the strain gauge converted the cecal mechanical contractions to electrical signals . \n the amplified signals were recorded and analyzed with an online computer by the s.p.e.l . advanced isosys data acquisition system ( experimetria ) . \n the basal contractions were detected for at least 10 minutes before the first dose of neostigmine . \n the area under the curve of these 10 minutes was used as the control , and the stimulation was calculated as a percentage of this initial period . \n following the addition of each concentration of neostigmine , the area under the curve of a 10-minute period was evaluated . \n the ed50 values , that is , the doses that provoke a response half way between the basal and the maximal response , were calculated and the unpaired t - test was applied for statistical analysis with the prism 5.0 computer program ( graphpad software , inc . , la jolla , ca , usa ) . before ep , the rats were shaved on the abdominal surface and the remaining hair was removed with veet depilatory cream ( reckit benckiser , bristol , uk ) . \n neostigmine was administered in cumulative doses of 0.2 , 0.67 , 2.0 , 6.7 , 20.0 , and 66.7 g / kg . for ep \n , neostigmine methylsulfate was dissolved in a 2.5% hydroxyethylcellulose - containing hydrogel ( natrosol hec , ashland inc . , \n the final volume of the neostigmine - containing hydrogel was 25 l and the ph of the hydrogel was 6.95 . \n the mezoforte duo ep device ( serial number mez 120905-d ) , produced by dr derm equipment ltd . \n ( budapest , hungary ) , was provided by the derm clinic of anti - aging dermatology , aesthetic laser and plastic surgery ( budapest , hungary ) . \n the polypropylene - covered treating headpiece contains a plate electrode 25 mm in diameter indirectly contacting with the treated surface . \n modulation was achieved with 1,800 vpp ( peak - to - peak voltage ) pulses with a duration of 5 milliseconds , followed by a 20 milliseconds break . \n this pulse treatment was utilized on the abdominal surface for 2 minutes ( 2,200 periods / min ) , during which period the applied neostigmine - containing hydrogel was absorbed through the skin , with only a dry film layer remaining on the surface of the skin . a 10-minute waiting period ensued before the next ep - delivered neostigmine dose . for iv administration , a neostigmine methylsulfate injection ( stigmosan , pharmamagist , budapest , hungary ) was diluted in physiological saline solution . the cumulative neostigmine doses and \n the period for iv administration was ~2030 seconds , and the recording of contractions was started 2 minutes after the start of the neostigmine administration . \n analytical grade sodium dihydrogenphosphate and disodium hydrogenphosphate dodecahydrate were obtained from sigma - aldrich ( budapest , hungary ) . \n high - performance liquid chromatography ( hplc ) grade glacial acetic acid , acetonitrile , and methanol were purchased from merck ( darmstadt , germany ) . \n benzyltri - n - propylammonium chloride ( internal standard ) and neostigmine methylsulfate were from sigma - aldrich . \n the water used was purified and deionized with the milli - q system ( millipore , milford , ma , usa ) . \n the hplc apparatus consisted of a shimadzu system ( shimadzu corporation , kyoto , japan ) equipped with a solvent delivery system ( lc-20ad ) , a dgu-20a3 on - line degasser , a sil 20a ht autoinjector , a cto-20a column oven , an spd - m20a photodiode - array detector , and a cbm-20a system controller . \n the chromatographic system was equipped with a rheodyne model 7125 injector ( rheodyne corp . , cotati , ca , usa ) with a 20 l loop . \n the system control and data acquisition were performed with shimadzu lc solution software ( shimadzu corporation ) . \n the chromatographic separations were performed on a phenosphere scx ( 5 m , 1504.6 mm ) analytical column ( phenomenex inc . , \n separations were performed in isocratic mode . the mobile phase used for the separation consisted of 0.5 m nah2po4 buffer ( ph = 3.5):acetonitrile = 45:55 ( v / v ) pumped at a flow rate of 1 ml / min . \n the mobile phase was filtered by a millipore vacuum filtration system equipped with a 0.45 m pore size filter and degassed by ultrasonication . \n the detection wavelength was 200 nm . a stock solution of neostigmine methylsulfate ( 1 mg / ml ) was prepared in the hplc mobile phase and diluted with mobile phase to obtain a series of working standard solutions with concentrations ranging from 3 to 50 g / ml . the internal standard stock solution ( 1 mg / ml in methanol ) was further diluted to 50 g / ml with water . \n stock solutions were stored at 20c , and working solutions were kept refrigerated at 2c6c . \n the working solutions were used to prepare seven calibration samples in blank plasma ( 0.3 , 1 , 3 , 5 , 10 , 30 , and 50 g / ml ) . \n the blood samples were collected via the previously inserted polyethylene cannula 2 minutes after each ep or iv neostigmine treatment . \n an aliquot of plasma ( 200 l ) was combined with 20 l of internal standard working solution . \n the mixture was loaded into a strata - x - cw 33u solid - phase extraction tube ( phenomenex inc . ) \n previously conditioned with 0.5 ml 5% glacial acetic acid in methanol , 0.5 ml methanol , and 0.5 ml 0.2 m na2hpo4 ( ph = 9 ) . \n the cartridge was washed with 1 ml of a 0.2 m na2hpo4 ( ph = 9):methanol = 90:10 mixture ( v / v ) . \n the neostigmine methylsulfate retained in the cartridge was eluted with 1 ml 5% glacial acetic acid in methanol into a glass tube . \n the eluate was evaporated to dryness under a stream of nitrogen at 40c and reconstituted with 100 l mobile phase , and 20 l was then injected into the hplc system . \n the seven - point calibration curves , prepared in triplicate , exhibited good linearity ( r=0.9984 ) in the concentration range 0.350 g / ml for neostigmine methylsulfate . \n the limits of quantification and detection were 0.05 and 0.1 g / ml , respectively . \n all animals were treated in full accordance with the european communities council directives ( 86/609/ecc ) and the hungarian act for the protection of animals in research ( xxviii.tv.32. ) . \n all experiments involving animal subjects were carried out under sterile conditions with the approval of the hungarian ethical committee for animal research ( registration number : iv/198/2013 ) . \n all animal - handling procedures were performed according to the guide for the care and use of laboratory animals of the national institutes of health and followed the guidelines of the animal welfare act . \n sprague - dawley rats ( charles - river laboratories , budapest , hungary ) were housed at 22c3c in a relative humidity of 30%70% under a 12-hour light / dark cycle . \n pellet food ( charles - river laboratories ) and tap water were provided ad libitum . \n male sprague - dawley rats ( 67 weeks old , body weight : 190220 g ) participated either in repeated iv ( n=10 ) or transdermal ep treatment ( n=8 ) with neostigmine methylsulfate ( teva pharmaceutical industries ltd . \n the animals were kept under deep anesthesia with a combination of intraperitoneal ketamine and xylazine ( 36 and 4 mg / kg , respectively ) . \n the jugular vein was cannulated for drug administration and the carotid artery for blood collection . \n the abdominal cavity was opened and an implantable force / displacement transducer or strain gauge ( egg-01 sg ; experimetria , budapest , hungary ) was sutured onto the surface of the cecum . the animals were then placed onto a 37c heated operating table ( exp - d - tc / ma-02 ; experimetria ) in order to maintain the body temperature . the strain gauge converted the cecal mechanical contractions to electrical signals . \n the amplified signals were recorded and analyzed with an online computer by the s.p.e.l . advanced isosys data acquisition system ( experimetria ) . \n the basal contractions were detected for at least 10 minutes before the first dose of neostigmine . \n the area under the curve of these 10 minutes was used as the control , and the stimulation was calculated as a percentage of this initial period . following the addition of each concentration of neostigmine \n three - parameter , symmetrical sigmoidal concentration response curves were fitted . the ed50 values , that is , the doses that provoke a response half way between the basal and the maximal response , were calculated and the unpaired t - test was applied for statistical analysis with the prism 5.0 computer program ( graphpad software , inc . , la jolla , ca , usa ) . \n before ep , the rats were shaved on the abdominal surface and the remaining hair was removed with veet depilatory cream ( reckit benckiser , bristol , uk ) . \n neostigmine was administered in cumulative doses of 0.2 , 0.67 , 2.0 , 6.7 , 20.0 , and 66.7 g / kg . for ep , \n neostigmine methylsulfate was dissolved in a 2.5% hydroxyethylcellulose - containing hydrogel ( natrosol hec , ashland inc . , \n the final volume of the neostigmine - containing hydrogel was 25 l and the ph of the hydrogel was 6.95 . \n the mezoforte duo ep device ( serial number mez 120905-d ) , produced by dr derm equipment ltd . \n ( budapest , hungary ) , was provided by the derm clinic of anti - aging dermatology , aesthetic laser and plastic surgery ( budapest , hungary ) . \n the polypropylene - covered treating headpiece contains a plate electrode 25 mm in diameter indirectly contacting with the treated surface . \n modulation was achieved with 1,800 vpp ( peak - to - peak voltage ) pulses with a duration of 5 milliseconds , followed by a 20 milliseconds break . \n this pulse treatment was utilized on the abdominal surface for 2 minutes ( 2,200 periods / min ) , during which period the applied neostigmine - containing hydrogel was absorbed through the skin , with only a dry film layer remaining on the surface of the skin . a 10-minute waiting period ensued before the next ep - delivered neostigmine dose . for iv administration , a neostigmine methylsulfate injection ( stigmosan , pharmamagist , budapest , hungary ) \n the cumulative neostigmine doses and recording protocol were the same as in the ep protocol . \n the period for iv administration was ~2030 seconds , and the recording of contractions was started 2 minutes after the start of the neostigmine administration . \n analytical grade sodium dihydrogenphosphate and disodium hydrogenphosphate dodecahydrate were obtained from sigma - aldrich ( budapest , hungary ) . \n high - performance liquid chromatography ( hplc ) grade glacial acetic acid , acetonitrile , and methanol were purchased from merck ( darmstadt , germany ) . \n benzyltri - n - propylammonium chloride ( internal standard ) and neostigmine methylsulfate were from sigma - aldrich . \n the water used was purified and deionized with the milli - q system ( millipore , milford , ma , usa ) . \n the hplc apparatus consisted of a shimadzu system ( shimadzu corporation , kyoto , japan ) equipped with a solvent delivery system ( lc-20ad ) , a dgu-20a3 on - line degasser , a sil 20a ht autoinjector , a cto-20a column oven , an spd - m20a photodiode - array detector , and a cbm-20a system controller . \n the chromatographic system was equipped with a rheodyne model 7125 injector ( rheodyne corp . , cotati , ca , usa ) with a 20 l loop . \n the system control and data acquisition were performed with shimadzu lc solution software ( shimadzu corporation ) . \n the chromatographic separations were performed on a phenosphere scx ( 5 m , 1504.6 mm ) analytical column ( phenomenex inc . , \n separations were performed in isocratic mode . the mobile phase used for the separation consisted of 0.5 m nah2po4 buffer ( ph = 3.5):acetonitrile = 45:55 ( v / v ) pumped at a flow rate of 1 ml / min . \n the mobile phase was filtered by a millipore vacuum filtration system equipped with a 0.45 m pore size filter and degassed by ultrasonication . \n the detection wavelength was 200 nm . a stock solution of neostigmine methylsulfate ( 1 mg / ml ) was prepared in the hplc mobile phase and diluted with mobile phase to obtain a series of working standard solutions with concentrations ranging from 3 to 50 g / ml . the internal standard stock solution ( 1 mg / ml in methanol ) was further diluted to 50 g / ml with water . \n stock solutions were stored at 20c , and working solutions were kept refrigerated at 2c6c . \n the working solutions were used to prepare seven calibration samples in blank plasma ( 0.3 , 1 , 3 , 5 , 10 , 30 , and 50 g / ml ) . \n the blood samples were collected via the previously inserted polyethylene cannula 2 minutes after each ep or iv neostigmine treatment . \n an aliquot of plasma ( 200 l ) was combined with 20 l of internal standard working solution . \n the mixture was loaded into a strata - x - cw 33u solid - phase extraction tube ( phenomenex inc . ) \n previously conditioned with 0.5 ml 5% glacial acetic acid in methanol , 0.5 ml methanol , and 0.5 ml 0.2 m na2hpo4 ( ph = 9 ) . the cartridge was washed with 1 ml of a 0.2 m na2hpo4 ( ph = 9):methanol = 90:10 mixture ( v / v ) . \n the neostigmine methylsulfate retained in the cartridge was eluted with 1 ml 5% glacial acetic acid in methanol into a glass tube . \n the eluate was evaporated to dryness under a stream of nitrogen at 40c and reconstituted with 100 l mobile phase , and 20 l was then injected into the hplc system . \n the seven - point calibration curves , prepared in triplicate , exhibited good linearity ( r=0.9984 ) in the concentration range 0.350 g / ml for neostigmine methylsulfate . \n the limits of quantification and detection were 0.05 and 0.1 g / ml , respectively . \n analytical grade sodium dihydrogenphosphate and disodium hydrogenphosphate dodecahydrate were obtained from sigma - aldrich ( budapest , hungary ) . \n high - performance liquid chromatography ( hplc ) grade glacial acetic acid , acetonitrile , and methanol were purchased from merck ( darmstadt , germany ) . \n benzyltri - n - propylammonium chloride ( internal standard ) and neostigmine methylsulfate were from sigma - aldrich . \n the water used was purified and deionized with the milli - q system ( millipore , milford , ma , usa ) . \n the hplc apparatus consisted of a shimadzu system ( shimadzu corporation , kyoto , japan ) equipped with a solvent delivery system ( lc-20ad ) , a dgu-20a3 on - line degasser , a sil 20a ht autoinjector , a cto-20a column oven , an spd - m20a photodiode - array detector , and a cbm-20a system controller . \n the chromatographic system was equipped with a rheodyne model 7125 injector ( rheodyne corp . , \n the system control and data acquisition were performed with shimadzu lc solution software ( shimadzu corporation ) . \n the chromatographic separations were performed on a phenosphere scx ( 5 m , 1504.6 mm ) analytical column ( phenomenex inc . , \n separations were performed in isocratic mode . the mobile phase used for the separation consisted of 0.5 m nah2po4 buffer ( ph = 3.5):acetonitrile = 45:55 ( v / v ) pumped at a flow rate of 1 ml / min . \n the mobile phase was filtered by a millipore vacuum filtration system equipped with a 0.45 m pore size filter and degassed by ultrasonication . \n a stock solution of neostigmine methylsulfate ( 1 mg / ml ) was prepared in the hplc mobile phase and diluted with mobile phase to obtain a series of working standard solutions with concentrations ranging from 3 to 50 g / ml . the internal standard stock solution ( 1 mg / ml in methanol ) was further diluted to 50 g / ml with water \n . stock solutions were stored at 20c , and working solutions were kept refrigerated at 2c6c . \n the working solutions were used to prepare seven calibration samples in blank plasma ( 0.3 , 1 , 3 , 5 , 10 , 30 , and 50 g / ml ) . \n the blood samples were collected via the previously inserted polyethylene cannula 2 minutes after each ep or iv neostigmine treatment . \n an aliquot of plasma ( 200 l ) was combined with 20 l of internal standard working solution . \n the mixture was loaded into a strata - x - cw 33u solid - phase extraction tube ( phenomenex inc . ) \n previously conditioned with 0.5 ml 5% glacial acetic acid in methanol , 0.5 ml methanol , and 0.5 ml 0.2 m na2hpo4 ( ph = 9 ) . \n the cartridge was washed with 1 ml of a 0.2 m na2hpo4 ( ph = 9):methanol = 90:10 mixture ( v / v ) . \n the neostigmine methylsulfate retained in the cartridge was eluted with 1 ml 5% glacial acetic acid in methanol into a glass tube . \n the eluate was evaporated to dryness under a stream of nitrogen at 40c and reconstituted with 100 l mobile phase , and 20 l was then injected into the hplc system . \n the seven - point calibration curves , prepared in triplicate , exhibited good linearity ( r=0.9984 ) in the concentration range 0.350 g / ml for neostigmine methylsulfate . \n the limits of quantification and detection were 0.05 and 0.1 g / ml , respectively . \n neostigmine increased the cecal contractions after both iv and transdermal ep administration ( figure 2a ) . \n the calculated ed50 value for neostigmine was approximately twice as high after iv administration as compared with the ep route . \n however , this difference is statistically not significant . the calculated maximum increase in contractions was only 20% lower after ep administration than that after iv treatment ( table 1 ) . \n the cecal contractile responses to iv- or ep - administered neostigmine did not differ significantly in the investigated dose interval ( 0.266.7 g / kg ) . \n the cecal smooth muscle did not show any response to ep stimulation without neostigmine ( figure 2b ) . \n the chromatogram of blank rat plasma spiked with 10 g / ml neostigmine gave a clear neostigmine peak with a retention time of 7.730.31 minutes ( figure 3a ) . \n in neostigmine - treated rats , a smaller but identifiable peak was found at the same retention time as that of the neostigmine - spiked blank rat plasma ( figure 3b ) . \n the magnitudes of the peak of the internal standard were the same in both cases , indicating the reliability of the method . \n the hplc analysis of the neostigmine plasma levels revealed that the two routes of administration resulted in very similar drug concentrations . \n the neostigmine plasma concentrations were the same after both iv and ep administrations ; statistically there was no difference between the two plasma curves ( figure 4 ) . when the cecal contractions were represented as a function of the plasma concentration of neostigmine , the concentration response curves were similar to the dose response curves ( figure 5 ) . \n there is an increasing need for new and noninvasive routes of drug administration in clinical practice . \n moreover , there is a demand for fast and safe drug administration for acute care and even chronic treatment . \n the increasing numbers of peptide drugs have also given rise to a requirement for noninvasive therapy.16 novel biological therapies involve peptide compounds , mainly monoclonal antibodies , and the antidiabetic or ovulation induction therapies also apply peptide hormones . \n these peptide drugs are not applicable via oral administration because of their sensitivity to peptidases in the gastrointestinal tract . \n the most frequent route of administration of such compounds is subcutaneous administration , but many patients fear the needles , especially in self - treatment . \n ep is a method of noninvasive drug administration which is widely used for cosmetic interventions,17,18 delivery of genes into cells19 and experimental animals,20,21 or the delivery of anticancer agents into tumor cells.22 attempts have been made to apply ep for transdermal drug delivery in systemic therapies.9 a number of papers have described the local action of ep - delivered drugs,23 but only a few reports can be found concerning the systemic applicability of this method for drug delivery.9,10,12 the electrodes and the electric pulse parameters are the key information in ep applications . \n iontophoresis applies a low intensity ( < 0.5 ma / cm ) electric field for a period of minutes or hours with low voltage ( 510 v or less ) . \n direct current is usually used , but pulsed direct current can enhance the efficacy of iontophoresis if the pulse frequency is not too high.24 ep makes use of short ( < 1 second ) and high - voltage pulses ( > 50 v ) , creating an aqueous pathway for transport through lipid bilayers of the skin.25 in our ep method , an amplitude - modulated sine wave radiofrequency current was utilized as the source of pulses for ep . \n the high voltage ( 1,800 vpp ) and the high pulse frequency ( 2,200/min ) applied exclude the possibility of neostigmine being delivered by iontophoretic processes in our system . \n we detected the systemic action of ep - delivered neostigmine methylsulfate with plasma drug level control . \n neostigmine methylsulfate is a highly water - soluble compound that is unable to penetrate through the barriers of the dermal lipid layers . \n since neostigmine exerts a well expressed contracting effect on the gastrointestinal smooth muscle , we selected a part of the large intestine ( the cecum ) as the target organ of our measurements , and the contraction - increasing effects and plasma levels of ep - delivered neostigmine were compared with its effects after iv administration . for the detection of plasma levels of neostigmine , an hplc setup was employed . \n although the plasma concentration of neostigmine was relatively low , the sensitivity of the method was sufficient for qualitative determination . \n somewhat surprisingly , no difference in cecal - contracting effect or plasma level of neostigmine was observed after 2 minutes of ep and iv administration . \n ep may therefore be considered to be equivalent to iv administration for systemic drug delivery . moreover \n , the action of neostigmine could be adjusted through the use of relatively small doses , which suggests that distinguished dosages can be applied via ep . \n we also proved that the plasma concentrations of neostigmine correlate with the increases in cecal contractions after both iv and ep administrations . \n this correlation is further evidence that ep - administered neostigmine reaches the circulation and is solely responsible for the measured physiological response . \n however , in our system , the ep did not have any direct contracting effect on the smooth muscle , and thus all the registered changes in the cecal contractions were consequences of the drug action . \n the period for iv administration was ~2030 seconds , and the recording of contractions was therefore started 2 minutes after the start of the injection in order to make the time frame similar to that of ep . \n the plasma concentration of an iv - administered drug is highest immediately after the injection , but the blood sample was collected after 2 minutes of iv delivery . \n this means that we missed the highest plasma peaks after iv administration , which may explain why the plasma curves are similar after iv and ep drug delivery . for the contractions , \n the neostigmine should be distributed in the large intestine tissue ; this is not an immediate action , and we therefore suppose that any difference between the maximum effects of iv and ep drug delivery is not significant , or the distribution process equilibrates the difference . \n another limitation is that the impulse of the applied ep parameters was constant ; we did not test the effects of different voltages or pulse durations on the bowel action and plasma level of neostigmine . \n further studies are necessary to reveal the threshold voltage needed to induce the systemic absorption of the drugs . however , with regard to the earlier and present findings , we have a good reason to suspect that ep works on the principle of all or nothing , opening all the biological barriers in the tissues or cell membranes at once.26 additionally , we do not know what size of plate electrode should be used in humans . a diameter proportional to that used in rats \n on the other hand , the drug concentration of the hydrogel and the area of the treated surface can be modified easily to find the optimal setup for human therapy . \n drugs with different chemical properties should also be tested with this delivery system in order to assess the applicability of this method . \n the potential clinical application of ep may involve the rapid therapy of a life - threatening condition to replace iv treatment ( eg , epileptic seizure or a cardiac arrest ) and may make protein drug delivery ( eg , insulin or low molecular weight heparin ) easy and painless during self - administration by the patients . \n we conclude that transdermal ep - delivered neostigmine elicits action equivalent to that of intravenous administration both in time and intensity . through ep , even low doses of water - soluble compounds \n although our findings are potentially promising for the clinical application of ep for drug delivery , a number of questions remain to be clarified before human therapy can be initiated .", "role": "user" }, { "content": "purposetransdermal electroporation has become one of the most promising noninvasive methods for drug administration , with greatly increased transport of macromolecules through the skin . \n the cecal - contracting effects of repeated transdermal electroporation delivery and intravenous administration of neostigmine were compared in anesthetized rats.methodsthe cecal contractions were detected with implantable strain gauge sensors , and the plasma levels of neostigmine were followed by high - performance liquid chromatography.resultsboth intravenously and ep - administered neostigmine ( 0.266.7 g / kg ) increased the cecal contractions in a dose - dependent manner . for both the low doses and the highest dose , the neostigmine plasma concentrations were the same after the two modes of administration , while an insignificantly higher level was observed at a dose of 20 g / kg after intravenous administration as compared with the electroporation route . \n the contractile responses did not differ significantly after the two administration routes.conclusionthe results suggest that electroporation - delivered neostigmine elicits action equivalent to that observed after intravenous administration as concerning both time and intensity . \n electroporation permits the delivery of even lower doses of water - soluble compounds through the skin , which is very promising for clinical practice .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: situational syncope is characterized by loss of consciousness in particular situations such as with a cough , micturition , deglutition.1 - 3 ) this form of syncope is thought to account for 5% of syncopal episodes.2 ) several cases of deglutition syncope have been reported to be successfully treated with a permanent pacemaker . \n , we report a case of deglutition syncope in a patient with permanent atrial fibrillation , who underwent permanent pacemaker implantation to prevent ventricular asystole during the episodes of deglutition syncope . \n he reported the feeling of a foreign body sensation at his mid sternal area after drinking a cold beverage , and then suddenly lost consciousness . \n there were no seizure - like movements or incontinence during the attack , and he felt no numbness or motor weakness before or after the events . \n the patient reported more than twelve episodes of syncope before presenting to the cardiology outpatient clinic at samsung medical center . \n the patient was diagnosed with atrial fibrillation seven to eight years ago , and had been taking warfarin since then . \n the initial electrocardiogram ( ecg ) showed atrial fibrillation with a ventricular response of 60 - 70 . \n his echocardiography did not show any significant abnormality of the heart except bilateral atrial enlargement . on the second day of admission \n , he felt a globulous sensation at the mid esophagus after drinking a cold beverage in the sitting position , and then lost consciousness . \n his telemetry ecg monitoring at that time showed abrupt ventricular asystole that was sustained for 12 seconds ( fig . \n 2 ) . we evaluated the esophagus with a barium swallow ; there were no abnormal findings in the esophagus . on the treadmill test , \n the head - up tilt test three months before admission was negative ; the head - up tilt test was repeated . during the repeated head - up tilt test , \n the patient underwent permanent pacemaker implantation of a vvi type pacemaker to prevent ventricular asystole . \n after implantation of the permanent pacemaker , there were no further episodes of syncope after drinking a cold beverage ( fig . \n deglutition syncope was first documented in 1906 by meckenzie.3 ) since then , it has been reported in patients evaluated by many different medical disciplines including : cardiology , gastroenterology , neurology , and otolaryngology . \n the vasovagal reflex between the heart and the esophagus is thought to be associated with deglutition syncope via the vagus nerve , where a signal from the mechanoreceptors in the esophagus is sent to the cardioinhibitory center in the medulla ; the medulla then delivers the signal to the sino - atrial or atrioventricular ( av ) nodes via the vagus nerve again , and the result is a variety of brady - arrhythmias.4)5 ) sapru et al.3 ) reported a case supporting this theory . \n they found that an esophageal lesion caused syncope while swallowing in a young female patient by repeating esophageal ballooning with ecg monitoring ; the patient had eight episodes of syncope while swallowing . \n the vagus nerve is the key route in the afferent and efferent limbs of deglutition syncope . \n inhibition of the vagal reflex with medication has been tried for treatment in some cases . \n intravenous atropine injection abolished an av block in some provocation tests.6)7 ) in another case of av block after swallowing , oral atropine sulphate tablets were tried . \n however , the symptoms were not relieved fully and there were intolerable side effects.3 ) deglutition syncope is often combined with esophageal disorders such as a hernia , stricture , achalasia , diverticulum , and esophageal spasm.8 ) gordon et al.9 ) reported syncope with paroxysmal atrial fibrillation provoked by esophageal reflux . \n maekawa et al.10 ) reported a patient with deglutition syncope that had a very large hiatal hernia compressing the left atrium after eating a large meal . \n if deglutition syncope is suspected by the patient 's history , an evaluation for esophageal abnormalities should be performed . \n the patient in our case had no abnormality of esophageal function or anatomic structure , as shown by the barium swallow . \n implantation of a permanent pacemaker successfully treated the symptoms of av block and ventricular asystole with swallowing . in a case of deglutition syncope without ecg changes , the pacemaker does not improve symptoms.11 ) therefore , prior to implantation of a permanent pacemaker , ecg documentation of an av block or pause should be obtained . \n gordon et al.9 ) reported that the occurrence of paroxysmal atrial fibrillation with a rapid ventricular response caused syncope after swallowing . \n armstrong et al.11 ) reported a case with a slow idioventricular rhythm with permanent atrial fibrillation associated with syncope after drinking . \n however , our patient had ventricular asystole that caused syncope after drinking a cold beverage ; after implantation of the permanent pacemaker the patient did not lose consciousness .", "role": "user" }, { "content": "deglutition syncope is a situational syncope that is diagnosed only by a detailed history . \n we report deglutition syncope in a 62-year - old man , who had permanent atrial fibrillation . \n the patient had no structural or functional abnormalities of the esophagus . during syncopal attacks , \n his electrocardiography showed ventricular asystole that was sustained for 12 seconds . \n the patient was successfully treated by implantation of a permanent pacemaker .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: obesity may be considered as the result of a positive energy balance in conditions of energy excess . correlated with economic , social , and lifestyle changes \n , it represents a common condition of different populations living in environments characterised by abundant calorie - rich food and low physical activity . \n hence , obesity is rapidly arriving at epidemic proportions in many parts of world and is becoming one of the major public health problems . \n more than 1 billion individuals are overweight and more than 300 million worldwide subjects can be classified as obese ( with body mass index ( bmi ) of 30 kg / m or higher ) . \n more than two thirds of american population is overweight , a common condition of other western populations . \n in particular , the highest frequency of obesity is observed in the united states , europe and the middle east and the lowest in sub - saharan africa and east asia . in these parts of world , \n this condition is very alarming , because it occurs in children and adolescents [ 4 , 5 ] . \n hence , the current obesity may be only considered the tip of the iceberg , which will see young subjects develop the typical age - related diseases , because obesity predisposes to a variety of age - related inflammatory diseases , including insulin resistance ( ir ) , type 2 diabetes , atherosclerosis and its complications , fatty liver diseases , osteoarthritis , rheumatoid arthritis , and cancer . \n the obesity state is , indeed , characterized by what has been called low - grade systemic inflammation , induced by different inflammatory mediators , as demonstrated for the first time by hotamisligil et al . in 1993 . \n the growing evidence on the obesity and the associated pathologies has led to understand the role of adipose tissue as an active potential participant in controlling the physiological and pathological processes . to date , the adipose tissue is considered as an endocrine organ able to mediate biological effects on metabolism and inflammation , contributing to the maintenance of energy homeostasis and , probably , pathogenesis of obesity - related metabolic and inflammatory complications . \n this review describes the role of adipose tissue and evidences the biological effects and clinical significance of many adipokines in obesity - related inflammatory diseases . \n it represents the major source of fatty acids ( ffa ) in the postprandial fasting state for energy use and heat production . \n two types of adipose tissue are present in mammals : white adipose tissue ( wat ) and brown adipose tissue ( bat ) . they have not only different functions , but also a different cellular composition and localization . \n wat constitutes the major component of body 's adipose tissue , provides most of the total body fat and is the source of ffa , used as energy substrates for the generation through oxidative phosphorylation of adenosine triphosphate ( atp ) high - energy bonds . \n its major depots are intraabdominal around the omentum , intestines and peri - renal areas , and subcutaneous in the buttocks , thighs and abdomen . \n hence , it is possible to identify several local wat subgroups , including visceral , muscle , epicardial , perivascular and kidney . \n furthermore , wat seems to have two key functions , as recently demonstrated by worzniak et al . and juge - aubry et al . [ 8 , 10 ] . \n it is involved in the control of the metabolism through energy homeostasis , adipocyte differentiation , and insulin sensitivity . \n besides , it affects inflammation , through a control mechanism mediated by antiinflammatory molecules and the activation of anti - inflammatory metabolic and immune pathways [ 8 , 10 ] . \n its excessive accumulation in these body 's sites might arise and determine the development of obesity and the obesity - related diseases . \n much common is the wat excess in the upper parts of body , the so - called android obesity or central obesity , which represents a strong risk factor for some inflammatory pathologies . \n the wat excess in other lower body 's sites gives rise to the so - called gynoid obesity with no metabolic complications [ 9 , 11 ] . \n to understand the different wat distribution and its different link with metabolic and inflammatory complications , several theories have been advanced . among these , \n the first is based on the anatomy of central obesity and its capacity to drain ffa and inflammatory mediators into the portal circulation , where they can act preferentially on the liver to affect metabolism . \n the second considers cell biology and different properties of wat cells linked with a major or minor risk to develop metabolic and inflammatory diseases . \n significant differences in expression of several genes between the different body 's deposits of wat in both rodents and human have been detected [ 1315 ] . \n interestingly , a different mediator profile has also been observed between visceral and peripheral wat . \n several types of cells constitute wat : mature adipocytes and a variety of other cells ( i.e. , preadipocytes , fibroblasts , endothelial cells , and macrophages ) , usually grouped and described as the stroma vascular fraction [ 9 , 11 , 16 ] . \n the adipocytes , preadipocytes , and macrophages have metabolic and inflammatory functions , which render wat able to release several mediators with different biological effects in the wat itself or other tissues , acting in paracrine or endocrine way [ 8 , 10 , 1620 ] . \n in particular , the macrophages are responsible for the circulating levels of specific inflammatory molecules , determining the low - grade chronic obesity - related inflammation [ 8 , 11 , 16 , 17 , 21 ] . unlike wat , bat provides energy expenditure from nonoxidative phosphorylation in form of heat largely for cold adaptation . \n the uncoupling of phosphorylation in bat is due to the activity of uncoupling protein-1 , expressed on the internal mitochondrial membrane , which by creating a proton leak exhausts the electrochemical gradient needed for oxidative phosphorylation . as consequence , bat affects energy use by producing heat from uncoupled oxidative phosphorylation . unlike wat , bat also presents a smaller number of fat cells , which have richer vascular supplies with more abundant mitochondrial chromogens , responsible for the brown colour . \n bat with a richer vascular supply responds more rapidly to sympathetic nervous system ( sns ) stimulation , which then elicits heat production , rather than atp production , from nonshivering cold adaptive thermogenesis . \n hence , bat shows a different function respect to wat , and , in most mammals , it is responsible of the heat for fever , the arousal state from hibernation and cold - induced - thermogenesis . in humans , bat is difficult to find postnatally . \n however , the positron emission tomography has clearly shown in adult humans metabolically active bat depots in cervical , supraclavicular , axillary and paraventral body 's regions . \n these depots can be induced in response to cold and sns activation [ 2224 ] . \n this highlights bat as a potential relevant target for both pharmacological and gene expression manipulation to combat human obesity [ 23 , 24 ] . to understand the potential mechanisms \n involved in energy - rich condition under overnutrition , it is necessary to known the processes of energy homeostasis . \n adequate body fat and energy homeostasis are ensured through a dynamic process of fat remodelling , without excessive weight gain or loss . \n conditions of increased appetite and food intake determine a positive energy balance with weight gain . \n in contrast , satiety limits food consumption determining a negative energy balance and weight loss . \n energy expenditure is regulated by central and autonomic nervous systems , which achieve a balanced energy homeostasis depending on physiological needs . \n hence , conditions of more energy expenditure determine wat lipolysis and the consequent augment of ffa , or , conversely , less energy expenditure states allow an increased fat storage . \n bat responds to cold - induced sns activity with increased production of heat from uncoupled oxidative phosphorylation [ 27 , 28 ] . \n wat stimulated by upregulated sns activity in response to cold increases the thermogenesis from oxidative phosphorylation of ffa within liver , muscle and fat cells , which is increased in obesity . \n conditions of increased calorie intake associated with decreased energy use induce obesity . in obese conditions , bat mass and function are strongly decreased . \n obese individuals who are heat intolerant are less able to dissipate heat from both wat and bat . \n a regulated interaction between metabolic and immunity system exists . both over and undernutrition conditions influence metabolism and immune functions [ 30 , 31 ] . \n malnutrition conditions can suppress immune system and increase susceptibility to infections [ 30 , 31 ] . \n obesity , an energy - rich condition associated with overnutrition , impairs systemic metabolic homeostasis and elicits stress . \n an inflammatory process is simultaneously activated by increased wat mass in metabolically active sites , such as wat itself , liver and immune cells [ 11 , 1618 , 20 ] . \n this response determines a strong increase in circulating levels of proinflammatory cytokines , hormone - like molecules and other inflammatory markers , collectively defined adipokines [ 8 , 18 , 19 ] . to counteract the obesity - related stress , hypothalamic - pituitary - adrenal axis and central and peripheral components of autonomic nervous system \n this leads to an increased level of glucocorticoid , a steroid hormone able also to induce the development and differentiation of preadipocytes , favouring consequently the further increase of wat mass . \n on the other hand , the secretion of pro - inflammatory cytokines by wat may act as additional chronic stimulus for activation of hypothalamic - pituitary - adrenal axis . \n hence , a vicious cycle between metabolic and immune responses in obesity state is promoted , inducing a chronic active inflammatory condition able to determine the onset of obesity - related pathologies [ 29 , 31 ] . \n the causes and mechanisms involved in obesity - induced inflammatory state are not fully understood , even if the link between inflammation and obesity has been indicated by epidemiological studies from 1950s onwards . \n the discovery of the production of proinflammatory cytokines in the wat , such as tumour necrosis factor ( tnf)- , and tnf- capacity to regulate insulin action has systemically also represented a driving force in this field . today \n , current opinion proposes that , under normal wat conditions , adipocytes store lipids and regulate metabolic homeostasis , and resident tissue macrophages , with polarization essentially of m2 type , release anti - inflammatory cytokines . \n m2 macrophages produce arginase ( enzyme involved in the inhibition of nitric oxide synthase , inos ) and il-10 , il-1ra anti - inflammatory cytokines [ 21 , 34 , 35 ] . in contrast \n , m1 type macrophages have a specific surface marker ( cd11c+ ) and release inos and classical proinflammatory cytokines [ 21 , 34 , 35 ] . \n normal wat is , so , characterised by an anti - inflammatory tissue milieu able to protect from the development of obesity - related inflammation and ir , most likely also due to activity of members of peroxisome proliferator - activated receptor-(ppar)s ( particularly ppar- and - ) and liver x receptor-(lxr ) families , molecules involved in nutrient transport and metabolism and able to antagonize inflammatory activity [ 36 , 37 ] . to contribute to this physiological wat condition is a new adipokine , the lipocalin-2 ( lcn2 ) . \n lcn2 upregulates ppar , increases the release of adiponectin and also antagonizes tnf- effects on inflammatory and metabolic gene expression in adipocytes and macrophages . \n conversely , knocking down lcn2 expression , using lentiviral shrna gene silencing , results in decreased expression of ppar and its target genes , adiponectin , and leptin . \n hence , lcn2 , seems to act as an antagonist to the effect of inflammatory molecules on inflammation and secretion of adipokines . in obesity conditions , wat becomes inflamed , state determined by a crosstalk principally between adipocytes and macrophages [ 8 , 16 , 21 ] . \n the obesity - related inflammatory state occurs in several sequential stages , characterised by a cellular wat composition remodelling . \n an increase in number ( hyperplasia ) and size ( hypertrophy ) of adipocytes , a macrophage infiltration , and fibrosis characterise wat in obesity human conditions [ 3945 ] . \n adipocyte hypertrophy is induced by two factors : increased fat storage in fully differentiated adipocytes and increased expression of proinflammatory mediators [ 4345 ] . \n on the other hand , hypertrophic adipocytes shift the immune balance towards the production of proinflammatory molecules [ 40 , 4649 ] . \n the shift in the cytokines profile creates a tissue milieu responsible of the strong modification of the wat macrophages pool from activated m2 type to classically - activated m1 type [ 21 , 34 , 35 , 40 , 4649 ] . \n in addition , the m1 macrophage wat pool considerably increases because of the differentiation of monocytes recruited in inflamed wat . in obese wat \n , macrophages also aggregate in crown - like structures constituted by necrotic - like adipocytes and adipocyte cellular fragments [ 4651 ] . \n an increased infiltration of macrophages , indeed , occurs in the inflamed wat , preferentially into visceral wat , which contributes of the wat inflammation state and its exacerbation [ 10 , 16 , 17 , 20 , 21 , 34 , 35 , 46 , 47 ] . \n it seems also to be directly correlated with both hyperplasia and hypertrophy of adipocytes and inflammatory mediator production [ 10 , 16 , 17 , 20 , 21 ] . \n however , the mechanisms responsible for attracting monocyte / macrophage cells and their entry into the fat mass remain unclear . \n the group of sengens et al . has recently evidenced a key role of endothelial cells in the control of the inflammatory wat process . \n it has also been described the potential involvement of wat - endothelial cells as further factors involved in the regulation of macrophage phenotype in the inflamed fat tissue . \n inflammatory wat cytokine profile seems to be responsible of the activation of endothelial cells and their expression of a series of adhesion molecules involved in the recruitment of monocyte / macrophages . \n furthermore , it has been demonstrated an association between angiogenesis and adipogenesis . concerning the shift of cytokines ( m2/m1 cytokine profile ) , \n the exact mechanisms involved have not yet been clarified [ 21 , 34 , 35 , 40 , 4649 ] . \n it has been proposed that adipocytes from different body depots show differences in their inflammatory phenotype , with visceral fat characterised by more inflammatory phenotype respect to subcutaneous fat , as discussed above [ 9 , 12 ] . \n besides , the increased obesity - associated preadipocyte differentiation process seems also to contribute to this inflammatory cytokine profile [ 9 , 12 ] . \n however , human wat macrophage subsets show no strict m1 or m2 polarization , as recently demonstrated by bourlier et al . and zeyda et al . \n furthermore , another characteristic phenomenon , the local hypoxia induced by hypoperfusion due to rapid fat mass expanding seems to contribute to wat inflammatory state [ 5355 ] . \n adipose hypoxia , indeed , induces the release of proinflammatory mediators [ 5355 ] . \n however , on the whole , these observations give no a clear dissection of the cause and effect relationship between obesity and inflammation . on the other hand , \n it has , recently , been demonstrated that increased adipose tissue mass is not essentially related with wat inflammation state , as observed in two studies performed in adiponectin transgenic mice and lipocalin-2 knockout mice [ 5658 ] . \n this suggests that , although obesity is directly linked to inflammation , the specific role of adipokines and related pathways might be clarified . \n wat releases hundreds of biologically active molecules , the adipokines , including more than 50 cytokines , chemokines , hormone - like factors and other mediators [ 8 , 18 , 19 ] not exclusively produced by wat cells , these mediators are released by other different body 's tissues and organs with functions unrelated to those within wat [ 18 , 19 ] . adipokines affect appetite and satiety , glucose and lipid metabolism , blood pressure regulation , inflammation and immune functions [ 8 , 18 , 19 ] . \n precisely , they work as a network to regulate inflammation , insulin action , and glucose metabolism locally and systemically . \n this adipokine / cytokine networking system is altered in obesity , contributing to inflammation state and impaired adipocyte metabolism . \n however , how adipokines and cytokines coordinately regulate obesity - related inflammation and metabolism is not clearly understood [ 8 , 18 , 19 ] . \n different mechanisms are involved in the adipokine secretion . the production of inflammatory adipokines ( such as proinflammatory cytokines , chemokines , molecules associated with thrombosis , and hypertension , etc . ) \n seems to be complex and involves several inflammatory pathways , activated by both extracellular mediators and intracellular stressors . among extracellular factors , \n , they are chronically elevated ( by determining lipotoxicity ) , because of blunted incapacity of insulin to inhibit the lipolysis and the excessive consumption of dietary lipids . \n innate immunity receptors , such as toll - like receptor ( tlr)-4 and -2 , are expressed in wat ( particularly by adipocytes , preadipocytes , macrophages , and endothelial cells ) and are involved in this obesity - related inflammatory process . \n ffa and other molecules produced by hypoxic conditions during obesity activate these receptors , particularly tlr4 [ 60 , 61 ] . \n it is continually produced within the gut by death of gram - negative bacteria and is absorbed into intestinal capillaries to be transported by lipoproteins [ 63 , 64 ] . \n on the other hand , it has been observed that a high - fat diet given to mice increases the proportion of gut lps [ 63 , 64 ] . \n these data indicate the gut microbiotia may have an important role in the induction of chronic obesity - related inflammation . \n hence , ffa , particularly via tlr4 induce the pro - inflammatory adipokine production in adipocytes [ 65 , 66 ] . \n ffa also activate macrophages , referentially of the cd11c+ subset , through the tlr4 pathway , exacerbating their pro - inflammatory activity [ 6668 ] . \n furthermore , a paracrine loop between hypertrophied adipocytes and macrophages has been evidenced , able to induce a vicious circle of inflammatory exacerbated wat state . \n this paracrine loop involves ffa and tnf-. as a result , macrophages secrete the pro - inflammatory tnf-. tnf- in turn , acting particularly on tnf- receptor 1 subtype , induces inflammatory changes in hypertrophied adipocytes as well as increased release of ffa . \n in addition , this paracrine cross - talk could be further improved in obese subjects through the adipocyte hyperresponsiveness to tnf- and subsequent hyperactivation of inflammatory pathway . \n ffa may also be active on the adipocyte in an autocrine way to evoke an inflammatory state and chemokine / adipokine overproduction at least in part via tlr4 . \n this autocrine mechanism has been proposed to be an initial event of the inflammatory wat cascade , but this issue is still controversial . in obese \n wat the cells and the intracellular organelles are also exposed to increased stress , mainly as a result of metabolic overload . \n in particular , mitochondria and the endoplasmic reticulum appear to be the most sensitive organelles to metabolic stressors . \n in addition , the development of hypoxic conditions in the expanded wat during obesity results in an increased production of reactive oxygen species and the corresponding development of oxidative stress . \n signals mediated by both extracellular and intracellular factors culminate predominantly in the activation , principally via tlr4 receptor , of nf-b transcriptional factor , responsible of the production of inflammatory mediators , as well as the direct inhibition of insulin signaling [ 60 , 61 , 71 ] . \n hence , nf-b pathway represents the crucial and major factor responsible of obesity - induced inflammation . to amplify inflammation - mediated inhibition of insulin action are also other pathways , such as those mediated through the suppressor of cytokine signaling-(socs)-proteins and inos [ 72 , 73 ] \n in contrast , anti - inflammatory adipokine molecules seem to be released through the activation of different transcription factors induced via ppar- and lxr receptors , as mentioned above [ 3638 ] . in conditions of overnutrition , fatty acid - binding proteins , fabps , \n likely sequester ligands of ppar- and lxrs and induce no activation of these transcription factors . in this paper , \n the attention has particularly been focussed on adipokines involved in the obesity - related inflammatory diseases . \n the biological effects of metabolic and inflammatory adipokines are reported in tables 1 and 2 . \n several pathologies are associated with obesity , such as type 2 diabetes and cardiovascular diseases ( cvd ) . \n more recently , the obesity - related risk has also been extended to cancer , including prostate , breast , liver , kidney , colon , ovarian and endometrial cancers [ 7581 ] . \n the obesity - related diseases are characterised by inflammatory pathophysiology induced by several risk factors ( environmental stressors , genetic factors , etc . ) and an onset generally correlated with ageing process . \n epidemiological studies have revealed that a common yet preventable risk factor for these diseases is the increase of the visceral fat , a characterised hallmark of ageing in humans ( figure 1 ) [ 8 , 11 , 12 , 82 ] . using either waist circumference and/or waist - to - hip ratio as a proxy of visceral obesity , the role of visceral fat as stronger risk factor for these diseases , than bmi or other fat depots , has been confirmed . obesity - related risk is not only limited to these diseases , but also to cognitive decline , alzheimer 's disease ( ad ) and disability , as recently demonstrated [ 6 , 8385 ] . \n recent evidence also reports an association of obesity with increased risk of disease specific and all - cause mortality , and with a reduced life expectancy . \n for example , the group of fontaine reported that caucasian men and women with a bmi > 40 and age range 2029 years , could expect a reduction in remaining years of life expected by approximately 6 and 12 years , respectively . \n an increment of mortality and a reduction of life expectancy correlated with obesity , especially in old subjects , has been , indeed , proposed . on the other hand , obesity , and precisely visceral obesity , \n it has been demonstrated that obese women have telomeres of 240 bp shorter lean women of a similar age . in view of \n the hypothesis that telomere length in vivo represents cellular turnover and exposure to oxidative and inflammatory damage , this difference in telomere length between being lean and being obese might correspond to 8.8 years of ageing . \n the increased evidence on visceral obesity , as a stronger predictor of these diseases , has led to assess the mortality risk correlated with abdominal obesity [ 8890 ] . in 2008 , \n a large european study reported that both general ( bmi ) and abdominal adiposity ( waist circumference ; waist - to - hip ratio ) are strong predictors of mortality risk . \n however , the importance of visceral obesity was most remarkable among persons with a low bmi . the question of visceral fat , as factor capable of reducing life expectancy , has been recently clarified in an animal model study . \n the extrapolation of its data in humans suggests the key role of visceral fat and the possibility through its depletion to favour the survival and , hence , longevity , as demonstrated in calorie restriction rats . in human beings , \n its beneficial effects might be greater , since humans visceral fat depots have direct portal access and , so , a greater potential to harm the liver [ 82 , 92 ] . \n this has recently led huffman and barzilai to hypothesise the presumed link of visceral fat with both age - related diseases and lifespan . \n accumulation of visceral fat represents a greater risk for the development of ir and other processes of metabolic syndrome than other fat depots due to its anatomical location , high lipolytic rate and secretion of inflammatory adipokines . \n this determines some specific perturbations to tissue including hepatic ir , impaired glucose uptake by skeletal muscle and increased basal lipolytic rate and wat free fatty acid release . \n the long - term consequences are an increased risk for obesity - related inflammatory diseases and mortality and a reduced lifespan . \n the association of obesity with obesity - related inflammatory diseases might be explained through evolutionary speculations . \n it is appropriate , hence , to consider the fundamental biological necessities for the survival of an organism : ( 1 ) the ability to resist to starvation and ( 2 ) to evoke an efficient immune response to pathogens . to this aim , \n several metabolic and immune pathways and nutrient- and pathogen - sensing systems have been selected and evolutionarily conserved throughout species . \n the metabolic systems have been selected to assure energy efficiency through the storage of excess calories particularly under intermittent food uptake conditions . \n in contrast , under continuous overnutritional conditions , these systems induce a fat excess , as no advantageous state associated with the onset of several chronic disorders , such as obesity and its complications . at the same time \n , the necessity to defend against the infections has determined the selection of strong immune components , particularly induced by the epidemic and pandemic infections [ 93 , 94 ] . \n the combination of these efficient systems has likely created a fundamental biological instrument able to store energy and to evoke immune - inflammatory responses . \n its existence is showed by the several pathways with metabolic and immune functions evolved from common and ancestral units . \n a characteristic ancestral unit is the body fat of drosophila , having metabolic functions and an intimate control of immune responses . \n it has given rise after about 600 million years to homologous mammalian tissues , such as haematopoietic and immune systems , liver and adipose tissue [ 9598 ] . \n these mammalian tissues have conserved their development heritage and show metabolic and immune cellular components with an architectural organization able to have immediate access into blood vessels . \n hence , they have continuous and dynamic interactions with other important metabolic and immune sites , such as pancreas . \n this contributes to understand the mechanisms involved in metabolic diseases , such as type 2 diabetes . \n they have common regulatory molecular pathways and pathogen - sensing systems able to regulate both metabolic and immune functions . \n characteristic example is the tlr4-nf- pathway , evolved by drosophila homologous toll and able to mediate efficient immune responses also metabolically or nutritionally induced and lipid - related pathways able to respond to the energy necessities of particular conditions , such as during the induction of immune or inflammatory response [ 66 , 93 , 95 ] . \n its dysfunction is dangerous and responsible of the development of some diseases . in particular , overnutritional conditions , fruit of current nutritional habits and lifestyles of most modern western populations , are responsible of the development of the obesity - related inflammatory diseases . in the light of these observations and suggestions , we described the role of adipokines in the pathophysiology of obesity - related inflammatory diseases . \n the term metabolic syndrome ( ms ) assembles some abnormalities , including visceral obesity , dyslipidemia , hyperglycaemia and hypertension . \n the criteria to define ms have been established by international diabetes federation ( idf ) . in the idf consensus , \n ms is defined by the presence of visceral obesity plus two of the described components [ 101 , 102 ] . \n the presence of any two of the four next components is also required : elevated circulating levels of triglycerides , reduced levels of hdl - cholesterol , high blood pressure and impaired fasting glycaemia [ 101 , 102 ] . \n the idf eventually recommends other criteria to diagnose ms , such as increased levels of circulating inflammatory and/or thrombotic markers ( crp , saa , tnf- , il-6 , and pai ) or reduced levels of anti - inflammatory molecules , such as adiponectin . \n this syndrome is currently considered one of the major public health challenges , as demonstrated by two large studies performed , respectively , in 2.600 american individuals ( age range 2564 years ) and 3000 european subjects ( age range 55 years ) . in the two populations , the 25%40% and 30% ( of an italian cohort ) , respectively , were affected by ms . \n several reports have demonstrated in ms patients increased il-6 levels related to bmi [ 100 , 101 ] . \n in particular , the involvement of il-6 in ir and its complications has been evidenced , even if its role remains controversial [ 104106 ] . \n . however , il-6 seems to induce ir , impairing hepatic signaling through the increased expression of socs-3 and affecting the phosphorylation of insulin receptor substrate 1 ( irs-1 ) and the transcription factor pkb / akt [ 104106 ] . \n socs-3 has the capacity to bind and to inhibit the insulin receptor and to induce the proteosomal degradation of irs proteins . \n using 3t3-l1 adipocytes , it has been demonstrated the il-6 capacity to induce partial resistance in insulin - dependent glucose uptake through down - regulation of the phosphorylation of irs-1 and the expression of irs-1 and glucose transporter 4 ( glut4 ) [ 10 , 6668 , 107 ] . \n furthermore , in 3t3-l1 adipocytes , il-6 reduces the activity of lipoprotein lipase - lpl [ 52 , 107 ] . \n the relationship between high levels of tnf- and ms is related to the tnf- capacity to induce a c - jun nh2-terminal kinase to mediate a serine phosphorylation of irs-1 . \n this determines the inhibition of normal tyrosine phosphorylation of irs-1 and downstream insulin signaling . \n furthermore , in obesity , an overexpression of angiotensinogen and an increased activity of vasoconstrictor renin - angiotensin system have been demonstrated . \n this phenomenon seems also to contribute to the alteration of insulin sensitivity and to increase the incidence of type 2 diabetes and ms . \n recent evidence also demonstrates the association of elevated levels of systemic inflammatory molecules , such as saa and crp , with type 2 diabetes and ms . \n ( i.e. , proopiomelanocortin and corticotrophin - releasing hormone ) and , reciprocally the inhibition of orexigenic peptides \n ( i.e. , neuropeptide y and agouti - related protein ) , thereby limiting food intake . in obesity conditions , hypothalamic resistance to leptin has been found and ascribed to reduced transport of leptin across the blood - brain barrier and to increased levels of socs-3 and er stress , which inhibit leptin signaling [ 112 , 113 ] . \n this evokes profound changes in energy balance and hormone production via the hypothalamus , analogous to those induced in response to fasting . \n hence , a response of adaptation to low levels of leptin is induced , determining overfeeding and inhibition of energy expenditure , thyroid and reproductive hormones , and immunity . \n hypothetically , this response may be evolved as a protection against the threat of starvation . in obese subjects , \n these changes determine reduced energy expenditure and to regain weight , associated with lipid accumulation . \n ectopic lipid storage ( in liver , epicardial , and muscle fat ) is also induced in obese conditions because of leptin resistance , which may in turn further impair insulin sensitivity . like leptin effects \n its role may be evidenced in rodents , as suggested by an interesting theory [ 18 , 19 , 52 ] . however , successive studies in both rodents and humans have reported contradictory data [ 18 , 19 ] . an interesting role in the ms pathophysiology and its complications \n seems mediated through a more recent discovery adipokine , visfatin , which its plasma levels are correlated to lipid metabolism and inflammatory response [ 18 , 115 ] . \n it mediates a nicotinamide adenine dinucleotide ( nad ) biosynthetic activity in pancreatic cells . \n hence , visfatin acts as nicotinamide phosphoribosyltransferase ( nampt ) , the rate - limiting enzyme that converts nicotinamide ( a form of vitamin b3 ) to nicotinamide mononucleotide ( nmn ) , a nad precursor . \n it has been reported a decline with advanced age of nampt - mediated systemic nad biosynthesis , able to determine a reduced sirtuin-1 activity . \n this mechanism might contribute to decreased function of pancreatic cells in aged subjects . \n furthermore , another adipokine recently identified with a key role in insulin resistance is lcn-2 , as demonstrated in lcn-2 knockout mice . \n in contrast , a protective role of adiponectin against ms ( and the other obesity - related pathologies ) has recently been demonstrated . \n this molecule reduces m1 macrophage functions , by inhibiting phagocyte activity and release of il-6 and tnf- , and increases the il-10 and il-1ra production in adipocytes and macrophages [ 10 , 18 , 19 ] . \n increased plasma and wat levels of apelin have been detected [ 18 , 19 ] . \n tnf- seems to be the responsible of these increased levels both in plasma and wat [ 18 , 19 ] . \n this molecule seems to reestablish glucose tolerance and increased glucose utilization , as demonstrated in a mice study . \n studies on animal models particularly in the apelin - knockout mice have evidenced that loss of apelin determines heart diseases in response to pressure overload . \n growing evidence highlights the link of systemic - obesity inflammatory state with both cvd onset and cvd risk [ 110 , 121 ] . \n several studies have demonstrated a link between wat excess and cvd mortality in young ( particularly in adolescents ) and old subjects [ 110 , 121 ] . \n furthermore , a relationship between wat excess and coronary artery calcium ( a marker of coronary atherosclerosis ) measurement has been reported . \n imaging approaches have also been confirmed this association . how obesity determines the cvd development , it is until now not clearly understood . \n complex and numerous obesity - mediated mechanisms are identified , as well as the cvd risk obesity - related factors ( including hypertension , ir and dyslipidemia ) . \n systemic and wat adipokines seem also to affect vessel wall , by determining adverse effects [ 110 , 121 , 122 ] . \n precisely , proinflammatory cytokines , hormone - like molecules and other wat adipokines act in the liver , causing changes in the production and the release of lipoproteins , coagulation factors and inflammatory molecules [ 110 , 121 , 122 ] . in particular , they induce an increase of very - low - density lipoprotein , apolipoprotein b ( apob ) , and triglyceride secretion . \n these liver - released molecules act on endothelial , arterial smooth muscle and macrophages cells , by inducing atherogenic effects on the vessel wall through the regulation of their gene expression and functions [ 110 , 121 , 122 ] . \n in addition , visceral fat seems to be particularly involved in the activation of these pathways [ 122 , 123 ] . \n interestingly , among adipokines , leptin mediates different effects on cells of vessel wall . it evokes on endothelial cells oxidative stress , increased production of adhesion molecules and chemokines and proliferation [ 110 , 121 , 122 ] . \n for example , an increased blood release of mcp-1 in obese condition has been observed . \n it seems to increase the number of cd11c+ monocytes , favouring the binding of monocytes / macrophages to the vessel wall . acting also on smooth muscle cells \n , leptin induces their migration , proliferation , and hypertrophy [ 110 , 121 , 122 ] . \n it also induces a further activation and cytokine production of macrophages , neutrophils , and t cells and it seems also involved in the calcification of cells of vessel wall and the thrombosis through the increase of platelet aggregation [ 110 , 121 , 122 ] . \n these effects are also indirectly mediate of leptin through leptin resistance ( mentioned above ) . \n it induces on endothelial cells an increased expression of adhesion molecules , proinflammatory cytokines , and pentraxin .on smooth muscle cells , it evokes their migration . \n an increased expression of cd36 on macrophages seems to be also mediated by resistin , facilitating lipid accumulation and formation of foam cells [ 126 , 127 ] . on macrophages it also mediates an increased production of proinflammatory cytokines , through via tlr4 and nf-b pathway . among the adipokines of recent discovery , visfatin , and apelin \n visfatin has a key role in plaque destabilization , associated with its increased expression in macrophages of human unstable carotid and coronary atherosclerosis . \n have demonstrated that visfatin can , however , prolong the life of human smooth muscle cells . \n unlike visfatin , apelin is associated with a positive hemodynamic profile and has positive inotropic effects in normal and failing rat hearts and in isolated cardiomyocytes [ 132134 ] . in patients affected by single atrial fibrillation and chronic heart failure , reduced plasma apelin levels \n have been found [ 135 , 136 ] . in vessel wall and cardiovascular tissue of rats \n , apelin production seems to be upregulated by hypoxia and ischemic cardiomyopathy , likely as a compensatory mechanism [ 137 , 138 ] . \n its levels are positively correlated with hdl levels , and negatively with triglyceride levels , ir , and systemic circulating inflammatory markers [ 139 , 140 ] . furthermore , a negative correlation between adiponectin and coronary artery calcium has been observed . \n it also promotes several anti - atherogenic and anti - inflammatory effects on vessel cells : it downregulates the expression of adhesion molecules on endothelial cells ; it decreases endothelial oxidative stress and increases enos activity ; in smooth muscle cells it inhibits proliferation by suppressing the release of growth factors ; and in macrophages it reduces lipid accumulation and the expression of scavenger receptors . \n furthermore , crp , usually increased in cdv , has atherogenic effects on vessel wall [ 146 , 147 ] . \n this atherogenic effect is also increased by other wat molecules , such as agt , angiotensin - converting enzyme and pai-1 . \n agt ii has vasoconstrictive actions and also promotes systemic inflammation [ 121 , 122 ] ; agt contributes to the activation of renin - angiotensin system ( ras ) and both these molecules induce a hypertensive response [ 117 , 118 ] . \n ad is a heterogeneous and progressive neurodegenerative disease which in western societies mainly accounts for clinical dementia . \n the ad prevalence is below 1% in individuals aged 60 years , but shows an almost exponential increase with age , so that , in the western world , in people aged 85 years or older the prevalence is between 24% and 33% . \n it prevalence is expected to quadruple by the year 2047 in the united stated . \n there is currently no cure for ad and its pathogenesis remains the subject of many theories involving genetic as well as environmental factors . \n recent mounting evidence has been supposed the involvement of modifiable risk factors in ad neurodegeneration , such as lifestyle factors . among these \n several potential mechanisms seem to link obesity with ad : hyperglycemia , advanced glycosylation products , adipokine action , and the influence of obesity on vascular risk and cerebrovascular disease . \n ir and hyperinsulinemia seem to represent the key causes for the development of some age - related diseases , such as ad . \n precisely , insulin , crossing the blood brain barrier from periphery to central nervous system , seems to compete with a amyloid peptide for insulin degrading enzyme ( ide ) in the brain , including also the hippocampus . \n in contrast , insulin produced in the brain seems to have an advantageous effect on amyloid clearance . opposing effects seem to be mediated by conditions of peripheral hyperinsulinemia . \n they seem to determine the inhibition of brain insulin production , which in turn results in impaired amyloid clearance and a higher ad risk . \n these data suggest that reducing peripheral hyperinsulinemia and increasing brain insulin levels , beneficial effects might be attained on ad neurodegeneration . \n therapy strategies able to reduce blood insulin levels in humans have been demonstrated to affect cognition and levels of amyloid in the cerebrospinal fluid , supporting the potential direct role of insulin in ad [ 153 , 154 ] . \n hyperglycemia seems to be also responsible of the increased levels of advanced glycosylation end products ( ages ) . \n an increased glycation of amyloid has been demonstrated to improve its aggregation in vitro . \n furthermore , age receptors seem also to be specific cell surface receptors for amyloid , thus potentially facilitating neuronal damage . concerning the role of adipokines in ad , it is not clear whether their involvement in the ad pathophysiology are direct or associated with ir and hyperinsulinemia . \n several effects of leptin on the brain development and potentially on brain health in cognition and ageing have also been observed . \n this evidences the capacity of leptin to affect the function of the hypothalamus and learning and memory processes controlled by the hippocampus . \n leptin receptors have been observed in the hippocampus , hypothalamus , amygdala , cerebellum , and brain stem , supporting its capacity to mediate regulatory mechanisms . a direct interaction between leptin and adiponectin and \n however , other roles of leptin and related adipose - derived factors in the ad brain are not clear . fasting plasma leptin \n has been inversely correlated with grey matter volume in areas of the brain in which obese have reduced grey matter in comparison with lean individuals . \n current opinion proposes cd as additional brain damage to amyloid neurotoxicity [ 161 , 162 ] \n ras system regulates the blood pressure . both human brain and wat express ras , with wat ras involved in adipocyte growth , differentiation and metabolism [ 163 , 164 ] . \n its interaction with specific receptors induces the activation of ras , determining an increased of blood pressure . in the brain , angiotensin ii continues its conversion to angiotensin iv , which enhances learning and memory in animal models [ 165 , 166 ] . \n , some prospective studies have examined total ldl and hdl cholesterol levels as possible risk ad factors . \n the association of cholesterol with dementia may vary depending upon when cholesterol is measured in the life - span and/or relative to the course of disease . \n high cholesterol may be a risk factor if measured in midlife many years before clinical onset , but then as the disease pathology progresses , cholesterol levels may fall such that it appears that high cholesterol is protective . \n two finnish studies have , indeed , observed that high total cholesterol levels in mid - life are associated with an increased risk of ad more than 20 years later [ 167 , 168 ] . \n two studies each with more than 25 years of follow - up , did not find an association between mid - life total and hdl cholesterol and incident ad [ 169 , 170 ] . \n three other studies in elderly populations also did not find associations between ldl and/or hdl cholesterol and incident ad after follow - ups of 2 years and 7 years [ 171 , 172 ] . \n in fact , one of these studies reported an inverse association between total cholesterol and ad , such that those in the lowest quartile had the greatest risk . \n similarly , higher cholesterol levels have been reported to be associated with a reduced risk for ad [ 173 , 174 ] . \n prostate cancer ( pc ) is the most common cancer in western elderly male populations . \n the development of pc is based on the interaction between genetic factors and the host exposure to environmental factors , such as infectious agents , dietary carcinogens and hormonal imbalances . in this complex situation \n as reported above , the risk associated with obesity has also been extended to several malignancies . \n data on the association between obesity and pc incidence are inconsistent , and in some studies obesity is associated with an increase in risk of low - grade tumours . \n the reasons of these contrasting results may be due , in part , to variation of the methods of anthropometric measurement , such as bmi and the waist - to - hip ratio . \n however , a recent study has revealed visceral fat accumulation as specific risk factor for pc [ 6 , 76 ] . \n more consistently , it has recently been suggested that obesity reduces the risk of nonaggressive pc disease and increases the risk of aggressive pc disease . \n hence , it is possible that rather than increasing the absolute risk of pc development , obesity may be associated with the progression of latent or microscopic pc to clinically significant and metastatic pc . \n furthermore , the differential effects of obesity on pc subtypes suggest aetiological heterogeneity of these tumours and complex interaction between androgen metabolism and several putative risk factors , including ir , diabetes , inflammation , and genetic susceptibility , on pc risk . \n the molecular mechanisms liking obesity and pc pathophysiology are numerous and occur at several levels . \n however , the relationship between sex steroid hormones and obesity is complex and biological processes involved are unclear . \n current opinion suggests a decline in men of serum testosterone levels in obese conditions . \n in addition , increased peripheral aromatization of androgens to oestrogens , correlated with fat overload , is also involved in the decline of androgens . on the other hand , \n recent data have shown that higher serum levels of total testosterone are associated with a reduced risk of high - grade pc , but with an increased risk of low - grade pc . \n this emphasizes the complex relationship between obesity and serum sex steroid , and their differential effect on pc , but further supports the differential effect of obesity on pc subtypes . \n another mechanism is correlated to capacity of obesity to modify the production of other hormones , such as insulin - like growth factors ( igfs ) , having mitogenic properties . \n in particular , leptin , il-6 and tnf- seem able to enhance tumour growth . \n the obtained data have reported a positive association between high leptin levels and the risk of large volume prostatic tumours . \n stattin et al . have evidenced an association between moderately high leptin levels and later pc development . \n furthermore , the association between leptin and pc seems particularly confined to male subjects having a with waist - to - hip ratio > 0.87 . \n this datum evidences the interaction of leptin with other molecules correlated with abdominal obesity , such as sex hormones bioavailability and igf-1 levels . \n another study has demonstrated in a relatively small number of pc patients an association between serum leptin levels and prostate specific antigen and gleason score . in vitro studies \n have evidenced a role of leptin in pc carcinogenesis and its capacity to promote the proliferation of androgen - independent pc cell lines . in vitro , it has been also observed the capacity of leptin to induce vascular endothelial cell proliferation , and in vivo angiogenesis , key processes involved in cancer progression , invasion , and metastasis . \n the proliferative response of pc cells to leptin has been shown to involve intracellular signaling molecules such as phosphatidyl - inositol 3-kinase ( pi3-k ) and c - jun nh2-terminal kinase ( jnk ) . \n alterations in these signaling pathways are not only critical in processes of prostate carcinogenesis and malignant transformation , but also important in obesity , diabetes , and ir . \n difference effects seem to be mediated by the other adipokines , such as adiponectin proposed as an anticancer factor in some tumours , pc included . in support of this , \n significant lower levels of adiponectin have been observed in pc patients respect to subjects with benign prostatic hyperplasia or healthy controls . \n this study also evidences a negative association between plasma adiponectin and gleason score and pc stage . \n adiponectin receptors have been found in both benign and malignant human prostate tissue . in the lncap and pc3 pc cell lines , it has been evidenced that androgens , oestrogen , tnf- , leptin and adiponectin seem all to act and regulate adiponectin receptors . \n these results might to suggest a complex role of adiponectin in the pc carcinogenesis , mediated through its interaction with sex hormones and cytokines . \n human visceral obesity represents one of the major risk factors for obesity - related diseases . \n possible strategies for the prevention and the development of new therapeutic treatments are , hence , crucial medical challenge . in researching potential strategies , crucial questions remains open . \n furthermore , it is not also clear whether inflammation can simply be considered a state activated by altered nutrient clearance . to date , the literature evidence leads to consider the regulator molecular pathways , evolutionary well - conserved and able to control the evocation of immune responses and metabolic processes and , as possible ways for therapeutic approaches . however , their selection is difficult , as well as their manipulation with possible pharmacological agents to interfere with immune and metabolic systems , without to determine severe consequences on key mechanisms of organism \n . a possible candidate might be the tlr4-nf-b pathway , having the role of hub in the induction of both metabolic and inflammatory processes , as described . \n hence , its antagonists might be used to block the release of metabolic and inflammatory adipokines . on the other hand \n , tlr4-nf-b pathway has a key role in the pathophysiology of age - related inflammatory diseases , such as cvd , ad , and pc , as we have recently demonstrated [ 62 , 176 , 186 , 187 ] . \n other possible pathways might be the lipid - related pathways , such as ppar- and lxr pathways . \n it is already established with success that the use of thiazolidinediones or statins ( ligands of this pathway and insulin sensitising compounds ) is able to regulate lipid metabolism and to induce anti - inflammatory effects . another possible way for the development of possible pharmacological approaches for inflammatory obesity - related diseases might involve the adipokines , even if several their effects and functions remain unclear . in this case , the strategy might hypothetically have as aim the control of the bioavailability of some adipokines , such as leptin and adiponectin , in obese conditions . \n exogenous administration of adiponectin might counteract the consequences of obesity state , such as leptin - induced inflammation , or activate its antiatherogenic , vasoprotective and anticancer actions . \n another alternative avenue might be the inhibition of leptin receptors through monoclonal antibodies or mutant leptin . \n other possible targets might be pro - inflammatory cytokines and chemokines or their receptors , through the use of their agonists or monoclonal antibodies . in summary , \n these observations emphasize the necessity to discover the metabolic and immune pathways , including also the molecules involved in metabolic and pathogen sensing systems , involved in the delicate balance of interplay between metabolic and immune systems . \n this might be useful to clarify and to understand the mechanisms induced and to open possible ways for therapeutic approaches able to enhance the capacity of endogenous molecules to prevent stress and inflammatory responses induced by metabolic signals .", "role": "user" }, { "content": "obesity is an energy - rich condition associated with overnutrition , which impairs systemic metabolic homeostasis and elicits stress . \n it also activates an inflammatory process in metabolically active sites , such as white adipose tissue , liver , and immune cells . as consequence , \n increased circulating levels of proinflammatory cytokines , hormone - like molecules , and other inflammatory markers are induced . \n this determines a chronic active inflammatory condition , associated with the development of the obesity - related inflammatory diseases . \n this paper describes the role of adipose tissue and the biological effects of many adipokines in these diseases .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: klatskin tumor is malignant cholangiocarcinoma that occurs in the extrahepatic bile duct around the confluence of the left and right hepatic bile ducts . in 1975 , \n bismuth corlette classified klatskin tumors into 5 types according to the extent of tumor invasion . \n many surgeons hold the opinion that of 5 types , type iv is impossible to perform a curative resection , but it is not true in all cases . when radical hepatic resection is performed to improve the prognosis of klatskin tumor , because of its anatomical position , large resection is necessary , resulting in decreased volume of the future liver remnant ( flr ) despite small tumor size . also , the possibility of postoperative liver failure is higher in cases with accompanied jaundice that can impede liver regeneration . \n portal vein embolization ( pve ) is used to increase the volume of flr after liver resection ; 2 to 4 weeks before surgery the portal vein of liver to be resected is blocked with gelfoam or coil to induce regeneration of hepatocytes in the nonembolized liver . \n usually , conventional right pve is performed ; however , if more regeneration of flr is required in case of right trisectionectomy , aggressive pve including right pv , p4 or p1 can be performed by first , entry into the left portal vein , blocking the segment iv portal vein ( p4 ) , followed by right pve . \n this method could result in more effective hypertrophy in segments ii and iii , as compared to right pve alone , and preventive effect on tumor growth in the segment iv . \n pve is considered as a very safe procedure . in a large - scale meta - analysis with 1088 patients who underwent pve , \n the overall rate of morbidity caused by pve itself was approximately 2.2% , mainly including hemobilia , hematoma , cholangitis , thrombosis , overflow of embolization material , coil displacement , etc . , and \n however , we experienced 2 mortalities with klatskin tumor of a bismuth corlette type iv that underwent trisectional pve . \n a 69-year - old woman was referred to our hospital with suspected klatskin tumor . abdominal computed tomography ( ct ) and abdominal magnetic resonance imaging \n were performed at another hospital at which she presented with itching and jaundice as main complaints . \n additionally , positron emission tomography - ct was performed to examine whether the tumor was metastasized . \n findings based on all imaging studies showed that patient had a bismuth corlette type iv klatskin tumor , encasing the right hepatic artery and abutting the segment iv hepatic artery with no distant metastasis ( fig . \n when the patient first came to our hospital , carcinoembryonic antigen level was 6.0 ng / ml and carbohydrate antigen 199 was 555 u / ml . \n the serum total bilirubin ( tb ) level of 24.2 mg / dl decreased to 14.4 mg / dl after placement of endoscopic nasobiliary drainage catheter for 1 month . \n however , the patient complained of severe discomfort and wanted to remove the endoscopic nasobiliary drainage catheter ; therefore , left - sided percutaneous transhepatic biliary drainage ( ptbd ) was performed . \n right - sided ptbd was additionally performed , because even after 2 weeks after left - sided ptbd , the serum tb level did not sufficiently decrease , with 11.9 mg / dl . \n two weeks later after right - sided ptbd , the serum tb level was 7.0 mg / dl . \n ( a ) case 1 patient 's axial view of abdominal ct , performed prior to the pve procedure , reveals bilateral ihd dilatation , enhanced wall thickening of hepatic duct , abutting s4 hepatic artery ( arrow ) , and encasing right hepatic artery ( arrow head ) . \n ( b ) coronal view of preprocedure abdominal mri reveals enhanced wall thickening at hepatic duct , chd , and cbd to just intrapancreatic portion ( arrow ) . \n ( c ) trisectional pve was performed using gelfoam particles and interlock coils with a diameter of 5 mm . \n right pve was performed ( arrow ) after the segment iv portal vein ( p4 ) was blocked ( arrowhead ) . \n ( d ) noncontrast abdominal ct , performed 8 days post - pve , shows the right - sided ptbd ( arrow ) dislocated into the abdomen and ascites ( arrowhead ) . \n the segments ii and iii , that is , flr , was 29.5% , with a 0.5% increase in volume . \n cbd = common bile duct , chd = common hepatic duct , ct = computed tomography , flr = future liver remnant , ihd = intrahepatic duct , mri = magnetic resonance imaging , ptbd = percutaneous transhepatic biliary drainage , pve = portal vein embolization . on the following day \n first , p6 was micropunctured under the guidance of ultrasound and fluoroscopy , and a 5-french sheath was inserted . \n then , a 5-french side - hole catheter ( sos omni flush ; angiodynamics , queensbury , ny ) was placed in the proximal portion of the main portal vein . \n the portal vein anatomy was identified by performing angiography and cone - beam computerized tomography . the right portal vein bifurcated into right anterior and posterior portal veins . in the left portal vein , \n 3 small p4s were present , and p1 originated in the left main portal vein and was in a direction toward the spigelian lobe . \n gelfoam particles were infused in 3 p4s sequentially , followed by embolization on each os with 3 interlock coils of 5 mm diameter . \n embolization was performed on p1 that was oriented toward the spigelian lobe , only using gelfoam particles and the portal vein oriented toward the caudate process was not embolized . \n next , complete embolization was performed on the right portal vein , in which the entire vein was embolized with gelfoam particles and glue was injected into the right anterior portal vein . \n finally , p6 was embolized with the tract where the sheath was inserted , using glue ( fig . \n two days after the pve procedure , the patient 's mean blood pressure ( mbp ) was 52 mm hg . \n abdominal ct angiography was performed to differentiate bleeding but no bleeding focus was found . at the time , fever was not present , the white blood cell ( wbc ) count was 15,510/l , the hemoglobin level was 9.2 g / dl , the platelet count was 161,000/l , and the serum tb level was 9.0 mg / dl . \n oozing of slightly bile - tinged ascites was observed 2 days prior at the right - sided ptbd insertion site , but there was no dislocation of ptbd in ct scans . after the administration of intravenous fluid and norepinephrine , her mbp was maintained at a level higher than 65 mm hg and intravenous antibiotics were used . on the following day , \n ileus and right pleural effusion were found on plain abdominal x - ray and chest radiograph . \n three days later , dyspnea did not improve , and due to an 8 kg weight increase , decreased urine output , and increased ascites , right chest percutaneous catheter drainage ( pcd ) and ascites tapping were performed . at the time , the serum wbc count was 18,600/l , the serum tb was 9.0 mg / dl , the ascitic fluid absolute polymorphonuclear leukocyte count was 48,191/mm , and the serum - ascites albumin gradient was 1.0 . following chest pcd and ascites tapping , symptoms momentarily improved , but deteriorated again ; in addition , on the noncontrast abdominal ct performed 2 days later , the segments ii and iii , that is , flr , was estimated at 29.5% , with a mere 0.5% increase in volume . \n moreover , ascites increased , and right - sided ptbd was dislocated into the abdomen ( fig . \n after the right - sided ptbd was changed and an abdominal pcd catheter was inserted , the patient was transferred to the intensive care unit , where intubation and continuous renal replacement therapy began . at the time , the serum wbc count was 31,030/l , the platelet count was 54,000/l , the tb level was 8.7 mg / dl , and the prothrombin time international normalized ratio was 2.59 . \n the patient 's medical conditions continuously worsened , and the patient died 5 days later . at the time of death , the serum wbc count was 48,930/l , the platelet count was 32,000/l , the tb level was 16.5 mg / dl , and prothrombin time international normalized ratio was 3.45 . \n a 79-year - old man with suspected type iv klatskin tumor came to our hospital for reevaluation and a 2nd opinion , after presenting at another hospital with jaundice as a main complaint , where javascript : endicautolink ( indigestion ) ; abdominal ct and abdominal magnetic resonance imaging were performed . \n a review of all imaging studies showed that the findings were consistent with klatskin tumor of bismuth corlette type iv , abutting the right hepatic artery and right portal vein , and invading the liver hilum . \n right trisectionectomy of the liver was planned , but flr was estimated at only 21% ( fig . \n he had already undergone endoscopic retrograde biliary drainage on the left intrahepatic bile duct at the other hospital 2 weeks prior . at the time of his visit to us , \n the serum tb was 2.9 mg / dl , the carcinoembryonic antigen level was 2.3 ng / ml , and the carbohydrate antigen 199 level was 515 u / ml . \n the patient was a chronic alcoholic and the indocyanine green retention rate at 15 minutes , tested at the other hospital , was 48.5% . \n ( a ) case 2 patient 's axial view of preprocedure abdominal ct shows ihd dilatation and segmentation in both hemilivers , and abutting right hepatic artery ( arrow ) . \n ( b ) coronal view of preprocedure abdominal mri shows bile duct enhanced narrowing at hepatic duct , chd , and proximal cbd ( arrow ) . \n ( c ) trisectional pve was performed using gelfoam particles and interlock coils with a diameter of 5 mm . \n right pve was performed ( arrow ) after the segment iv portal vein ( p4 ) was blocked ( arrowhead ) . \n ( d ) ct performed 5 days post - pve indicated a perihepatic fluid collection ( arrow ) suspected of biloma . \n additionally , a large quantity of pleural effusion ( arrowhead ) was seen in the right lung base . \n ( e ) in ct performed 3 weeks after pve , spleen hypertrophy ( arrow ) was seen in comparison to ( f ) the pre - pve abdominal ct ; the segments ii and iii flr was 25.5% , with a 4.5% increase in volume . \n cbd = common bile duct , chd = common hepatic duct , ct = computed tomography , flr = future liver remnant , ihd = intrahepatic duct , mri = magnetic resonance imaging , ptbd = percutaneous transhepatic biliary drainage , pve = portal vein embolization . \n on portography , p5 and p8 were seen to originate from the right anterior portal vein , while p6 and p7 were seen to originate from the main portal vein . \n two p4s were confirmed , and 2 caudate portal veins were observed going from the hilum toward the spigelian lobe . \n gelfoam particles were infused in 2 p4s sequentially , and each os was embolized using 3 interlock coils of 5 mm diameter . \n next , complete embolization was performed on the right portal vein , in which the entire vein was embolized with gelfoam particles and glue was injected into p6 , p7 , and p8 . \n finally , p5 in which a sheath had been inserted using glue was embolized with the tract where the sheath was inserted , which completed the procedure ( fig . \n 2c ) . on the same day , left - sided ptbd was performed through b3 because endoscopic retrograde biliary drainage had been inserted to only b2 and b3 had been dilated . \n two days later , the patient continuously complained of abdominal distension , with watery diarrhea 5 to 8 times a day , and ileus was found on the plain abdominal x - ray . \n abdominal ct revealed a perihepatic fluid collection of an area of 13 3 cm suspected of biloma that possibly occurred during pve , and a large quantity of pleural effusion in the right lung base ( fig . \n , patients pulse rate was 120/minute , mbp was 60 mm hg , and wbc count was 18,350/l , and intravenous fluid and norepinephrine were administered , after which , the vital signs stabilized . for suspected biloma \n symptoms improved transiently , but , 2 days later , due to fever ( 38.5 c ) and dyspnea , a pcd catheter was inserted in the right chest and the vital signs and respiratory symptoms improved . however , the amount of fluid draining from left - sided ptbd gradually decreased , and the serum tb level increased to 6.4 mg / dl 2 weeks post - pve . around the same time , the patient was transferred to the intensive care unit due to pulmonary edema , where urine output gradually decreased despite the use of diuretics . \n three weeks post - pve , the serum tb was 14.0 mg / dl and on abdominal ct , the segments ii and iii , that is , flr , was estimated at 25.5% , with a 4.5% increase in volume , and spleen hypertrophy was found ( fig . 2e , f ) . \n subsequently , the patient gradually deteriorated and died of a multiorgan failure 4 weeks after pve . at the time of death , the serum tb was 15.9 mg / dl . \n a 69-year - old woman was referred to our hospital with suspected klatskin tumor . abdominal computed tomography ( ct ) and abdominal magnetic resonance imaging \n were performed at another hospital at which she presented with itching and jaundice as main complaints . \n additionally , positron emission tomography - ct was performed to examine whether the tumor was metastasized . \n findings based on all imaging studies showed that patient had a bismuth corlette type iv klatskin tumor , encasing the right hepatic artery and abutting the segment iv hepatic artery with no distant metastasis ( fig . \n when the patient first came to our hospital , carcinoembryonic antigen level was 6.0 ng / ml and carbohydrate antigen 199 was 555 u / ml . \n the serum total bilirubin ( tb ) level of 24.2 mg / dl decreased to 14.4 mg / dl after placement of endoscopic nasobiliary drainage catheter for 1 month . \n however , the patient complained of severe discomfort and wanted to remove the endoscopic nasobiliary drainage catheter ; therefore , left - sided percutaneous transhepatic biliary drainage ( ptbd ) was performed . \n right - sided ptbd was additionally performed , because even after 2 weeks after left - sided ptbd , the serum tb level did not sufficiently decrease , with 11.9 mg / dl . \n two weeks later after right - sided ptbd , the serum tb level was 7.0 mg / dl . \n ( a ) case 1 patient 's axial view of abdominal ct , performed prior to the pve procedure , reveals bilateral ihd dilatation , enhanced wall thickening of hepatic duct , abutting s4 hepatic artery ( arrow ) , and encasing right hepatic artery ( arrow head ) . \n ( b ) coronal view of preprocedure abdominal mri reveals enhanced wall thickening at hepatic duct , chd , and cbd to just intrapancreatic portion ( arrow ) . \n ( c ) trisectional pve was performed using gelfoam particles and interlock coils with a diameter of 5 mm . \n right pve was performed ( arrow ) after the segment iv portal vein ( p4 ) was blocked ( arrowhead ) . \n ( d ) noncontrast abdominal ct , performed 8 days post - pve , shows the right - sided ptbd ( arrow ) dislocated into the abdomen and ascites ( arrowhead ) . \n the segments ii and iii , that is , flr , was 29.5% , with a 0.5% increase in volume . \n cbd = common bile duct , chd = common hepatic duct , ct = computed tomography , flr = future liver remnant , ihd = intrahepatic duct , mri = magnetic resonance imaging , ptbd = percutaneous transhepatic biliary drainage , pve = portal vein embolization . on the following day \n first , p6 was micropunctured under the guidance of ultrasound and fluoroscopy , and a 5-french sheath was inserted . \n then , a 5-french side - hole catheter ( sos omni flush ; angiodynamics , queensbury , ny ) was placed in the proximal portion of the main portal vein . \n the portal vein anatomy was identified by performing angiography and cone - beam computerized tomography . the right portal vein bifurcated into right anterior and posterior portal veins . in the left portal vein , \n 3 small p4s were present , and p1 originated in the left main portal vein and was in a direction toward the spigelian lobe . \n gelfoam particles were infused in 3 p4s sequentially , followed by embolization on each os with 3 interlock coils of 5 mm diameter . \n embolization was performed on p1 that was oriented toward the spigelian lobe , only using gelfoam particles and the portal vein oriented toward the caudate process was not embolized . \n next , complete embolization was performed on the right portal vein , in which the entire vein was embolized with gelfoam particles and glue was injected into the right anterior portal vein . \n finally , p6 was embolized with the tract where the sheath was inserted , using glue ( fig . \n two days after the pve procedure , the patient 's mean blood pressure ( mbp ) was 52 mm hg . \n abdominal ct angiography was performed to differentiate bleeding but no bleeding focus was found . at the time , fever was not present , the white blood cell ( wbc ) count was 15,510/l , the hemoglobin level was 9.2 g / dl , the platelet count was 161,000/l , and the serum tb level was 9.0 mg / dl . \n oozing of slightly bile - tinged ascites was observed 2 days prior at the right - sided ptbd insertion site , but there was no dislocation of ptbd in ct scans . after the administration of intravenous fluid and norepinephrine , her mbp was maintained at a level higher than 65 mm hg and intravenous antibiotics were used . on the following day , \n ileus and right pleural effusion were found on plain abdominal x - ray and chest radiograph . \n three days later , dyspnea did not improve , and due to an 8 kg weight increase , decreased urine output , and increased ascites , right chest percutaneous catheter drainage ( pcd ) and ascites tapping were performed . at the time , the serum wbc count was 18,600/l , the serum tb was 9.0 mg / dl , the ascitic fluid absolute polymorphonuclear leukocyte count was 48,191/mm , and the serum - ascites albumin gradient was 1.0 . following chest pcd and ascites tapping , symptoms momentarily improved , but deteriorated again ; in addition , on the noncontrast abdominal ct performed 2 days later , the segments ii and iii , that is , flr , was estimated at 29.5% , with a mere 0.5% increase in volume . \n moreover , ascites increased , and right - sided ptbd was dislocated into the abdomen ( fig . \n after the right - sided ptbd was changed and an abdominal pcd catheter was inserted , the patient was transferred to the intensive care unit , where intubation and continuous renal replacement therapy began . at the time , the serum wbc count was 31,030/l , the platelet count was 54,000/l , the tb level was 8.7 mg / dl , and the prothrombin time international normalized ratio was 2.59 . \n the patient 's medical conditions continuously worsened , and the patient died 5 days later . at the time of death , the serum wbc count was 48,930/l , the platelet count was 32,000/l , the tb level was 16.5 mg / dl , and prothrombin time international normalized ratio was 3.45 . \n a 79-year - old man with suspected type iv klatskin tumor came to our hospital for reevaluation and a 2nd opinion , after presenting at another hospital with jaundice as a main complaint , where javascript : endicautolink ( indigestion ) ; abdominal ct and abdominal magnetic resonance imaging were performed . \n a review of all imaging studies showed that the findings were consistent with klatskin tumor of bismuth corlette type iv , abutting the right hepatic artery and right portal vein , and invading the liver hilum . \n right trisectionectomy of the liver was planned , but flr was estimated at only 21% ( fig . \n he had already undergone endoscopic retrograde biliary drainage on the left intrahepatic bile duct at the other hospital 2 weeks prior . at the time of his visit to us , the serum tb was 2.9 mg / dl , \n the carcinoembryonic antigen level was 2.3 ng / ml , and the carbohydrate antigen 199 level was 515 u / ml . \n the patient was a chronic alcoholic and the indocyanine green retention rate at 15 minutes , tested at the other hospital , was 48.5% . \n ( a ) case 2 patient 's axial view of preprocedure abdominal ct shows ihd dilatation and segmentation in both hemilivers , and abutting right hepatic artery ( arrow ) . \n ( b ) coronal view of preprocedure abdominal mri shows bile duct enhanced narrowing at hepatic duct , chd , and proximal cbd ( arrow ) . \n ( c ) trisectional pve was performed using gelfoam particles and interlock coils with a diameter of 5 mm . \n right pve was performed ( arrow ) after the segment iv portal vein ( p4 ) was blocked ( arrowhead ) . \n ( d ) ct performed 5 days post - pve indicated a perihepatic fluid collection ( arrow ) suspected of biloma . \n additionally , a large quantity of pleural effusion ( arrowhead ) was seen in the right lung base . \n ( e ) in ct performed 3 weeks after pve , spleen hypertrophy ( arrow ) was seen in comparison to ( f ) the pre - pve abdominal ct ; the segments ii and iii flr was 25.5% , with a 4.5% increase in volume . \n cbd = common bile duct , chd = common hepatic duct , ct = computed tomography , flr = future liver remnant , ihd = intrahepatic duct , mri = magnetic resonance imaging , ptbd = percutaneous transhepatic biliary drainage , pve = portal vein embolization . \n on portography , p5 and p8 were seen to originate from the right anterior portal vein , while p6 and p7 were seen to originate from the main portal vein . \n two p4s were confirmed , and 2 caudate portal veins were observed going from the hilum toward the spigelian lobe . \n gelfoam particles were infused in 2 p4s sequentially , and each os was embolized using 3 interlock coils of 5 mm diameter . \n next , complete embolization was performed on the right portal vein , in which the entire vein was embolized with gelfoam particles and glue was injected into p6 , p7 , and p8 . \n finally , p5 in which a sheath had been inserted using glue was embolized with the tract where the sheath was inserted , which completed the procedure ( fig . \n on the same day , left - sided ptbd was performed through b3 because endoscopic retrograde biliary drainage had been inserted to only b2 and b3 had been dilated . \n two days later , the patient continuously complained of abdominal distension , with watery diarrhea 5 to 8 times a day , and ileus was found on the plain abdominal x - ray . \n abdominal ct revealed a perihepatic fluid collection of an area of 13 3 cm suspected of biloma that possibly occurred during pve , and a large quantity of pleural effusion in the right lung base ( fig . \n patients pulse rate was 120/minute , mbp was 60 mm hg , and wbc count was 18,350/l , and intravenous fluid and norepinephrine were administered , after which , the vital signs stabilized . for suspected biloma \n symptoms improved transiently , but , 2 days later , due to fever ( 38.5 c ) and dyspnea , a pcd catheter was inserted in the right chest and the vital signs and respiratory symptoms improved . however , the amount of fluid draining from left - sided ptbd gradually decreased , and the serum tb level increased to 6.4 mg / dl 2 weeks post - pve . around the same time , the patient was transferred to the intensive care unit due to pulmonary edema , where urine output gradually decreased despite the use of diuretics . \n three weeks post - pve , the serum tb was 14.0 mg / dl and on abdominal ct , the segments ii and iii , that is , flr , was estimated at 25.5% , with a 4.5% increase in volume , and spleen hypertrophy was found ( fig . 2e , f ) . \n subsequently , the patient gradually deteriorated and died of a multiorgan failure 4 weeks after pve . at the time of death , the serum tb was 15.9 mg / dl . \n pve has been considered as a very safe preoperative procedure to attain flr hypertrophy in patients who need extended hepatectomy . a large - scale meta - analysis reported morbidity rate due to pve of 2.2% , 0% mortality , and an flr value higher than the level necessary to perform surgery in all but 1.6% of cases . \n simultaneous embolization up to p4 is controversial , but some studies have reported that effective hypertrophy in the segments ii and iii , and a preventive effect on tumor growth in the segment iv can be expected . until now , pve - related mortality has not been reported . in the current study , bacterial peritonitis was confirmed in case 1 , but it was unclear if primary or secondary based on ascitic fluid polymorphonuclear leukocyte count of 48,191/mm and serum - ascites albumin gradient 1.0 . \n slightly persistent ascites oozing at the right - sided ptbd insertion site occurred for 2 days before symptom onset , but there was no dislocation of ptbd in abdominal ct at that time . \n although citrobacter freundii was identified in the bile drained from ptbd , the bacteria were not identified in repeated blood and ascites bacterial culture tests . \n case 2 patient showed clear symptom improvement for a while after infected bile and right pleural effusion was drained . \n but , the amount of fluid draining from ptbd slowly decreased , and although the serum tb ( mainly direct bilirubin ) gradually increased , the alkaline phosphatase and -glutamyltranspeptidase did not increase , possibly due to hepatic insult caused by sepsis within 1 week after pve and progression of acute liver failure . \n second , right pve as well as p4 and p1 embolization , that is , trisectional pve resulting in the large deportalized liver , was performed in both patients . \n fifth , each had heart - related disease , that is , case 1 patient had a history of congestive heart failure and case 2 patient had unstable angina , with a coronary - stent placement . \n sixth and finally , the 2 patients in our cases suffered from long - lasting jaundice for at least 2 months and 2 weeks prior to pve , respectively , which could reduce hepatic metabolic and regenerative capacity , and increases rates of liver dysfunction after major resection . \n furthermore , their serum bilirubin levels did not reach the normal range even right before pve and left - sided ptbd was performed simultaneously in case 2 patient . \n in conclusion , sepsis might be the most critical factor that influenced the outcomes of 2 patients after pve . however , the extent of pve , chronic alcohol consumption , age , comorbidity , long - lasting jaundice , concurrent biliary procedure such as ptbd , and the like should also be critically considered when performing pve .", "role": "user" }, { "content": "abstractportal vein embolization ( pve ) is increasingly performed worldwide to reduce the possibility of liver failure after extended hepatectomy , by inducing future liver remnant ( flr ) hypertrophy and atrophy of the liver planned for resection . \n the procedure is known to be very safe and to have few procedure - related complications.in this study , we described 2 elderly patients with bismuth corlette type iv klatskin tumor who underwent right trisectional pve involving the embolization of the right portal vein , the left medial sectional portal branch , and caudate portal vein . within 1 week after pve , patients went into sepsis combined with bile leak and died within 1 month.sepsis can cause acute liver failure in patients with chronic liver disease . in this study , the common patient characteristics other than sepsis , that is , trisectional pve ; chronic alcoholism ; aged > 65 years ; heart - related comorbidity ; and elevated serum total bilirubin ( tb ) level ( 7.0 mg / dl ) at the time of the pve procedure in 1 patient , and concurrent biliary procedure , that is , percutaneous transhepatic biliary drainage in the other patient might have affected the outcomes of pve.these cases highlight that pve is not a safe procedure . \n care should be taken to minimize the occurrence of infectious events because sepsis following pve can cause acute liver failure . additionally , prior to performing pve , the extent of pve , chronic alcohol consumption , age , comorbidity , long - lasting jaundice , concurrent biliary procedure , etc . \n should be considered for patient safety .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: patients within this group are at risk of energy imbalance and an increased prevalence of obesity \n . studies of childhood cancer survivors who were treated in the 1970s and 1980s demonstrate a clear association between cranial radiotherapy ( crt ) and an increased prevalence of obesity , especially with higher radiation doses [ 24 ] . \n contemporary treatment protocols have removed crt for the majority of children with all and , where it is still utilized , reduced the doses delivered . despite these improvements in treatment protocols , obesity is still a concern during treatment and follow - up [ 58 ] . \n various risk factors have been identified including younger age at diagnosis [ 5 , 7 ] , elevated body mass index ( bmi ) at diagnosis , dose of corticosteroid , treatment risk [ 9 , 10 ] , and female sex [ 8 , 11 ] but these observations are not consistent among all reports [ 9 , 10 ] . in a recent meta - analysis of obesity in survivors of pediatric all , zhang et al . concluded that such modifiers of bmi remain speculative . \n for those studies of patients on modern treatment protocols for all with multiple observations during treatment , few have adjusted for or included all these predictors in the same analysis . \n our aim was to identify those patients at greatest risk of becoming obese during treatment for all . \n we therefore performed a retrospective chart review of all children and adolescents diagnosed with all in western australia between 2003 and 2007 to evaluate longitudinal changes in bmi during treatment for all and to identify risk factors that would inform future intervention strategies . \n between 1 january 2003 and 31 december 2007 , a total of 89 children ( 017 y ) were newly diagnosed with all in western australia . all patients were treated at princess margaret hospital ( pmh ) for children , the sole tertiary pediatric hospital in the state of western australia . \n patients were treated on a variety of children 's cancer group ( ccg ) or children 's oncology group ( cog ) protocols . \n exclusion criteria included patients with infant all ( n = 3 ) , mature b cell all ( n = 2 ) , and trisomy 21 ( n = 2 ) and patients who did not proceed to maintenance therapy due to relapse ( n = 1 ) or death ( n = 1 ) . \n thus , 80 patients were eligible for inclusion in this study ( see figure 1 ) . \n medical records were retrospectively reviewed and information pertaining to auxology and cancer treatment was abstracted . \n data collected included height ( meters ) and weight ( kilograms ) ; risk stratification , which correlates with therapeutic intensity , according to national cancer institute ( nci ) criteria ( standard / high ) ; cumulative corticosteroid exposure ; and receipt of crt . \n heights ( measured using a stadiometer ) and weights were obtained at the start of each treatment phase by accredited oncology nurses for the purpose of calculating chemotherapy doses , where available heights and weights from other oncology visits were included . during treatment , height and weight were collected at least every three months . \n cumulative steroid doses during treatment were calculated in mg / m for both dexamethasone ( dex ) and prednisone ( pdn ) . \n the total cumulative steroid dose was expressed as pdn equivalents after multiplying the dex dose by 6.67 to account for the differences in steroid potency . \n for the analysis , total steroid dose was cumulated separately for the duration of maintenance treatment and for the early treatment period prior to maintenance . \n heights and weights were therefore collected for 3.35 years after the start of treatment for all patients unless data were censored at the date of relapse , transferring out of western australia , or transition to adult services ; see figure 1 for summary . \n this audit was approved by the child and adolescent health service , quality and safety committee with delegated authority from the pmh institutional review board . \n it conforms to the provisions of the declaration of helsinki in 1995 ( as revised in tokyo 2004 ) and the national statement on ethical conduct in human research , australian national health and medical research council . \n heights and weights of children from the raine study were used as a comparison population to the all cohort . the raine study ( http://www.rainestudy.org.au/ ) \n briefly , 2900 pregnancies were recruited at king edward memorial hospital ( perth , western australia ) at 18 weeks ' gestation from 1989 to 1991 . \n auxological review of this pregnancy cohort was carried out at ages 1 , 2 , 3 , 6 , 8 , 10 , 14 , 17 , and 21 years . \n the current raine cohort has been shown to be representative of the ethnicity and demographics of the general population of perth , western australia . \n this study was approved by the raine executive committee and the ethics committees of king edward memorial hospital and pmh . \n written consent was provided by adolescent participants and their accompanying parent or guardian . in comparison with the raine cohort , \n 33% of the patient cohort were born at the same time of within 5 years of the raine cohort , 35% of the patient cohort were born within 510 years of the raine cohort , and 32% were born within 1015 years of the raine cohort . \n the outcome of interest was bmi , which was calculated using the standard formula : weight ( kg)/height ( m ) . \n bmi values for patients aged between 2 and 20 years were converted to age and sex - adjusted z - scores using the formula ( ( ( x / m ) ) 1)/ls , where x is the bmi measurement and l , m , and s are the age and sex specific values for the power in the box - cox transformation and the median and the coefficient of variation , respectively , by the sas macros for the center for disease control ( cdc ) 2000 growth charts [ 15 , 16 ] . \n bmi z - score categories are defined as underweight ( < 5th percentile ) , healthy weight ( 5th percentile to < 85th percentile ) , overweight ( 85th to < 95th percentile ) , and obese ( 95th percentile ) . \n who 2006 growth charts were used to calculate the bmi z - score at diagnosis for the six children who were less than two years of age . \n these values were not included in the longitudinal response variable but were included in a covariate variable ( bmi z - score at start of treatment ) to ensure that all individuals were included in the statistical analysis . \n proportions were compared using fisher 's exact test ( independent samples ) or mcnemar 's test ( paired data ) . \n longitudinal bmi z - scores for the all cohort were analyzed using linear mixed - effects , including fixed effects for time since start of treatment ( quartic polynomial ) and time - dependent interactions with sex , age , and bmi z - score at the start of treatment , nci risk , and total maintenance steroid dose received . \n random effects for intercept and time and a compound symmetry correlation structure for the errors using the lme function from the statistical package nlme in r were included in the models [ 17 , 18 ] . \n p values were calculated for each covariate , including associated interaction terms , using the likelihood ratio test . \n sample - mean predicted bmi z - scores were estimated using the pred function ( package nlme ) and associated 95% confidence intervals were calculated , which were graphed using the ggplot2 package . \n longitudinal bmi z - scores for the raine cohort were analyzed similarly , including fixed effects for age ( quartic polynomial ) and age - dependent sex interaction and random effects for intercept and age . a significance level of 5% \n selected characteristics of the 51 male and 29 female patients included in the study are presented in table 1 . \n the median age at diagnosis was 5.49 years ( range : 1.0216.66 ) , with six children diagnosed before 2 years of age . \n the majority of the children were diagnosed with pre - b all ( 88.8% ) , of which 73% ( n = 52/71 ) were standard risk . \n patients were treated on ccg and cog protocols : ccg1961 ( n = 10 ) , ccg1991 ( n = 24 ) , all0031 ( n = 4 ) , all0232 ( n = 12 ) , all0331 ( n = 29 ) , and all0434 ( n = 1 ) . \n the duration of treatment was greater for males ( median 3.18 years ) than females ( median 2.18 years ) , as males receive an additional year of maintenance therapy on these protocols . \n twelve patients ( 15% ) ( 10 male , 2 female ) received crt as part of their therapy . \n the majority of patients received dex ( n = 62 , 78% ) as the only corticosteroid , one patient received pdn only , and the remaining 17 patients received both dex and pdn during treatment . \n no patient received growth hormone during treatment or in the two years immediately following the end of therapy . at the time of diagnosis the bmi z - scores for individuals with all predominantly fall within the 95% prediction interval for the healthy ( raine ) cohort ( figure 2(a ) ) ; 77.5% ( 62/80 ) of the patients were in the healthy weight category , 3.8% ( 3/80 ) were in the underweight category , and 8.8% ( 7/80 ) were classified as overweight and 10% ( 8/80 ) as obese according to cdc reference standards . \n there was no sex difference in the proportion of males and females in each of the bmi categories . at the end of treatment ( figure 2(b ) ) , 46.3% ( 37/80 ) of the patients were in the healthy weight category , 2.5% ( 2/80 ) were in the underweight category , 26.3% ( 21/80 ) were classified as overweight , and 25% ( 20/80 ) were classified as obese . at the end of treatment \n , there was an increase in bmi z - scores for individuals with all diagnosed before 10 years of age , whereas individuals diagnosed after 10 years of age predominantly were within or below the 95% prediction interval for the healthy ( raine ) cohort . by the end of treatment \n there were significant differences in the proportions of males and females in each bmi category ( p = 0.006 ; fisher 's exact test ) . during treatment , \n increases in bmi z - scores were greater for females than males ; the prevalence of obesity increased from 10.3% to 44.8% ( p < 0.004 ) for females but remained relatively unchanged for males ( 9.8% to 13.7% , p = 0.7 ) . \n the mean number of bmi observations per individual was 34.8 ( sd 19.7 ) for females and 27.9 ( sd 17.0 ) for males . \n the peak increase in bmi z - scores occurs around two years posttreatment , for both sexes , and thereafter gradually declines ( figure 3 ) . \n the acceleration in bmi z - scores in females , compared to males , predominantly occurs between 6 and 12 months posttreatment , whereas from two years posttreatment an approximately constant mean difference in bmi z - scores is maintained between the sexes . \n bmi z - scores were associated with sex , nci risk , age and bmi z - score at diagnosis , and total maintenance therapy steroid dose ( see table s1 in supplementary material available online at http://dx.doi.org/10.1155/2015/386413 ) . \n no associations were detected between bmi z - scores and either total steroid dose in premaintenance therapy or cranial radiotherapy . \n significant associations with bmi z - scores were identified for time - dependent interactions with sex ( lrt p = 0.0005 ) , bmi z - score at diagnosis ( p = 0.0005 ) , and total dose of steroid during the maintenance phase ( p = 0.004 ) , in addition to sex and time interactions for nci risk ( lrt p < 0.0001 ) and age at diagnosis ( lrt p = 0.0001 ) . \n these interactions are illustrated in figure 4 and contrasted with mean bmi z - score for healthy ( raine ) males and females at the same age . \n standard risk and earlier age at diagnosis were associated with the greatest increases in mean bmi z - score , which is more pronounced in females . \n bmi z - scores for high - risk individuals were not significantly different from healthy individuals for either sex \n . table 2 illustrates that , on average , standard risk females have bmi z - scores 1 sd higher than healthy females of the same age . \n a similar effect size was seen in standard risk males for the youngest age group ( 2 years ) but this effect rapidly diminished across the older age groups . to further investigate the relationship between bmi z - score and steroid intake we predicted bmi trajectories based on identical steroid doses ( total maintenance therapy ) in males and females using the fully adjusted model described above ( figure s1 in supplementary material ) . \n although slightly higher mean bmi z - score values are predicted with higher steroid doses , the greatest increases are based on female sex and earlier ages at diagnosis . \n obesity is a recognized consequence of treatment for all ; however , risk factors for this increase remain speculative . \n obesity may exacerbate late - effects of cancer therapy such as cardiovascular and metabolic health ; it is therefore important to identify survivors of all who are at greatest risk of becoming obese . \n our longitudinal analysis which includes a median of 30 auxological measurements per patient over a period of 3.35 years has confirmed that bmi increases during treatment for all in childhood . \n the prevalence of obesity in the western australian all cohort increased from 10% at the start of treatment to 25% by the end of treatment for the whole cohort , similar to other reports of 11% to 21% and 14% to 23% , where increases in mean bmi were expressed as z - scores based on the cdc reference population and increases of 0.61.0 sd units [ 6 , 7 , 10 ] are similar to our observed increase of 0.6 sd units from the start to the end of treatment . while there was a significant increase in mean bmi z - score during maintenance treatment in the study by esbenshade and colleagues , the prevalence of obesity at the start and end of treatment ( 19% versus 21% ) was not significantly different , which may be explained by a higher prevalence of obesity at diagnosis in this study compared with other studies . in our cohort , \n female sex was a risk factor for increased bmi during treatment for all . in the longitudinal mixed - effects model adjusted for sex only , there were differences in predicted mean bmi z - scores between males and females . \n although mean bmi z - scores increased during the first two years of treatment for both sexes , this increase was greater for females than males . \n consistent with our observation , greater increases in bmi during treatment for females compared to males have been identified during treatment in several studies [ 5 , 6 , 8 , 20 ] , whereas other studies have found no differences between the sexes [ 9 , 10 , 21 ] . \n analysis of adult bmi in one of the largest cohorts of childhood cancer survivors , the childhood cancer survivor study , has confirmed that there is a greater prevalence of obesity in adult female survivors of all compared to males . \n in addition , a uk cohort treated from 1997 to 2003 , which excluded patients who received crt , also found increased bmi z - scores in females , which persisted 6 years after end of treatment . \n taken together , these data raise the possibility that increases in bmi during treatment for all in childhood persist into adulthood . \n longitudinal changes in bmi z - scores in children treated for all were associated not only with sex but also with age at diagnosis and nci risk / therapeutic intensity . for \n patients with high - risk all , mean bmi z - scores did not increase with treatment irrespective of age at diagnosis or sex . for patients with standard risk all , \n mean bmi z - scores increased for standard risk females irrespective of age but only younger standard risk males had an increase in bmi z - score . \n thus , for standard risk patients predictors for increased bmi during treatment are younger age at diagnosis and being female . \n studies typically investigate the association of bmi with either age at diagnosis or risk profile due to the potential confounding effects of age at diagnosis , which is one of the determinants of disease risk . \n younger age at diagnosis has been associated with increased bmi in several studies [ 7 , 8 , 23 ] . \n in addition , an association between treatment for higher risk all and lower bmi during treatment has also been reported [ 9 , 10 ] . \n although they are administered in high doses during treatment for all , few studies provide data on corticosteroid exposure during treatment for all , of which some [ 23 , 25 ] support a role for corticosteroids in the development of obesity whereas others do not [ 3 , 9 , 26 ] \n . a recent meta - analysis did not include corticosteroid exposure in its analysis due to the small number of studies with the availability of this data . in our cohort \n we identified a small , albeit significant , effect of cumulative steroid dose during maintenance and bmi . \n there was no interaction between corticosteroid dose and sex and therefore this association does not explain why females who are treated with one year less maintenance therapy compared with males have a higher prevalence of obesity by the end of treatment . \n corticosteroids are widely used for other pediatric illnesses and while their use is associated with side effects such as adrenal suppression and altered bone metabolism [ 2729 ] there are no reports of increased prevalence of obesity in females compared to males due to corticosteroid exposure . \n it is known that cancer survivors who were treated in the 1970s and 1980s are at increased risk of becoming obese with risk persisting well into adulthood . \n children treated for all or brain tumors with high doses of crt are most at risk , especially females or those who were younger at diagnosis [ 30 , 31 ] . increased \n risk of obesity has been associated with crt doses 20 gy or 18 gy . \n various studies have suggested that crt is associated with hypothalamic damage which leads to hyperleptinemia and/or gh deficiency in young adulthood [ 3235 ] . \n however , analysis of cohorts treated since 1990 that include patients exposed to crt does not show an association with crt and increased bmi [ 5 , 8 , 9 ] . \n cranial radiation was not identified as a risk factor for increased bmi in our cohort . \n however , the 15% of the patients that received crt were administered a relatively low ( 1218 gy ) dose compared to earlier studies where over half of the study cohorts received much higher doses of crt . \n further studies are required to elucidate the etiology of obesity in children treated for all on contemporary protocols , in particular why females are more susceptible to the late - effects of treatment compared with males , an effect that is consistent among a variety of cancer diagnoses and treatment protocols . \n the ccg / cog treatment protocols for all typically include one year less maintenance therapy for females compared with males , yet paradoxically they are at an increased risk of obesity , suggesting that treatment regimes per se may not explain the sex difference and that further studies should focus on life style factors in addition to treatment modalities . \n younger age at diagnosis is consistently a risk factor for development of endocrine late - effects of treatment in cancer survivors including obesity . \n one study has reported that children diagnosed with all who were younger than 2.5 years of age were more likely to experience an earlier adiposity rebound which is an important risk factor in adult obesity . \n long - term survivors of all are at risk of elevated abdominal obesity , an atherogenic ldl phenotype , and diabetes . \n additional follow - up of recent cohorts of all survivors beyond the end of treatment and into adulthood may determine incidence of metabolic syndrome and other morbidities . \n recent studies that focus on energy balance through eating behavior and physical activity in all survivors suggest obesity in survivors is a result of both disordered / increased energy intake and reduced physical activity associated with fatigue , with the decrease in physical activity greater for females compared to males [ 42 , 43 ] . \n the strengths of our study include the frequent measurement of heights and weights and analysis by longitudinal modelling . \n thus , female patients in our cohort who received standard risk protocols for all as well as younger males who received standard risk protocols for all were at the greatest risk of becoming obese towards the end of treatment . \n our patient cohort was compared to the raine cohort which is from the same geographical location . \n all children and adolescents diagnosed with all in the state of western australia are treated at pmh and therefore our cohort has 100% ascertainment of the selection criteria for the state . \n we have compared the changes in bmi of our all cohort to both the cdc reference population and the raine cohort which is representative of the western australian population . \n although the mean bmi z - scores were slightly greater in the raine population compared to the cdc reference , the increases in the bmi z - scores of the cohort with all were greater than those observed for children in the raine cohort over the same time frame . \n a third of our patient cohort was born 1015 years after the raine . however , a meta - analysis of trends in the prevalence of childhood overweight and obesity in australia between 1985 and 2008 identified an increase in mean bmi z - score of no more than 0.1 sd units in any 3-year period with no significant differences in the rates of change between boys and girls . \n it seems unlikely therefore that the increases in bmi observed in our patient cohort reflect secular changes in our local population . in conclusion \n , this study has confirmed that there is an increased prevalence of obesity at the end of treatment for childhood all . in the statewide cohort of western australian children \n treated on ccg / cog protocols between 2003 and 2007 , the biological risk factors for increased bmi / obesity during standard risk therapy are younger age at diagnosis and female sex . \n the philosophy of nutritional / dietician support in oncology units concentrates on detecting underweight children and adding high calorie feeds . \n while further data is required to determine the causes of obesity in survivors and the female propensity , our findings support further consideration of appropriate nutrition and energy balance during therapy and empowering of parents to exert control over excess calorie intake in their children with leukemia in the same manner as for their healthy children .", "role": "user" }, { "content": "objective & design . \n we undertook a retrospective review of children diagnosed with acute lymphoblastic leukemia ( all ) and treated with modern cog protocols ( n = 80 ) to determine longitudinal changes in body mass index ( bmi ) and the prevalence of obesity compared with a healthy reference population . \n results . at diagnosis , \n the majority of patients ( 77.5% ) were in the healthy weight category . during treatment , \n increases in bmi z - scores were greater for females than males ; the prevalence of obesity increased from 10.3% to 44.8% ( p < 0.004 ) for females but remained relatively unchanged for males ( 9.8% to 13.7% , p = 0.7 ) . \n longitudinal analysis using linear mixed - effects identified associations between bmi z - scores and time - dependent interactions with sex ( p = 0.0005 ) , disease risk ( p < 0.0001 ) , age ( p = 0.0001 ) , and bmi z - score ( p \n < 0.0001 ) at diagnosis and total dose of steroid during maintenance ( p = 0.01 ) . predicted mean bmi z - scores at the end of therapy were greater for females with standard risk all irrespective of age at diagnosis and for males younger than 4 years of age at diagnosis with standard risk all . \n conclusion . \n females treated on standard risk protocols and younger males may be at greatest risk of becoming obese during treatment for all . \n these subgroups may benefit from intervention strategies to manage bmi during treatment for all .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: gold nanoparticles have found widespread applications in life sciences and attracted significant research interest . in fact \n , the use of aunps has a long history in biology , dating back to the application of immunogold in biological imaging in the 1970 s . in 1996 , mirkin s group and alivisatos group independently reported that aunps - dna conjugates could serve as scaffolds for nanostructures [ 2 , 3 ] . \n by exploiting the unique optical and electronic properties of aunps , mirkin and coworkers later developed a series of novel methods for ultrasensitive detection of dna and proteins [ 48 ] . \n their approaches relied on the modification of aunps with thiolated dna probes , which underwent characteristic red - to - blue color changes during the process of target dna - mediated aggregation of aunps . very recently , li et al . reported an even simpler method for colorimetric detection of target dna by using unmodified aunps \n the mechanism lying behind their strategy is that single - stranded ( ss- ) dna , while not double - stranded ( ds- ) dna , spontaneously binds to unmodified aunps , and effectively stabilizes aunps in solutions of high ionic strength . interestingly , the differentiation ability of aunps between ss- and ds- dna also forms the basis of our recently developed nanoparticle pcr , a novel aunps - enhanced pcr strategy with high selectivity . in view of the wide applicability of aunps , it is important to synthesize high - quality aunps in dna - based biodetection . in certain applications , \n therefore , it is the goal of this work to develop a new approach to synthesize aunps of high quality and high concentration that are appropriate for preparation of dna - aunps conjugates . \n we evaluated the size distribution of synthesized 13-nm aunps via atomic force microscopy ( afm ) . \n as shown in figure 1 , aunps of 3.5 nm synthesized by direct reduction method were almost monodispersed , with a size of 12.5 2.3 nm . in spite of this \n , we still observed a small amount of particles of smaller size as indicated in figure 1a . \n in contrast , aunps of 17 nm prepared from the direct reduction method ( method i ) were poorly dispersed in size ( 14 5 nm ) , containing approximately 30 % large particles . \n we then used the two - step approach ( method ii ) , and found that the size distribution of thus prepared aunps was as good as or even better than that of aunps of 3.5 nm . \n in fact , even the small particles observed in 3.5-nm aunps samples were absent in this centrifugation method . \n we found that the addition of 10 l of 0.1 m pbs to 100 l of aunps prepared from method i resulted in a color change from red to purple ( figure 3 ) . at higher concentrations of salts , aunps became blue colored , suggesting the formation of large aggregation and the shift of spr absorption . \n as shown in figure 4 , the absorption at 520 nm gradually decreased along with the addition of salts . \n in contrast , aunps prepared from method ii were much more resistant to salt - induced aggregation . \n even with 25 l of 0.1 m pbs , aunps remained to be red colored . \n in fact , the characteristic color change was only found after the addition of 80 l of 0.1 m pbs . this significantly increased stability might arise due to the absence of large particles in solution . \n high - concentration aunps are useful for the preparation of dna - aunps conjugates . as shown in figure 5 , after dna self - assembly and centrifuging , dna absorption at 260 nm largely decreased , suggesting the removal of unbound dna , while the thiolated dna remained at the surface of aunps . \n we again found that it was better to use aunps prepared from method ii than from method i. after the formation of dna - aunps , the precipitates from method ii were readily dispersed while those from method i required repetitive tapping . \n in addition , aunps from method i showed slight absorption shift from 520 nm to 522 nm , suggesting the formation of some aggregation . \n we found that the conjugates from method ii were highly stable , which could tolerate salt concentration as high as 2.6 m , while those from method i could only tolerate a solution of 1.5 m nacl . \n more importantly , the storage stability of dna - aunps conjugates prepared from method ii was also much better . as a comparison , the conjugates from method i showed some precipitates only after 7-day storage at 4 c , while those from method ii were stable for at least 30 days . \n in summary , we showed that monodispersed 13-nm aunps were readily synthesized at relatively low concentrations ( e.g. 3.5 nm ) while not at high concentrations ( 17 nm ) . \n we then proposed a two - step approach , i.e. chemical reduction at low concentrations and subsequent centrifugation . \n compared to the direct reduction method , this new two - step method led to aunps with high salt resistance and high stability , which are essential for the preparation of dna - aunps conjugates for biodetection . \n indeed , dna - aunps conjugates prepared from the two - step approach showed much improved stability toward salt - induced aggregation , as well as much longer storage time . \n the thiolated oligonucleotide was obtained from sangon , shanghai , with a sequence of 5-hs - ttttttttttagggtcggaacaggaga-3. haucl4.4h2o ( au content > 47.8 % ) was from national pharmaceutical , china ; sodium citrate was from sangon , shanghai , and all other reagents were of analytical grade . \n uv - vis spectra was performed at a u-3010 uv - vis spectroscopy ( hitachi ) . \n atomic force microscopy was a di nanoscope iiia from veeco instrument co. the synthesis of aunps follows the work of natan and coworkers . for 3.5 nm aunps \n , 100 ml of 0.01 % haucl4 was added to a 250 ml round bottle , and boiled . under rapid stirring \n , 3.5 ml of sodium citrate ( 1 % ) was added and further rapidly stirred for 15 min . \n after stirred for 30-min , the solution was then gradually cooled to room temperature , and was filtered by 0.22 m filter paper . for 17 nm aunps , \n we used two methods , that is , direct reduction method ( method i ) and centrafuging method ( method ii ) . \n method i : 100 ml of 1 mm haucl4 was added to a 250 ml round bottle , and boiled . under rapid stirring \n , 5 ml of 38.8 mm sodium citrate was added and further rapidly stirred for 15 min . \n after stirred for 30 min , the solution was then gradually cooled to room temperature , and was filtered by 0.22 m filter paper . \n method ii : aunps of 3.5 nm was first synthesized by reduction , and then centrifuged to a concentrated solution of 17 nm . we experimentally found that the optimum conditions were centrifuging for 20 min at 4 c , with a rcf of 11930 g. shape , concentration and size - distribution of syntheized aunps were characterized by uv - vis spectroscopy and afm . \n 100 l of aunps ( 17 nm ) from either method i or method ii were challenged by pbs ( 10 mm pb , ph 7.0 , 0.1 m nacl ) of appropriate volumes , respectively . instead , \n dna - aunps conjugates were challenged by a solution of 5 m nacl of appropriate volumes . \n the protocol for the synthesis of dna - aunps conjugates was similar to previously reported . \n aunps of 17 nm were added by thiolate dna , leading to a final concentration of 10 nm . \n after 20-min , a solution of 1 m pbs ( 100 mm pb , ph 7.0 , 1 m nacl ) was gradually added to the solution until the salt concentration reached 0 . \n after that , the solution was centrifuged , and the precipitate was washed by 100 l of 0.1 m pbs . \n this washing process was repeated for three times , and the final product was diluted in 100 l of 0.1 m pbs . \n the thiolated oligonucleotide was obtained from sangon , shanghai , with a sequence of 5-hs - ttttttttttagggtcggaacaggaga-3. haucl4.4h2o ( au content > 47.8 % ) was from national pharmaceutical , china ; sodium citrate was from sangon , shanghai , and all other reagents were of analytical grade . \n uv - vis spectra was performed at a u-3010 uv - vis spectroscopy ( hitachi ) . \n the synthesis of aunps follows the work of natan and coworkers . for 3.5 nm aunps , \n 100 ml of 0.01 % haucl4 was added to a 250 ml round bottle , and boiled . under rapid stirring , 3.5 ml of sodium citrate ( 1 % ) was added and further rapidly stirred for 15 min . \n after stirred for 30-min , the solution was then gradually cooled to room temperature , and was filtered by 0.22 m filter paper . for 17 nm aunps , we used two methods , that is , direct reduction method ( method i ) and centrafuging method ( method ii ) . \n method i : 100 ml of 1 mm haucl4 was added to a 250 ml round bottle , and boiled . under rapid stirring \n , 5 ml of 38.8 mm sodium citrate was added and further rapidly stirred for 15 min . \n after stirred for 30 min , the solution was then gradually cooled to room temperature , and was filtered by 0.22 m filter paper . \n method ii : aunps of 3.5 nm was first synthesized by reduction , and then centrifuged to a concentrated solution of 17 nm . we experimentally found that the optimum conditions were centrifuging for 20 min at 4 c , with a rcf of 11930 g. shape , concentration and size - distribution of syntheized aunps were characterized by uv - vis spectroscopy and afm . \n 100 l of aunps ( 17 nm ) from either method i or method ii were challenged by pbs ( 10 mm pb , ph 7.0 , 0.1 m nacl ) of appropriate volumes , respectively . instead , dna - aunps conjugates were challenged by a solution of 5 m nacl of appropriate volumes . \n the protocol for the synthesis of dna - aunps conjugates was similar to previously reported . \n aunps of 17 nm were added by thiolate dna , leading to a final concentration of 10 nm . \n after 20-min , a solution of 1 m pbs ( 100 mm pb , ph 7.0 , 1 m nacl ) was gradually added to the solution until the salt concentration reached 0 . \n after that , the solution was centrifuged , and the precipitate was washed by 100 l of 0.1 m pbs . \n this washing process was repeated for three times , and the final product was diluted in 100 l of 0.1 m pbs .", "role": "user" }, { "content": "gold nanoparticles ( aunps ) have found widespread applications in life sciences . \n while synthesis of monodispersed aunps has been fairly convenient by using chemical reduction of chloroauric acid by sodium citrate , we found that aunps of high quality and high concentrations were not readily obtained via this method . \n as an example , we showed that monodispersed 13-nm aunps were readily synthesized at relatively low concentrations ( e.g. 3.5 nm ) ; in contrast , 13-nm aunps of 17 nm obtained by the direct reduction method were irregularly shaped and not well dispersed . in this work , we demonstrated that aunps of high concentration could be prepared by a two - step approach , i.e. chemical reduction at low concentrations and subsequent centrifugation . \n compared to the direct reduction method , this new two - step method led to aunps with high salt resistance and high stability , which are essential for the preparation of dna - aunps conjugates for dna biodetection .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: it is a body defense reaction in order to eliminate or limit the spread of injurious agent . \n there are various components to an inflammatory reaction that can contribute to the associated symptoms and tissue injury . \n the complex events and mediators involved in the inflammatory reaction can induce or aggravate many reactions . \n as it is well known , the probiotic bacteria are nonpathogenic and consumed as / with food since a long time . \n the use of probiotic bacteria in dietary supplements or dietary products is widely documented in the literature . \n lactobacillus and its important species like l. casei and l. acidophilus have been used against many pathological and disease conditions . \n lactobacillus is known for its antimicrobial , antilipidemic , immunomodulatory , anticancerous , antidiabetic , and antiarthritic properties [ 310 ] . \n lactobacillus has been assessed for its immunomodulatory properties in different experiments [ 1115 ] . according to the who report , about 7080% of the world 's population \n rely on nonconventional medicine mainly from herbal sources in their primary health care [ 16 , 17 ] . especially , its demand is increasing day by day in developing countries where the cost of consulting a physician and price of medicine are beyond the limit of most people . \n these drugs are anti - inflammatory and used to ease pain in various conditions including : arthritis , muscle , and ligament pains . \n conventional drugs treatments are limited in their effectiveness in managing the incidence and outcome of many inflammatory diseases . \n they also present a significant number of side effects in patients . with these facts taken into account , \n present study was planned to find out the possibility of anti - inflammatory activity of l. casei and l. acidophilus using carrageenan - induced acute inflammatory model . \n lactobacillus acidophilus ( atcc 314 ) and lactobacillus casei ( atcc 334 ) were purchased from hi media , navi mumbai , india . \n lyophilized culture was streaked over de mann rogosa sharpe agar ( mrs ) at 37c in anaerobic condition . \n standard anti - inflammatory drug diclofenac sodium was purchased from recon , bangalore , india . \n cytokines assay kits were purchased from ray biotech , norcross ga , usa and dna bio , hyderabad , andhra pradesh , india . 35 male wistar rats ( 200 gm each ) were used for the present study . \n all the experimental procedures were done following the guidelines of the institutional animals ethics committee ( ieac ) . for the anti - inflammatory activity against the acute inflammation , \n group a ( carrageenan control ) did not receive any oral treatment ; group b ( control ) received 500 l of distilled water ; group c and group d received 2 10 cfu / ml of l. casei and l. acidophilus , respectively , suspended in 500 l of distilled water . \n group e ( positive control ) animals were administered with diclofenac sodium ( 150 mg / kg body weight ) . \n anti - inflammatory activity was measured using carrageenan - induced rat paw edema assay [ 20 , 21 ] . \n edema was induced by subplantar injection of 100 l of 1% freshly prepared solution of carrageenan in distilled water into the right - hind paws of each rat of all the groups except the group a. animals of group b / c , d / e were treated with the single dose of vehicle , cultures , and drug , respectively ; 30 minutes prior to carrageenan injection . \n paw thickness were measured just before the carrageenan injection , that is , at 0 hour and then at 1 , 2 , 3 , 4 , and 24th hour after carrageenan injection . \n increase in paw thickness was measured as the difference in paw thickness at 0 hour and paw thickness at respective hours . \n overnight fasting animals were trained for one week to climb a staircase with steps at 5 , 10 , and 15 cm having water at the second and food at the third step . climbing ability of the rats in above groups was scored 0 if the rats did not climb ; 1 , if the rats climbed onto step 1 ; 2 , if the rats climbed onto step 2 ; 3 , if the rat could climb all the three steps [ 22 , 23 ] . \n the motility pattern of the rats was observed for a period of 5 minutes and scored 0 , if the rat walked with difficulty and avoided touching the toes of the inflamed paw to the floor ; 1 , if the rat walked with little difficulty , but with toe touching the floor ; 2 , if the rat walked easily [ 22 , 23 ] . after 24 hours \n , all animals were sacrificed with cardiovascular bleeding with the help of di ethyl ether according to the guidelines of cpscea committee . \n blood samples were left to coagulate for room temperature for 60 minutes and then centrifuged at 1500 g for 15 minutes and crude serum was kept in new tubes . \n il-10 ( anti - inflammatory cytokines ) and il-6 , tnf- ( proinflammatory cytokines ) in picogram per millilitre ( pg / ml ) were estimated with the help of elisa reader ( lisa plus , germany ) . \n tnf- ( ray bio ) and il-10 ( dna bio ) elisa kits were used . \n the value for edema volume is expressed as mean sem of seven observations and anova followed by post hoc test . \n the stair climbing ability test and motility are expressed as median scores and the kruskal - wallis test was used to compare the groups . \n injection of carrageenan into the hind paw induced a progressive edema reaching its maximum at 4 hours . in case of group a animals paw thickness found at t = 0 was 3.023 0.0408 cm and this remains constant at the end of 24 hours . \n group b animals had showed an increase in paw thickness at each hour which was significant at p < 0.001 . at 0 hours \n the thickness was 3.028 0.040 cm , which increased to 3.59 0.049 cm at t = 3 hours . at 24 hours \n the paw thickness of group c animals was 3 0.028 cm which showed a mild increase at the end of 2nd hour , that is , 3.35 0.0102 cm . \n after the 2nd hour it decreased to 3.04 0.077 cm , 3.014 0.0489 cm , 2.99 0.0053 cm , and 3.014 0.024 cm at the end of 3 , 4 , 5 , and 24 hours , respectively . \n 3.03 0.065 cm thickness was found at the end of third hour , which decreased to 3.0014 0.0024 cm at t = 24 hours . \n so , groups c and d indicated a statistically significant decrease in paw thickness ( p < 0.001 ) . \n group e animals also showed an increase in paw thickness of 3.042 0.077 cm ( t = 0 hours ) , 3.26 0.069 cm ( t = 1 hours ) , 3.22 0.0184 cm ( t = 2 hours ) , and 3.074 0.0762 cm ( t = 3 hours ) . \n it increased after the third hour to 3.174 0.057 cm ( t = 24 hours ) . \n these values were found to be statistically significant at p < 0.001 ( figure 1 ) . \n their stair climbing activity was 0.28 0.244 , while highest score was observed in group a animals at 3 0.00 ( statistically significant ; p < 0.001 ) . \n lactobacillus treatment significantly increased the stair climbing score of 2.57 0.489 and 2.71 0.408 for group c and group d respectively ( significant at p < 0.001 ) . \n group b animal score was lowest in comparison to groups a , c , d , and e animals ( figure 2 ) . walking ability of the rats to climb the staircase at the time of peak inflammation \n group c and group d animals were showing the highest score of 1.42 0.489 ( significant at p < 0.001 ) . \n score for group a animals was 2 0.00 whereas 0.14 0.244 was found in case of group b animals . \n this was found to be the lowest when comparing group e and group b animals ( figure 3 ) . \n serum levels of il-6 and tnf- were highest in group b animals , that is , 70.45 0.266 pg / ml and 669.23 0.050 \n pg / ml , respectively , while this group was showing lowest value of il-10 ( 14.15 0.035 pg / ml ) . on the contrary , \n lactobacillus treatment statistically decreased the il-6 and tnf- in group c and group d at p < 0.0001 . \n lowest value for il-6 was observed in case of group d at 44.505 0.198 \n pg / ml , while lowest value of tnf- was observed for group c at 420.77 0.265 pg / ml . \n group e animals was showing il-6 , tnf- , and il-10 values of 64.60 0.131 pg / ml , 490.52 0.228 \n only il-6 concentration for group e animals was not significant at p < 0.0001 while il-10 and tnf- concentrations were significant at p < 0.0001 ( table 1 ) . \n carrageenan - induced rat paw edema model is a suitable test for evaluating anti - inflammatory drugs , which has frequently been used to assess the antiedematous effect of the drug . \n carrageenan is a strong chemical use for the release of inflammatory and proinflammatory mediators ( prostaglandins , leukotrienes , histamine , bradykinin , tnf- , etc . ) \n first phase starts with the release of histamine , serotonin , and kinins after the injection of phlogistic agent in the first few hours . while the second phase is related to the release of prostaglandins like substances in 2 - 3 hours . \n second phase is sensitive to both the clinically useful steroidal and nonsteroidal anti - inflammatory agent . \n lactobacillus sp might be containing some anti - inflammatory agent which is responsible for the blockage of prostaglandins and inflammatory pathway . \n in this model of inflammation , l. casei and l. acidophilus had very consistent anti - inflammatory activity and thus showed significant decrease in the paw thickness of rat ( group c and group d ) . \n previously , some researchers have also proposed the anti - inflammatory property of lactobacillus in gut [ 2729 ] . although , the cyclooxygenase and lipoxygenase pathways play a pivotal role in the inflammatory process , the inhibition of cyclooxygenase is more effective in inhibiting carrageenan - induced inflammation than lipoxygenase inhibitors . \n oral administration of lactobacillus significantly downregulated the proinflammatory cytokines while upregulated the anti - inflammatory cytokines . \n prostaglandins synthesis is down regulated by anti - inflammatory cytokines like il-10 , il-4 and il-13 , which also check coxygenase-2 synthesis . \n coxygenase-2 is responsible for the increased production of prostaglandins . and hence , l. casei and l. acidophilus overcome the inflammation induced by carrageenan . \n our present findings are consistent with the results of some other workers [ 7 , 3134 ] . \n studies have shown that il-10 has been found as a potent macrophage deactivator , which blocked tnf- , il-1 , il-6 , il-8 , and gm - csf by human monocytes . \n knowledge on the immune - mediated mechanisms in metabolic scenario has markedly increased in the recent past , evidencing the role that dietary components may have to modulate immunity by enhancing or suppressing the immune response . \n for instance , certain strains of probiotics have been demonstrated to be able to modulate the immune system by stimulating release of different patterns of cytokines by different cells . \n it could be able to modify the number of cd4 t cells and actively interfere with anti - inflammatory and proinflammatory signalling pathways by inducing production of il-10 and reducing inf- and tnf- release . \n probiotics modulate both innate and acquired immunity by interacting with indigenous bacteria and/or host mucosal cells to induce or modulate the immune response \n . this can be another possible reason behind its anti - inflammatory property in this study . \n the present results suggest that lactobacillus suppresses the first phase of carrageenan - induced paw edema , thus , confirming an nsaid - like property . \n the present study showed that l. casei and l. acidophilus have both analgesic and anti - inflammatory properties .", "role": "user" }, { "content": "introduction . lactobacillus casei and lactobacillus acidophilus were used to assess the anti - inflammatory properties in carrageenan induced acute inflammatory model . \n materials and methods . \n diclofenac sodium was used as standard drug at concentration of 150 mg / kg of body weight . \n culture of lactobacillus 2 107 cfu / ml was given orally . \n edema was induced with 1% carrageenan to all the groups after one hour of the oral treatments . \n paw thickness was checked at t = 1 , 2 , 3 , 4 , 5 , and 24 hours . \n stair climbing score and motility score were assessed at t = 24 hours . \n cytokines assay for il-6 , il-10 , and tnf- was performed on serum samples . results . \n lactobacillus showed a statistically significant decrease in paw thickness at p < 0.001 . \n l. acidophilus and l. casei decreased by 32% and 28% in paw thickness . \n they both significantly increased the stair climbing and motility score . \n lactobacillus treatment significantly downregulated il-6 and tnf- while upregulated il-10 at p < 0.0001 . \n conclusion . \n l. casei and l. acidophilus significantly decreased the inflammatory reactions induced by carrageenan . \n this study has also proposed that lactobacillus ameliorated the inflammatory reaction by downregulating the proinflammatory cytokines pathway .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: environmental 18s rdna sequences of opisthokonts were obtained from genbank following a two - step screening process . \n second , we used these and other published sequences from cultures or environmental surveys that belong to the target groups ( but are not labeled as such in genbank ) to retrieve additional sequences using blastn . \n maximum likelihood phylogenetic trees were constructed using raxml with the gtrcati model of evolution and with wide taxon coverage , to establish whether ambiguous divergent sequences belonged to a given group . repeated runs on distinct starting trees \n were carried out to select the tree with the best topology ( the most likely of 1,000 alternative trees ) . \n details on the phylogenetic methods are explained elsewhere ( del campo and massana 2011 ) . \n ", "role": "user" }, { "content": "the opisthokonta clade includes metazoa , fungi , and several unicellular lineages , such as choanoflagellates , filastereans , ichthyosporeans , and nucleariids . to date \n , studies of the evolutionary diversity of opisthokonts have focused exclusively on metazoans , fungi , and , very recently , choanoflagellates . \n thus , very little is known about diversity among the filastereans , ichthyosporeans , and nucleariids . to better understand the evolutionary diversity and ecology of the opisthokonts , here we analyze published environmental data from nonfungal unicellular opisthokonts and report 18s ribosomal dna phylogenetic analyses . \n our data reveal extensive diversity among all unicellular opisthokonts , except for the filastereans . \n we identify several clades that consist exclusively of environmental sequences , especially among ichthyosporeans and choanoflagellates . \n moreover , we show that the ichthyosporeans represent a significant percentage of overall unicellular opisthokont diversity , with a greater ecological role in marine environments than previously believed . \n our results provide a useful phylogenetic framework for future ecological and evolutionary studies of these poorly known lineages .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cardia is an ongoing , multicenter , prospective observational study to investigate the evolution of cardiovascular disease risk factors from young adulthood to midlife . in 1985 to 1986 , 5,114 american young adults , aged 1830 years , were recruited from four u.s . \n cities : birmingham , al ; chicago , il ; minneapolis , mn ; and oakland , ca . the sampling scheme was designed to achieve a balance at each site by age ( 1824 and 2530 years ) , sex , ethnicity ( african american and caucasian ) , and education ( high school degree or less and more than high school ) . \n the nail mass was too small to be used in 18 samples . among 4,344 participants with toenail mercury data available , we excluded 31 participants with prevalent diabetes at baseline in 1987 , 36 with no information on key covariates , 191 with insufficient information for defining incident diabetes during follow - up , and 211 women who were pregnant at any exam . \n toenail clippings were collected with a stainless - steel clipper from all 10 toes by the participants themselves during the clinical examination in 1987 and stored at ambient room temperature and humidity . \n all toenail clippings were processed with a washing procedure in a sonicator with deionized water . \n toenail mercury concentrations were assessed by instrumental neutron - activation analysis at the university of missouri - columbia research reactor center ( 10 ) . \n toenail clippings were assayed in random order by laboratory personnel blinded to other clinical measures . \n toenail mercury levels are recognized as excellent biomarkers of long - term mehg exposure and have been used in epidemiological studies ( 1113 ) . \n a study found that spearman correlation coefficient for the reproducibility of toenail levels of mercury was 0.54 over 6 years among 127 u.s . \n fasting blood samples were collected according to standardized cardia procedures and processed at central laboratories ( 9 ) . \n fasting plasma insulin was measured originally by a nonspecific insulin assay at baseline and in later examinations by a new radioimmunoassay ( linco research inc . , \n st . charles , mo ) . to assure comparability of insulin across examinations , sera stored from baseline \n the pearson correlation of log insulin values for baseline by the original ( 15 ) and the new method ( 16 ) was 0.81 . \n fasting glucose was detected by hexokinase method on a cobas mira plus chemistry analyzer ( roche diagnostic systems , montclair , nj ) at each examination ( 14 ) . based on reassays of glucose in 2006 and 2007 in 200 samples per examination drawn at exam years 7 , 10 , 15 , and 20 and of insulin in 100 samples stored since exam year 15 \n recalibrated glucose values were 6.98 + 0.94 year 7 glucose concentrations , 7.15 + 0.96 year 10 glucose concentration , 6.99 + 1.01 year 15 glucose concentration , and 4.06 + 0.97 year 20 glucose concentration . \n homeostasis model assessment ( homa ) of insulin resistance ( homa - ir ) was calculated as follows : glucose ( mmol / l ) insulin ( mu / l)/22.5 . \n homa of -cell function was computed as follows : ( 20 insulin)/(glucose 3.5 ) ( 18 ) . \n hemoglobin a1c was assessed using a tosoh g7 high - performance liquid chromatography instrument ( tosoh bioscience ) at year 20 . \n , participants with one or more of the following were determined to have incident diabetes : 1 ) fasting plasma glucose 7.0 \n mmol / l ; 2 ) nonfasting plasma glucose 11.1 mmol / l ; 3 ) postprandial 2-h plasma glucose 11.1 \n mmol / l from an oral glucose tolerance test ( ogtt ) ; 4 ) hemoglobin a1c 6.5% ; or 5 ) reported use of antidiabetes medications , which were verified by medication names ( 19 ) . \n we could not clearly distinguish diabetes type , because some participants were young at diagnosis and used insulin as treatment . \n therefore , we used the term diabetes rather than type 2 diabetes , although presumably the great majority of participants had type 2 diabetes . demographic variables , including age , sex , ethnicity and education level , were collected through a self - administered questionnaire and verified during clinic examinations . \n smoking status was determined based on self - report , and participants were classified into five groups : never smokers , former smokers , and current smokers ( 04 , 510 , and 11 pack - year ) . \n alcohol consumption was measured by a validated questionnaire and classified into four groups according to total daily intake : 0 ( never drink ) , 0.19.9 , 10.019.9 , or 20 g / day . \n body weight and height were measured in light clothes without shoes during the clinical examination . \n bmi was calculated as weight in kilograms divided by the square of height in meters . \n three measurements of resting systolic and diastolic fifth - phase blood pressures were taken using a random - zero sphygmomanometer . \n physical activity was assessed using the cardia physical activity history questionnaire , an interviewer - administered self - report of frequency of participation in 13 categories of recreational sports , exercise , leisure , and occupational activities over the previous 12 months . \n the physical activity score was calculated in exercise units ( eu ) reflecting the frequency and duration of activity over the previous year . \n a score of 100 eu is roughly equivalent to participation in a vigorous activity 2 to 3 h / week for 6 months of the year ( 2022 ) . \n diet was assessed three times at baseline and years 7 and 20 with an interview - based diet history questionnaire . \n group comparisons of baseline characteristics were performed using anova , kruskal - wallis test , or test as appropriate . \n cox proportional hazards models were used to estimate the hazard ratios ( hrs ) and 95% cis of incident diabetes . \n follow - up time was calculated as the difference between the baseline examination and the year in which diabetes was first identified , the year a participant was censored , or the end of the study . if a case was diagnosed prior to a visit and the exact date could not be determined , the follow - up time was assigned as the midpoint between the current and the previous visit . \n because of limited literature , potential confounders were identified based mainly on statistical tests and our previous knowledge in studying mercury exposure and fish consumption in relation to other health end points . \n we considered several sequential models in the main analysis : model 1 adjusted for age , sex , ethnicity , and study center ; model 2 additionally adjusted for bmi ; model 3 further adjusted for other major lifestyle variables , including education , family history of diabetes , smoking status , alcohol consumption , and physical activity ; and models 46 additionally adjusted for intake of long - chain n-3 polyunsaturated fatty acid fatty acids ( lcn-3pufas ) , magnesium , and toenail selenium sequentially . \n these three nutrients were selected because they concentrate in fish ( 25 ) and have been related to diabetes risk ( 26 ) . \n a continuous variable using the median mercury concentration in each quintile was created for trend tests . \n moreover , we tested for possible interactions between toenail mercury levels and preidentified potential - effect modifiers by adding corresponding multiplicative interaction terms in the models , followed by the likelihood ratio test . \n we also stratified data according to these variables to determine whether they modified the associations . \n furthermore , because the cutoff point of fasting glucose for defining diabetes was changed from 140 to 126 mg / dl in 1997 , we used a cutoff point of 140 mg / dl at exam years before 1997 in a sensitivity analysis to test the robustness of our results . \n in addition , we examined the association between toenail mercury concentrations and fasting insulin , glucose , homa - ir , and homa of -cell function . a logarithmic transformation was used to improve the normality of the distribution of these parameters . since fasting insulin and glucose were measured multiple times , generalized estimating equations with exchangeable correlation structure for simplicity were used . \n all analyses were performed with sas ( version 9.2 ; sas institute , cary , nc ) . \n cardia is an ongoing , multicenter , prospective observational study to investigate the evolution of cardiovascular disease risk factors from young adulthood to midlife . in 1985 to 1986 , 5,114 american young adults , aged 1830 years , were recruited from four u.s . \n cities : birmingham , al ; chicago , il ; minneapolis , mn ; and oakland , ca . the sampling scheme was designed to achieve a balance at each site by age ( 1824 and 2530 years ) , sex , ethnicity ( african american and caucasian ) , and education ( high school degree or less and more than high school ) . \n the nail mass was too small to be used in 18 samples . among 4,344 participants with toenail mercury data available , we excluded 31 participants with prevalent diabetes at baseline in 1987 , 36 with no information on key covariates , 191 with insufficient information for defining incident diabetes during follow - up , and 211 women who were pregnant at any exam . \n toenail clippings were collected with a stainless - steel clipper from all 10 toes by the participants themselves during the clinical examination in 1987 and stored at ambient room temperature and humidity . \n all toenail clippings were processed with a washing procedure in a sonicator with deionized water . \n toenail mercury concentrations were assessed by instrumental neutron - activation analysis at the university of missouri - columbia research reactor center ( 10 ) . \n toenail clippings were assayed in random order by laboratory personnel blinded to other clinical measures . \n toenail mercury levels are recognized as excellent biomarkers of long - term mehg exposure and have been used in epidemiological studies ( 1113 ) . \n a study found that spearman correlation coefficient for the reproducibility of toenail levels of mercury was 0.54 over 6 years among 127 u.s . \n fasting blood samples were collected according to standardized cardia procedures and processed at central laboratories ( 9 ) . \n fasting plasma insulin was measured originally by a nonspecific insulin assay at baseline and in later examinations by a new radioimmunoassay ( linco research inc . , \n st . charles , mo ) . to assure comparability of insulin across examinations , sera stored from baseline \n the pearson correlation of log insulin values for baseline by the original ( 15 ) and the new method ( 16 ) was 0.81 . \n fasting glucose was detected by hexokinase method on a cobas mira plus chemistry analyzer ( roche diagnostic systems , montclair , nj ) at each examination ( 14 ) . based on reassays of glucose in 2006 and 2007 in 200 samples per examination drawn at exam years 7 , 10 , 15 , and 20 and of insulin in 100 samples stored since exam year 15 \n recalibrated glucose values were 6.98 + 0.94 year 7 glucose concentrations , 7.15 + 0.96 year 10 glucose concentration , 6.99 + 1.01 year 15 glucose concentration , and 4.06 + 0.97 year 20 glucose concentration . \n . homeostasis model assessment ( homa ) of insulin resistance ( homa - ir ) was calculated as follows : glucose ( mmol / l ) insulin ( mu / l)/22.5 . \n homa of -cell function was computed as follows : ( 20 insulin)/(glucose 3.5 ) ( 18 ) . \n hemoglobin a1c was assessed using a tosoh g7 high - performance liquid chromatography instrument ( tosoh bioscience ) at year 20 . \n at any follow - up examination , participants with one or more of the following were determined to have incident diabetes : 1 ) fasting plasma glucose 7.0 \n mmol / l from an oral glucose tolerance test ( ogtt ) ; 4 ) hemoglobin a1c 6.5% ; or 5 ) reported use of antidiabetes medications , which were verified by medication names ( 19 ) . \n we could not clearly distinguish diabetes type , because some participants were young at diagnosis and used insulin as treatment . \n therefore , we used the term diabetes rather than type 2 diabetes , although presumably the great majority of participants had type 2 diabetes . \n demographic variables , including age , sex , ethnicity and education level , were collected through a self - administered questionnaire and verified during clinic examinations . \n smoking status was determined based on self - report , and participants were classified into five groups : never smokers , former smokers , and current smokers ( 04 , 510 , and 11 pack - year ) . \n alcohol consumption was measured by a validated questionnaire and classified into four groups according to total daily intake : 0 ( never drink ) , 0.19.9 , 10.019.9 , or 20 g / day . \n body weight and height were measured in light clothes without shoes during the clinical examination . \n bmi was calculated as weight in kilograms divided by the square of height in meters . \n three measurements of resting systolic and diastolic fifth - phase blood pressures were taken using a random - zero sphygmomanometer . \n physical activity was assessed using the cardia physical activity history questionnaire , an interviewer - administered self - report of frequency of participation in 13 categories of recreational sports , exercise , leisure , and occupational activities over the previous 12 months . \n the physical activity score was calculated in exercise units ( eu ) reflecting the frequency and duration of activity over the previous year . \n a score of 100 eu is roughly equivalent to participation in a vigorous activity 2 to 3 h / week for 6 months of the year ( 2022 ) . \n diet was assessed three times at baseline and years 7 and 20 with an interview - based diet history questionnaire . \n group comparisons of baseline characteristics were performed using anova , kruskal - wallis test , or test as appropriate . \n cox proportional hazards models were used to estimate the hazard ratios ( hrs ) and 95% cis of incident diabetes . \n follow - up time was calculated as the difference between the baseline examination and the year in which diabetes was first identified , the year a participant was censored , or the end of the study . \n if a case was diagnosed prior to a visit and the exact date could not be determined , the follow - up time was assigned as the midpoint between the current and the previous visit . because of limited literature , potential confounders were identified based mainly on statistical tests and our previous knowledge in studying mercury exposure and fish consumption in relation to other health end points . \n we considered several sequential models in the main analysis : model 1 adjusted for age , sex , ethnicity , and study center ; model 2 additionally adjusted for bmi ; model 3 further adjusted for other major lifestyle variables , including education , family history of diabetes , smoking status , alcohol consumption , and physical activity ; and models 46 additionally adjusted for intake of long - chain n-3 polyunsaturated fatty acid fatty acids ( lcn-3pufas ) , magnesium , and toenail selenium sequentially . \n these three nutrients were selected because they concentrate in fish ( 25 ) and have been related to diabetes risk ( 26 ) . \n a continuous variable using the median mercury concentration in each quintile was created for trend tests . \n moreover , we tested for possible interactions between toenail mercury levels and preidentified potential - effect modifiers by adding corresponding multiplicative interaction terms in the models , followed by the likelihood ratio test . \n we also stratified data according to these variables to determine whether they modified the associations . furthermore , because the cutoff point of fasting glucose for defining diabetes was changed from 140 to 126 mg / dl in 1997 , we used a cutoff point of 140 mg / dl at exam years before 1997 in a sensitivity analysis to test the robustness of our results . \n in addition , we examined the association between toenail mercury concentrations and fasting insulin , glucose , homa - ir , and homa of -cell function . \n a logarithmic transformation was used to improve the normality of the distribution of these parameters . since fasting insulin and glucose were measured multiple times , generalized estimating equations with exchangeable correlation structure for simplicity were used . \n all analyses were performed with sas ( version 9.2 ; sas institute , cary , nc ) . \n the median values of toenail mercury across quintiles were 0.073 , 0.139 , 0.213 , 0.332 , and 0.607 g / g ( table 1 ) . compared with those in the lowest quintile of toenail mercury , participants in the highest quintile were slightly older , were more likely to be females and caucasians , exercised more , had a higher education level , had higher toenail selenium levels , had lower bmi and waist circumference , were less likely to be current smokers , and had slightly lower fasting insulin levels . \n in addition , participants with higher mercury exposure consumed more alcohol , fish , lcn-3pufas , and magnesium . \n baseline characteristics by toenail mercury levels ( quintiles ) : the cardia trace element study , 19872005 ( n = 3,875 ) during the 18 years of follow - up , 288 participants developed diabetes , including 193 case subjects identified by fasting criteria and 3 , 35 , 25 , and 32 case subjects determined by nonfasting glucose , 2-h glucose after ogtt , hemoglobin a1c , and antidiabetes medication use criteria , respectively . \n after adjustment for demographic and major lifestyle variables , especially bmi , a statistically nonsignificant positive association was found ( table 2 ) . \n after further adjustment for intake of lcn-3pufas and magnesium and for toenail selenium , the observed positive association became statistically significant . \n compared with those in the lowest quintile of toenail mercury levels , the fully adjusted hr ( 95% ci ) for participants in the highest quintile was 1.65 ( 1.072.56 ; p for trend = 0.02 ) . \n multivariable - adjusted hrs and 95% cis of diabetes according to quintiles of toenail mercury levels in sensitivity analyses , we considered other potential dietary and nondietary confounders in the analyses , we substituted waist circumference for bmi in the models , and we used different definitions of diabetes based on the time period of the examination . \n our results were essentially the same as findings from the primary analysis ( data not shown ) . \n in stratified analyses according to a few prespecified factors , the observed association between mercury exposure and diabetes risk was not appreciably modified by sex , bmi ( normal weight or overweight ) , ethnicity ( african american or caucasian ) , or selenium concentration ( below or above median ) . \n intake of lcn-3pufas or magnesium above the median appeared to attenuate the potential effect of mercury exposure on diabetes risk ( data not shown ) . nonetheless , the tests for interactions were only marginally significant ( p for interaction is 0.08 for lcn-3pufas and 0.15 for magnesium ) \n . to explore the potential mechanisms , we investigated the associations between toenail mercury concentrations and fasting plasma glucose and insulin levels and homa - ir score , as well as homa of -cell function index , excluding those under diabetes treatment and those whose fasting time was < 8 h ( fig . \n higher mercury exposure was associated with elevated fasting glucose and insulin levels , increased homa - ir , and decreased homa of -cell function index , but only the association with homa of -cell function index showed a significant linear trend . \n multivariable - adjusted associations between toenail mercury levels and fasting glucose and insulin levels , homa - ir , and homa of -cell function ( homa- ) . \n participants were excluded if they were on diabetes medication and fasting levels were < 8 h. all of the models were constructed by using generalized estimating equations . \n results were adjusted for the covariates listed for model 6 in table 2 plus measurement occasions ( indictor variables ) and baseline values of outcome of interest ( continuous ) . \n ( a high - quality color representation of this figure is available in the online issue . ) \n in this prospective cohort study , mercury exposure measured in toenails was associated with increased incidence of diabetes in a dose - response manner among american young adults . \n this association was evident only after adjustment for demographic , major lifestyle , and dietary factors , particularly bmi and intake of long - chain n-3 fatty acid and magnesium . \n results from this study also suggest that high mercury exposure may be associated with pancreatic islet -cell dysfunction . \n both in vitro and in vivo studies ( 6,7 ) found that mehg exposure , at a level similar to that in some seafood , significantly decreased cell viability in the pancreatic -cell line and caused pancreatic islet -cell dysfunction , which may lead to diabetes development ( 1 ) . \n in particular , laboratory studies demonstrated that islet -cell function and survival was affected by mercury exposure through an oxidative stress pathway ( 6,7 ) . in mouse models , \n even low - dose mercury exposure caused pancreatic islet -cell dysfunction by inducing oxidative stress and phosphatidylinositol 3-kinase activation ( 7 ) . \n also , mehg was observed to induce oxidative stress triggered -cell apoptosis and death ( 6 ) . \n in addition , a study found that 8-hydroxy-2-deoxyguanosine , a biomarker of oxidative dna damage , was significantly higher in urine samples of mercury - exposed persons compared with control subjects ( 27 ) . \n human data relating mercury exposure to diabetes are sparse , and the results were contradictory . a study conducted in japan reported that mercury levels in hair from patients including patients with diabetes were considerably higher than that of healthy people of the same age groups ( 28 ) . \n this finding was in agreement with results from studies conducted in turkey ( 29 ) and mexico ( 30 ) , but was not consistent with another japanese survey in which the prevalence of diabetes among people living in an mehg - polluted area was not increased ( 31 ) . \n in a recent study conducted in taiwan ( 32 ) , blood mercury concentrations were significantly associated with homa - ir and homa of -cell function index . \n in addition , a study conducted in korea reported that hair mercury levels in patients with metabolic syndrome were significantly higher than those in normal control subjects ( 33 ) . \n our investigation provides evidence from a human study supporting that mercury exposure at young adulthood may be longitudinally associated with increased risk of diabetes and pancreatic islet -cell dysfunction . of note \n , mehg is a major contaminant in some fish , and toenail mercury concentration is generally correlated with fish consumption . while lcn-3pufas , largely derived from fish consumption , are considered to be the key nutrients responsible for the potential benefits of fish intake , fish is also a good dietary source of selenium and magnesium . \n it is likely that the overall health impact of fish consumption may reflect the interactions of nutrients and contaminants in fish ( 34 ) . \n thus , studying any of these nutrients and contaminants such as mercury should consider confounding from other components in fish . in the current study , the association between mercury exposure and diabetes incidence \n although the existing literature is inconsistent , some studies suggest that lcn-3pufas are beneficial to glucose metabolism ( 35,36 ) , which may lead to reduced risk of diabetes . \n in addition , a body of evidence suggests that magnesium intake is significantly inversely related to diabetes risk ( 26 ) . \n hence , a possible association between mercury exposure and risk of diabetes can be attenuated or masked by lcn-3pufas and/or magnesium and vice versa . \n recent meta - analyses found that fish consumption was not associated with risk of diabetes ( 37,38 ) . \n thus , the possibility of a null association between fish and diabetes biased by mercury exposure could not be excluded . \n moreover , the association between selenium and diabetes is still not quite clear . in the current study , \n in addition to a large cohort of young adults and a long - term prospective follow - up period , a few strengths of our study need to be highlighted . \n mercury exposure was measured in toenails using instrumental neutron - activation analysis , which is considered as a reliable objective biomarker reflecting relatively long - term exposure ( 12,13 ) . also , we defined diabetes cases based mainly on fasting and postprandial glucose levels from an ogtt and hemoglobin a1c measurements in addition to a self - reported questionnaire . \n furthermore , we longitudinally measured fasting insulin levels , which enable us to calculate homa - ir and homa of -cell function over 18 years of follow - up and explore potential pathophysiological mechanisms linking mercury exposure to diabetes risk . \n similar to other observational studies , the possibility of confounding from unknown or unmeasured factors including other pollutants ( e.g. , polychlorinated biphenyl ) can not be completely excluded . \n however , the likelihood should be small that our results were largely explained by confounding , given our extensive data analysis , consistent findings in sensitivity analyses , and the supportive biological mechanisms . \n in fact , the baseline data indicated that participants in the highest quintile of toenail mercury levels , presumably due to higher fish consumption , had a relatively healthy lifestyle . \n for example , they had lower bmi and waist circumference , exercised more , and were less likely to be current smokers . \n in addition , our capability to further explore the effect modifications was limited by the relatively small number of cases . \n finally , the generalizability may be limited since the young adult cohort was recruited from urban areas . \n however , there is little evidence that biological effects of mehg in this study population would be different from those in the general population . in summary \n , this prospective cohort study provides evidence supporting that high mercury exposure may affect pancreatic islet -cell function and lead to elevated risk of diabetes among american young adults . \n the potential adverse effect of mercury exposure , presumably derived from diet , may be attenuated by other nutrients , in particular lcn-3pufas and magnesium .", "role": "user" }, { "content": "objectivelaboratory studies suggest that exposure to methylmercury at a level similar to those found in fish may induce pancreatic islet -cell dysfunction . \n few , if any , human studies have examined the association between mercury exposure and diabetes incidence . \n we examined whether toenail mercury levels are associated with incidence of diabetes in a large prospective cohort.reseach design and methodsa prospective cohort of 3,875 american young adults , aged 2032 years , free of diabetes in 1987 ( baseline ) , were enrolled and followed six times until 2005 . \n baseline toenail mercury levels were measured with instrumental neutron - activation analysis . \n incident diabetes was identified by plasma glucose levels , oral glucose tolerance tests , hemoglobin a1c levels , and/or antidiabetes medications.resultsa total of 288 incident cases of diabetes occurred over 18 years of follow - up . in multivariate analyses adjusted for age , sex , ethnicity , study center , education , smoking status , alcohol consumption , physical activity , family history of diabetes , intakes of long - chain n-3 fatty acids and magnesium , and toenail selenium , toenail mercury levels \n were positively associated with the incidence of diabetes . \n the hazard ratio ( 95% ci ) of incident diabetes compared the highest to the lowest quintiles of mercury exposure was 1.65 ( 1.072.56 ; p for trend = 0.02 ) . \n higher mercury exposure at baseline was also significantly associated with decreased homeostasis model assessment of -cell function index ( p for trend < 0.01).conclusionsour results are consistent with findings from laboratory studies and provide longitudinal human data suggesting that people with high mercury exposure in young adulthood may have elevated risk of diabetes later in life .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: as the ebola virus disease ( evd ) outbreak in west africa of 2013 continues ( 1 ) , public health and emerging infectious disease officers have declared a state of emergency ( 2 ) . as of 8 january 2015 \n , the mean lethality in this outbreak , caused by ebola virus ( ebov ) , reached 39.4% ( http://www.who.int/csr/don/archive/disease/ebola/en/ ) . \n another study , utilizing different methods , calculated the real case fatality rate at 70% ( 3 ) . \n the uncontrolled situation in the outbreak area , now spread over six west african countries , and the risk of further ebov exportation beyond the african continent prompted the world health organization to adopt emergency containment measures . among them \n is the testing of as - yet - unapproved medical countermeasures in the affected human population ( 47 ) . at the moment \n , there are three treatment modalities directly based on the ebov genomic sequence that have been explored for postexposure treatment of evd with encouraging results in nonhuman - primate models : small interfering rnas ( sirnas ) ( 8) and phosphorodiamidate morpholino oligomers ( pmos ) ( 9 ) targeting ebov genome l , vp24 , and/or vp35 gene transcripts and passive immunotherapy based on antibodies or antibody cocktails targeting ebov epitopes ( 1014 ) . \n briefly , they inhibit viral replication by either targeting viral transcripts for degradation ( sirna ) , by blocking translation ( pmo ) , or by acutely neutralizing the virus to allow the host to mount an effective immune response against the pathogen ( passive immunotherapy ) . the binding sites for antisense therapeutics based on sirnas and pmos \n all of them were designed specifically against sequences derived from the ebov variant causing an evd outbreak around yambuku , zaire ( present - day democratic republic of the congo ) , in 1976 ( ebola virus / h.sapiens - tc / cod/1976/yambuku - mayinga ; short name , ebov / yam - may ; refseq no . \n all monoclonal antibodies used for passive immunotherapy were generated against the glycoprotein of the ebov variant causing an evd outbreak in kikwit , zaire , in 1995 ( ebola virus / h.sapiens - tc / cod/1995/kikwit-9510621 ; short name , ebov / kik-9510621 ; genbank no . \n coimmunoprecipitation assays were performed against broad domains of the glycoprotein to identify binding targets of conformational antibodies ( 18 , 19 ) . \n table 1 summarizes publicly available information ( 812 , 15 , 18 , 19 ) for the three treatment types , including therapeutic targeting and efficacy in postinoculation treatment of experimental ebov infection in animals . \n all postexposure studies evaluating these therapeutics were completed using ebov / kik-9510621 as the challenge virus . \n summary of binding and postexposure efficacy data available for ebov therapeutics mab , monoclonal antibody ; na , not applicable ; p.i . \n survival range is dependent on addition of ad - ifn ( interferon co - treatment ) to treatment 1 day p.i . \n cross - reacts with tafv ( tai forest virus ) and sudv ( sudan virus ) gp . for this study , we reviewed all publicly available genomic information for the ebola virus makona variant ( ebov / mak ) causing the 20132014 west african outbreak ( 102 genomic sequences ) ( 1 , 20 , 21 ) and assessed the potential of the observed ebov / mak genetic drift relative to ebov / yam - may and ebov / kik-9510621 to affect each therapeutic . when ebov / mak was compared against ebov / kik-9510621 , a total of 640 ( 3.38% of the genome ) single - nucleotide polymorphisms ( snps ) \n were identified ( 327 synonymous , 76 nonsynonymous , and 237 noncoding ) , whereas when it was compared against ebov / yam - may , a total of 603 ( 3.18% of the genome ) snps were identified ( 297 synonymous , 80 nonsynonymous and 226 noncoding ) . \n four mutations are located in the published binding region of the sirna- or pmo - based therapeutics , and 21 induce nonsynonymous changes to epitopes recognized by monoclonal antibodies in passive immunotherapy cocktails . \n figure 1 combines an snp table with a heat map that outlines the potential of each snp to affect the efficacy of available therapeutics . the column designated \n % ebov - wa stratifies changes by the number of west african sequences that support each mutation . \n changes that are present in all sequences obtained from west africa are considered interoutbreak ; changes that are observed in only some sequences from the west african outbreak are considered intraoutbreak \n ( i.e. , ebov - wa represents < 100% of the population at the specified position ) . \n of the 28 sites observed within binding regions , 3 snps ( 21.4% ) evolved during the 20132014 evd outbreak ( intraoutbreak ) , whereas 22 snps ( 78.6% ) evolved prior to the outbreak ( interoutbreak ) . \n none of the specific snps presented here have been previously associated with ebov resistance to any therapeutic ; however , there is a general lack of information surrounding the appearance of viral resistance to ebov therapeutics compared to viral systems like influenza virus and hiv due to the limitations of gain - of - function experiments . \n eighteen of the changes have been demonstrated to be tolerated by the zmapp cocktail ( 13c6 , 4g7 , and 2g4 ) , which demonstrated an increased binding affinity to the ebov / mak glycoprotein sequence ( 12 ) , thus minimizing the potential impact of the mutations . \n nevertheless , some of the intraoutbreak changes observed in this region still need to be evaluated . \n the changes observed in the west african sequences that are already represented in ebov / yam - may are also listed as tolerated ( yellow ) , as the therapeutics discussed here have had testing completed with both viruses or mouse / guinea pig - adapted version of the virus and are not different between ebov / yam - may and ebov / mak ( 19 , 2224 ) . \n the other ten mutations , affecting the binding sites of mab 13f6 , mab 6d8 ( part of mb-003 ) , mab 13c6 ( part of mb-003 and zmapp ) , mab 1h3 ( part of zmab ) , and sirna ek-1 , vp24 , and vp35 targets , might influence the binding efficacy of the sequence - based therapeutics ; their efficacy should be tested against the currently circulating strain ( fig . 2 ) . \n an snp table is combined with a heat map based on three categories : ( i ) mutation shown to be tolerated by the therapeutic ( 10 ) , ( ii ) mutations that are within the binding region of the therapeutic but have not been tested ( 812 , 15 , 18 , 19 ) , and ( iii ) tolerated diversity between development strains . \n % ebov - wa , percentage of genomes containing a change in the west african ( wa ) sequences of 2014 from ebov / kik-9510621 . \n each of the therapeutics was mapped onto the genome of ebov / kik-9510621 according to published binding information . \n red vertical bars denote nonsynonymous mutations , blue vertical bars represent synonymous mutations , and green vertical bars represent noncoding mutations . closing this gap might be critical to ongoing efforts to control the outbreak . a robust genomics screening , pre- and post - treatment , would allow clinicians to make informed choices in treatment regimen as well as clarify what signs of viral resistant development should be tracked . \n ( i ) this analysis is limited to the binding regions of candidate therapeutics , yet deleterious changes may not be limited to these regions . \n ( ii ) changes in the binding regions may be well tolerated and not influence therapeutic efficacy . \n ( iii ) as ebov / mak genomes from humans treated with these therapeutics have not yet been determined , conclusions about intrahost selection pressure can not be made at this stage . \n it is also important to note that some of the therapeutics have been deliberately designed to be tolerant to possible target mutation : for instance , sirnas and pmos were targeted to areas of higher conservation where mutation was thought to be unlikely ( based mainly on conservation on all available ebov sequences at the time of design ) , and monoclonal antibody cocktails were designed to include several antibodies that bind to distinct regions of the ebov glycoprotein ( 18 , 19 ) . \n this multitarget development may ensure that multiple genetic bottlenecks are present to minimize the impact of individual mutations of an evolving ebov variant . in summary , \n the information presented here offers a concise evaluation of the potential impact of the evolutionary drift of ebola virus makona in the development of sequence - based therapeutics based on sequence information available in september 2014 . \n given the ongoing continued person - to - person transmission , it is imperative that more current isolates be sequenced and evaluated in a similar manner . \n ", "role": "user" }, { "content": "abstract until recently , ebola virus ( ebov ) was a rarely encountered human pathogen that caused disease among small populations with extraordinarily high lethality . at the end of 2013 , ebov initiated an unprecedented disease outbreak in west africa that is still ongoing and has already caused thousands of deaths . \n recent studies revealed the genomic changes this particular ebov variant undergoes over time during human - to - human transmission . \n here we highlight the genomic changes that might negatively impact the efficacy of currently available ebov sequence - based candidate therapeutics , such as small interfering rnas ( sirnas ) , phosphorodiamidate morpholino oligomers ( pmos ) , and antibodies . \n ten of the observed mutations modify the sequence of the binding sites of monoclonal antibody ( mab ) 13f6 , mab 1h3 , mab 6d8 , mab 13c6 , and sirna ek-1 , vp24 , and vp35 targets and might influence the binding efficacy of the sequence - based therapeutics , suggesting that their efficacy should be reevaluated against the currently circulating strain .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: resistant hypertension ( rh ) is defined when blood pressure remains high ( 140 90 mm hg ) despite the use of three antihypertensive drug classes , including a diuretic and all prescribed in appropriate doses . \n in addition , the blood pressure controlled with the use of four or more medications is also considered rh . \n since these patients are under greater risk of presenting reversible and/or secondary causes of hypertension , they may be benefited by therapeutical approach for this diagnosis . \n it is important to know the difference between arterial hypertension ( ah ) , noncontrolled , and rh because the first one includes patients with low adherence to treatment or under inappropriate treatment . \n although its prevalence is not known for sure , it is a common clinical problem mainly due to the increase in life expectancy and the prevalence of chronic diseases such as diabetes , obesity , and kidney disease . according to the vi brazilian guidelines of ah \n , a brazilian study revealed that 59.1% of adult individuals are known to be hypertensive ; 67.3% of them were in treatment and only 26.1% had their blood pressure controlled ( 140 90 mm hg ) . \n the same source also highlights that approximately 70.6% of deaths in 2007 in brazil were a result of cardiovascular disease and stroke which was the leading cause of death throughout the country . \n the ah is an important risk factor to the development of cardiovascular diseases and complications like cerebral vascular disease , coronary artery disease , heart failure , chronic kidney disease and peripheral vascular disease . in this context , it is estimated that 40% of the deaths by stroke are secondary to ah , as well as 25% of the deaths by coronary artery disease . \n the prognosis of patients with rh compared with patients with ah easily controlled was specifically evaluated in a recent study that demonstrated a higher cardiovascular risk among rh patients . \n however considering the significant reduction of the risk achieved with the effective treatment of ah , it is estimated that the effective control of rh promotes more significant benefits . \n it is a condition of multifactorial origin including genetic factors , lifestyle , use of certain drugs , and secondary causes , namely , obstructive sleep apnea , primary hyperaldosteronism , cushing 's syndrome , pheochromocytoma , renal parenchymal disease , renal artery stenosis , hypothyroidism , hyperthyroidism , acromegaly , hyperparathyroidism , and aortic coarctation . \n as has been shown in the literature and in medical practice , the rh is a relevant clinical problem found in the general population . \n given the risk that the maintenance of very high blood pressure represents for the development of diseases with significant mortality , it is assumed that the rh increases the susceptibility to these conditions , exposing the resistant hypertensives to a higher risk . \n furthermore , in this set of patients , we can identify a unique opportunity to prevent diseases associated with ah . \n however , the rh is currently little studied , is necessary and more knowledge of this clinical condition in order to improve the prognosis of its bearers . \n in addition , this is a study of resistant hypertension in a brazilian population that is an emergent country . \n these reports from this kind of population are uncommon in the literature . in view of the assumptions made above \n , we proposed the analysis of specific causes of rh by using a standardized protocol in brazilian patients diagnosed in a center for evaluation and treatment of hypertension . \n the current study has monitored patients diagnosed with resistant hypertension treated by a university center for management of ah ( cha ) in botucatu medical school ( botucatu sp brazil ) . \n the management of these patients was conducted in an outpatient resistant hypertension clinic linked to cha , with application of a preformulated protocol which aimed at the identification of the causes of resistant hypertension in each patient through the management standardization ( figure 1 ) . \n the clinical protocol was composed of.ambulatory blood pressure monitoring ( abpm ) to the exclusion of pseudo - resistance by white coat effect.measurement of arterial stiffness by evaluation of aortic pulse wave velocity , central blood pressure measurement , and augmentation index.analysis of proteinuria urinary sediment and estimation of glomerular filtration rate to check the presence of parenchymatous renal disease.perform a clinical score of renovascular disease .verification of lifestyle factors : quantifying 24 hours urinary sodium ; calculation of body mass index ( bmi ) ; survey of hypertensive drugs use ; application of questionnaires of compliance ( morisky survey ) and obstructive sleep apnea ( berlin questionnaire ) [ 57 ] ; reminder of daily intake of alcohol and application of cage questionnaire [ 8 , 9].tsh and t4 dosage for search of hyper and hypothyroidism.determination of renin , aldosterone , and adrenal tomography for the investigation of primary aldosteronism when applicable . \n ambulatory blood pressure monitoring ( abpm ) to the exclusion of pseudo - resistance by white coat effect . \n measurement of arterial stiffness by evaluation of aortic pulse wave velocity , central blood pressure measurement , and augmentation index . \n analysis of proteinuria urinary sediment and estimation of glomerular filtration rate to check the presence of parenchymatous renal disease . \n verification of lifestyle factors : quantifying 24 hours urinary sodium ; calculation of body mass index ( bmi ) ; survey of hypertensive drugs use ; application of questionnaires of compliance ( morisky survey ) and obstructive sleep apnea ( berlin questionnaire ) [ 57 ] ; reminder of daily intake of alcohol and application of cage questionnaire [ 8 , 9 ] . \n determination of renin , aldosterone , and adrenal tomography for the investigation of primary aldosteronism when applicable . \n when identified the source of resistance , the necessary adjustments were made in the treatment of these patients aiming the at improvement of their condition . \n continuous variables of parametric distribution were expressed as mean standard deviation and of nonparametric distribution in median ( first quartile and third quartile ) . \n eighty - six out of 209 patients from the outpatient hypertension clinic had resistant hypertension criteria , and 30 of them agreed to participate in this study . \n these thirty patients assessed were composed by seven male and twenty - three females , of whom six afrodescendants and twenty - four whites . \n the patients had a weight of 84 21.1 kg and 162 11.0 cm high , resulting in a bmi of 32 5.6 kg / m , 36 of them had a bmi over and 30 kg / m . \n the abpm systolic blood pressure ( sbp ) was 145 19.9 mm hg , and diastolic blood pressure ( dbp ) was 87 13.4 mm hg . \n the office sbp was 147 19.4 mm hg , while the office dbp was 14.1 90 mm hg . \n the sleep sbp was 139 22.4 mm hg , and the sleep dbp was 11.8 79 mm hg . the dip of sbp was 0.05 0.10 , and the dip of dbp was 0.11 0.10 during sleep . \n the percentage of nondipper patients was 31% dipper for sbp and was 44% dipper for dbp . \n used antihypertensive classes were calcium channel blockers in 64% ; converting enzyme inhibitors in 63% of patients ; angiotensin ii antagonist in 43% ; converting enzyme inhibitors or angiotensin ii antagonist or aliskiren in 96% ; beta - blockers in 36% ; alfa-2 adrenergic agonist in 36% ; spironolactone in 32% ; vasodilators in 11% ; aliskiren in 0.04% . \n after the beginning of this study , all the patients became adherent to the drug treatment , but only two of them had achieved an adequate blood pressure control . \n so , only two patients had pseudoresistance , which shows the representativeness of our approach . \n the application of berlin questionnaire pointed out a frequency of 44% patients with high risk of obstructive sleep apnea , and they were referred for expert evaluation . \n eighty percent of the patients presented either low compliance or high risk for sleep apnea . \n the application of cage questionnaire , referring to use of alcohol , obtained only a positive response . \n eight patients used hypertensive drugs four of these used chronically diclofenac , and one of them associated sibutramine with amfepramone . among patients who made use of hypertensive drugs , \n two patients presented a score higher than 10 points in the renovascular disease score ; these patients were referred to hemodynamic assessment . \n this patient was confirmed as having renal vascular disease in hemodynamic assessment . among the laboratory tests performed , the 24 hours urinary was 204.41 98.79 meq/24 h. the excretion of sodium in 24 hours was above 150 meq/24 h in 53% of patients , and \n only one patient presented sodium excretion less than 100 meq/24 h. the urinalysis pointed a proteinuria frequency of 7 in 30 patients . \n the 24 hours proteinuria was 0.35 0.66 g/24 h , one patient had proteinuria exceeding 2 g. this patient had all clinical criteria for diabetic nephropathy , and proteinuria remitted after tight control of blood pressure with intensive inhibition of renin angiotensin axis . \n the median of albuminuria was 20 ( 5523 ) , and the prevalence of albuminuria > 30 mg/24 h was 36% . \n all patients with albuminuria > 30 mg/24 h were nondipper or to sbp or to dbp . \n the aldosterone ( ng / dl)/renin ( ng / ml / h ) relationship was over 30 , and only one showed an abnormality in adrenal tomography ( hyperplasia ) . \n one patient had a reduction in serum potassium with normal aldosterone / renin relationship and responded satisfactorily to the use of amiloride . \n one patient presented a hematocrit of 68% and hemoglobin of 22 g / dl and was referred to hematological investigation , and an analysis of bone marrow confirm the diagnosis of polycythemia vera . \n so , seven patients had secondary hypertension of different causes ; 19 of the 23 remaining patients failed to reducing the blood pressure values by obstructive sleep apnea , high sodium intake , and a low compliance to drug treatment in the beginning of protocol . \n nevertheless only two patients of these achieved blood pressure target . only four patients could not find any obvious cause for resistant hypertension . \n all patients were evaluated as outpatients from the proposed protocol , and the appropriate therapeutics were implemented . \n resistant hypertension is a serious public health problem , and its treatment has sparked attention from experts in hypertension . \n these data bring the information about the causes of resistant hypertension in a hypertension clinic of an emergent country and are very uncommon in the literature . in this way \n furthermore , few studies used an algorithm for differential diagnosis in resistant hypertension highlighting the importance of our approach . \n . however , there are few studies that apply a standardized and broad algorithm and show the results as we do in this paper . in this study , were identified seven patients with secondary resistant hypertension in 30 patients , two patients with primary hyperaldosteronism , renovascular disease in two , one with a renal parenchymatous disease , a liddle 's syndrome , and a polycythemia vera in one . \n almost all the 23 patients had some degree of noncompliance either to drug treatment or diet . however , after the beginning of the study , all patients became adherent and were using effectively at least 3 medications , but only two of them had achieved blood pressure control . \n thirty patients of 86 in the resistant hypertension criteria agreed to participate in the implementation of the protocol and accompaniment ; however , even with the limited number of patients , the current study allowed the evaluation of these individuals consistently . \n of the thirty patients studied , only seven have secondary causes of hypertension , showing a prevalence of 23.3% . \n the score for renovascular disease was 8.6 , which corresponds to an estimated frequency of approximately 9% according to the diagram of drastic study . \n this estimated prevalence is similar to the frequency of renovascular disease observed in this study ( 6.6% ) . in the current study , of the thirty patients \n evaluated , 13 showed high risk for obstructive sleep apnea , which represents prevalence of 43.3% . in a recent study , calhoun and \n cols suggested that there is a close relationship between the serum level of aldosterone and obstructive sleep apnea . according to these authors , elevated aldosterone levels \n both patients diagnosed with primary hyperaldosteronism presented a high risk for obstructive sleep apnea according to the berlin questionnaire . \n prospective studies have shown that the prevalence of primary hyperaldosteronism in patients with resistant hypertension reaches about 14%21% , which is too high in relation to the general hypertensive population . in our study , two patients had this diagnosis representing 6.6% of the studied sample \n . in the set of patients studied , 68% did not have adequate compliance to drug treatment , highlighting that this is one of the main factors limiting the reduction of blood pressure in these patients . \n the lifestyle , associated with high sodium intake , a sedentary lifestyle , and obesity , is a factor that complicates even more the appropriate treatment of these patients . \n it is known that these drugs attenuate the antihypertensive effect of diuretics and converting enzyme inhibitors which may contribute to the resistance to treatment . \n surprisingly , the frequency of alcoholism was low , only one patient , which can be explained by a possible selection bias with a female predominance . \n it is due to the knowledge and the awareness of women in comparison with that of men to seek medical care for their problems , so we can speculate that alcoholics with resistant hypertension could be underdiagnosed . \n the data obtained suggest that among patients with resistant hypertension , there is a higher prevalence of secondary hypertension than that observed in general hypertensive ones and higher prevalence of sleep apnea . \n but there are a predominance of obesity , noncompliance either with diet or drugs and frequent use of hypertensive drugs . \n these latter factors are likely approachable at primary level health care , since that detailed anamnesis directed to the causes of resistant hypertension are applied .", "role": "user" }, { "content": "resistant hypertension ( rh ) is characterized by blood pressure above 140 90 mm hg , despite the use , in appropriate doses , of three antihypertensive drug classes , including a diuretic , or the need of four classes to control blood pressure . \n resistant hypertension patients are under a greater risk of presenting secondary causes of hypertension and may be benefited by therapeutical approach for this diagnosis . however , the rh is currently little studied , and more knowledge of this clinical condition is necessary . \n in addition , few studies had evaluated this issue in emergent countries . \n therefore , we proposed the analysis of specific causes of rh by using a standardized protocol in brazilian patients diagnosed in a center for the evaluation and treatment of hypertension . \n the management of these patients was conducted with the application of a preformulated protocol which aimed at the identification of the causes of resistant hypertension in each patient through management standardization . \n the data obtained suggest that among patients with resistant hypertension there is a higher prevalence of secondary hypertension , than that observed in general hypertensive ones and a higher prevalence of sleep apnea as well . \n but there are a predominance of obesity , noncompliance with diet , and frequent use of hypertensive drugs . \n these latter factors are likely approachable at primary level health care , since that detailed anamneses directed to the causes of resistant hypertension are applied .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: we consider a network of n neurons , with n(n 1 ) possible ( directed ) connections jij . \n the synaptic connections jij , during the learning mode when patterns to be stored are presented , are subject to plasticity and change their efficacy according to a learning rule inspired to the stdp . in stdp ( magee and johnston , 1997 ; \n , 1998 ; feldman , 2000 ) synaptic strength increases or decreases whether the presynaptic spike precedes or follows the postsynaptic one by few milliseconds , with a degree of change that depends on the delay between pre and postsynaptic spikes , through a temporally asymmetric learning window . \n we indicate with xi(t ) the activity , or firing rate , of ith neuron at time t. it means that the firing probability of unit i in the interval ( t , t + t ) is proportional to xi(t)t in the limit t 0 . \n according to the learning rule we use in this work , already introduced in ( scarpetta et al . \n , 2001 , 2002a ; yoshioka et al . , 2007 ) , the change in the connection jij occurring in the time interval [ t , 0 ] can be formulated as follows : where xj(t ) is the activity of the presynaptic neuron , and xi(t ) the activity of the postsynaptic one . \n the learning window a( ) is the measure of the strength of synaptic change when there is a time delay between pre and postsynaptic activity . to model the experimental results of stdp , the learning window a( ) should be an asymmetric function of , mainly positive ( ltp ) for > 0 and mainly negative ( ltd ) for < 0 . \n the shape of a( ) strongly affects jij and the dynamics of the networks , as discussed in the following . \n ( a ) the learning window a( ) used in the learning rule in eq . \n ( 2002 ) , a()=ape/tpade/tp if > 0 , a()=ape/tdade/td if < 0 , with the same parameters used in abarbanel et al . ( 2002 ) to fit the experimental data of bi and poo ( 1998 ) , ap > = [1/tp + /td ] , ad = [/tp + 1/td ] , with tp = 10.2 ms , td = 28.6 ms , = 4 , = 42 . notably , this function satisfies the condition a()d=0 , i.e. (0 ) = 0 . \n ( b ) the phase of the fourier transform of a( ) as a function of the frequency . \n ( 1 ) , implicitly we have assumed that the effects of separate spike pairs due to stdp sum linearly . \n however note that non - linear effects have been observed when both pre and postsynaptic neurons fire simultaneously at more then 40 hz ( sjostrom et al . \n , 2001 ; froemke and dan , 2002 ) , therefore our model holds only in the case of lower firing rates , and in cases where linear summation is a good approximation . \n we consider periodic patterns of activity that are periodic patterns , in which the information is encoded in the relative phases , that is in the relative timing of the maximum firing rate of a neuron . \n therefore , we define the pattern to be stored by where phases i are randomly chosen from a uniform distribution in [ 0,2 ) , and /2 is the frequency of oscillation of the neurons ( see figure 2a ) \n . each pattern is therefore defined by its frequency /2 , and by the specific phases i of the neurons i = 1, ,n . \n the activity of 10 randomly chosen neurons in a network of n = 3000 fully connected analog neurons , with p = 30 stored patterns . \n ( 4 ) with = 0.24. neurons are sorted by increasing phase i1 of the first pattern , and shifted correspondingly on the vertical axis . \n ( a ) the first stored pattern , that is the activity of the network given by eq . \n ( 2 ) used to encode the pattern in the learning mode , with frequency /2 = 20 hz . ( b ) the self - sustained dynamics of the network , when the initial condition is given by the first pattern xi1(0 ) . \n the retrieved the pattern has the same phase relationships of the encoded one . in this case \n the overlap is |m1|0.22 , and the output frequency is in agreement with the analytical value tan()/2m = 15 hz . ( c ) \n same as in ( b ) , but with = 0.45. output frequency is in agreement with the analytical value tan()/2m = 100 hz . in the limit of large t , when the network is forced in the state given by eq . \n ( 1 ) , the change in the synaptic strength will be given by where ( ) is the fourier transform of the kernel , defined by and ( ) = arg[( ) ] is the phase of the fourier transform . \n the factor depends on the learning rate and on the total learning time t ( scarpetta et al . \n when we store multiple patterns = 1,2, ,p , the learned weights are the sum of the contributions from individual patterns . after learning p patterns , each with frequency /2 and phase - shift i , we get the connections in this paper we choose a(0)=a()d=0 , which gives a balance between potentiation and inhibition . \n notably , the condition (0 ) = 0 also holds when using the learning window of figure 1 . in the present study \n , we choose to store patterns all with the same , and to ease the notation we define = ( ) . in the retrieval mode , \n the dynamic equations for unit xi are given by where the transfer function f(h ) denotes the input \n output relationship of neurons , hi(t ) = jjijxj(t ) is the local field acting on neuron i , m is the time constant of neuron i ( for simplicity , m has the same value for all neurons ) , and jij is the connection after the learning procedure given in eq . ( 4 ) . \n spontaneous activity dynamics of the coupled non - linear system is therefore determined by the function f(h ) and by the coupling matrix jij . \n we take the function f(h ) to be equal to the heaviside function (h ) . \n note that in this case the learning factor is immaterial . during the retrieval mode , \n the network selectively replays one of the stored phase - coded patterns , depending on the initial conditions . \n it means that if we force the network , for t < 0 , with an input which resembles one of the phase - coded patterns , and then we switch off the input at times t > 0 , the network spontaneously gives sustained oscillatory activity with the relative phases of the retrieved pattern , while the frequency can be different ( see figure 2 ) . \n for the analog model ( 5 ) , where the state of the network is represented by the rates xi(t ) , the same can be achieved if we simply initialize the rates at t = 0 with values xi(0 ) corresponding to one of the phase - coded patterns , or also to a partially corrupted version of it . \n analytical calculations ( yoshioka et al . , 2007 ; scarpetta et al . , 2008 ) show that the output frequency of oscillation is given by and this is confirmed by numerical simulations of eq . \n 4 ) . as an example , the learning window in figure 1 , when the frequency of the stored pattern is /2 = 20 hz , gives = 0.24 , and an output frequency of oscillation /2 15 hz ( with m = 10 ms ) . \n numerical simulations of the network with = 0.24 , n = 3000 fully connected neurons and p = 30 stored patterns , are shown in figure 2b . in figure 2c \n , the output frequency is much higher , while the oscillations of the firing rates with respect to the mean value 1/2 is much smaller . in the following sections \n , we analyze the behavior when multiple patterns are stored and we study the network capacity as a function of learning window parameters and as a function of connectivity topology . \n in this section we study the network capacity , in the case of fully connected network , where all the n(n 1 ) connections are subject to the learning process given by eq . \n , the spontaneous dynamics of the network selectively replay one of the stored phase - coded patterns , depending on initial condition , so that , when retrieval is successful , the spontaneous activity of the network is an oscillating pattern of activity with phase of firing equal to the stored phases i ( while the frequency of oscillation is governed by the time scale of single neuron and by the parameter of learning window ) . \n similarity between the network activity during retrieval mode and the stored phase - coded pattern is measured by the overlap |m| , introduced in ( scarpetta et al . , 2002a ) and studied in ( yoshioka et al . , 2007 ) , if the activity xi(t ) is equal to the pattern xi(t ) in eq . \n ( 2 ) , then the overlap is equal to 1/4 ( perfect retrieval ) , while it is ~1/n when the phases of firing have nothing to do with the stored phases . \n numerically we study the capacity of the network , c = pmax / n , where n is the number of neurons and pmax is the maximum number of items that can be stored and retrieved successfully . \n we extract p different random patterns , choosing phases j randomly from a uniform distribution in [ 0 , 2 ) . \n the values of the firing rates are initialized at time t = 0 at the value given by eq . ( 2 ) with t = 0 and = 1 of the first pattern , the dynamics in eq . \n if the absolute value |m(t)| tends to a constant greater than 0.1 at long times , then we consider that the pattern has been encoded and replayed well by the network . the maximum value of p at which the network is able to replay the pattern is the capacity of the network . \n . a systematic study of the robustness of the dynamical basins of attraction from the noise in the initialization has not been carried out yet . here \n we study the dependence of the network capacity on the learning rule parameter . the parameter depends on the learning window shape , and on the frequency of oscillation /2 of the pattern presented during the learning process . in figure 3 \n we plot the capacity as a function of 0 < < /2 for a fully connected network with n = 3000 and n = 6000 , considering pmax the maximum number of patterns such that the retrieved patterns have overlaps |m| > 0.1 . \n the capacity is approximately constant with the network size , showing that the maximum number of patterns pmax scales linearly with the number of neurons . maximum capacity c = pmax / \n n of a network of n = 3000 ( red ) and n = 6000 ( blue ) fully connected analog neurons , as a function of the learning window asymmetry . the limit = 0 corresponds to a symmetric learning window ( jijjji ) that is to output frequency /2 that tends to zero . \n the limit = /2 corresponds instead to a perfectly anti - symmetric learning window , and output frequency /2 = . the intermediate value 0.25 gives the best performance of the network . \n we see that capacity strongly depends on the shape of learning window through parameter . the limit of equal to zero corresponds to output frequency /2 equal to zero , and therefore to the limit of static output . \n we see that the capacity of the oscillating network is larger then the static limit for a large range of frequencies . \n when approaches /2 , then the output frequency /2=tan()/2m tends to infinity , and capacity decreases . \n the best performance is given at intermediate values of . therefore , since depends on the degree of time asymmetry of the learning window , we see that there is a range of time asymmetry of the learning window which provides good capacity , while both the case of perfectly symmetric learning window = 0 , and the case of perfectly anti - symmetric learning window = /2 , give worse capacity performances . \n interestingly , the learning window in figure 1 gives intermediate values of for a large interval of frequencies . note that the decrease in the capacity of the network when the phase approaches /2 is essentially due to the fact that the oscillations of the firing rates with respect to the mean value 1/2 become small in this regime . \n ( 5 ) in the case of sparse connectivity , where only a fraction of the connections are subject to the learning rule given by eq . ( 4 ) , while all the others are set to zero . \n we start from a network in which neurons are put on the vertices of a two- or three - dimensional lattice ; each neuron is connected only to neurons within a given distance ( in units of lattice spacings ) and we call z the number of connections of a single neuron . for each neuron , we then rewire a finite fraction of its connections , deleting the existing short - range connections and creating , in place of them , long range connections to randomly chosen neurons . \n we consider a three - dimensional network with 24 neurons , and a two - dimensional one with 118 neurons . in figure \n 4a we plot the maximum capacity c = pmax / n as a function of the connectivity z / n for three different values of , for the three - dimensional case . \n the value = 0 ( red curve ) corresponds to the pure short - range network , in which all connections are between neurons within a given distance on the three - dimensional lattice , = 1 ( blue curve ) corresponds to the random network , where the three - dimensional topology is completely lost , and = 0.3 to an intermediate case , where 30% of the connections are long range , and the others are short range . \n ( a ) maximum capacity c = pmax / n for a network with 24 analog neurons , with z connections per neuron , with fixed to its optimal value 0.24. the red curve corresponds to = 0 , that is to a network with only short - range connections . \n the green one to = 0.3 , and the blue one to = 1 , that is to a random network where the finite dimensional topology is completely lost . \n ( b ) maximum capacity c = pmax / n , for the same values of n and and for connectivity z / n = 0.11 , as a function of , for the 24 lattice ( red ) and for a two dimensional 118 lattice ( blue ) . \n ( c ) same data as in ( b ) , but as a function of the clustering coefficient c. considering that the capacity of the fully connected network ( z / n = 1 ) is c 0.02 , we see that the random network with z / n 0.1 already has 40% of the capacity of the fully connected network . \n this means the capacity does not scale linearly with the density of connections , and when the density of connections grows there is a sort of saturation effect , due to the presence of partially redundant connections . \n then , we look at the dependence of the capacity from the fraction of short range and long range connections for z / n 0.11 . in figure 4b \n , we see that the capacity gain , with respect to the short - range network , given by 30% long range connections ( = 0.3 ) , is about 80% the one of the fully random network ( = 1 ) . \n therefore , the presence of a small number of long range connections is able to amplify the capacity of the network . \n this is shown in figure 4b , where the capacity as a function of for z / n = 0.11 is plotted ( red curve ) . \n note that the above effect is not so important in smaller networks , for example with n = 18 neurons , where the capacity of the short - range network is nearer to that of a random network . \n therefore , it seems plausible that , for very large networks , the amplifying effect of a small fraction of long range connections will be even stronger . \n it is reasonable to suppose that the fraction of long range connections , in real networks , is determined by a trade - off between the increase of capacity given by long range connections , and their higher wiring cost . \n a large amplifying effect of long range connections on the capacity , together with a large wiring cost with respect to short range ones , will result in the optimal topology of the network being small - world like , with a small fraction of long range connections , as observed in many areas of the brain , from c. elegans ( white et al . \n , 1986 ; achacoso and yamamoto , 1991 ) to the visual cortex of the cat ( yu et al . , 2008 ) . \n the experiments on a two - dimensional lattice with 118 neurons do not show any qualitative differences with respect to the three - dimensional case . in figure \n 4b we plot the capacity of the two - dimensional network ( blue curve ) as a function of , along with the capacity of the three - dimensional one ( red curve ) . \n the figure 4c shows the same data of figure 4b , but as a function of the clustering coefficient c , defined as the probability that two sites , neighbors of a given site , are neighbors themselves . as reported in figure 4c , \n once fixed the number of connections per neuron z , the lower the clustering coefficient , the higher the capacity of the network . \n this is reasonable , because a high clustering coefficient means that connections will be partially redundant , as already observed in the case of the dependence on the connectivity z / n . \n note that the mean path length , for the considered value of z / n = 0.11 , is a decreasing function of from = 0 up to = 0.01 , and then remains practically constant for higher values of . this means that the ratio between c and , that is the small - worldness of the network , has a maximum about = 0.01 . \n only when the wiring cost of the connections is taken in account , the optimal topology turns out to be one with a small fraction of long range connections . \n note also that for more realistic values of z / n , much lower than z / n = 0.11 , the maximum of the small - worldness shifts to higher values of . \n ( 5 ) , that is simple enough to admit analytical predictions for dynamics when the connectivity is given by eq . ( 4 ) . \n the simple model defined by eq . ( 5 ) has state variables xi(t ) , representing instantaneous firing rate or probability of firing , and it has only one time scale m , which is the time constant of a single unit , allowing us to focus on the effect of the learning window shape and connectivity structure . \n however , we expect that , while details of dynamics may depend on the model of single unit , the crucial results of storing and recall of phase - coded patterns can be seen also in a spiking model . \n we use a simple spike response model formulation ( srm ) ( gerstner and kistler , 2002 ; gerstner et al . , 1993 ) of the leaky \n while integrate and fire models are usually defined in terms of differential equations , the srm expresses the membrane potential at time t as an integral over the past ( gerstner and kistler , 2002 ) . \n this allows us to use an event - driven programming and makes the numerical simulations faster than in the differential equation formulation . \n each presynaptic spike j , with arrival time tj , is supposed to add to the membrane potential a postsynaptic potential of the form jij ( ttj ) , where where m is the membrane time constant ( here 10 ms ) , s is the synapse time constant ( here 5 ms ) , (t ) is the heaviside step function , and k is a multiplicative constant chosen so that the maximum value of the kernel is 1 . \n the sign of the synaptic connection jij set the sign of the postsynaptic potential change . \n the synaptic signals received by neuron i , after time ti of the last spike of neuron i , are added to find the total postsynaptic potential when the postsynaptic potential of neuron i reaches the threshold t , a postsynaptic spike is scheduled , and postsynaptic potential is set to the resting value zero . we simulate this simple model with jij taken from the learning rule given by eq . \n the learning rule eq . ( 4 ) comes out of the learning process given by eq . \n ( 1 ) , when a sequence of spikes is learned , and spikes are generated in such a way that the probability that unit i has a spike in the interval ( t , t + t ) is proportional to xi(t)t in the limit t 0 , with the rate xi(t ) given by eq . ( 2 ) . \n after the learning process , to recall one of the encoded patterns , we give an initial signal made up of m < n spikes , taken from the stored pattern , and we check that after this short signal the spontaneous dynamics of the network gives sustained activity with spikes aligned to the phases i of pattern ( figure 5 ) . \n recall of a pattern by the spiking if model , with n = 1000 neurons and = 0.24. one pattern ( p = 1 ) defined by the phases i is stored in the network with the rule given by eq . \n then a short train of m = 150 spikes , at times ti=i/ with /2 = 20 hz , is induced on the neurons that have the m lowest phases i. this short train triggers the replay of the pattern by the network . \n depending on the value of t , the phase - coded pattern is replayed with a different number of spikes per cycle . \n note that changing t in our model may correspond to a change in the value of physical threshold or in the value of the parameter ( ) appearing in the synaptic connections jij learning rule . \n ( a ) thirty neurons of the network are randomly chosen and sorted by the value of the phase i. then the phases of the encoded pattern are shown , plotting on the x axis the times ( i+2n)/ , and on the y axis the label of the neuron . \n ( b ) the replayed pattern with threshold t = 85 is shown , plotting on the x axis the times of the spikes , and on the y axis the label of the spiking neuron . \n black dots represent externally induced spikes , while red dots represent spikes generated by the intrinsic dynamics of the network . \n we also investigate the role of the threshold t. as shown in figure 5 , when the threshold t is lower a burst of activity takes place within each cycle , with phases aligned with the pattern . \n therefore the same phase - coded pattern is retrieved , but with a different number of spikes per cycle . \n this open the possibility to have a coding scheme in which the phases encode pattern 's informations , and rate in each cycle represents the strength and saliency of the retrieval or it may encode another variable . \n the recall of the same phase - coded pattern with different number of spikes per cycle , shown in figure 5 , accords well with recent observation of huxter et al . \n ( 2003 ) in hippocampal place cells , showing occurrence of the same phases with different rates . \n they show that the phase of firing and firing rate are dissociable and can represent two independent variables , e.g. the animals location within the place field and its speed of movement through the field . \n note that a change of t in our model may correspond to a change in the value of physical threshold , or to a change in the value of the parameter ( ) appearing in the synaptic connections jij . \n ( 4 ) is that of changing the output frequency of collective oscillation during retrieval . \n ( 5 ) , lower values of correspond to lower frequencies , even though in the spiking model both time constants of the single neuron ( m and s ) play a role to set output frequency . therefore , the simple formula that holds for the output frequency of the analog model is not valid in the spiking model . \n output activity during recall , for = 0.24 , is shown in figure 5 , while output activity when = 0.4 has a higher frequency , as shown in figure 6 . \n selective recall of two of the stored patterns are shown in figure 6 when p = 5 patterns are stored , and = 0.4. example of selective retrieval of different patterns , in a network with n = 1000 if neurons and p = 5 stored patterns . here \n we choose the asymmetry parameter to be = 0.4. thirty neurons are chosen randomly , and then sorted by the value of i1 in ( a c ) , and sorted by the value of i2 in ( d f ) . in ( a ) and ( d ) we show the phases of the first two stored patterns , plotting the times ( i+2n)/ respectively for = 1 and = 2 . in ( b ) and \n ( e ) we show the generated dynamics when a short train of m = 100 spikes corresponding to the = 1 pattern is induced on the network , while in ( c ) and ( f ) the dynamics when the = 2 pattern is instead triggered . \n the network dynamics selectively replay the stored pattern , depending on the partial cue stimulation . \n note that , because the parameter here is greater than in figure 5 , the frequency of the retrieved pattern here is greater . to estimate the network capacity of the spiking model , we did numerical simulations of the if network in eqs . \n ( 7 ) and ( 8) , with n = 3000 neurons , and connections jij given by eq . \n ( 4 ) , with different number of patterns p. we give an initial short train of m = 300 spikes chosen at times ti=i/ from pattern = 1 . to check \n if the initial train triggers the replay of pattern = 1 at large times , we measure the overlap m(t ) between the spontaneous dynamics of the network and the phases of pattern \n = 1 . in analogy with eq . ( 6 ) , the overlap m(t ) is defined as where tj is the spike timing of neuron j during the spontaneous dynamics , and t * is an estimation of the period of the collective spontaneous dynamics . \n ( 9 ) is equal to 1 when the phase - coded pattern is perfectly retrieved ( even though on a different time scale ) , and is of order 1/n when the phases of spikes have nothing to do with the stored phases of pattern . we consider a successful recall each time the overlap ( averaged over 50 runs ) is larger then 0.7 . \n the capacity of the fully connected spiking network as a function of is shown in figure 7 , for threshold t = 200 and n = 3000 . \n ( a ) maximum capacity c = pmax / n of a network of n = 3000 fully connected spiking if neurons , as a function of the learning window asymmetry . the spontaneous dynamics induced by a short train of m = 300 spikes with = 20 hz and phases given by encoded pattern = 1 is considered , with threshold set to t = 200 . \n ( b ) the output frequency of the replay , as a function of , when p = 1 , t = 200 , n = 3000 . \n while in the analog model the output frequency tends to infinity when /2 , in the spiking model output frequency increases but not diverge at /2 , as shown in figure 7b . as in the analog model , the capacity decreases as soon as is near or larger then /2 . with parameters used in figure 7 , \n we see that , for larger then 0.55 , the stimulation spikes are not able to initiate the recall of the pattern and the network is silent , unless we choose a lower threshold . \n this behavior is similar to a small oscillation obtained in the analog model at /2 . a systematic study of the dependence of the storage capacity on the threshold t , on the number m of spikes used to trigger the recall , and on time constants m and s still has to be done . \n future work will also consider the case in which patterns to be learned are not defined through the rate xi in eq . \n ( 2 ) , but are defined as sequences of spikes whose timing is exactly given by ( i+2n)/mu . we expect for this case a higher storage capacity . \n in this paper we studied the storage and recall of patterns in which information is encoded in the phase - based timing of firing relative to the cycle . \n ( 4 ) to memorize multiple phase - coded patterns , such that the spontaneous dynamics of the network , defined by eq . ( 5 ) , selectively gives sustained activity which matches one of the stored phase - coded patterns , depending on the initialization of the network . \n it means that if one of the stored items is presented as input to the network at time t < 0 , and it is switched off at time t 0 , the spontaneous activity of the network at t > 0 gives sustained activity whose phases alignments match those presented before . \n it is not trivial that the network performed retrieval competently , as analog associative memory is hard ( treves , 1990 ) . \n we compute the storage capacity of phase - coded patterns in the analog model , finding a linear scaling of number of patterns with network size , with maximal capacity c 0.02 for the fully connected network . \n our model can not be easily compared to classical models such as hopfield 's , since the dynamical phases - coded patterns are strongly different from the classical static rate - coded patterns . whereas the capacity of rate - coded networks has been well understood , that of spiking or phase - coded networks is not yet well understood . \n we are not aware of previous work who measures the storage capacity of phase - coded patterns , except of the phase - coded patterns in a spin model by yoshioka ( 2009 ) , whose capacity is in quantitative agreement with our analog model results . \n however , the scaling of capacity with connectivity displays properties similar to those of classical models . for strong dilution ( z n ) , the capacity pmax , that is the maximum number of patterns encodable in the network , is proportional to z rather than to n. on the other hand , for weak dilution ( z of the order of n ) \n , pmax is proportional to the number of neurons n. our results on the if spiking model show that there is a qualitative agreement between the analog and the spiking model ability to store multiple phase - coded patterns and recall them selectively . \n we also study the storage capacity of the analog model for different degrees of sparseness and small - worldness of the connections . \n we put neurons on the vertices of a two- or three - dimensional lattice , and connect each neuron to neurons that are nearer than some distance in units of lattice spacings . \n then a fraction of these connections are rewired , deleting the short - range connection and creating a long range connection to a random neuron . \n changing the proportion between short - range and long - range connections , we go from a two- or three - dimensional network with only nearest - neighbors connections ( = 0 ) to a random network ( = 1 ) . \n small but finite values of give a small world topology , similar to that found in many areas of nervous system . \n we see that , for system size n = 24 , the capacity of a random network with only 10% connectivity already has about 40% the capacity of the fully connected network , showing that there is a saturation effect when the density of connections grows above 10% . \n looking at the dependence on the fraction of short range and long range connections , we see that at z / n = 0.11 the capacity gain with respect to the short range network , given by 30% long range connections , already is about 80% the gain given by the full random network . \n this last factor is likely to increase for larger system sizes , because the larger the system , the more different are long range connections with respect to short - range ones . \n this is interesting considering that a long - range connection clearly have a higher cost then a short - range one , and implies that a small - world network topology is optimal , as a compromise between the cost of long range connections and the capacity increase . \n however , this is not a really spiking model , since only firing activity or \n therefore we perform numerical simulation of a if model with spike response kernels , to show that while details of dynamics may depend on the model of single unit , the crucial results of ability to store and recall of phase - coded memories can be seen also in a spiking model . indeed numerical simulations of the spiking model in eq . \n a pattern of spikes with the stored phases , i.e. with the phase - based timing of spikes relative to the cycle , is activated by the intrinsic dynamics of the network when a partial cue of the stored pattern ( few spikes at proper timings ) is presented for a short time . \n figure 6 shows that the network is able to store multiple phase - coded memories and selectively replay one of them depending from the partial cue that is presented . changing the parameter of the learning rule changes the period of the cycle during recall dynamics , while changing the value of t changes the number of spikes per cycle , without changing the phase pattern . \n so the same phase - coded pattern can be recalled with one spike per cycle or with a short burst per cycle . \n this agrees well with recent observations , like occurrence of phase precession with very low as well as high firing rate ( huxter et al . , \n the number of spikes per cycle is a sort of strength or saliency of recall . \n this leaves open the possibility that variations in number of spikes per cycle might convey additional information about other variables not coded in the phase pattern , as suggested in ( huxter et al . , 2003 ; \n , 2005 ; wu and yamaguchi , 2010 ) for place cells , or may convey information about the saliency of retrieved pattern ( lengyel and dayan , 2007 ) . in our treatment , we distinguish a learning mode , in which connections are plastic and activity is clamped to the phase - coded pattern to be stored in the synaptic connections jij , from a recall mode , in which connection strengths do not change . \n of course , this distinction is somewhat artificial ; real neural dynamics may not be separated so clearly into such distinct modes . \n nevertheless , data on cholinergic neuromodulatory effects ( hasselmo , 1993 , 1999 ) in cortical structures suggesting that high levels of acetylcholine selectively suppress intrinsic but not afferent fiber transmission and enhance long - term plasticity , seems to provide a possible neurophysiological mechanism for this distinction in two operational modes . \n another point is given by the physical constraints on the sign of synaptic connections jij , that for a given presynaptic unit j , are all positive when presynaptic unit j is excitatory , and all negative when presynaptic unit j is inhibitory , a condition not respected by our learning formula eq . \n , one may add an initial background weight j0 to each connection , independent of i and j , such that jij + j0 > 0 for all i and j , to make all the units excitatory and plastic connections positive , and then one has to add a global inhibition equal to j0 times the mean field y = jxj to save equilibrium between excitation and inhibition . \n in such a way , we have a network of n excitatory units , with positive couplings , and a global inhibition , that is mathematically equivalent to eq . \n ( 5 ) when y = jxj , and numerically also gives the same results when y = n/2 . considering the if model of section integrate and fire model , also in this case we can consider a network of all excitatory neurons , with plastic positive connections given by jij + j0 with j0 constant such that jij + j0 > 0 , and then add a proper inhibitory term to save the equilibrium between excitation and inhibition . in this way , the postsynaptic potential of neuron i , after time ti of its last spike , is given by the inhibitory term j0j / tj > ti(ttj ) can be realized in different ways , for example imaging that for each excitatory unit j , there is a fast inhibitory interneuron j , that emits a spike each time its excitatory unit does , and is connected with all the other excitatory neurons with constant weight connections j0 . \n the task of storing and recalling phase - coded memories has been also investigated in ( lengyel et al . , 2005b ) in the framework of probabilistic inference . \n ( 7 ) , the paper ( lengyel et al . , 2005b ) studies this problem from a normative theory of autoassociative memory , in which variable xi of neuron i represents the neuron i spike timing with respect to a reference point of an ongoing field potential , and the interaction h(xi , xj ) among units is mediated by the derivative of the synaptic plasticity rule used to store memories . in ( lengyel et al . \n , 2005b ) , the case of limited connectivity is studied , showing how recall performance depends to the degree of connectivity when connections are cut randomly . here \n we show that performance also depends from the topology of the connectivity , and capacity depends not only from the number of connections but also from the fraction of long range versus short - range connections . \n the role of stdp in learning and detecting spatio - temporal patterns has been studied recently in ( masquelier et al . , 2009 ) . \n they show that a repeating spatio - temporal spike pattern , hidden in equally dense distracter spike trains , can be robustly detected by a set of listening neurons equipped with stdp . \n when a spatio - temporal pattern repeats periodically , it can be considered a periodic phase - coded pattern . while in masquelier \n ( 2009 ) the detection of the pattern is investigated when it is the input of the listening neurons , in our paper we investigate the associative memory property , which makes the pattern imprinted in the connectivity of the population an attractor of the dynamics . \n when a partial cue of the pattern is presented ( or in the analog case the network is initialized with xi(0 ) ) , then the original stored pattern is replayed . differently from masquelier \n ( 2009 ) , here the pattern is imprinted in the neural population , in such a way that exactly the same encoded phase - coded pattern is replayed during persistent spontaneous activity . \n this associative memory behavior , that replay the stored sequence , can be a method for recognize an item , by activating the same memorized pattern in response of a similar input , or may be also a way to transfer the memorized item to another area of the brain ( such as for memory consolidation during sleep ) . \n our results shows that in the spiking model a critical role is played by the threshold t : changing the threshold one goes from a silent state to a spontaneously active phase - coded pattern with one spike per cycle , and then to the same phase - coded pattern with many spikes per cycle ( bursting ) . \n therefore , a possible conjecture is that when we observe the replay of a periodic spatio - temporal pattern , then if one is able to change the threshold of spiking of the neurons , one can observe the same phase pattern but with more or less spikes per cycle . in future \n we will also investigate the capacity when patterns with different frequencies are encoded in the same network . in this paper \n we compute the capacity when encoded patterns have all the same frequency , however it would be interesting to see how the network work with different frequencies . \n preliminary results on the analog model ( scarpetta et al . , 2008 ) show that it 's possible to store two different frequencies in a manner that both are stable if a relationship holds between the two frequencies and the shape of the learning window . \n we plan to investigate this both in the analog and in the spiking model . concerning the shape of learning kernel a( ) \n , in our model the values of the connections jij depend on the kernel shape only through the time integral of the kernel , and the fourier transform of the kernel at the frequency of the encoded pattern . as shown in our previous paper ( yoshioka et al . , 2007 ) , \n best results are obtained when the time integral of the kernel is equal to zero a()d=a(0)=0 . \n hence in the present paper we choose to set this value to zero , and varied only the phase of the fourier transform . \n the case of a purely symmetric kernel corresponds to = 0 , while a purely anti - symmetric ( causal ) one corresponds to = /2 . \n we find that intermediate values 0 < < /2 work better then values /2 < < , for which the network is not able to replay patterns competently . \n we study here positive values of , i.e. a causal kernel ( potentiation for pre \n post , and depotentiation for post pre ) , however an anti - causal kernel would give a negative value of , and a negative frequency of replay , that is the pattern would be replayed in time reversed order ( scarpetta et al . \n , 2008 ) . for what concerns the variety of shapes of the learning window observed in the brain , it has to be considered that they may accomplish different needs , such as maximize storage capacity , or set the time scale of replay , which in our model depends on the kernel shape . \n notably , in our model we observe a good storage capacity for values of phase which correspond to a large interval of frequency of oscillation during replay , and therefore there is good storage capacity also for values of which correspond to a compressed - in - time replay of phase pattern on very short time scale . \n future work will investigate the relation between this framework and the time - compressed replay of spatial experience in rat . \n it has been indeed observed that during pauses in exploration and during sleep , ensembles of place cells in the rat hippocampus and cortex re - express firing sequences corresponding to past spatial experience ( lee and wilson , 2002 ; foster and wilson , 2006 ; david et al . \n , 2007 ; diba and buzsaki , 2007 ; hasselmo , 2008 ; davidson et al . , 2009 ) . \n such time - compressed hippocampal replay of behavioral sequences co - occurs with ripple events : high - frequency oscillations that are associated with increased hippocampal \n it 's intriguing the hypothesis that sequence replay during ripple is the recall of one of the multiple stored phase - coded memories , a replay that occur on a fast time scale ( high ) , triggered by a short sequence of spike . \n the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .", "role": "user" }, { "content": "we study the storage and retrieval of phase - coded patterns as stable dynamical attractors in recurrent neural networks , for both an analog and a integrate and fire spiking model . \n the synaptic strength is determined by a learning rule based on spike - time - dependent plasticity , with an asymmetric time window depending on the relative timing between pre and postsynaptic activity . \n we store multiple patterns and study the network capacity . for the analog model , we find that the network capacity scales linearly with the network size , and that both capacity and the oscillation frequency of the retrieval state depend on the asymmetry of the learning time window . \n in addition to fully connected networks , we study sparse networks , where each neuron is connected only to a small number z n of other neurons . \n connections can be short range , between neighboring neurons placed on a regular lattice , or long range , between randomly chosen pairs of neurons . \n we find that a small fraction of long range connections is able to amplify the capacity of the network . \n this imply that a small - world - network topology is optimal , as a compromise between the cost of long range connections and the capacity increase . \n also in the spiking integrate and fire model the crucial result of storing and retrieval of multiple phase - coded patterns is observed . \n the capacity of the fully - connected spiking network is investigated , together with the relation between oscillation frequency of retrieval state and window asymmetry .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: acanthamoeba keratitis ( ak ) is a very painful , serious corneal infection caused by free - living pathogenic protozoans of the genus acanthamoeba ( mcculley et al . , 1995 , \n acanthamoeba species are ubiquitous , free - living protozoa that exist as motile trophozoites and dormant cysts in many environments , including swimming pools , hot tubs , lakes , soil , dust and drinking fountains ( brown et al . , 1982 ) . \n the trophozoite stage of acanthamoeba feeds on organic particles and microbes and divides mitotically under optimal condition . with exposure to harsh conditions or during a period of stress , \n the inner wall of the cyst possesses cellulose and the outer wall consists of proteins and polysaccharides . during encystation , the largest increases in resistance are observed . \n an increasing number of cases of severe ocular inflammation and visual loss have been caused by acanthamoeba infection in the past two decades . \n this increased prevalence has been linked to the increasing use of contact lenses ( brown et al . , 1982 , \n broxton et al . , 1983 , auran et al . , 1987 , allen et al . , 2004 ) . \n clinical cases of ak are largely restricted to contact lens wearers who have experienced some sort of trauma to their corneal epithelium ( cdc , 1987 , paszko - kolva et al . , 1991 , \n 1997 ) . due to difficulty in early diagnosis and poor response to most antibiotics , therapeutic penetrating keratoplasty \n is often used to try to eradicate the pathogen in uncontrolled disease . if it is not diagnosed early and treated aggressively , extensive ocular damage include a ring - like corneal infiltrate , epithelial destruction , and disproportionately severe ocular pain , could occur and enucleation may be required ( auran et al . , 1987 ) . \n the first two ak cases in taiwan were reported in 1988 , corneal biopsy yielded confirmative diagnosis ( chan and chan , 1988 ) . \n medical records reviewed by all patients with clinically diagnosed microbial keratitis presenting at the national taiwan university hospital from january 1992 to december 2001 , indicated that 4.4% of cases of microbial keratitis were caused by acanthamoeba species ( fong et al . , 2004 ) . \n currently , the treatment regimen in taiwan involves hourly drug applications for prolonged periods ( gray et al . , 1994 , \n of these drugs , phmb is a membrane - active agent with broad - spectrum antimicrobial efficacy that has been used as an antiseptic in infective keratitis ( gray et al . \n , 1994 , mcdonnell and russell , 1999 , donoso et al . , 2002 , narasimhan et al . , 2002 ) , swimming pool sanitization , and the treatment of cooling systems ( kusnetsov et al . , 1997 ) . \n preparations of phmb are mixtures of polymeric biguanides with an approximate molecular weight range of 4008000 . \n the structure of phmb is as follows : [ (ch2)6.nh.c ( \n 000000000000 \n 000000000000 \n 000000000000 \n 111111111111 \n 000000000000 \n 111111111111 \n 000000000000 \n 000000000000 \n 000000000000 \n nh).nh.c(nh).nh]n , where n = 240 , with an approximate molecular weight range of 4008000 . in previous studies on prokaryotic cells , phmb was shown to interact with cytoplasmic membranes to cause lethal action , nonspecific alterations in membrane integrity , loss of lps , and loss of function in membrane proteins ( broxton et al . , 1983 \n , broxton et al . , 1984 , gilbert et al . , 1990 ) . \n phmb has also been shown to interfere with prokaryotic cell functions by binding to nucleotides ( allen et al . , 2004 ) , and chindera et al . \n observed that phmb not only disrupt the microbial membrane but also arrests cell division and the condensation of chromosomes in treated bacteria species ( chindera et al . , 2016 ) . \n phmb is further believed to cause the production of large quantities of phosphorus , which accumulate in the nuclei of a. castellanii cells as a result of reduced permeability and protein coagulation or the aggregation of phospholipids ( khunkitti et al . , 1999 ) . \n complex phmb - nucleotide formations have been observed near the cell wall and nuclei following drug uptake by acanthamoeba . \n nonetheless , clinical outcomes tend to be poor , particularly in cases involving drug - resistant / tolerant strains . \n the mechanism underlying the resistance to phmb by acanthamoeba cells has yet to be elucidated for overcoming infection caused by these phmb - resistant / tolerant strains . to gain a deeper understanding of the mechanism underlying the first step of resistance to phmb in acanthamoeba \n , we established an rna - seq database for acanthamoeba , including the non - pathogenic atcc strain and the highly phmb - tolerant acanthamoeba castellanii strain , nckh_d ( huang et al . , 2015 ) . \n in our previous study , we have shown that a. castellanii clinical isolates nckh_b and nckh_d have higher tolerance toward phmb than does the standard strain , atcc 30010 ( huang et al . , 2015 ) . \n these two isolates differ in their response to phmb stress : nckh_b transforms into a pseudocyst to escape the drug , but nckh_d does not . \n therefore , nckh_d utilized an alternative drug tolerance strategy rather than transform into pseudocyst / cyst . in this study \n , we try to reveal the molecular mechanism of the phmb resistance in nckh_d trophozoites . \n furthermore , we found that the mrna expression level of the disulfideisomerase domain containing protein ( pdi ) had risen rapidly in surviving cells of the nckh_d strain but not in the atcc standard strain during phmb treatment . \n after pdi - specific silencing , nckh_d was found to be more vulnerable to phmb treatment . \n the results of this study will help to characterize the potential phmb resistance mechanisms of acanthamoeba and will aid in the development of a more effective treatment regimen for ak . \n acanthamoeba species are axenically cultured in a protease peptone - yeast extract - glucose ( pyg ) medium , ph 6.5 , at 28 c in cell culture flasks . \n the clinical isolates were isolated from the corneal ulcers of patients who were diagnosed with ak in the cheng kung university hospital ( li et al . , 2012 ) , including the high phmb tolerance pathogenic acanthamoeba castellanii isolates ncku_d which is used in this study ( huang et al . , 2015 ) . \n detached cells will be centrifuged and the pellet will be suspended in a 0.5% trypan blue solution in sterile pbs for 1 min . \n cells will be then counted in a neubauer hemocytometer chamber , and the stained cells will be considered dead . \n cell counting will be performed under a light microscope in the duration to get the numbers of alive and dead cells which will be differentiated with trypan blue dye exclusion viability method \n . the number of stained cells will be subtracted from the total , indicating the death ratio in each interaction condition and time . \n phmb will be preparation in different concentration in page 's amoeba saline ( pas ) . to further clarify the appropriate amount of cells , drug concentration and duration of drug experiment ; we will add the counted cells in drug solution and shake by 100 rpm . \n we collected the rna samples from the non - pathogenic isolate atcc 30010 and the pathogenic acanthamoeba castellanii isolates ncku_d trophozoites . \n pellet the cells by centrifugation , lyse the pellet of acanthamoeba with trizol(invitrogen ) , add 100% ethanol ( merck ) as 1:1 vol , mix it well by vortexing . extract the rna by direct - zol rna miniprep kit ( zymo research ) . \n the entire concentration and a260/a280 ratio of mrna were measured with nd-1000 ( nanodrop ) . \n high capacity cdna reverse transcription kits ( applied biosystems ) were used in this study . \n the rna samples from the untreated / phmb treated a. castellanii atcc 30010 and clinical isolates nckh_d were used for generating sequence reads with illumina platform , by which more than 21 million of sequence reads . \n one - step reverse transcription pcr was performed with superscript one - step rt - pcr with platinum taq kit ( invitrogen ) to investigate the gene expression of acanthamoeba . \n all of the cdna was synthesized from 1 g of total rna of acanthamoeba . \n rt - pcr products were separated on the etbr - stained gel after electrophoresis in 1.01.2% agarose . \n small interfering rna ( sirna ) targeting on the 1265th to 1283rd nucleotide in the exon coding region of the pdi ( aca1_189420 ) gene of acanthamoeba was designed and synthesized by dharmacon ( ge healthcare dharmacon inc . ) , based on the cdna sequence of the pdi gene . the sense and \n the sirna was transfected to acanthamoeba trophozoites as described in a previous study ( kong and pollard , 2002 ) . as a negative control , sirna with a scrambled sequence ( dharmacon ) absent in acanthamoeba was used . \n to characterize the potential phmb resistance mechanisms of acanthamoeba and to develop a more effective treatment for ak , we isolated the clinical strains nckh_d with high phmb tolerance and created the platforms for screening and elucidating the efficacy of treatment ( huang et al . , 2015 ) . \n to confirm that nckh_d does not depend on transforming to a cyst to escape the drug , we used a differential interference contrast microscope to observe the morphology of nckh_d . \n the result clearly indicates that nckh_d did not transform to cyst during the 6 h phmb treatment ( video 1 ) . \n we proposed that acanthamoeba could produce the stress proteins and regulate certain genes for responding to phmb treatments . in this study , we established the rna datasets of strains including nckh_d and the standard strain , atcc 30010 , for examining the genes associated with phmb resistance . \n the following is the supplementary data related to this article : video 1the long - term observation of acanthamoeba nckh_d trophozoites during the 6 h phmb treatment . \n images were taken every 30 min by using a differential interference contrast microscope and the analysis is uses for the software of cell.video 1 the long - term observation of acanthamoeba nckh_d trophozoites during the 6 h phmb treatment . \n images were taken every 30 min by using a differential interference contrast microscope and the analysis is uses for the software of cell . \n we analysed the rna - seq data which were collected from treated and non - treated acanthamoeba cells , with the software package edger ( empirical analysis of dge in r ) , which is part of the bioconductor project ( gentleman et al . \n the differential gene expression results from the comparative analysis are shown in table 2 . \n after combining the differential gene expression results from rna - seq databases , we noticed that a special gene , the disulfideisomerase domain containing protein ( pdi , aca1_189420 ) , is up - regulated during phmb treatment in nckh_d but down - regulated during phmb treatment in atcc 30010 . from the comparative analysis of rna - seq , we found that not only one isoform of pdis , aca1_189420 , is upregulated during the phmb - treated experiments but also three isoforms of pdi in the ncbi gene database , including aca1_149830 , aca1_374090 , and aca1_374120 , were up - regulated . to confirm the expression patterns of the pdi isoforms we analysed the rna samples which were not only previous samples for establishing the database but also those repeated by reverse transcription pcr . \n only the aca1_189420 in surviving cells of the nckh_d , a highly phmb - tolerated isolate strain associated with keratitis infection , increased rapidly compared to the atcc standard strain , and the three other a. castellanii isolates , nckh_a , c , and p , which were collected from patients with phmb treatment successes ( fig . \n to understand the functions of pdi aca1_189420 , we predicted its functional domains via the ncbi conserved domain search website ( http://www.ncbi.nlm.nih.gov/structure/cdd/wrpsb.cgi ) . from the analysed prediction , \n there are two thioredoxin - like superfamily domains in aca1_189420 ( fig . 1d ) . \n thioredoxins are proteins that act as antioxidants . therefore , we proposed that pdi ( aca1_189420 ) may be involved in oxidative protein folding in the endoplasmic reticulum by acting as a catalyst and folding assistant . \n the proteins that act as antioxidants are usually maintained in their reduced form at steady state . \n so we were curious about the expression pattern of thioredoxindisulfide reductase ( aca1_398900 ) , which is the enzyme used to reduce thioredoxindisulfide in acanthamoebal cells during the phmb treatment . from the results shown in fig . \n 2a and b , the transcriptional expression level of aca1_398900 does not change after phmb treatment . for elucidating the importance of pdi aca1_189420 in the phmb tolerance of nckh_d , we knocked down the gene expression and used the phmb treatment again . \n after pdi aca1_189420-specific sirna treatment , we found nckh_d to be more vulnerable to phmb ( fig . 3 ) . \n the result revealed that pdi is an important gene for the phmb tolerance ability . to prove that aca1_189420 is a general stress or a phmb specific induced response protein , we tested physical and chemical stresses , such as heat shock and h2o2 treatments . in heat shock experiments \n , we found that nckh_d is more tolerant to high - temperature treatment than the atcc standard strain 30010 ( fig . \n these results indicate that the pdi ( aca1_189420 ) expression of 30010 and nckh_d is both downregulated , which means pdi is not important for the high - temperature tolerance ability of nckh_d ( fig . \n nckh_d was also more tolerant to hydrogen peroxide treatment than 30010 , but the pdi expression of nckh_d had no specific change ( fig . \n thus , we have shown that pdi ( aca1_189420 ) is a phmb induced stress protein but not a general stress protein . \n the broad - spectrum antimicrobial polymer phmb kills bacteria , fungi , parasites and certain viruses . presently , ak treatment involves hourly applications of phmb over a prolonged period ; however , even this aggressive approach is unable to ensure anything other than a poor prognosis . \n our previous work presented a phmb highly tolerant isolate , nckh_d , which does not depend on transforming to a cyst to escape the drug ( huang et al . , 2015 ) . \n however , the action and resistance mechanisms of phmb in acanthamoeba cells are still not clear . \n knowledge of these mechanisms could be used to progress the current treatment for more effective use against the infection . \n based on the experimental results of the present study , we have for the first time provided solid evidence that pdi ( aca1_189420 ) is a phmb resistance associated gene in acanthamoeba . \n thioredoxin ( trx ) , an important factor for protein dithiol / disulfide homeostasis and is conserved from bacteria to man . \n however , the role of the thioredoxin reductase ( trxr)/trx system is still poorly understood in acanthamoeba . in other protists , there are alternative factors in the trx system that have been reported as drug targets for parasites . in 2007 , leitsch et al . found that the anti - oxidative enzyme , trxr , could reduce metronidazole and other nitro compounds in entamoeba histolytica ( leitsch et al . , 2007 ) . \n trxr has also been found to reduce metronidazole and other nitro - heterocyclic drugs in trichomonas vaginalis ( leitsch et al . , 2009 ) . \n in giardia lamblia , trxr has been suggested to assist as a drug target ( leitsch et al . , 2016 ) . \n in this study , we have elucidated the associated gene and possible mechanism of phmb resistance , as described here with a highly phmb - tolerant strain of acanthamoeba . \n this study also provides novel insight for dissecting the phmb resistant mechanisms in acanthamoeba and possible improvements for phmb treatment of acanthamoeba keratitis . \n these results described above show that pdi ( aca1_189420 ) is an important gene for phmb tolerance ability in highly phmb - tolerant acanthamoeba . \n ", "role": "user" }, { "content": "acanthamoeba castellanii is a free - living protozoan pathogen capable of causing a blinding keratitis and fatal granulomatous encephalitis . \n current treatment generally involves an hourly application of polyhexamethylene biguanide ( phmb ) over a period of several days but this is not entirely effective against all strains / isolates . the tolerance mechanisms of phmb in acanthamoeba cells remain unclear . in this study , we found that the mrna expression level of disulfideisomerase domain containing protein ( pdi ) increased rapidly in surviving cells of the highly phmb - tolerant acanthamoeba castellanii strain , nckh_d , during phmb treatment , but not in the atcc standard strain . \n after pdi - specific silencing , nckh_d was found to be more vulnerable to phmb treatment . \n the results described above show that pdi is an important gene for phmb tolerance ability in a highly phmb - tolerant strain of acanthamoeba and provide a new insight for more efficient medicine development for acanthamoeba keratitis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the term acute acoustic trauma represents injury to the ear due to blast or impulse noise to the auditory system usually caused by detonation of explosives . \n impulse noise is a single pulse of about 140 db or more that fades quickly . \n acoustic trauma is different from noise induced hearing loss that develops over several years and is of insidious in onset . \n blast trauma can damage the tympanic membrane , ossicles and cochlea singly or in combination and produces immediate severe hearing loss and may be associated with tinnitus and vestibular symptoms . \n hearing loss recovers spontaneously in many cases but may be permanent in 30 - 55% cases . \n suitable compensation is awarded after calculation of permanent disability which is usually based on pure tone thresholds . as pure tone audiometry is subjective , malingering for the purpose of claiming compensation needs to be excluded . \n thirteen patients working in an explosive manufacturing unit in andhra pradesh were exposed to blast trauma at work place . \n none of the workers had exposure to noise at workplace and all were using earmuffs ( ppe ) at workplace . \n they were referred to our medical board for disability evaluation after 2 - 3 years of initial injury . \n all the patients were re - evaluated in our centre with clinical examination and audiological investigations comprising of pure tone audiometry , impedence audiometry , acousticreflex test and abr ( bera ) test and in some cases otoacoustic emission ( oae ) test . based on estimation of pure tone thresholds with the results of these investigations , of monaural hearing impairment of each ear \n was calculated by averaging pure tone thresholds at 500 , 1000 , 2000 and 4000 hz and subtracting from 25 db ( lower fence ) and multiplying the result by a factor of 1.5 . \n whole man impairment was calculated using the formula , ( better ear% multiplied by 5 ) + ( worse ear ) 6 . \n tinnitus was a feature in 11/13 casesassociated tympanic membrane perforation was found in 3/13 casesin the immediate period ( less than 1 month ) 10 of the 13 cases had pure tone threshold of more than 70 db in the worse ear [ table 1]audiometry 2 years after trauma showed pure tone threshold more than 60 db in 12 of the 13 cases [ table 2]acoustic reflex was present in 12 of the 13 cases at 80 db and above [ table 3]hearing threshold evaluation by abr ( bera ) was less than 40 db in 12 of the 13 patients [ table 4 ] . \n tinnitus was a feature in 11/13 cases associated tympanic membrane perforation was found in 3/13 cases in the immediate period ( less than 1 month ) 10 of the 13 cases had pure tone threshold of more than 70 db in the worse ear [ table 1 ] audiometry 2 years after trauma showed pure tone threshold more than 60 db in 12 of the 13 cases [ table 2 ] acoustic reflex was present in 12 of the 13 cases at 80 db and above [ table 3 ] hearing threshold evaluation by abr ( bera ) was less than 40 db in 12 of the 13 patients [ table 4 ] . \n initial audiometry ( 1 month after trauma ) ( n13 ) audiometry after 2 years ( n13 ) acoustic reflexes ( n13 ) hearing threshold levels estimation by abr ( n13 ) \n tinnitus was a feature in 11/13 casesassociated tympanic membrane perforation was found in 3/13 casesin the immediate period ( less than 1 month ) 10 of the 13 cases had pure tone threshold of more than 70 db in the worse ear [ table 1]audiometry 2 years after trauma showed pure tone threshold more than 60 db in 12 of the 13 cases [ table 2]acoustic reflex was present in 12 of the 13 cases at 80 db and above [ table 3]hearing threshold evaluation by abr ( bera ) was less than 40 db in 12 of the 13 patients [ table 4 ] . \n tinnitus was a feature in 11/13 cases associated tympanic membrane perforation was found in 3/13 cases in the immediate period ( less than 1 month ) 10 of the 13 cases had pure tone threshold of more than 70 db in the worse ear [ table 1 ] audiometry 2 years after trauma showed pure tone threshold more than 60 db in 12 of the 13 cases [ table 2 ] acoustic reflex was present in 12 of the 13 cases at 80 db and above [ table 3 ] hearing threshold evaluation by abr ( bera ) was less than 40 db in 12 of the 13 patients [ table 4 ] . \n initial audiometry ( 1 month after trauma ) ( n13 ) audiometry after 2 years ( n13 ) acoustic reflexes ( n13 ) hearing threshold levels estimation by abr ( n13 ) \n acoustic - blast trauma is a dramatic event that and often accompanied by multiple injuries . \n it is caused by impulse noise which may be defined as a single - pulse sound or a burst of sound with a duration of between 0.001 and 1 second and is typified by a sound , typically equal to or greater than 140 db , which rapidly rises to a sharp peak and then quickly fades . \n examples of sources of impulse noise include commercial blasting , sonic boom , muzzle blast and backfire from an internal combustion engine . \n movement of considerable volumes of combustion products and air often reach tens of kilopascals while in impulse noise they are usually less than 2 kpa . \n blast trauma can involve the external , middle and internal ears . in the middle ears it may blast waves involve the lead to perforation of the ear drum and ossicular disruption . in such an event , \n paradoxically the damage to the inner ear is reduced as the tympanic membrane and ossicle absorb some of the damaging shock . \n permanent , pure snhl is the most prevalent type of auditory impairment in blast trauma , accounting for 35 to 54 percent of injuries . \n the initial presentation is frequently a mixed hearing loss ( conductive and snhl ) due to middle ear injury . \n blast injuries produce a sloping high - frequency hearing loss that often affects frequencies below 8 khz . \n experimental work has shown that recovery following blast trauma starts immediately ; stops for 5 - 12 hours , then resumes till a stable level is reached . \n it is generally accepted that , providing there has been no further exposure to harmful noise , further deterioration in hearing is unlikely to be attributable to the initial injury a year after an episode of acute acoustic trauma . \n recovery of hearing after blast trauma with stabilization of hearing has been reported by other authors also [ jagdale 3 , isha tyagi 4 ] . \n acoustic trauma and noise induced hearing loss are separate entities and are caused by different pathological mechanisms in the middle and inner ears . \n nihl is a compensable occupational disease as per employees state insurance act ( 1948 ) and workmen 's compensation act ( 1923 ) . \n hearing loss due to acoustic trauma is a dramatic event and may tempt to claim compensation . \n all the patients in the present series were victims of blast trauma and were referred for evaluation for permanent disability . \n otoscopy revealed healed perforation in 3 patients initial audiometry was done between 7 and 28 days after injury showed pure tone thresholds of > 70 db in more than 75% cases ( 10/13 ) . \n the gold standard of disability evaluation in case of hearing loss is pure tone audiometry which is purely subjective and can be fallacious due to malingering . \n therefore objective tests such as acoustic reflex threshold and abr for hearing threshold estimation have become important . in these cases malingering \n was suspected when all the patients were able to comprehend normal speech and pure tone audiometry showed severe to profound hearing loss in almost 12 of 13 ( 92% ) patients . therefore other objective tests were done . \n acoustic reflex threshold is approximately 70 - 105 db above the pure tone threshold and can be reliably used for measuring pure tone threshold . in this series \n , acoustic reflexes were elicited between 80 - 95 db in 12 of 13 patients thus estimating the hearing thresholds of < 25 db in these cases . \n this was corroborated by abr that estimated the hearing thresholds of 21 - 30 db in 12 of the thirteen cases . \n disability calculation was done by averaging pure tone thresholds at 500 , 1000 , 2000 and 3000 hz ( ref ) . on the basis of pure tone audiometry alone , 11 of the 13 cases \n had > 75% impairment , whereas calculation with re - estimated of pure tone threshold with acoustic reflexes and abr showed the impairment to below 5% in 12 of the13 cases , thus avoiding significant financial liability [ table 5 ] . \n disability calculation ( whole man ) as literature on the subject suggest , recovery of hearing following blast trauma does not occur beyond one year . \n hence , for proper permanent disability calculation in acoustic blast trauma , evaluation should be done after a period of at least one year after injury . \n objective tests like acoustic reflexes , oae and abr play an important role besides pure tone audiometry in the evaluation of hearing threshold levels . \n this study also demonstrates spontaneous recovery of hearing loss in a large number of cases of acoustic blast trauma . \n objective hearing tests should be carried out after one year or more before evaluation of permanent disability . \n \n ", "role": "user" }, { "content": "introduction : acoustic blast trauma is different from noise induced hearing loss . \n blast trauma can damage the tympanic membrane , ossicles and cochlea singly or in combination . \n it produces immediate severe hearing loss and may be associated with tinnitus and vestibular symptoms . \n hearing loss recovers spontaneously in many cases but may be permanent in 30 - 55% cases . \n thirteen patients working in an explosive manufacturing unit in andhra pradesh were exposed to blast trauma at work place . \n all these workers complained of immediate hearing loss and were subjected to audiological investigations.methods:initial evaluation showed a severe sensorineural type of hearing loss 10 of the 13 cases ( 77% ) . \n they were referred to our medical board for disability evaluation after 2 - 3 years of initial injury . \n pure tone audiometry indicated severe hearing loss in 12 of 13 cases ( 92% ) that was not correlating clinically . \n re - evaluation with acoustic reflex and abr ( bera ) tests were done and permanent disability was evaluated with the results of these investigations.observations:no significant hearing loss was found in most patients and these patients had minimal disability.conclusion:objective hearing tests should be carried out after one year or more before evaluation of permanent disability .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: micrornas ( mirnas ) are small ( ~22 nucleotides ) noncoding rnas that regulate more than half of the genes in human cells.1 by complementary binding into the 3'-untranslated region ( 3'-utr ) of mrnas , they suppress translation and induce degradation of mrnas . because of their broad targeting range , mirnas are expected to be involved in most cellular processes . \n accordingly , dysregulation of the expression of mirnas results in diverse disease states.2 analysis of mirna levels in human plasma and serum showed that extracellular mirnas are unexpectedly stable in body fluids.3 moreover , many studies showed that the mirna profile is altered in the blood of patients compared with that of healthy persons . \n these discoveries have attracted much interest in utilizing the level of extracellular mirnas as a novel biomarker in diverse diseases . in this review , \n i briefly introduce in chronological order the important discoveries that led to the establishment of the mirnas as novel biomarkers . \n i also discuss the possible origin of extracellular mirnas and the reliability of mirnas as biomarkers . \n finally , i make several suggestions for experimental processes to identify mirna biomarkers with higher consistency . \n because of the many such studies , reports of specific mirnas for disease markers are not dealt with thoroughly in this review . \n i recommend that researchers who want to identify novel biomarkers or who want to search the identified markers for a specific disease search the databases in which the published mirna markers for diverse diseases are collected , with links to their corresponding published studies.4 note that although diverse terms are used to define mirna in the extracellular space , including extracellular mirna , vesicular mirna , exosomal mirna , and circulating mirna , i will use the term extracellular mirna to represent all mirnas detected outside cells . \n after the discovery of the first mirna in caenorhabditis elegans in 1993 , it took 7 years to encounter the second mirna , also in c. elegans ( fig . \n 1).567 until that time , these tiny rnas were regarded as molecules specific to lower organisms . \n the importance of mirna as a regulatory molecule was first implied by the discovery that the second mirna identified , let-7 , is conserved throughout bilateral animals.8 the identification of dozens of mirnas from worm , fly , and human suggested that mirnas indeed constitute a large group of previously unknown regulatory molecules.91011 the function of mirnas began to be discovered , and it was soon reported that mirnas are highly related to human diseases , such as chronic myeloid leukemia ( cll).12 numerous studies to analyze the involvement of mirnas in human disease were triggered by the development of the microarray platform , which made the global profiling of mirna possible.13 strikingly , the classification of cancer phenotypes was more successful when the expression profile of mirna rather than that of mrna was used.13 the availability of profiling based on microarray , and subsequently next generation sequencing , established a foundation for those studies to discover mirna biomarkers for the classification and diagnosis of disease ( fig . \n although the analysis of the mirna profile in human tissues showed the great potential of mirna as a disease marker , a less invasive method would make this analysis more practical . in this regard , \n extracellular mirnas were first discovered in cell culture medium.14 interestingly , encapsulated inside exosomes , the extracellular mirnas secreted from donor cells could be transferred into other recipient cells . \n the existence of extracellular mirnas in the body fluids of humans was soon reported in several studies.15161718 an important discovery was that the mirna profiles in the body fluids of diseased persons were considerably different from the profiles in healthy persons.moreover , the mirnas in body fluids remained stable in diverse severe conditions such as boiling , very low or high ph , repetitive freezing - thawing , and storage at room temperature for a long time.1518 these studies raised the possibility that mirnas from body fluids could be used to diagnose human diseases . \n after these discoveries , hundreds of research studies were conducted to find extracellular mirnas that could be used as diagnostic or prognostic markers for specific diseases ( fig . \n it is much easier to profile the global level of mirnas rather than that of proteins or metabolites because of the high sensitivity and throughput of transcriptome profiling techniques . \n furthermore , thousands of mirnas with tissue- and disease - specific expression patterns exist in humans . for these reasons , a large amount of information \n in addition to these kinds of research , recent studies suggested that extracellular mirnas may be used as active signaling molecules . \n it was reported that some mirnas released from donor cells exert regulatory effects on the mrnas in recipient cells , functioning as endocrine signals.19 unexpectedly , both precursor mirnas ( pre - mirnas ) and the enzymes required for mirna biogenesis were observed in the extracellular exosomes , enabling the production of mirnas inside the exosomes.20 moreover , those exosomes derived from the cells and sera of breast cancer patients could make normal cells become cancerous.20 these studies and many other reports support the hypothesis that mirna can function as a previously unidentified hormone transferring signals between distant cells.21 \n one simple explanation for the origin of extracellular mirnas is that the death of cells as a consequence of disease or other necrotic events results in the passive release of mirnas in the cytoplasm , and that the released mirnas are detected in the blood . \n although this kind of mirna release is feasible , it is likely that a regulatory pathway is also involved in the cellular release of mirnas . \n initial study found that the mirna profile inside cells differs from the mirna profile in the culture media , which suggests the existence of a selective pathway for the release of mirnas.14 mirnas are found in multivesicular bodies ( mvbs ) , the cellular structure containing vesicles that are released into the extracellular space as exosomes ( fig . \n 3a).22 later , it was shown that neutral sphingomyelinase 2 ( nsmase2 ) is involved in the secretion of mirna - containing exosomes into the extracellular space.23 the secretion of exosomes is triggered by ceramides , whose synthesis is regulated by nsmase2 . \n also , heterogeneous nuclear ribonucleoprotein a2b1 ( hnrnpa2b1 ) was identified to recognize specific sequence motifs in a subset of mirnas and to regulate their sorting into exosomes.24 although these studies identified the factors involved in the release of cellular mirnas into the extracellular space , we still do not understand the detailed mechanism governing this process . \n the elucidation of the mechanism by which mirnas are selected to be released from donor cells , how those specific groups of mirnas are embedded inside the exosomes , and when the release of mirnas is triggered would be helpful for studies attempting to use extracellular mirnas as biomarkers in diseases . \n extracellular mirnas have been discovered in diverse macromolecules in the blood and other body fluids ( fig . \n because of their small size , mirnas can be incorporated into some proteins and protected from nuclease attack . \n ago protein is the most prevalent such protein , because normal biogenesis results in the incorporation of mirna into the ago protein . \n the majority of extracellular mirnas cofractionate with ago2 protein complexes , whereas only a small portion of mirnas are encapsulated in the extracellular vesicles or exosomes in the human plasma.2526 in the bloodstream , various extracellular vesicles or exosomes circulate throughout the body . \n the extracellular vesicles are made by direct budding of the cellular membrane , whereas the exosomes are released from the cells as a result of the fusion of mvbs into the plasma membrane.27 early studies identified diverse mirnas in these extracellular structures ( fig . \n 3b).2829 in addition , many following studies determined the level of those mirnas and showed that the mirna level could be used to predict whether a person has a disease or not.3 another interesting discovery was that extracellular mirnas are embedded in high - density lipoprotein ( hdl).30 the expression profile of mirnas in hdl showed that the mirna population clearly differs between samples from healthy persons and samples from persons with atherosclerosis . \n moreover , the nsmase2-dependent pathway was noted to be involved in the release of mirna - containing hdl from the cells.30 more studies are required to determine whether the alteration of the mirna level in hdl is linked to disease progression . in a recent study , it was shown that vesicle - embedded mirnas injected into the mouse bloodstream could be distributed into diverse tissues and suppress target mrnas in recipient cells.31 moreover , direct in vivo evidence of rna exchange between cells through exosomes was presented in living mice.32 these studies confirmed that mirnas actually circulate throughout the body fluids and function in targeted cells . \n compared with the mechanism of the release of mirna - containing macromolecules , there are no reports regarding the mechanism of uptake . although the receptor for the mirna - containing exosomes or mirna - ago2 complexes has not been identified , it is possible that the specific uptake by target cells might be determined by the presence of a cell surface receptor for those macromolecules . \n it is also plausible that the specificity is determined by the existence of target mrnas in the recipient cells , because only the mrnas containing mirna - binding sites would be influenced . \n more research is required to elucidate the mechanism of both cellular release and uptake of mirnas . \n although most studies to identify mirna biomarkers use blood , plasma , or serum , mirnas are observed in most body fluids ( fig . \n 3c).433 because different mirnas are profiled from each body fluid , researchers should select the proper fluid sample for their purpose \n . widespread distribution of mirnas in the body fluids suggests that mirna biomarkers could be applicable for diverse diseases . \n compared to currently used biomarkers , which are generally based on the levels of specific proteins in the blood , a novel biomarker based on mirna levels has several merits . \n one of the strongest points is that the global mirna level can be measured rapidly and accurately . \n current sequencing technology enables the analysis of billions of sequences in a single run with very high precision.34 the entire mirna population , which is composed of thousands of different sequences in humans , can be rapidly measured owing to high - throughput sequencing technology.35 because diverse mirnas are expressed differentially in different tissues and cellular states , the combination of mirna levels would provide a wealth of information . an early study designed to classify the origin of cancer tissues on the basis of the mirna level showed that the combination of only 48 mirnas was enough to reach near perfect accuracy in the classification of most cancer tissues.36 although a similar study has not been systematically performed using mirna levels in body fluids , it is worth trying a similar approach with the combination of thousands of mirnas in the body fluids . for a new biomarker to be utilized , \n it is essential to have a reagent or a method that can be used to measure the level of the marker with high specificity . \n compared with the technique used to detect nucleic acids , it is more laborious and time - consuming to develop a specific antibody or other kind of detection agent against a protein - based marker . on the other hand , with the help of the robust polymerase chain reaction ( pcr ) and sequencing technologies , \n there is nearly no need to develop a new agent for the detection of novel rna molecules . \n although various biomolecules containing useful information for a disease state may exist in a sample , they would be less reliable if the amount of starting material is too small and the quantity of the molecules can not be measured . in this sense , \n compared with the measurement of protein or other kinds of molecules , for which no amplification method is applicable , pcr - based amplification enables the measurement of very low amounts of mirnas in a small volume of body fluids . \n finally , the high stability of mirnas in the body fluids makes mirna a good candidate for a biomarker . \n as discussed above , mirnas in the blood are protected from nuclease - mediated cleavage . \n other typical longer rnas such as messenger rnas are too long to be protected inside protein complexes or small vesicles . in summary , \n the diversity and stability of mirnas in combination with technical availabilities establish mirnas as novel and promising biomarkers for the diagnosis of human diseases . \n although many new mirnas that can be used as disease markers have been identified in body fluids , more studies are needed before mirnas can be used as reliable biomarkers . \n one of the most critical problems in utilizing mirnas as disease markers is the lack of consistency between reports . \n that is , different and nonoverlapping sets of mirnas have been reported as biomarkers for the same disease . in a study that collected data from several reports in which the mirna level was measured in plasma and serum to identify breast cancer - specific markers \n , there were no overlapping mirnas among all the previously published papers.37 although the exact reason for this discrepancy was not scrutinized , a major reason may be methodological differences in the experimental processes.38 to enable the discovery of more useful mirna biomarkers of diseases and to increase their consistency , several methodological aspects should be considered . \n first , although body fluids contain diverse macromolecules of different composition , subpopulation - specific rna preparation is not considered carefully . in a previous study , for example \n , it was shown that mirna profiles differ considerably between serum and plasma.39 the suspected reason for this difference was that the mirnas were released from blood cells into serum during coagulation . \n also , different sets of mirnas are observed in different populations of extracellular vesicles and exosomes . \n for example , it was shown that different molecules were profiled between exosomes that were morphologically similar but that differed in surface antigens.40 extracellular vesicles of different sizes also have different contents . \n for example , one kind of exosome called an oncosome is larger than typical exosomes and is similar in size to platelets.41 it was reported that a specific group of mirnas enriched in the oncosome enhanced the cancer phenotype . in addition \n , mirnas are also embedded inside different protein complexes . because of these diversities , the mirna profile can be influenced by the choice of subpopulation in the body fluids . \n second , because the amount of mirnas inside the body fluids is small , the profiling of mirnas is greatly affected by minute perturbations of experimental processes . \n for example , we showed that mirna profiles differed considerably when the initial amounts of total rna differed , even though the same rna was used for mirna extraction.42 this is because mirnas are small in size and their secondary structures are strikingly different , resulting in different degrees of precipitation during rna extraction . \n because it is not easy to standardize the initial amounts of rna among fluid samples , mirnas could be extracted with different efficiency from different body fluid samples . \n third , there is still no proper control for the normalization of the mirna level in the body fluids . \n the control rnas generally used for measurement of the cellular mirna level , which include u6 small nuclear rna ( snrna ) and 5s ribosomal rna ( rrna ) , do not give consistent results when used for extracellular mirna control.15 moreover , there is no known mirna with a consistent expression level among the diverse body fluids . \n this problem makes the quantitation of the mirna level and the comparison of mirna levels between published data difficult . \n to overcome the aspects described above , diverse factors should be considered during the preparation of samples and the analysis of results . \n standardized sampling and processing protocols are required , including sample preparation methods , rna extraction methods , and profiling platforms . \n in addition , one should make comparisons only between published data derived from experiments conducted with the use of the same protocol . \n also , detailed protocols for complete processes should be described in the text for later comparison by other researchers . \n because a small amount of cell debris contains a large quantity of rna molecules , it is necessary to ensure that the samples are not contaminated by blood cells during rna extraction process.43 excessive mechanical force should be avoided during the removal of cells from the blood . \n even after excluding the possibility of blood cell contamination , one should be cautious when the identified biomarker is one of the well - known blood cell - enriched mirnas . \n the suspicious mirnas originating from blood cells include mir-150 from lymphoid blood cells ; let-7a , mir-197 , mir-223 , and mir-574 - 3p from myeloid blood cells ; and mir-16 , mir-92a , mir-451 , and mir-486 - 5p from red blood cells.43 it is better to exclude these mirnas . during rna preparation from blood samples , \n of the anticoagulants , edta has a minimal effect on the mirna profile during the sample preparation step.38 on the other hand , heparin and citrate inhibit the pcr , which is the inevitable step for amplifying the small amount of mirnas in body fluid samples . \n because the plasma or serum contains diverse sets of macromolecules , results will be more reliable if researchers measure the expression level of mirnas in a specific subpopulation . \n possible choices of macromolecules include exosomes , extracellular vesicles , hdl , and ago protein . \n the main drawback in purifying a subpopulation is that the experimental process is somewhat laborious and time - consuming . to circumvent this problem , \n . however , controversy exists over whether the data produced from those kits are more reliable than the data obtained by the traditional ultracentrifuge - based method.44 more studies and technical advances are required to make the purification of a subpopulation easier . \n it would also be better if one could purify the extracellular vesicles or exosomes originating from a specific tissue , namely , a diseased tissue . \n it is plausible that proteins or lipids in the membrane of the vesicle may vary among those vesicles originating from different types of cells , although more studies are required to determine whether this kind of approach is feasible . \n some mirnas were repeatedly observed to be increased or decreased in the blood of patients with different types of diseases . \n for example , the level of extracellular mir-21 is known to increase in many diseases , including diverse cancer types , hepatitis , multiple sclerosis , myocardial infarction , and lupus.45 other representative mirnas with expression changes in diverse diseases include mir-16 , mir-126 , mir-146a , mir-155 , and mir-223 . in the case of mirnas included in this list , \n instead , the combination of expression changes based on multiple mirnas would be more reliable as a biomarker . because of the lack of proper endogenous control for normalization , it is recommended to add spike - in rnas , the rna molecules used to normalize measurements , into the same amount of body fluid samples right after the rnasedenaturation step . \n several rnas used for normalization such as u6 snrna or 5s rrna are much more susceptible to degradation than are mirnas . \n representative spike - in rna is the synthetic mirna with the sequence from organisms other than human . \n examples of such spike - in rnas , which are commercially available , include mir-39 , mir-67 , and mir-239b in c. elegans . \n the body fluids may contain not only the mirnas that are altered by disease states , but also other mirnas that are secreted from diverse cells for the purpose of endocrine signals . as a result \n , it might be difficult to distinguish the disease - specific mirna biomarkers from other molecules . in this case , the identification of mirnas that are not detected in the body fluids under normal conditions , but are detected only in a specific disease state , could be a good strategy . \n since the discovery of mirnas in body fluids , many efforts have been made to find reliable biomarkers for diverse diseases on the basis of the mirna level . despite many new discoveries about extracellular mirnas , \n however , more research is needed to increase the reliability of mirnas as promising disease markers . because the experimental method for measuring the amount of mirnas in the body fluids is still not optimized , \n more technical advances are needed . moreover , many gaps still remain in our understanding about the physiological role of extracellular mirnas and the mechanism of cellular release and uptake of mirna - containing molecules . with the complementation of experimental techniques and \n the increase in our knowledge about extracellular mirnas , the use of mirnas as noninvasive biomarkers will become an invaluable tool .", "role": "user" }, { "content": "dysregulation of microrna ( mirna ) levels is observed in diverse disease states . \n early studies showed that by analyzing the expression profile of mirnas in the tissue sample of a diseased person , it was possible to classify the disease into a specific subtype . to be used for diagnostic purposes more practically , however , a less invasive method than tissue biopsy is required . \n surprisingly , it was discovered that a notable amount of extracellular mirnas circulate throughout the body fluids with high stability . \n moreover , the expression profile of mirnas was shown to differ considerably between healthy and diseased people . \n in addition , evidence has been accumulating of extracellular mirnas acting as signaling molecules between distantly located cells . \n if the expression profile faithfully reflects the disease states , the profiling of extracellular mirnas will become a useful means of early warning or diagnosis of diverse diseases , replacing more invasive biopsy methods .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: with 14.7% of 1559-year - olds testing anti - hcv positive , egypt has the highest hcv prevalence in the world . \n although parenteral antischistosomiasis therapy ( pat ) was important in the genesis of egypt 's hcv epidemic this was stopped over 25 years ago and hcv incidence remains high estimated between 150 000 and 500 000 new infections per year [ 24 ] . \n infection from inadequate sterility of dental and medical devices has been shown to play a role in this regard [ 1 , 2 , 512 ] . \n support for this theory comes from studies such as a longitudinal study of incidence in two villages in egypt , which found that the strongest predictor of incident of hcv was having an anti - hcv positive family member . among those that did and \n did not have a family member infected with hcv , hcv incidence was 5.8 and 1.0/1000 person years , respectively . \n this elevated risk of incident of hcv of family members could be due to sharing of implements such as razors or toothbrushes or due to sexual transmission between family members [ 14 , 15 ] . \n alternatively , the elevated risk may be due to shared risk factors ( such as the family members all attending a particular health practitioner ) rather than being caused by direct transmission between family members . to disentangle these relationships \n if a husband , is infected is this associated with an increased risk of his wife being infected and vice versa ? is the risk higher for a spouse than nonspousal family members ? \n are these relationships affected by whether the affected individuals are hcv rna as opposed to antibody positive ? in 2008 \n egypt conducted its first nationally representative survey of hcv prevalence the 2008 egyptian demographic and health survey ( edhs ) . a recently published analysis of this survey found that hcv prevalence increased steadily with age but more so in men than women , reaching , in the 5059-year - age group , 46.3% in men and 30.8% in women . \n hcv was also more prevalent in rural than urban areas and on multivariate analysis it was found to be associated with male sex , age , poverty , past history of pat , and blood transfusion . in urban regions , those with a lack of education and females with genital cutting were more likely to be hcv infected . \n this analysis did not however examine the extent to which hcv infection covaried within couples and families . \n the edhs is the first hcv survey in the world that is both nationally representative and done in a way which enables researchers to link the hcv status of husbands and wives . in this paper \n the edhs entailed a three - stage probability sample that provided a nationally representative sample of 16527 ever - married women aged 1549 who were interviewed about a range of key population indicators ( kpi ) . \n in addition , in a subsample of 4953 households , 6702 women and 6078 men aged 1559 were sampled for a special health topics ( sht ) component ( see figure 1 ) . \n the overall response rate for this latter section was 96.2% and 87.6% for the men and women , respectively . \n this sht component was selected so as to provide a sample which was representative for egypt and the six major areas that the edhs was stratified by : urban and frontier governorates and upper and lower egypt ( each of the latter two was divided into rural and urban areas ) . in order to link husbands and wives , we made use of the fact that 3877 women completed both questionnaires . \n these were the women who had ever been married , were 1449 years old , and completed the kpi questionnaire . \n if the respondent was currently married , then the kpi questionnaire specified the husband 's line number within their house . \n , we established that , in the case of 2591 individuals , the husband of a respondent also completed the sht component of the edhs . in this paper \n we study the relationships between hcv and various risk factors in these 2591 husband - wife pairs . apart from the 5182 individuals in this married subgroup , further 2338 persons aged 1559 years , living in the same houses as the married couples , \n although the outcome variable used in this study is the presence of anti - hcv antibodies in the 5182 members of the married subgroup , the relationship between the hcv serostatus of the married couples and that of the other household members is also of relevance . \n we therefore included the hcv antibody and rna status of these 2338 individuals as exposure variables in our analyses . \n these were used as a measure of local or community hcv prevalence . unless otherwise stated the terms hcv prevalence and infection refer to hcv antibody prevalence . \n the hcv antibody prevalence rates were calculated for a range of potential risk factors available in the special health topics questionnaire . because of the strong association between age and hcv prevalence all the odds ratios and p values given are age - adjusted . \n logistic regression was used to explore the strength of the association of each variable with hcv infection in the 5192 individuals in the married couples cohort . \n these tests revealed that the effect of several of the variables varied according to urban / rural location and men / women . as a result \n , separate models were constructed for men and women as well as urban and rural areas . \n all the urban women who had not undergone female genital cutting were hcv negative . to avoid the collinearity that this created in the analyses , for the analysis limited to urban women , we randomly selected one urban woman who had not undergone female genital cutting and changed her hcv status as positive . \n the final models were constructed by including all variables with p values < 0.2 on univariate logistic regression . \n the education variable was not included due to significant collinearity with the income variable . the hcv status of the spouse and that of the other household members ( both exposure variables ) were represented by hcv rna instead of hcv antibody positivity in the multivariate models due to exerting a stronger effect on the outcome variable ( and considerable collinearity between the rna and antibody hcv tests ) . \n statistical analysis was conducted using stata version 12.0 ( statacorp , college station , tx ) . \n the hcv prevalence rates for the husbands and wives were also stratified by the wives ' excision status to explore how hcv prevalence in both husbands and wives varies according to the excision status of the woman . \n the terms excision and female genital cutting ( fgc ) are used synonymously in the paper . \n the fgc variable was defined as follows : both the women who had experienced fgc and the men whose wives had undergone fgc were coded as 1 and the women and men whose wives had not undergone fgc were coded as 0 . to assess \n the impact of whether hcv prevalence in women was associated with who conducted the fgc , a second fgc variable , termed fgc - operator , was constructed as follows : women with no history of fgc coded 0 , fgc performed by doctor and nondoctor coded as 1 and 2 , respectively . \n the multivariate models for women were run separately with the fgc and fgc - operator variables . \n a third generation enzyme - linked immunosorbent assay was used to detect hcv antibodies ( adaltis eiagen hcv ab , casalecchio di reno , italy ) . \n seropositive specimens were tested for hcv rna using the realtime_m2000 system ( abbott laboratories , abbott park , il , usa ) . \n full details of the survey and sampling strategy have been previously published [ 1 , 16 ] . \n overall hcv antibody prevalence in the married couples was 18.2% ( 95% ci , 16.819.6 ) . \n hcv antibody prevalence was higher in the husbands ( 23.7% ) than the wives ( 12.1% ; p < 0.001 ; see table 1 ) . restricting \n this analysis to the 1549-year - olds reduced the difference in hcv between the husbands and wives ( 18.8% and 11.6% resp . \n hcv prevalence was also higher in rural ( 20.4% ) than urban ( 12.0% ) regions ( p < 0.001 ) . \n hcv prevalence increased steadily with age reaching 30.2% ( 95% ci , 26.833.8 ) in men and 23.9% ( 95% ci , 20.427.7 ) in women in the 4149-year - old category . amongst women \n , there was a stepwise increase in hcv prevalence with increasing number of children : 6.9% if 02 children , 14.1% if 35 children , and 24.5% if more than 5 children . \n there was a lower hcv prevalence in those who had completed secondary level education ( 14.3% ) compared to those with no education ( 23.5% ; p = 0.001 ) and those in the top two income quintiles ( 12.1 and 12.9% ) compared to those in the poorest quintile ( 22.8% ; p < 0.001 ) . \n hcv prevalence in persons who had received pat ( 32.1% ) was higher than in those who had not ( 16.5% ; p < 0.001 ) . \n women with excision had a trend to higher hcv prevalence ( 12.5% ) than those without ( 3.9% ; \n p = 0.096 ; see tables 1 and 2 ) . men whose wives had been excised had a higher hcv prevalence than those whose wives had not ( 23.7% versus 8.3% ; p = 0.003 ) . \n women who had been excised by a doctor had a lower hcv prevalence than those excised by a nondoctor ( 5.6% versus 13.7% ; p = 0.003 ) . \n respondents who had received a blood transfusion had nonsignificantly higher hcv prevalence rates than those who had not ( 26.9% versus 17.8% ; p = 0.132 ) . \n hcv prevalence increased with length of marriage , increasing from 8.2% to 17.6 and 29.6% in those married for ten years or less , 1120 years , and over 20 years , respectively . \n persons with an hcv seropositive partner had a higher hcv prevalence than those who did not ( 32.6% versus 15.1% ; p < 0.001 ) . \n this effect was also evident if one 's partner was rna positive for hcv ( 34.7% versus 15.9% ; p < 0.001 ) . \n the effect was not as marked if it was another member of the household who was hcv antibody ( 23.3% versus 17.7% ; p = 0.004 ) or rna positive ( 23% versus 17.9% ; p = 0.015 ) . \n in the multivariate logistic regression analyses , three variables were associated with hcv infection in all models ; see table 3 . these were age , local hcv prevalence , and having a spouse who was infected with hcv . \n having a nonspousal household member who was hcv infected was not independently associated with hcv . for both men and women hcv was less prevalent in the richer quintiles but in the case of men \n hcv was associated with a blood transfusion in women but this association only applied to the rural areas . \n pat was associated with hcv in all the models except in the men in the rural and the women in the urban areas . \n being married for longer than 20 years was associated with hcv , but only for men . \n this relationship in men was driven by a relatively strong association in urban areas . amongst the women \n , there was no association between fgc and hcv overall but in urban areas none of the women who were not excised were hcv infected . in the second set of women 's models substitution of the fgc variable with the fgc - operator variable had little effect . \n fgc had no effect in rural areas and a strong effect in urban areas regardless of whether it was conducted by a doctor or nondoctor ( data not shown ) . \n the edhs reveals that , of the women who had undergone fgc , 99.9% had done so by the age of 18 . \n of the women aged 1518 surveyed in the edhs , the hcv prevalence was significantly higher in those who had been excised ( 39/723 ; 5.4% ) than those who had not ( 0/164 ; 0% , p = 0.028 ) . \n there was no evidence of interaction between the wife 's fgc status and hcv status of the partner variables . \n linking husbands and wives allowed us to test the association of hcv infection between husbands and wives . \n this represents the first time that this has been done in a nationally representative hcv survey . \n the sampling strategy used to describe the epidemiology of hcv in the usa , although nationally representative , does not include sexual partners in a linked way that would allow a similar analysis . \n this is true for analyses limited to rural and urban areas and for subanalyses of men and women within these areas . \n the relationship is slightly stronger when the hcv in the partner is measured with an rna - based as opposed to an antibody - based test . \n if not due to confounding , this association may be due to nonsexual intrafamilial transmission ( such as shared utensils , toothbrushes , and razors ) , sexual transmission , or shared risk exposures ( such as attending to the same health care practitioner ) . \n if the former was predominant then we should expect an association between hcv infection in nonspousal family members and in respondents . \n there was no evidence of such an association in any of the multivariate models . in our models we controlled for a large number of plausible , shared risk exposure types ( such as blood transfusions , multiple injections , and pat ) , but these did not affect the strength of the relationship between respondent and partner hcv status . \n the stronger association between the respondent 's hcv status and that of their wife / husband as opposed to that of other family members may be mediated by the greater length of time they spent together . \n the fact that there is a relationship between length of marriage and hcv infection ( for men ) could be interpreted as supporting evidence for this idea . \n an alternative explanation , and one that is also supported by the relationship between hcv infection and length of marriage , is that sexual transmission between partners is responsible for the relationship of hcv infection in married couples . \n we can not however exclude the possibility that the reason why the association between the wife and the husband 's hcv status remains strongly positive after controlling for the hcv status of the other household members is due to the partner 's hcv status being a better measure of general ( nonsexual ) infection pressure than the hcv status of the other household members . in the models we do control for the hcv in the surrounding community , but this is defined at the level of the governorate . \n there is a strong relationship between hcv infection and fgc in the urban areas but none in the rural areas . \n for the men in the urban areas there is an association between hcv infection and having a wife who was excised ( or 3 ; 95% ci , 1.17.9 ) . in the case of women , \n though this is possible , it should be noted that it is circumcision by nondoctors that is most strongly correlated with hcv infection and in rural areas the proportion of fgc performed by nondoctors is higher ( 84.2% ) than in urban areas ( 73.0% ; p < 0.001 ) . \n another possibility is that fgc is so prevalent in the rural areas ( 97.2% ) that there are too few nonexcised women to be able to demonstrate an effect of fgc on hcv prevalence . \n for example , in two of the other studies , to consider the impact of fgc on hcv in egypt , no effect was found , but this may have been due to the extremely low numbers of persons not excised . in the first study there was only one person ( out of 1989 individuals in the survey over the age of 20 ) who was not excised . in the second study , \n only 4 women out of 1051 ( 0.4% ) over the age of 30 were not excised . \n this study found a nonsignificant increase in the risk of hcv infection in those women who had been excised by an informal health care provider as opposed to those nonexcised combined with those excised by a formal health care provider ( or 1.6 ; 95% ci , 0.73.8 ) . in a separate analysis of the edhs a strong ecological association \n a population - based , cross - sectional study from the gambia , for example , found a strong association between prevalent fgc and herpes simplex virus-2 infection ( or 4.7 , 95% ci , 3.76.4 ) and a weaker association between fgc and bacterial vaginosis . \n a case - control study of primary infertility in sudan found more extensive forms of fgc to be more prevalent in the cases . there were too few cases and controls without fgc in sudan study to allow any analysis of those with versus those without fgc . \n a case control study of the determinants of infertility found that cases were more likely to have been excised by a traditional practitioner and more likely to have had more extensive forms of fgc . \n what could be the possible mechanisms for fgc to result in increased rates of hcv for both men and women ? \n the higher hcv prevalence in excised versus nonexcised 1518-year - olds in the edhs could be interpreted as evidence supporting this nonsterility hypothesis . \n in addition , hcv transmission at the time of fgc could have been greater in the past when a considerably greater proportion of fgc procedures were performed by nondoctors . \n two studies from egypt have found an association between male circumcision performed by informal health care providers and prevalent hcv infection [ 5 , 24 ] . \n the anatomical changes produced by fgc , particularly the more extensive forms of fgc , could also promote subsequent female to male and male to female hcv transmission . \n it is biologically plausible that fgc could both enhance women 's susceptibility to the sexual transmission of hcv and increase the chances that hcv is transmitted to their partner . \n we can not however exclude the possibility that the relationship between fgc and hcv is due to an unmeasured confounding variable . \n there is considerable controversy in the literature about the extent to which hcv can be transmitted by sexual contact and cohabitation . in general most studies and two systematic reviews \n have found that hcv can be transmitted sexually but that the risk of infection is low [ 14 , 25 ] . \n the most recent systematic review tried to make sense of the conflicting results by dividing the studies into those from high ( japanese ) and low ( non - japanese ) prevalence regions . \n they found that pooling the results of studies along these lines provided strong evidence of increased hcv prevalence in offspring of affected persons in endemic areas but no such effect in nonendemic areas . \n in contrast they found evidence of an increased hcv prevalence amongst the spouses of persons who were hcv seropositive in nonendemic areas but no evidence for this effect in endemic areas . \n one interpretation of these apparently discordant findings is that hcv prevalence in spouses of hcv seropositive persons was not higher than controls in endemic areas as the prevalence in the controls was so high . in endemic settings \n , transmission rates may be so high that close to all susceptible persons are infected by the time they are married . \n sexual transmission was shown to occur in low prevalence areas such as usa but not in high prevalence areas such as east asia [ 26 , 27 ] . \n more recent studies have found evidence of spousal transmission of hcv in endemic areas [ 5 , 6 , 11 , 13 , 2830 ] . \n genotypic studies provide further evidence of the spousal transmission of hcv [ 8 , 15 , 30 , 31 ] . in egypt \n there is an increasing amount of evidence that intrafamilial transmission is an important source of new infections [ 5 , 13 , 29 ] . \n two prospective studies investigating the correlates of incident of hcv in egypt have found evidence of intrafamilial transmission [ 13 , 32 ] . \n one of these was a study that followed up a cohort of 6734 hcv antibody negative persons from 2 rural villages over a median of 1.6 years . in this time \n there were 33 new hcv infections , 27 of which occurred in families with an anti - hcv positive member . \n parenteral factors were not associated with an elevated hcv incidence and in 21 of the cases there was no history of any parenteral exposure . \n hcv incidence per 1000 person years was higher in spouses of hcv antibody positive as opposed to antibody negative persons ( 13.1 versus 1.9 ; p = 0.08 ) . \n men and women with anti - hcv positive spouses were 7 and 2 times as likely to seroconvert as those with seronegative spouses . \n hcv incidence in children increased in a stepwise manner if they had one of two parents who is hcv antibody positive . \n a number of other studies have found marriage to be a risk factor for hcv infection but not all of these are controlled for age , which is likely a significant confounder [ 5 , 6 , 29 ] . \n one study found that parenteral factors only play a part in explaining prevalent cases in those over the age of 20 in egypt . \n one way of tying together the seemingly discordant findings about the extent of intrafamilial hcv transmission from different studies around the world is to apply the insight from hepatitis b virus epidemiology that the predominant mode of transmission may vary considerably between different regions of the world . \n hepatitis b transmission in east asia is predominantly perinatal , in usa it is largely sexual and intravenous drug use [ 33 , 34 ] , and in sub - saharan africa an important cause is horizontal transmission between children through poorly defined mechanisms [ 3537 ] . in usa , iatrogenic and intravenous drug usage have been shown to be the dominant modes of hcv transmission . \n there is mounting evidence that sexual transmission is important in hcv outbreaks of men who have sex with men . \n the best quality evidence however suggests that sexual transmission has not played a large role in hcv transmission among heterosexuals in the usa [ 17 , 39 ] . \n however , most individuals infected by this route clear the virus spontaneously [ 6 , 40 ] . \n unsterile procedures have clearly played an important role [ 1 , 2 , 68 , 11 ] . a large proportion of cases are however not explained by these factors [ 1 , 6 , 9 , 13 ] . \n our study backs up the evidence from elsewhere of the likelihood of horizontal spread between family / household members [ 5 , 9 ] . \n some of this may be sexual but much is likely to be via other , as yet unclearly defined , mechanisms . \n the findings presented here also build on the evidence from elsewhere that fgc may have played a role in the spread of hcv both at the time of the procedure and via enhancing the sexual transmission of hcv . \n the edhs was a cross - sectional survey and thus the direction of any implied causation can not be established . \n only 5182 individuals ( out of 11126 individuals surveyed in the special health topics sample ) could be linked together to provide the wife - husband dyad sample used for this analysis . furthermore the limitations imposed by the linking process meant that the ages of the husbands were from a wider age - band ( 1559 years old ) than that of the wives ( 1549 ) . \n because of these limitations , the sample we used can not be assumed to be representative of whole egypt . \n the uni- and multivariate analyses of the married couple subsample are , however , remarkably similar to those found in analyses of the entire sample of 11126 respondents ( presented in guerra et al . ) . \n given the ongoing high incidence of hcv in egypt , further research is needed to better define the mechanisms for intrafamilial spread so as to guide new prevention strategies . in particular further research is needed to ascertain if fgc is an effect - modifier in the sexual transmission of hcv .", "role": "user" }, { "content": "objective . to identify the risk factors for hcv infection within married couples in egypt \n . methods . in 2008 \n egypt conducted its first nationally representative survey of hcv prevalence . \n 11126 of the 12780 individuals aged 1559 year who were sampled agreed to participate and provided information via a questionnaire about demographic and behavioural characteristics and blood for hcv antibody and rna analysis . \n we assessed the risk factors for hcv infection in a subsample of 5182 married individuals via multivariate logistic regression . \n results . overall hcv antibody prevalence in \n the married couples was 18.2% ( 95% ci , 16.819.6 ) . \n hcv antibody prevalence was higher in the husbands ( 23.7% ) than the wives ( 12.1% ; p < 0.001 ) . having a spouse who was infected with hcv was an independent risk factor for hcv infection with odds ratios of 2.1 ( 95% ci , 1.62.9 ) and 2.2 ( 95% ci , 1.63.1 ) for women and men , respectively . \n husbands whose wives had experienced female genital cutting ( fgc ) had a higher prevalence of hcv and this relationship was driven by a strong association in urban areas . amongst the women \n there was no association between fgc and hcv overall but in urban areas only women who had experienced fgc were hcv infected . \n conclusions . \n this study provides additional evidence of the importance of intrafamilial transmission of hcv in egypt .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: gestational diabetes mellitus ( gdm ) has been defined for many years as any degree of glucose intolerance with onset or first recognition during pregnancy . according to the hyperglycemia and adverse pregnancy outcomes ( hapo study ) , a large - scale multinational epidemiologic study \n , the risk of adverse maternal , fetal , and neonatal outcomes continuously increases as a function of maternal glycemia at 2428 weeks of gestation . \n there was no threshold for most of these complications , but preventing and early identifying gdm is a growing health concern . because the prevalence of gdm is increasing in a similar way to the ongoing epidemic of obesity and type 2 diabetes in women of child - bearing age , understanding the significance of risk factors becomes of highlighted importance . \n nonmodifiable risk factors such as past history of gdm and increasing maternal age have been identified [ 4 , 5 ] . \n however , the impact of diet and lifestyle modifiable risk factors has not yet been systematically synthesized [ 6 , 7 ] ; they can be different in countries of the mediterranean area , and only preliminary data are known . \n the aim of this study is to establish a risk appraisal model for gdm by identifying modifiable factors that can help predict the risk of gdm in a large population of women living in spain and target early intervention , at the time of screening for gdm , with the potential of preventing the development of or ameliorating gdm . \n participants were recruited from women attending prenatal care at our hospital during the years 2009 - 2010 , at 2428 weeks of gestation , when screening for gdm was performed . \n a total of 2194 women were invited to participate and gave their written informed consent . \n the study was approved by the ethical committee of the hospital clnico san carlos and was carried out following the principles expressed in the helsinki declaration . \n table 1 shows a summary of the demographic and anthropomorphic characteristics of the study population , according to the positive or negative diagnosis of gdm . \n women were screened for gdm based on the two - step american diabetes association recommendations : at week 2428 of gestation , women with no previous history of diabetes mellitus were assessed , after a 12-hour fasting and no diet restriction on previous days , via the o'sullivan test ( os ) . when plasma glucose levels one hour after glucose load were 7.2 mmol / l ( 140 mg / dl ) , a further 100-gram ogtt was performed , and new glucose levels were measured while fasting and 1 , 2 , and 3 hours after the intake . \n these questionnaires were used to gather information on sociodemographic , anthropomorphic and behavioral characteristics , and reproductive and medical histories . \n the following were stratified in a semiquantitative way : history of smoking habit ( never , smoke to 6 months before pregnancy , to pregnancy , \n currently ) , pregestational and gestational physical activity ( walking frequency , climbing up stairs per day and at least 30-minute moderate intensity sports per week ) , and pregestational and gestational weekly intake of vegetables , salads , fruit , dried fruits , nuts , blue fish , whole wheat bread , legumes , skimmed dairy products , red and processed meats , sauces , sugared drinks and sodas , juices , biscuits , pastries , alcohol , coffee and water . \n regarding medical history , three groups were analyzed : obstetric history , which included previous abortion , gdm and hypertension ; personal medical history , which considered overweight , dyslipidemia , hypertension and altered glucose metabolism ; family history , which grouped diabetes , obesity , dyslipidemia and hypertension . \n answers were reorganized according to the number of events in each category , and the differences between the gdm and non - gdm groups were analyzed ( table 2 ) . \n the relationship between the nonmodifiable factors age , pregestational weight , ethnicity , and personal and family past medical history , and the independent variable gdm , was assessed . \n the population 's lifestyle habits were evaluated , and the chi - square test was used to investigate the existence of possible differences in their association to the characteristic of gdm / non - gdm . to analyze the effects of the different items of lifestyle habits , a generalized lineal model of binary logistic type was performed . \n the dependent variable was the diagnosis or not of gdm ; reference category was taken as value 0 , meaning non - gdm , whilst diagnosis of gdm was taken as value 1 . \n seventeen items were selected as predictors of gdm : ten related to pregestational intake of nutrients ( biscuits and pastries , red and processed meats , fruit , dried fruit and nuts , skimmed dairy products , legumes , whole wheat bread , blue fish , sauces , vegetables and salad ) ; four regarding pregestational consumption of beverages ( water , alcohol , sugared drinks and juices and coffee ) ; three related to pregestational physical activity ( sports , light walking and climbing up stairs ) . for each of the previous indicators , \n intensity was graded according to an ordinary increasing scale with three category levels ; low , medium , and high . \n missing values were excluded from the analysis . a model of the principal effects of each of the factors considered was chosen , including the intercept . \n type iii analysis was used because of the fact that the items considered do not follow any specific arrangement . to be able to refine and improve the interpretation of the results of the generalized lineal model of binary logistic type , an automatic lineal regression analysis of the model was elaborated . \n the characteristic of gdm was again considered the outcome , and all of the items previously referred to regarding lifestyle habits were taken as entry predictors . \n the option of automatic preparation of data was selected ; this option may group some of the categories of the items so that the procedure 's predictive capacity can be optimized . \n mean age of the pregnant women enrolled in the study was 31.35 years old [ range 1347 ] . \n diagnosis of gdm was confirmed in 213 ( 9.7% ) women ( table 1 ) . \n differences in gdm rate were observed between ethnicities ( p 0.05 ) , although it must be pointed out that the number of african and asian women in the sample was small . \n age , pregestational bw and bmi did not follow a normal distribution ( kolmogorov - smirnof test , p < 0.001 in all cases ) . \n independent samples of mann - whitney u test used to compare the effect of these variables on the diagnosis of gdm showed significant differences between the gdm and non - gdm groups . \n however , some of these differences were not observed when comparisons according to the different ethnicities were made ( table 1 ) . the distribution of the number of events related to medical history , according to the different ethnicities , for the gdm and non - gdm groups is shown in table 2 . \n the chi - square test showed significant differences for some of the comparisons and these were more evident when cases for which events were unknown were excluded . \n again , it is worth mentioning the fact that , in some cases , the number of observations was small . \n the colored bar represents the distribution of the intake levels or practice frequency of each lifestyle item . \n significant differences in the intake of red and processed meats ( p = 0.023 ) , sugared drinks ( p = 0.035 ) , and coffee ( p = 0.022 ) were found . \n we observed a trend for differences in biscuits and pastries ( p = 0.068 ) and lifestyle habits related to sports and light walking ( p = 0.073 and p = 0.088 , resp . ) . \n differences among the remaining factors were not found . when comparing distributions by pairs , the following significant differences were found : high intake of biscuits and pastries ( > 4/week ) , red and processed meats ( > 6/week ) , sugared drinks ( > 4/week ) , and coffee ( > 3/day ) , and low level of practice of sports ( < 2 days / week ) and light walking ( < 30 minutes / day ) was greater amongst gdm . low intake ( < 2/week ) of sugared drinks was greater in non - gdm . \n the significant coefficients observed were red and processed meats = 36 times / week ( b = 0.423 ; p = 0.015 ) ; coffee = 2 - 3 times / day ( b = 0.472 ; p = 0.051 ) ; sauces = 24/week ( b = 0.394 ; p = 0.058 ) ; practice of sports = less than 2 times / week ( b = 0,676 ; p = 0.038 ) . \n automatic lineal modeling discarded all except the following factors : biscuits and pastries , red and processed meats , sugared drinks , coffee , light walking , and sports . \n the model reclassified the values as shown in table 4 in order to optimize the signification level . \n bearing this fact in mind , the logistic regression using the transformed variables as independent variables was applied . \n the signification of factors are now biscuits and pastries < 4/week ( p = 0.118 ) , red and processed meats < 6/week ( p = 0.017 ) , sugared drinks < 4/week ( p = 0.146 ) , coffee < 3/day ( p = 0.066 ) , light walking < 60 minutes / day ( p = 0.310 ) , and sports < 2 days / week ( p = 0.026 ) . the corresponding odds ratio ( or ) at 95% ci \n the prevalence of gdm in different ethnic populations has been reported between 1 and 17.8% [ 11 , 12 ] . \n the number is steadily increasing , and it is becoming a growing health concern during the last decade . according to data obtained in this study , \n the prevalence of gdm was between 217% , similar to figures previously reported . considering this number , \n the purpose of our study gains importance , as potential nutritional intervention could be carried out to avoid progression of prevalence . \n previous risk factors established for gdm , including prepregnancy bw and bmi , age and history of gdm [ 14 , 15 ] , were confirmed in this study as independent predictors of glucose intolerance . regarding the distribution of eating habits , \n several published case - control and prospective cohort studies have examined associations of diet with gdm [ 1621 ] . \n they mostly agreed that diet with low fiber , low complex carbohydrates and high glycemic load was associated with an increased risk of gdm . according to data obtained in this study , \n differences between the gdm and the non - gdm group in the distribution of the intake of biscuits and pastries , red and processed meats , coffee and sugared drinks were found . \n the association of these factors to the risk of developing type 2 diabetes is widely known , and because of the increasing prevalence of the analogous gdm , several published studies have begun to study this association . \n our data support these previous findings and go one step further in providing new information ; they show which types of food are related to higher risk of developing gdm and with what odds . \n we can then calculate a coefficient of risk based on the level ( low , medium , or high ) of the factor considered and evaluate how the odds of being diagnosed as gdm are modified . by using generalized logistic regression and an automatic lineal regression model , we could identify the factors related to gdm . \n this stratification would not be possible for all of the items in the questionnaire because for some of the options data would be insufficient . to be able to assure the influence of these factors despite other circumstances such as age or ethnicity , \n our study population should be greater , allowing a greater number of women diagnosed with gdm . \n if we look at the results regarding coffee intake , although its association with type 2 diabetes has been widely studied [ 22 , 23 ] , there are few papers that consider its role in pregnant women . \n the systematic review of van dam and hu concluded that habitual coffee consumption was associated with a substantially lower risk of type 2 diabetes , but wedick et al . \n , on the other hand , could not demonstrate changes in glycemia or insulin sensitivity with coffee consumption . \n the study by adeney et al . concluded that moderate prepregnancy caffeinated coffee consumption may have a protective association with gdm . \n our study agrees with these previous findings and emphasizes the fact that a higher level of consumption can nullify this protective effect . \n a possible explanation for this is that , in spanish population , an increase in coffee intake is associated with an increase in the intake of whole milk and sweets . \n previous data have described that this is one of the strongest predictors contributing to the inverse association to gdm [ 15 , 2527 ] , and the results of a recent systematic review and meta - analysis demonstrated that greater physical activity before or during early pregnancy is significantly associated with lower risk of gdm , with the magnitude of the association being stronger for prepregnancy physical activity . \n our results agree with these previous studies , showing that the less exercise women practiced prior to pregnancy , the more likely they were to develop gdm , and vice versa , the more exercise , the less likely the diagnosis of gdm . \n firstly , data regarding information on sociodemographic anthropometric and behavioral characteristics was gathered via self - report in questionnaires . \n although these were completed with supervision of a trained nurse , we can not rule out possible imprecision of pregestational bw and misclassification of food frequency intake and lifestyle habits . \n this is a common bias in any nutritional epidemiological study , but we assume , however , that bias would occur in a constant and random way , especially because women were unaware of their gdm diagnosis at the time of assessment , and the resulting error would be minimized . \n for example , women with higher bmi may tend to underreport their food intake , either globally or with specific foods , such as junk foods . \n this introduces a source of confounding that is difficult to account for statistically , although , again , we assume that the magnitude of the error is low , because women were unaware of the ogtt result . \n instructions for women attending prenatal care for gdm screening were the same for all participants , all had no previous history of diabetes mellitus and all glucose determinations were made in the same laboratory . \n allows a plausible temporal relationship between behavioral characteristics and gdm , which usually develops after the second trimester . in conclusion , promoting healthy lifestyle habits among women of reproductive age , such as moderate intake of coffee , low intake of biscuits and pastries , sugared drinks and red and processed meats , and regular physical activity , may represent a promising approach for the prevention of gdm and subsequent complications of children born from pregnancies affected by gdm . \n moreover , if we know what a woman 's pregestational lifestyle habits are before the screening for gdm , we can predict how the risk is modified , in relation to the population 's prevalence . however , further intervention studies are needed to evaluate if this appraisal model of risk calculation can be useful for prevention and treatment of altered glucose metabolism during pregnancy . \n it is still unknown whether intervention in dietary habits and beginning an exercise routine before pregnancy results in gdm prevention . \n further research and cost - effectiveness studies are warranted to establish the possible risk reduction and economic benefit .", "role": "user" }, { "content": "the aim of this study is to establish a risk appraisal model for gdm by identifying modifiable factors that can help predict the risk of gdm in a large population of 2194 women living in spain . \n they were recruited between 2009 - 2010 when screening for gdm was performed . \n participants completed a questionnaire on socio - demographic , anthropomorphic and behavioral characteristics , and reproductive and medical history . \n a total of 213 ( 9.7% ) women were diagnosed as having gdm . \n age , pregestational body weight ( bw ) and body mass index ( bmi ) , and number of events of medical , obstetric and family history were significantly associated with gdm . \n after logistic regression model , biscuits and pastries intake < 4 times / week , red and processed meats intake < 6 servings / week , sugared drinks < 4 servings / week , light walking > 30 minutes / day , and 30 minutes / day of sports at least 2 days / week , compared with opposite consumption , was associated with less gdm risk . \n our study identified several pregestational modifiable lifestyle risk factors associated with an increase in the risk of developing gdm . \n this may represent a promising approach for the prevention of gdm and subsequent complications . \n further intervention studies are needed to evaluate if this appraisal model of risk calculation can be useful for prevention and treatment of gdm .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: more than 97% of a human genome consists of noncoding dna , the function of which was unknown until recent years . \n microrna ( mirna ) is a subclass of noncoding rna that is involved in a wide variety of physiological and developmental events , including developmental timing , embryonic patterning , cell fate determination , cell lineage differentiation , cell proliferation , apoptosis , organogenesis , growth control , and metabolism [ 1 , 2 ] . \n mirnas are single - stranded molecules consisting of about 18 to 27 ribonucleotides in length and regulate the expression of other protein - coding genes through an intracellular gene silencing mechanism named rna interference ( rnai ) . \n mirnas can be located within the noncoding dna or protein - coding region of dna [ 2 , 3 ] . \n after transcription , instead of being translated the primary mirna transcript ( pri - mirna ) is processed by drosha - like endoribonucleases to a hairpin - like stem - loop precursor , termed pre - mirna . \n further processing of the precursor by dicer - like endoribonucleases results in a single - stranded mature mirna which subsequently forms an rna - induced silencing complex ( risc ) with argonaute proteins and binds complementarily to matched sequences of one or more messenger rnas ( mrnas ) for executing targeted gene silencing through either direct mrna degradation or translational suppression . \n many introns and untranslated regions ( utrs ) of mrnas also contain tri- or tetranucleotide repeat expansions , capable of being transcribed and processed into repeat - associated micrornas ( ramrnas ) [ 47 ] . \n intronic mirna is a subset of mirna that is derived from the noncoding dna regions of a gene , such as the intron or 5- and 3-utr . in vertebrates , \n first , mirna is transcribed as a long primary precursor microrna ( pri - mirna)by type ii rna polymerases ( pol - ii ) from the intron or utr of a primary gene transcript . \n second , after intron splicing , the long pri - mirna is excised by spliceosomal components and may be further processed by other drosha - like rnaseiii endonucleases / microprocessors to form precursor microrna ( pre - mirna ) [ 811 ] . \n however , intronic mirna precursors may also bypass drosha processing . during the third step , the pre - mirna is exported out of the cell nucleus into the cytoplasm , by ran - gtp and exportin receptors [ 13 , 14 ] . \n fourth , once in the cytoplasm , a dicer - like endoribonuclease cleaves the pre - mirna to form mature mirna [ 9 , 10 ] . \n finally , the mature mirna is assembled into a ribonuclear particle ( rnp ) to form an rna - induced silencing complex ( risc ) or rna - induced transcriptional silencing ( rits ) complex for executing rnai - related gene silencing mechanisms [ 9 , 10 , 15 , 16 ] . \n although the biogenic pathways of small interfering rna ( sirna)/small hairpin rna ( shrna ) and mirna are thought to be relatively comparable , many characteristics of the mechanistic components are distinctly different from each other [ 17 , 18 ] . in zebrafish \n , we have observed that the stem - loop structure of intronic pre - mirna is involved in strand selection for mature mirna during mirna - associated risc ( mirisc ) assembly . \n furthermore , unlike the sirna / shrna pathway , excessive rna accumulation can be prevented by the intracellular nonsense - mediated decay ( nmd ) mechanism , a specific rna degradation system for unstructured spliceosomal introns . \n these findings indicate that the sirna / shrna pathway is likely lacking some advanced properties required for the regulation of intronic mirna generation and function . \n given that natural evolution leads to more complex and variable introns in higher animals and plants for the coordination of gene expression volumes and interactions , an intronic repeat expansion or deletion may cause dysregulation of some mirna biogenesis or mirna - targeted interactions and thus lead to triplet repeat expansion diseases ( treds ) . as shown in table 1 , \n currently identified treds include dentatorubral - pallidoluysian atrophy ( drpla ) , fragile x mental retardation syndrome ( fxs ) , friedreich ataxia ( frda ) , huntington 's disease ( hd ) , myotonic dystrophy ( dm ) , spinobulbar muscular atrophy ( sbma ) , and a number of spinocerebellar ataxias ( scas ) . \n one commonality between these treds is that they all express mutant genes with elevated expansion of either cgg / ccg ( fxs / fxtas ) or cat / ctg ( others ) . \n however , the correlation between the intron - encoded repeat - associated microrna ( ramrna ) and its related tred remains to be determined . in order to understand the role of a specific ramrna in the pathogenic mechanism \n , we must first identify the structure and function of the rna molecular associated with a tred . \n for years the existence of ramrna has been speculated [ 5 , 7 , 19 ] . \n several groups have suggested a correlation between rna toxicity and treds [ 2026 ] ; however , there has been no evidence linking a specific ramrna to a tred . in this paper , we will describe the process of discovering the first ramrna identity and how it was used as a tool to establish a transgenic animal model for studying its function in vivo . \n in 2006 , our group successfully found and isolated the first native ramrna identity , mir - fmr1 , which is involved in the pathogenetic development of fragile x syndrome ( fxs ) in a zebrafish model [ 4 , 6 ] . \n there are two isoforms of the primary mir - fmr1 ramrnas , mir - fmr1 - 27 and mir - fmr1 - 42 , both of which are derived from the fmr1 5-utr cgg repeat region approximately 65-nucleotide upstream of the translational start codon ( accession number nm_152963 ) ( figure 1(b ) ) . \n these two isoforms contain the same seed and core sequence to interact with the zebrafish fmr1 gene and/or its gene transcripts . \n northern blotting of the two mir - fmr1 isoforms isolated from either the cytoplasm or nucleus of the pallium neurons further demonstrated that mir - fmr1 - 42 is the only ramrna accumulated in the nucleus of the fxs neurons . accompanying nuclear mir - fmr1 - 42 accumulation , a significant increase of genomic dna methylation in the fmr1 5-promoter upstream region was also identified using bisulfite sequencing assays . \n fxs - related dna methylation occurs mostly in the cpg - rich binding sites of several fmr1-associated transcriptional cofactors , such as nrf1 ( gcgcgc ) , sp1 ( gc box ) , and usf1/usf2 ( e box ) , resulting in transcriptional silencing of the fmr1 gene . \n the tissue - specific expression pattern of both mir - fmr1 ramrnas in the zebrafish brain has also been identified using fluorescent in - situ hybridization ( fish ) with a locked nucleic acid ( lna ) probe directed against the mir - fmr1 seed and core sequence [ 4 , 6 ] . as shown in figures 1(a ) and 1(c ) , the normal expression pattern of mir - fmr1 is limited in the neuronal bodies and nuclei but not the dendrites of the hippocampal - cortical junction , hippocampal stratum radiatum , and cerebellum neurons . in fxs brains , \n the presence of mir - fmr1 is however further extended into the dendrites of these neurons and hence causes synaptic deformity . \n such broader mir - fmr1 distribution throughout the dendrites may serve as a marker for fxs diagnosis . \n it should be noted that mir - fmr1 - 42 has a unique pre - mirna structure consisting of ( a ) multiple loops and short matched stems in a relatively long hairpin precursor , ( b ) a nuclear import signal ( nis ) motif ( probably to allow the reentry of the mature ramrna into the cell nucleus ) , and ( c ) a c / g - rich gene binding motif to recruit dna methylation machinery ( figure 1(b ) ) . \n deletion of the nis motif from the mir - fmr1 - 42 precursor has been shown to significantly increase mir - fmr1 accumulation in the cytoplasm , but not the nucleus of the neurons , suggesting that nis is responsible for the nuclear entry of mir - fmr1 - 42 . \n these characteristics support a novel disease model in which mature ramrnas originating from the trinucleotide repeat expansion of a gene can reversely bind back to the corresponding triplet repeat regions of the gene . \n individuals with more trinucleotide repeats in the gene generate more mature ramrnas . as more ramrnas binding back to the targeted gene , dna methylation of the triplet repeat regions of the gene occurs , consequently leading to targeted gene inactivation . \n due to our discovery of ramrna and its function in dna methylation , this ramrna - induced dna methylation model may provide further important insights into the mechanism underlying specific gene inactivation in treds . \n fxs is one of the most common neuropsychiatric and mental retardation disorders in humans , affecting approximately one in 2000 males and one in 4000 females . in boys , \n characteristic features of fxs include a long face , prominent ears , large testes , delayed speech , hyperactivity , tactile defensiveness , gross motor delays , and autistic behaviors . \n the disease is caused by a dynamic mutation ( expansion of microsatellite - like trinucleotide(cytosine - guanine - guanine)repeats or termed r(cgg ) ) at an inherited fragile site on the long arm of the x chromosome , located at the fmr1 gene . due to the dynamic nature of this mutation \n , trinucleotide repeats can increase in length and hence in severity from generation to generation , from person to person , and even within a given person . \n patients with fxs have an increased number of r(cgg ) > 200 copies in the 5-utr of the fmr1 gene [ 20 , 28 , 29 ] . \n the cpg - rich r(cgg ) expansion region is often heavily methylated , with a methyl group replacing the hydrogen atom of cytosine ( c ) and thus the cytosine is conversed to 5-methylcytosine in the fmr1 5-utr . \n such r(cgg ) expansion and methylation leads to physical , neurocognitive , and emotional characteristics linked to the fmr1 inactivation and the deficiency of its protein product fmrp . \n fmr1 encodes an rna - binding protein , fmrp , which is associated with polyribosome assembly in an rnp - dependent manner and is capable of suppressing translation through an rnai - like pathway that is important for neuronal development and plasticity . \n fmrp also contains a nuclear localization signal ( nls ) and a nuclear export signal ( nes ) for shuttling specific mrnas between nucleus and cytoplasm [ 30 , 31 ] . \n hence , excessive expression of r(cgg)-derived ramrnas during embryonic brain development may cause early fmr1 gene inactivation , leading to the pathogenesis of fxs . \n first , handa et al . found that noncoding rna transcripts transcribed from the fmr1 r(cgg ) expansion can fold into rna hairpins and are further processed by rnaseiii dicer to suppress the fmr1 expression . \n proposed that mirna - mediated gene methylation may occur in the cpg regions of the fmr1 r(cgg ) expansion , which are targeted by hairpin rnas derived from the 3-end of the fmr1 expanded allele transcript . \n conceivably , the dicer - processed hairpin rnas may trigger the formation of rits assembly on the homologous r(cgg ) sequences and result in transcriptional repression of the fmr1 chromatin locus ; yet , the real mechanism was unclear at that time . \n ongoing neuroscience research on fxs using animal models ( such as the fmr1-deleted mouse and fly ) has provided a wealth of information in subcellular , cellular , and intercellular networks to delineate the neurobiology of this disorder . \n still none of these models demonstrate the pathogenic role of noncoding rnas in fxs etiology . to overcome this barrier , \n we have developed and established the first ramrna - mediated loss - of - fmr1-function zebrafish strain as a viable animal model for studying the aforementioned r(cgg)-derived mirna - induced fxs theory [ 4 , 6 , 32 , 33 ] . \n this novel in vivo model may also be used to develop and test drugs or therapies for the treatment of fxs . \n our previous studies have shown that effective mature mirnas can be generated from an artificial intron inserted in a zebrafish vertebrate gene [ 3 , 34 ] . as demonstrated in figure 2 , \n the intron containing pre - mirna structures is cotranscribed with its encoding gene by a type - ii rna polymerase ( pol - ii ) and further excised by spliceosomal components to form mature mirnas . because this intronic mirna biogenesis pathway is coordinately regulated by intracellular pol - ii transcription , rna splicing , and nmd mechanisms , the resulting mirna effector is safe , effective , and powerful as a new genetic tool for regulating targeted gene function [ 8 , 9 , 33 ] . using this pol - ii - mediated intronic mirna expression system , \n we observed target - specific rnai effects of various man - made mirnas in mouse and human cell lines in vitro [ 3 , 33 , 35 ] as well as mouse skin , chicken embryo , and zebrafish in vivo [ 4 , 6 , 9 , 32 ] . \n based on similar expression designs , zhou et al . and chung et al . \n have also observed that both native intergenic and intronic mirnas possess the same rnai effectiveness , while the use of intronic mirna allows coexpression of a protein marker with the mirna at a defined expression ratio . \n given that there are currently over 1000 native mirna species found in vertebrates and many more new mirna homologs continue to be identified , we are able to utilize this intronic mirna expression system as a transgenic tool for generating target - specific loss - of - gene - function animal strains or cell lines for evaluating the gene function of interest . previously , several kinds of vector - based rnai systems have been developed based on a directly exonic shrna expression mechanism , using type - iii rna polymerases ( pol - iii ) [ 3840 ] . \n although some of these studies have succeeded in maintaining constant gene silencing effects in vivo [ 41 , 42 ] , they failed to provide tissue - specific rnai efficacy in a cell population due to the ubiquitous existence of pol - iii activities . \n moreover , because pol - iii machinery often reads through a short dna template in the absence of proper termination , large double - stranded rna ( dsrna ) products ( e.g. , > 30 base pairs ) may be synthesized and cause unexpected interferon cytotoxicity , particularly in the vertebrates [ 43 , 44 ] . \n such a problem may also result from the competitive conflict between the pol - iii promoter and another vector promoter ( i.e. , ltr and cmv promoters ) . \n lin and ying have reported that high concentrates of sirna / shrna ( e.g. , > 250 nm in human t cells ) can result in strong cytotoxicity similar to that caused by long dsrnas . \n notably , grimm et al . further demonstrated that the pol - iii - directed rnai systems often generate high concentrated sirna / shrna which can oversaturate the cellular mirna pathway , resulting in global mirna inhibition and cell death . in view of these problems , a pol - ii - mediated intronic mirna expression system has the advantage of its autoregulation by the cellular rna splicing , and nmd mechanisms [ 9 , 33 , 47 ] , both of which degrade excessive rna accumulation to prevent possible cytotoxicity . \n the pol - ii - mediated intronic mirna expression system is designed around a recombinant gene construct containing one or more splicing - competent rna introns , namely , sprnai [ 3 , 8 , 9 ] . \n structurally , the sprnai consists of several consensus nucleotide elements such as 5-splice site , branch - point motif , polypyrimidine tract , and 3-splice site . a pre - mirna or pre - mirna cluster insert \n is placed within the sprnai intron sequence between the 5-splice site and the branch - point motif . \n this portion of an intron would normally form a lariat structure during rna splicing and processing . \n the spliceosomal u2 and u6 snrnps , both helicases , may be involved in the unwinding and excision of the lariat rna fragment into pre - mirna ; however , the detailed processing mechanism remains to be elucidated . \n moreover , the sprnai contains a multiple translational stop codon motif ( ts codons ) in its 3-proximal region , which , if presented in a premature mrna , will signal diversion of the premature mrna processing to the nonsense - mediated decay ( nmd ) pathway and thus eliminates excess rna accumulation in the cell . \n this feature guarantees the safety of the intronic mirna biogenesis pathway . using this intronic mirna expression construct , \n we have tested various hairpin - like mirna precursors ( pre - mirnas ) , many of which resulted in mature mirnas with full capacity for triggering rnai - associated gene silencing effects in mouse , rat , and human cell lines in vitro [ 3 , 33 , 35 ] and in mouse , chicken , and zebrafish in vivo [ 4 , 6 , 10 , 32 ] . \n further advances in the intronic mirna expression system have also been reported in mice ; chung et al . successfully performed ectopic expression of a cluster of polycistronic mirnas , which were processed into multiple mirnas via the cellular mirna pathway . \n this kind of pol - ii - driven mirna expression has several advantages over the conventional pol - iii - directed sirna / shrna expression systems . \n first , pol - ii expression can be tissue specific , whereas pol - iii expression can not . \n second , pol - ii expression is compatible with the native mirna pathway , while grimm et al . have reported some incompatibility in the pol - iii - directed sirna / shrna expression systems . \n third , excessive rna accumulation and cytotoxicity can be prevented by the nmd mechanism of a cellular intronic expression system , but not a direct expression system [ 46 , 48 ] . \n finally , one pol - ii is able to express a large cluster ( > 10 kb ) of polycistronic shrnas / mirnas , which can be further excised into multiple shrnas / mirnas via the native mirna pathway , so as to prevent the promoter conflict that often occurs in a vector system containing multiple promoters . \n animal models mimicking the human developmental events and diseases are essential tools for the advancement of biomedical research . zebrafish \n ( danio rerio ) , a fresh water tropical fish , has set an impressive record as an in vivo viable model for studies of mechanisms involving in embryogenesis , organogenesis , physiology , and behavior ; developmental neuroscience has also benefited from research using the zebrafish model . \n advantages of using zebrafish include low cost , easy maintenance , rapid life cycle , small size , and embryonic transparency . \n also , zebrafish exhibit fast development ( i.e. , nervous system precursors presented by 6 - 7 hour postfertilization ( hpf ) ; first neuron formed by 1824 hpf ) , large generation number ( i.e. , clutch sizes from a single mating pair range between 100 to 200 embryos ) , and the phenotypes can be easily assessed in many high - throughput assays [ 4951 ] . screening genetic suppressors in zebrafish will advance the understanding of loss - of - gene - function phenotypes that are related to certain diseases and help identify logical drug target candidates . \n in addition , screening for morphological or behavioral mutants is often more time- and cost - effective than the equivalent assays in mouse . \n these advantages have provided great advances in understanding the detailed pathological mechanisms underlying brain disorders that may lead to functional and behavioral defects . \n for example , zebrafish possess three fmrp - related genes , fmr1 , fxr1 , and fxr2 that are orthologous to the human fmr1 , fxr1 , and fxr2 genes , respectively . the expression patterns of these genes in zebrafish are also consistent with those in mouse and human [ 52 , 53 ] , suggesting that zebrafish is one of the best models for studying human fmrp - related disorders . to investigate the molecular mechanism of r(cgg)-derived ramrna - mediated fmr1 inactivation \n , we developed a transgenic fxs model in zebrafish , in which fish fmr1 is silenced by overexpression of an isolated r(cgg ) expansion from the fmr1 5-utr [ 4 , 6 ] . \n our previous reports have demonstrated the use of a pantropic retroviral vector , plncx2-rt , to deliver a recombinant sprnai - containing red fluorescent protein ( sprnai - rgfp ) transgene that is able to express desired mirna precursors ( pre - mirna ) in a ubiquitous actin promoter - driven green egfp - expressing tg(uas : gfp ) strain zebrafish , tg(actin - gal4:uas - gfp ) [ 10 , 32 ] . in this fxs model , an isolated fmr1 5-utr r(cgg ) \n expansion ( accession number nw_001511047 from the 124001st to 124121st nucleotide ) was incorporated into the pre - mirna insertion site of the sprnai intron . \n the original weak fmr1 promoter ( 1001000 copies of mrna per cell ) was further replaced by a fish gamma - aminobutyric acid receptor 2 ( gaba r2 ) promoter ( 500015,000 copies of mrna per cell ) to boost the expression of the isolated fmr1 5-utr r(cgg ) expansion . \n the plncx2-rt vector was previously modified from a pseudotyped moloney murine leukemia virus , plncx2 ( clontech , palo alto , ca ) , by replacing the original cmv promoter with an isolated fish gaba r2 promoter and then inserting the sprnai - rgfp transgene into the gene cloning site of the plncx2 construct , so as to form a transgenic pgabar2-rt - sprnai - rgfp retroviral vector . \n given that gaba r2 and fmr1 genes are closely coexpressed in many major brain areas in particular , cortex , hippocampus and cerebellum [ 54 , 55 ] , the infection of pgabar2-rt - sprnai - rgfp retroviral vector generated a novel transgenic zebrafish strain displaying a full spectrum of fxs disorders . \n the pgabar2-rt - sprnai - rgfp vector so obtained was injected directly into one - cell - stage fertilized eggs or used to prepare high - titer retroviruses for infecting the 110 hpf - stage zebrafish embryos [ 4 , 6 , 10 , 32 ] . \n transgenic f0 zebrafish obtained from this process were selectively separated into four groups based on their different fmr1 knockdown levels , as determined by western blot analysis , including < 50% , 50%75% , 75%90% , and > 90% knockdown of fmr1 expression . \n the zebrafish showing above 90% fmr1 knockdown were too unstable to be raised into a transgenic line . \n these fish were then crossed with one another to generate the f1 founder line with a stable 75%85% fmr1 knockdown rate . \n after genotyping and transgene sequencing analyses , the f1 and f2 transgenic lines exhibited two copies of the transgene in a consistent genomic insertion site located in the chromosome 18 close to the 3-side of the loc565390 locus region a region that encodes no gene . we have also showed that fish with > 90% fmr1 knockdown possess on average 35 copies of the transgene located in two to three genomic insertion sites . \n the principle of this loss - of - fmr1-function zebrafish model and human fxs is based on the same molecular interaction between the r(cgg)-derived ramrna and the fmr1 5-utr r(cgg ) expansion . \n both mechanisms result in similar pathological defects triggered by ramrna - mediated fmr1 inactivation . we found that increasing the expression of fmr1 5-utr r(cgg ) expansion results in a corresponding elevation of mir - fmr1 concentration over 6-fold in the transgenic zebrafish with 75%85% fmr1 knockdown [ 4 , 6 ] . because we only isolated 30% of the whole fmr1 5-utr r(cgg ) expansion region , each transgene after gaba r2 promoter - driven transcription would approximately create a total 24-fold increase in mir - fmr1 production . as a result , \n the zebrafish with 75%85% fmr1 knockdown express 6-fold more mir - fmr1 than the wild - type zebrafish , similar to the difference between human fxs ( > 200 copies ) and normal ( < 50 copies ) r(cgg ) expansion expression . during native embryonic development , excessive expression of r(cgg)-derived ramrnas ( over 4 fold ) \n we also found that both human and fish fxs models present similar pathological abnormalities in synaptic connectivity and neuronal plasticity . \n fish with 50%75% fmr1 knockdown may be related to fragile x tremor / ataxia syndrome ( fxtas ) , which expresses a moderate increase of r(cgg ) expansion ( ~120 copies ) and often displays elevated fmr1 mrna but not fmrp protein levels , accordingly . \n despite some notable differences in the size , the overall organization of major brain components in zebrafish is highly similar to the human brain [ 56 , 57 ] . as in other vertebrates , \n zebrafish possess all of the classical sense modalities such as vision , hearing , olfaction , taste , tactile , balance , and sensory pathways . \n we have compared the phenotypes of human and zebrafish fxs in detail to provide an informative groundwork for the use of this novel r(cgg)-derived ramrna - mediated animal model for fxs - related research and drug development . \n our previous studies using fluorescent three - dimensional ( 3d ) micrograph have shown abnormal neuron morphology and connectivity in the embryonic brains of the fxs fish , reminiscent of those found in human fxs [ 4 , 6 ] . in the normal fish lateral pallium ( \n similar to human hippocampal - neocortical junction ) , wild - type neurons present normal dendrite outlines and are well connected to each other , whereas the fmr1-knockdown fxs transgenics exhibit thin , strip - shape neurons , similar to the abnormal dendritic spine neurons in human fxs . \n synaptic deformity frequently occurs in the fmr1-knockdown neurons , indicating that the functional role of fmr1 is to maintain neuronal plasticity . \n similar alterations in synaptic plasticity have been observed to be a major physiological damage in human fxs , particularly in the hippocampal stratum radiatum , layer iv / v cortex and sometimes cerebellum of severe cases [ 5861 ] . \n fmr1 mrna is present in dendritic spines and translated in response to activation of the type 1 metabotropic glutamate receptors ( mglur-1 ) in synaptoneurosomes [ 62 , 63 ] . \n the activation of mglur1 stimulates a phosphorylation cascade , triggering rapid association of some mrnas with translation machinery near synapses and leading to protein synthesis of the mrnas . \n fmrp protein is , however , a translational inhibitor that binds with the mrna species involved in regulation of microtubule - dependent synapse growth and function , including its own mrna [ 20 , 64 , 65 ] . \n such translational suppression in dendritic spines is though to be crucial for eliminating immature synapses and enhancing synaptic strength during brain development . \n changes in spine shape are often coupled to the absence of fmrp function in fxs patients . \n thus , an increased density of long , immature dendritic spines found in the fmr1-knockdown fxs neurons may provide new insights into the role of fmrp in synaptic maturation and pruning . \n based on the present evidence , not only fmrp protein but also mir - fmr1 ramrna can modulate the expression of certain neural genes involved in synaptic development and maturation . in three - month - old male fxs zebrafish , excitatory synapses in slices of the pallium - neocortical junction \n were found to exhibit diminished long - term potentiation ( ltp ) , as compared with wild - type controls . \n ltp in hippocampus is a learning - related form of synaptic plasticity and is highly involved in changes found in abnormally shaped dendritic spines . \n this result observed in fmr1-knockdown fxs neurons indicates that deficits in hippocampal - cortical ltp mechanisms likely contribute to cognitive impairments in fxs disorders . on the other hand , postsynaptic stimulation of mglur increases neural protein synthesis and \n this process is crucial for the expression of long - term depression ( ltd ) , which refers to a long - lasting decrease in synaptic strength to below the normal baseline level . \n given that fmrp is a downstream gene stimulated by mglur to reversely quench this ltd process , deficiency of fmrp in fxs neurons hence interrupts this feedback regulation mechanism and leads to ltd overamplification . in particular , the pallium neuron ltd is augmented in the absence of fmr1 , suggesting that exaggerated ltd may be also responsible for aspects of abnormal neuronal responses in fxs , such as autism . \n this exaggerated ltd , however , can be inhibited by treating the brain slices of the fxs fish with mglur - specific agonists , such as 3,5-dihydroxyphenyglycine ( dhpg ) . \n these findings in fxs zebrafish raise a possibility in fxs - associated autism , which is also supported by other evidence that induction of mglur1-dependent ltd is enhanced in pyramidal cells of the hippocampus in fmr1-deleted mice . \n thus , altered ltp and ltd in fxs hippocampal neurons may explain how and why such fmr1 inactivation hinders the normal learning and cognition process in the brain , which is important for the development of human intelligence quotient ( iq ) . \n in sum , our studies have established a novel animal model and possible etiological mechanism for fxs ( figure 3 ) , in which excessive expression of ramrnas derived from the fmr1 5-utr r(cgg ) expansion results in nuclear ramrna accumulation and hence inactivated the fmr1 gene transcription through promoter dna methylation . \n rad54l and mecp2 also play a crucial role in the rits assembly of the ramrnas responsible for the fmr1 promoter methylation . \n the pathological outcomes of this ramrna - mediated fmr1 gene silencing were corresponded to the neurodegenerative and cognitive impairments in fxs disorders , like neuronal deformity , immature synapse formation , long dendritic spine shaping , ltp diminishment , and mglur - ltd augment . in current studies , we overexpressed one - third of the wild - type fmr1 5-utr r(cgg ) expansion region and found one effective ramrna , mir - fmr1 - 42 ; it is estimated that the full fmr1 r(cgg ) expansion in fxs may generate more than 12 kinds of ramrnas . \n these findings signify a high similarity between the real human fxs and our ramrna - induced fxs animal model , which may shed light on new therapeutic interventions . \n the list of developmental and degenerative diseases that are caused by expansion of microsatellite - like genomic repeats continues to grow . \n many of the trinucleotide repeats are predicted to encode mirnas ; nevertheless , no repeat - associated mirna ( ramrna ) has ever been identified before our studies . \n first , mature ramrnas , namely , mir - fmr1 , can be generated from the 5-utr r(cgg ) expansion of the fmr1 gene in zebrafish , matching the previously predicted epigenetic disease model of human fxs . \n second , the ramrna - induced fxs zebrafish can be raised and maintained to show the same neural defects found in human fxs . finally , the normal expression pattern of mir - fmr1 in wild - type zebrafish is limited within the cytoplasm of neuronal bodies , whereas the presence of r(cgg)-associated ramrnas in fxs neurons can extend into the compartments of nuclei and dendrites , consequently leading to transcriptional fmr1 inactivation . \n these findings confirm the feasibility of using this novel fxs animal model for studying ramrna - mediated pathogenesis and neuropathology , which may be common in human fxs patients but difficult to identify in other fmr1-deleted animal models . \n in addition , our novel ramrna overexpression approach may provide further insights into the molecular mechanism of brain - specific trinucleotide repeats for understanding how a ramrna affects human iq . \n given that there are still many more microsatellite - like nucleotide repeats in the human genome , which may code for a variety of ramrna species , as might be expected , learning how to use the newly established intronic mirna expression system for exploiting the functional roles of these ramrnas in vivo will be a forthcoming challenge .", "role": "user" }, { "content": "the majority of the human genome is comprised of non - coding dna , which frequently contains redundant microsatellite - like trinucleotide repeats . \n many of these trinucleotide repeats are involved in triplet repeat expansion diseases ( treds ) such as fragile x syndrome ( fxs ) . \n after transcription , the trinucleotide repeats can fold into rna hairpins and are further processed by dicer endoribonuclases to form microrna ( mirna)-like molecules that are capable of triggering targeted gene - silencing effects in the treds . \n however , the function of these repeat - associated mirnas ( ramrnas ) is unclear . to solve this question \n , we identified the first native ramrna in fxs and successfully developed a transgenic zebrafish model for studying its function . \n our studies showed that ramrna - induced dna methylation of the fmr1 5-utr cgg trinucleotide repeat expansion is responsible for both pathological and neurocognitive characteristics linked to the transcriptional fmr1 gene inactivation and the deficiency of its protein product fmrp . \n fmrp deficiency often causes synapse deformity in the neurons essential for cognition and memory activities , while fmr1 inactivation augments metabotropic glutamate receptor ( mglur)-activated long - term depression ( ltd ) , leading to abnormal neuronal responses in fxs . using this novel animal model \n , we may further dissect the etiological mechanisms of treds , with the hope of providing insights into new means for therapeutic intervention .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: loin pain haematuria syndrome was first described in 1967 as a syndrome of visceral loin pain and fever , associated with microscopic or macroscopic haematuria . \n a number of reports have emphasized psychiatric disturbances and factitious illness in some patients with the syndrome and have suggested that the condition has some characteristics of a somatoform disorder [ 24 ] . \n the arteriographic abnormalities have not proved to be a constant feature of the syndrome , and psychiatric disturbance can not explain the presence of haematuria . \n some patients with proven glomerulonephritis experience loin pain during episodes of macroscopic haematuria , possibly due to oedema with stretching of the renal capsule , but most patients with loin pain and haematuria do not have glomerulonephritis . the anatomical abnormality causing compression as the left renal vein passes between the aorta and the superior mesenteric artery was first described in 1950 . \n noted vascular impressions ( varicosities ) indenting the left ureter on urography . the term \n nutcracker phenomenon was coined by de schepper in 1972 to describe the anatomical problem . \n what is important about the case presented here is that the predominant symptom was pain ; symptoms of venous obstruction other than macroscopic haematuria were not prominent . \n the case therefore resembled loin pain haematuria syndrome so it is important that the distinction between the two conditions is made more widely known . \n a 19-year - old female anatomy student ( h.b.v . ) was referred for further evaluation of recurrent macroscopic haematuria , without clots , and severe bilateral flank pain , with a provisional diagnosis of loin pain haematuria syndrome . \n twelve months earlier , she had been evaluated elsewhere , with negative urine culture , ultrasound and plain radiology and cystoscopy ; the symptoms resolved for several months but then returned , and at presentation , she was passing visibly blood - stained urine nearly every day . \n she had a history of chrondromalacia patellae , for which she had taken regular non - steroidal anti - inflammatory drugs . \n loin pain and haematuria had worsened shortly after switching from ibuprofen to diclofenac for an exacerbation of knee pain which had continued despite successful arthroscopic knee surgery . \n there was a family history of von willebrand s disease , however , the patient s clotting studies were normal . \n estimated glomerular filtration rate was 96 ml / min/1.73 m and urine protein : creatinine ratio was 33 mg / mmol . \n the frequency and severity of macroscopic haematuria were atypical for glomerulonephritis , papillary necrosis or loin pain haematuria syndrome ; the severity of the pain was atypical for renal arteriovenous malformations or nutcracker phenomenon . \n she was referred to a pain management service , and in view of the atypical presentation , magnetic resonance angiography was performed . \n there was evidence of partial occlusion of the left renal vein just before it entered the inferior vena cava as it passed between the aorta and superior mesenteric artery ( figures 1 and 2 ) \n . lateral reconstruction of magnetic resonance imaging showing acute angle and narrow space ( arrow ) between superior mesenteric artery and aorta . \n composite coronal venous phase magnetic resonance angiogram images showing kidneys of equal size with venous congestion at the hilum of the left kidney . \n congested partially obstructed left renal veins ( arrow ) are shown at the lateral margin of the aorta with poorly developed collaterals to lumbar veins . \n the absence of either a lieno - renal pathway or an incompetent ovarian vein may explain the severity of her symptoms . \n after discussion of the relative risks and benefits of renal venous stenting and autotransplantation , the patient opted for the latter . \n haematuria resolved 2 days after transplantation of the left kidney into the pelvis , and 2 months later , she was pain free and back to normal student life . \n there have been no post - operative complications in > 3 years of follow - up , and renal excretory function remains normal . \n the loin pain haematuria syndrome is essentially a diagnosis of exclusion , particularly of urinary tract infection , nephrolithiasis , papillary necrosis and glomerulonephritis . \n we believe that this is the first time that the nutcracker phenomenon has been shown to mimic the condition . \n the symptoms of nutcracker syndrome are a consequence of chronic obstruction of the left renal vein and its tributaries , which are the veins of the renal hilum , the suprarenal vein from above and the testicular or ovarian vein from below . \n left - sided renal venous hypertension leads to dilatation of the tributaries and development of collaterals around the kidney and its ureter , and perhaps the venous congestion is responsible for the left flank pain . \n rupture of venules in the collecting system leads to the typical unilateral haematuria and sometimes proteinuria , with pain in the left flank . \n pelvic congestion syndromedysmenorrhoea , post - coital ache , dyspareunia and the formation of ovarian , pelvic , vulvar and sometimes gluteal vein varicosities . \n 28 were found to have obstruction to the left renal vein compared with 2 of 76 controls . in the case of the patient described here , it is possible that the severity of the symptoms was a result of her particular anatomy . \n the lack of either a lienorenal pathway or of collaterals between the left renal vein and lumbar veins on imaging meant that there was no run - off to dissipate the high venous pressure . \n imaging also demonstrated that the valve at the junction of the left ovarian vein with the left renal vein was not incompetent . \n our case illustrates the importance of keeping an open mind when seeing patients with loin pain and haematuria .", "role": "user" }, { "content": "a 19-year - old female presented with bilateral severe loin pain associated with recurrent macroscopic haematuria . a provisional diagnosis of loin pain haematuria syndrome was made ; the severity and frequency of pain led to referral to the pain management service . \n alternative diagnoses were considered . \n although previous reports of obstruction of the left renal vein have not described pain of this severity , magnetic resonance angiography was performed ; it showed obstruction of the left renal vein as it passed between the superior mesenteric artery and aorta , i.e. the nutcracker phenomenon . \n both pain and haematuria resolved fully after autotransplantation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the conventional morphologic features on common palmar digital nerve and artery is well - documented3 ) . \n the median and ulnar nerve divided into three common palmar digital nerves , then descending with common palmar digital arteries without any branch before finger webs . in this present study \n , we describe a rare and unreported variation in the course and distribution of the common palmar digital nerves and its relation to the common palmar digital arteries . \n knowledge of the frequency of anatomical variations of the neural and arterial pattern of the hand is crucial for safe and successful hand surgery . \n as the number of hand surgical interventions increase a better understanding of the anatomy of hand nerves and arteries gain in importance . here \n we describe a rare anatomic variation of the common palmar digital nerves and arteries in a 42-year - old yellow male cadaver right palm fixed in 10% formalin . that cadaver specimen was detected during dissections performed in a routine gross anatomy course . \n the skin of the bottoms of palm was removed , and the vessels and nerves were exposed . the superficial palmar arch and three unusual anatomic variation pairs of the common palmar digital nerves and arteries were identified . \n each common palmar digital nerve divided into 2 or 3 branches and clamped the corresponding common palmar digital artery ( fig . \n the variation of common palmar digital arteries went through palmar digital nerves have so far not been described . \n to understand the rare anatomic variation and collect new anatomical data , now it is reported as follows . \n we set the line connecting the scaphoid node with the pisiform bone as a reference line . \n we show here three common palmar digital nerves originated from the median nerve or ulnar nerve divided into 2 or 3 smaller branches , and clamped the corresponding common palmar digital artery . the distance from the crotch of nerves to the reference line were 53.12 mm , 54.70 mm , 54.46 mm , respectively . \n the distance from the concourse to the reference line were 65.60 mm , 67.76 mm , 58.80 mm , respectively . \n each common palmar digital nerve downward to the finger weds , and then divided into two branches named proper palmar digital nerves . \n besides , from intersection of each common palmar digital artery and nerve we also detected the vascular impression with the diameter of 1.38 mm , 1.18 mm , 1.26 mm , respectively . \n the diameter of proximal vascular impressions were 1.52 mm , 1.73 mm , 1.56 mm , respectively ( fig . \n bozkurt et al.2 ) described an unusual termination of the ulnar nerve in the palm . \n vollala et al.8 ) observed formation of superficial palmar arch solely by superficial branch of ulnar artery without any contribution from the radial artery or median artery . \n meals and shaner6 ) in their comprehensive study on the common palmar digital nerves of 50 palms did not find the variation of common palmar digital nerves divided into 2 or 3 smaller branches , and clamped the corresponding common palmar digital artery . \n the injury of common palmar digital nerves and arteries are the center of attraction for most of the surgical procedures and traumatic events in the hand . \n the hand surgeon should keep in mind this kind of variations before performing surgical procedures such as , neurosuture , arterial repairs , replantation of severed limbs4 ) . \n the knowledge of the variations of the common palmar digital nerves and arteries is useful in clinical as well as surgical practice \n . they may be the cause of nerve entrapment syndrome , ischemia because of variable relations of nerves with the surrounding muscles and the vessels . \n the presence of anatomical variations in the common palmar digital nerves and arteries is used to explain unexpected signs and symptoms useful in medical practice . \n the present case revealed the common palmar digital arteries went through the common palmar digital nerves . \n this variation can cause anomalies of the sensory innervations of the hand . with the deepening of cognition on peripheral nerve compression \n , the incidence of nerve entrapment syndrome of common palmar digital nerve has been increasing year by year . as one of reasons , \n thus , these variations are important to note by the anatomist and clinicians . knowing the existence of the abnormal case of the common palmar digital nerves and arteries is very essential , as it may be damaged during surgery , in trauma in these area .", "role": "user" }, { "content": "variations in the course and distribution of common palmar digital nerves and arteries are rare . \n a classic common palmar digital nerves and arteries are defined as concomitant . during routine dissection classes to undergraduate medical students we observed formation of each common palmar digital nerve divided into 2 or 3 branches and formed a ring enclosing the corresponding common palmar digital artery . \n knowledge of the anatomical variations of the common palmar digital nerves and arteries is crucial for safe and successful hand surgery .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the growth and development of cold blooded water organisms is strongly affected by temperature . in many ecological models , air temperature or \n for example , organisms that live close to the water surface in shallow waters , such as the larvae of mosquito species , are exposed to temperatures that differ considerably from the air or bulk water temperature . \n simulation studies with mosquito species that act as vectors of malaria have shown that variations in mortality and development of the aquatic stages due to surface water temperature are the most important factor in determining the number of emerging adult mosquitoes ( jetten and takken 1994a ) . \n for example , if the water temperature in an aquatic ecosystem increases , the rate of photosynthesis in the plants also increases . \n photosynthesis rates increase up to a temperature of about 32c . as the rate of photosynthesis increases , the number of aquatic plants increases . \n this increase also leads to an increase in the number of plants that die and are decomposed by aerobic bacteria , which consume oxygen in the process ( nicolet et al . 2004 ; de meester et al . 2005 ) . \n knowledge of the behaviour of the temperature within shallow waters is also of importance for practical applications in aquaculture . \n examples include fish ponds and rice paddies , since a direct relationship exists between the density gradient in water as influenced by temperature and the consequent growth rate of fish or development and growth of rice , respectively ( losordo and piedrahita 1991 ; bouman et al . \n furthermore , the temperature of shallow water is an important factor influencing competition between species . \n this has already been shown for some closely related malaria vector species ( jetten and takken 1994b ) . in such circumstances , \n the incidence of malaria may be closely related to the presence of more or less anthropophilic vector species . \n the most important input quantities in natural shallow water bodies during the daytime are the incoming short- and net long - wave radiation , the air temperature and the wind speed . \n long - wave radiation is absorbed at the top of the water body , as well as a large part \n the so - called near - infra red of the incoming short - wave radiation . during the day , this leads to a stable stratification in natural water bodies . however , if the wind speed is high enough , strong forced mixing occurs , which leads to an isothermal water temperature . during the night , the most important forcing term is long - wave radiative cooling , which triggers the growth of a mixing layer starting from the water atmosphere interface . \n depending on the weather , the conditions at the side boundaries of the water body , and the size of the water surface , the water temperature behaviour in shallow waters can be very dynamic and complex . \n numerous models have been presented in the literature to describe the thermal behaviour of water bodies . \n the most intensively studied are the one - dimensional models , which can in fact be subdivided into two types ( harleman 1982 ) : diffusion models , which describe the temperature profile of the water in detail ( e.g. losordo and piedrahita 1991 ; jacobs et al . 1997 ) ; and integral energy models , which describe the water temperature uniformly ( e.g. debruin 1981 ) . for most applications , \n for example , for entomological applications , the water temperature in a very shallow layer at the top of the water body is important , while in certain fish pond applications , such as the breeding of flatfish , the temperature at the bottom of a pond is important ( tibbs and galat 1998 ) . in these cases , \n the diffusion models are more suitable as they provide a detailed description of the water temperature with depth . \n the objectives of the present study were firstly to extend an existing one - dimensional atmosphere / water model to simulate the behaviour of the diurnal water temperature cycle in relatively very small water bodies . \n the model we used is adopted from an earlier study by jacobs et al . ( 1997 ) . \n the second objective was to perform an outdoor experiment to verify the model in different atmospheric conditions throughout the seasons . \n wageningen university operates a long - term meteorological observatory , the haarweg station , in the centre of the netherlands ( latitude 5158n , longitude 538w , altitude 7 m a.s.l . ; \n this grassland region is covered mainly with perennial species of ryegrass ( lolium perenne l. ) and rough bluegrass ( poa trivialis l. ) . \n the soil at the site is predominantly heavy basin clay resulting from the back - swamps of the rhine river ( snel 2004 ) . \n an aspirated psychrometer was used to measure the air temperature , ta , and wet - bulb temperature , tw , at reference height zr = 1.5 m. the wind speed u was measured by a cup anemometer at reference height zr = 1.5 m. the air temperature ta(0.10 m ) was measured with a shielded pt-100 thermometer at 0.10 m height . \n the total incoming short - wave radiation , kin , was measured with an aspirated pyranometer ( kipp & zonen , model cm11 ; delft , the netherlands ) at a height of 1.5 m. also at this height , the incoming diffusive short wave radiation , kdif , is measured with an pyranometer ( kipp & zonen , model cm11 ) combined with a shadow ring ( kipp & zonen , model cm 121b / c ) . the incoming direct beam short wave radiation , kdir , is calculated by subtraction , kdir = kinkdif . the incoming long - wave radiation , lin , was measured with a pyrgeometer ( kipp & zonen , model cg 1 ) at a height of 1.5 m. to estimate the thermal stability of the atmosphere , the turbulent momentum and sensible heat fluxes were measured at a height of 3.5 m with a three - dimensional sonic anemometer - thermometer ( 3d solent res , model a1012r2 ; gill instruments , lymington , uk ) . \n soil temperatures , tsoil , were measured by pt-100 elements at depths of 0.05 , 0.10 , 0.20 , 0.50 and 1.0 m. the soil moisture content at depths of 0.01 , 0.10 and 0.50 m were measured with a tdr ( time domain reflectrometry ) system ( tdr 100 , probe type cs 610 ; campbell scientific , loughborough , uk ) . \n the soil moisture results were used to obtain a reliable estimate of the actual heat conductivity of the soil . \n the soil heat flux was measured by a heat plate ( ws 31-cp ; tno , delft , the netherlands ) buried at a depth of 75 mm . in addition to the continuous station measurements , a detailed sub - experiment was carried out in and around a shallow artificial water body of still water throughout 2003 . at the observatory site , about 30 m west of the radiation instruments , \n a circular plastic box was dug into the soil in which the water experiments were carried out . \n the box has a diameter of 1.10 m and a depth of 0.375 m. the bottom of the box was cut out and replaced by a thin plastic sheet in order to ensure good thermal contact between the water and the underlying soil . \n the side walls of the box are made of 3-mm - thick pvc , and it appeared that hardly any heat flux occurred through the side walls . \n in fact this also means that our water model can be thought of as a so - called 1-d problem . \n the box was initially filled with tap water to a depth of 0.250 m. the water level in the box was kept constant and checked daily . \n the surface of the water is 0.12 m below the mean surface level of the surrounding soil . \n a stable floating system was designed with a inverted mast to which small glass - coated thermistors ( model beta g22k7mcd8 ) were connected at depths of 1 , 18 , 66 , 128 and 196 mm . \n the thermistors have a diameter of 0.8 mm . at the bottom of the water body , \n a heat soil flux plate is installed ( tno , model ws 31-cp ) . two thermometers ( pt100-elements ) \n were buried in the soil at a depth of 50 mm below the bottom of the water body . \n the heat conductivity of the soil was measured at various depths and locations using a non - stationary hot needle technique ( heusinkveld et al . \n the light extinction coefficient was measured following the method of kirk ( 1984 ) , with two underwater light sensors ( type ra100 ; bottemanne weather instruments , amsterdam ) . \n 1schematic outline of the experimental layout around the artificial water body schematic outline of the experimental layout around the artificial water body data from the fast response sonic system were sampled at 20 hz , and all other slow response meteorological instruments were sampled at 0.25 hz . data were averaged at 30-min intervals and stored in data loggers for subsequent processing . for more details of the measurements , site and data processing , see kraai ( 2004 ) and jacobs et al . \n the one - dimensional model is based on the energy budget ( see upper panel in fig . 2 ) . here \n , the driving force during daytime is the incoming short - wave radiation . immediately at the water surface a fraction , , of the net short - wave radiation is absorbed ( cathcart 1987 ; jacobs et al . \n water is transparent to short - wave radiation , where absorption depends not only on the path length but also strongly on the turbidity of the water . \n also at the water surface , exchange processes of long - wave ( incoming and outgoing ) radiation , sensible and latent heat take place ( cathcart 1987 ) . \n for the first water layer with thickness , the energy budget is : \n 1a\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\delta k + l_{{net } } - h - le - g_{w } = { \\mathop c\\nolimits_w } \\delta \\frac{{\\delta { \\mathop t\\nolimits_w } } } { { \\delta t } } $ $ \\end{document}where , k is the absorbed short - wave radiation in this layer , h the sensible heat flux and le the evaporation at the top of this layer , gw the convective heat at the bottom of this layer , cw the volumetric heat capacity of water , tw the mean temperature change of this water layer , and lnet the net long - wave radiation . for all other water layers \n the energy budget is : \n 1b\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\delta k - \\delta { \\mathop g\\nolimits_w } = { \\mathop c\\nolimits_w } \\delta \\frac{{\\delta { \\mathop t\\nolimits_w } } } { { \\delta t } } $ $ \\end{document}fig . \n top panel daytime situation , bottom panel nighttime situation schematic overview of the main energy terms in a water body . \n air interface is calculated by taking the measured incoming long - wave radiation , lin , minus the calculated outgoing long - wave radiation , lout , at the air water interface . \n the uppermost water temperature is used to calculate the outgoing long - wave radiation at the air water interface , lout , according to eq . 2 : \n 2\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ l_{{out } } = \\varepsilon _ { w } \\sigma t^{4}_{w } $ $ \\end{document}where w ( 0.99 ) is the emissivity of the water and ( 5.67 10 wmk ) is the stefan boltzmann constant . \n it must be noted that lin is corrected for the sky view factor , since the water body sees not only the sky but also a part of the side wall of the water box . in our case , \n the mean view factor is 150 , which means that the water body sees the sky for 150 and the edges for 30. remember also that gw at the lowest layer is the sediment heat flux . \n the absorbed short - wave radiation in the aquatic surface layer , n = 1 , equals : \n 3a\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\delta k{\\left ( { n = 1 } \\right ) } = k_{{in } } { \\left ( { 1 - \\alpha } \\right ) } { \\left [ { \\beta + { \\left ( { 1 - \\beta } \\right)}{\\left ( { 1 - { \\mathop e\\nolimits^ { - \\frac{{\\varepsilon \\delta } } { { xx } } } } } \\right ) } } \\right ] } $ $ \\end{document}and in all other water layers , n > 1 : \n 3b\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\delta k{\\left ( n \\right ) } = k_{{in } } { \\left ( { 1 - \\alpha } \\right ) } { \\left ( { 1 - \\beta } \\right ) } { \\mathop e\\nolimits^{\\frac { { - \\varepsilon ( n - 1 ) \\delta } } { { xx } } } } { \\left ( { 1 - { \\mathop e\\nolimits^{\\frac { { - \\varepsilon \\delta } } { { xx } } } } } \\right ) } $ $ \\end{document}where , kin is the incoming short - wave radiation at the water surface , \n the albedo at the water surface , the radiation extinction coefficient in the water , xx the correction factor for the actual path length ( hhne 1954 ; stefan et al . 1983 ) depending on solar height and ratio of the direct and diffusive solar radiation , the amount of short - wave radiation immediately absorbed in the first layer ( taken as 45% of the incoming short - wave radiation at the water surface ; orlob 1983 ; octavio et al . 1977 ) . \n the behaviour of the albedo of water , , is complex and depends on the solar elevation ( so - called fresnel albedo ) , on the diffusive component of the irradiation , and on the condition of the water surface . in the present study , \n the solar elevation was calculated and the fresnel albedo , dir , for the direct irradiation was estimated according to graham cogley ( 1979 ) : \n 4\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\alpha _ { { dir } } = 0.5{\\left [ { \\frac{{\\sin ^{2 } { \\left ( { \\tfrac{\\pi } { 2 } - e - r } \\right ) } } } { { \\sin ^{2 } { \\left ( { \\tfrac{\\pi } { 2 } - e + r } \\right ) } } } + \\frac{{\\tan ^{2 } { \\left ( { \\tfrac{\\pi } { 2 } - e - r } \\right ) } } } { { \\tan ^{2 } { \\left ( { \\tfrac{\\pi } { 2 } - e + r } \\right ) } } } } \\right ] } $ $ \\end{document}where e is the solar elevation and r is the refraction angle . for the diffusive radiation , a constant albedo of dif = 0.06 \n the total reflection coefficient was calculated as follows : \n 5\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\alpha = f\\alpha _ { { dir } } + { \\left ( { 1 - f } \\right)}\\alpha _ { { dif } } $ $ \\end{document}where f is the fraction of the direct radiation and equals : \n 6\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ f = \\frac{{k_{{dir } } } } { { k_{{in } } } } $ $ \\end{document}it is interesting to note that if no diffusive irradiation is available , the fraction f can also be calculated by using the scheme established by dejong ( see e.g. jacobs and van pul 1990 ) . \n the transport of turbulent latent heat , le , and sensible heat , h , from the water body towards the atmosphere , were parameterised by arya ( 1988 ) : \n 7\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\begin{array}{*{20}l } { { le = \\rho lc_{e } u{\\left ( { z_{r } } \\right)}{\\left ( { x{\\left ( { z_{r } } \\right ) } - x_{s } } \\right ) } } \\hfill } \\\\ { { h = \\rho c_{p } c_{h } u{\\left ( { z_{r } } \\right)}{\\left ( { t_{a } { \\left ( { z_{r } } \\right ) } - t_{s } } \\right ) } } \\hfill } \\\\ \\end{array } $ $ \\end{document}where ( kg m ) is air density ; l ( j kg ) latent heat for vaporisation ; ce and ch are water vapour and sensible heat exchange coefficients , respectively ; u ( m s ) is wind speed at reference height zr ; cp ( j kg k ) is the specific heat capacity of air ; x ( kg kg ) is specific humidity ; and index s refers to the water surface . \n in the present study , the turbulent exchange coefficients are chosen to be ( mascart et al . \n 1995 ) : \n 8\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ c_{e } = c_{h } = c_{{dn } } f_{h } $ $ \\end{document}where , fh is the stability correction factor , and cdn the drag coefficient of the grass cover under neutral conditions , as defined by ( mascart et al . \n 1995 ) : \n 9\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ c_{{dn } } = \\frac{{\\kappa ^{2 } } } { { { \\left ( { \\ln \\frac{{z_{r } } } { { z_{o } } } } \\right)}^{2 } } } $ $ \\end{document}where , ( 0.4 ) is von karman s constant and zo ( m ) is the roughness length of the grass cover . within the water body , \n , it is assumed that no mean water flow is allowed , but that mixing is influenced by water density stratification and the wind component at the air water interface ( bloss and harleman 1979 ) . \n the convective heat transport is taken as : \n 10\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ { \\mathop g\\nolimits_w } { \\left ( z \\right ) } = - { \\mathop { \\rho _ { w } c}\\nolimits_w } { \\mathop k\\nolimits_w } { \\left ( z \\right ) } \\frac{{\\delta { \\mathop t\\nolimits_w } } } { { \\delta z } } \n $ $ \\end{document}where kw(z ) is a complex function of the water surface friction velocity and w * is the depth , z , in the water and the density stratification in the water , expressed by the water richardson number , riw . in the model , \n the turbulent heat conductivity as suggested by henderson - sellers ( 1984 ) is used : \n 11\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ { \\mathop k\\nolimits_{o , z } } { \\left ( z \\right ) } = \\frac{{w * } } { { 30 k * } } { \\mathop e\\nolimits^ { - k * z } } $ $ \\end{document}along with the stratification corrections suggested by sundaram and rehm ( 1973 ) : \n 12\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ { \\mathop k\\nolimits_w } { \\left ( z \\right ) } = \\frac{{{\\mathop k\\nolimits_{o , w } } { \\left ( z \\right ) } } } { { 1 + { \\mathop \\sigma \\nolimits_1 } { \\mathop { ri}\\nolimits_w } { \\left ( z \\right ) } } } $ $ \\end{document}where k * and 1 represent an empirical function and a constant , respectively , and the water richardson number , riw , equals : \n 13\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ { \\mathop { ri}\\nolimits_w } { \\left ( z \\right ) } = \\frac{{{\\mathop a\\nolimits_w } g\\;z^{2 } \\delta t } } { { w*^{2 } \\delta z } } $ $ \\end{document}where , g is gravity and aw is the expansion coefficient for water , taken from sundaram and rehm ( 1973 ) : \n 14\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ { \\mathop a\\nolimits_w } = 1.5 \\cdot 10^ { { - 5 } } { \\left ( { \\overline{t } - 277 } \\right ) } - 2 \\cdot 10^ { { - 7 } } { \\left ( { \\overline{t } - 277 } \\right)}^{2 } $ $ \\end{document } the surface friction velocity at the water surface , w * , is suggested to be ( henderson - sellers 1984 ) : \n 15\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ w * = { \\sqrt { \\frac{{\\rho _ { a } c{\\left ( { z_{r } } \\right)}u^{2 } { \\left ( { z_{r } } \\right ) } } } { { \\rho _ { w } } } } } $ $ \\end{document}where , c(zr ) ( 0.001 ) is the drag coefficient for a large water surface ( arya 1988 ) . at the bottom of the circular water body , \n the measured soil heat conductivity is taken as the lowest boundary condition . at night , long - wave radiative cooling at the surface of the water body is the driving force ( see bottom panel in fig . 2 ) . \n a decrease of the top temperature increases the water density in that layer , which is responsible for the growth of a mixing layer of uniform density . \n in the course of the night the temperature of the mixing layer decreases gradually and , as a consequence , the depth of the mixing layer also increases . \n if it rains , it is assumed that the raindrops , as a first guess , have the same temperature as the wet bulb temperature , tw , of the ambient air at screen height ( 1.5 m ) . \n it is also assumed that , during a rain event , the uppermost water layer is affected by cooler or warmer rain drops . \n thus , in the upper water layer , an additional energy , qrain , must be inserted , which equals : \n 16\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ q_{{rain } } = c_{w } r{\\left ( { t_{w } - t_{{wa } } } \\right ) } $ $ \\end{document}where r is the precipitation intensity in ( m s ) . \n the number of water layers is n = 10 , which corresponds to a mean thickness of 25 mm . to fulfill the numerical stability condition , \n wageningen university operates a long - term meteorological observatory , the haarweg station , in the centre of the netherlands ( latitude 5158n , longitude 538w , altitude 7 m a.s.l . ; \n this grassland region is covered mainly with perennial species of ryegrass ( lolium perenne l. ) and rough bluegrass ( poa trivialis l. ) . \n the soil at the site is predominantly heavy basin clay resulting from the back - swamps of the rhine river ( snel 2004 ) . \n an aspirated psychrometer was used to measure the air temperature , ta , and wet - bulb temperature , tw , at reference height zr = 1.5 m. the wind speed u was measured by a cup anemometer at reference height zr = 1.5 m. the air temperature ta(0.10 m ) was measured with a shielded pt-100 thermometer at 0.10 m height . \n the total incoming short - wave radiation , kin , was measured with an aspirated pyranometer ( kipp & zonen , model cm11 ; delft , the netherlands ) at a height of 1.5 m. also at this height , the incoming diffusive short wave radiation , kdif , is measured with an pyranometer ( kipp & zonen , model cm11 ) combined with a shadow ring ( kipp & zonen , model cm 121b / c ) . the incoming direct beam short wave radiation , kdir , is calculated by subtraction , kdir = kinkdif . the incoming long - wave radiation , lin , was measured with a pyrgeometer ( kipp & zonen , model cg 1 ) at a height of 1.5 m. to estimate the thermal stability of the atmosphere , the turbulent momentum and sensible heat fluxes were measured at a height of 3.5 m with a three - dimensional sonic anemometer - thermometer ( 3d solent res , model a1012r2 ; gill instruments , lymington , uk ) . \n soil temperatures , tsoil , were measured by pt-100 elements at depths of 0.05 , 0.10 , 0.20 , 0.50 and 1.0 m. the soil moisture content at depths of 0.01 , 0.10 and 0.50 m were measured with a tdr ( time domain reflectrometry ) system ( tdr 100 , probe type cs 610 ; campbell scientific , loughborough , uk ) . \n the soil moisture results were used to obtain a reliable estimate of the actual heat conductivity of the soil . \n the soil heat flux was measured by a heat plate ( ws 31-cp ; tno , delft , the netherlands ) buried at a depth of 75 mm . in addition to the continuous station measurements , a detailed sub - experiment was carried out in and around a shallow artificial water body of still water throughout 2003 . at the observatory site , about 30 m west of the radiation instruments , \n a circular plastic box was dug into the soil in which the water experiments were carried out . \n the box has a diameter of 1.10 m and a depth of 0.375 m. the bottom of the box was cut out and replaced by a thin plastic sheet in order to ensure good thermal contact between the water and the underlying soil . \n the side walls of the box are made of 3-mm - thick pvc , and it appeared that hardly any heat flux occurred through the side walls . \n in fact this also means that our water model can be thought of as a so - called 1-d problem . \n the box was initially filled with tap water to a depth of 0.250 m. the water level in the box was kept constant and checked daily . \n the surface of the water is 0.12 m below the mean surface level of the surrounding soil . \n a stable floating system was designed with a inverted mast to which small glass - coated thermistors ( model beta g22k7mcd8 ) were connected at depths of 1 , 18 , 66 , 128 and 196 mm . \n the thermistors have a diameter of 0.8 mm . at the bottom of the water body , \n a heat soil flux plate is installed ( tno , model ws 31-cp ) . two thermometers ( pt100-elements ) \n were buried in the soil at a depth of 50 mm below the bottom of the water body . \n the heat conductivity of the soil was measured at various depths and locations using a non - stationary hot needle technique ( heusinkveld et al . \n the light extinction coefficient was measured following the method of kirk ( 1984 ) , with two underwater light sensors ( type ra100 ; bottemanne weather instruments , amsterdam ) . \n 1schematic outline of the experimental layout around the artificial water body schematic outline of the experimental layout around the artificial water body data from the fast response sonic system were sampled at 20 hz , and all other slow response meteorological instruments were sampled at 0.25 hz . data were averaged at 30-min intervals and stored in data loggers for subsequent processing . for more details of the measurements , site and data processing , see kraai ( 2004 ) and jacobs et al . \n the one - dimensional model is based on the energy budget ( see upper panel in fig . 2 ) . here \n , the driving force during daytime is the incoming short - wave radiation . immediately at the water surface a fraction , , of the net short - wave radiation is absorbed ( cathcart 1987 ; jacobs et al . \n water is transparent to short - wave radiation , where absorption depends not only on the path length but also strongly on the turbidity of the water . also at the water surface , \n exchange processes of long - wave ( incoming and outgoing ) radiation , sensible and latent heat take place ( cathcart 1987 ) . for the first water layer with thickness , \n the energy budget is : \n 1a\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\delta k + l_{{net } } - h - le - g_{w } = { \\mathop c\\nolimits_w } \\delta \\frac{{\\delta { \\mathop t\\nolimits_w } } } { { \\delta t } } $ $ \\end{document}where , k is the absorbed short - wave radiation in this layer , h the sensible heat flux and le the evaporation at the top of this layer , gw the convective heat at the bottom of this layer , cw the volumetric heat capacity of water , tw the mean temperature change of this water layer , and lnet the net long - wave radiation . for all other water layers \n the energy budget is : \n 1b\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\delta k - \\delta { \\mathop g\\nolimits_w } = { \\mathop c\\nolimits_w } \\delta \\frac{{\\delta { \\mathop t\\nolimits_w } } } { { \\delta t } } $ $ \\end{document}fig . \n top panel daytime situation , bottom panel nighttime situation schematic overview of the main energy terms in a water body . \n air interface is calculated by taking the measured incoming long - wave radiation , lin , minus the calculated outgoing long - wave radiation , lout , at the air water interface . \n the uppermost water temperature is used to calculate the outgoing long - wave radiation at the air water interface , lout , according to eq . 2 : \n 2\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ l_{{out } } = \\varepsilon _ { w } \\sigma t^{4}_{w } $ $ \\end{document}where w ( 0.99 ) is the emissivity of the water and ( 5.67 10 wmk ) is the stefan boltzmann constant . it must be noted that lin is corrected for the sky view factor , since the water body sees not only the sky but also a part of the side wall of the water box . in our case , \n the mean view factor is 150 , which means that the water body sees the sky for 150 and the edges for 30. remember also that gw at the lowest layer is the sediment heat flux . \n the absorbed short - wave radiation in the aquatic surface layer , n = 1 , equals : \n 3a\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\delta k{\\left ( { n = 1 } \\right ) } = k_{{in } } { \\left ( { 1 - \\alpha } \\right ) } { \\left [ { \\beta + { \\left ( { 1 - \\beta } \\right)}{\\left ( { 1 - { \\mathop e\\nolimits^ { - \\frac{{\\varepsilon \\delta } } { { xx } } } } } \\right ) } } \\right ] } $ $ \\end{document}and in all other water layers , n > 1 : \n 3b\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\delta k{\\left ( n \\right ) } = k_{{in } } { \\left ( { 1 - \\alpha } \\right ) } { \\left ( { 1 - \\beta } \\right ) } { \\mathop e\\nolimits^{\\frac { { - \\varepsilon ( n - 1 ) \\delta } } { { xx } } } } { \\left ( { 1 - { \\mathop e\\nolimits^{\\frac { { - \\varepsilon \\delta } } { { xx } } } } } \\right ) } $ $ \\end{document}where , kin is the incoming short - wave radiation at the water surface , \n the albedo at the water surface , the radiation extinction coefficient in the water , xx the correction factor for the actual path length ( hhne 1954 ; stefan et al . 1983 ) depending on solar height and ratio of the direct and diffusive solar radiation , the amount of short - wave radiation immediately absorbed in the first layer ( taken as 45% of the incoming short - wave radiation at the water surface ; orlob 1983 ; octavio et al . 1977 ) . \n the behaviour of the albedo of water , , is complex and depends on the solar elevation ( so - called fresnel albedo ) , on the diffusive component of the irradiation , and on the condition of the water surface . in the present study , \n the solar elevation was calculated and the fresnel albedo , dir , for the direct irradiation was estimated according to graham cogley ( 1979 ) : \n 4\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\alpha _ { { dir } } = 0.5{\\left [ { \\frac{{\\sin ^{2 } { \\left ( { \\tfrac{\\pi } { 2 } - e - r } \\right ) } } } { { \\sin ^{2 } { \\left ( { \\tfrac{\\pi } { 2 } - e + r } \\right ) } } } + \\frac{{\\tan ^{2 } { \\left ( { \\tfrac{\\pi } { 2 } - e - r } \\right ) } } } { { \\tan ^{2 } { \\left ( { \\tfrac{\\pi } { 2 } - e + r } \\right ) } } } } \\right ] } $ $ \\end{document}where e is the solar elevation and r is the refraction angle . for the diffusive radiation , a constant albedo of dif = 0.06 \n the total reflection coefficient was calculated as follows : \n 5\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\alpha = f\\alpha _ { { dir } } + { \\left ( { 1 - f } \\right)}\\alpha _ { { dif } } $ $ \\end{document}where f is the fraction of the direct radiation and equals : \n 6\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ f = \\frac{{k_{{dir } } } } { { k_{{in } } } } $ $ \\end{document}it is interesting to note that if no diffusive irradiation is available , the fraction f can also be calculated by using the scheme established by dejong ( see e.g. jacobs and van pul 1990 ) . \n the transport of turbulent latent heat , le , and sensible heat , h , from the water body towards the atmosphere , were parameterised by arya ( 1988 ) : \n 7\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ \\begin{array}{*{20}l } { { le = \\rho lc_{e } u{\\left ( { z_{r } } \\right)}{\\left ( { x{\\left ( { z_{r } } \\right ) } - x_{s } } \\right ) } } \\hfill } \\\\ { { h = \\rho c_{p } c_{h } u{\\left ( { z_{r } } \\right)}{\\left ( { t_{a } { \\left ( { z_{r } } \\right ) } - t_{s } } \\right ) } } \\hfill } \\\\ \\end{array } $ $ \\end{document}where ( kg m ) is air density ; l ( j kg ) latent heat for vaporisation ; ce and ch are water vapour and sensible heat exchange coefficients , respectively ; u ( m s ) is wind speed at reference height zr ; cp ( j kg k ) is the specific heat capacity of air ; x ( kg kg ) is specific humidity ; and index s refers to the water surface . \n in the present study , the turbulent exchange coefficients are chosen to be ( mascart et al . \n 1995 ) : \n 8\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ c_{e } = c_{h } = c_{{dn } } f_{h } $ $ \\end{document}where , fh is the stability correction factor , and cdn the drag coefficient of the grass cover under neutral conditions , as defined by ( mascart et al . \n 1995 ) : \n 9\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ c_{{dn } } = \\frac{{\\kappa ^{2 } } } { { { \\left ( { \\ln \\frac{{z_{r } } } { { z_{o } } } } \\right)}^{2 } } } $ $ \\end{document}where , ( 0.4 ) is von karman s constant and zo ( m ) is the roughness length of the grass cover . within the water body , \n , it is assumed that no mean water flow is allowed , but that mixing is influenced by water density stratification and the wind component at the air water interface ( bloss and harleman 1979 ) . \n the convective heat transport is taken as : \n 10\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ { \\mathop g\\nolimits_w } { \\left ( z \\right ) } = - { \\mathop { \\rho _ { w } c}\\nolimits_w } { \\mathop k\\nolimits_w } { \\left ( z \\right ) } \\frac{{\\delta { \\mathop t\\nolimits_w } } } { { \\delta z } } \n $ $ \\end{document}where kw(z ) is a complex function of the water surface friction velocity and w * is the depth , z , in the water and the density stratification in the water , expressed by the water richardson number , riw . in the model , \n the turbulent heat conductivity as suggested by henderson - sellers ( 1984 ) is used : \n 11\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ { \\mathop k\\nolimits_{o , z } } { \\left ( z \\right ) } = \\frac{{w * } } { { 30 k * } } { \\mathop e\\nolimits^ { - k * z } } $ $ \\end{document}along with the stratification corrections suggested by sundaram and rehm ( 1973 ) : \n 12\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ { \\mathop k\\nolimits_w } { \\left ( z \\right ) } = \\frac{{{\\mathop k\\nolimits_{o , w } } { \\left ( z \\right ) } } } { { 1 + { \\mathop \\sigma \\nolimits_1 } { \\mathop { ri}\\nolimits_w } { \\left ( z \\right ) } } } $ $ \\end{document}where k * and 1 represent an empirical function and a constant , respectively , and the water richardson number , riw , equals : \n 13\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ { \\mathop { ri}\\nolimits_w } { \\left ( z \\right ) } = \\frac{{{\\mathop a\\nolimits_w } g\\;z^{2 } \\delta t } } { { w*^{2 } \\delta z } } $ $ \\end{document}where , g is gravity and aw is the expansion coefficient for water , taken from sundaram and rehm ( 1973 ) : \n 14\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ { \\mathop a\\nolimits_w } = 1.5 \\cdot 10^ { { - 5 } } { \\left ( { \\overline{t } - 277 } \\right ) } - 2 \\cdot 10^ { { - 7 } } { \\left ( { \\overline{t } - 277 } \\right)}^{2 } $ $ \\end{document } the surface friction velocity at the water surface , w * , is suggested to be ( henderson - sellers 1984 ) : \n 15\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ w * = { \\sqrt { \\frac{{\\rho _ { a } c{\\left ( { z_{r } } \\right)}u^{2 } { \\left ( { z_{r } } \\right ) } } } { { \\rho _ { w } } } } } $ $ \\end{document}where , c(zr ) ( 0.001 ) is the drag coefficient for a large water surface ( arya 1988 ) . at the bottom of the circular water body , \n the measured soil heat conductivity is taken as the lowest boundary condition . at night , long - wave radiative cooling at the surface of the water body is the driving force ( see bottom panel in fig . 2 ) . \n a decrease of the top temperature increases the water density in that layer , which is responsible for the growth of a mixing layer of uniform density . \n in the course of the night the temperature of the mixing layer decreases gradually and , as a consequence , the depth of the mixing layer also increases . if it rains , it is assumed that the raindrops , as a first guess , have the same temperature as the wet bulb temperature , tw , of the ambient air at screen height ( 1.5 m ) . \n it is also assumed that , during a rain event , the uppermost water layer is affected by cooler or warmer rain drops . \n thus , in the upper water layer , an additional energy , qrain , must be inserted , which equals : \n 16\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{mathrsfs } \n \\usepackage{upgreek } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document}$$ q_{{rain } } = c_{w } r{\\left ( { t_{w } - t_{{wa } } } \\right ) } $ $ \\end{document}where r is the precipitation intensity in ( m s ) . \n the number of water layers is n = 10 , which corresponds to a mean thickness of 25 mm . to fulfill the numerical stability condition , \n the response of the water temperature to meteorological conditions throughout the seasons was investigated in spring , summer and autumn . \n first , 3 consecutive days in spring ( 14 , 15 and 16 april 2003 ) with fine weather and low wind speed [ u(1.5 m ) < 3.5 m s , where u(1.5 m ) is wind speed at 1.5 m height ] were selected in order to analyse the effect of weather in spring on the behaviour of the water temperature at various depths . \n the top panel of fig . 3 illustrates the most important environmental variables during these days . \n the bottom panel of fig . 3 shows the results of measurements of water temperature and air temperature , ta , at 1.5 m , and the soil temperature at a depth of 50 mm , together with the simulation results . \n the soil temperature at 50 mm is the soil temperature at the undisturbed reference location of the observatory . \n the radiation extinction coefficient in the water was = 8 m during this period . \n figure 3 shows a clear stratification starting after sunrise for the measured water temperatures , twa , at all levels . \n when cooling begins in the afternoon , a slow but clear mixing layer starts from the surface of the water . \n also , it can be seen that a complete well mixed layer exists late at night . from the wind measurements shown in fig . \n 3 , it can be observed that the wind speed was low [ u(1.5 m ) < 3.5 m s ] throughout the entire period and consequently could not have caused a well forced convective mixing within the water body . \n fig . 3top panel relevant environmental conditions during a period in spring ( 1416 april 2003 ) . \n ta air temperature , kin total incoming short - wave radiation , lin measured incoming long - wave radiation . \n bottom panel observed ( dashed lines ) and simulated ( solid lines ) water temperatures , along with the air temperature ta at 2 m height and the undisturbed soil temperature tsoil at 50 mm depth top panel relevant environmental conditions during a period in spring ( 1416 april 2003 ) . \n ta air temperature , kin total incoming short - wave radiation , lin measured incoming long - wave radiation . \n bottom panel observed ( dashed lines ) and simulated ( solid lines ) water temperatures , along with the air temperature ta at 2 m height and the undisturbed soil temperature tsoil at 50 mm depth the temperature model simulations , tmo , mimic well the measured water temperatures during daytime . during the night , however , dissimilarity between model and experiment is evident in the higher levels of nocturnal cooling [ tmo(0.02 m ) and tmo(0.13 m ) ] of about 1c . \n notice also that the air temperature , ta(1.5 m ) , always exceeds the water temperature during this period of the year . \n this means that the surface of the surrounding grass cover usually has a higher temperature than the water surface . \n in contrast , the soil temperature at 50 mm depth , tsoil(50 mm ) , is nearly always lower than the water temperature . \n the soil temperature slowly tends towards a higher level due to spring heating of the soil and due to the large heat capacity of the soil . \n a second period of 3 days in summer ( 4 , 5 and 6 august 2003 ) with low wind conditions and with a level of incoming short - wave radiation about the same as in the selected spring period was selected . \n the radiation extinction coefficient in the water was = 12 m during this period . \n the measurement results and model simulations are plotted in the bottom panel of fig . \n the results from fig . 4 show that the general pattern agrees with that found in spring \n first , as must be expected , the air , soil and water temperatures are much higher during this period of the year than in spring . \n air interface lies close to the air temperature during daytime . at night , however , all water temperatures are much higher than the air temperature . as a consequence it must be expected that , during the night , the water body will lose energy by sensible heat as well as by evaporation . \n 4top panel relevant environmental conditions during a period in summer ( 46 august 2003 ) . \n bottom panel observed ( dashed lines ) and simulated ( solid lines ) water temperatures , along with the air temperature ta at 1.5 m height and the undisturbed soil temperature tsoil at 50 mm depth top panel relevant environmental conditions during a period in summer ( 46 august 2003 ) . \n bottom panel observed ( dashed lines ) and simulated ( solid lines ) water temperatures , along with the air temperature ta at 1.5 m height and the undisturbed soil temperature tsoil at 50 mm depth the simulated water temperatures agree much better with the measured water temperatures during this period . \n a third period of 3 days ( 15 , 16 and 17 october 2003 ) in autumn was selected . \n the measurement results and model simulations are plotted in the bottom panel of fig . \n the radiation extinction coefficient in the water was = 20 m during this period . \n 5top panel relevant environmental conditions during a period in autumn ( 1517 october 2003 ) . \n bottom panel observed ( dashed lines ) and simulated ( solid lines ) water temperatures , along with the air temperature ta at 2 m height and the undisturbed soil temperature tsoil at 50 mm depth top panel relevant environmental conditions during a period in autumn ( 1517 october 2003 ) . \n bottom panel observed ( dashed lines ) and simulated ( solid lines ) water temperatures , along with the air temperature ta at 2 m height and the undisturbed soil temperature tsoil at 50 mm depth the behaviour of the soil temperature was interesting ( fig . \n , the soil temperature is relatively high , which means that the soil contains a high amount of energy , which is released slowly to the atmosphere and , in our case , also to the water body . \n in fact , this means that the cooling of the water temperatures in autumn is slowed down by the heat capacity of the soil . \n another interesting phenomenon is the changes in air temperature behaviour throughout the seasons . in spring \n the air temperature is much higher than the water temperature , while in summer and autumn the air and water temperatures are more or less equal . \n as will be shown later , the highest dynamics at the boundaries of the water body occur during spring . \n figure 6 shows the fluxes of sensible heat , evaporation and soil heat in the sediment below the water body . from these results \n , it can be clearly concluded that the system dynamics are highest in spring and relatively low in all other seasons . in spring \n the air is relatively dry , which enhances the evaporation flux from the water body during daytime as well as during nighttime . \n in addition , the water body temperature during spring is relatively low , which causes a sensible heat flux opposite to the evaporation flux . during this season \n we suspect that the reason the agreement between model and experimental results is lowest in spring is because the dynamics of the fluxes is highest in spring . \n 6fluxes of evaporation and sensible heat at the water atmosphere interface and the sediment heat flux at the water sediment interface in spring ( top panel ) , summer ( middle panel ) and autumn ( bottom panel ) fluxes of evaporation and sensible heat at the water \n atmosphere interface and the sediment heat flux at the water sediment interface in spring ( top panel ) , summer ( middle panel ) and autumn ( bottom panel ) in august , the water temperature rises to a higher level , causing a more or less constant evaporative flux . \n in contrast , the sensible heat flux above the water shows a small daily cycle opposite to that of the daily sensible heat flux cycle above vegetation ; during the daytime modest heating by the ambient air ( ta > tw ) , with a release of sensible heat during the night ( ta < tw ) . \n the sediment heat flux during this period shows a clear daily cycle whereby the sediment is heated during daytime and cooled during nighttime . in autumn \n , there is a relatively large sediment heat flux from the underlying soil sediment , which heats the water throughout the whole day and consequently delays seasonal cooling . \n 5 ) that in autumn the water temperature at the water atmosphere interface is higher then the air temperature all day . \n this means an all - day cooling of the water at the water air interface . \n this process is clearly reflected in the results presented in the bottom panel of fig . \n an additional fourth period ( 4 june 2003 ) with a rain event during daytime was selected in order to investigate the effect of precipitation on water temperature . \n 7 shows the measured and modelled water temperatures along with the air temperature and the rain events ; the bottom panel shows the various fluxes . \n bottom panel observed ( dashed lines ) and simulated ( solid lines ) water temperatures , along with the air temperature ta at 1.5 m height and the undisturbed soil temperature tsoil at 50 mm depth top panel relevant environmental conditions during a rain event ( 4 june 2003 ) . \n bottom panel observed ( dashed lines ) and simulated ( solid lines ) water temperatures , along with the air temperature ta at 1.5 m height and the undisturbed soil temperature tsoil at 50 mm depth during the rain event , a clear drop in the air temperature occurs and , in addition , a small drop in the uppermost water temperature . \n however , no great effect of this rain event of about 5 mm in 20 min can be observed . the energy drop caused by the cold raindrops , qrain ( see eq . \n 9 ) , was 80 w m , while during the rain event the incoming short - wave radiation was 400 w m. the energy drop caused by the raindrops is relatively small compared to the short - wave irradiation , hence for this particular rain event no large effect on the water temperature can be expected . also , it is important to note that , in our case , the heat capacity of the water body , which is per unit of the water surface , is about 1.2 10 j m k , which is very high and reduces any effect of the rain on water temperature . \n however , in a study on small water puddles caused by the hoof prints of animals , and which are often breeding places for malaria larvae , we found large effects of rain events ( k.p . \n however , in this latter case the water puddles are very small ( = 0.16 m ) and very shallow ( 0.04 m depth ) . from the bottom panel in fig . \n 7 , it can be observed that only the evaporation flux is somewhat affected by the rain event ; hardly any effect on the sensible heat and soil heat flux in the sediment can be observed . \n few past studies have examined very small water bodies of the size we used in our experiments . \n 1997 ) focussed on a larger natural water body with a diameter of 6 m and a water depth of 0.35 m. water plants grew near the edges of the water body , and the vegetation around the water body in this natural bog area comprised tussocks of relatively long grasses ( height 0.45 m ) . \n generally , the pattern of the water temperatures measured in this water body was similar to the results from this study during the summer period . \n one difference , however , was that the daytime temperature gradient within the water was at least two - fold larger . \n the reason for this difference in temperature gradient is that the tussocks around the water body caused an effective sheltering from the wind , reducing turbulence just above the water surface and consequently reducing mixing within the water body . \n the second study was of a so - called class a evaporation pan ( jacobs et al . \n this pan has a diameter of 1.2 m and a height of 0.25 m. the evaporation pan was placed on the grass cover of our observatory , which means that the wind speed was seriously disturbed by the edges of the pan and enhanced the turbulence above the water . \n the result of this extra turbulence was that the water body was always well mixed and the temperature of the water body behaved more or less uniformly . \n the same homogeneous water temperature result is found in large lakes and in large water reservoirs ( e.g. smith 1979 ) . in these studies , \n the wind has a long free fetch ; consequently , no wind sheltering or wind blocking by the boundaries of the lake or water reservoir can affect the wind profile above these large water bodies . for large water bodies such as lakes and water reservoirs , turbulence in the water is strongly dependent on wind speed as well as on the wave spectrum , whereas the wave spectrum is strongly fetch dependent ( arya 1988 ) . in the german literature , there is an old , but nice study on small water bodies ( hohne 1954 ) . \n it was published in the former ddr republic , however , and nowadays it is difficult to obtain a copy of this study . \n it is a theoretical study presenting qualitative figures only of the course of the water temperature at various depths . during daytime \n , these qualitative results roughly agree with our results ; however , during the night no good mixing was observed , which is quite different from the results of our study . \n there is an interesting study from losordo and piedrahita ( 1991 ) executed in aquaculture ponds . \n the ponds in their study are quite large ( up to 10 ha with a depth of about 2 m ) and had an effective fetch of approximately 65 m , which means that , during daytime , only under very low wind conditions could stratification be observed . \n the difference between losordo and piedrahita s study and the present study is that our water body is orders of magnitude smaller . \n that means that we have no undisturbed wind fetch and consequently no equilibrium between wind speed above the water and the surface speed of the underlying water surface . for our experiments \n it means that the degree of turbulence just above the water body is defined by the edge type ( step upward or step downward ) and by wind sheltering the vegetation around the water body . \n an existing water model was extended to simulate the water temperatures and the fluxes at the boundaries . \n moreover , the effect of a rain event on the water temperature has been analysed . \n the following main conclusions can be drawn from the experiments and the simulations : \n during daytime a clear stratification in the water exists under relatively low wind conditions.during nighttime a clear mixed layer starts to grow from the atmosphere \n water interface.a clear seasonal effect can be observed in which the sediment heat flux plays a dominant role . in spring \n the heating of the water body is delayed , while in autumn cooling is delayed.the model simulations mimic our experimental observations reasonably well . \n a possible reason might be that , particularly in spring , the dynamics of the fluxes at the boundaries are largest.because of the high heat capacity of the water body , hardly any effect of rain events on water temperatures can be observed . during daytime \n a clear seasonal effect can be observed in which the sediment heat flux plays a dominant role . in spring \n the heating of the water body is delayed , while in autumn cooling is delayed . \n a possible reason might be that , particularly in spring , the dynamics of the fluxes at the boundaries are largest . because of the high heat capacity of the water body , hardly any effect of rain events on water temperatures can be observed .", "role": "user" }, { "content": "for aquatic biological processes , diurnal and annual cycles of water temperature are very important to plants as well as to animals and microbes living in the water . \n an existing one - dimensional model has been extended to simulate the temperature profile within a small water body . \n a year - round outdoor experiment has been conducted to estimate the model input parameters and to verify the model . \n both model simulations and measurements show a strong temperature stratification in the water during daytime . throughout the night , however , a well - mixed layer starting at the water surface develops . \n because the water body is relatively small , it appears that the sediment heat flux has a strong effect on the behaviour of the water temperature throughout the seasons . in spring \n , the water temperature remains relatively low due to the cold surrounding soil , while in autumn the opposite occurs due to the relatively warm soil . \n it appears that , in small water bodies , the total amount of incoming long wave radiation is sensitive to the sky view factor . in our experiments \n , the intensity of precipitation also appears to have a small effect on the stratification of the water temperature .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: guillain - barre syndrome ( gbs ) is usually a monophasic illness , but relapses due to recurrences and treatment - related fluctuations ( trf ) with immunotherapy ( immunoglobulins or plasma exchange ) do occur . \n trf needs to be differentiated from acute onset chronic inflammatory demyelinating polyradiculoneuropathy ( a - cidp ) . \n a 55-year - old female who suffered from vitiligo and essential hypertension came to the neurology unit with progressive weakness of the lower limbs over 5 days . \n she had flaccid motor weakness ( proximal > distal ) and areflexia with intact sensation . over the next 2 days her weakness ascended to involve the upper limbs . \n intravenous immunoglobulin was initiated on day 6 of the illness and continued for 5 days . on day 7 she had grade 2 power in the lower limbs and grade 4 power in the upper limbs ( gbs motor disability scale of grade 3 ) . \n she made gradual recovery until day 13 , when she had grade 4 power in the lower limbs and normal power in the upper limbs . \n she was quadriplegic ( grade 0 in lower limbs , grade 2 in upper limbs ) and she could not flex her neck ( motor disability of grade 4 ) . \n she was hyponatremic ( 108 meq / l ) suggesting syndrome of inappropriate secretion of antidiuretic hormone . \n she was able to walk without support ( lower limbs- grade 4 ) and was subsequently discharged ( motor disability scale of grade 2 ) . \n investigations during her stay in hospital including full blood count , esr , crp , renal and liver functions were normal . \n autoimmune screen and screening for hiv , mycoplasma , campylobacter , cytomegalovirus and hsv were negative . \n clinical evaluation and investigations had ruled out associated connective tissue disorders , malignancy and chronic infections . \n trf is defined as improvement in the gbs disability scale of at least one grade after completion of immunotherapy ( immunoglobulin / plasmapharesis ) followed by a worsening of the disability scale of at least one grade within the first 2 months after disease onset . \n recurrence of gbs is identified and is defined as two or more episodes that fulfilled the criteria for gbs , with either a minimum interval greater than 4 months between episodes if the patient did not recover completely or greater than 2 months when there was a complete or near - complete recovery after the previous episode . \n the differential diagnosis of trf to be considered is a - cidp . thus differentiating the two entities are paramount . \n the diagnosis of a - cidp should be considered when a patient thought to have guillain - barre syndrome deteriorates again after 8 weeks from onset or when deterioration occurs three times or more . in a dutch study 10% of 170 subjects diagnosed with gbs had trf , and all of the episodes occurred within 8 weeks after symptom onset , typically at around 4 weeks after onset . \n median length of time before the first trf was 18 days , ( ranged from 10 to 54 days ) ; 31% had a second trf , but no additional fluctuations after 8 weeks . \n none of the eight patients found to have a - cidp began fluctuating until after 8 weeks in the said study . \n the above patient deteriorated within 8 weeks of onset of illness ( day 16 ) and has not shown a consecutive chronic course but had complete recovery by 6 months without any further deterioration making a - cidp an unlikely diagnosis . in the dutch study a - cidp patients were less severely affected , did not need artificial ventilation and rarely had cranial nerve dysfunction which makes a - cidp in our patient unlikely as she showed greater disability , keeping with the diagnosis of gbs - trf . \n romano et al suggested the presence of an associated medical condition as a predictor of relapse . \n a dutch study concluded that the most important factor for not having trf was the presence of predominant distal weakness . \n the above patient experienced a rapid deterioration in muscle strength with neck and respiratory muscle involvement . in the dutch study \n gbs - trf patients were more severely affected when compared to patients with gbs without fluctuations . \n if therapy is initiated very early when the disease process is active , it will only temporarily arrest the disease process and once treatment is over the disease could recur . in such instances repeat treatment \n immune reactions against target epitopes in schwann - cell surface membrane or myelin result in acute inflammatory demyelinating polyradiculoneuropathy ; reactions against epitopes contained in the axonal membrane cause the acute axonal forms of gbs \n . the predominant mechanisms by which ivig therapy exerts its action appear to be a combined effect of complement inactivation , neutralisation of antibodies , cytokine inhibition and saturation of fc receptors on macrophages . \n fluctuation with early relapse and improvement on repeat treatment thus could be thought as due to rebounding of the antibodies or immune reactions on those epitopes . however , some studies dispute this claim . in one description of a japanese man with trf \n the antibody titres steadily declined irrespective of the clinical fluctuations and authors concluded that the clinical fluctuation was not due to changes in the production of antibodies but presumably due to the inflammatory response in peripheral nerves outlasting the transient beneficial effects of intravenous immunoglobulin . \n recurrence may also be due to ongoing immune activation . a transient high ana titre and the presence of vitiligo seen in this patient may signify autoimmunity as an underlying mechanism for the trf . therefore early treatment , and continued immune activation could have contributed to the trf in our patient . \n this case illustrates the value of insight regarding the risk factors for trf for the practicing clinician to give a reasonable prognosis and to anticipate and be prepared for difficulties in management . also there is a need to rule out other coexisting immune disorders and to exclude a - cidp as an alternative diagnosis .", "role": "user" }, { "content": "guillain - barre syndrome ( gbs ) is usually a monophasic illness but relapses occur . a 55-year - old female with hypertension and vitiligo presented with acute inflammatory demyelinating polyradiculoneuropathy . \n she improved with immunoglobulin treatment started on day 6 of illness , but relapsed on day 14 warranting repeat immunoglobulin therapy . \n thereafter recovery was complete . \n her relapse was due to treatment - related fluctuation ( trf ) . \n trf is improvement in the gbs disability scale of at least one grade after completion of immunotherapy followed by worsening of the disability scale of at least one grade within the first 2 months after disease onset . \n recurrent gbs and chronic inflammatory demyelinating polyradiculoneuropathy were excluded . during the peak of the illness ana titres \n were transiently high . \n the presence of other medical conditions , predominant proximal weakness and the absence of preceding diarrhea are predictors for trf seen in this patient . \n early treatment and evidence of ongoing immune activation have contributed toward trf .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the anatomy of the vagus nerve was first described by galen in the second century ad , and further investigated by surgeons during the first quarter of the century . \n vagotomy , known as the surgical resection or cutting of parts of the vagus nerve that innervates the stomach , actually comprises at least three different types of surgery that include truncal , selective and highly selective vagotomies [ 2 , 3 ] . \n the vagus nerve divides into two branches , and each branch innervates one side of the stomach . \n vagotomy is often performed together with other surgical procedures , such as pyloroplasty , gastric resection or antrectomy . in the surgical management of peptic ulcers \n the history of peptic ulcer treatment began in the 19th century , when william prout discovered hydrochloric acid within the gastric lumen , enabling him to relate the presence of hydrochloric acid in the stomach to the occurrence of dyspepsia . \n the role of the vagus nerve in the control of gastric acid secretion was identified in 1814 by benjamin brodie and later elaborated on by ivan pavlov . in the early 1900s , \n the standard operation for the treatment of gastric and duodenal ulcers was either a pyloroplasty without vagotomy , or a gastroenterostomy . \n pyloroplasty was later surpassed by gastroenterostomy as the treatment of choice , which then was superseded by gastric resection , comprising 80% of procedures by the early 1950s . \n based on a better understanding of the mechanism behind gastric acid secretion , subtotal gastrectomy was used for the treatment of ulcers for the next several decades . \n the effects of vagotomy on acid secretion and gastric motility were established in the early 20th century . in 1921 , andre latarjet applied knowledge of the anatomy of the vagus nerve clinically by performing an anatomically complete vagotomy for dyspepsia . by the year 1938 , komarov had confirmed the existence of gastrin and its stimulatory effects on acid secretion , and in 1943 , lester dragstedt reported that subdiaphragmatic vagotomy favorably influence the clinical course of duodenal ulcer [ 1 , 3 ] . the surgical approach at this time designed largely to reduce acid secretion . by incorporating both vagotomy and antrectomy ( which removed acid stimulating gastrin cells ) , acid production would be effectively reduced , thus continuing the no acid , no ulcer dogma of the time . \n dragstedt also introduced into clinical practice the combination of truncal vagotomies with a pyloroplasty . after the world war \n ii , this paradigm of surgical control of acid secretion served as the basis of treatment of peptic ulcer disease . with the introduction of selective vagotomies , e.g. proximal gastric vagotomy without pyloroplasty , both decreased acid secretion and less - effected motility were achieved . \n type i gastric ulcers were preferentially treated either by partial gastrectomy or by performing antrectomy with gastroduodenostomy ( bilroth i ) . \n currently , gastrectomy to treat peptic ulcers is only used if there is a defined risk for gastric cancer in an unhealed gastric ulcer . \n gastrectomy may also be performed in the case of recurrent or therapy - resistant pre - pyloric ulcers . in the late 1970s , \n the use of h2 blockers was introduced and later proton pump inhibitors emerged . a remarkable parallel can be seen between the developments of the two approaches in the 1970s ; highly selective vagotomy was introduced as a new alternative to partial gastrectomy in surgical treatment of peptic ulcers in 1971 . later during the same decade , surgery was performed less often as a result of improved h2 receptor antagonist treatment [ 8 , 5 ] . \n after 1984 , the etiological role of helicobacter pylori ( h. pylori ) in the peptic ulcer disease was recognized and with this came a better understanding of the pathophysiology of peptic ulcers , and thus treatment changed accordingly [ 1 , 4 ] . \n research has shown a clear role for h. pylori in the development of not only peptic ulcers , but also gastric cancer , a topic extensively reviewed by david y. graham in 2014 . \n graham also recently published an updated overview of effective therapies and possible benefits associated with h. pylori eradication to prevent gastric carcinogenesis . \n vagotomy had been used as a surgical treatment for peptic ulcers because it reduces gastric acid secretion . \n the secondary hypochlorhydria and hypergastrinemia have been thought to be risk factors for gastric tumorigenesis . \n in fact , vagotomy is much less powerful than h2 receptor inhibitors or proton pump inhibitors in terms of the inhibition of acid secretion and the secondary elevation of circulating gastrin levels . \n conceivably , vagotomy would unlikely increase the risk for gastric cancer if h2 receptor inhibitors or ppis were without the effect . \n indeed , there is no evidence for a carcinogenic effect after long - term use of h2 antagonists . \n it was reported that patients had an excess gastric cancer incidence during the first 4 years of treatment , but this was almost certainly due to initially misdiagnosed cancer [ 11 - 13 ] . also , in a study investigating the risk of gastric cancer among cimetidine users it was reported that there was an increased long - term risk of cancer in female but not male patients . \n the sample size was too low to reach any conclusion as there were only 6 women diagnosed with gastric cancer in that study . \n ppis have become one of the most commonly used medications worldwide , as they are currently the best treatment of choice for several gastric acid - related gastrointestinal disorders because they are effective in reducing the acid secretion and have no long - term adverse effects [ 14 , 15 ] . \n it is not surprising that there has been debated whether ppi therapy increases , decreases or has no effect on gastric cancer risk [ 16 - 19 ] . \n it has been well recognized that there is a positive association between gastric ulcer disease and the risk of developing gastric cancer , and a negative association between duodenal ulcerations and the risk of gastric cancer . \n thus , it would be of interest to find out whether vagotomy that was initially performed in gastric ulcer patients could increase the risk of gastric cancer . \n surgical treatment such as partial gastrectomy or vagotomy has traditionally been thought to be associated with an increased risk of gastric cancer due to the secondary hypochlorhydric conditions in the stomach [ 21 - 26 ] . \n a prospective study , which included 1495 patients , used a pathological gastritis index to evaluatethe risk of developing gastric cancer after peptic ulcer surgery . \n patients who underwent either truncal vagotomy with drainage or partial gastrectomy displayed atrophic gastritis index 2.3 0.08 and 2.6 0.1 , respectively , in comparison with nonoperated patients with dysplasia at 1.8 0.08 . \n thus , there was no evidence to that vagotomy or partial gastrectomy could lead to either an increased risk of cancer or precancerous lesions . \n furthermore , a 20 + -year follow - up study , which included 5018 patients who underwent gastric surgery or truncal vagotomy with either drainage or gastroenterostomy , showed that of the 5 gastric ulcer patients who underwent vagotomy , 1 case of cancer was observed compared to 0.6 cases expected during the first 19 postoperative years , thus yielding a mortality rate of 1.7 . \n apparently , there was no significant increase in mortality during the 20-year follow - up . \n an epidemiological study , which included 7198 patients , showed that standardized incidence ratio ( sir ) of gastric cancer patients diagnosed with gastric ulcer which underwent vagotomy was 1.5 after the first 10 years and reduced to zero after the second 10 years . \n it should be noticed that sir of gastric cancer patients diagnosed with duodenal ulcer which underwent vagotomy was 1.3 both after the first and the second 10-years . \n given that hypochlorhydria might be associated with increased concentration of carcinogenic n - nitroso compounds in the gastric juice , animal studies using vagotomy and n - methyl - n-nitro - n - nitrosoguanidine in drinking water were conducted , and indeed vagotomy increased the number of adenocarcinomas formation in the stomach in these animal models [ 29 , 30 ] . \n however , it should be noticed that the vagotomy performed in those studies was without drainage procedures . \n thus , the increased risk of gastric cancer upon vagotomy was most likely due to delayed gastric emptying , with increased exposure time of orally administered chemical carcinogens on the gastric mucosa in these animals . \n to study whether the vagus nerve has the direct trophic effect in the stomach , an experimental model of unilateral vagotomy has been used given that each ( anterior or posterior ) vagal trunk innervates only one half of the stomach . \n consequently , denervation of one side of the stomach does not impair the overall functional capacity of the stomach , leaving gastric acid output , circulating gastrin levels and motility unchanged [ 31 , 32 ] . utilizing this approach , hkanson et al . \n were able to demonstrate that the vagus nerve per se has the trophic effect on the gastric mucosa and that the vagnus nerve is essential for the growth effect by ppi - induced hypergastrinemia on the gastric oxyntic mucosa in general and the enterochromaffin - like cells in particular [ 33 , 34 ] . \n this was later confirmed by using gene knockout of muscarinic acetylcholine receptor type 3 ( m3ko ) mice . \n given that the vagus nerve - mediated m3r signaling may potentiate a proliferative effect on gastric epithelium , it became again an interesting question whether the vagus nerve promotes gastric cancer development . \n indeed , most of gastric cancers arise from lesser curvature of the stomach , where more pronounce vagus nerve ending is distributed [ 36 , 37 ] , suggesting the role of vagus nerve in tumor microenvironment . very recently , the important role of the vagus nerve in gastric tumorigenesis has been investigated carefully in mouse models and in human patients . \n 1 ) during the preneoplastic stage of tumorigenesis reduced the tumor incidence and size , and attenuated tumor cell proliferation specifically in the denervation portion of the stomach ( after uvt ) in the mouse models of gastric cancer , i.e. , the genetically - induced mouse model ( ins gas ) [ 39 - 43 ] , a chemically - induced ( mnu ) mouse model and a helicobacter pylori - infected mouse model . more importantly , unilateral vagotomy ( uvt ) ( fig . \n 2 ) , or local pharmacologic denervation via injection of botulinum toxin a in the gastric wall , similarly impaired preneoplastic growth , indicating the direct effect on tumor progression by vagus stimuli . at later stages of gastric tumorigenesis , vagotomy , botulinum toxin a injection , or systemic treatment with darifenacin , a m3r antagonist , suppressed the cancer progression and augmented the anti - tumor effect of chemotherapy , leading to prolonged survival ( fig . \n furthermore , the progression stage of gastric cancer was found to be significantly correlated with pronounced nerve supply . \n comprehensive gene expression analysis of gastric tumors with or without vagotomy showed that this denervation effect was mediated predominantly by inhibition of wnt signaling , which is a known major regulator of gastrointestinal stem cells and tumor formation . in earlier studies , it has been suggested that aberrant acetylcholine - m3r signaling causes transformability in part through wnt/-catenin signaling activation [ 45 , 46 ] . \n consistent with those findings , vagotomy inhibited the expansion of leucine - rich repeat containing g protein - couple receptor 5-positive ( lgr5 + ) stem cells during carcinogenesis by suppressing wnt signaling in the stomach . in the stomach , the most abundant acetylcholine receptor is m3r , followed by low expression of m1r ( muscarinic acetylcholine receptor 1 ) expression , and they are known to be expressed in parietal cells and chief cells . \n interestingly , lgr5 + stem cells specifically express high levels of m3r , and can be activated by acetylcholine and then activated lgr5 + cells promote epithelial proliferation . \n thus , nerves play an important role in stem cell niche and tumor microenvironment , providing new insights into the cellular and molecular bases of tumorigenesis and pointing to the potential utility of anti - neurogenic therapies ( fig .", "role": "user" }, { "content": "vagotomy reduces gastric acid secretion and was therefore introduced as a surgical treatment for peptic ulcers in the 1970s . later \n , it was replaced by acid reducing medication , such as histamine type 2 ( h2 ) receptor antagonists and proton pump inhibitors ( ppis ) . \n a large body of evidence has indicated that drug - induced hypochlorhydria per se does not increase the risk of gastric cancer . \n early studies on the effects of vagotomy in chemically - induced rodent models of gastric cancer reported an increased risk of developing gastric cancer . \n this was most likely due to a delayed gastric emptying , which later has been accounted for by including an additional drainage procedure , e.g. pyloroplasty . \n in a recent study using three different mouse models of gastric cancer ( including genetically engineered , chemically - induced and helicobacter pylori - infected mice ) , either unilateral vagotomy or bilateral truncal vagotomy with pyloroplasty was found to significantly attenuate tumorigenesis in the denervated side of the stomach at early preneoplastic stages as well as at later stages of tumorigenesis . \n consistently , pharmacological denervation using botulinum toxin a or muscarinic acetylcholine receptor 3 ( m3r ) blockade inhibited tumorigenesis . \n moreover , it was found that recurrence of gastric cancer was reduced in patients following vagotomy . \n thus , these new findings suggest the potential treatment strategies to target the nerve , neurotransmitters , corresponding receptors and their downstream signaling pathways for the malignancy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: numerous studies have shown that individuals with human immunodeficiency virus ( hiv ) disease have microvascular abnormalities and changes in blood flow . \n the retinal microvasculopathy of hiv disease is characterized by ultrastructural changes similar to diabetic retinopathy . \n the combination of abnormal blood flow and microvasculopathy is believed to result in focal ischemia with the development of microaneurysms , retinal hemorrhages and cotton - wool spots . \n an electron microscopic study in patients with acquired immune deficiency syndrome ( aids ) revealed ischemic maculopathy in 6% of eye autopsies . human immunodeficiency virus associated with microvascular ischemia and damage , in theory \n herein , we report two patients with aids and cmv retinitis who developed decreased vision secondary to foveal ischemia manifesting as macular edema and irregular enlargement of the foveal avascular zone ; fluorescein angiography ( fa ) and optical coherence tomography ( oct ) findings are presented . \n he complained of decreased visual acuity ( va ) and floaters of 45 days duration in his right eye . \n visual loss was gradual , progressive , painless , and involved both central and peripheral vision . \n examination revealed best corrected visual acuity ( bcva ) of 20/400 in the right eye ( re ) and 20/30 in the left eye ( le ) . \n slit lamp biomicroscopic examination showed rubeosis iridis , 1 + cells and flare in the anterior chamber , and 1 + cells in the anterior vitreous in the re . \n intraocular pressure ( iop ) was 24 mmhg in the re and 12 mmhg in the le . \n posterior segment examination of the re showed juxtafoveal retinal opacification and macular edema [ figure 1a ] , and a large area of peripheral cmv retinitis in zones 2 and 3 occupying 30% of the nasal retina . \n fluorescein angiography ( topcon trc , oakland , nj , usa ) revealed an enlarged and irregular foveal avascular zone extending to the temporal retina with faint , late staining of juxtafoveal vessels . \n optical coherence tomography ( stratus oct , carl zeiss , dublin , ca , usa ) demonstrated increased reflectivity at the inner retinal layer with a preponderance in the nasal area of the macula [ figure 1b and c ] . the patient was treated with oral valgancyclovir , started on haart , and administered a high dose of intravitreal ganciclovir ( 5.0 mg/0.1 ml once a week ) for 5 doses followed by panretinal photocoagulation in the re , which controlled the retinitis and rubeosis iridis . \n six months later , bcva was 20/300 in the re with an increase in retinal thickness in the temporal area of the fovea , an epiretinal membrane and healed cmv retinitis , as demonstrated by oct [ figure 1d ] . \n case 1 : ( a ) color fundus photograph of the posterior pole shows juxtafoveal retinal opacification and macular edema . \n ( b ) fluorescein angiography reveals an enlarged foveal avascular zone extending to the temporal retina . \n ( c ) optical coherence tomography ( oct ) demonstrated increased reflectivity from the inner retinal layers ( arrow ) . \n ( d ) six months later , oct demonstrates increased retinal thickness in the temporal fovea with an epiretinal membrane ( arrow ) . \n a 50-year - old white man was diagnosed with hiv / aids at the age of 49 . \n he had a history of progressive outer retinal necrosis ( porn ) in the le treated with antivirals and three - port pars plana vitrectomy 1 year earlier . \n the patient complained of floaters , red eye and visual loss in the re of two months duration . \n visual acuity was 20/400 in the re and no light perception ( nlp ) in the le . \n fundus examination revealed an active granular cmv retinitis lesion in the nasal periphery of the re . \n cotton wool spots in fovea and parafoveal area were seen in the re [ figure 2a ] . \n fluorescein angiography revealed an enlarged foveal avascular zone [ figure 2b ] , and oct showed exudative inner limiting membrane detachment in the macular area and an increase in reflectivity from the inner retinal layers corresponding to retinal ischemia of the re [ figure 2c ] . \n the patient was treated with oral valgancyclovir , started on haart , and administered a high dose intravitreal ganciclovir ( 5.0 mg/0.1 ml once a week ) ; the cmv retinitis healed after 3 doses . \n nine months later , best corrected visual acuity was 20/300 in the re with reduction in retinal thickness at the foveal area as demonstrated by oct [ figure 2d ] . \n ( a ) color fundus photograph shows cotton - wool spots in the fovea and parafoveal area in the right eye ( white arrow ) . \n ( c ) optical coherence tomography ( oct ) showed internal limiting membrane ( ilm ) detachment ( yellow arrow ) in the macular area with increased reflectivity at the inner retinal layer ( white arrows ) corresponding to retinal ischemia . \n this shows that the ilm detachment was not serous and contained inflammatory / proteinaceous fluid ( exudative ilm detachment ) . \n he complained of decreased visual acuity ( va ) and floaters of 45 days duration in his right eye . \n visual loss was gradual , progressive , painless , and involved both central and peripheral vision . \n examination revealed best corrected visual acuity ( bcva ) of 20/400 in the right eye ( re ) and 20/30 in the left eye ( le ) . \n slit lamp biomicroscopic examination showed rubeosis iridis , 1 + cells and flare in the anterior chamber , and 1 + cells in the anterior vitreous in the re . \n intraocular pressure ( iop ) was 24 mmhg in the re and 12 mmhg in the le . \n posterior segment examination of the re showed juxtafoveal retinal opacification and macular edema [ figure 1a ] , and a large area of peripheral cmv retinitis in zones 2 and 3 occupying 30% of the nasal retina . \n fluorescein angiography ( topcon trc , oakland , nj , usa ) revealed an enlarged and irregular foveal avascular zone extending to the temporal retina with faint , late staining of juxtafoveal vessels . \n optical coherence tomography ( stratus oct , carl zeiss , dublin , ca , usa ) demonstrated increased reflectivity at the inner retinal layer with a preponderance in the nasal area of the macula [ figure 1b and c ] . the patient was treated with oral valgancyclovir , started on haart , and administered a high dose of intravitreal ganciclovir ( 5.0 mg/0.1 ml once a week ) for 5 doses followed by panretinal photocoagulation in the re , which controlled the retinitis and rubeosis iridis . \n six months later , bcva was 20/300 in the re with an increase in retinal thickness in the temporal area of the fovea , an epiretinal membrane and healed cmv retinitis , as demonstrated by oct [ figure 1d ] . \n case 1 : ( a ) color fundus photograph of the posterior pole shows juxtafoveal retinal opacification and macular edema . \n ( b ) fluorescein angiography reveals an enlarged foveal avascular zone extending to the temporal retina . \n ( c ) optical coherence tomography ( oct ) demonstrated increased reflectivity from the inner retinal layers ( arrow ) . \n ( d ) six months later , oct demonstrates increased retinal thickness in the temporal fovea with an epiretinal membrane ( arrow ) . \n a 50-year - old white man was diagnosed with hiv / aids at the age of 49 . he had a history of progressive outer retinal necrosis ( porn ) in the le treated with antivirals and three - port pars plana vitrectomy 1 year earlier . \n the patient complained of floaters , red eye and visual loss in the re of two months duration . \n visual acuity was 20/400 in the re and no light perception ( nlp ) in the le . \n fundus examination revealed an active granular cmv retinitis lesion in the nasal periphery of the re . \n cotton wool spots in fovea and parafoveal area were seen in the re [ figure 2a ] . \n fluorescein angiography revealed an enlarged foveal avascular zone [ figure 2b ] , and oct showed exudative inner limiting membrane detachment in the macular area and an increase in reflectivity from the inner retinal layers corresponding to retinal ischemia of the re [ figure 2c ] . \n the patient was treated with oral valgancyclovir , started on haart , and administered a high dose intravitreal ganciclovir ( 5.0 mg/0.1 ml once a week ) ; the cmv retinitis healed after 3 doses . \n nine months later , best corrected visual acuity was 20/300 in the re with reduction in retinal thickness at the foveal area as demonstrated by oct [ figure 2d ] . \n ( a ) color fundus photograph shows cotton - wool spots in the fovea and parafoveal area in the right eye ( white arrow ) . \n ( c ) optical coherence tomography ( oct ) showed internal limiting membrane ( ilm ) detachment ( yellow arrow ) in the macular area with increased reflectivity at the inner retinal layer ( white arrows ) corresponding to retinal ischemia . \n this shows that the ilm detachment was not serous and contained inflammatory / proteinaceous fluid ( exudative ilm detachment ) . \n ocular findings of hiv microvasculopathy include sluggish blood flow in the conjunctival capillaries in addition to cotton - wool spots , intraretinal hemorrhage and microaneurysms in the retina affecting up to 50% of patients with aids at some point in their disease . \n using fluorescein angiography , faber et al noted focal loss of capillary perfusion in hiv - infected individuals supporting histologic findings of retinal capillary cell loss and focal occlusion of small vessels . \n pepose et al described retinal changes attributed to the microvasculopathy of hiv disease because of its similarity to changes seen with diabetic retinopathy . \n opacification of the superficial retina in the macular area and intraretinal edema suggested the diagnosis . \n fluorescein angiography changes were similar in the two cases with enlargement of the foveal avascular zone and late staining of juxtafoveal vessels . \n oct changes consisted of increased reflectivity from the inner retina and decreased backscattering from the retinal photoreceptors due to fluid and retinal edema . \n the prevalence of cotton - wool spots in patients with aids ( 70% ) is significantly higher than other human immunodeficiency virus - infected individuals . \n increased fibrinogen levels in hiv - infected patients contribute to sludging of blood flow by increasing red blood cell aggregation . \n sludging of blood flow ( probably in association with other factors ) causes damage to the retinal microvasculature . \n anemia , opportunistic infections , or other unknown factors lead to transient episodes of increased retinal ischemia . in severely immunosuppressed individuals at risk of opportunistic infections , \n abnormal blood flow might increase the risk of retinal infection with blood - borne pathogens . \n although our patients were immunosuppressed , were not on haart and had concurrent cmv retinitis ( which by itself may involve the macula or cause optic neuritis ) , there were no sign of macular involvement due to cmv . \n in summary , ischemic maculopathy causing severe visual loss can be seen in patients with aids . \n the presence of superficial retinal opacification on fundus examination , impaired foveal circulation on fluorescein angiography , and increased foveal and parafoveal inner retina reflectivity on oct scans suggest the diagnosis . \n fluorescein angiography and oct should be considered in any patient with aids and unexplained visual loss . \n the mechanisms of ischemic maculopathy may be multifactorial and remain unknown . supported in part by the arevalo - coutinho foundation for research in ophthalmology , caracas , venezuela . \n supported in part by the arevalo - coutinho foundation for research in ophthalmology , caracas , venezuela . \n ", "role": "user" }, { "content": "to describe the clinical and optical coherence tomography ( oct ) characteristics of ischemic maculopathy in two patients with acquired immunodeficiency syndrome ( aids ) . \n two patients with aids and cytomegalovirus ( cmv ) retinitis developed ischemic maculopathy . \n both patients presented with central visual loss and active granular cmv retinitis . \n the presence of opacification of the superficial retina in the macular area and intraretinal edema suggested the diagnosis . \n fluorescein angiography changes were similar in the two cases with enlargement of the foveal avascular zone and late staining of juxtafoveal vessels . \n oct changes were suggestive of retinal ischemia : increased reflectivity from the inner retinal layer and decreased backscattering from the retinal photoreceptors due to fluid and retinal edema . \n ischemic maculopathy may cause a severe and permanent decrease in vision in aids patients . \n fluorescein angiography and oct should be considered in any patient with aids and unexplained visual loss . \n the mechanism of ischemic maculopathy may be multifactorial .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the term hemophagocytosis describes the pathologic finding of activated macrophages , engulfing erythrocytes , leukocytes , platelets , and their precursor cells . \n hlh is an unusual syndrome characterized by fever , splenomegaly , jaundice , and the pathologic finding of hemophagocytosis ( phagocytosis by macrophages of erythrocytes , leukocytes , platelets , and their precursors ) in bone marrow and other tissues . \n we report an adult patient who presented with systemic inflammatory response syndrome and features consistent with severe sepsis and septic shock , who subsequently received a diagnosis of secondary hlh . \n we reviewed the relationship between hlh and septic shock from the perspective of an intensivist . \n a 50 years female presented to intensive care unit ( icu ) with fever , rash , and loss of appetite . \n she was admitted in an outside hospital with 24 h of epigastric abdominal pain radiating to her flanks . \n there was no history of night sweats , weight loss , new medications , or toxin exposure . on admission , she presented with a temperature of 38.5c , a heart rate of 120/min , and an erythematous scaling rash covering over 50% of her body surface area , with increased scaling over her scalp . \n her abdomen was soft and nontender , with splenomegaly palpable 3 cm below the costal margin . \n there was no peripheral lymphadenopathy , and the rest of her physical exam was unremarkable . \n her initial blood work consisted of an elevated ferritin and lactic acid dehydrogenase ( ldh ) level , pancytopenia , acute kidney injury , hepatitis , and hypofibrinogenemia . \n broad - spectrum empirical antibiotics were administered for the presumed diagnosis of sepsis , but without apparent benefit . over a period of 24 days , she developed pressor - dependent hypotension , acute respiratory distress syndrome ( ards ) , acute kidney injury , bicytopenia ( anemia and thrombocytopenia ) , deranged liver functions ( transaminitis ) , and coagulopathy ; and increased inflammatory markers c - reactive protein and patent cooperation treaty . \n the clinical course in this patient met the criteria for severe sepsis and septic shock except in that it was unclear whether associated infections were causative . \n persistent fever , severe pancytopenia , hyperferritinemia , hypertriglyceridemia , increased ldh , and splenomegaly eventually prompted bone marrow aspiration ( bma ) leading to the diagnosis of hlh . \n no family history of hlh was found , and a primary familial form was considered unlikely . according to the computed tomography ( ct ) scan and bone marrow biopsy results , \n no hematological malignancy was thought to be responsible for a secondary form . despite an extensive multi - site sampling and serological studies , \n laboratory tests for viral infection including epstein - barr virus , cytomegalovirus , herpes simplex virus , viral hepatitis b and c , hiv were unremarkable . \n prolonged fever , splenomegaly , bicytopenia , hypofibrinogenemia , hyperferritinemia , and hypertriglyceridemia confirmed the diagnosis of hfs . \n the delay in diagnosis due to its rare incidence leads the patient to secondary sepsis in spite of aggressive and symptomatic treatment . \n hlh is a rare disease characterized by uncontrolled proliferation of mature histiocytes , hemophagocytosis , and up - regulation of inflammatory cytokines . \n the more typical findings are fever , peripheral cytopenia affecting two lineages at least , hepatosplenomegaly , hypertriglyceridemia and/or hypofibrinogenemia , and hemophagocytosis . \n recently , the histiocyte society updated its guidelines and proposed to add three diagnostic criteria : hyperferritinemia decreased or absent natural killer ( nk ) cell activity , and high soluble interleukin-2 receptor serum levels . \n they were present in our patient , who developed high persistent fever , severe pancytopenia , splenomegaly on abdominal ct scan , and very high plasma levels of ferritin , triglycerides , and ldh . \n the hlh-2004 diagnostic criteria considered the gold standard are largely based on studies of children with familial hlh . \n many of the criteria have poor operating characteristics when considered in the differential diagnosis of septic shock in adults . \n fever , anemia , thrombocytopenia , hypofibrinogenemia , and hypertriglyceridemia are common features of both syndromes . \n several studies show that hyperferritinemia consistent with hlh ( > 500 g / l ) occurs in the majority of adults with septic shock \n . the sensitivity of diagnostic criteria such as hypertriglyceridemia , hypofibrinogenemia , and splenomegaly may be no better than about 50% . \n the sensitivity of nk cell activity and soluble cd-25 levels approaches 100% , but these tests are not widely available . \n a strict requirement to fulfill five hlh-2004 diagnostic criteria in the adult patient in an icu could delay potentially lifesaving therapy . \n other available hlh-2004 criteria should be used in conjunction , with consideration of the limitations in their operating characteristics and logistics in the icu . in our opinion , hlh treatment should be considered in patients with the clinical syndrome of unremitting severe sepsis and/or septic shock with bicytopenia or pancytopenia , elevated ferritin levels , prompting for a bma , which will show histiocytic hemophagocytosis . \n therapy should be started in all cases with high suspicion after diagnostic tests have been initiated , but regardless of whether the results of all examinations have been obtained . among patients who are acutely ill or deteriorating , we suggest hlh - specific therapy based on the hlh-94 protocol or enrollment in a clinical trial rather than treatment based on the hlh-2004 protocol . \n hlh-94-based therapy includes etoposide and dexamethasone given at tapering doses over 8 weeks , with intrathecal methotrexate and hydrocortisone for those with central nervous system involvement . \n additional supportive measures include transfusion of blood products as indicated , induction of amenorrhea , and use of prophylactic antibiotics . \n the response to initial therapy is a major factor in determining the need for additional therapy including hematopoietic cell transplant . \n a short course of intravenous ( iv ) methylprednisolone ( 12 mg / kg / d ) is often sufficient in treating hs associated with secondary infections . \n this treatment is given in concert with adequate anti infectious agents , and it must be administered for the shortest time necessary for correction of the most life - threatening symptoms associated with hs because of the added immunosuppression in the context of severe infection . \n new antiviral drugs such as cidofovir or ribavirin and rituximab ( anti - cd20 antibody ) may be useful . \n consideration should be given to the use of iv immunoglobulin in infection - associated hs , to minimize the risk of immunosuppression . \n importantly , however , the initiation of hlh - specific therapy for severely ill patients should not be delayed while awaiting resolution of a system infection . \n clinicians are encouraged to enter patients in clinical trials such as the hybrid immunotherapy for hlh trial in the united states ( hit - hlh ; nct01104025 ) or the euro - hit - hlh trial in europe ( eudract201100205214 ) . \n further study of hlh , may provide important insights into the optimal treatment of sepsis , perhaps leading to the identification of a subset of patients with sepsis in which tissue damage secondary to a hyper inflammatory state might be ameliorated by immunosuppressive therapy . \n \n \n ", "role": "user" }, { "content": "hemophagocytic lymphohistiocytosis is a clinic pathologic entity characterized by increased proliferation and activation of benign macrophages with hemophagocytosis throughout the reticuloendothelial system . \n it is a potentially lethal disorder due to an uncontrolled immune response to a triggering agent . \n hps may be primary , or secondary to malignancy , infections , auto - immune diseases , and pharmacotherapy . \n hps is a rare , but life - threatening complication . \n herein , we described a female patient with hps with secondary sepsis . \n our objective was to raise the importance of early diagnosis of hfs by presenting a representative case .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: dr sinoff is an opinion leader in neurology , neuro - ophthalmology , and balance disorders . \n he is currently medical director of both the morton plant mease balance center and the morton plant sleep laboratory , clearwater , florida .", "role": "user" }, { "content": "this book should be of interest , as the author states , to those who are chiefly concerned with healing and the relief of suffering.the state of medicine is unsatisfying and due for an overhaul a difficult premise to reject . remodelling medicine proposes guiding principles for the process . \n this is integrative care , with an emphasis on care . \n dr swayne does not write a prescription for remodeling medicine ; instead , he offers arguments that can not be ignored and that will provoke lively debate.the biomedical model is valuable , while inadequate by itself , to the tasks of healing and the relief of suffering . \n swayne argues persuasively that we need to utilize science in the right way , a way that hears a patient 's narrative and understands that narrative within the context of the person 's entire life narrative .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: members of the lesbian , gay , bisexual , and transgender ( lgbt ) communities have been identified as a population group at elevated risk for smoking - related health disparities [ 1 , 2 ] . \n for example , results from national samples of lgbt persons consistently demonstrate disparate rates of tobacco use , with prevalence rates of smoking roughly twice those of heterosexuals [ 25 ] . \n a recent study found that tobacco use contributes to the greater than expected rates of acute respiratory illnesses among lgbt young adults compared to a heterosexual comparison group . furthermore , lgbt persons have higher than expected prevalence of risk factors ( e.g. , heavy drinking ) for diseases associated with or exacerbated by smoking ( e.g. , heart disease , hiv infection , and lung cancer ) [ 68 ] . as such , \n tobacco prevention and control have emerged as a significant priority for researchers , policy makers , and national organizations focused on lgbt concerns . yet , \n best practices for smoking cessation among lgbt populations are glaringly absent because of the lack of empirical research [ 9 , 10 ] . \n testing innovations developed by community organizations , local health departments , and others outside of academic centers ( i.e. , practice - based research ) can help address such gaps [ 11 , 12 ] . in the general population the majority of current smokers ( 68.8% ) report wanting to quit , and more than half of smokers ( 52.4% ) \n similarly , members of the lgbt communities are knowledgeable about the risks associated with smoking and interested in quitting smoking . \n for example , awareness of the health risks associated with smoking and acceptance of tobacco control activities was high in a recent study of smoking - related knowledge , attitudes , and behaviors of lgbt persons . \n in addition , high levels of awareness of smoking prevention campaigns , stated intentions to quit smoking , and reports of recent quit attempts have recently been observed among lgbt samples [ 15 , 16 ] . with regard to treatment seeking , data collected from a large ( n = 1633 ) convenience sample of current lgbt smokers suggested that the majority ( 75% ) were willing to talk with their providers about access to smoking cessation treatments . \n about one - quarter of those respondents indicated their intention to use nicotine replacement therapy ( nrt ) during their next quit attempt , a rate consistent with the general population of smokers . \n taken together , these findings suggest both a receptivity to and an opportunity for further engaging lgbt smokers in smoking cessation efforts . increasing the availability of evidence - based treatments to lgbt smokers \n although effective smoking cessation treatments are now widely available , the majority of these treatments were designed as interventions for the general population and not culturally tailored to the specific needs of any particular subgroup . \n a large body of evidence suggests that psychosocial and cultural factors related to smoking cessation are differentially distributed among subgroups and that addressing these differences may improve treatment outcomes . \n indeed , a survey conducted with gay / bisexual male smokers revealed a stronger preference for smoking cessation programs tailored to gay men over generic programs . \n culturally tailored interventions have been shown to be effective in improving outcomes for a range of health promotion interventions [ 21 , 22 ] . \n examples of tailored smoking cessation interventions include programs for people with chronic illnesses such as cancer ; racial and ethnic minority youth ; and members of hispanic , african american , and indigenous populations . as members of a highly stigmatized minority group , lgbt persons experience unique and formidable barriers to smoking cessation including stress associated with discrimination , internalized homophobia , and limited access to culturally competent health care . \n to address these unique concerns , efforts have been made to develop culturally competent and tailored smoking cessation treatment materials that address the cultural and psychosocial needs of lgbt smokers [ 2932 ] . despite the availability of culturally specific smoking cessation materials , little research exists on outcomes for lgbt smokers based on either tailored or nontailored treatment programs [ 2 , 9 , 33 ] . \n one example is provided by harding and colleagues who conducted a pilot smoking - cessation intervention that was culturally tailored for gay men in the united kingdom ( n = 69 ) . \n walls and wisneski reported on a preliminary evaluation of the acceptability of a set of community - based smoking cessation classes , the last drag , that were culturally tailored to the sociocultural needs of lgbt smokers ( n = 44 ) . \n the smoking cessation classes were based on a culturally adapted version of the american lung association 's freedom from smoking ( ala - ffs ) curriculum and included seven group - based counseling and peer support sessions . \n of the 44 individuals who participated , 36 were in attendance in the final class , and 89% of those self - reported being quit . \n ratings of the cultural appropriateness of the program were also strong . in a larger scale evaluation of the last drag \n program , eliason and colleagues reported results from all participants who completed one or more sessions from august 2005 to january 2010 ( n = 233 ) . \n self - reported quit rates for the sample were 53% at one month and 36% at 3 and 6 months , respectively . \n finally , a recent study examined smoking cessation outcomes based on sexual orientation following a nontailored smoking cessation intervention . \n a total of 54 sexual minority men ( smm ) and 243 heterosexual male smokers received 8 weeks of treatment that included nicotine patch , bupropion , and individual behavioral counseling sessions . \n rates of quitting among smm were nearly identical to those of heterosexual males ( week 8 ; smm = 59% versus heterosexual = 57% ) . \n the results from the few existing smoking cessation treatment programs involving lgbt smokers are promising ; however , additional research is needed to establish culturally appropriate and evidence - based treatment strategies . in the absence of extensive research - based evidence , data available from existing smoking cessation treatments offered as part of routine clinical services can provide important information about smoking cessation treatments in real world settings and can guide future research and provide models for other community - based treatment centers . \n the purpose of this study was to evaluate the treatment outcomes associated with a culturally tailored smoking cessation treatment program for lgbt smokers that were offered as part of clinical practice in a community - based health center . \n we sought to answer the following research questions : ( 1 ) what were the participation rates of lgbt smokers taking part in a community - based smoking cessation treatment program ? ( 2 ) was there evidence that the culturally tailored programs were effective for reducing smoking behaviors ? \n ( 3 ) what participant characteristics ( demographic , smoking , and treatment attendance ) were associated with better treatment outcomes ? \n data for this study were obtained from a series of smoking cessation treatment programs tailored to lgbt smokers and offered at howard brown health center ( hbhc ) from 2002 to 2006 . \n the original program , call it quits , was developed as part of a research grant awarded to hbhc . \n after completion of the research grant , additional funding was obtained to offer smoking cessation treatments as part of clinical services at hbhc . \n a total of three separate programs were offered including call it quits ( ciq , 2002 , a total of 105 smokers participated in 15 cessation groups ) , bitch to quit \n ( btq , 2005 - 2006 , a total of 33 smokers participated in 5 cessation groups ) , and put it out \n ( pio , 20062008 , a total of 60 smokers participated in 10 cessation groups ) . \n each of these clinical programs were based on the core ciq curriculum ; however , some variations in approaches occurred , including changes in program names , assessment measures , the inclusion of a peer support \n the smoking cessation classes were advertised using a range of strategies including provider referrals and information posted in hbhc 's medical clinic and through postings and materials ( e.g. , posters , flyers , and matchbooks ) in community venues . \n when possible , additional funding was obtained to do specific outreach and advertising to subpopulations of the lgbt communities based on race / ethnicity , gender , or gender identity . \n these groups followed the same treatment procedures as the standard groups but were held in locations specifically serving the needs of members from these communities . in general , \n eligibility criteria for the smoking cessation treatment programs included ( 1 ) self - identified as lgbt , ( 2 ) age 1865 , and ( 3 ) current cigarette smoker ( any level of smoking ) . depending on \n when smoking cessation services were received , treatment was either free of charge or provided on a sliding scale fee schedule according to income . \n the institutional review board of hbhc has approved the secondary analysis of programmatic data . \n all treatment programs were developed based on the well - established ala - ffs , a group - based and cost - effective group smoking cessation treatment [ 36 , 38 ] . \n the underlying premise of the ala - ffs cognitive / behavioral program is that smoking is a learned habit . \n the program focuses on how to make behavioral changes and to quit smoking in the context of a group environment . \n the ala - ffs program was selected because it incorporates many of the best practices identified by the treatment practice guidelines including skill building and preparation for quitting , intratreatment social support , and optimal treatment dosing ( i.e. , 47 sessions ) . because the ala - ffs program was designed for the mainstream usa population , the program was adapted for the lgbt community . \n the culturally tailored smoking cessation program maintained the core cognitive and behavioral approaches and smoking education content used in the standard ala - ffs program . \n the goal of the tailoring was to adapt the existing ala - ffs cessation materials to the culture , norms , and beliefs of lgbt men and women and to address the unique factors associated with their smoking behaviors . \n first we focused on strategies to increase the level of trust and acceptability of the program . \n these included hosting all smoking cessation treatments at lgbt community organizations , employing lgbt - identified smoking cessation counselors , and branding recruitment and program materials with lgbt - specific images . \n the culturally specific content was informed by information obtained from focus group interviews with lgbt smokers that explored barriers and facilitators to smoking cessation ( n = 9 groups ) , published guidelines for conducting culturally competent smoking cessation treatments , a panel of lgbt health experts , a review of the literature , and recommendations from existing tailored smoking cessation programs ( e.g. , queertips ) . \n a few examples of culturally tailored elements included a discussion of health concerns for lgbt smokers ( e.g. , hiv / aids , hormone use among transgender smokers ) ; the role of smoking in the lgbt culture ; stress due to homophobia as triggers for smoking and relapse ; ways to increase social support for nonsmoking ; relationships between bar culture , drinking , and smoking ; targeting of the lgbt communities by the tobacco industry ; providing smoking statistics / rates specially for the lgbt communities ; and the inclusion of themes related to community empowerment and health . \n the combined information was folded into the ala - ffs curriculum to create the tailored call it quits \n bitch to quit and put it out ) smoking cessation program materials and the training curriculum for group facilitators . \n additional funding was obtained to offer ciq at three other community - based locations serving the needs of lgbt smokers from diverse ethnic and racial backgrounds . \n lgbt - identified professional facilitators conducted each group session . in the ciq sessions only , lgbt ex - smokers served as peer support buddies . \n smoking cessation counselors were trained through the american lung association of metropolitan chicago ( alamc ) . \n the number of weekly treatment sessions varied somewhat across the differing treatment groups ( ciq = 8 sessions , btq = 8 sessions , pio = 6 sessions ) . \n outcome and process measures were collected at baseline , weekly , and at the end of treatment ( approximately one month after quit date ) . \n nrt ( i.e. , patches ) was provided free of charge as part of the pio sessions from 2006 to 2008 . \n use of nicotine replacement and other pharmacotherapies during the course of treatment was measured for all treatment participants regardless of whether nrt was offered as part of treatment . \n demographic characteristics measured as part of the baseline assessment included age , race ( asian , black , white , other ) , gender ( male , female , transgender ) , education ( high school or lower , some college , college and above ) , employment status ( full time , part time , unemployed , retired , disabled , other ) , annual income ( $ 010,999 , $ 1120,999 , $ 2130,999 , $ 3149,999 , $ 50,000 and over ) , and sexual orientation ( gay , lesbian , bisexual , other ) . \n this test assesses a smoker 's level of dependency on nicotine and has demonstrated validity and reliability in previous research . \n nicotine dependence was classified into three levels based on these composite scores : low ( 03 ) , medium ( 46 ) , and high ( 710 ) . \n smoking frequency was asked by the following single item : how many cigarettes / day do you smoke ? \n ( 3140 or more cigarettes , 2130 cigarettes , 1120 cigarettes , 10 or less cigarettes ) . \n attitudes towards quitting were measured at baseline using four individual questions developed to measure cognitive factors associated with quitting behavior : ( 1 ) how much do you want to quit smoking ? ( definitely not , probably not , not sure , probably yes , definitely yes ) ; ( 2 ) how important is it for you to quit smoking ? ( not at all , a little , moderately , very , extremely ) ; ( 3 ) do you intend to quit smoking ? ( definitely not , probably not , not sure , probably yes , definitely yes ) ; and ( 4 ) how confident are you in your ability to quit smoking completely ? ( not at all , a little , moderately , very , extremely ) . \n these items were all worded in the same direction such that higher scores on each corresponded to more agreement with the question . \n the primary outcome measured was self - reported seven - day point prevalence abstinence measured at completion of the smoking cessation intervention sessions . \n individuals who had missing data for quit - smoking status were treated as nonquit based on an intention to - treat ( itt ) approach to data analysis . \n session attendance , a measure of treatment dose , was also measured as an important treatment outcome . \n given that the number of treatment sessions differed somewhat between treatment programs ( ciq = 8 sessions , btq = 8 sessions , and pio = 6 sessions ) , treatment completion was operationally defined as attending 75% or more of all available treatment sessions . \n finally , all participants were asked whether they used any kind of stop - smoking medications during treatment , including nicotine replacement ( e.g. , patch , gum ) or medications ( e.g. , chantix , bupropion ) . \n data were available from n = 198 lgbt smokers who completed at least one session of the culturally tailored smoking cessation programs . \n comparisons of characteristics between smoking cession groups ( i.e. , ciq , btq , and pio ) were performed using chi - square ( ) tests for categorical variables and analysis of variance ( anova ) for continuous variables . \n multivariate binary logistic regression was performed to describe associations between smoking status and demographic characteristics , smoking attitudes , smoking characteristics , and treatment factors ( i.e. , use of nrt and number of sessions completed ) . \n finally , additional multivariate linear regression analyses were conducted to examine the associations between session attendance and demographic characteristics , smoking attitudes , smoking characteristics , and treatment factors . \n the majority of participants were white ( 70.4% ) and male ( 60.5% ) and had at least a college degree ( 58.4% ) . \n as shown in table 1 , the participants in each of the three smoking cessation treatment programs differed significantly based on demographic characteristics . \n ciq had the highest proportion of male ( 76.7% ) and unemployed people ( 43.3% ) ; btq had the highest proportion of non - white ( 39.4% ) , female ( 93.9% ) , employed people ( 75.8% ) , and annual income more than $ 50,000 ( 45.5% ) ; and pio had the highest proportion of white people ( 83.3% ) , with these differences reaching statistical significance . \n accordingly , a set of key demographic factors was used as control variables in subsequent analyses . at pretreatment , the majority of program participants reported definitely wanting to ( 62.4% ) and intending to quit smoking ( 57.2% ) , and the vast majority of all participants indicated that it was either very or extremely important to quit smoking ( 85.1% ) . \n however , the proportion reporting that they were either very or extremely confident in their ability to quit smoking was comparatively lower ( 43.3% ) . \n another 35.9% were light smokers ( 010 cigarettes per day ) and 24.3% were heavy smokers ( 21 + cigarettes per day ) . \n based on the fagerstrm measure , mean nicotine dependency scores for all participants indicated moderate levels of dependency ( m = 4.18 , sd = 2.49 ) \n . nearly one - fifth of the sample ( 17.9% ) scored in the high nicotine dependence range on the fagerstrm measure . \n significant differences in smoking characteristics were also observed for participants in each of the three different treatment groups ( see table 1 ) . \n overall 32.3% of all participants self - reported having quit at the end of treatment . \n multivariate analyses were conducted to assess the association between quit - smoking status and smoking characteristics ( nicotine dependence ) , attitudes about quitting ( want to quit , important to quit , intend to quit , confidence to quit ) , and treatment factors ( session attendance and use of stop - smoking medications ) controlling for demographic characteristics ( race , gender , education , sexual orientation ) . \n results showed that baseline levels of nicotine dependence , use of any stop - smoking medications as an adjunct to group counseling , and number of sessions attended were significantly associated with quit - smoking status . \n any use of nicotine replacement ( or = 4.24 , 95% ci = 1.2314.50 ) and increased number of sessions attended ( or = 2.45 , 95% ci = 1.454.15 ) were associated with higher odds of quitting smoking , respectively . \n however , increased nicotine dependence scores were associated with lower odds of quitting smoking ( or = 0.73 , 95% ci = 0.570.94 ) ( see table 2 ) . \n multivariate analyses were also performed to examine the associations between session attendance rates and smoking characteristics ( nicotine dependence ) , attitudes about quitting ( want to quit , important to quit , intend to quit , confidence to quit ) , and treatment factors ( nicotine replacement use ) while controlling for each demographic characteristic ( race , gender , education , sexual orientation ) . after introducing all demographic and smoking characteristics in the multivariate model , education and nicotine replacement use still significantly associated with session attendance . \n participants with some college education or less had lower session attendance rates compared to those with a college degree or more education ( = 0.10 , p < 0.05 ) . \n people who had ever used nicotine replacement had higher session attendance rates than those who had not used it ( = 0.10 , p < 0.05 ) ( see table 3 ) . \n evaluation of smoking cessation treatments offered as part of clinical or behavioral health services provides opportunities to answer important questions about lgbt smoking cessation and can help establish the evidence base for treating tobacco addiction in lgbt smokers . \n the purpose of this paper was to address a significant gap in the literature on tobacco cessation by reporting on the outcomes associated with culturally tailored treatment programs for lgbt smokers . \n study results suggest that culturally specific smoking cessation treatments offered in a community setting are beneficial for reducing smoking among lgbt smokers . \n contrary to data suggesting low awareness and engagement of lgbt smokers with formal treatment programs , we demonstrated the ability to enroll and retain lgbt smokers into a community - based and intensive group smoking cessation program . \n further , quit rates were on average consistent with outcomes associated with general population results from the ala - ffs program . \n these promising findings warrant future research to replicate results and to examine differences in smoking cessation outcomes from the tailored and nontailored ala - ffs programs . \n overall quit rates were in the expected range for community - based smoking cessation treatments and ranged from 23.3 to 39.1% at the end of treatment . these intent - to - treat , quit rates at end of treatment and followup are comparable to those observed in mainly caucasian smokers engaged in similar treatment ( i.e. , with nicotine patch and intensive counseling ) . however , the same contextual factors observed in lgbt communities that hinder smoking cessation ( e.g. , stress associated with discrimination , fewer deterrents to smoking , and limited access to culturally competent health care ) may also serve as formidable barriers to long - term cessation and should be systematically addressed as part of intensive relapse prevention treatment . as such , additional research is needed to examine maintenance of quit rates over time . in the general population , \n quit rates following smoking cessation treatment vary substantially based on demographic characteristics such as race / ethnicity . \n however , in multivariate analyses , demographic characteristics were not statistically significant predictors of the quit status of program participants . \n the likelihood of being a nonsmoker was positively associated with use of stop - smoking medications and session attendance rates such that the odds of quitting were more than doubled with the use of any medications and completion of more treatment sessions . \n it should be noted that , in general , the use of stop - smoking medications was relatively low across program participants ( 24.2% ) . in general , \n nicotine dependency scores were in the moderate range and were associated with quit status such that those smokers with higher levels of nicotine dependency had lower odds of being quit after treatment . \n the relationship between nicotine dependence and lower quit rates suggests the need for increasing awareness and uptake of pharmacological approaches as key adjuncts to stop - smoking counseling programs . \n after introducing all demographic and smoking characteristics in the multivariate model , education level and nicotine replacement use were significantly and positively associated with session attendance rates . given the association between treatment attendance and quit outcomes , future initiatives should focus on strategies increasing adherence to treatment . \n a strength of the smoking cessation treatments offered at hbhc was the adaption of an existing and evidence - based program . \n this approach was consistent with calls to increase access to treatments for priority populations by disseminating effective behavioral interventions . \n other strategies to increase the impact and cultural competency of smoking cessation treatments have been well described and minimally include the following : ( 1 ) conduct the treatment programs in settings that are considered safe to community members ; ( 2 ) treatments should be administered by facilitators with expertise in smoking cessation and cultural competency in working with the lgbt communities ; ( 3 ) distribute appropriate , inclusive , and creative promotional materials through community - based outlets ; ( 4 ) provide cultural competency training to all non - lgbt staff who interact with participants ; and ( 5 ) modify the curricula to include lgbt - specific and other culturally relevant information for participants . \n in addition , our findings suggest that the core cognitive and behavioral components of the ala - ffs curriculum are beneficial for reducing smoking behaviors . \n consistent with treatment and practice guidelines and our findings , it is important to include stop - smoking medications as a standard part of treatment . \n that being said , adherence to nrt was low among participants even when it was offered free of charge . \n as such , additional emphasis should be placed on identifying and addressing barriers to uptake of nrt as a part of standard treatment . \n in addition , focus groups were used to tailor these treatment programs to the needs of lgbt smokers . \n several years have passed since this qualitative research was conducted and the findings may no longer be applicable to the current smokers based on a number of factors including identity factors ( e.g. , queer , gender nonconforming ) , smoking behaviors ( e.g. , menthol , light smokers , use of new tobacco products ) , barriers and facilitators to smoking cessation , and types of images and messaging that are appropriate . \n consequently , additional formative research may be needed to revise and refine materials to address the needs of current lgbt smokers . \n the tailored curriculum retained the essential effective components of the ala - ffs program , only deviating from the standard intervention in minimal ways . \n we believe we were able to maintain the integrity of the program and that the adapted intervention was largely equivalent to the standard ala - ffs program . additional strengths of the study included culturally tailoring an existing and effective smoking cessation treatment program for lgbt smokers , measurement of demographic and smoking variables that may impact treatment outcomes , and posttreatment follow - up of treatment participants . \n for example , the majority of these quit rates were not biochemically confirmed by objective measures and there was no comparison control condition . as such , these initial promising findings need replication and extension using more robust methodology . \n additionally , we did not collect any culturally specific measures ( e.g. , minority stress ) that may have provided additional insight into factors that may influence within - group differences in smoking behavior . \n although basic demographic and smoking variables were measured as part of the treatment programs , a full battery of smoking questions was not included . \n finally , no data were available on longer - term quit rates associated with the program . \n study findings demonstrate the feasibility and benefits of providing smoking cessation treatments for lgbt smokers as part of clinical services . \n future studies should build on the success of this clinical program of smoking cessation treatment by systematically evaluating the benefits of a culturally tailored intervention for improving smoking cessation outcomes in lgbt smokers . \n a research program should address the limitations of our clinical program by ( 1 ) improving the internal validity of the intervention ( randomization , inclusion of a control condition , and adequate power ) ; ( 2 ) incorporating smoking cessation intervention best practices ( objective verification of smoking status , nrt , and long - term followup ) ; and ( 3 ) systematically tailoring the ala - ffs intervention modules ( focus group research to guide development of peripheral , evidential , linguistic , sociocultural , and constituent tailoring strategies ) . a research study such as \n this would allow for a more rigorous test of the added benefits of culturally tailoring the ala - ffs program for lgbt smokers .", "role": "user" }, { "content": "introduction . little is known about lesbian , gay , bisexual , and transgender ( lgbt ) people 's response to smoking cessation interventions . \n this descriptive study examined the benefits of a community - based , culturally tailored smoking cessation treatment program for lgbt smokers . \n methods . a total of n = 198 lgbt individuals recruited from clinical practice and community outreach participated in group - based treatment . \n sessions were based on the american lung association 's freedom from smoking program \n ( ala - ffs ) and were tailored to lgbt smokers ' needs . \n seven - day smoking point prevalence abstinence served as the primary outcome . \n results . participants ( m age = 40.5 ) were mostly white ( 70.4% ) and male ( 60.5% ) and had at least a college degree ( 58.4% ) . \n forty - four percent scored in the moderate range on the fagerstrm test for nicotine dependence pretreatment , and 42.4% completed treatment ( 75% sessions ) . \n higher educational attainment and use of nicotine replacement therapy ( nrt ) were associated with treatment completion . \n self - reported quit rates were 32.3% at posttreatment assessment . \n treatment attendance ( or = 2.45 ) , use of nrt ( or = 4.24 ) , and lower nicotine dependency ( or = 0.73 ) were positively associated with quitting smoking . \n conclusions . \n results suggest the benefits of offering lgbt smokers culturally tailored smoking cessation treatments . \n future research could improve outcomes by encouraging treatment attendance and promoting nrt uptake .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the clinical applications of positron emission tomography / computed tomography ( pet - ct ) with the glucose analogue 2-[fluorine 18]fluoro-2-deoxy - d - glucose ( fdg ) are spreading beyond the area of oncology . apart from concentrating in malignant tissues , fdg is also accumulating at the sites of infection and inflammation due to increased glycolytic activity of inflammatory cells such as neutrophils , lymphocytes , and macrophages . \n this increased fdg uptake is based on the fact that these cells use glucose as an energy source only after activation during the metabolic burst[1 - 2 ] . \n for instance , mononuclear cells and granulocytes use large quantities of glucose by way of the hexose monophosphate shunt and their rates of oxygen uptake increase intensely during their so called respiratory burst while fighting an infection . \n when stimulated by phagocytosis , the hexose monophosphate shunt increases up to 20 - 30 times the baseline value , being the cause of high fdg uptake . \n the involved mechanisms have been commonly linked to increased intracellular hexokinase and phosphofructokinase levels as well as increased numbers of cell surface glucose transporter proteins such as glut 1[3 - 5 ] . \n for example , it has been shown that stimulation with cytokines results in glut 1 overexpression and increased glucose uptake in both inflammatory and granulation tissues . \n this avidity of inflammatory cells for 18f - fdg has led to the concept of using fdg pet - ct for imaging a variety of inflammatory and infectious conditions , including granulomatous diseases and fungal infections . \n furthermore , ex vivo labeling of white blood cells with fdg represents an initial attempt to develop an infection - specific positron emitting tracer[7 - 8 ] . in the heart , \n fdg uptake by the myocardium allows assessment of myocardial viability in patients with myocardial ischemia , revealing potential regions of hibernating but viable myocardium . as a matter of fact \n , in many centers , cardiac fdg pet is becoming the gold standard for assessment of myocardial viability . in patients with cardiac sarcoidosis , fdg pet has proven useful as a follow - up tool for disease monitoring . \n of note is that a high percentage of cardiac sarcoidosis patients have arrhythmias and implanted cardiac devices that may interfere with a cardiac mr examination . in the brain , \n fdg uptake by the cortical and subcortical structures allows noninvasive quantification of cerebral metabolism and may provide valuable information before any morphological changes become discernible . \n current evidence in patients with epilepsy indicates that fdg pet may provide crucial data that guide surgical resections of the epileptogenic zone for medically refractory epilepsy . \n a decade of brain pet research has also provided evidence that brain fdg pet is an effective and safe modality to identify diagnostic patterns of glucose hypometabolism in neurodegenerative dementias and is an effective and useful adjunct to other diagnostic information in the assessment of patients with progressive cognitive impairment . \n potential new areas that require further investigations may extend to evaluating the functional integrity of the brain in a variety of conditions like fetal alcohol spectrum disorders , especially becaus such functional abnormalities have already been reported by spect . \n hereby , we aimed to provide a concise summary of the broad areas of fdg pet - ct applications in non - oncologic conditions . \n tissue inflammation results in increased fdg accumulation , making the methodology useful for detecting a variety of chronic or occult infections . \n it is not uncommon for the site of infection or inflammation to have elevated fdg activity , but unremarkable anatomical changes . \n an increasing number of reports indicate that fdg pet - ct has become a useful tool in the diagnosis , treatment evaluation and follow - up of patients with such conditions as sarcoidosis , spondylodiscitis , and vasculitis , and is already the gold standard for some indications,[13 - 14 ] . \n an example of fdg - avid tracheobronchitis without obvious ct findings is provided in fig . \n rheumatoid arthritis , autoimmune pancreatitis , and fungal infections , hard evidence is lacking , but studies also point out that fdg pet - ct could be useful . \n pet images demonstrated intense fdg activity throughout the tracheal and bronchial walls ( red arrows ) , consistent with tracheopbronchitis . \n several foci of increased fdg activity in the lungs ( small yellow arrows ) were indicative of associated inflammatory changes in the adjacent lung parenchyma , even though the parenchimal lesions could not account for patient 's persistent cough . \n fdg pet is a promising technique in detecting acute and chronic infection in the axial and peripheral skeleton . \n fdg pet has been reported to have an excellent sensitivity , normally reaching or exceeding 95% , with high specificities above 87%[15 - 16 ] . \n the modality proved especially valuable in patients with chronic osteomyelitis or suspected recurrence . in most cases , \n osteomyelitis is limited to a specific bone or body area , making it suitable for magnetic resonance imaging ( mri ) , which is also highly accurate for detecting bone infections without exposing the patient to any radiation . in clinical practice \n , however , different factors may need to be considered , including associated conditions , equivocal imaging findings , mri contraindications or claustrophobia . \n osteomyelitis in children , for example , can present with disseminated foci involving several bones , with a higher chance of being detected using a whole body imaging modality such as fdg pet or whole body mri . in patients with diabetes mellitus , on the other hand \n , peripheral insulin resistance and diabetic microangiopathy might also translate into lower fdg uptake at the site of inflammation . \n comparative studies performed in patients with non - healing diabetic foot ulcers indicate that mri appears superior to fdg pet in detecting foot ulcer - associated osteomyelitis and might be the preferred imaging modality in such cases . despite these limitations , fdg pet \n still can play a valuable role in the setting of charcot 's neuroarthropathy by reliably differentiating it from osteomyelitis , both in general and when foot ulcer is present . \n furthermore , studies performed in patients undergoing surgical interventions report that the differentiation between charcot 's lesions and florid osteomyelitis provides the surgeon with important additional information , which is often unavailable from mri . \n because of this important additional data , pet could be considered preferable to morphologic imaging ( ct , projection radiography ) in the preoperative work - up of charcot 's foot . \n the fdg uptake patterns may also help differentiate between inflammatory and degenerative changes in the vertebral body endplates and predict or exclude spondylodiscitis . \n due to its high sensitivity , a negative pet result in the setting of a diagnostically unclear case diminishes the need for surgical intervention . \n in contrast , a positive pet result does not always clearly establish the cause of increased fdg uptake and may require further investigations . at the moment , the competition between mri and fdg pet - ct for the detection of osteomyelitis , spondylitis or spondylodiscitis is still ongoing and new prospective controlled clinical trials have to be performed to answer the question of which imaging modality is most efficient for such patients . \n fdg pet has also been reported as a useful imaging modality for detecting infections associated with lower limb arthroplasty . \n comparative studies showed a relatively higher accuracy for detecting infections associated with hip prostheses ( sensitivity , specificity , and accuracy of 90% , 89.3% , and 89.5% , respectively ) versus those associated with knee prostheses ( sensitivity , specificity , and accuracy of 90.9% , 72.0% , and 77.8% , respectively ) . \n in the literature , there are two predominant opinions related to the patterns of fdg uptake in septic and aseptic loosening of hip prostheses . \n the first opinion suggests that septic and aseptic loosening are not characterized by a specific topographic pattern of fdg distribution , the differentiation relying on the quantity of fdg uptake with higher values in septic loosening[22 - 23 ] . \n however , it is known that intense fdg activity can exist in the head or neck portion decades after hip arthroplasty in asymptomatic patients . \n the second opinion hypothesizes that fdg localization in bone - prosthesis interface is a characteristic of septic loosening . \n thus , when fdg pet is used to diagnose periprosthetic infection in patients with hip arthroplasty , the location of increased fdg uptake appears more important than the intensity of the uptake . \n therefore the presence of an osteolytic area seen on x - ray with little or absent fdg uptake on pet should be related to aseptic loosening-,[24 - 25 ] . \n in contrast , a negative pet result in the setting of a diagnostically unclear situation eliminates the need for revision surgery due to the high sensitivity of pet . \n while the elevated activity in the prosthesis head , i.e. bone - prosthesis interface , may be non - specific , distal activity in the prosthesis shaft provides a valuable diagnostic clue . the patient presented with persistent pain in his right hip despite receiving prior courses of empiric antimicrobial therapy . \n elevated fdg activity in the prosthesis head region at the bone - prosthesis interface ( small arrows ) may be nonspecific ; however , distal activity in the prosthesis shaft ( large arrows ) is consistent with focal infection . \n fdg pet - ct is a reliable modality for the diagnosis of vascular graft - related infection . \n the precise anatomic localization of increased fdg uptake enables accurate differentiation between graft and soft - tissue infection as well as identification of potentially lethal complications such as fistulas into adjacent structures[27 - 29 ] . \n non - acute vascular prosthesis infection showed that fdg pet - ct gave reliable results with an accuracy over 95% in 75% of prostheses and an accuracy of 70%75% in the remaining 25% of cases . \n excessive fdg uptake in blood vessel walls can be also seen in such conditions as central and peripheral vasculitis ( fig . \n 5 ) or other blood vessel abnormalities . since no other imaging method is able to directly detect acute inflammation within the aortic wall , fdg pet has been demonstrated to be a powerful tool in evaluating patients with pathologies such as aortitis or giant cell arteritis . it can be also used to follow the development of vasculitis activity during therapy as well as to delineate which vessels are involved[30 - 31 ] . \n studies aimed to semiquantify the relationship between aortic and liver uptake in patients with giant cell arteritis showed that fdg pet region - of - interest analysis with aorta - to - liver maximal standardized uptake value ratios is a reliable , investigator - independent indicator of large - vessel inflammation . \n receiver operating characteristic ( roc ) analysis revealed optimal selectivity for a cut off ratio of 1.0 , which was associated with a sensitivity of 88.9% , a specificity of 95.1% , and an accuracy of 94.4% . \n vasculitis represents a relative rare pet indication and the assessment with fdg pet remains difficult and dependent on the experience of the investigator . the use of fdg pet in a variety of other systemic diseases and infections is also expanding . \n for example , wegener granulomatosis lesions could be detected earlier by fdg pet - ct than by serum pr3-anca titers . \n the modality proved also feasible for determining the biopsy sites , evaluating lesion activities , therapeutic monitoring , and follow - up of wegener granulomatosis . in patients with dermatomyositis or paraneoplastic syndromes and associated malignancies , \n fdg pet - ct imaging may offer an all - in - one procedure as an alternative to other diagnostic procedures , reducing the number of unnecessary investigations . \n associated infections in oncologic patients undergoing fdt pet - ct imaging also require differentiation from neoplastic lesions . \n multiple studies have shown that dual time - point imaging of fdg pet may be helpful in differentiating malignancy from benign processes , including associated infections , . \n however , exceptions exist and new developments are required to further define the roles of fdg pet - ct in the management of infections in patients with associated malignancies . \n elevated fdg activity can be seen in the arterial wall of the aortic root ( arrow red , upper panel ) , celiac artery ( arrow blue , middle panel ) and superior mesenteric artery ( arrow yellow , lower panel ) . left panels display fused pet - ct images , while right panels show corresponding ct slices . \n linear fdg activity in both legs seen on maximum intensity projection ( mip ) images ( black arrows , left panel ) localized to proximal ( red arrow ) , middle ( orange arrow ) and distal ( yellow arrow ) femoral arteries on fussed pet - ct images ( right panel ) . \n intense fdg activity is seen at the periphery of the thrombus as pointed by arrows . \n associated dilation of the superior vena cava in this region is also apparent on ct . in subjects with sarcoidosis , \n fdg pet - ct is more sensitive than the gallium scan , which was traditionally used in the evaluation of sarcoidosis . \n it allows obtainment of a complete morpho - functional cartography of inflammatory active localizations and follow - up treatment efficacy , particularly in atypical , complex , and multisystemic forms . \n the concurrent presence of fdg - avid lymphadenopathy and the scar sign ( a rare but characteristic cutaneous manifestation of sarcoidosis ) is a useful finding on fdg pet - ct to suggest sarcoidosis , especially when biopsy specimens are difficult to obtain[40 - 41 ] . \n apart from evaluating the extent of disease , fdg pet - ct can uncover a suitable location for biopsy in such patients . \n studies investigating the presence of bone / bone marrow localizations of sarcoidosis showed that more than one - third of pet - ct - positive sarcoidosis patients had osseous abnormalities on pet - ct and the majority of these lesions ( 94% ) could not be detected on low - dose ct . \n usefulness of fdg pet - ct in other granulomatous diseases such as tuberculosis has also been described , where the modality has the advantage of being able to screen the whole body and can assist in preventing unfavorable clinical results based on misdiagnoses[44 - 46 ] . \n additionally , fdg pet - ct allows an easy evaluation of early therapeutic response in patients with tuberculosis , particularly those presenting with extra - pulmonary disease . \n the technique also enables the differentiation between patients with active granulomatous inflammation and those with fibrous lesions . in many patients , \n however , the fdg avid lesions are rather not specific , and the differentiation of extrathoracic lymphadenopathy from metastatic disease or lymphoma may be difficult . therefore , familiarity with the functional imaging features of granulomatous inflammatory lesions in various anatomical locations plays a crucial role in the diagnosis and management of these patients . \n in patients with hiv infection , resting lymphocytes are activated and switch to glycolysis , increasing their glucose uptake by around 20-fold over 24 hours . \n this increased glucose utilization by activated lymphocytes can translate into increased fdg uptake in the affected lymph nodes[49 - 50 ] . \n studies performed in hiv - infected patients reported that fdg uptake was a sensitive marker of disease state and its relation with cd8/cd38/cd45ro t cells indicates that it can be considered a marker of disease status . \n whole - body fdg pet images have even shown a specific pattern reflecting the hiv stage , suggesting that lymphoid tissues are engaged in a predictable sequence . \n such patterns include increased fdg uptake in the head and neck during the acute phase ( a ) , fdg avid cervical , axillary , and inguinal lymph nodes during the mid stages ( b ) and increased fdg accumulation in the colon with associated fdg avid mesenteric and ileocecal lymphadenopathy during the late disease stages ( c ) , . \n while this may provide valuable information related to the anatomic correlates of hiv progression without the need for biopsy , care should be taken as it can also lead to false - positive interpretations of malignancy . \n fdg pet - ct proved valuable in detecting both infections and malignancies in hiv - positive patients , showing an overall sensitivity and specificity of over 90% for localization of focal pathology in subjects presenting with unexplained fever , weight loss , or confusion . \n the modality has also the ability to differentiate malignancy from infectious lesions in the central nervous system of patients with hiv infection , guiding the initiation of the appropriate treatment and precluding the need for invasive biopsy , . \n in addition , a unique application of fdg pet - ct is the differentiation of cerebral lesions between toxoplasmosis and lymphoma in aids patients , which can not be reliably achieved with either ct or mri . in patients receiving highly active antiretroviral therapy ( haart ) , fdg \n pet - ct has been reported useful both for monitoring the response to therapy and for evaluating common side effects of treatment such as lipodystrophy , a syndrome characterized by central adiposity , peripheral fat wasting and associated metabolic abnormalities such as hyperlipidemia , hyperglycemia and insulin resistance , , . \n the modality has been even suggested for assessing the lipodystrophy - inducing effect of newly developed antiretroviral regimens . \n newer imaging techniques have been studied for evaluation of hiv - associated multicentric castleman disease ( mcd ) , a rare lymphoproliferative disorder presenting with fevers , anemia and multifocal lymphadenopathy[57 - 58 ] . \n preliminary findings suggest that fdg pet - ct may assist , in the management of hiv - associated mcd , in selecting appropriate sites for biopsy as well as in staging and monitoring disease activity[59 - 62 ] . \n accurate diagnosis of the cause of fever of unknown origin ( fuo ) can guide therapeutic intervention , reduce hospitalization time , and decrease morbidity and mortality . \n localization of the source of infection can also guide biopsy procedures and therapy planning . despite significant advances in modern diagnostic techniques \n , however , the underlying cause of fuo remains undiagnosed in 10% to 50% of patients,[63 - 64 ] . \n studies performed in patients with fuo indicate the fdg pet - ct appears to offer a great advantage as malignancy , inflammation and infection can be detected at the same time . \n when systemic diseases are excluded , the modality has a high negative predictive value ( up to 100% ) for focal etiologies of fuo . in patients with metastatic infectious foci , \n fdg pet - ct detected infectious complications in 75% of patients , with reported positive and negative predictive values of 91% and 99% , respectively . \n of note is that even though a median number of 4 diagnostic procedures had been performed prior to pet in such patients , pet identified clinically relevant new foci in 45% of cases , . \n the addition of fdg pet - ct in the diagnostic work - up of high - risk patients with gram - positive bacteremia was also associated with an overall decrease in mortality after 6 months from 32% to 19% because of a decrease in relapse rate . \n because of its high sensitivity , fdg pet - ct is commonly recommended in patients with high - risk gram - positive bacteremia or suspected disseminated infection , especially when the responsible focus of infection remains undetected ( fig . \n the technique also proved useful in identifying the source of fuo in patients with such conditions as vasculitis ( fig . \n 4 ) , inflammatory bowel disease , sarcoidosis , painless subacute thyroiditis , cholangiolitis , etc,[68 - 69 ] . the investigation revealed an unsuspected abscess in the right gluteus muscle ( large arrows red ) and a second fdg - avid focus in the right lung ( small black arrow ) . additionally , fdg pet - ct represents a valuable tool for early and correct diagnosis of occult sources of infection in immunocompromised patients presenting with a variety of opportunistic infections such as mycobacterium , fungal infections , herpes simplex virus , toxoplasmosis , etc . \n its utility in hiv - positive patients presenting with fuo has already been described in a separate paragraph . \n studies performed in children with fuo showed that fdg pet and pet - ct are also valuable diagnostic tools in the pediatric population , being non - traumatic , attractive for use in children and depicting inflammation in the whole body \n . nevertheless , the current algorithms for fdg pet - ct indications in the diagnostic process of fuo are not strictly evidence based and need further defining within a multidisciplinary setting , avoiding both selection and interstudy bias whenever possible . \n the practical applications of fdg pet are expanding and there is increasing evidence regarding its value for assessing patients with cardiac pathology . \n the heart metabolizes a variety of substrates , but under normal conditions free fatty acids and glucose are the major sources of energy . in myocardial ischemia \n , however , oxidative metabolism of free fatty acids is decreased and exogenous glucose becomes the preferred substrate with the production of energy depending mainly on anaerobic glycolysis . \n cardiac imaging using fdg pet allows the evaluation of these metabolic changes and can provide important information about the functional state of myocardium , including regions of hibernating but viable tissue . in clinical practice , \n the assessment of myocardial viability in patients with ischemic cardiomyopathy has become an important aspect of the diagnostic work - up for revascularization surgery or heart transplantation . among the many viability tests , noninvasive assessment of cardiac glucose use ( as a marker of viable tissue ) with fdg pet is considered the most accurate technique to detect viable myocardial tissue from the myocardium with no potential for functional recovery . \n fdg data have been shown to accurately identify patients with viable myocardium that are likely to benefit from revascularization procedures , adequately predict regional and global ventricular function improvement as well as alleviation of heart failure symptoms after revascularization , and can also be a powerful predictor of prognosis[72 - 73 ] . \n many authors actually point out that pet imaging has become a standard for myocardial viability assessment . \n apart from a noninvasive assessment of cardiac glucose use , gated fdg pet can be used for simultaneous assessment of overall left ventricular function and calculation of such parameters as end - diastolic volume ( edv ) , end - systolic volume ( esv ) and left ventricular ejection fraction ( lvef ) . \n comparative studies showed an excellent agreement between gated fdg pet and cardiac magnetic resonance imaging ( cmri ) in this regard . while cmri with late gadolinium enhancement was much more sensitive in detecting moderate fibrosis , fdg pet could detect a more impaired but viable myocardium . \n the two modalities also showed an excellent correlation for such parameters as edv ( r = 0.948 , p<0.001 ) , esv ( r = 0.939 , p<0.001 ) , and lvef ( r = 0.685 , p<0.001 ) . \n edv and esv were underestimated , whereas lvef was slightly overestimated by gated pet in comparison to cmri , which should be kept in mind when comparing the two modalities . \n lvef , edv and esv measured by gated fdg pet were also highly correlated with those obtained by single photon emission computed tomography ( spect ) modalities such as gated tc99 m sestamibi spect . \n the results confirm that apart from providing accurate evaluations of myocardial viability , gated fdg pet holds the potential for simultaneous assessment of left ventricular function . \n studies evaluating right ventricular ( rv ) parameters also reported that gated fdg pet had moderate - to - high correlation with cmri and cardiac computed tomography in the assessments of rv volume and ejection fraction , and that the modality proved suitable for simultaneous assessment of rv function and myocardial glucose metabolism . \n moreover , the increased fdg accumulation in the rv myocardium was reported to correlate with prognostic markers in patients with pulmonary hypertension including reduced exercise capacity , elevated plasma brain natriuretic peptide , and echo variables of tricuspid annular function . in the chronic phase of severe myocardial infarction , \n a recent pilot multimodal imaging study performed in such patients showed that perfusion enhancement obtained with bone marrow mononuclear cells in areas of chronic myocardial infarction might require an intermediate level of viability documented with fdg - pet and mri and that totally necrotic myocardial infarction seems refractory to cell therapy . in cardiac sarcoidosis , fasting fdg pet can detect the sarcoid in early stages , when fewer perfusion abnormalities and high inflammatory activity are noted , before the development of advanced fibrosis and myocardial impairment , . comparative studies with gallium-67 and tc99 m sestamibi scans showed that fdg pet can detect cardiac sarcoidosis when gallium-67 or tc99 m sestamibi scintigraphy appears negative[81 - 82 ] . \n studies comparing fdg pet with cmri showed that fdg pet correlated with elevated serum angiotensin converting enzyme ( ace ) levels , which was in contrast to cmri , suggesting that fdg pet may be more useful for active disease assessment and for following treatment response , . \n the different distributions of the findings by the two modalities also suggest the potential of fdg pet and cmri in detecting different pathological processes in the heart . due to frequently associated arrhythmias , \n a high percentage of patients with cardiac sarcoidosis have implanted cardiac devices such as pacemakers and/or defibrillators that may interfere with an mri examination . \n . an fdg pet scan may be even more helpful in such patients for evaluating the full extent of the disease , allowing detection of clinically silent or unsuspected lesions as well as identification of potential biopsy sites . additionally , fdg pet proved particularly useful for evaluating interval changes following therapy , being commonly used to follow treatment efficacy in patients with cardiac sar - coidosis . \n abnormal patterns of cardiac fdg activity can be noted in a variety of other conditions such as lipomatous hypertrophy of the interatrial septum , epicardial and pericardial fat , increased atrial activity associated with atrial fibrillation or a prominent crista terminalis , endocarditis , myocarditis , pericarditis , etc . \n prominent fdg uptake involving all cardiac chambers may be also related to heart strain caused by acute pulmonary embolism . \n furthermore , it has been shown that metabolic activity in thrombosed veins decreases with time , suggesting that fdg pet - ct may be helpful in assessing the age of the clot . \n fdg uptake in vascular walls can be noted in vasculitis caused by a variety of autoimmune , infectious or inflammatory conditions as well as in arteriosclerosis . in vessels affected by atherosclerosis , fdg accumulates in plaque macrophages and its uptake is correlated with macrophage density . since \n vulnerable and stable plaques can be distinguished by quantitative analysis of fdg uptake , fdg pet has the potential to be used for predicting thrombosis events and risk - stratification in patients with atherosclerotic disease[87 - 88 ] . \n delayed time - point fdg pet studies performed in patients with atherosclerosis further suggest utilization of 3-hour delayed imaging to obtain optimal data for the detection and quantification of atherosclerotic plaque inflammation in human arteries as delayed imaging enhances assessment of atherosclerotic plaque inflammation . \n the visual grading of vascular fdg uptake and its pattern of distribution may help discriminate arteritis from atherosclerosis . \n last but not least , it should be also remembered that cardiac fdg uptake in fasted patients has been widely reported as variable . \n focal or regional increased fdg activity can be observed in healthy subjects within papillary muscles , the atria , posterolateral wall of the left ventricle and distal anteroapical region , as well as left ventricular base . \n understanding the range of these normal patterns of cardiac fdg activity is crucial for differentiating them from cardiac pathology . \n fdg pet - ct is increasingly used in a variety of other non - oncologic conditions interconnecting to different medical disciplines . in neurology , \n fdg pet is playing an important role in the evaluation of various epileptic syndromes , where it can be used alone or in combination with brain single - photon emission computed tomography ( spect ) . \n overall , ictal spect has the highest diagnostic sensitivity for both temporal and extratemporal lobe epilepsy , and pet is known to have high sensitivity for the evaluation of extratemporal lobe epilepsy . \n for example , interictal fdg pet and ictal subtraction spect of the brain have been shown to be valuable tests in the presurgical evaluation of epilepsy . \n fdg pet also shows hypometabolism in a majority of patients with nonlesional temporal lobe epilepsy , even in the absence of hippocampal atrophy , . a separate entity of mri - negative pet - positive temporal lobe epilepsy has even been described . \n studies performed in the pediatric population showed that pet used for brain mapping in children provides the surgeon with strategic preoperative information not readily attainable with traditional invasive wada testing or intraoperative cortical stimulation ; it may also improve the outcome of extratemporal resections by allowing aggressive seizure focus resection . \n additionally , serial brain maps may optimize timing for surgical intervention by demonstrating reorganization of eloquent cortex often seen in younger children after cortical injury . \n the modality also provided new insights and proved helpful in the clinical evaluation of patients with a variety of other disorders including cognitive impairment and dementias , neurodegenerative diseases , schizophrenia , huntington 's disease , creutzfeldt - jakob disease , encephalitis caused by different etiologies , etc[95 - 99 ] . \n for instance , in patients presenting with cognitive impairment , fdg pet is particularly useful for differentiating alzheimer disease from other degenerative dementias such as frontotemporal dementia ( ftd ) and dementia with lewy bodies ( dlb ) . \n fdg pet has also been used in the study of mild cognitive impairment to accurately predict the subsequent decline to alzheimer disease . \n given the increasing variety of applications of pet imaging of the brain and their expanding interconnections to such disciplines as neurology , psychiatry , neuropsychology and cognitive neuroscience , the area represents a separate topic and is therefore only briefly mentioned in this paper . \n fdg pet - ct applications in endocrine and neuroendocrine pathology are similarly expanding . as both type 1 and type 2 diabetes mellitus \n are associated with a functional loss of -cell mass , most efforts to cure diabetic patients have focused on preserving -cell mass and its function . with recent advances in islet cell transplantation techniques , \n fdg pet has the potential to image transplanted islets and evaluate their location , distribution , and function following transplantation . \n currently , two modalities are being assessed for this purpose : fdg pet and mri . \n both techniques require that ex vivo islets be labeled , before transplantation , with 2-[fluorine 18]fluoro-2-deoxy - d - glucose ( fdg ) for pet and superparamagnetic iron oxide ( spio ) for mr imaging . \n experimental studies have shown that the labeled islets may be visualized at both pet and mr imaging , thus allowing monitoring of the success of engraftment[101 - 103 ] . \n the main advantages of fdg pet - ct is that it is readily available in most centers performing islet transplantation and that it allows real - time measurement of islet survival and distribution after transplantation , while the main limitation is related to a relatively short half - life of fdg , which limits the visualization of the transplanted islet to the first few hours following transplantation . \n metabolic imaging with fdg may also provide useful information in patients with other endocrine disorders and systemic diseases such as thymic pathology , focal and diffuse thyroid diseases , primary hyperparathyroidism , ectopic cushing syndrome , amyloidosis , etc[104 - 111 ] . \n for example , studies performed in patients with primary hyperparathyroidism showed that fdg pet is more sensitive than tc99 m sestamibi spect in the preoperative localization of parathyroid adenomas . in patients with graves ' disease , fdg pet may provide information on the biological activity of graves ' disease as well as on early radiation effects , while in myasthenia gravis , selective use of fdg pet was reported useful in differentiating thymoma from hyperplasia , especially when ct scan is controversial . published reports indicate that fdg pet - ct may also have the potential for monitoring the development of amyloid lesions[110 - 111 ] . \n however , despite the expanding areas of fdg pet applications in non - oncologic disorders , new prospective studies are needed to determine the place of fdg pet in the diagnostic work - up of many of these conditions . \n the clinical applications of fdg pet - ct are rapidly expanding , involving many clinical disciplines and areas of research . \n the modality has become a valuable tool in the diagnosis , treatment evaluation and follow - up of patients with a variety of infections and inflammatory conditions and is already the gold standard for some indications . \n the modality proved especially useful in detecting the source of fever of unknown origin , including in immunocompromised and hiv - positive subjects , by showing an overall sensitivity and specificity of over 90% for localization of focal pathology in subjects presenting with unexplained fever , weight loss , or confusion . \n it may also provide valuable information related to the anatomic correlates of hiv progression without the need for biopsy and for monitoring the response to therapy . in cardiology , \n fdg pet - ct imaging has become a standard for myocardial viability assessment and also holds the potential for simultaneous assessment of left ventricular function . in patients with cardiac sarcoidosis , \n fdg pet - ct and cmri may complement each other by providing valuable information related to disease extent and treatment response . \n an fdg pet - ct scan may be especially helpful in patients with simultaneous extracardiac lesions , allowing evaluation of the full extent of the disease and identification of potential biopsy sites . \n promising results have also been obtained for a variety of other potential applications , including risk - stratification for atherosclerotic disease . in neurology , \n fdg pet - ct is playing an important role in the evaluation of various epileptic syndromes as well as in the clinical assessment of patients with a multitude of other disorders , including cognitive impairment and dementias . with recent advances in the islet cell transplantation techniques , \n fdg pet - ct has the potential to image transplanted islets and evaluate their location , distribution , and function following transplantation . \n the modality may also provide useful information in patients with a variety of other endocrine and systemic disorders , having the advantage of being able to screen the whole body . \n however , despite the expanding areas of metabolic imaging with fdg , new prospective studies are needed to determine the place of fdg pet - ct in the diagnostic work - up of many of these conditions .", "role": "user" }, { "content": "abstractas the number of clinical applications of 2-[fluorine 18]fluoro-2-deoxy - d - glucose ( fdg ) positron emission tomography / computed tomography ( pet - ct ) grows , familiarity with the conditions that can be diagnosed by this modality and when relevant pieces of additional information can be obtained becomes increasingly important for both requesting physicians and nuclear medicine physicians or radiologists who interpret the findings . \n apart from its heavy use in clinical oncology , fdg pet - ct is widely used in a variety of non - oncologic conditions interconnecting to such disciplines as general internal medicine , infectious diseases , cardiology , neurology , surgery , traumatology , orthopedics , pediatrics , endocrinology , rheumatology , psychiatry , neuropsychology , and cognitive neuroscience . \n the aim of this review was to summarize the current evidence of fdg pet - ct applications in evaluating non - oncologic pathologies and the relevant information it can add to achieve a final diagnosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: meckel 's diverticulum ( md ) is the most common congenital gastrointestinal anomaly with incidence of 2% in general population and reported complication rate of 4 - 40% . \n the most common complications are bleeding , intestinal obstruction and diverticulitis . in 60% of cases \n md are lined with heterotopic mucosa , in the following manner : gastric mucosa , 62% ; of pancreatic , 6% ; both gastric and pancreatic , 5% , jejunal , 2% ; brunner 's glands , 2% ; and gastric and duodenal , 2% . \n based upon these histological facts , 99 m technetium - pertechnetate is the most commonly performed functional imaging for localization of md lined with heterotopic ( mucin secreting cells ) gastric mucosa . higher sensitivity ( 85 - 90% ) in the pediatric population than in adult ( 60% ) patients is reported . \n it is most commonly visualized in the right lower quadrant and umbilical regions and less commonly in other regions . \n wandering or mobile md during scintigraphy is a rare presentation and may pose a diagnostic challenge for nuclear physicians . \n we are presenting a case of wandering md during scintigraphy , which would help our readers to be cognizant of this atypical presentation in their clinical practice . \n a 2-year - old male child admitted to the emergency room with 2 days history of 3 episodes of painless per rectal fresh bleeding . on examination , \n child was irritable , grossly anemic , afebrile with mild abdomen distention , but audible gut sounds . \n his hemoglobin was 4.9 g / dl ( normal 11 - 14 g / dl ) while other biochemical and bleeding parameters were within the normal limits . \n ultrasound abdomen was unremarkable and child had blood transfusions with and started on oral ranitidine ( 2 mg / kg 12 hourly ) . on the 3 admission day , \n md scintigraphy was performed with 3 mci of 99 m technetium - pertechnetate injected intravenously with 3 h fasting . \n dynamic study for 60 min with a frame rate of 20s / frame was acquired in anterior projection under a dual head digital gamma camera ( ecam , siemens , germany ) fitted with low energy high resolution collimators . \n early images showed the appearance of focus of abnormal tracer deposition in hypogastric region concomitant with the appearance of gastric activity in left hypochondrium and better delineation in subsequent frames same as native gastric activity . \n sequential images revealed gross shifting of abnormal focus to left iliac region , hypogastrium , right lumbar , umbilical and finally in epigastric region [ figure 1 ] . as this abnormal focus remained compact during its tortuous path with no sign of change in its morphology during its whole path , an intraluminal source of radiotracer like bleed ( which keeps on changing its shape in lumen of small or large bowel ) was ruled out and provisional diagnosis of a wandering md with heterotopic gastric mucosa was made . \n the child underwent an exploratory laparotomy and md was resected and histopathology revealed md with heterotopic gastric and pancreatic mucosa . \n 99 m technetium - pertechnetate meckel 's diverticulum scintigraphy : sequential images showing appearance of abnormal focus ( arrow ) having temporal correlation with gastric activity and wandering in various quadrants maintaining its compactness \n md is the most common congenital intestinal anomaly with equal frequency in both genders , but higher incidence of complication in male gender . \n presence of adequate heterotopic gastric mucosa ( mucin secreting cells ) is mandatory for scintigraphic localization of md with good sensitivity in pediatric group . \n the characteristic diagnostic criteria are temporal correlation with gastric activity and presence of abnormal focus in umbilical or right lower quadrant . in this case , although there was a good temporal correlation , but abnormal focus was grossly mobile or wandering in various abdominal quadrants . \n this could easily be confused with ureteric activity or secreted gastric activity entering into duodenum . however \n furthermore , compactness of mobile focal uptake would be changing with time as it passes through ureter or small bowel lumen . to the best of our knowledge , \n primary reason for this feature is mobile and long mesentery and this was the perioperative finding in this child as well . \n although diagnosis of md having heterotopic gastric mucosa on scintigraphy is easy and straightforward but a dynamic or wandering md may pose a diagnostic challenge . \n however , temporal correlation with gastric activity and compactness of the focus during wandering period is two sentinel criteria favoring the diagnosis of a md lined with heterotopic gastric mucosa . \n we conclude that wandering md is a rare scintigraphic presentation , which may pose a diagnostic challenge , but the presence of temporal correlation with gastric activity and compactness of focus during wandering period could make this riddle easy .", "role": "user" }, { "content": "meckel 's diverticulum ( md ) is the most common gastrointestinal anomaly with heterotopic mucosa in 60% of cases . \n 99 m technetium - pertechnetate scintigraphy is a sensitive tool for detection of md containing heterotopic gastric mucosa . \n it is usually located in the right lower quadrant or umbilical region and less frequently in other quadrants . \n a mobile or wandering md is a rare clinical presentation and may pose a diagnostic dilemma . \n however , presence of temporal correlation with gastric activity and compactness of focus during wandering period could make this riddle easy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: pachydermoperiostosis ( pdp ) , or touraine - solente - gol syndrome , is the primary form of hypertrophic osteoarthropathy . \n it must be distinguished from the secondary form of hypertrophic osteoarthropathy which is much more frequent ( 95% ) and mostly due to various cardiac diseases , and pulmonary or thyroid malignancies . \n pdp is due to mutations of the gene encoding for 15-hydroxyprostaglandin dehydrogenase ( 15hpgd ) [ 2 , 3 ] . \n clinical manifestations of pdp are thought to be due to excessive collagen formation and dysregulation of matrix proteins due to fibroblastic hyperactivation . \n we report here the observation of a patient with pdp who presented symptoms of severe digestive bleeding due to juvenile polyposis of the stomach that contained foci of severe dysplasia . \n a 33-year - old caucasian man was admitted to the emergency room for melena and deep asthenia . \n his past history only showed a known pdp , with progressive thickening of the hands , feet and scalp , associated with digital clubbing ( fig . \n two of them measured 8 6 cm and 6 5 cm , respectively . \n histological examination of the biopsy specimens from several polyps showed hyperplastic crypts , with cystic dilatations in an edematous stroma with inflammatory infiltrates . \n after a multidisciplinary discussion we decided to perform gastrectomy , because of the severe anemia , the young age and good condition of the patient , and finally the extension of lesions together with foci of high - grade dysplasia . \n macroscopical examination of the resected stomach showed the presence of multiple polyps , most of them being located in the antrum ( fig . \n foci of high - grade dysplasia were present in the two huge polyps ( fig . \n we proposed the diagnosis of juvenile polyposis of the stomach with foci of high - grade dysplasia . \n seborrhea , hyperhydrosis , acne , cutis verticis gyrata , gynecomastia , joint pain and flushes are minor criteria . in our patient , \n the diagnosis of pdp was made based on pachydermia , cutis verticis gyrata and digital clubbing , associated with typical radiological diffuse periostosis . \n upper digestive symptoms are reported by 1149% of patients with pdp [ 5 , 7 ] . at endoscopic examination , gastroduodenal ulcers , \n atrophic gastritis , hypertrophic gastropathy , menetrier 's disease , juvenile polyps or gastric adenocarcinoma can be found ( table 1 ) . \n finally , combination with crohn 's disease or exudative enteropathy have also been reported [ 5 , 7 , 8 ] . \n jajic and al . reported 76 cases of pdp : in 21 patients , upper gastrointestinal endoscopic examination was performed that showed gastroduodenal ulcers in 13 and hypertrophic gastropathy in 8 patients . \n finally , involvement of the upper digestive tract in pdp may be underestimated as most patients are asymptomatic and thus do not undergo endoscopic examination . since pdp is often associated with gastric changes and occasionally with gastric premalignant lesions , an endoscopic follow - up seems to be important in patients affected with pdp who complain of upper digestive symptoms . in our patient , the uncommonly severe anemia ( hemoglobin 26 \n g / l ) was probably due to a chronic silent bleeding , explaining the surprising good clinical tolerance . due to the microcytic character of the anemia , a potential role of myelofibrosis , a condition seen in pdp , seemed to be unlikely . \n association of pdp with juvenile polyposis of the stomach has been reported in only one patient before . \n established a working definition of juvenile polyposis : = 5 juvenile polyps of the colorectum and/or juvenile polyps throughout the gastrointestinal tract and/or any number of juvenile polyps with a family history of juvenile polyposis . \n the colon is systematically affected ( 98% ) , but polyps are less frequent in the stomach ( 14% ) or the small bowel ( 9% ) . in the stomach , \n polyps are mostly located in the antrum and dysplasia occurs in nearly 30% of cases . \n patients affected by juvenile gastric polyposis often undergo gastrectomy because a malignant course is possible . in our observation , \n pdp combined with juvenile polyposis was circumscribed to the stomach as colonoscopy and videoenteroscopy were normal . since foci of high - grade dysplasia were found in the huge polyps , we considered reasonable to perform total gastrectomy to preclude a malignant course . \n few authors have related hypertrophic osteoarthropathy associated with gastrointestinal polyposis [ 14 , 15 , 16 ] . \n osteoarthropathy seemed to be secondary to polyposis and was often associated with cystic fibrosis of the liver or the lungs and/or arteriovenous pulmonary malformation . in our observation , these abnormalities were not found . \n thus , osteoarthropathy was not likely to be secondary to gastric neoplasia , since the latter developed several years after the diagnosis of pdp . \n mutations of the gene encoding for 15hpgd are involved [ 3 , 4 ] , leading to an increase in the plasmatic rate of prostaglandin e2 ( pge2 ) . \n a chronic increase of pge2 seems to be implicated in periostosis by stimulating osteoblastic growth , and also in pachydermia and clubbing by stimulating fibroblastic growth \n . pathogenic implication of vascular endothelial growth factor has been suggested by the hypertrophy of the endothelium on skin biopsies . \n these chronic vascular changes may lead to deregulation of the anabolic activity of fibroblasts , resulting in unorganized accumulation of collagen in the matrix , responsible for pachydermia and digital clubbing . \n as pdp may be due to fibroblastic hyperactivation and hypercollagenosis of the extracellular matrix , these mechanisms may be responsible for chronic hypertrophic gastritis , which is often associated with this disease . \n staalman and umans have reported the combination of pdp with malignant lymphomas or melanomas . \n 15hpgd is a tumor suppressor gene which counterbalances the production of pge2 by cyclooxygenase 2 in gastric , colorectal , breast and lung cancers . \n the oncogenic process seems to be associated with an early increase of cyclooxygenase 2 expression and so pge2 , then an abolition of 15hpgd expression as a second step . \n moreover , 15hpgd may be an antitumoral agent as it leads to the inhibition of tumor invasion and cellular migration . \n involvement of the upper digestive tract seems to be frequent in pdp , even though it has not been systematically explored . \n upper gastrointestinal endoscopic examination should be part of the check - up in patients affected by this disease . in case of severe gastric involvement \n surgical gastrectomy should be considered in symptomatic patients or in those whose biopsies reveal severe dysplasia to preclude a malignant course .", "role": "user" }, { "content": "pachydermoperiostosis ( pdp ) is the primary form of hypertrophic osteoarthropathy . \n it is a very rare disease consisting of pachydermia , digital clubbing and radiologic periostosis . \n various digestive symptoms in pdp are seen in 1149% of patients and juvenile polyps may be found at gastric endoscopy . \n we report here the history of a patient with pdp who was referred for assessment of severe anemia . \n endoscopy of the upper digestive tract showed multiple polyps of the stomach with two huge lesions exhibiting foci of high - grade dysplasia . \n this observation suggests that pdp can be considered as a precancerous condition of the stomach and systematic screening using endoscopy should be considered in these patients .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: this multi - center trial was conducted at 13 sites with subjects aged 845 years with autoimmune type 1 diabetes for less than 3 months and with evidence of -cell function evidenced by stimulated c - peptide > 0.2 pmol on a 2-h mixed meal tolerance test ( mmtt ) . \n autoimmune type 1 diabetes was defined by the presence of any of four islet autoantibodies within 14 days of diagnosis ( gad , insulinoma - associated protein 2 , or islet cell autoantibodies [ icas ] ) . \n subjects were otherwise healthy without major systemic illness nor allergic or autoimmune conditions requiring treatment with immunosuppressive agents or steroids . \n the protocol was approved by the type 1 diabetes trialnet steering committee , the data and safety monitoring board ( dsmb ) , and regulatory authorities ; human subject approval was obtained at participating sites prior to study initiation . \n the study was a three - arm , randomized , double - masked , placebo - controlled clinical trial conducted by type 1 diabetes trialnet . \n roche pharmaceuticals provided mmf , dzb , and placebo , but had no involvement in study management , data collection and analysis , or manuscript preparation . \n there were 126 subjects randomized to receive mmf alone ( with dzb placebo ) , mmf and dzb in combination , or control ( mmf placebo and dzb placebo ) , stratified within clinical center . \n by error , among the last six sites to join the study , 12 subjects assigned to receive mmf alone inadvertently received dzb - alone , thus resulting in an imbalance in the group sample sizes . the results from these 12 subjects \n mmf or matched placebo was administered daily at a dose of 600 mg / m ( maximum 2,000 mg / day ) in 23 divided doses for 2 years . \n dzb or matched placebo was given by intravenous infusion at study day 0 and two weeks later at a dose of 1 mg / kg . all subjects were to be followed for at least 2 years under the intention - to - treat principle , including those who did not receive the full course of assigned therapy . because both drugs reduce the ability to fight viral infections , screening for cytomegalovirus ( cmv ) , and epstein - barr virus ( ebv ) \n thereafter , ebv - negative subjects were followed monthly , and ebv - positive subjects were followed at 3-month intervals . \n visits included assessment of diabetes care , adverse events , and laboratory measurements to assess medication side effects . in the case of an acute infection , \n an infectious disease committee developed treatment algorithms for common infections and provided consultation as needed . \n a 4-h mmtt was conducted at baseline and 2 years , and a 2-h mmtt at 3 , 6 , 12 , and 18 months with timed sample collection at 1530 min intervals . \n c - peptide levels were measured using a two - site immunoenzymometeric assay ( tosoh 600 ii analyzer ) . \n a1c was measured quarterly using ion - exchange high performance liquid chromatography ( variant ii , bio - rad diagnostics ) . \n biochemical autoantibodies ( gad-65 , ica-512 , miaa ) were measured using radio - immunobinding assays ; icas were measured using indirect immunofluorescence . \n potential participants were screened for antibodies to hepatitis b surface antigen , hepatitis c , and human immunodeficiency virus using enzyme immunoassays that , if positive , resulted in exclusion from the study . \n antibodies to cmv ebv were measured using indirect immunofluorescence ( anti - ebv vca igm ) and enzyme immunoassay ( anti - cmv igg and igm ; anti - ebv vca and ebna igg ) . \n cmv and ebv viral load was measured using real time quantitative pcr ( lightcycler system ; roche applied science ) . \n the prespecified primary analyses were based on the intention - to - treat cohort that included all subjects randomized correctly to the three specified treatment groups . \n the primary outcome was the geometric mean difference between active- and placebo - treated subjects of the area under the stimulated c - peptide curve over the first 2 h of a 4-h mmtt conducted at the 2-year visit in an ancova model adjusting for the baseline c - peptide , age , and sex . \n the 2-h c - peptide area under the curve ( auc ) ( pmol / ml/120 min ) was computed using the trapezoidal rule from timed measurements of c - peptide during each mmtt ( including the basal ) . \n the auc mean ( pmol / ml ) equals the auc divided by the interval of time . \n the log([mean c - peptide ] + 1 ) transformation of the baseline and follow - up auc mean was used to allow for mean c - peptide values close to zero and to normalize the distribution of the residuals ( 6 ) . \n data from all 13 centers contributed to the primary and secondary effectiveness analyses of the mmf plus dzb combination and its respective control group . \n however , owing to the randomization error , subjects received mmf alone in only seven centers . \n thus , these analyses compare the mmf alone subjects only with the concurrently randomized control subjects from these centers . \n secondary analyses include assessment of differences between groups over time in a longitudinal normal errors repeated - measures model of the log([mean c - peptide ] + 1 ) values . \n the mean rate of change over 324 months was estimated using a mixed effects random coefficient model ( 18 ) using the log values . \n the cox proportional hazards model assessed the relative risk ( hazard ratio ) of the loss of the 2-h c - peptide < 0.2 pmol / ml ( 19 ) . \n prespecified secondary outcomes also include : differences in a1c , insulin dose , hypoglycemic episodes , rates of infection , and adverse events over time . for assessment of safety , \n the percents of subjects with an event were compared among the three groups using fisher exact test . \n the rate of events per subject was compared between groups using the poisson model test ( 20 ) . \n the target sample size of 120 subjects ( 40 per group ) provided 85% power to detect a 65% difference in the geometric mean c - peptide for any one of the three possible pairwise comparisons among the three treatment groups using a test at the 0.05 level ( one - sided , adjusted for three comparisons ) , with 10% loss to follow - up . \n owing to the randomization error , the protocol was modified to compare the mmf and dzb combination group versus all placebo subjects , and to compare the mmf only subjects versus the placebo subjects enrolled within the same clinical centers ( 7 of the original 13 ) in which the randomization was not affected , each using a test at the 0.025 level ( one - sided , adjusted for two comparisons ) . \n the mmf plus dzb versus placebo comparison , with about 40 per group , provided 85% power to detect a 61% difference ; and the mmf alone versus placebo comparison , with about 30 per group , provided 80% power to detect a 67% increase , each allowing for 10% losses to follow - up . in april 2008 , \n based on 41 and 47% of the planned total information , the dsmb recommended termination of the treatment phase of the study . at that time \n the conditional power of each comparison under the current trend in the data were less than 0.02% and under the original design assumptions , termination for futility led to less than a 1% increase in the probability of a type ii error ( 21 ) . \n sites were notified on april 30 , 2008 , to immediately terminate treatment but continue to follow all subjects . \n this report is based on closed and locked data for all visits through april 30 , 2008 . \n nominal one - sided p values ( without adjustment for multiple tests ) are presented for analyses of primary and secondary effectiveness outcomes ; 2-sided p values for safety outcomes . \n the study was a three - arm , randomized , double - masked , placebo - controlled clinical trial conducted by type 1 diabetes trialnet . \n roche pharmaceuticals provided mmf , dzb , and placebo , but had no involvement in study management , data collection and analysis , or manuscript preparation . \n there were 126 subjects randomized to receive mmf alone ( with dzb placebo ) , mmf and dzb in combination , or control ( mmf placebo and dzb placebo ) , stratified within clinical center . by error , among the last six sites to join the study , 12 subjects assigned to receive mmf alone inadvertently received dzb - alone , thus resulting in an imbalance in the group sample sizes . \n mmf or matched placebo was administered daily at a dose of 600 mg / m ( maximum 2,000 mg / day ) in 23 divided doses for 2 years . \n dzb or matched placebo was given by intravenous infusion at study day 0 and two weeks later at a dose of 1 mg / kg . all subjects were to be followed for at least 2 years under the intention - to - treat principle , including those who did not receive the full course of assigned therapy . because both drugs reduce the ability to fight viral infections , screening for cytomegalovirus ( cmv ) , and epstein - barr virus ( ebv ) was based on close surveillance rather than active prophylaxis . \n thereafter , ebv - negative subjects were followed monthly , and ebv - positive subjects were followed at 3-month intervals . \n visits included assessment of diabetes care , adverse events , and laboratory measurements to assess medication side effects . in the case of an acute infection \n an infectious disease committee developed treatment algorithms for common infections and provided consultation as needed . \n a 4-h mmtt was conducted at baseline and 2 years , and a 2-h mmtt at 3 , 6 , 12 , and 18 months with timed sample collection at 1530 min intervals . \n c - peptide levels were measured using a two - site immunoenzymometeric assay ( tosoh 600 ii analyzer ) . \n a1c was measured quarterly using ion - exchange high performance liquid chromatography ( variant ii , bio - rad diagnostics ) . \n biochemical autoantibodies ( gad-65 , ica-512 , miaa ) were measured using radio - immunobinding assays ; icas were measured using indirect immunofluorescence . \n potential participants were screened for antibodies to hepatitis b surface antigen , hepatitis c , and human immunodeficiency virus using enzyme immunoassays that , if positive , resulted in exclusion from the study . \n antibodies to cmv ebv were measured using indirect immunofluorescence ( anti - ebv vca igm ) and enzyme immunoassay ( anti - cmv igg and igm ; anti - ebv vca and ebna igg ) . \n cmv and ebv viral load was measured using real time quantitative pcr ( lightcycler system ; roche applied science ) . \n the prespecified primary analyses were based on the intention - to - treat cohort that included all subjects randomized correctly to the three specified treatment groups . \n the primary outcome was the geometric mean difference between active- and placebo - treated subjects of the area under the stimulated c - peptide curve over the first 2 h of a 4-h mmtt conducted at the 2-year visit in an ancova model adjusting for the baseline c - peptide , age , and sex . \n the 2-h c - peptide area under the curve ( auc ) ( pmol / ml/120 min ) was computed using the trapezoidal rule from timed measurements of c - peptide during each mmtt ( including the basal ) . \n the auc mean ( pmol / ml ) equals the auc divided by the interval of time . the log([mean c - peptide ] \n + 1 ) transformation of the baseline and follow - up auc mean was used to allow for mean c - peptide values close to zero and to normalize the distribution of the residuals ( 6 ) . \n data from all 13 centers contributed to the primary and secondary effectiveness analyses of the mmf plus dzb combination and its respective control group . \n however , owing to the randomization error , subjects received mmf alone in only seven centers . \n thus , these analyses compare the mmf alone subjects only with the concurrently randomized control subjects from these centers . \n secondary analyses include assessment of differences between groups over time in a longitudinal normal errors repeated - measures model of the log([mean c - peptide ] + 1 ) values . \n the mean rate of change over 324 months was estimated using a mixed effects random coefficient model ( 18 ) using the log values . \n the cox proportional hazards model assessed the relative risk ( hazard ratio ) of the loss of the 2-h c - peptide < 0.2 pmol / ml ( 19 ) . prespecified \n secondary outcomes also include : differences in a1c , insulin dose , hypoglycemic episodes , rates of infection , and adverse events over time . \n for assessment of safety , the two active groups are compared with the total control group enrolled . \n the percents of subjects with an event were compared among the three groups using fisher exact test . \n the rate of events per subject was compared between groups using the poisson model test ( 20 ) . \n the target sample size of 120 subjects ( 40 per group ) provided 85% power to detect a 65% difference in the geometric mean c - peptide for any one of the three possible pairwise comparisons among the three treatment groups using a test at the 0.05 level ( one - sided , adjusted for three comparisons ) , with 10% loss to follow - up . \n owing to the randomization error , the protocol was modified to compare the mmf and dzb combination group versus all placebo subjects , and to compare the mmf only subjects versus the placebo subjects enrolled within the same clinical centers ( 7 of the original 13 ) in which the randomization was not affected , each using a test at the 0.025 level ( one - sided , adjusted for two comparisons ) . \n the mmf plus dzb versus placebo comparison , with about 40 per group , provided 85% power to detect a 61% difference ; and the mmf alone versus placebo comparison , with about 30 per group , provided 80% power to detect a 67% increase , each allowing for 10% losses to follow - up . in april 2008 , based on 41 and 47% of the planned total information , the dsmb recommended termination of the treatment phase of the study . \n at that time the conditional power of each comparison under the current trend in the data were less than 0.02% and under the original design assumptions , termination for futility led to less than a 1% increase in the probability of a type ii error ( 21 ) . \n sites were notified on april 30 , 2008 , to immediately terminate treatment but continue to follow all subjects . \n this report is based on closed and locked data for all visits through april 30 , 2008 . \n nominal one - sided p values ( without adjustment for multiple tests ) are presented for analyses of primary and secondary effectiveness outcomes ; 2-sided p values for safety outcomes . \n supplemental figure a1 ( available in the online appendix at http://care.diabetesjournals.org/cgi/content/full/dc09-1349 ) summarizes subject disposition - screening of 228 subjects , randomization of 126 subjects , and subsequent disposition . \n table 1 presents baseline characteristics for each active therapy group versus its respective control group . \n the groups were well - matched with 30% ages 812 years , 31% ages 1317 years , and 39% age 18 years . \n baseline characteristics of the treatment groups , including all 114 subjects correctly randomized means sd are presented for continuous variables . \n * one subject did not receive the second infusion due to patient decision to continue study treatment . * * * 80% or greater by capsule count up through last recorded visit starting with month 3 . \n safety data are presented on all 114 properly randomized subjects , excluding the 12 who received the dzb - alone instead of mmf alone . of these \n , 60 completed an mmtt at 2 years and contributed to the primary outcome analysis . \n all randomized subjects received study treatment , and all but one received the two planned dzb / placebo infusions . \n median compliance with mmf daily capsules was estimated to be 75% in the mmf plus dzb group , 63% in the mmf alone group , and 71% in the control group over the treatment period based on capsule counts . \n mean mpa trough levels over 24 months were 4.5 3.4 ( mcg / ml ) and 5.8 4.0 ( mcg / ml ) , respectively , for mmf plus dzb and mmf alone groups with expected trough range of 1.03.5 g / ml . treatment was terminated in 23 subjects due to adverse events ( 5 ) , elevated liver enzymes ( 2 ) , ebv pcr - positivity ( 8) , treatment noncompliance ( 3 ) , or loss to follow - up ( 5 ) ( supplemental figure a1 ) . \n control subjects lost c - peptide at a rate of 53.5% per year , and both the mmf alone and the mmf plus dzb treatment groups had comparable rates of loss , 46.4% and 48.1% , respectively . in the primary analysis ( fig . \n 1a ) at 2 years,;the geometric mean stimulated c - peptide auc was 0.28 pmol / ml ( 95% ci 0.190.37 ) in those treated with mmf plus dzb , compared with 0.27 ( 0.180.37 ) for their control subjects , p = 0.47 ; and 0.25 ( 0.140.37 ) in mmf alone treated subjects , compared with 0.23 ( 0.120.35 ) for their control subjects , p = 0.41 . \n there was no statistical difference between treatment and control subjects over 2 years or during the early phase when dzb would have been more active . \n a ) the geometric means and 95% cis for the 2-h auc stimulated c - peptide levels over time within each group . \n b ) the cumulative incidence of decline in peak c - peptide to < 0.2 pmol / ml within each group . the relative hazard was 0.61 ( 95% ci : 0.281.33 , p = 0.11 ) for mmf plus dzb vs. control , and 1.05 ( 0.502.19 , p = 0.83 ) for mmf alone vs. control . \n c ) ratio of geometric means for mmf plus dzb vs. control groups , with 95% cis , within subgroups of subjects defined at baseline . \n d ) likewise for mmf alone vs. control ( a1c 2nd tertile upper 95% confidence limit is 28.9 ) . during follow - up , all but eight subjects had detectable levels of c - peptide . \n the auc mean c - peptide fell below 0.2 pmol / ml during follow - up in 12 mmf plus dzb , 16 mmf alone , and 17 control subjects . \n cumulative incidence of decline of peak c - peptide below 0.2 pmol / ml did not differ between groups ( fig . \n the geometric mean ratio for mmf plus dzb versus control subjects was 1.02 ( 95% ci 0.651.59 ) and for mmf alone versus control subjects was 1.08 ( 0.572.02 ) . \n figure 1c and d show that these mean ratios and confidence limits within subgroups , defined by baseline characteristics , are not nominally significantly different from 1 , with the exception of the effect of mmf alone within the 10 subjects in the highest tertile of baseline a1c ( p = 0.042 ) . however , comparison of ratios among the a1c tertiles , and among all other subgroups , failed to reach significance demonstrating that variation among subgroups was within the realm of chance . \n similar results applied to subgroups defined from the mean levels of a1c and insulin dose over 24 months . \n dzb reduced cd4cd25 t - cell levels maximally at 4 weeks ( depletion 83.9% and blocking 97.5% ) and these recovered within 612 months . the month 24 c - peptide level was not associated with either percent reduction in cd4cd25 t - cells within the mmf plus dzb group , or mmf trough levels in either the mmf plus dzb or mmf alone groups . \n mirroring changes in c - peptide , daily insulin dose slowly rose from below 0.5 units / kg at baseline to 0.57 units / kg with mmf plus dzb versus 0.61 units / kg among control subjects ( p = 0.17 ) ; and to 0.65 units / kg with mmf alone versus 0.62 units / kg among control subjects ( p = 0.68 ) ( fig . \n there were 19 serious adverse events ( aes ) reported for 14 subjects ( 34% ) in the mmf and dzb group , nine in five subjects ( 16% ) in the mmf alone group , and three in three subjects ( 7% ) in the control group ( online appendix table 1 ) , p < 0.01 . \n more grade 2 or higher aes occurred in mmf plus dzb subjects ( 167 or 4.1 events / subject ) compared with mmf alone ( 117 , 3.8 events / subject ) or control subjects ( 133 , 3.2 events / subject ) , p = 0.09 ( online appendix table 1 ) . \n contrary to expectations , there was no difference in the occurrence of infectious or gastrointestinal events among groups . \n eight individuals had asymptomatic reactivation of previous ebv infection using a sensitive pcr assay ( five in mmf plus dzb , one in mmf , and two in control ) . \n neutropenia and leukopenia , both side effects of mmf and dzb , occurred approximately equally among the three groups . a slight excess of elevated liver enzymes occurred in the mmf plus dzb group . \n major hypoglycemic events were reported for 27 subjects , with an average of two each , with no difference among groups . \n supplemental figure a1 ( available in the online appendix at http://care.diabetesjournals.org/cgi/content/full/dc09-1349 ) summarizes subject disposition - screening of 228 subjects , randomization of 126 subjects , and subsequent disposition . \n table 1 presents baseline characteristics for each active therapy group versus its respective control group . \n the groups were well - matched with 30% ages 812 years , 31% ages 1317 years , and 39% age 18 years . \n baseline characteristics of the treatment groups , including all 114 subjects correctly randomized means sd are presented for continuous variables . \n * one subject did not receive the second infusion due to patient decision to continue study treatment . * * * 80% or greater by capsule count up through last recorded visit starting with month 3 . \n safety data are presented on all 114 properly randomized subjects , excluding the 12 who received the dzb - alone instead of mmf alone . of these \n , 60 completed an mmtt at 2 years and contributed to the primary outcome analysis . \n all randomized subjects received study treatment , and all but one received the two planned dzb / placebo infusions . \n median compliance with mmf daily capsules was estimated to be 75% in the mmf plus dzb group , 63% in the mmf alone group , and 71% in the control group over the treatment period based on capsule counts . \n mean mpa trough levels over 24 months were 4.5 3.4 ( mcg / ml ) and 5.8 4.0 ( mcg / ml ) , respectively , for mmf plus dzb and mmf alone groups with expected trough range of 1.03.5 g / ml . treatment was terminated in 23 subjects due to adverse events ( 5 ) , elevated liver enzymes ( 2 ) , ebv pcr - positivity ( 8) , treatment noncompliance ( 3 ) , or loss to follow - up ( 5 ) ( supplemental figure a1 ) . \n mean auc c - peptide at entry was 0.70 0.33 pmol / ml . control subjects lost c - peptide at a rate of 53.5% per year , and both the mmf alone and the mmf plus dzb treatment groups had comparable rates of loss , 46.4% and 48.1% , respectively . in the primary analysis ( fig . \n 1a ) at 2 years,;the geometric mean stimulated c - peptide auc was 0.28 pmol / ml ( 95% ci 0.190.37 ) in those treated with mmf plus dzb , compared with 0.27 ( 0.180.37 ) for their control subjects , p = 0.47 ; and 0.25 ( 0.140.37 ) in mmf alone treated subjects , compared with 0.23 ( 0.120.35 ) for their control subjects , p = 0.41 . \n there was no statistical difference between treatment and control subjects over 2 years or during the early phase when dzb would have been more active . \n a ) the geometric means and 95% cis for the 2-h auc stimulated c - peptide levels over time within each group . \n b ) the cumulative incidence of decline in peak c - peptide to < 0.2 pmol / ml within each group . \n the relative hazard was 0.61 ( 95% ci : 0.281.33 , p = 0.11 ) for mmf plus dzb vs. control , and 1.05 ( 0.502.19 , p = 0.83 ) for mmf alone vs. control . \n c ) ratio of geometric means for mmf plus dzb vs. control groups , with 95% cis , within subgroups of subjects defined at baseline . \n d ) likewise for mmf alone vs. control ( a1c 2nd tertile upper 95% confidence limit is 28.9 ) . during follow - up , all but eight subjects had detectable levels of c - peptide . \n the auc mean c - peptide fell below 0.2 pmol / ml during follow - up in 12 mmf plus dzb , 16 mmf alone , and 17 control subjects . \n cumulative incidence of decline of peak c - peptide below 0.2 pmol / ml did not differ between groups ( fig . \n the geometric mean ratio for mmf plus dzb versus control subjects was 1.02 ( 95% ci 0.651.59 ) and for mmf alone versus control subjects was 1.08 ( 0.572.02 ) . \n figure 1c and d show that these mean ratios and confidence limits within subgroups , defined by baseline characteristics , are not nominally significantly different from 1 , with the exception of the effect of mmf alone within the 10 subjects in the highest tertile of baseline a1c ( p = 0.042 ) . however , comparison of ratios among the a1c tertiles , and among all other subgroups , failed to reach significance demonstrating that variation among subgroups was within the realm of chance . \n similar results applied to subgroups defined from the mean levels of a1c and insulin dose over 24 months . \n dzb reduced cd4cd25 t - cell levels maximally at 4 weeks ( depletion 83.9% and blocking 97.5% ) and these recovered within 612 months . the month 24 c - peptide level was not associated with either percent reduction in cd4cd25 t - cells within the mmf plus dzb group , or mmf trough levels in either the mmf plus dzb or mmf alone groups . \n mirroring changes in c - peptide , daily insulin dose slowly rose from below 0.5 units / kg at baseline to 0.57 units / kg with mmf plus dzb versus 0.61 units / kg among control subjects ( p = 0.17 ) ; and to 0.65 units / kg with mmf alone versus 0.62 units / kg among control subjects ( p = 0.68 ) ( fig . \n there were 19 serious adverse events ( aes ) reported for 14 subjects ( 34% ) in the mmf and dzb group , nine in five subjects ( 16% ) in the mmf alone group , and three in three subjects ( 7% ) in the control group ( online appendix table 1 ) , p < 0.01 . \n more grade 2 or higher aes occurred in mmf plus dzb subjects ( 167 or 4.1 events / subject ) compared with mmf alone ( 117 , 3.8 events / subject ) or control subjects ( 133 , 3.2 events / subject ) , p = 0.09 ( online appendix table 1 ) . \n contrary to expectations , there was no difference in the occurrence of infectious or gastrointestinal events among groups . \n eight individuals had asymptomatic reactivation of previous ebv infection using a sensitive pcr assay ( five in mmf plus dzb , one in mmf , and two in control ) . \n neutropenia and leukopenia , both side effects of mmf and dzb , occurred approximately equally among the three groups . a slight excess of elevated liver enzymes occurred in the mmf plus dzb group . \n major hypoglycemic events were reported for 27 subjects , with an average of two each , with no difference among groups . \n the aim of the present study was to arrest -cell destruction in recently diagnosed type 1 diabetic subjects when preservation of existing -cells may have a clinically meaningful effect on long - term outcomes of type 1 diabetes . \n we found no treatment benefit from either mmf alone or from the combination of mmf and dzb in this randomized , masked , placebo - controlled trial . \n although mmf has been effective in combination with other anti - rejection drugs ( such as sirolimus and tacrolimus ) in a number of transplant protocols ( 11 ) , alone it may not have as much effect on effector cells , which can damage and kill islets without requiring cell division , the primary mode of mmf action . \n although several studies have reported a potential negative effect of mmf on islet cell function , we did not see any greater loss of c - peptide in the mmf alone group compared with control subjects . for both mmf and dzb , we chose the lowest known effective doses of each . \n dzb has been shown to reduce recurrences in multiple sclerosis ( 15 ) and uveitis ( 16 ) when given monthly . \n our use of two doses of dzb may not have been sufficient to affect activated effectors cells in the pancreas even with mmf , despite reasonably good depletion / coating in the peripheral circulation . \n cyclosporine , which also affects the il-2 signaling pathway , was shown to be effective in past trials if given at high doses and early enough in the course of disease ( 22 ) . \n this , and the aforementioned effect of dzb in two other autoimmune diseases , suggests that the lower dose may have played a major part in the lack of effect of this therapy . although higher doses may have greater therapeutic effect , this has to be measured against the increased risk of side effects . even at the doses used in this study \n , there was an increase in aes when the two drugs were used together in comparison to mmf alone or placebo . \n cd4cd25 + regulatory t - cells play an important role in immune regulation and a potential problem with an anti - il-2 receptor antibody is worsening autoimmunity rather than reducing it if the effects of the drug on the regulatory cell population outweigh its effects on the activated - effector cell population . in this study \n we saw no worsening of -cell destruction or development of other autoimmune conditions with the use of dzb . \n while overall compliance with the mmf and dzb regimens was high , it is possible that the need to withdraw study drug , primarily mmf , for various intervals due to aes , may have affected the ability to demonstrate a beneficial effect . \n however , mechanistic assessments showed that mmf and dzb each were bioavailable and had the intended immunologic effects , but these effects were not associated with the c - peptide levels after 2 years . \n modified anti - cd3 antibodies have been shown to reduce the rate of loss of c - peptide in new - onset type 1 diabetic subjects similar to those studied in this trial ( 24 ) . \n mmf and anti - il-2r are downstream of the important major histocompatibility complex - peptide / t - cell receptor interaction , which is the driver of the autoimmune response . \n therapies such as anti - cd3 and anti - cd20 as well as antigens such as gad , oral insulin , and diapep277 may have the potential to alter this critical reaction and blunt the direct activation of autoreactive t - cells rather than limit their activity and division , which is where mmf and dzb are most critical . \n one additional difference between this study and the cyclosporine trials ( 22 ) that had been successful was that the time to treatment was 56 days with anti - cd3 versus 76 days in this study . \n post hoc analysis did not reveal this to be a factor in the failure to see an effect and probably suggests that more targeted therapy at sufficient dose is necessary to arrest the diabetes process . \n new therapies such as diapep277 in adults ( 23 ) or gad immunization ( 24 ) have recently been shown to slow the rate of loss of c - peptide , and others are under study such as anti - cd20 , abatacept , and thymoglobulin . although we were concerned with the number of adverse events that might occur from the use of immunosuppressive agents , it is clear from our analysis that the number and type we detected were for the most part within our prestudy expectations and did not prevent study subjects from continuing treatment . \n the finding of asymptomatic low - level pcr reactivation of ebv in both treated and untreated patients was unexpected and may reflect the differential sensitivity of our ebv viral pcr assay as well as our rigorous screening program to ensure patient safety . \n type 1 diabetes trialnet is an national institutes of health ( nih)-sponsored multicenter trial group formed to perform intervention trials in new - onset type 1 diabetes and pre - diabetes , as well as to develop immunologic and mechanistic assays to better understand type 1 diabetes pathogenesis . \n proposed studies are rigorously reviewed for scientific and ethical justification , clinical feasibility and prioritization by a diverse group of clinicians , basic scientists , statisticians , and ethicists ( 25 ) . \n trials are monitored by metabolic , infectious disease , and safety monitoring committees in addition to oversight by an independent dsmb . \n although this trial was unsuccessful at finding new therapies to induce clinical remission in type 1 diabetes , it showed that our network can successfully design , recruit , and conduct clinical trials of sufficient size . \n the use of novel agents , alone or in combination , will be facilitated by the clinical trial process developed for this first trial under the trialnet mechanism . \n ", "role": "user" }, { "content": "objectivethis trial tested whether mycophenolate mofetil ( mmf ) alone or with daclizumab ( dzb ) could arrest the loss of insulin - producing -cells in subjects with new - onset type 1 diabetes.research design and methodsa multi - center , randomized , placebo - controlled , double - masked trial was initiated by type 1 diabetes trialnet at 13 sites in north america and europe . \n subjects diagnosed with type 1 diabetes and with sufficient c - peptide within 3 months of diagnosis were randomized to either mmf alone , mmf plus dzb , or placebo , and then followed for 2 years . \n the primary outcome was the geometric mean area under the curve ( auc ) c - peptide from the 2-h mixed meal tolerance test.resultsone hundred and twenty - six subjects were randomized and treated during the trial . \n the geometric mean c - peptide auc at 2 years was unaffected by mmf alone or mmf plus dzb versus placebo . \n adverse events were more frequent in the active therapy groups relative to the control group , but not significantly.conclusionsneither mmf alone nor mmf in combination with dzb had an effect on the loss of c - peptide in subjects with new - onset type 1 diabetes . \n higher doses or more targeted immunotherapies may be needed to affect the autoimmune process .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: asymmetrical foot placement affects the center of gravity \n ( cog ) trajectory during the sit - to - stand motion , with trunk displacement toward the foot \n placed behind2 . \n however , the reason for \n this bias in the cog trajectory toward the backward lower limb is unknown . \n there are many studies examining the sit - to - stand motion in patients with hemiparesis3,4,5,6,7,8,9,10,11,12,13,14,15 . \n asymmetry was observed in these studies , \n with the center of pressure greatly deviating toward the unaffected side . however , when the \n affected foot was placed behind the unaffected foot , near symmetry was obtained . \n when \n choosing therapeutic exercises , physical therapists utilize this phenomenon to treat \n patients with hemiplegia16,17,18 . however , the \n reason for the achievement of near - symmetry when the affected foot is placed behind the \n unaffected foot is not understood . human movement , such as bipedal walking , \n is influenced by energy expenditure19 . to elucidate whether bipedal walking is a \n more economical form of movement \n , scholars have examined the energy expenditure of human \n locomotion relative to that of other mammalian species . \n comparative analyses indicate that \n at walking speeds , humans expend significantly less energy than most quadrupeds20 . \n it is believed that energy expenditure \n strongly influences the formation of the cog trajectory during motion . \n in contrast to studies of energy expenditure during walking , when the duration of motion is \n short , the energy cost can not be measured with oxygen consumption . flash and hogan21 suggested that the minimization of the \n mean - squared jerk is a mathematical model of one movement objective , i.e. , the production of \n smooth , graceful movements . \n the concept of movement economy requires \n some jerk costs to be associated with muscular exertion in movement , with the goal of \n minimizing some measure of cost within the limits of constraints22 . \n moreover , some studies indicate that the jerk cost \n influences the coordination of arm movements21 , 23 , 24 . \n the purpose of this study was to examine the relationship between the jerk cost and the \n formation of the cog trajectory during a sit - to - stand motion with asymmetrical foot \n placement . \n this study included 19 male volunteers ( mean age : 21 1 years , height : 172.3 5.9 cm , \n body mass : 66.0 9.0 kg ) . \n all subjects provided written informed consent prior to \n participation , and the study was approved by the human subjects ethics committee of tohoku \n bunka gakuen university . \n the height of the seat was set as the distance from the floor surface to the caput fibulae \n using 0 degrees of dorsiflexion ( fig . \n the subjects moved from a sitting position to a standing position under two \n different foot placement conditions : ( 1 ) 0 degrees of dorsiflexion on the non - dominant side \n and 20 degrees of dorsiflexion on the dominant side ( p1 ) and ( 2 ) 20 degrees of \n plantarflexion on the non - dominant side and 20 degrees of dorsiflexion on the dominant side \n ( p2 ) . \n the \n distance between the left and right foot in the frontal plane was matched with the length \n between the left and right anterior superior iliac spines . \n the subjects stood under two \n movement conditions : ( 1 ) natural movement ( n - m ) and ( 2 ) instructed movement ( i - m ) , with \n instructions to increase weight bearing on the non - dominant side . \n asymmetrical foot placement conditions df : dorsiflexion ; pf : plantarflexion reflective markers were placed bilaterally on the tip of the acromion process , the greater \n trochanter , the lateral femoral epicondyle , and the lateral malleolus of each subject . \n marker positions were recorded using a locus system ( ma-5000 , anima , japan ) at a sampling \n frequency of 250 hz . \n two force plates ( mg-1090 , anima , japan ) were used : a chair was set on \n one of the force plates and the subjects placed both feet on the other . \n the start and the end of a movement were defined as the time at which the angular velocity \n of the left hip joint movement exhibited its first and second zero - crossings , respectively . \n marker \n positions were used to calculate joint angles , from which the angular velocity was \n calculated . \n the cog was calculated using marker positions , and then the cog velocity , \n acceleration , and jerk21 were computed . \n the anthropometric data described by winter25 were used to calculate the cog . the cog trajectory and its jerk \n cost \n were calculated at each axis : front and back ( x - axis : jerk x ) , right and left ( y - axis : \n jerk y ) , and vertical ( z - axis : jerk z ) . \n the equation of the jerk cost is shown below : : jerk , a : acceleration , t : \n duration the start of a movement was defined as the time at which the flexional angular velocity of \n the hip joint on the non - dominant side crossed the threshold value of 1.5 \n degrees . \n the end of a movement was defined as the time at which the \n extensional angular velocity of the hip joint on the non - dominant side fell below 1.5 \n degrees . \n moreover , the time at which the floor reaction force of the seat \n side reached zero was considered the lift - off time , i.e. , the time when the buttocks lifted \n from the seat . \n the cog displacement along the y - axis was calculated from the difference \n between the start position and the lift - off position . \n the parameters were calculated using \n an original matlab program ( 2014b , mathworks ) . \n paired t - tests were used to compare the differences in each parameter between n - m and i - m \n at each foot placement condition . \n differences were assessed using two - sided tests , with an \n alpha value of 0.05 . \n table 1table 1.comparison of parameters between movement conditions at each foot \n placementunitp1p2n - mi - mn - mi - mdurations2.66 0.37 2.99 0.30 2.79 0.50 3.02 0.35 lift - off times1.04 0.18 1.18 0.22 1.15 0.30 1.12 0.18 lift - off time / duration%39.6 5.8 39.6 6.1 40.9 5.4 37.3 5.9 cog displacementcm1.3 \n 0.8 3.9 1.6 2.9 1.3 1.9 1.3 jerk xms10.1 3.5 12.0 5.3 11.0 3.8 17.4 9.1 jerk yms1.1 0.8 2.3 1.1 1.6 0.8 4.0 1.5 jerk zms24.0 12.0 23.2 16.1 25.0 15.4 28.9 20.4 maximum hip angledeg112.1 7.4 118.2 6.3 115.2 6.8 124.4 7.6 maximum hip angular velocitydegs70.2 12.1 80.3 12.2 76.6 11.5 91.8 15.0 p1 : 0 degrees of dorsiflexion on the non - dominant side and 20 degrees of dorsiflexion \n on the dominant sidep2 : 20 degrees of plantarflexion on the non - dominant side and 20 degrees of \n dorsiflexion on the dominant sidei - m : instructed movement , with instructions to increase weight bearing on the \n non - dominant sidelift - off time : the time that the buttocks lifted from the chaircenter of gravity ( cog ) displacement : positive values indicate displacement toward \n the non - dominant side1 non - dominant sidep<0.05 , p<0.01 shows the duration , lift - off time , cog displacement , jerk - x , jerk - y , jerk - z , \n maximum hip joint angle , and maximum hip joint angular velocity for all conditions . \n p1 : 0 degrees of dorsiflexion on the non - dominant side and 20 degrees of dorsiflexion \n on the dominant side p2 : 20 degrees of plantarflexion on the non - dominant side and 20 degrees of \n dorsiflexion on the dominant side i - m : instructed movement , with instructions to increase weight bearing on the \n non - dominant side lift - off time : the time that the buttocks lifted from the chair center of gravity ( cog ) displacement : positive values indicate displacement toward \n the non - dominant side the duration and lift - off time were significantly longer for i - m than n - m in p1 ( p < \n 0.01 ) . however , there was no significant difference in the duration or lift - off time between \n i - m and n - m in p2 . \n however , although the ratio of the lift - off time to the duration in p1 \n was not significantly different between i - m and n - m , this ratio was greater with n - m than \n i - m in p2 ( p < 0.05 ) . in p1 , \n the cog displacement upon lift - off during n - m was 1.3 0.8 cm , toward the dominant \n side , and during i - m was 3.9 1.6 cm , toward the non - dominant side . \n in contrast , in p2 , the \n cog displacement upon lift - off during n - m was 2.9 1.3 cm and during i - m was 1.9 1.3 cm . \n during n - m , the cog of all subjects displaced to the dominant side in both postures . \n both the maximum hip joint angle and the maximum hip joint angular velocity were \n significantly higher during i - m than n - m for both postures ( p < 0.01 ) . \n moreover , jerk - x \n and jerk - y were significantly larger during i - m than n - m for both postures ( p < 0.01 ) . \n jerk - z was not significantly different between i - m and n - m for both postures . \n when the subjects stood up from the chair using n - m , the cog trajectory shifted toward the \n dominant side of the lower extremity . \n the jerk cost \n in both the right - left and front - back directions were significantly larger during i - m than \n during n - m . \n thus , the jerk cost increases when the subject intentionally changes the cog . in \n particular , in the front - back direction , the increase in the jerk cost resulted from an \n increase in the hip joint angular velocity . \n similarly , the fast movement of the trunk is \n thought to influence the increase in the jerk cost in the right - left direction . \n nelson22 explained that the trajectory \n is formed based on the principle of minimum energy expenditure within the limits of \n constraints . \n therefore , the jerk cost influences the formation of the cog trajectory during \n sit - to - stand motion with asymmetrical foot placement . \n schneider23 reported that hand - trajectory smoothness changed during \n the practice of a motor task in which smoothness was quantified by jerk cost ; namely , the \n total jerk cost and the magnitudinal and directional jerk - cost components were significantly \n less when the slowest hand movements were compared after practice versus during \n practice . \n gillette and stevermer2 also reported \n that utilizing asymmetric foot placement during a sit - to - stand motion resulted in increased \n ankle plantarflexion and knee extension in the posteriorly placed limb and decreased ankle \n plantarflexion and knee extension in the anteriorly placed limb . \n it is thought that the \n increase in the torque of the posteriorly placed limb was caused by an increase in weight \n bearing . in the present study , weight bearing on the posteriorly placed limb occurred on the \n dominant side , and it increased during the natural sit - to - stand motion in both positions . \n however , it is thought that the total cost was low compared with the increased weight \n bearing of the anteriorly placed limb . \n fleckenstein et al.26 reported that during a sit - to - stand motion with a symmetrical foot \n position , the maximum hip flexion torque increased more when using 75 degrees of knee \n flexion than when using 105 degrees of knee flexion . \n the activity of the erector spinae also \n increased when using 90 degrees of knee flexion in the symmetrical position27 . \n one limitation of this study is that it was difficult to strictly control the duration of \n the movement . \n therefore , the duration was significantly different between i - m and n - m at p1 . \n this difference may have slightly influenced the jerk cost , because the jerk cost is a \n function of time . in conclusion \n , our results suggest that the energy cost influences the formation of the cog \n trajectory during sit - to - stand motion with asymmetrical foot placement . \n moreover , these \n results suggest that rising from a chair with asymmetrical foot placement may be useful for \n treating stroke patients with affected lower limbs .", "role": "user" }, { "content": "[ purpose ] the purpose of this study was to examine the relationship between jerk cost and \n the formation of the center of gravity trajectory during sit - to - stand motion with \n asymmetrical foot placement . \n [ subjects ] nineteen male volunteers were included ( age : 21 \n 1 years ) . \n [ methods ] the subjects moved from a sitting position to a standing position \n under two different foot placement conditions : ( 1 ) 0 degrees of dorsiflexion on the \n non - dominant side and 20 degrees of dorsiflexion on the dominant side ( p1 ) and ( 2 ) 20 \n degrees of plantarflexion on the non - dominant side and 20 degrees of dorsiflexion on the \n dominant side ( p2 ) . \n two standing conditions were used : ( 1 ) natural movement and ( 2 ) \n instructed movement , with instructions to increase weight bearing on the non - dominant \n side . \n the center of gravity trajectory and its jerk cost were calculated at each axis : \n front and back ( jerk - x ) , right and left ( jerk - y ) , and vertical ( jerk - z ) . [ results ] jerk - x \n and jerk - y were significantly larger during instructed movement than natural movement in \n both p1 and p2 . \n jerk - z was not significantly different between instructed and natural \n movement in p1 or p2 . \n [ conclusion ] these results indicate that energy cost influences the \n formation of the center of gravity trajectory during sit - to - stand motion with asymmetrical \n foot placement .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: nowadays , a remarkable increase has been reported in the incidence of non - carious lesions in the general population . \n factors such as bulimia , gastric acid reflux and frequent acidic diet exposure play an important role in the development of dental erosion [ 25 ] . \n there is a global increase in the ingestion of acidic beverages , such as soft drinks and fruit juices especially by young children . \n a high drinking rate of non - alcoholic beverages in iran is one of the main causes of dental erosion . \n it was reported that the annual drinking of beverages in iran is 48 litres per person per year that is equal to 144 bottles per person which is relatively a high rate . \n attempts were performed to decrease the side effects of these beverages and to introduce types of light and regular drinking . \n the ability of acidic soft drinks in producing dental erosion is related to factors such as acid type containing , titratable acid , buffered capacity and the temperature of the drink . \n it appears that this factor may influence the loss of hard tissues of the tooth at the cervical third . \n there are various evaluation techniques , such as profilometry , atom force microscopy , scanning electron microscopy , micro - radiography , iodide permeability and the micro - hardness test for measuring the loss of dental hard structures and softening of tooth tissues by erosive processes , [ 1114 ] . \n the micro - hardness technique is often used for measuring surface hardness of dental hard tissues . \n early stages of dental hard tissue dissolution that result in tooth surface weakening can be well determined by hardness measurement techniques . since there is no definitive information about the effects of varied temperatures of beverages in dental erosion ; therefore , the present study was designed to evaluate the effect of common diet and regular coca - cola on enamel erosion in cold and room temperatures . \n thirty eight intact human maxillary premolars that were extracted during the previous two months were collected from dental centers and private offices . the teeth were cleaned with pumice - water slurry using bristle brushes in a low - speed handpiece . \n the teeth were stored in 0.5% chloramine - t solution at room temperature to prevent bacterial growth until the next step . \n then , they were examined with a stereomicroscope to discard those with cracks , fractures or structural abnormalities that could interfere with the results . \n the crown of each tooth was removed at the cement - enamel junction with the water - cooled diamond saw of a precision sectioning machine ( miniton ; struers a / s , copenhagen , denmark ) . \n subsequently , the crowns of the teeth were sectioned into two labial and palatal parts . \n the prepared specimens were fixed in self - cured acrylic resin ( acropars , kaveh , tehran , iran ) so that the complete tooth was embedded in acrylic resin except for the enamel area leaving a circular enamel area ( 3 mm in diameter ) on the flattest region . to prevent dehydration , \n the teeth were kept in de - ionized water until the beginning of the tests . \n the specimens in groups 1 and 2 were immersed in the regular beverage ( coca - cola trademark regd . , \n khoshgovar co. , tehran , iran ) at room ( 20 c ) and refrigerator ( 2 c ) temperatures , respectively for 20 minutes , 3 times per day for 7 days . \n enamel surfaces were kept in synthetic saliva ( potassium : 20 meq / lit , chloride : 27.4 meq / lit , sodium : 0.22 mg , magnesium : 1.5 mg , calcium : 0.6 mg , fluoride : 0.5 mg , phosphorous : 0.21 mg , hydroxy propyl methyl cellulose 3% ) between each immersion cycle as well as the complete resting time . in groups 3 and 4 , \n khoshgovar co. , tehran , iran ) in room and refrigerator temperatures , respectively similar to groups 1 and 2 . \n specimens in control subjects ( group 5 ) were placed in synthetic saliva at room temperature for 7 days . in this study , \n vickers test was applied for at least 3 points with 500 gr force for 5 seconds by micro - hardness tester ( micrometer 1 , buehler , lake bluff , il , usa ) . \n the mean of micro - hardness values for points were considered for the micro - hardness value of each sample . \n the ph value of regular and diet beverages were measured with a digital ph meter ( accumet 925 ph / ion meter , fisher scientific , pittsburgh , pa ) and acid titration for both beverages was performed . \n the mean and standard deviations of micro - hardness values of the studied groups are summarized in table 1 . \n group 2 showed the highest microhardness values and the lowest ones were seen in group 4 . \n two - way anova for the studied groups showed a significant difference in the beverage type as the main factor ( p=0.017 ) , but temperature factor ( p=0.089 ) and its interaction effect on enamel hardness showed no significant difference ( p=0.719 ) . \n tukey test showed that there were significant differences between control and diet groups as well as regular and diet groups ( p<0.05 ) . \n in the present study , the effect of diet and regular coca cola beverages on enamel micro - hardness in room and cold temperature was evaluated . \n the micro - hardness test , a valid test in the previous studies [ 1618 ] , was used to measure enamel loss . \n enamel and dentin dissolution and surface softening in early stages may be determined by this test . \n the micro - hardness method has been previously used in several studies to determine enamel erosion [ 1 , 16 , 19 ] . in this study , \n vickers test was designed using a diamond tip indentation and known geometrical dimensions for a special load and duration . \n micro - indentations for determining erosive variations in the surfaces have been performed with different forces . \n because of the capability of the loading machine used , 500 gram force was selected for testing in the present study while different forces have been used in other studies [ 1 , 19 , 20 ] . due to presence of slight variations in the nature of substra , micro - hardness was measured from 3 to 5 points . regarding immersion and rinsing cycles , torres immersed the specimens for 5 minutes in 75 ml of the beverage , 3 times a day with 4-h intervals between the immersion cycles , during a 60-day experimental period . in another study , \n van eygen immersed the enamel surfaces in the groups in coca - cola at different frequencies : 1 , 2 , or 3 times per day for 20 minutes each for 7 days . \n the specimens in the experimental groups in this study were immersed in diet and regular coca - cola for 7 days . \n this is the approximate total exposure time in the mouth per each year for everyone except those who sip soft drinks continuously . \n the findings of the present study showed that both studied beverages can potentially erode the enamel surfaces after immersion cycles . \n regular beverage did not show any significant difference in comparison with the control group , but the diet type showed a considerable significant difference in terms of enamel softening . \n these results are in opposition with the study performed by rios et al . who indicated diet cola promoted less enamel wear than regular cola . \n it can be explained that erosion might be related to some of its characteristics , such as its lower ph , buffering capacity and titratable acidity . \n ph measurement of both beverages showed that there were no considerable differences between this value . \n although regular beverages contain more phosphoric acid , the erosive potential of diet coke is more pronounced due to the presence of citric acid . \n citric acid acts as a chelator that binds to the minerals of the hydroxyappetite such as calcium . \n it seems that in the oral environment , the greater the titratable capacity of the beverage , the longer it causes saliva to neutralize the acid . \n it is predicted that erosion is more severe at high temperatures and reduced at low temperatures , because the solubility of solutes depends on temperature and heat is required to break the bonds holding the molecules in the solid together . \n banan and hedge observed that frozen and refrigerated acidic juices caused more decrease in plaque and salivary ph than juices in room temperature . \n ferreira concluded that with a decrease in the temperature of dairy beverages , their ph is reduced . \n eisenburger and addy also confirmed the results of the study conducted by ferreira and pozzobon . \n temperature had no considerable effect on hardness in all experimental groups of the present study . \n it seems that under the conditions of this study , temperature did not alter ph beverages significantly . \n arbour , also showed there were no significant differences between enamel softening and erosion caused by soft drinks at a range of temperatures . in the present study , a cycling model for simulation of physiological conditions \n complete simulation of oral condition is difficult since pellicle on tooth surfaces affects the erosive destruction induced by acidic solutions . \n furthermore ; some factors such as tooth brushing or tongue movement in the oral cavity may have an additive abrasive influence on erosively altered dental hard tissues . \n therefore , it should be noted that the findings observed in the present study may not reflect the in vivo situation , which was a limit for this study . \n the cycling model was compatible with the study performed by van eygen et al . . \n in order to simulate the oral cavity conditions , future in vivo studies are recommended . \n in addition , the exposure time was limited , ; therefore , we recommend other studies with long term exposure times in order to obtain more accurate findings . \n within the limits of this study , it may be concluded that : \n the diet coca - cola is more erosive than the regular type.temperature of the used beverages had no significant influence on enamel erosion . the diet coca - cola is more erosive than the regular type .", "role": "user" }, { "content": "objective : this study compared diet and regular coca - cola on enamel erosion in cold and room temperatures.materials and methods : seventy five enamel specimens were prepared and divided into 5 equal groups ( n=15 ) as follows : group 1 : regular beverage at room temperature , group 2 : regular beverage at refri - gerator temperature , group 3 : diet beverage at room and group 4 : diet beverage at refrige - rator temperature . the specimens were immersed in the regular or diet beverage ( coca - cola , trade mark regd . \n khoshgovar co. , tehran , iran ) at room ( 20c ) or refrigerator ( 2c ) temperatures for 20 minutes , 3 times per day for 7 days . \n specimens in the control subjects ( group 5 ) were placed in synthetic saliva at room temperature for 7 days . \n the hardness of specimens was tested using vickers test under 500 gr loads for 5 seconds . \n the data were analyzed using two - way anova and tukey tests.results:the mean and standard deviations of micro - hardness values of the studied groups were as follow : g1 : 304.2629.71 , g2 : 285.5342.14 , g3 : 279.0639.52 , g4 : 266.8023.98 and g5 : 319 30.79 . \n there was a significant difference in the beverage type as the main factor ( p<0.05 ) , but temperature factor and their interaction effect on enamel hardness showed no significant difference ( p>0.05 ) . \n tukey tests showed that there were significant differences between control and diet groups as well as regular and diet groups.conclusion:diet coca - cola is more erosive than the regular type and the temperature of the beverages used had no significant influence on enamel erosion .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the hemostatic system has evolved to maintain blood in a fluid state under physiological conditions , but also to react rapidly to vessel injury by sealing defects with fibrin clots . \n thrombosis , the primary cause of heart attacks and strokes , is thought to occur when natural anticoagulant mechanisms , which help restrict the clot to the site of injury , are genetically impaired or are overwhelmed by the severity of the initial injury . \n platelets are critical for hemostasis both for the formation of blood clots , as platelet aggregates are an essential constituent of the arterial thrombus , and as a platform for activation of coagulation proteins . \n however , this commentary will focus predominantly on the coagulation system a network of sequentially activated plasma serine proteases that trigger the production of fibrin , the protein that forms the meshwork of the clot . normal blood clotting and thrombosis \n are thought to occur by the same pathway . in this issue , however , kleinschnitz et al . \n ( p. 513 ) show that fxii is required for thrombosis but is dispensable for normal clotting ( 1 ) , suggesting that the mechanisms regulating these two processes are not identical . \n in the current view of physiological blood coagulation , the formation of fibrin can be initiated through either of two converging cascades : the extrinsic pathway and the intrinsic pathway ( fig . \n the extrinsic pathway is triggered when circulating factor vii ( fvii ) binds to its membrane - bound receptor tissue factor ( tf ) . \n tf is expressed on subendothelial layers of blood vessels and on extravascular cells and thus is only exposed to the blood when the normal vasculature is disrupted ( 2 ) . \n tf complex then cleaves factor x ( fx ) into its active form ( fxa ) . \n fxa associates with factor v ( fv ) to form prothrombinase , which converts prothrombin to thrombin . \n the extrinsic pathway is initiated by the binding of fvii to tf which results in the autoactivation of fvii ( fviia ) . \n the activation of this pathway ultimately leads to the formation of thrombin , which feeds back to activate fxi on the surface of platelets . \n the intrinsic pathway is triggered by the activation of factor ix ( fix ) , which is mediated by the tf \n factor xi ( fxi ) , a clotting factor upstream of fix that is expressed on activated platelets , can be directly activated by thrombin and thus feeds into the intrinsic pathway ( 4 ) . \n fxi then activates fix to fixa , which in turn activates fx in the presence of factor viii ( fviii ) . \n the end result is a burst in the production of thrombin and the promotion of clot formation . \n hereditary deficiencies in proteins of the extrinsic pathway ( fvii ) , the intrinsic pathway ( fxi , fix , fviii ) , or proteins common to both pathways ( fx , fv , prothrombin ) impair blood clotting in vivo and lead to hemorrhagic disorders , thus demonstrating that both the extrinsic and intrinsic pathways of coagulation are essential for hemostasis . \n the intrinsic pathway can also be activated in vitro by the autoactivation of fxii , for which the primary substrate is fxi . \n thus , fxii , which has been studied for over 50 years , was long considered dispensable for clotting in vivo . \n but two new studies now challenge this assumption ( 5 ) . in a recent issue , renne et al . showed that fxii - deficient mice , like humans , have normal hemostasis and no bleeding abnormalities . \n based on these results , the authors concluded that fxii is required only for pathologic coagulation and not for hemostasis ( 5 ) . in this issue , a report from the same group strengthens this hypothesis . \n ( 1 ) demonstrate that mice lacking fxii , or mice treated with a small molecule inhibitor of fxii , are protected against the development of ischemia - induced brain infarction ( stroke ) after cerebral artery occlusion ( 6 ) . again \n , the protection was specifically caused by the fxii deficiency , as reconstituting the fxii - deficient mice with human fxii reversed the protective effect . \n fxi - deficient mice were also protected against stroke and both the fxi- and fxii- deficient mice had reduced ischemia - induced fibrin accumulation in the brain compared with wild - type mice , suggesting that the thrombosis - inducing effects of fxii are mediated through fxi and the intrinsic pathway . \n it is interesting to note that some people with hereditary deficiencies in fxi , unlike those lacking fxii , suffer from mild bleeding disorders , suggesting that fxi is required for hemostasis and can be activated independently of fxiia . \n as mentioned previously , thrombin can cleave and activate fxi ( 4 ) , which can then convert fix to fixa in the coagulation cascade ( 7 ) . \n the ability of thrombin to activate fxi might explain why fxii is not required for physiological hemostasis . \n although these new data clearly demonstrate a requirement for the activation of fxi , fxii might act on other substrates that also play an essential role in pathological thrombosis . \n in thrombotic conditions , such as sepsis- induced disseminated intravascular coagulation ( dic ) , bacterial endotoxin or proteoglycans may activate fxii . \n in addition , polyphosphates that are released upon platelet degranulation can also activate fxii , thus accelerating coagulation ( 8) . activated fxii can cleave fvii to an activated form , which is identical to that produced by fxa in the extrinsic pathway . \n but unlike fxa , which eventually digests and inactivates the fviia that it produces , activated fxii produces a stable form of fviia ( 9 ) \n . the availability of even a small concentration of fviia can markedly accelerate the extrinsic pathway by two different mechanisms ( fig . \n the first is through the normal autoactivation pathway of fvii in the presence of exposed vascular tf , as occurs during physiological blood clotting . \n the autoactivation of fvii requires a conformational change in fviia that occurs upon binding to tf . by cleaving fvii \n , fxiia provides the initial few molecules of fviia that are needed to trigger for the exponential explosion of this autocatalytic cascade . \n the effectiveness of factor viia in triggering this cascade is evident in the successful use of recombinant fviia to treat bleeding episodes and during surgery in patients with hemophilia ( 1012 ) . \n pathological thrombosis fxii is activated by exposure to negatively charged molecules to factor xiia ( fxiia ) . \n factor xiia also hydrolyzes fvii to fviia , which combines with tf on the surface of activated monocytes or vascular cells to initiate the extrinsic system . \n both coagulation pathways are required for pathological thrombosis as occurs during stroke and disseminated intravascular coagulation . \n the second mechanism by which fxiia - mediated activation of fvii can accelerate the extrinsic pathway is through interaction of fvii and tf that is exposed on activated circulating monocytes . \n a progressive generation of thrombin during surgery is responsible for the thromboembolic and bleeding complications associated with these operations . during these procedures , \n monocyte activation triggers an increase in the expression of integrins on the cell surface and the synthesis of tf ( 13 , 14 ) . \n substantial concentrations of tf rapidly appear in the pericardial fluid during cardiopulmonary bypass surgery , and the production of tf is accompanied by thrombin formation ( 15 ) . in the presence of tf , activated monocytes convert all available fvii to fviia . \n we have recently demonstrated a second mechanism by which soluble tf can generate fviia in the presence of fvii and activated monocytes ( 16 ) . \n as the velocity of the reaction that produces fviia is proportional to the concentration of fvii available , the presence of additional fviia , such as that produced by fxiia , would potentiate the extrinsic pathway . as mentioned previously \n , fxiia can also activate fxi to fxia on the surface of activated platelets in the intrinsic pathway . \n fixa , in the presence of fviii , activates fx the convergence point in the extrinsic and intrinsic pathways ( fig . \n 2 ) . activated monocytes and platelets are present during pathological thrombosis ( such as dic ) , suggesting that these mechanisms most likely operate in a wide range of inflammatory conditions . \n activated fxii ( fxiia ) also triggers the production of vasoactive peptides known as kinins . \n this pathway called the contact system is triggered by the slow autoactivation of fxii ( 17 ) that occurs when fxii is exposed to negatively charged surfaces such as the membranes of activated blood cells . \n kallikrein then activates fxii ( thus amplifying the pathway ) and also cleaves high molecular weight kininogen into the potent hypotensive peptide bradykinin ( 18 ) . whether the contact system contributes to fxii - driven thrombosis in models of stroke and arteriole injury \n however , previous work on another model of pathologic coagulation , dic , suggests that the contact system might not be involved in the hemostatic defect ( 19 ) . \n dic is a syndrome in which thrombin is produced in excess of antithrombin and exerts its actions systemically rather than locally ( 20 ) , resulting in the formation of fibrin thrombi in the microvasculature . \n dic occurs in humans with bacterial septicemia , a disorder that is often accompanied by hypotensive shock . \n my group has shown that fxii is activated in these patients , suggesting that this factor might play a role in the development of hypotension associated with septicemia - induced dic ( 21 ) . in a baboon model of sepsis , a monoclonal antibody to fxii prevented the development of irreversible hypotension , likely caused by the inhibition of bradykinin release . however , the anti - fxii antibody had no impact on the development of dic . \n thus , the hypotension , but not the hemostatic abnormality , appeared to be related to fxii - dependent activation of the contact system . \n however , these results do not rule out a role of the contact system in pathologic coagulation because the human fxii - specific antibody only neutralized 60% of baboon fxii . \n thus , the residual fxii may have been sufficient to support dic in this model . \n future studies will be required to determine whether the contact pathway contributes to thrombus formation in other models of pathological coagulation . \n the selection of anticoagulant therapy whether for venous thrombembolism or arterial thrombosis ( myocardial infarction or stroke)is based on how well the drug inhibits thrombosis and on the extent of the bleeding side effects . the discovery that fxii deficiency protects against thrombosis without causing spontaneous bleeding makes fxii a unique and ideal target for drug design . \n carefully performed experimental studies followed by controlled prospective clinical trials are required to validate this new hypothesis .", "role": "user" }, { "content": "factor xii ( fxii ) , a clotting enzyme that can initiate coagulation in vitro , has long been considered dispensable for normal blood clotting in vivo because hereditary deficiencies in fxii are not associated with spontaneous or excessive bleeding . \n however , new studies show that mice lacking fxii are protected against arterial thrombosis ( obstructive clot formation ) and stroke . \n thus , fxii could be a unique drug target that could be blocked to prevent thrombosis without the side effect of increased bleeding .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: differential diagnoses for the relatively rare nasopharyngeal cysts include tornwaldt s disease , rathke s cleft cyst , intra - adenoid cyst , branchial cysts , and \n pseudocysts.1 here we report a case in which the presence of nasopharyngeal cysts was indicated as hampering nasal continuous positive airway pressure ( ncpap ) treatment of refractory obstructive sleep apnea syndrome ( osas ) . \n nasopharyngeal cysts are comparatively rare , and most do not exhibit themselves but are found incidentally . \n however , various symptoms , such as nasal congestion , apnea , and hearing loss , may be exhibited depending on the developing site due to increasing cyst diameter.1 diagnosis is often difficult and is comprehensively determined by the site of occurrence , characteristics of the cyst surface , and tissue findings . \n tornwaldt s disease , rathke s cleft cyst , pharyngeal tonsil central fossa cyst , branchial cysts , and pseudocysts are raised as differential diagnosis.2 the frequency of occurrence of nasopharyngeal cysts has not been previously mentioned , but in one report it was observed that this occurs in 1.4%3.3% cases of tornwaldt s disease by autopsy.3 moreover , according pathophysiological findings , nasopharyngeal cysts can be classified as congenital when occurring in the pharyngeal bursa vestigial remnant or rathke s pouch , or as acquired as a result of infection or surgery.4 we recently encountered a case that suggested nasopharyngeal cysts as the cause of treatment - resistant osas . here , we report it including bibliographic considerations . \n a woman in her 50s was referred to the otorhinolaryngology department , kyorin university , with the chief complaint of nasal congestion and pharyngeal discomfort . \n her weight and height were 70.0 kg and 153 cm , respectively , with a bmi of 29.9 kg / m . \n the patient had been experiencing nasal congestion for approximately 20 years , but had opted against seeking treatment . \n a local internist diagnosed the patient with sas in june 2010 , and initiated ncpap therapy . \n consequently , the patient experienced exacerbation of her nasal congestion , and chose to visit a local otolaryngologist . \n a tumor lesion was discovered in the patient s nasopharynx , and the doctor referred her to our department . \n the initial clinical findings following nasopharyngeal fiberscopy included the presence of an oval tumor with a grooved surface in the nasopharynx , which was not associated with the eustachian orifice ( fig . \n the results of laboratory blood analyses revealed no evidence of an inflammatory reaction . in order to examine the cause of the hypertension , serum levels of thyroid - stimulating hormone ( tsh ) , free thyroxine , free tri - iodothyronine , epinephrine , norepinephrine , dopamine , aldosterone , and renin were analyzed . \n cytological results of an aspiration biopsy indicated ciliated columnar epithelial cells with mildly enlarged nuclei . \n a culture of the cyst contents resulted in the detection of coagulase - negative staphylococci of 1 + , and staphylococcus aureus ( mssa ) of 1 + . \n noncontrast computed tomography ( ct ) imaging findings included the detection of a partially fluid - filled cystic lesion in the nasopharynx that had its base on the median part . \n a cystic lesion was detected by magnetic resonance imaging ( mri ) , the contents of which were hypointense and relatively hyperintense on the t1- and t2-weighted images , respectively ( fig . \n extirpation of the lesion was performed under general anesthesia . because no clear contents of the tumor lesion could be aspirated by centesis \n , the anterior wall of the tumor was dissected by forceps to allow removal of the contents . \n after debridement using a ktp laser to control the bleeding , the cyst was totally extirpated . \n the histopathological findings following hematoxylin eosin ( h&e ) staining included the detection of lymphoid tissue accompanied by expansion of the crypt , as well as inflammatory cell infiltration and follicular hyperplasia ( fig . \n the expression of cd4 , cd8 , cd20 , bcl-2 , and ckae1ae3 was evaluated using immunohistochemistry , and the results indicated the presence of cd20-positive b cells in the follicles , cd4-positive helper t cells in the interfollicular region , and cytokeratin in the lymphoepithelial symbiosis aspect of the crypt . \n also , the expression of cd8 and bcl-2 was detected , which indicated continued immune function of the pharyngeal tonsils in an individual over the age of 50 ( fig . \n 3c , d , e , f , and g ) . nonetheless , the association with the sacculation was unclear . \n thirty - three months following the operation , the patient s nasal congestion disappeared and she was able to get sound sleep . \n in addition , the patient s systolic blood pressure improved from 140160 to 120140 mmhg . however , her body weight and bmi increased to 72.3 kg and 30.9 kg / m , respectively . \n a polysomnography ( psg ) showed an apnea hypopnea index ( ahi ) of 26.6 before the operation . \n . however , ahi was still 26.4 , and we could not see any improvement . \n nasopharyngeal cysts are comparatively rare , and most do not exhibit themselves but are found incidentally . \n however , various symptoms , such as nasal congestion , apnea , and hearing loss , may show up depending on the developing site due to increasing cyst diameter.1 diagnosis is often difficult and comprehensively determined by the occurring site , characteristics of the cyst surface , and tissue findings.2 differential diagnoses for nasopharyngeal cysts include rathke s cleft cysts , pseudocysts , tornwaldt s disease , branchial cysts , intra - adenoid cyst , abscesses , and retention cysts ( table 1).2 a rathke s cleft cyst is a benign growth in the rathke s pouch , which is the opening of the craniopharyngeal duct to the pharynx during the embryonic period . \n rathke s cleft cyst is usually completely occluded by the second month of embryonic development . in most cases \n , the site of development is localized to the intrasellar region of the sella turcica , or the intrasellar and suprasellar regions , of which the latter accounts for 70% . \n further , the development of a rathke s cleft cyst in the suprasellar region is rare . \n ct findings have shown low attenuation areas in a majority of the cysts and capsular enhancement in nearly half of the cysts . however , calcification of the cysts is rare . \n mri findings have indicated that two - thirds of the cysts are hyperintensive , while the remaining one - third are hypointensive on the t1-weighted image , whereas about 50% are hyperintensive on t2-weighted images . \n however , many cases are asymptomatic , and the overall incidence is approximately 0.4%.5 pseudocysts are caused by brain hernias , teratomas , and meningiomas that escape from the persistent craniopharyngeal duct . \n pseudocysts can be differentiated from other cysts by using diagnostic imaging to confirm the contents . \n tornwaldt s disease is characterized by the presence of inflammation or an abscess of the embryonic remnant cyst in the area between the front end of the notochord and the nasopharyngeal epithelium between the bilateral anterior vertebral muscles on the posterior median nasopharyngeal wall . according to previous reports , tornwaldt s disease is more prevalent in individuals aged between 20 and 30 years , with overall incidence ranging from 0.2% to 5.0%.3 the lesion is located on the medial aspect of the nasopharynx and has a smooth surface . \n ct scans of the lesion reveal high attenuation areas because the cyst s contents often include blood and an elevated protein concentration . \n the lesion is hyperintensive on t1- and t2-weighted mri images , but gd contrast agents show no contrast effect . \n histopathologically , the lesion is covered with a respiratory epithelium without lymphoid tissue , and ranges in size from 2 to 30 mm in diameter.2 branchial cysts develop from remnants of the second branchial groove and are usually unilateral but occasionally bilateral . the difference between branchial cysts and other nasopharyngeal cysts \n bailey classified the cysts into four types based on the relative position of the cyst : sternocleidomastoid muscle , internal jugular vein , jugular vein , and the pharynx . among the different classes of branchial cysts , \n type iv is designated as a nasopharyngeal cyst.6 histopathologically , the lesions exhibit lymphocytic infiltration and the formation of lymph follicles . \n further , the lesion is hypointensive and hyperintensive on the t1-and t2-weighted mri images , respectively , but gd contrast agents show no contrast effect . \n intra - adenoid cysts are caused by mechanical or inflammatory occlusion of an embryonic groove ( central fossa ) on the pharyngeal tonsil before lymphoid tissues appear . \n histopathologically , crypts possess lymphoid tissue , and are characterized by columnar as well as squamous and columnar epithelium . in mri without contrast , the crypts appear hypointensive and hyperintensive on the t1- and t2-weighted images , respectively , whereas gd contrast agents exhibit no contrast . \n nevertheless , in many cases the intra - adenoid cysts are difficult to distinguish from tornwaldt s disease . \n for that reason , tornwaldt s syndrome , including intra - adenoid cyst and tornwaldt s disease , was proposed in a previous report.7 different types of nasopharyngeal cysts can be ascertained from the site of their development ( fig . \n 4 ) . rathke s cleft cysts are located in the cranial area . beneath them \n are intra - adenoid cysts , followed by tornwaldt s disease , and branchial cysts are located in the lowermost area among them . \n the cysts are characterized by their development on the medial wall of the nasopharynx , except for branchial cysts which develop on the lateral wall . in the present case , because the lesion was nasopharyngeal and cystic , and the contents were hypointensive on the t1- weighted mri images and relatively hyperintensive on the t2-weighted images , we ruled out rathke s cleft cysts . \n branchial cysts were also excluded because the basal portion of the cyst was located on the median of the nasopharynx , and a grooved surface was present according to the nasopharyngeal fiberscopy and ct findings . \n pseudocysts , tornwaldt s disease , and retention cysts were eventually ruled out because , according to the histopathological findings , the lesion possessed lymphoid tissue with follicular hyperplasia . \n therefore , we diagnosed the lesions as crypts in the nasopharynx . regarding the relationship between sas and nasopharyngeal tumors , \n the latter are detected at a rate that is approximately four times more frequent in sas patients than in the general population . \n furthermore , according to a previous report , a tumor or cystic disease causes complications in the upper respiratory tract in 0.24% of sas patients.8 as a clinical condition of hypertension accompanying sleep apnea , sympathetic nerve stimulation due to hypoxemia is considered to be related,9 but no abnormality was observed in the preoperative serum hormone concentration ( e and en ) . \n however , since blood pressure decreased postoperatively , a cystectomy was performed for ncpap function , and this is thought to have contributed to a decrease in blood pressure . \n however , sas was caused not only by obstructions but also by a central nervous system factor . \n in addition , ahi unfortunately did not improve in our patient because there was no change in her body weight . \n investigation of a possible nasopharyngeal lesion is considered particularly useful for the ncpap treatment of refractory osas . \n we treated a case in which a cyst occupied the nasopharyngeal space and caused nasal congestion . \n histopathologically , the cyst was located on the median of the nasopharyngeal space and showed hyperplasia of lymph follicles . therefore , we diagnosed it as an intra - adenoid cyst , which resulted in continued immune function of the pharyngeal tonsils in an individual over the age of 50 . \n finally , the presence of a nasopharyngeal cystic disease was determined as the cause that hampered ncpap treatment of refractory osas .", "role": "user" }, { "content": "a woman in her 50s was referred to our department with the chief complaint of nasal congestion and pharyngeal discomfort . \n the patient had been diagnosed with sleep apnea at the department of internal medicine , and had undergone nasal continuous positive airway pressure ( ncpap ) therapy , but her response to the treatment was poor . \n a cystic lesion occupying the nasopharynx , which was detected by nasopharyngeal fiberscopy , computed tomography , and magnetic resonance imaging , was thought to be the cause of the nasal congestion , pharyngeal discomfort , and obstructive sleep apnea syndrome ( osas ) . \n consequently , the patient underwent extirpation of the lesion under general anesthesia for the purpose of obtaining a definitive diagnosis as well as for treatment of the nasopharyngeal tumor . \n the diagnosis of intra - adenoid cyst was eventually made based on the pathological findings , which revealed lymphoid tissue accompanied by expansion of the crypt , as well as inflammatory cell infiltration with follicular hyperplasia . \n after the operation , the patient reported subjective improvement of her symptoms , and began to respond to the ncpap therapy for her sleep apnea syndrome . \n nasopharyngeal cysts , in particular adult intra - adenoid cyst , are relatively rare . \n the outcomes of the current case indicated that the presence of a nasopharyngeal cystic disease was hampering the ncpap treatment of refractory osas .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: dental trauma among young people represents a widespread clinical and dental public health problem.1 among children younger than 6 , 18% of all somatic injuries affect the oral region.25 the prevalence of traumatic dental injuries among this age group has been reported to vary from 11% to 30%.69 in addition to causing pain , traumatic injuries to primary teeth can result in functional and esthetic problems10 and can affect the developing tooth germ.11,12 despite the significance of primary tooth injuries , few studies are available on the topic , and few epidemiological studies include primary teeth . \n the purpose of the present study was to evaluate the type , prevalence , and treatment outcomes of primary tooth injuries among children referred to the department of pedodontics at the ankara university faculty of dentistry in turkey . \n the study population consisted of all patients applying to the ankara university faculty of dentistry s department of pedodontics with a primary tooth injury over the 21-months period from 15 may 2007 to 15 february 2009 . \n age , sex , time of injury , cause of injury , and number of teeth affected were recorded , and the type of trauma was identified according to andreasen s classification,2 as follows : \n enamel fracture , including enamel chipping;enamel - dentin fracture , without pulpal involvement;enamel - dentin fracture , with pulpal involvement;root fracture;crown - root fracture , without pulpal involvement;crown - root fracture , with pulpal involvement;concussion;subluxation;intrusive luxation;extrusive luxation;lateral luxation;avulsion . \n enamel fracture , including enamel chipping ; enamel - dentin fracture , without pulpal involvement ; enamel - dentin fracture , with pulpal involvement ; crown - root fracture , without pulpal involvement ; crown - root fracture , with pulpal involvement ; examination and treatment planning were performed by two of the authors . \n a total of 99 teeth in 51 patients were treated by one of the authors ( v. a. ) . \n during the 21-months period from 15 may 2007 to 15 february 2009 , 51 patients presented with trauma to 99 primary teeth . the age and sex distribution of patients \n of the 51 patients , 31 were boys ( 60.8% ) , and 20 were girls ( 39.2% ) . in total , 21 patients ( 41.2% ) presented with 1 affected tooth ; 20 patients ( 39.2% ) , with 2 affected teeth ; and 10 patients ( 19.6% ) , with 3 or more affected teeth . with the exception of 1 patient , \n the most commonly affected tooth was the maxillary left central incisor ( 74.5% ) , followed by the maxillary right central incisor ( 64.7% ) . \n the distribution , by month , of dental injuries in patients presenting at the clinic over the first 12 months of the study is given in table 3 . \n the most common cause of injury was falling ( 80.4% ) , followed by collision ( 11.8% ) . \n the distribution of injuries by patient age and injury type is shown in table 4 . \n luxation injuries accounted for the majority of injuries ( 35/41 , 85.4% ) at age 2 , whereas hard tissue injuries accounted for the majority of injuries ( 12/22 , 56% ) at age 4 . \n overall , the most common type of injury was lateral luxation ( 33.3% ) , followed by subluxation ( 14.1% ) . \n the most common form of treatment was follow - up only ( 39/99 , 39.4% ) , followed by extraction ( 29/99 , 29.3% ) and root canal treatment ( 12/99 , 12.1% ) . \n the majority of extracted teeth ( 19/29 ) were from patients aged 3 years and younger , with extraction required in 16 of these cases because the children s uncooperative behavior made it impossible to carry out any other treatment . \n five of the 29 extracted teeth had root fractures , for which treatment is contraindicated.13 the remainder of the extracted teeth had wide radiolucent areas around the apical region and/or pathological root resorption resulting from the delay between the time of injury and presentation at the clinic for treatment . of the teeth receiving no treatment but followup , \n 28.2% were intrusive luxations , none of which appeared to be a risk to their successors because of the direction of intrusion . \n another 33.3% of teeth treated by follow - up only were lateral luxations , all of which were luxated less than 2 mm , had no occlusal interference , and were luxated in the palatinal direction , so they did not pose a risk to their successors . \n all of these teeth were repositioned with appropriate pressure and splinted with 0.5 mm orthodontic wire and composite resin . \n the splint time was 10 days for all teeth , with the exception of one case in which the splint time was increased to 14 days due to tooth mobility . all teeth receiving root canal treatment were followed up for a minimum of 1 year and , with the exception of one case , were judged to be clinically and radiographically successful . \n no treatment but follow - up was applied to avulsed teeth , with the exception of one case in which a patient aged 3 years presented at the clinic 20 min after the time of injury . \n the tooth had been stored in milk since the injury , and the injury had occurred inside the home , so the risk of contamination was considered minimal . given the circumstances , the decision was made to reimplant the tooth after obtaining informed consent from the parents . \n the average follow - up period was 11 months , with the longest being 21 months and the shortest 3 months . \n all cases followed up with for less than 6 months were extractions , and , with the exception of 1 re - implantation , all cases for which follow - up lasted from 6 months to 1 year were cases receiving no treatment but follow - up . \n complications were observed during follow - up in 4 cases . in one of these cases , \n although the tooth re - erupted completely , pathological external root resorption was observed at 3 weeks following the injury , and the patient s age made it impossible to obtain cooperation ; therefore , the tooth had to be extracted . \n in another case with complications during follow - up , a laterally luxated central incisor in a patient who applied to the clinic 1 day after injury was gently repositioned , and a semi - rigid splint constructed of 0.5 mm orthodontic wire and composite resin was applied . \n the splint was removed after 1 week , and a root canal was performed using calcium hydroxide paste . \n after 9 months , the tooth had to be extracted due to pathological root resorption that had started in the 7 month . \n complications during follow - up also occurred in a patient with 2 crown fractures with pulpal involvement that received root canal treatment . \n after 7 months of follow - up , the teeth were again exposed to serious crown trauma that made restoration impossible ; therefore , these teeth were also extracted . \n only 16 of the 51 patients ( 31.4% ) presented at our clinic within 24 hours of injury , whereas 17 ( 33.3% ) presented between 24 hours and 10 days following injury and 18 ( 35.3% ) presented after 10 days . \n the results of the present study generally conform to those of previous studies in the literature . almost all studies report a higher frequency of dental trauma among boys than girls.1,1418 in our study \n , boys were found to be 1.5 times more likely to receive a dental injury than girls . \n this higher incidence may be associated with differences in the types of games played by boys and girls . during the period \n when children start to walk , especially between the ages of 1 and 2 years , poor muscle coordination results in an increased risk of trauma.4,6,19 andreasen reported another peak in injury at age 4 , when children s physical activity increases.2 in line with previous studies , our study found that 39.2% of traumatic injuries occurred between the ages of 1 and 2 and 23.5% at age 4 . \n these findings highlight the need to inform parents and preschool teachers about traumatic injuries , since nearly all of the injuries at these ages occur at home or at preschool . \n the majority of patients had more than 1 tooth injured by trauma ( 58.8% ) . \n this finding stands in contrast to previous findings that show the majority of traumatic injury involves only 1 injured tooth . in a retrospective study of 543 children with traumatic injuries , rodriguez reported that 70.9% had only 1 injured tooth;1 skaare and jacobsen also reported a higher percentage of patients ( 58% ) with only 1 injured tooth,15 as did oliviera et al.16 differences in methodologies and sample sizes may account for the variation in the numbers of injured teeth reported by different studies . in the present study , except for 1 tooth , \n in line with previous studies,1,1416 the maxillary central incisors were found to be the most frequently injured teeth . \n this is probably related to the position of the maxillary central incisors , which exposes them to direct traumatic force . \n in contrast to the mandible , whose mobility tends to reduce the impact of force , the maxillary bone s fixed position in the skull prevents it from absorbing traumatic force , and , thus , the maxillary teeth are directly affected.20 our study found that most traumatic injuries to primary teeth ( 33.3% ) presented in the month of may . \n this result is in agreement with saroglu and sonmez14 and perez et al,21 which indicates a seasonal variation in the distribution of traumatic injuries . \n this variation may be due to a sudden increase in children s physical activity as temperatures increase in the springtime . in terms of etiology , \n our study found falls to be the most common cause of traumatic injury to primary dentition ( 80.4% ) . \n this is in line with earlier findings14,15,22 and , as mentioned above , may be related to children s lack of muscle coordination during early childhood . \n the next most frequent cause of traumatic injury to primary dentition ( 11.8% ) was collisions . \n this finding is in line with most previous studies,6,14,23,24 although some authors have found hard tissue injuries to be the most common type of injury to primary dentition.7,25 the more frequent occurrence of periodontal tissue injury may be explained by the more resilient character of bone in young children in comparison to young adults . in our study , the rate of hard tissue injuries increased with age , whereas the rate of luxation injuries decreased ( table 4 ) . although some exceptions were observed after age 4 , the number of cases is insufficient to be conclusive . \n the most common treatment for injured primary teeth was follow - up only ( 39.4% ) . \n this finding is similar to that of previous studies.21,26,28 according to 2007 guidelines for traumatic injuries,13 follow - up for re - eruption is recommended for intruded primary teeth if the apex is displaced through or toward the labial bone plate . \n all the teeth with intrusive luxations in the present study met these criteria , and all re - erupted during follow - up periods of between 3 weeks and 2 months . \n this tooth had intruded 4 mm into the alveolar bone , compared to intrusion of less than 3 mm for all the other teeth . in view of this finding , one might conclude that the prognosis for intruded primary teeth is dependent upon the degree of intrusion , with teeth intruded less than 3 mm capable of spontaneous re - eruption and healing without any treatment . \n although guidelines do not recommend reimplanting primary teeth,13 some authors have reported successful cases of reimplantation.29 in deciding whether to attempt reimplantation , the benefits as well as risks to the patient should be weighed carefully , and the tooth should be followed up with closely . in our case , \n reimplantation was considered appropriate because of the short time between injury and presentation and the fact that the tooth had been stored in milk following injury . \n additionally , a close follow - up of the patient was possible . at 7 months of follow - up , \n both clinical and radiographic examination indicated the treatment to be successful , and close follow - up is continuing . \n several recent studies have been conducted on the prevalence of dental trauma among children in ankara , turkey . \n a study by saroglu and sonmez14 examining dental trauma to both primary and permanent dentition among children presenting at the ankara university faculty of dentistry s department of pedodontics described 34 cases of traumatic primary tooth injury treated during an 18 months period ( 1999 october to 2001 april ) . \n another prevalence study by altay and gungor26 conducted at hacettepe university , a university dental clinic in ankara , described 72 cases of traumatic injury to primary teeth treated over a 4 years period ( 19962000 ) . \n one can conclude from these studies and the present study that the incidence of traumatic injury to primary dentition in ankara has increased in recent years . \n it is also possible that the increase in patients presenting with traumatic injury to a primary tooth may be related to changes in government health policy and increases in the number of patients applying to university hospitals instead of other private or state hospitals . \n findings from the present study indicate that in the absence of acute symptoms , parents tend not to apply to a dental clinic for children s dental injuries , especially those affecting primary teeth . however , the finding of periapical radiolucency among 39.1% of patients who did not apply to a clinic until at least 10 days after injury highlights the importance of immediate examination and treatment of traumatic injuries to primary teeth . \n this finding also indicates the importance of informing the public , especially parents and teachers , about primary tooth injuries and their consequences .", "role": "user" }, { "content": "objectives : the aim of the present study was to evaluate the type and prevalence of primary tooth injuries , as well as their treatment and treatment outcomes , among children referred to the department of pedodontics at the ankara university faculty of dentistry in turkey.methods:the study population consisted of patients applying to the department with a primary tooth injury over a period of 21 months . \n fifty - one patients presented with trauma to 99 primary teeth . \n clinical and radiographic examinations were conducted on each patient . \n age , sex , time , cause of injury , and number of teeth affected were recorded , and the type of trauma was identified according to andreasen s classification . \n the teeth were treated by one of the authors.results:the majority of trauma occurred between the ages of 2 and 4 . \n the most common type of injury was lateral luxation ( 33.3% ) . \n most injuries ( 33.3% ) presented during may . the most common form of treatment was follow - up only ( 39.4% ) , followed by extraction ( 29.3% ) and root canal treatment ( 12.1% ) . \n the average follow - up period was 11 months . during the follow - up period , complications were observed in 4 teeth.conclusions:the study results show that in the absence of acute symptoms , parents tend not to apply to a dental clinic for children s injuries . \n this finding highlights the importance of informing the public about primary tooth injuries and their consequences .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the prevalence of obesity in children has increased worldwide ; especially among those with a low socio - economic background . \n obesity among children is a problem in both developed and less developed countries around the world . \n excess of weight is a problem rising these days and the complications of this situation when the child reaches adulthood is growing . \n assessment of body mass index ( bmi ) according to age and sex evaluates the child s weight situation . \n children s eating style has changed so much leading to the outbreak of increase in weight . \n increase of obesity worldwide is due to using non - alcoholic beverages and fast food and decrease in exercise . \n a study in the usa documented that children are amongst the fastest growing group of the overweight and obese population . \n childhood obesity may lead to serious disease , a decrease in life expectancy and numerous other problems . \n a high body weight is associated with a greater risk for type 2 diabetes and might be at risk factor for cardiovascular disease , asthma , arthritis , and general poor health . \n obese adolescents are more likely to become obese adults , and obese adults have an increased risk of morbidity and mortality in adulthood . \n iran has experienced a rapid nutrition transition characterized by decrease in physical activity and increase in energy intake leading to rapid overweight since the 1990s . \n there are many reports of refined carbohydrate consumption and the prevalence of tooth decay ; however , studies assessing the relationship between obesity and tooth decay in children have been limited . \n the objective of this study was to investigate the relationship between dental caries and bmi among elementary school children . \n this cross - sectional study was conducted from may to july 2009 in hamedan , western iran . \n the sampling technique used in the present study was a cluster random sampling , a total of 1000 pupils ( 500 girls , 500 boys ) aged 611 years from 20 private and state elementary schools ( 10 boys , 10 girls ) were screened . \n each school was considered as clusters that were selected by random selection in view of the total sample size . \n the sample size was estimated according to prior studies ( calculated as p=0.05 , confidence coefficient 99% and error coefficient 3% of the number of the sample size 900 ) . \n the dental and physical examinations of the children were only conducted with the written consent of the parents . \n body weight was recorded by using digital electronic scale with italian trade mark laica to the nearest 100-gram using a standard beam balance scale with the subject barefoot and wearing light dresses . \n the balance was calibrated at the beginning of each working day and at frequent intervals throughout the day . \n body height was recorded using with china trademark seca that fixed at 2 meter height , according to the following protocol : no shoes , heels together and head touching the ruler with line of slight aligned horizontally . to avoid subjective errors , \n weight status in children is measured by assessment of body mass index ( bmi ) ( = body weight / body height kg / m ) corresponding to gender and age - ranked percentages . \n bmi for age [ ( weight in kilograms)/(height in meters ) ] percentiles are dependent on gender and age - specific weight for height curves for those aged 520 years . \n according to these curves under weight is defined as under the 5th percentile curve , normal as between 5th and 85th percentile , at risk for overweight as higher than 85th and lower than the 95th percentile and overweight as higher or equal to the 95th percentile . to assess the caries frequency the decayed - filled teeth ( dft ) \n index for permanent dentition and the decayed - filled teeth ( dft ) index for primary dentition were used because they define the condition of caries in children . \n the dental examination was performed by the same operator , was noninvasive ( non magnifying mirror , dental probes , cotton roll with day light ) . \n teeth with fissure sealants were separately recorded as having received prophylactic treatment [ sound teeth ] . \n if restoration materials were present , the teeth were marked as sufficiently or insufficiently treated ( filled ) . \n teeth filled with temporary materials were considered as filled and not as decayed and no radiographs were taken . \n missing teeth were not pointed out because without an appropriate dental history no definite statement is possible about the actual existence of the tooth or occurrence of an early removal . \n t - test was used to analyzed the mean decayed and filled permanent / primary teeth ( dft / dft ) and the difference between groups , chi square test for evaluation of association between bmi - for - age and gender also to compare outcomes of different weight groups , and one way analysis of variance anova for evaluation of association between bmi - for - aged and dft / dft indices . \n the gender distribution was even with 50% boys and 50% girls ( age range ; 6 to 11 years ) . \n the dental examination showed that only 51 of the children ( 24 girls and 27 boys ) were caries - free without decayed or filled teeth . \n 9.1% of the children in the study ( n=91 ; 44 boys and 47 girls ) were underweight , 71.9% ( n=719 ; 349 boys and 370 girls ) of the children were normal weight , 11% ( n=111 ; 59 boys and 55 girls ) of the children were overweight and at risk of overweight was present in 7.9% ( n=79 ; 51 boys and 28 girls ) of the children . \n the boys showed a mean of 5.28 carious lesions ( df - t values ) in the first dentition and 1.55 in the permanent dentition ( df - t values ) . \n the girls showed a mean df - t value of 4.76 and a mean df - t value of 1.82 and mean total dft / dft value of 6.82 in boys and 6.58 in girls ( fig 1 ) . \n the distribution of the children according to gender ( boys , girls ) and different weight classes ( bmi ) is given ( fig 2 ) . \n underweight children ( n=91 ) showed a mean dft value of 1.39 ( mean df - t=5.34 ) , children with normal weight ( n=719 ) had a mean df - t value of 1.74 ( mean df t=5.1 ) . at risk of overweight children ( n=79 ) had a mean df - t value of 1.59 ( mean df- t=4.25 ) , and overweight children ( n=111 ) had a mean df - t value of 1.59 ( mean df t=4.79 ( fig 3 ) . \n the highest total mean ( dft / dft ) was seen in normal weight and the lowest mean was reported in at risk of overweight children . \n on the other hand , the highest dft was seen in normal weight and the lowest in the underweight group . \n 11.8% of underweight children were caries - free , while 66.7% of normal weight , 9.8% overweight and 11.8% of at risk of overweight children had oral cavity without any caries . \n there was no statistically significant relationship found between high weight and caries frequency in the first ( p=0.08 ) and permanent dentition ( p=0.06 ) . \n the association between underweight and high caries experience in total values dft / dft in boys could be observed , although this relationship was not observed in girls . \n it is thought that the increase in children s overweight status has occurred because of an increase in caloric intake and also because of lack of physical activity among children and adolescents . \n the amount of carbohydrates in children s diet has been increasing over the last 10 years as a consequence of recommendations to decrease dietary fat . \n overweight in children has been associated with increased carbohydrate intake and may be related to prolong exposure to carbohydrates [ 17 , 18 ] . given the causative relation between refined carbohydrates and dental caries , it is appropriate to hypothesize that overweight might also be a marker for dental caries in children and teenagers . \n body weight of a population can be viewed as a continuum from underweight to obesity . \n both under - weight / malnutrition and overweight / obesity have significant adverse implications for health . \n an accepted method to evaluate an individual s body weight relative to population norms is through calculation of body mass index ( bmi ) using the formula bmi = weight in kilograms / height in meters . in assessing oral health ( caries experience ) \n authors choose different kinds of indices 3 without radiograph or with radiograph for interdental decay ; wilierhausen and sadeghi , df - t / df - t sheller ( dmf - t ) ; forestier ( dmf - t ) and pinto , decayed surfaces ( as / ds ) index . \n results of the present study showed the high prevalence of 11.1% overweight and 7.9% obesity in the 6 to 11-year - old children in hamedan . there is a growing epidemic of overweight in iran among children and teenagers . \n a study showed that the prevalence of overweight was 20.8% in 3 to 9-year - old children according to bmi . \n the mean total dft / dft indices in obese children were less than children in other groups . \n several reports including ours describe an inverse relationship between dental caries and weight [ 24 , 25 ] . \n chen et al also investigated bmi index and dft score in three - year - old children . \n they concluded that there were no significant differences in the dft score of carious children among different bmi groups and there is no relationship between carious deciduous teeth and weight status . \n macek and mitola found that overweight children aged 67 years had a significantly lower dental caries severity than children of normal bmi - for - age . \n pinto et al concluded that there is no statistically significant association between bmi - for - age and dental caries prevalence for children aged 611 years . \n sheller et al found that in severe early childhood caries , the bmi percentile was not correlated with dmft or the number of pulp - involved teeth , even after adjusting for confounding factors in 2 to 5-year - old children . \n willerhausen investigated bmi index and df - t / df- t values in 6 to 11-year - old children . \n they demonstrated a significant association between caries frequency and weight in 1290 german elementary school children ( 13 ) . \n tuomi reported that obesity at young age and caries experience in children aged 513 years were useful in predicting the risk of dental caries , especially in permanent second molars . \n larsson et al found that caries - prone adolescents were more obese and had higher blood pressure than caries - free adolescents . \n burt and pai reported that children of low birth weight subsequently developed more caries in primary dentition than children with normal to high birth weight . \n they concluded that this may be related to social deprivation factors during the development of the primary dentition . \n another study from willerschausem following 2071 primary school pupils , aged 6 to 10 years showed the significant correlation between bmi and caries frequency persisted even after adjustment to the children s age . in a swedish study , children with dmft indices over 9 had significant higher bmi values than caries - free children . \n another swedish study of 15-year - old children revealed a significant positive correlation between dmfs indices and relative bmis in the obese group . \n factors affecting the onset of carious lesions include oral hygiene , diet composition and frequency , socioeconomic status , salivary immunoglobulins , bacterial loud and fluoride intake . \n dental hygiene , intake of fluoride and dietary habits ( snacking ) were not evaluated in the pediatric population we studied . \n presumably the low prevalence of obese children found in this sample could have biased the results towards a negative correlation . \n albeit the findings of the present study are meant to be used in future preventive programs [ 31 , 36 ] . \n not with standing the fact that the results of this preliminary study do not support an association between dental caries and obesity . \n both obesity and caries have common determinants and require a comprehensive , integrated management approach by multidisciplinary teams .", "role": "user" }, { "content": "objectiveexcessive weight in children is a major public health concern . \n the intake of refined carbohydrates , especially sugars and the prevalence of dental caries are well documented in the literature . \n the purpose of this study was to investigate the relationship between dental caries and bmi in elementary school children.materials and methodsthe sampling technique used in the present study was a cluster random sampling . \n a total of 1000 pupils ( 500 girls , 500 boys ) aged 611 years from 20 private and state elementary schools ( 10 boys , 10 girls ) . \n the weight status was measured in children by assessment of body mass index ( bmi ) ( = body weight / body height2 kg / m2 ) corresponding to gender and age - ranked percentages . to assess the caries frequency the decayed filled teeth ( dft ) \n index for permanent dentition and the dft index for primary dentition were used since they give good perception about the situation of tooth caries in young patients.resultsthe highest mean total dft / dft was seen in normal weight and lowest average in at risk of overweight children . \n there was not a statistically significant relationship found between high weight and caries frequency in the first ( p=0.08 ) and permanent dentitions ( p=0.06).conclusionthe results of this preliminary study do not support an association between dental caries and obesity .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: beauty lies in the eyes of the beholder - keeping this old adage in mind , smile corrections can be done in patients with cosmetic concerns . \n what constitutes a pleasant smile varies from person to person , but usually depends on the extent of gingival exposure . \n when a person smiles , the entire crowns of maxillary central incisors and 1 mm of pink attached gingival is visible . \n a gummy smile is seen usually when more than 3 mm of gingival is visible . \n the form of the lips and the position of lips during speech and smiling can not be changed easily , but the dentist can modify / control the form of the teeth , interdental papilla , and position of the gingival margin and incisal edges of the teeth . while correcting the position of the marginal gingiva , one should be cautious in preserving the biologic width . often , osseous recontouring becomes essential to maintain the integrity of the biologic width and enable proper margin placement . \n various methods have been documented including gingivectomy , flap surgery with osseous contouring , apically displaced flaps , and orthodontic therapy \n . excessive display of the gingiva is sometimes caused by vertical maxillary excess and a long mid - face . \n surgical crown lengthening does not suffice in such cases and the maxilla has to be surgically treated with maxillofacial surgery . \n an interdisciplinary approach is vital in such cases when the patient is unwilling for a major surgery . a combination of soft and hard tissue contouring with appropriate prosthetic restoration to alter the shape of the teeth achieves an aesthetic result , at least partially . a classification system for aesthetic crown lengthening procedures has been proposed by lee \n type i - sufficient soft tissue present allowing gingival exposure of the alveolar crest or violation of the biologic width . \n type ii - sufficient soft tissue allows gingival excision without exposure of the alveolar crest , but in violation of the biologic width . \n type iii - gingival excision to the desired clinical crown length will expose the alveolar crest . \n staging of the procedures and alternative treatment sequence may minimize display of exposed subgingival structures . \n prior to developing a suitable treatment plan , it is essential to establish a complete and accurate assessement of the conditions with which the patient presents . \n reasons for seeking treatment;assessment of systemic health and habits;height and symmetry of face;thickness , length , and profile of lips;smile line;condition and dimensions of teeth;width of keratinized gingiva;gingival biotype ; andfacial and lingual bone levels , thickness of alveolar . \n reasons for seeking treatment ; assessment of systemic health and habits ; height and symmetry of face ; thickness , length , and profile of lips ; condition and dimensions of teeth ; \n width of keratinized gingiva ; gingival biotype ; and facial and lingual bone levels , thickness of alveolar . \n prior to developing a suitable treatment plan , it is essential to establish a complete and accurate assessement of the conditions with which the patient presents . \n reasons for seeking treatment;assessment of systemic health and habits;height and symmetry of face;thickness , length , and profile of lips;smile line;condition and dimensions of teeth;width of keratinized gingiva;gingival biotype ; andfacial and lingual bone levels , thickness of alveolar . \n reasons for seeking treatment ; assessment of systemic health and habits ; height and symmetry of face ; thickness , length , and profile of lips ; condition and dimensions of teeth ; width of keratinized gingiva ; gingival biotype ; and facial and lingual bone levels , thickness of alveolar . \n surgical crown lengthening without osseous correction : a 33-year - old female patient with unaesthetic crowns on the maxillary anteriors , with localized periodontitis , and maxillary gingival excess resulting in a gummy smile reported to a consultant prosthodontist for replacement of crowns [ figure 1 ] . \n a treatment plan involving surgical crown lengthening without osseous correction on account of the existing bone loss and consequent pockets , followed by replacement of the crowns was drawn up and presented to the patient . after obtaining approval of the treatment plan and informed consent , phase 1 periodontal therapy \n bone sounding was done [ figure 2 ] under anesthesia , before starting the excision , to clearly establish the position of the bone . \n inverse bevel gingivectomy [ figure 3 ] was done , and the flap rose for debridement and curettage . \n inverse - bevel gingivectomy the flap was sutured back [ figure 4 ] and the original bridge was cemented in place , temporarily [ figure 5 ] . \n the patient was recalled after four weeks , and a new temporary bridge was cemented [ figure 6 ] . \n crown lengthening complete original bridge cemented new provisional bridge surgical crown lengthening with osseous correction for gummy smile : a 30-year - old female patient reported to the clinic with a chief complaint of a gummy smile that was not acceptable aesthetically . on clinical examination , she was found to have a vertical maxillary excess , and was a candidate for orthognathic surgery . however , the patient was unwilling to go through a complicated surgical procedure involving hospitalization , and yet wanted her smile to be altered . \n hence , she was given an option of compromised correction by doing surgical crown lengthening involving soft tissue as well as osseous correction along with prosthetic placement of venners . \n in [ figure 7 ] , the preoperative view can be seen with a severe maxillary excess causing a gummy smile . \n a crevicular incision was made from distal of tooth number , 14 to 24 , and mucoperiosteal flap was raised [ figure 8 ] . \n osseous correction was then performed , keeping in mind the biologic width requirements using a large round diamond bur on an airotor [ figure 9 ] . \n after six weeks of healing and allowing complete shrinkage , gingivectomy was performed with aesthetic contouring [ figure 10 ] . \n after eight weeks of healing , composite veneers were placed as provisional restorations [ figure 11 ] . \n flap raised and bony crests revealed osseous recontouring complete gingival recontouring after six weeks composite veneers placed \n surgical crown lengthening without osseous correction : a 33-year - old female patient with unaesthetic crowns on the maxillary anteriors , with localized periodontitis , and maxillary gingival excess resulting in a gummy smile reported to a consultant prosthodontist for replacement of crowns [ figure 1 ] . \n a treatment plan involving surgical crown lengthening without osseous correction on account of the existing bone loss and consequent pockets , followed by replacement of the crowns was drawn up and presented to the patient . after obtaining approval of the treatment plan and informed consent , phase 1 periodontal therapy \n bone sounding was done [ figure 2 ] under anesthesia , before starting the excision , to clearly establish the position of the bone . \n inverse bevel gingivectomy [ figure 3 ] was done , and the flap rose for debridement and curettage . \n inverse - bevel gingivectomy the flap was sutured back [ figure 4 ] and the original bridge was cemented in place , temporarily [ figure 5 ] . \n the patient was recalled after four weeks , and a new temporary bridge was cemented [ figure 6 ] . \n surgical crown lengthening with osseous correction for gummy smile : a 30-year - old female patient reported to the clinic with a chief complaint of a gummy smile that was not acceptable aesthetically . on clinical examination , she was found to have a vertical maxillary excess , and was a candidate for orthognathic surgery . however , the patient was unwilling to go through a complicated surgical procedure involving hospitalization , and yet wanted her smile to be altered . \n hence , she was given an option of compromised correction by doing surgical crown lengthening involving soft tissue as well as osseous correction along with prosthetic placement of venners . \n in [ figure 7 ] , the preoperative view can be seen with a severe maxillary excess causing a gummy smile . \n a crevicular incision was made from distal of tooth number , 14 to 24 , and mucoperiosteal flap was raised [ figure 8 ] . \n osseous correction was then performed , keeping in mind the biologic width requirements using a large round diamond bur on an airotor [ figure 9 ] . \n the flap was sutured back in the same position . after six weeks of healing and \n after eight weeks of healing , composite veneers were placed as provisional restorations [ figure 11 ] . \n flap raised and bony crests revealed osseous recontouring complete gingival recontouring after six weeks composite veneers placed \n there are two aspects to the crown lengthening procedure : aesthetic and functional . in both cases \n , the surgical procedure is aimed at re - establishing the biological width , apically , while exposing more tooth structure . \n the average space occupied by the sum of the junctional epithelium and the supracrestal connective tissue fibers was found to be 2.04 mm . \n violation of biological width has been associated with gingival inflammation , discomfort , gingival recession , alveolar bone loss , and pocket formation . to have a harmonious and successful long - term restoration , \n a 3 mm sound supracrestal tooth structure between bone and prosthetic margins , which allows for the reformation of the biological width plus sulcus depth is advocated . \n this can be achieved surgically ( crown lengthening ) , orthodontically ( forced eruption ) , or by a combination of both . \n patients that require aesthetic crown lengthening , however , frequently exhibit a high smile line . as a result \n , pressure is often placed on the restorative dentist to correct aesthetic deficiencies as early as possible , and maintain certain aesthetic standards throughout the treatment . \n however , conventional protocols require a waiting period of four to six weeks for sufficient healing of the attachment apparatus , prior to initiating restorative procedures . \n the surfaces exposed due to crown lengthening will be displayed through the healing period until the provisional prosthesis can be fabricated or relined . \n the exposed areas may be limited to cemento - enamel junctions and varying amounts of root surface , but may also include the margins of previous restorations . \n crown lengthening can be limited to the soft tissues when there is enough gingiva coronal to the alveolar bone , allowing for surgical modification of the gingival margins , without the need for osseous recontouring ( that is , pseudopockets in cases of gingival hyperplasia ) , as seen in case 1 , which presented with periodontitis and bone loss . \n an external or internal bevel gingivectomy ( gingivoplasty ) is the procedure of choice in these cases . \n the biological width has not been compromised , and , as a result , the soft tissue pocket is eliminated and the teeth exposed without the need for osseous resection . \n unfortunately , the majority of cases will involve bone recontouring as well as gingival resection to accommodate aesthetics and function . \n this is a more delicate procedure that requires exposing root surface , positioning gingival margins at the desired height , and apically reestablishing the biological width . \n the level of the alveolar crest must be determined prior to any considerations regarding aesthetic crown lengthening . \n bone sounding is utilized to determine the thickness of the soft tissue layer and height and thickness of the alveolar bone . \n bone sounding assists in determining the level of the alveolar crest , and thus , the need for osseous contouring . \n the crown - lengthening procedure enables restorative dentists to develop an adequate zone for crown retention without extending the crown margins deep into periodontal tissues . after the procedure , it is customary to wait six to eight weeks before cementing the final restoration . in the aesthetic zone , \n this reduces the chances of gingival recession following prosthetic crown insertion , specifically if there is a thin biotype . \n it may be beneficial in these scenarios to compartmentalize the soft and hard tissue components of the crown lengthening procedure and stage them individually for treatment . \n as with any procedure , the patient needs to be informed of any potential complications . for crown lengthening \n these include : \n possible poor aesthetics due to black triangles;root sensitivity;root resorption ; andtransient mobility of the teeth . \n possible poor aesthetics due to black triangles ; transient mobility of the teeth . \n as with any procedure , the patient needs to be informed of any potential complications . for crown lengthening \n these include : \n possible poor aesthetics due to black triangles;root sensitivity;root resorption ; andtransient mobility of the teeth . \n possible poor aesthetics due to black triangles ; transient mobility of the teeth . \n gingival topography is a complex interplay of the underlying bony architecture and the size , form and position of teeth . \n the concept of modern day dental aesthetics places equal impetus on the white and pink components , and a balance of the two is an essential ingredient in smile designing .", "role": "user" }, { "content": "cosmetically acceptable smiles show a gingival display of up to 3 mm . \n gingival display of greater than 3 mm results in a gummy smile which is often unsightly for the individual and correction is sought . \n there are a variety of procedures used for surgical crown lengthening . here , we describe two such cases requiring two different approaches for surgical crown lengthening .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: candida albicans subretinal abscess is extremely rare . to our knowledge , only one unilateral case has been reported . \n mixed bacterial infection was also suspected based on broad - range real - time polymerase chain reaction . \n a 64-year - old man being treated with oral corticosteroids for interstitial pneumonia visited us for visual loss in the left eye . \n best corrected visual acuity ( bcva ) was 20/20 in the right eye and 8/200 in the left eye . \n broad - range polymerase chain reaction of the vitreous fluid from the left eye showed a high copy count of bacterial 16s ribosome rna . despite large doses of antibiotics , \n exenteration of the left eye was performed followed by microscopic examination showing gram - negative bacilli , and c. albicans was also cultured . \n antibiotics and the maximum doses of antifungal drugs were administered . however , the abscess in the right eye expanded , and bcva decreased to 2/200 . \n follow - up , bcva was stable at 4/200 with healing of the subretinal abscess under silicone oil . \n since c. albicans subretinal abscess is extremely rare and there was a concurrent mixed bacterial infection , diagnostic procedures in our bilateral case were more complicated than usual . c. albicans infection \n endogenous fungal endophthalmitis first results in the formation of infectious lesions in the choroid through fungemia , followed by invasion of the retina . \n it then disseminates from the retina to the vitreous cavity , and induces marked vitreous opacity and traction retinal detachment in severe cases.1 in other words , fungal infections usually disseminate vertically , and thus rarely form a subretinal abscess . \n conversely , if an infection progresses horizontally under the sensory retina or the retinal pigment epithelium , a subretinal abscess will form , and the vitreous cavity will not become cloudy until the advanced stage . \n aspergillus has been identified as the most frequent fungal cause of subretinal abscess,2 while candida albicans subretinal abscess is extremely rare . to our knowledge \n , only one unilateral case has been reported.3 we had an experience with a patient with bilateral subretinal abscesses . c. albicans was cultured from surgical specimens , and mixed bacterial infection was also suspected based on broad - range real - time polymerase chain reaction ( pcr).4,5 \n a 64-year - old man visited jichi medical university hospital complaining of left eye visual loss and floaters in the right eye . \n he was referred to us by the department of allergy and rheumatism of our hospital , having been administrated 40 mg of oral prednisolone for more than 6 weeks as treatment for interstitial pneumonia accompanying rheumatoid arthritis . \n best - corrected visual acuity ( bcva ) was 20/20 in the right eye and 8/200 in the left eye . \n funduscopy revealed round yellowish - white subretinal lesions with retinal hemorrhage in both eyes ( figure 1a and b ) . \n laboratory studies showed elevated titers of the anti - toxoplasma , anti - herpes simplex virus igg , anti - herpes simplex virus igm , and anti - cytomegalovirus igg antibodies , as well as low cell lymphocyte and cd4-positive lymphocyte counts . \n in contrast , the white blood cell count , c - reactive protein , and -d glucan levels were not increased . \n administration of oral anti - toxoplasma ( acetylspiramycin 1,800 mg / day ) and anti - viral drugs ( valganciclovir 1,800 mg / day ) was initiated . however , the lesions expanded in both eyes . \n diagnostic vitrectomy of the left eye was performed 4 weeks after the initial examination . although the vitreous fluid sample was subjected to broad - range pcr , multiplex pcr , and other culture tests , no positive results were obtained . \n based on the fundus findings , broad - spectrum antibiotic treatment ( imipenem / cilastatin 2,000 mg / day and amikacin 600 mg / day ) was initiated , under suspicion of bacterial infections including nocardia . \n thus , antibiotics ( ceftazidime 2 mg , vancomycin 1 mg , and voriconazole 0.05 mg/0.1 ml each ) were injected into the vitreous cavity 6 weeks after the initial examination , and a vitreous tap was simultaneously performed . \n broad - range pcr of the vitreous fluid showed 3.7510 copies / ml of bacterial 16s ribosomal rna , strongly suggesting bacterial infection . \n albeit with antibiotic treatment , the lesions further deteriorated bcva to light perception ( figure 2a ) . \n seven weeks after the initial examination , exenteration of the left eye was performed . immediately after the operation , microscopic observation of the removed and then gram - stained tissue revealed gram - negative rods \n . however , no bacteria corresponding to these organisms grew in culture of either the removed tissue or vitreous fluid , and only c. albicans was isolated . \n sheep blood agar and chocolate agar were used for culture and intubated with 5% carbon dioxide at 35c for 48 hours . \n the picture of the gram - stained sample was taken from this culture ( figure 2b , left ) . \n then , the colonies grown on these cultures were harvested and cultivated on the chromagar for identification . \n the picture of the agar plate shows the colonies that are green in color on the chromagar suggesting the species of c. albicans based on its color ( figure 2b , right ) . \n based on these findings , mixed bacterial and fungal infection was considered , and simultaneous systemic administrations of antibiotics ( levofloxacin 500 mg / day ) and maximum - dose antifungal agent ( fosfluconazole 600 mg / day ) were initiated . \n in addition , antibiotics ( ceftazidime 2 mg , vancomycin 1 mg , and voriconazole 0.05 mg/0.1 ml each ) were injected into the vitreous cavity of the right eye three times from 8 weeks to 10 weeks after the initial examination . \n broad - range pcr of the vitreous fluid obtained from simultaneous vitreous tap 8 weeks after the initial examination revealed 7.1910 copies / ml of bacterial 16s ribosomal rna , and 1.8510 copies / ml of fungal 28s ribosomal rna , suggesting a fungus - dominant mixed infection . \n the subretinal abscess in the right eye expanded , approaching the central fovea ( figure 3a ) , and bcva decreased to 2/200 . \n vitrectomy combined with cataract surgery and silicone oil injection was performed 10 weeks after the initial examination . c. albicans was detected by vitreous fluid culture . \n systemic administration of the antifungal agent was continued after surgery , and the lesions healed under silicone oil ( figure 3b ) . \n the fundus had stabilized 1 year and 4 months after the initial examination , and bcva was maintained at 4/200 . \n subretinal abscess formation in endogenous endophthalmitis is rare . since the most frequent causative bacterium is reportedly nocardia,2 we considered nocardia infection in our case . \n aspergillus was identified as the most frequent fungal cause of subretinal abscess.2 rao and hidayat reported the histopathological features of 13 cases with aspergillus and 12 cases with candida endophthalmitis.6 in their report , the authors stated that aspergillus was most abundantly seen at the subretinal and subretinal pigment epithelium regions , whereas candida was noted primarily in the vitreous.6 to our knowledge , only one unilateral case of c. albicans subretinal abscess after liver transplantation has been reported.3 thus , our patient may be the second c. albicans subretinal abscess case to be reported . \n our patient was treated with high - dose prednisolone ( 0.7 mg / kg , more than 6 weeks ) for interstitial pneumonia and could well have been immunocompromised . \n whole - body examination was performed , but no infectious lesions were found other than those in the eyes . thus , detection of the fungus in the intraocular tissue and vitreous fluid was necessary to make a definite diagnosis . the frequency of fungal isolation and culture from vitreous fluid is reportedly 42%,7 but the frequency may be lower when lesions are limited to the subretinal space . \n fungal identification by direct biopsy of a subretinal abscess using a vitreous cutter has been reported , but proliferative vitreoretinopathy developed from the biopsied site.8 another report described successful transscleral drainage of a subretinal abscess,9 but this procedure is only applicable when the lesion is present in the peripheral fundus . \n there are as yet no safe and reliable methods for direct biopsy of a subretinal abscess . in our case , \n bcva of the left eye deteriorated to light perception despite systemic and intravitreal administration of antibiotics , and the lesion was not present in the peripheral fundus . \n the blood -d glucan - positive rate was reported to be 95% in fungal endophthalmitis patients.10 however , the blood -d glucan level was not elevated in our patient , making the diagnosis more difficult . \n this may be due to the limited location of fungal infection exclusively to the eyes . \n we also performed broad - range real - time pcr and multiplex pcr tests.4,5 diverse exogenous micro - organisms causing ocular inflammatory diseases can be exhaustively screened by these tests within a short time.4,5 in our patient , vitreous fluid obtained on diagnostic vitrectomy of the left eye performed 4 weeks after the initial examination was tested , but positive results were not obtained . \n this may be due to localization of the abscess in the subretinal space and poor dissemination of the causative agents to the vitreous cavity . \n on vitreous tap of the left eye 6 weeks after the initial examination , only bacteria were detected by broad - range pcr , and the reason for this was unclear . \n in contrast , the vitreous tap of the right eye 8 weeks after the initial examination was positive for both bacteria and fungi . considering that no safe and reliable biopsy method is available for subretinal abscesses , further improvements in sensitivity and specificity of pcr tests are needed . \n we have described herein a rare case of bilateral endogenous c. albicans subretinal abscesses in which mixed bacterial infection was suspected and made the diagnosis more complicated . c. albicans infection should be included in the differential diagnosis of subretinal abscesses .", "role": "user" }, { "content": "purposecandida albicans subretinal abscess is extremely rare . to our knowledge , only one unilateral case has been reported . \n herein , we report one bilateral case . \n mixed bacterial infection was also suspected based on broad - range real - time polymerase chain reaction.methodsa 64-year - old man being treated with oral corticosteroids for interstitial pneumonia visited us for visual loss in the left eye . \n best corrected visual acuity ( bcva ) was 20/20 in the right eye and 8/200 in the left eye . \n funduscopy revealed round yellowish - white subretinal lesions with retinal hemorrhage in both eyes.resultsbroad-range polymerase chain reaction of the vitreous fluid from the left eye showed a high copy count of bacterial 16s ribosome rna . despite large doses of antibiotics , \n the abscess expanded and vision decreased to light perception in the left eye . \n exenteration of the left eye was performed followed by microscopic examination showing gram - negative bacilli , and c. albicans was also cultured . \n antibiotics and the maximum doses of antifungal drugs were administered . however , the abscess in the right eye expanded , and bcva decreased to 2/200 . \n vitrectomy and silicone oil tamponade were performed . \n vitreous fluid culture revealed c. albicans . at 16 months \n follow - up , bcva was stable at 4/200 with healing of the subretinal abscess under silicone oil.conclusionsince c. albicans subretinal abscess is extremely rare and there was a concurrent mixed bacterial infection , diagnostic procedures in our bilateral case were more complicated than usual . c. albicans infection should be included in the differential diagnosis of subretinal abscesses .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: zhigancao , glycyrrhizae radix et rhizoma praeparata cum melle , originates from the processed dried roots or rhizomes of glycyrrhriza uralensis fisch . \n it is most frequently used in traditional chinese medical formulary to harmonize all drugs and detoxify the adverse effects of herbs . \n clinically , it treats disorders such as shortness of breath , fatigue , epigastria and abdominal pain , musculoskeletal and smooth muscle cramp and pain , and diarrhea . due to the numerous bioactive compounds in it such as terpenoids , saponins , polysaccharides , and flavonoids , \n zhigancao has been reported to possess anti - inflammatory activities , antioxidative [ 3 , 4 ] , neuroprotective , antiallergic , anticonvulsant activities , and so forth . \n two chalcone derivatives in figure 1 , isoliquiritin apioside ( ila ) and isoliquiritin ( il ) , which are important ingredients in zhigancao , are selected to research their pharmacokinetics . \n il has been reported to have shown various pharmacological activities such as antiangiogenic effect dependent upon antitube formation , antidepressant - like effects in mice induced by forced swimming and tail suspension , and inhibitory effects on tyrosinase . \n the bioavailability of drugs is the cornerstone for extending their in vitro biological functions to humans in vivo . \n the flavonoid glycosides show low oral bioavailability possibly because of the extensive conjugation of the free hydroxyl groups [ 1214 ] or / and glycosides hydrolysis to the aglycones in the intestinal lumen [ 1416 ] . \n the pharmacokinetic study of ila and il is essential for us to comprehend the bioavailability of two analytes after an oral administration of zhigancao extrat . to my knowledge , ila and \n il quantification method ( lc - ms / ms ) has been performed to study pharmacokinetics of multiple licorice flavonoids after an oral dose of xiaochaihu - tang to rats , but lc - ms / ms method is simply not available in most laboratories . in this study , we established the hplc method which was highly selective and sensitive for simultaneous quantification of ila and il in rat plasma . \n the method was used to explore the possible pharmacokinetics of ila and il after an oral administration of zhigancao extract . \n isoliquiritin apioside ( ila ) and isoliquiritin ( il ) were purchased from xi'an xiaocao botanical development co. , ltd . \n wogonoside ( internal standard , is ) was obtained from national institute for food and drug control ( beijing , china ) . \n zhigancao which was produced under the guidance of the theory of traditional chinese medicine science was provided by chifeng xinzhou traditional chinese medicine co. , ltd . \n the material was authenticated as the dried roots of g. uralensis by professor ting - guo kang from liaoning university of traditional chinese medicine . \n hplc grade acetonitrile and analytical grade chloroform were purchased from shandong yuwang chemical industry co. , ltd . \n the water in the study was purified with a milli - q water purification system from millipore ( bedford , usa ) . \n powdered herb materials were extracted twice under reflux condition with 70% ethanol ( 1 : 10 , w / v ) for 1 h under 100c . the extract was filtered and evaporated . finally , the residue was dried in vacuum drying oven at 60c to obtain a powder state of zhigancao extract . \n the contents of ila and il in the extract were detected by hplc , 33.72 and 28.17 mg / g , respectively . \n the liquid chromatography system employed was agilent 1100 with a variable wave length uv detector ( g1314a vwd ) . \n , 5 m , dikma technologies , china ) analytical column with a endcapped c18 ods guard column . \n the mobile phase composed of water ( containing phosphoric acid 0.1% , v / v ) and acetonitrile ( 72 : 28 , v / v ) was filtered through 0.22 m millipore membrane filter . the flow rate was 1.0 ml / min . \n the detection wavelength was set at 360 nm ( 09 min ) and 276 nm ( 912 min ) . \n stock solutions of is , ila and il with concentrations of 440 , 384 , and 480 g / ml , respectively , were prepared in methanol , and stored at 4c . the working solution for is was diluted with methanol to get a final concentration of 8.80 g / ml . stock solutions were diluted with methanol to serial standard working solutions at concentrations of 0.60 , 1.20 , 2.40 , 4.80 , 9.60 , 19.2 , and 38.4 g / ml for ila , 0.75 , 1.50 , 3.00 , 6.00 , 12.0 , 24.0 , 36.0 , and 48.0 g / ml for il . \n these solutions were then added to blank plasma ( 1 : 10 ) to make standards of 0.0603.84 g / ml for ila and 0.0754.80 g / ml for il . \n the quality control ( qc ) samples which were used for the intra- and inter - day accuracy , and precision , extraction recovery and stability study , were prepared in the same way at 0.12 , 0.48 and 3.07 g / ml for ila , and 0.15 , 0.60 and 3.84 g / ml for il . the 200 l of rat plasma was mixed with 20 l is working solution . \n after protein was precipitated with 500 l of acetonitrile in a 1.5 ml polypropylene tube by vortexing for 3 min , the sample was centrifuged at 6,677 g for 5 min . \n the supernatant was transferred into a 2.0 ml tube and was added with 1,000 l of chloroform . \n after vortexing and centrifugation , 20 l of water phase was injected for analysis . \n the analysis method was completely validated using spiked rat plasma samples , including selectivity , linearity , intra- and inter - day precision , accuracy and stability , according to the fda guideline for method validation of bioanalytical assays . \n the selectivity of the method was demonstrated by comparing chromatograms of blank plasma samples ( without is ) obtained from rats , plasma samples spiked with the analytes and is , and plasma samples after an oral dose . \n all blank plasma samples were prepared and analyzed to ensure the absence of interfering peaks . \n the linearity of the method was assessed by plotting calibration curves in plasma at seven concentration levels in triplicate on three consecutive days . \n the lower limit of quantification ( lloq ) was defined as the lowest concentration of the calibration curve , that was measured with accuracy and precision by analyzing samples in six replicates at the concentration of 0.060 g / ml for ila and 0.075 g / ml for il . \n precision and accuracy were evaluated by determining qc samples at three concentrations in six replicates on the same day ( intra - day accuracy and precision ) and three consecutive days ( inter - day accuracy and precision ) . \n accuracy was measured by relative error ( re ) and precision was evaluated by intra- and inter - day relative standard deviation ( rsd ) . \n the extraction recovery was evaluated by comparing the peak areas of the extracted qc samples at three concentrations in six replicates with those of unextracted standards that represented 100% recovery . \n similarly , the recovery of is was evaluated at a single concentration of 0.88 g / ml in the same way . \n the stability of ila and il in rat plasma was evaluated by comparing the mean of back - calculated concentration of the stored qc samples at three concentrations in triplicate with the spiked concentration of analytes . \n the qc samples treated as sample preparation were kept at room temperature for 12 h and then the stability was determined . \n the freeze - thaw stability was determined afterthree freeze ( 20c , 24 h ) and thaw ( room temperature ) cycles . \n long - term stability was assessed by keeping qc samples at 20c for 15 days . \n female sprague - dawley rats ( 200 20 g ) were kept in environmental controlled breeding room for 7 days until the experiment . \n the rats were fasted for 12 h but allowed water ad libitum before the zhigancao extract was orally administered at a dose of 1.21 g / kg . \n orbital venous blood samples ( 0.5 ml ) were collected before dosing , and at 0.5 , 1.0 , 1.5 , 2 , 3 , 4 , 6 , 8 , 12 , 24 , 36 , and 48 h after an administration . \n after centrifuging at 6,677 g for 5 min , the plasma samples were obtained and frozen at 20c until analysis . \n hplc analysis procedure was applied to analyze plasma concentration - time profiles of ila and il . \n data was processed by noncompartmental method using drug and statistics ( das ) 2.0 software package ( chinese pharmacological society , shanghai , china ) . \n the selectivity was evaluated by analyzing blank samples , spiked samples at lloq , and middle qc levels , and actual samples obtained from rats after an oral administration of zhigancao extract . \n for all blank samples , ila , il , and is retention windows were free from endogenous interfering peaks . \n the calibration curves were linear over the concentration range of 0.0603.84 g / ml for ila and 0.0754.80 g / ml for il by weighted ( 1/x ) linear least - squares regression method . \n the res of the back - calculated values of the standards from their nominal values were constantly within 15% for all values , including the lloq . \n the lloq measurement showed the respective averages 0.060 g / ml with rsd 14.5% for ila and 0.077 g / ml with rsd 12.3% for il . \n typical regression equations were calculated as follows : ila , y = 1.024x 0.004 ( r = 0.9954 ) ; il , y = 1.004x + 0.007 ( r = 0.9968 ) . the precision and accuracy data was shown in table 1 . \n the intra- and inter - day rsd values were lower than 10% , and the re values were within 5% . \n the extraction recoveries of ila and il from rat plasma were 79.5 4.2% , 82.5 4.4% , 84.7 4.0% at 1.2 , 4.8 , and 3.07 g / ml and 81.3 4.9% , 82.3 6.6% , 86.4 3.4% at 1.5 , 6.0 , and 3.84 g / ml , respectively . \n these results indicated that the extraction method was suitable to extract ila , il , and is from plasma . \n as shown in table 2 , stability of analytes showed no significant sample loss over 12 h at room temperature , three freeze - thaw cycles , and 15 days storage condition . \n the developed method was applied in pharmacokinetic study of ila and il in rat plasma after an oral administration of zhigancao extract ( at a dose containing 40.8 mg / kg ila and 34.1 mg / kg il , resp . ) . \n the mean plasma concentration - time profiles ( n = 6 ) were shown in figure 3 . \n the assay was sensitive enough for the determination of ila and il in rat plasma after an oral administration of zhigancao extract . \n in this study , we established an hplc method to simultaneously quantify ila and il in rat plasma . due to the stronger polarity of ila and il , \n the recovery with methanol was comparable to acetonitrile , during both processes the analyte concentration in the plasma was diluted when 2.5-fold organic solvent volume was added , so that ila and il couldnot be detected at a low concentration . yet evaporating supernatant to dryness and then dissolving it in a small amount of solvent to increase the concentration would be time - consuming and would cause the loss of analyte . so removing the organic solvent from the supernatant was employed . when the supernatant was added with chloroform , a clear water phase could be obtained by precipitating the protein with acetonitrile , but no stratification could be observed when methanol was used instead of acetonitrile therefore , plasma samples were processed by precipitating protein with acetonitrile which \n wogonoside was selected as the is because of its appropriate retention and extraction recovery . some other compounds such as rutin , baicalin and hesperidin \n were also tested with the selected condition above , but without ideal results . due to its satisfactory separation from the analytes , \n wogonoside was selected as the is . because wogonoside couldnot be detected at 360 nm at the concentration 0.88 g / ml , the wavelength was switched to 276 nm at 9 min . \n the extrapolated fraction of the auc0 accounted for only 5 - 6% , which indicated a suitability of the analytical method for ila and il pharmacokinetic study . \n these two analytes exhibited consistent tendencies in plasma concentration - time profiles and similar tmax , t1/2z and mrt values after an oral administration of zhigancao extract . \n the fact that these two compounds had the similar pharmacokinetic behavior could be tentatively attributed to their having similar structures . \n comparing the pharmacokinetic data of ila with that of il , cmax and auc of ila were lower than that of il although there was more content of the former in zhigancao extract . \n it was possible that ila could be hydrolysis to the il in the intestinal tract or transformed into il after being absorbed . \n we have developed and validated a selective and sensitive hplc method for simultaneous quantification of ila and il in rat plasma . \n the method was successfully applied to the pharmacokinetic study of ila and il in rat plasma after an oral administration of zhigancao extract .", "role": "user" }, { "content": "a sensitive hplc method was developed for the quantitative determination of isoliquiritin apioside ( ila ) and isoliquiritin ( il ) in rat plasma . \n after protein precipitation with acetonitrile , chloroform was used to separate lipid - soluble impurities from the plasma samples and remove acetonitrile . \n a chromatography was carried out on diamonsil c18 ( 150 4.6 mm ; 5 m ) analytical column , using a mobile phase consisting of water ( containing phosphoric acid 0.1% , v / v ) ; acetonitrile ( 72 : 28 , v / v ) at a flow rate of 1.0 ml / min . \n the wavelength - switching technology was performed to determine ila and il at 360 nm and wogonoside ( internal standard , is ) at 276 nm . \n the calibration curves of ila and il were fairly linear over the concentration ranges of 0.0603.84 g / ml ( r = 0.9954 ) and 0.0754.80 g / ml ( r = 0.9968 ) , respectively . \n the average extract recoveries of ila , il , and is were all over 80% . \n the precision and accuracy for all concentrations of quality controls and standards were within 15% . \n the lower limit of quantification ( lloq ) was 0.060 g / ml for ila and 0.075 g / ml for il . \n the method was used in pharmacokinetic study after an oral administration of zhigancao extract to rats .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: skin , the outermost body layer , is capable of displaying the earliest clinical manifestations of certain systemic diseases . according to statistics , cutaneous lesions are the first and sole diagnostic clues to around 1% of internal malignancies . first reported by bazex et al in 1965 , bazex syndrome , also known as acrokeratosis paraneoplastica , refers to a rare paraneoplastic syndrome , which is characterized by psoriasiform eruptions , nail dystrophy , and palmoplantar keratoderma . \n the cutaneous lesions usually involve the ears , nose , fingers , and to a lesser extent , the elbows and knees . \n isolated case reports demonstrated that the neoplasms of liver and the reproductive system could also lead to this paraneoplastic syndrome . here \n , we reported an uncommon case of bazex syndrome about an 83-year - old man with pulmonary adenocarcinoma and correlated osseous metastasis . \n the patient signed informed consent for the publication of this case report and any associated images . and \n an 83-year - old man came to our outpatient clinic presented with slightly pruritic cutaneous lesions involving face , hands , and feet for 5 years . on physical examination , infiltrative erythematous plaques with scales \n were observed on the nose , cheeks , ears , and the dorsa of interphalangeal joints ( figure 1a , b ) ; confluent erythema covered with yellow thick crust were seen on the knees ( figure 1c ) ; all the fingernails were yellow - brown and thickened , with subungual keratotic debris ( figure 1d ) ; both plantar pedis were discolored and hyperkeratotic ( figure 1e ) . \n ( a ) dark red , infiltrative , desquamative plaques on the nose and cheeks ; ( b ) dark red , infiltrative plaques with scales on the right auricle ; ( c ) confluent erythema covered with yellow thick crust on the knees ; ( d ) infiltrative erythematous plaques with scales on the dorsa of interphalangeal joints ; all the fingernails were yellow - brown and thickened , with subungual keratotic debris ; and ( e ) both plantar pedis were discolored and hyperkeratotic . the patient recalled a body - weight loss of 5 kg during the previous 2 years . \n laboratory analyses revealed that serum levels of creatine kinase , creatine kinase - mb , and lactate dehydrogenase were all within normal ranges . \n erythrocyte sedimentation rate ( 55 mm / hour ) and tumor marker ca125 ( 105.5 u / ml ) were significantly upregulated . the computed tomography ( ct ) scan detected a pulmonary adenocarcinoma and a number of local metastatic nodules on the right lower lobe , along with mediastinal swollen lymph nodes ( figure 2a ) . \n ( a ) computed tomography of the chest showed pulmonary adenocarcinoma on the right lower lobe with multiple local metastatic nodules ; the mediastinal lymph nodes were swollen ; ( b ) the histological examination of cutaneous lesions on the left knee ( he 200 ) exhibited pronounced epidermal hyperkeratosis and parakeratosis , mild irregular acanthosis , mononuclear cell infiltration around blood vessels within the upper dermis , and roughly normal subcutaneous tissue . \n direct microscopy and culture showed no signs of fungal infection in his fingernails or toenails . \n we performed a biopsy of cutaneous lesion over the left knee , which exhibited pronounced epidermal hyperkeratosis and parakeratosis , mild irregular acanthosis , mononuclear cell infiltration around blood vessels within the upper dermis , and roughly normal subcutaneous tissue ( figure 2b ) . based on his characteristic acral dermatitis and nail damage along with pulmonary adenocarcinoma , we diagnosed him as bazex syndrome . \n he was given topical dexamethasone ointment twice a day and oral acitretin 10 mg twice a day . \n since the cutaneous lesions had no significant improvement after 10 days , we discontinued this combined therapy . \n subsequently , the patient started to receive gefitinib tablet 250 mg once a day , which is a potent anticancer drug with reported efficacy in treating lung adenocarcinoma . \n repetitive imaging examination demonstrated that the size of his pulmonary considerably reduced , but his bone metastases remained unchanged . \n ( a , b ) after treatment with gefitinib , the facial lesions alleviated significantly . \n an 83-year - old man came to our outpatient clinic presented with slightly pruritic cutaneous lesions involving face , hands , and feet for 5 years . on physical examination , infiltrative \n erythematous plaques with scales were observed on the nose , cheeks , ears , and the dorsa of interphalangeal joints ( figure 1a , b ) ; confluent erythema covered with yellow thick crust were seen on the knees ( figure 1c ) ; all the fingernails were yellow - brown and thickened , with subungual keratotic debris ( figure 1d ) ; both plantar pedis were discolored and hyperkeratotic ( figure 1e ) . \n ( a ) dark red , infiltrative , desquamative plaques on the nose and cheeks ; ( b ) dark red , infiltrative plaques with scales on the right auricle ; ( c ) confluent erythema covered with yellow thick crust on the knees ; ( d ) infiltrative erythematous plaques with scales on the dorsa of interphalangeal joints ; all the fingernails were yellow - brown and thickened , with subungual keratotic debris ; and ( e ) both plantar pedis were discolored and hyperkeratotic . \n the patient recalled a body - weight loss of 5 kg during the previous 2 years . \n laboratory analyses revealed that serum levels of creatine kinase , creatine kinase - mb , and lactate dehydrogenase were all within normal ranges . \n erythrocyte sedimentation rate ( 55 mm / hour ) and tumor marker ca125 ( 105.5 u / ml ) were significantly upregulated . the computed tomography ( ct ) \n scan detected a pulmonary adenocarcinoma and a number of local metastatic nodules on the right lower lobe , along with mediastinal swollen lymph nodes ( figure 2a ) . \n ( a ) computed tomography of the chest showed pulmonary adenocarcinoma on the right lower lobe with multiple local metastatic nodules ; the mediastinal lymph nodes were swollen ; ( b ) the histological examination of cutaneous lesions on the left knee ( he 200 ) exhibited pronounced epidermal hyperkeratosis and parakeratosis , mild irregular acanthosis , mononuclear cell infiltration around blood vessels within the upper dermis , and roughly normal subcutaneous tissue . \n direct microscopy and culture showed no signs of fungal infection in his fingernails or toenails . \n we performed a biopsy of cutaneous lesion over the left knee , which exhibited pronounced epidermal hyperkeratosis and parakeratosis , mild irregular acanthosis , mononuclear cell infiltration around blood vessels within the upper dermis , and roughly normal subcutaneous tissue ( figure 2b ) . \n based on his characteristic acral dermatitis and nail damage along with pulmonary adenocarcinoma , we diagnosed him as bazex syndrome . \n he was given topical dexamethasone ointment twice a day and oral acitretin 10 mg twice a day . \n since the cutaneous lesions had no significant improvement after 10 days , we discontinued this combined therapy . \n subsequently , the patient started to receive gefitinib tablet 250 mg once a day , which is a potent anticancer drug with reported efficacy in treating lung adenocarcinoma . \n repetitive imaging examination demonstrated that the size of his pulmonary considerably reduced , but his bone metastases remained unchanged . \n ( a , b ) after treatment with gefitinib , the facial lesions alleviated significantly . \n bazex syndrome is a rare paraneoplastic disease , which is most prevalent with squamous cell carcinomas of the upper digestive tract and cervical metastasis of an unknown origin . \n the typical clinical feature of bazex syndrome is psoriasiform eruptions that favors acral such as the fingers ( 61% ) , toes ( 39% ) , ears ( 79% ) , and nose ( 63% ) , with tenderness but no pruritus in most cases . \n this disorder typically progresses in 3 stages : cutaneous lesions on the ears , fingers , and nails ; palmoplantar keratosis ; the involvement of the knees , elbows , and torso . \n remarkably , the underlying malignancy tends to display its symptoms during the stage of palmoplantar keratosis . \n particular features in the epidermis include hyperkeratosis , parakeratosis , and irregular acanthosis to a lesser extent . \n abreu velez and howard proposed a crossed reaction between specific types of tumor and cutaneous antigens . \n the growth factors released by highly proliferative cancer cells and neoplasm - associated zinc deficiency might also contribute to the occurrence of this cutaneous paraneoplastic disorder . \n the cutaneous eruptions of bazex syndrome are typically refractory to local therapy , including coal tar , salicylic acid , vitamin d analogues , corticosteroids , and ultraviolet radiation . \n notably , the reappearance of those lesions may indicate the recurrence of the tumor or tumor metastases . in the most reported cases , \n the emergence of cutaneous lesions precede the symptoms of an underlying neoplasm by several months . \n therefore , it is important to recognize these paraneoplastic skin features to achieve early diagnosis of malignancies . \n our report here highlighted a potential correlation between pulmonary adenocarcinoma and bazex syndrome , which is characterized by hallmark nail destruction and preferential involvement of body extremities . \n recognition of these hallmark signs may allow a timely diagnosis of the underlying malignancy . moreover ,", "role": "user" }, { "content": "abstractbazex syndrome , a rare paraneoplastic syndrome characterized by psoriasiform eruptions , palmoplantar keratosis , and symmetric onychodystrophy , is most prevalent with squamous cell carcinomas of the upper aerodigestive tract.here , we reported an uncommon case of bazex syndrome about an 83-year - old man with pulmonary adenocarcinoma and osseous metastasis , physical examination found psoriasiform eruptions on the nose , cheeks , ears , knees , and the dorsa of interphalangeal joints , along with plantar keratosis and symmetric onychodystrophy involving hands and feet . imaging analyses pulmonary adenocarcinoma with both local metastatic nodules and osseous metastasis.symptomatic treatment with topical corticosteroids and oral retinoids showed no improvement . \n a 4-month follow - up showed that gefitinib , an epidermal growth factor receptor tyrosine kinase inhibitor , successfully reduced primary tumor size and alleviated cutaneous lesions.our report here highlighted a potential correlation between pulmonary adenocarcinoma and bazex syndrome , which is characterized by hallmark nail destruction and preferential involvement of body extremities . \n moreover , etiological therapy against underlying malignancy is essential for treating paraneoplastic bazex syndrome .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: study participants were derived from a study of influenza vaccine effectiveness conducted within a 14zip code region surrounding marshfield , wisconsin , during january march 2005 . \n eligible participants included children 623 months of age , adults > 65 years of age , and persons 24 months64 years of age with a high - risk medical condition . \n research coordinators recruited eligible patients and obtained samples for influenza culture during inpatient and outpatient encounters for acute respiratory illness . each participant ( or parent ) completed a short interview form to assess symptoms and onset date , and culture - confirmed patients were contacted again to determine the illness recovery date . \n the study was approved by the marshfield clinic institutional review board , and all participants provided written informed consent . \n cultures were examined for cytopathic effect , and cultures showing no cytopathic effect were tested twice for hemagglutination titers . \n influenza a and b were confirmed by immunofluorescence ( chemicon international , inc . , temecula , ca , usa ) . \n all influenza a isolates were tested for adamantane resistance at the centers for disease control and prevention ( cdc ) . \n a medical record review was performed to assess any use of antiviral drugs by influenza a patients from 60 days before through 14 days after the enrollment date . \n univariate comparisons were performed , and crude and adjusted prevalence ratios were computed to evaluate the association between adamantane resistance and age , gender , vaccination status , date of clinical encounter , and presence of a high - risk medical condition . \n the referent period was the second 3-week period when the number of influenza cases peaked . \n influenza virus was isolated in 167 ( 20% ) of 818 cultures from ill cohort members ; 153 ( 92% ) were influenza a ( h3n2 ) and 14 ( 8% ) were influenza b ( figure ) . \n adamantane resistance was present in 72 ( 47% ) of 152 influenza a isolates ; 1 additional isolate was not characterized . \n all resistant isolates contained a point mutation resulting in a serine to asparagine change at amino acid 31 ( s31n ) of the m2 protein . \n the median age was 43.6 years among patients with resistant isolates and 64.7 years among those with susceptible isolates ( p = 0.002 ) . \n the proportion of patients with adamantane - resistant viruses was significantly higher in 6- to 23-month - old children ( 70% ) compared with adults > 65 years of age ( 39% ) ( unadjusted prevalence ratio 1.8 ; 95% confidence interval [ ci ] 1.22.6 ; p = 0.003 ) . \n number of symptoms and duration of illness were similar for patients with adamantane - resistant and -susceptible influenza isolates ( table 1 ) . \n the proportion of patients hospitalized was nearly the same in each group , and the distribution of individual symptoms did not differ significantly . \n forty - five patients received antiviral therapy ( 37 adamantanes , 8 oseltamivir ) , but only 1 was treated with amantadine before influenza culture was obtained . clinical features and duration of illness were similar whether or not patients received adamantane therapy . in a multivariable model that included patients of all ages , \n adamantane resistance was not associated with gender , time of clinical encounter , or influenza vaccination status ( table 2 ) . \n children 623 months old without a high - risk medical condition were significantly more likely to be infected with adamantane - resistant influenza a than were adults > 65 years of age who had a high - risk condition . in a secondary analysis \n , no association was found between adamantane resistance and number of symptoms , duration of illness , or hospitalization . \n * , fisher exact , or wilcoxon rank sum tests performed as appropriate . based on 128 influenza a patients who had recovered fully at the time of follow - up interview . \n children 6 to 23 months of age were excluded from the numerator and denominator for symptoms . \n for the multivariate model , a composite variable was created based on age and the presence or absence of a high - risk medical condition as defined by advisory committee on immunization practices criteria . \n this study provides epidemiologic evidence that the point mutation ( s31n ) conferring adamantane resistance has not altered influenza a ( h3n2 ) virulence as measured by clinical symptoms and duration of illness . \n hospitalization rates were also similar , although the power to detect a difference was low . \n these results are consistent with prior research in ferrets , which demonstrated that virulence was similar for adamantane - resistant and -susceptible influenza a ( h3n2 ) isolates ( 8) . \n the source population for this study included persons who were eligible for influenza vaccination based on age group or the presence of a high - risk medical condition . \n consequently , participants were more likely to experience influenza complications relative to the general population . \n the absence of any difference in clinical severity in this higher risk population provides some reassurance that adamantane resistance will not affect overall influenza morbidity . \n factors contributing to rapid emergence of adamantane - resistant influenza viruses are not fully known . \n resistance has been observed in a variety of outbreak and institutional settings for many years ( 1012 ) but did not spread into the general population until recently ( 6,7 ) . \n the proportion of human influenza a ( h3n2 ) isolates with adamantane resistance increased dramatically in people s republic of china and taiwan in 2003 ( 6 ) . \n however , the degree to which the spread of resistant viruses from asia contributed to the rapid escalation of adamantane resistance in the united states is uncertain . \n the 200405 influenza season provided an opportunity to learn more about the epidemiology of adamantane resistance during a period when drug resistance was increasing in wisconsin but was not yet universal . \n children had the highest risk of acquiring an adamantane - resistant influenza infection and are an important reservoir for transmission of influenza to adult household members and the community ( 13 ) . still \n , we can not explain why children were preferentially infected with adamantine - resistant strains in 200405 . \n the higher prevalence of resistance in children was therefore not attributable to individual adamantane use . \n there may have been multiple introductions of adamantane - resistant influenza viruses from other geographic areas during the 200405 season . \n this phenomenon was described in a recent phylogenetic analysis of influenza a ( h3n2 ) isolates from new york state over a 9-year period ( 14 ) . \n the analysis suggested that viral evolution within epidemic seasons is dominated by random importation of distinct viral strains from other geographic areas . \n cdc continues to recommend that adamantane drugs not be used for influenza treatment in the united states . \n given the recent emergence of oseltamivir - resistant influenza a and b infections ( 15,16 ) , ongoing monitoring of influenza virus susceptibility to adamantanes and neuraminidase inhibitors is essential .", "role": "user" }, { "content": "adamantane - resistant influenza a is an emerging problem , but infections caused by resistant and susceptible viruses have not been compared . \n we identified adamantane resistance in 47% of 152 influenza a virus ( h3n2 ) isolates collected during 2005 . \n resistant and susceptible viruses caused similar symptoms and illness duration . \n the prevalence of resistance was highest in children .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: risk stratification in patients suffering from heart failure ( hf ) is based on a variety of clinical and laboratory variables . \n indeed , several prognostic parameters have been identified , including age , new york heart association ( nyha ) class , renal function , comorbidity such as atrial fibrillation , diabetes mellitus , and ischemic heart disease . in acute decompensated heart failure ( adhf ) \n episodes , the degree of renal dysfunction and arterial hypotension easily stratified patients with worst clinical outcome . a single determination of brain natriuretic peptide ( bnp ) plasma level represents a reliable risk stratification procedure and its increase is considered a sensitive diagnostic marker of left ventricular dysfunction having a clear prognostic relevance in predicting cardiovascular events in hf patients . in discharged hf patients \n the combination of galectin-3 and nt - probnp seemed to be the best predictor for short - term ( 60-day ) mortality in the pride study . \n furthermore , in the substudy of coach galectin-3 demonstrated to be a robust independent marker of cardiovascular mid - term ( 18-month ) outcome in hf patients with much stronger relevance in patients with preserved left ventricular ejection fraction ( lvef ) in comparison with reduced lvef . finally , shah et al documented as a single determination of galectin-3 during an adhf hospitalization predicted mortality ( in 63% being above the median value ) in a longer follow - up ( 4-year ) independently of echocardiographic parameters of hf severity . \n advanced hf patients constitute a challenge for cardiologists according to their high mortality and rehospitalization rate . \n therefore , a strategy for stratify planning tailored clinical follow - up in those patients seems to be mandatory . \n the objective of this study was to analyze the value of a single , predischarged determination of plasma galectin-3 alone and in correlation with plasma bnp in predicting mid - term clinical outcome in worst clinical outcome [ frequent - flyers ( ff ) + death ] chronic hf patients discharged after an adhf episode . \n all chronic hf subjects discharged after an acute episode of cardiac decompensation were enrolled in an out - patient clinic follow - up . \n patients were classified as having chf according to the criteria commonly accepted in literature , namely the presence of 2 major criteria or 1 major criterion + 2 minor criteria according to the framingham score and an nyha functional class ii , iii , or iv , due to an exacerbation of symptoms with at least 1 class deterioration . \n the presence of inadequate echo images or no adherence to the therapy and disagreement with the periodical follow - up were considered exclusion criteria . \n all patients underwent a clinical examination , a 12-lead electrocardiogram , plasma determination of bnp , water composition ( on admission and at discharge ) , 6-minute walk test , noninvasive cardiac output , and a transthoracic echocardiogram within 48 hours upon hospital discharge . \n the criteria for discharging hf patients were the following : subjective improvement on the basis of nyha class , with no orthopnea ; 90 < sbp < 120 mm hg ; heart rate < 100 bpm ; pulse oxymetry in ambient air > 90% ; and diuresis > \n serum creatinine was checked on clinical stability . according to the study protocol , hf out - patients \n were checked at 3 and 6 months after discharge . in case of worsening of the clinical status ( worsening dyspnea , body weight increase or edema , and cardiac arrhythmias ) , \n the therapy prescribed in those patients included angiotensin - converting enzyme inhibitors ( enalapril , ramipril ) , angiotensin receptor blockade ( valsartan ) in case of enalapril / ramipril intolerance , beta - blockers ( bisoprolol ) , digoxin , loop diuretic , and spironolactone at low dose . for beta - blockers , angiotensin - converting enzyme inhibitors , and angiotensin receptor blockade , the patients \n echocardiograms were performed with a vivid 7 computed sonography system ( ge medical systems , waukesha , wi ) according to the recommendations of the american society of echocardiography . \n two - dimensional apical 2- and 4-chamber views were used for volume measurements ; left ventricle ejection fraction ( lvef ) was calculated with a modified simpson method using biplane apical ( 2- and 4-chamber ) views . the left ventricle ( lv ) end - diastolic volume and \n all the echo examinations were performed by expert operators blinded to the results of bnp assay ; the intraobserver variability in the evaluation of lvef was found to be<5% . \n echocardiographic measurements , including lv end - diastolic diameter and the diastolic thickness of the ventricular septum and the posterior lv wall , were determined according to the american society echocardiography recommendations . \n the definition of restrictive filling pattern ( grade 3 ) was a predefined modification of classifications used in prior studies : e / a 2 , dt 150 msec , s / d ratio < 1 , and ar > 35 cm / sec . \n the other diastolic filling patterns were classified as : grade 1 ( abnormal relaxation ) when e / a < 1 with a dt > 240 ms ; grade 2 ( pseudonormal ) when e / a between 0.75 and 1.5 , dt between 160 and 240 ms and finally e / ea > 15 . \n the doppler sample was set 1 to 2 mm under the free edges of the mitral valve using the apical 4-chamber projection ; an average of 5 beats was considered . in patients suffering from atrial fibrillation at the time of the echocardiogram , \n the diastolic function was classified as : restrictive pattern ( dt 150 msec ) or indeterminate ( dt > 150 msec ) . \n the presence of this diastolic pattern with an lvef > 50% was defined as an isolated diastolic dysfunction . \n the tricuspid annular plane systolic excursion was measured in a 4-chamber view by placing the 2d cursor at the tricuspid lateral annulus and measuring the distance of systolic annular rv excursion along a longitudinal line defining the end of systole as the end of the t wave in the electrocardiogram . \n systolic right ventricular ( or pulmonary artery ) pressure was calculated using the modified bernoulli equation : pap = 4 ( tricuspid systolic jet ) + 10 mm hg ( estimated right atrial pressure ) . \n whole blood was obtained from subjects via standard venipuncture just before discharging , when patients were considered stabilized after an acute hf admission . \n serum was isolated within 60 minutes of sampling , shipped overnight refrigerated and stored at 70 colder until the time of testing . \n this assay has a lower limit of detection of 1.13 g / l and demonstrated no cross - reactivity with other galectins or collagens . \n the bedside triage b type natriuretic fluorescence immunoassay ( alere diagnostics , ca ) was also used in all population studied . \n the triage meter is used to measure bnp concentration by detecting a fluorescent emission that reproduces the amount of bnp in the blood . \n a total of 250 l of whole blood was added to the disposable device , then the cells were filtered and separated from the plasma with bnp , which entered a reaction chamber , containing fluorescent bnp antibodies . \n after 2-minute incubation , the bnp antibody mixture migrated to an area containing immobilized antibodies and remained fixed . \n performance characteristics of the test : assay range 5 to 5000 pg / ml ; total cv 9.2% to 11.4% . death by any cause , cardiac transplantation , and worsening hf requiring readmission to the hospital were considered cardiovascular events . \n data regarding the occurrence of cardiovascular events were collected from multiple sources in all patients ( follow - up consultations or phone calls ) . \n the study protocol conforms to the ethical guidelines of the 1975 declaration of helsinki ; an informed consent was required for every patients and our local ethic committee approved this study . \n categorical data were presented as numbers ( percent ) , continuous data as mean standard deviation ( sd ) for normally distributed variables . \n wilk test was used to evaluate whether or not the distribution of the variables was normal . \n the mean values of any 2 groups were compared using the student t test and the means of more 2 groups were assessed using analysis of variance followed by the bonferroni multiple - comparison test . \n the pearson test and the fischer exact test were used for comparing categorical variables ( nyha class , cardiovascular events ) . \n the spearman rank - order correlation coefficient ( rho ) was used to measure the strength and direction of association between galectin-3 and glomerular filtrate and between galectin-3 and bnp . \n event - free survival was estimated by kaplan meier method , and curves were compared with the log - rank test . \n all statistical calculations were performed on stata software ( version 11.0 stata corporation , college station , tx ) . \n categorical data were presented as numbers ( percent ) , continuous data as mean standard deviation ( sd ) for normally distributed variables . \n wilk test was used to evaluate whether or not the distribution of the variables was normal . \n the mean values of any 2 groups were compared using the student t test and the means of more 2 groups were assessed using analysis of variance followed by the bonferroni multiple - comparison test . the pearson test and the fischer exact test were used for comparing categorical variables ( nyha class , cardiovascular events ) . \n the spearman rank - order correlation coefficient ( rho ) was used to measure the strength and direction of association between galectin-3 and glomerular filtrate and between galectin-3 and bnp . \n all statistical calculations were performed on stata software ( version 11.0 stata corporation , college station , tx ) . \n eighty - three patients ( 67 males , age 73.2 8.6 years old ) were discharged after a new diagnosis of chf or for acute decompensation in chronic chf and were requested to enter the study , signing an informed consent and were enrolled ( mean follow - up 11.6 5.2 months ; range 422 months ) . \n the etiology of hf was interpreted as : 35 ischemic ( 42.1% ) , 23 cardiomyopathy ( 28% ) , 22 hypertensive ( 26.5% ) , and finally 3 others ( 3.6% ) . during the follow - up 48 events ( 57.8% ) \n twenty - eight hf patients were hospitalized 2 times / year ( range 24 times / year ) and were defined ff ( 8 patients out of 28 died because of a cardiac death ) . \n therefore , the group with a worst clinical prognosis ( ff + cardiac death ) was formed by 33 patients ( 39.8% ) . \n although the events group population seemed to be not older or hyponatremic , the predischarge value of galectin-3 and plasma bnp were significantly higher ( p = 0.027 and 0.005 , respectively ) . in hf patients with worst clinical outcome a more severe impairment in lv systolic function ( p = 0.0037 ) emerged , without a significant lv enlargement or a right ventricular involvement . \n however , the diastolic filling pattern evaluated with echocardiography seemed to be not different in the 2 groups . at univariate analysis \n , a negative spearman coefficient ( rho ) of 0.38 indicates a moderate decreasing monotonic trend between galectin-3 and glomerular filtrate ( p = 0.0055 ) , while a positive correlation ( rho = 0.44 , p = 0.002 ) between galectin-3 and bnp was detected . at multivariate analysis \n , only galectin-3 showed a significant correlation with worst clinical prognosis ( p = 0.047 ; odds ratio 1.05 , confidence interval 1.0011.10 ) , independently to age and renal function , being for each galectin-3 increment of 1 ng / ml determined an increase of 5% in probability of cardiovascular events . \n choosing adequate cut - off points , the kaplan meier curves depicted the powerful stratification using a galectin-3 level of 17.6 pg / ml ( fig . \n 1 ) added to plasma bnp level of 500 pg / ml ( log rank 5.65 ; p = 0.017 ) . differences between main parameters in event group ( ff + death ) versus control group . \n the kaplan meier event - free curve ( with the log - rank ) according to the selected cut - off values for galectin-3 ( 17.6 ng / ml ) and brain natriuretic peptide ( bnp ) ( 500 pg / ml ) . \n elderly patients with chronic hf represent most of subjects ( 70% ) admitted to hospitals for acute cardiac decompensation ; the length of hospitalization lasts usually > 2 weeks in geriatric wards and readmissions are frequent . \n recently , the optimize - hf study included more than 30,000 hf patients discharged from 215 hospitals , described a short length of hospitalization ( 4 days ) but a 21.3% of rate of readmission within 30-day . \n this study evidenced as an early ( 1-week ) outpatient clinical follow - up after discharged helped hf patients to undergo to a lower probability to be readmitted within 30-day . in the in - hf outcome , an italian nationwide registry , the 30-day mortality after discharging for an acute episode of hf proved to be 2.8% and hospital readmission 6.2% . \n older age , longer in - hospital stay , the necessity of inotrope use , and worsening nyha class identified hf patients discharged home who are at highest risk of death or readmission . \n multiple interventions such as patients education , discharge planning , complete adherence to a correct and tailored medical therapy , scheduling follow - up after discharge , attention to caregivers , and follow - up telephone calls might be useful in reducing the 30-day risk of readmission and , generally , more comprehensive interventions reported greater success . according to the huge number of hf patients discharged from our hospitals , easy and practical prognostic parameters able to predict adverse outcome are mandatory in order to allocate correctly our resources and established tailoring specific follow - up . \n the analysis of this single - center hf clinic experience demonstrates as in older systolic hf patients discharged after an adhf episode , the single determination of galectin-3 and bnp permitted to predict worst clinical outcome ( death or multiple hospital admissions ) at mid - term ( 11 months ) follow - up . \n galectin-3 is a lectin secreted in plasma usually at low levels but increased substantially the secretion under conditions like injury or stress , having a biological role in cell adhesion , inflammation , and above all , tissue fibrosis . \n a single value of galectin-3 in patients admitted for an episode of adhf clearly demonstrated a powerful prognostic power in predicting mortality and rehospitalization at short- or long - term follow - up . on the contrary , a low plasma level of galectin-3 ( < 11.8 ng / ml ) proved to be an independent predictor ( odds ratio 20.9 ; p = 0.003 ) for the absence of mortality and rehospitalization at a short - term follow - up ( 6 months ) suggesting that a reclassification of the alive hf patients at discharge might help in planning an adequate clinical follow - up \n however , nt - probnp did not add an incremental value in order to predict low - risk events outcome postulating as natriuretic peptide , exploring hemodynamic loading conditions , might be less specific in detecting hf patients with favorable outcome \n . moreover , the pooled analysis of 3 clinical trials including 902 hf patients demonstrated as hf patients with galectin-3 > 17.8 pg / ml had more risk ( 2.63 times ) to be readmitted for adhf from 30 to 120 days after discharge . in our experience , none of other demonstrated parameters ( renal function , length of hospital stay [ los ] , and hemoglobin ) seemed to correlate with an unfavorable outcome . \n in particular , the los was not different in the 2 groups , being prolonged ( > 10 days ) according to the older age and the presence of comorbidity in a real - world population . \n in fact , while in optimize - hf the los was documented very short , in in - hf outcome , based on data coming from cardiology department , a prolonged los ( 10 days ) emerged and significantly correlated with the risk of 30-day readmission . \n data coming from the everest trial suggested as a longer los was associated with cardiovascular and all cause hospital admissions , but indicated a lower risk of hf readmissions for hf within 30 days after discharging . in our experience , the limited series and the prolonged los did not permit to observe an influence by los in clinical outcome . \n finally , in a paramount of interesting predicting parameters in hf , clinicians should concentrate their attention on the most specific and cheapest at the moment of discharging your patients . \n therefore , chronic hf patients discharged alive after an adhf with an elevated predischarge value of galectin-3 ( 17.6 ng / ml ) together with bnp ( 500 pg / ml ) might be inserted into a rigid clinical follow - up , performed by the general practitioner or the hf out - clinic ambulatory , providing a strict control of body weight , hydration status , pharmacological adherence , and clinical status in order to prevent multiple readmissions . \n the main limitation of this study was the small sample size observed that might reduce the power of some consolidated prognostic parameters ( as renal function ) . \n moreover , the sample size did not permit a correct distinction between hfref and hfpef . \n finally , the risk of multiple rehospitalization for hf has normally correlated to the severity of cardiac condition as well as other nontested patient - related factors ( social status , cognitive performance , and presence / absence of caregiver ) that might significantly influence the rate of readmissions . in fact , it has been documented in the dig trial , as about 58% of the nation variations in hospital readmission were correlated with socioeconomic factors .", "role": "user" }, { "content": "abstractgalectin-3 demonstrated to be a robust independent marker of cardiovascular mid - term ( 18-month ) outcome in heart failure ( hf ) patients . \n the objective of this study was to analyze the value of a predischarged determination of plasma galectin-3 alone and with plasma brain natriuretic peptide ( bnp ) in predicting mid - term outcome in frequent - flyers ( ff ) hf ( 2 hospitalization for hf / year)/dead patients discharged after an acute decompensated hf ( adhf ) episode.all ff chronic hf subjects discharged alive after an adhf were enrolled . \n all patients underwent a determination of bnp and galectin-3 , a 6-minute walk test , and an echocardiogram within 48 hours upon hospital discharge . \n death by any cause , cardiac transplantation , and worsening hf requiring readmission to hospital were considered cardiovascular events.eighty-three patients ( 67 males , age 73.2 8.6 years old ) were analyzed ( mean follow - up 11.6 5.2 months ; range 422 months ) . during the follow - up 38 events ( 45.7% ) were scheduled : ( 13 cardiac deaths , 35 rehospitalizations for adhf ) . according to medical history , in 33 patients ( 39.8% ) a definition of ff \n hf patients was performed ( range 24 hospitalization / year ) . \n hf patients who suffered an event ( ff or death ) demonstrated more impaired ventricular function ( p = 0.037 ) , higher plasma bnp ( p = 0.005 ) , and gal-3 at predischarge evaluation ( p = 0.027 ) . choosing adequate cut - off points ( bnp 500 pg / ml and gal-3 17.6 ng / ml ) , the kaplan meier curves depicted the powerful stratification using bnp + gal-3 in predicting clinical course at mid - term follow - up ( log rank 5.65 ; p = 0.017).adding gal-3 to bnp , a single predischarge strategy testing seemed to obtain a satisfactorily predictive value in alive hf patients discharged after an adhf episode .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: analgesic therapies for managing painful conditions currently rely on three major classes of drugs : non - steroidal anti - inflammatory drugs ( nsaids ) , opioids , and adjuvants ( antidepressants , anticonvulsants , local anesthetics , 2-adrenoceptor agonists ) . \n safe and effective pain control is essential for today 's dental practice and local anesthesia plays a fundamental role by reducing the fear , anxiety , and treatment time associated with dental procedures . \n local anesthesia forms the backbone of pain control techniques in dentistry . from cocaine ( 1884 ) , procaine ( 1904 ) , to lidocaine ( 1948 ) , dentistry has been in forefront in seeking to provide patients with pain - free treatment . \n amides are more often used than ester agents since amides produce more rapid and reliable profound surgical anesthesia . \n new amino ester local anesthetics were synthesized between 1891 and 1930 , such as tropocaine , holocaine , benzocaine , and tetracaine . \n in addition , amino amide local anesthetics were prepared between 1898 and 1972 , including procaine , chloroprocaine , cinchocaine , lidocaine , mepivacaine , prilocaine , bupivacaine , etidocaine , and articaine . \n lidocaine was prepared by nils lofgren in 1943 and was introduced into market in 1948 , and it has become the most common local anesthetic to be used . because of safety and effectiveness , lidocaine also has become the gold standard for comparison among the newer local anesthetic agents . \n carticaine , first prepared by rusching and colleagues in 1969 , had its generic name changed to articaine when it entered clinical practice in germany in 1976 . \n its use gradually spread , entering north america in 1983 and the united kingdom in 1998 . \n as with lidocaine , articaine is also classified under amide group of local anesthetics with intermediate duration of action . \n literature reports that patients treated with articaine become drug free more quickly than those who receive other local anesthetics . \n the advantages of articaine are as follows : articaine causes a transient and completely reversible state of anesthesia ( loss of sensation ) during dental procedures ; in dentistry , articaine is used both for infiltration and block injections , and with the block technique , it yields the greatest duration of anesthesia ; also , in people with hypokalemic sensory overstimulation , lidocaine is not very effective , but articaine works well . \n endodontic and operative treatments are among the most common oral non - surgical procedures done under local anesthesia . \n various local anesthetic agents like lidocaine , bupivacaine , and prilocaine have been used for the purpose . \n it was approved for use in the united states in april 2000 and is marketed as septocaine ( septodont , new castle , de , usa ) and as a 4% solution with 1:100,000 epinephrine . \n equal analgesic efficacy along with lower systemic toxicity ( i.e. , a wide therapeutic range ) allows use of articaine in higher concentrations than other amide - type local anesthetics . \n labial or lingual infiltration injections with lidocaine are not effective for achieving pulpal anesthesia in mandibular teeth . adding a labial infiltration of 1.8 ml of 2% lidocaine with 1:100,000 epinephrine to a conventional inferior alveolar nerve block injection increases the success of pulpal anesthesia in mandibular anterior teeth , but not in mandibular molar . on the contrary , an infiltration injection of the mandibular second molar with 4% articaine with 1:200,000 epinephrine successfully achieved pulpal anesthesia in 63% of cases . \n perhaps infiltration injection of an articaine solution adjacent to the first molar would be more successful and should be studied experimentally . \n a study was conducted to compare 2% lidocaine and 4% articaine in achieving pulpal anesthesia in mandibular molars and it reported statistically significant difference between these solutions in achieving pulpal anesthesia in mandibular molars by buccal infiltration . \n similar studies reported a success rate of 7592% with articaine and 4567% with lidocaine by single buccal infiltration in permanent mandibular molars . \n articaine is contraindicated in patients allergic to amide - type anesthetics and patients allergic to metabisulfites ( preservative present in the formula to extend the life of epinephrine ) , as there is no cross - allergenicity between sulfites ( preservatives ) , sulfur , and the sulfa-type antibiotics . \n it is contraindicated in patients with hemoglobinopathies ( sickle cell disease ) and also in patients with idiopathic or congenital methemoglobinemia , but methemoglobinemia is not a concern in the dental practice due to the small volumes of articaine used . \n articaine is not contraindicated in patients with sulfa allergies ; there is no cross - allergenicity between articaine 's sulfur - bearing thiophene ring and sulfonamides . \n however , the aim and objective of our study was to compare 4% articaine and 2% lidocaine in achieving pulpal anesthesia of the lower first permanent molar teeth objectively and also to assess and compare lip numbness and lingual mucosa numbness in volunteers subjectively after single buccal infiltration of local anesthesia . \n study was designed as a prospective randomized double - blind crossover trial , comparing lidocaine 2% ( 1:100,000 epinephrine ) with articaine 4% ( 1:100,000 epinephrine ) [ tables 1 and 2 ] . \n materials used in the study pharmacology of local anesthetics used a power calculation indicated that 31 subjects would provide a 90% chance of detecting an effect size of 0.83 ( a change of 0.83 standard deviations ) in a continuous outcome measure , assuming a significance level of 5% and a correlation of 0.5 between the responses of same subject . \n subjects with known or suspected allergies , sensitivities to sulfites and amide - type local anesthetics or to any ingredient in the anesthetic solution , concomitant cardiac disease , neurological disease , pregnant women or lactating mothers , subjects with concomitant use of monoamine oxidase inhibitors , tricyclic antidepressants , phenothiazine , vasodepressor drugs , or ergot - type oxytocic drugs , subjects who were on sedatives , who had taken aspirin , acetaminophen , nsaids 24 h prior to administration of local anesthetic , or the teeth tested as non - vital were not included in the study . \n thirty - two healthy subjects with age ranging from 15 to 35 years and having initial occlusal caries confirmed by intraoral periapical radiograph were selected as a group . \n they were treated as group i to receive 2% lidocaine with 1:100,000 epinephrine ( xylocaine ; astra zeneca pharma , uk ) in the first visit and the same individuals were treated as group ii to receive 4% articaine with 1:100,000 epinephrine ( septanest ; septodont , saint - maur - des - fosss , france ) local anesthesia in the second visit . \n the subjects were treated by the same operator and dental nurse at two different visits . \n the selected subjects received 1.7 ml of any one anesthetic in the mucobuccal fold adjacent to the mandibular first molar in the first visit , and the same individuals received the second infiltration at the same area using a standard dental aspirating syringe at least 1 week after the first visit . \n anesthesia was administered at the rate of 0.9 ml/15 s and was injected over a period of 30 s. both the subjects , and the dentist and dental nurse were blinded for the drug being used and had no involvement with testing the outcome . \n pulp sensitivity was determined by the dental nurse using an electric pulp tester ( gentle pulse ; parkell , edgewood , ny , usa ) on the occlusal surface of the mandibular first molar twice before the injection , in order to establish a baseline reading . \n the same area of the tooth was tested each time and the mean of these two readings was taken as the baseline data . \n pulp testing was then repeated once in every 2 min after injection for 30 min . to confirm the validity of reading , a control , unanesthetized tooth on the contralateral side was tested at the same time . the change in pulp tester readings at the first sensation from the baseline \n similarly , the numbers of episodes of no response at the maximum stimulation were recorded . \n in addition to objective assessment of pulpal anesthesia , volunteers were asked to inform the investigator about the feeling of numbness in the lip and lingual mucosa when it appeared . \n \n the study sample consisted of 32 patients , which was decided according to power calculation . \n the sample consisted of 7 males ( 21.9% ) and 25 females ( 78.1% ) , with the mean age 18.2 years . \n twenty - eight patients , i.e. 87.5% , experienced anesthetic success ( i.e. , two or more consecutive episodes of no sensation at maximum stimulation ) after 4% articaine injection with a mean time of onset 6.92 min , compared with 17 patients , i.e. 53.1% , after 2% lidocaine injection with a mean time of onset 10.35 min . \n this showed a high statistical significance with p = 0.006 [ table 3 and figure 1 ] . \n percentage of success , mean and sd of pulpal anaesthesia of 32 patients in both groups mean and sd of pulpal anaesthesia all patients experienced lip numbness after each local anesthetic injection . \n the onset of lip numbness ranged from 2 to 10 min after articaine with a mean of 3.56 min and sd of 1.66 min . in the lidocaine group , \n the onset of lip anesthesia ranged from 2 to 8 min with a mean of 4.9 min and sd of 1.36 min . \n this also showed a very high statistical significance with p = 0.0006 [ table 4 and figure 2 ] . \n percentage of success , mean and sd of lip numbness of 32 patients in both groups mean and sd of lip numbness lingual mucosa numbness was reported by 15 patients after 2% lidocaine and by 24 patients after 4% articaine buccal infiltration . the mean onset of time was 10.53 min for 2% lidocaine and 9.29 min for 4% articaine . \n this difference was not significant with p = 0.1 [ tables 5 and 6 and figure 3 ] . \n percentage of success , mean and sd of lingual mucosa numbness of 32 patients in both groups t value and p value of pulpal anaesthesia , lip numbness and lingual mucosa numbness in 32 patients mean and sd of lingual mucosa numbness the number of times of no sensation on maximal stimulation in the first molars over the period of the trial was greater for 4% articaine ( 297 ) than for 2% lidocaine ( 157 ) . \n equality of proportions was statistically analyzed and was found to be significan [ figures 4 and 5 ] . \n changes from baseline pulp tester readings at first sensation at time intervals after injection percentage of patients with no response at maximum stimulation at each interval the maximum duration of anesthesia possible in this study was 28 min . \n using local anesthetics to control patients pain is one of the most important factors for successful treatment . \n the choice of anesthetic solution should be based on three main clinical considerations : anesthetic potency , latency ( time of onset of anesthesia ) , and duration of the anesthetic effect . \n other important considerations are the pharmacokinetics ( absorption , distribution , metabolization , and excretion ) and toxicity of the drug . \n articaine , a new amide local anesthetic , was introduced in 1969 , and has a reputation of providing an improved local anesthetic effect . \n the formulation is known as septocaine ( septodont ) and is available as a 4% solution with 1:100,000 epinephrine . \n articaine is classified as an amide , but contains a thiophene ring instead of the benzene ring of other amide local anesthetics . \n a second molecular difference between articaine and other amide local anesthetics is the extra ester linkage incorporated into the articaine molecule which results in hydrolysis of articaine by plasma esterases . \n the rate of failures reported is approximately 15% and the incidence of adverse effects such as paresthesia , trismus , and hematoma is much greater . \n moreover , treatment of only one tooth does not require anesthesia of the entire nerve branch . \n literature reports state that 9095% of articaine is metabolized in the blood and only 510% is broken down in the liver . \n the plasma half - life has been reported to be as low as 20 min . \n both articaine and lidocaine have the same maximum milligram dose of 500 mg ( recommended dose of 6.67 mg / kg ) for the adult patient . because articaine is marketed as a 4% solution , the maximum manufacturer 's dose for a healthy 70 kg adult would be seven cartridges of an articaine solution , compared to 13 cartridges of a 2% lidocaine solution . in this study , we have compared the pulpal anesthesia of 2% lidocaine and 4% articaine in mandibular first molar buccal infiltration . \n injections of anesthetic solution were given on the same area at least 1 week apart . \n electronic pulp testing was undertaken at baseline and at 2 min intervals until 30 min post injection . to test the onset and efficacy of pulpal anesthesia \n , we used an electric pulp tester to measure pain because researches have concluded that electric pulp tester can be a valuable tool in predicting potential anesthetic problems in operative dentistry . \n a successful outcome was recorded in the absence of pulp sensation on two consecutive maximal pulp tester stimulations ; 87.5% of articaine and 53.13% of lidocaine infiltrations were successful . \n the mean time of onset of pulpal anesthesia was 6.92 min for 4% articaine and 10.35 min for 2% lidocaine . \n similar studies comparing articaine and lignocaine using buccal infiltration achieved a success rate of 4557% with lidocaine formulation and 7592% with articaine formulation . \n articaine infiltration produced significantly more episodes of no response to maximum stimulation in the first molars than lignocaine . \n a few studies have investigated the use of infiltration anesthesia in adult mandibular lower incisor following buccal and lingual infiltrations . \n they reported a success rate of 45% after labial injections of 2% lidocaine with 1:100,000 epinephrine and 50% after lingual infiltrations of the same solutions for lateral incisor pulpal anesthesia . for central incisors , \n some studies have reported no significant differences between articaine and lidocaine for different intraoral local anesthetic techniques , but some contradict the results . \n costa et al . , in their study on 20 patients with maxillary posterior teeth infiltration , concluded that articaine produced shorter onset and longer duration of action when compared to lignocaine . here , \n in our study , we did not measure the duration of anesthesia ; we measured and compared the onset of both solutions . \n it was found that articaine produced shorter onset ( 6.92 min ) when compared to lidocaine ( 10.35 min ) . \n this difference was highly significant ( p = 0.006 ) . to test the onset , duration , and efficacy of pulpal anesthesia , each of these authors used electric pulp tester for measuring pain . in the present study , \n we have compared the efficacy of 2% lidocaine and 4% articaine when administered as buccal infiltration in the mandible . \n we found that 4% articaine produced greater changes from the baseline pulp tester readings than 2% lidocaine , which is in agreement with the results of the studies conducted by kanaa et al . and robertson et al . \n although this difference is worth noting , the important result clinically is no response at maximum stimulation . \n we used two or more consecutive pulp tester readings at maximum stimulation without sensation as the criterion of success . \n this criterion was used by many authors and we obtained greater success in achieving anesthesia in the mandibular permanent first molar probably because the maximum current output of our pulp tester was 47 a , when compared to 80 a which was the maximum output of the pulp tester used by kanaa et al . \n some studies reported a success rate lesser than that reported in this study while using lidocaine . \n this may be due to testing a different tooth number , i.e. , mandibular second molar . \n the lack of success with lidocaine is because of its lower concentration ; this needs to be investigated further . \n some authors have also made a comparative study on the anesthetic efficacy of 4% articaine versus 2% lidocaine , both with epinephrine 1:100,000 , in the truncal block of the inferior alveolar nerve during the surgical extraction of impacted lower third molars . \n the results obtained suggest that 4% articaine offers better clinical performance than 2% lidocaine , particularly in terms of latency and duration of the anesthetic effect . \n we did not measure duration in our study ; therefore , future studies are required to measure duration . \n subjective anesthesia of the lingual mucosa was reported in 15 patients of 2% lidocaine group and 24 patients of 4% articaine group . \n this suggests the limited ability of the anesthetic to diffuse through the entire thickness of mandible , which agrees with the findings of haas et al . \n it is worth mentioning that none of our results was influenced by the type or concentration of the vasoconstrictor substance associated with the local anesthetics employed , because both agents contained 1:100,000 epinephrine . \n our success with articaine in achieving pulpal anesthesia in the mandibular first molar was greater ( 87.5% ) than the success rate reported by kanaa et al . \n kanaa et al . , reported a success of 64.5% with artcaine and 38.7% with lidocaine . \n our study was in agreement with robertson et al . who reported a success rate of 7592% with articaine and 4567% with lidocaine . \n the higher success rate achieved with articaine in these studies may be due to its higher concentration ( 4% ) when compared to 2% lidocaine . \n the diversity of anesthetic substances currently available on the market requires dental professionals to assess the drug both by its pharmacokinetic and also by its clinical characteristics during dental treatments . \n our study used 4% articaine , which is available in the market , for comparison with 2% lidocaine . \n further studies are required to use an equal concentration of both solutions to obtain more accurate results . \n \n ", "role": "user" }, { "content": "background : to compare 4% articaine and 2% lidocaine local anesthetics in achieving pulpal anesthesia of the lower first permanent molar teeth objectively , and to assess and compare lip and lingual mucosa numbness subjectively.materials and methods : all subjects received 1.7 ml of any one anesthetic in the mucobuccal fold adjacent to mandibular first molar teeth ; the same individuals received the second infiltration at least 1 week after the first . \n later , comparisons for pulpal anesthesia , lip and lingual mucosa numbness between these two anesthetics solutions were made.results:articaine showed significant results with p = 0.006 in achieving pulpal anesthesia objectively , when compared with lidocaine . \n articaine also showed very high significant results subjectively with p = 0.0006 in achieving lip numbness , when compared with lidocaine . \n but the results in achieving lingual mucosa numbness with articaine subjectively was not significant with p = 0.01 , when compared with lidocaine.conclusion:endodontic and operative treatments are one of the most common oral non - surgical procedures done under local anesthesia . \n the diversity of anesthetic substances currently available on the market requires dental professionals to assess the drug both by its pharmacokinetic and also by its clinical characteristics during dental treatments . \n our study used 4% articaine , which is available in the market , for comparison with 2% lidocaine . \n further studies are required to use an equal concentration of solutions to achieve more accurate results .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: gil yosipovitch opened the meeting , illuminating his itch journey as the first incumbent of the jeffrey bernhard lecture . \n this journey began as a resident witnessing the chronic itch suffered by patients with chronic kidney disease culminating leading to a clinical research career via extensive collaborative research . \n he described the characteristics of different types of chronic itch across the clinical spectrum and is linking these to their neural basis using fmri . \n earl carstens from the university of california , davis asked if itch is a specific sensation distinct from pain . \n he demonstrated the existence of subpopulations of specific pruriceptors and central neurons that signal itch he discussed the state - of - the - art regarding neurotransmitters and neuropeptides by demonstrating the specific involvement in itch of subtance p , grp , glutamate and nppb . \n he noted that the development and use of multiple antagonists to target the cognate signaling pathways has great promise with respect to leading to fundamental improvements in the successful treatment of itch . \n clifford woolf from boston children s hospital described an exciting strategy of reversibly silencing specific subsets of pruritogen- and noxious stimulus - sensitive sensory axons . \n this was accomplished by using qx-314 , a charged sodium - channel blocker derivative of uncharged lidocaine . \n however , in the presence of channel agonists that open pores , such as capsaicin , qx-313 passes through the pore to reversibly block these same channels . \n woolf suggested that targeted silencing of activated sensory fibers provides a new avenue to treating itch . \n diana bautista from university of california , berkley presented a new model in which thymic stromal lymphopoietin ( tslp ) release by keratinocytes , regulated through the orai1/nfat calcium signaling pathway , activates both primary afferent neurons and immune cells to induce inflammatory responses in the skin and airways leading to the atopic march seen in atopic patients . \n sarah wilson , a postdoctoral fellow in the bautista lab , discussed the ion channel trpa1 in a mouse model of chronic itch . \n her data suggest that trpa1 is required for both the transduction of chronic itch signals to the cns and pathophysiologic skin changes observed in chronic itch . \n xinzhong dong , from johns hopkins discussed mrgprs , a large family of g - protein - coupled receptors . \n mrgprs comprise the receptors for several pruritogens , including chloroquine , the hexapeptide sligrl , bam8 - 22 and beta - alanine . \n he demonstrated that mrgpr - expressing neurons in dorsal root ganglia defined itch - mediating primary sensory neurons with specific projection patters in the skin . \n sarina b. elmariah from massachusetts general hospital demonstrated that changes in neural innervation occur in an ovalbumin epicutaneous sensitized mouse model of atopic dermatitis . \n she employs in vivo confocal microscopy to visualize peripheral sensory nerves that have been fluorescently labeled genetically . \n specific subpopulations of peripheral sensory nerves were highly dynamic throughout the development of dermatitis and resulted in higher innervation density \n . she also demonstrated that neural blockade during epicutaneous sensitization prevented the neural changes and resulted in reduced scratching behavior . \n zhou - feng chen from washington university demonstrated that activation of the braf pathway in nav1.8 + neurons of mice causes spontaneous scratching . \n these mice have increased ectopic expression of gastrin - releasing peptide ( grp ) in drg neurons and the grp receptor ( grpr ) and perk in the spinal cord . \n he demonstrated that raf - mek - erk pathway is an upstream regulator of chronic itch . \n this finding suggests that bfaf inhibitors , already of particular interest in the treatment of certain cancers , including melanoma , may be useful in ameliorating chronic itch . \n mark hoon from the national institute of health gave a lecture on natriuretic polypeptide b ( nppb ) . \n he demonstrated that nppb knock out mice exhibit significant reduction in scratching bouts in response to injection of different pruritogens while they express normal behavioral responses to thermal and painful stimuli . \n his work indicated that nppb induced itch requires grp while grp induced itch does not require nppb . \n he concluded that the nppb receptor and grp are co - expressed in dorsal horn neurons and that nppb is an essential transmitter and mediator of itch at the level of the spinal cord . \n sarah ross from the university of pittsburgh presented her work on spinal b5-i interneurons which function to inhibit itch by releasing dynorphin , an endogenous kappa opioid agonist . \n henning holle from the university of hull presented his study on the mechanism of contagious itch and demonstrated neuroimaging and behavioral evidence for insular - mediated sharing of affect as the mechanism underlying contagious itch . \n herman o. handwerker from the institute of physiology , erlangen , presented his work on the functional connectivity of cerebral networks involving cortical somatosensory areas , insular cortices , frontal areas , limbic structures , thalamus and basal ganglia during cerebral processing of experimental itch compared to pain . \n he reported a higher functional connectivity during pain but regions revealing the highest correlations were similar in both itch and pain states confirming the processing of pain and itch in closely related networks . \n vitaly napadow from the martinos center for biomedical imaging presented his study on 14 atopic dermatitis patients and the susceptibility of itch to nocebo and placebo effects . \n his data suggest that when subjects perceive nocebo induced itch , the prefrontal and striatal circuitry activated by real allergen is also activated . \n andrea evers from radboud university medical centre presented evidence on the psychophysiological similarities and differences between itch and pain and the implication of therapeutic strategies using placebo mechanisms for chronic itch and pain . \n robert lamotte from yale presented work on chemically elicited biological measurements in mice and how to identify if they relate to itch or other sensory qualities . \n he has developed an intricate and powerful technology that allows for stimulation of sensory nerves in the skin while directly visualizing them and recording from their cell bodies in the drg in vivo . \n thiery olivry , a veterinary dermatology researcher from north carolina state university demonstrated that atopic dermatitis in dogs closely mimics atopic dermatitis in people . \n he discussed this large animal model and demonstrated that canines sensitized to allergens provide a powerful model of atopic dermatitis and thus can be used as a proxy for the human condition . \n jacek c. szepietowski from wroclaw medical university , and thomas mettang from the german clinic for diagnostics , wiesbaden , suggested the establishment of a new working group of clinicians and scientists for the study of uremic pruritus . despite the high prevalence of itch in chronic kidney disease , \n uremic pruritus remains an unresolved problem and its contribution to patient suffering continues to be under appreciated . \n suephy chen from emory university reviewed the prevalence of itch and discussed the methodology to measure the burden of itch . \n florence dalgard from university of oslow , presented the results of her study on patients from dermatology clinics in 13 european countries to assess the burden of itch . \n she reported that itch had a large impact on the quality of life of affected patients and they were more depressed ( 13% vs 5% ) and experienced more anxiety ( 21% vs 12% ) compared to controls . \n david roblin from creabilis , a biotechnology start - up , presented a study on 160 psoriasis patients . \n itch in psoriasis is underappreciated and despite the negative effect of itch on the quality of life of psoriasis patients , there are no available therapeutics that target this aspect of the condition . \n nora bergasa from the metropolitan hospital center , new york , reviewed the itch of cholestasis and discussed the relevance of proposed mechanisms of cholestatic itch . \n these mechanisms included central opioidergic tone , grp , the bile acid receptor tgr5 and autotaxin activity . \n majedeline belghiti from miguel hernandez university discussed the role of mesenteric mast cell degranulation , trpv1 and par2 in a bile duct ligated rat model of liver disease . \n leigh nattkemper from temple university presented her study on the peripheral role of il-31 in cutaneous t - cell lymphoma patients . \n il-31 levels are elevated in epidermal nerve fibers and at the dermopepidermal junction of these patients and correlate with the severity of itch in these patients . \n targeting il-31 with monoclonal antibodies is an active area of investigation and we await preliminary clinical studies in this area . \n sonja stnder from university hospital , mnster presented an update on the antipruritic effects of aprepitant , a neurokinin-1 receptor ( nk1r ) antagonist . \n she reported significant itch reduction in 62 patients treated with aprepitant with pruritus of various origins . \n aprepitant therapy is associated with a decreased number of cd5 , cd25 and il-17 positive t - lymphocytes in skin biopsies . \n charley merrill from mitsubishi tanabe pharma presented the ongoing investigations on nalfurafine , a centrally active kappa opioid agonist , for the treatment of uremic itch in subjects with chronic kidney disease receiving hemodialysis . \n this drug is approved for clinical use in japan and is in ongoing trials in the united states and europe . \n contrasting findings were set up when mitsutoshi tominaga from juntendo university , in chiba noted that h4 antagonists were not effective in a mouse model of atopic dermatitis while robin thurmond from janssen research & development , san diego , presented data that h4r antagonism was helpful in treating itch in human atopic dermatitis . \n he discussed jnj-39758979 , a potent oral h4r antagonist . while clinically effective , off - target effects prevented further development of this specific compound but that the antagonists of a different class should be effective . \n ifsi s clinical research award was given to henning holle for his work on auditory modulation of itch . \n the basic research award was provided to adam kardon in the laboratory of sarah ross for his work demonstrating that dynorphin acts as a neuromodulator to inhibit itch in the spinal cord , thus providing a mechanism by which -opioid agonists reduce the sensation of itch . \n the handwerker prize was awarded jointly to sarah wilson and lydia the in the bautista lab for their laboratory s studies on tslp . \n all aspects of the field of itch , from basic science to quality of life to therapeutics are moving rapidly . \n attendees are already looking forward to the next congress , in nara , japan in the fall of 2015 .", "role": "user" }, { "content": "the 7th world congress on itch was held in boston in september 2013 . \n this is the biennial meeting of the international forum for the study of itch ( ifsi ) , www.itchforum.net , there were 240 attendees from 17 countries . \n they spanned clinical practice , academics and patient advocacy while the opportunity for translation was demonstrated as 80 attendees were from industry . \n a large academic neuroscience contingent was present . \n there were plenary sessions , basic and clinical tracts , and sixty posters during the 2 day meeting . \n the meeting program and 160 abstracts are available at www.itchboston.org and the open access journal , acta dermato - venereologica , www.medicaljournals.se / acta/. this report highlights selected aspects of the congress and the latest advances in the field .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: periodontitis , viewed for years as primarily the outcome of plaque bacteria , is now seen as resulting from a complex interplay between bacterial infection and host response , which is often modified by behavioral and environmental factors . \n the host response is now considered as a key factor in the clinical expression of periodontitis . the inflammatory response to the bacterial products and other antigens is responsible for the activation of host immunoinflammatory cells ( i.e. neutrophils , macrophages , and lymphocytes ) . \n the latter migrate into the local tissues and subsequently produce tissue destructive cytokines , eicosanoids , and tissue matrix metalloproteinases and lead to activation of osteoclasts that are likely to have an indirect but major influence on connective tissue destruction , attachment loss and alveolar bone loss in most form of periodontitis . \n the present study has been performed to assess in ap subjects : \n myeloperoxidase ( mpo)-463g / a gene polymorphism andlevel of telomerase expression . \n the above parameters have been compared with the subjects of chronic periodontitis ( cp ) and that of the healthy controls ( n ) . \n myeloperoxidase is a lysosomal enzyme found in the azurophilic granules of polymorphonuclear leukocytes and is able to mediate inflammatory tissue destruction in ap . \n human telomerase is a multi - subunit ribonucleoprotein enzyme concerned with telomeric lengthening and homeostasis in man and has been found to be elevated in inflammatory conditions . in rheumatoid arthritis , the level of telomerase indicates the severity of the condition . keeping these factors in mind , \n this study has been performed to explore the probable role in ap of mpo-463g / a gene polymorphism and to evaluate the level of telomerase expression . \n they were of the age group 20 - 50 years , nonsmokers , free from any known systemic disease and had not undergone any periodontal therapy or had received any antibiotics and anti - inflammatory drugs in the previous 6 months . \n this study was conducted in accordance with the helsinki declaration of 1975 as revised in 2000 . \n the subjects were divided into three groups as follows : group i - periodontally healthy control ( n = 15 ) - subjects have healthy periodontium with no evidence of loss of connective tissue attachment or supporting bone or other signs of disease activity . \n group ii - cp ( n = 15)-subjects with signs of clinical inflammation consistent with local etiological factors , gingival index score > 1 , probing pocket depth 5 mm , clinical attachment loss of 3 mm , with radiographic evidence of bone loss . \n group iii - ap ( n = 15 ) - subjects with noncontributory medical history , rapid attachment loss , and bone destruction , familial aggregation of cases , and amount of deposits which are inconsistent with the severity of periodontal tissue destruction . \n the latter is either localized to permanent first molars and incisors or generalized interproximal attachment loss affecting at least three permanent teeth other than first molars and incisors . peripheral blood collected from the antecubital vein of each subject \n was kept in a vacutainer ( i.e. vacuum container ) coated with ethylene diamine tetra acetic acid . \n a volume of 5 ml peripheral blood was collected and stored at 20c until analysis . \n the region with a 463 a / g gene polymorphism located at the promoter region of the mpo gene was amplified by the reverse transcriptase - polymerase chain reaction ( rt - pcr ) method in roche lc 2.0 automated instrument using primer chain - mpof ( 5ggtataggcacaatggtgag ) and mpor ( 5 gcaatggttcaagcgattcttc ) . \n fluorescence was detected and measured in the rt - pcr thermocycler and its geometric increase corresponding to the exponential increase of the genome determined by the primer chains . \n amplification would appear as amplification curves [ figure 1 ] suggesting the quantity of the marked genome in the sample . \n gingival tissue samples were collected by performing incisional biopsy from the extraction site of hopeless teeth of the subjects of ap and cp . \n samples in the control group were collected from the surgical sites of crown lengthening procedures . \n the gingival tissue specimens obtained were thoroughly rinsed with sterile normal saline solution and transferred into two separate eppendorf microcentrifuge tubes one of which contained 1 ml 1x pbs ( phosphate buffer solution ) and 20 l protease inhibitor cocktail ( sigma - aldrich , usa ) , while the other contained 1 ml of tryzol reagent ( invitrogen ) . \n total rna was isolated from the gingival tissue specimens using trizol ( invitrogen ) following the manufacturer 's instructions . \n 40 l of diethyl pyrocarbonate treated water was added to the rna pellet to ensure complete dissolution of rna into the solution . \n 1 g rna was used to perform rt - pcr using the one - step rt - pcr kit ( qiagen , usa ) . \n human telomerase reverse transcriptase ( htert ) from tissue was amplified using the forward primer : 5-agagtgtctggagcaagttgc-3 and reverse primer : 5-cgtagtccatgttcacaatcg-3. the amplification conditions were reverse transcription at 50c for 30 min , initial pcr activation step at 95c for 15 min followed by 35 cycle denaturation at 95c for 30 s. annealing was done at 61c for 30 s. extension of the chain was done at 72c for 1 min with a final extension performed at 72c for 10 min . \n the glyceraldehydes-3-phosphate dehydrogenase was used as internal control for tissue expression which was amplified with a forward primer : 5-atggggaaggtgaaggtcgg-3 and reverse primer : 5-ggatgctaagcagttggt-3. the amplification conditions were 35 cycle denaturation at 95c for 30 s , followed by annealing at 61c for 30 s and finally the extension at 72c for 1 min . \n the amplified rt - pcr products were subjected to electrophoresis on 2% agarose gels and stained with ethidium bromide . \n the gel was placed in gel doc system ( perkinelmer , usa ) for visualization . \n the data were analyzed using software spss , version 13.0 ( chicago , il , usa ) . \n they were analyzed for appropriateness between the observed and expected genotypes and hardy - weinberg equilibrium . \n one - way analysis of variance was assessed by anova followed by tukey 's test . \n the correlation of htert expression with clinical parameters was assessed by spearman 's signed rank test . \n the rt - pcr expression was found using color deconvolution program in imagej image analysis system ( software , national institutes of health , bethesda , md , usa ) . \n a volume of 5 ml peripheral blood was collected and stored at 20c until analysis . \n the region with a 463 a / g gene polymorphism located at the promoter region of the mpo gene was amplified by the reverse transcriptase - polymerase chain reaction ( rt - pcr ) method in roche lc 2.0 automated instrument using primer chain - mpof ( 5ggtataggcacaatggtgag ) and mpor ( 5 gcaatggttcaagcgattcttc ) . \n fluorescence was detected and measured in the rt - pcr thermocycler and its geometric increase corresponding to the exponential increase of the genome determined by the primer chains . \n amplification would appear as amplification curves [ figure 1 ] suggesting the quantity of the marked genome in the sample . \n gingival tissue samples were collected by performing incisional biopsy from the extraction site of hopeless teeth of the subjects of ap and cp . \n samples in the control group were collected from the surgical sites of crown lengthening procedures . \n the gingival tissue specimens obtained were thoroughly rinsed with sterile normal saline solution and transferred into two separate eppendorf microcentrifuge tubes one of which contained 1 ml 1x pbs ( phosphate buffer solution ) and 20 l protease inhibitor cocktail ( sigma - aldrich , usa ) , while the other contained 1 ml of tryzol reagent ( invitrogen ) . \n total rna was isolated from the gingival tissue specimens using trizol ( invitrogen ) following the manufacturer 's instructions . \n 40 l of diethyl pyrocarbonate treated water was added to the rna pellet to ensure complete dissolution of rna into the solution . \n 1 g rna was used to perform rt - pcr using the one - step rt - pcr kit ( qiagen , usa ) . human telomerase reverse transcriptase ( htert ) from tissue was amplified using the forward primer : 5-agagtgtctggagcaagttgc-3 and reverse primer : 5-cgtagtccatgttcacaatcg-3. the amplification conditions were reverse transcription at 50c for 30 min , initial pcr activation step at 95c for 15 min followed by 35 cycle denaturation at 95c for 30 s. annealing was done at 61c for 30 s. extension of the chain was done at 72c for 1 min with a final extension performed at 72c for 10 min . \n the glyceraldehydes-3-phosphate dehydrogenase was used as internal control for tissue expression which was amplified with a forward primer : 5-atggggaaggtgaaggtcgg-3 and reverse primer : 5-ggatgctaagcagttggt-3. the amplification conditions were 35 cycle denaturation at 95c for 30 s , followed by annealing at 61c for 30 s and finally the extension at 72c for 1 min . \n the amplified rt - pcr products were subjected to electrophoresis on 2% agarose gels and stained with ethidium bromide . \n the gel was placed in gel doc system ( perkinelmer , usa ) for visualization . \n gingival tissue samples were collected by performing incisional biopsy from the extraction site of hopeless teeth of the subjects of ap and cp . \n samples in the control group were collected from the surgical sites of crown lengthening procedures . \n the gingival tissue specimens obtained were thoroughly rinsed with sterile normal saline solution and transferred into two separate eppendorf microcentrifuge tubes one of which contained 1 ml 1x pbs ( phosphate buffer solution ) and 20 l protease inhibitor cocktail ( sigma - aldrich , usa ) , while the other contained 1 ml of tryzol reagent ( invitrogen ) . \n total rna was isolated from the gingival tissue specimens using trizol ( invitrogen ) following the manufacturer 's instructions . \n 40 l of diethyl pyrocarbonate treated water was added to the rna pellet to ensure complete dissolution of rna into the solution . \n 1 g rna was used to perform rt - pcr using the one - step rt - pcr kit ( qiagen , usa ) . \n human telomerase reverse transcriptase ( htert ) from tissue was amplified using the forward primer : 5-agagtgtctggagcaagttgc-3 and reverse primer : 5-cgtagtccatgttcacaatcg-3. the amplification conditions were reverse transcription at 50c for 30 min , initial pcr activation step at 95c for 15 min followed by 35 cycle denaturation at 95c for 30 s. annealing was done at 61c for 30 s. extension of the chain was done at 72c for 1 min with a final extension performed at 72c for 10 min . \n the glyceraldehydes-3-phosphate dehydrogenase was used as internal control for tissue expression which was amplified with a forward primer : 5-atggggaaggtgaaggtcgg-3 and reverse primer : 5-ggatgctaagcagttggt-3. the amplification conditions were 35 cycle denaturation at 95c for 30 s , followed by annealing at 61c for 30 s and finally the extension at 72c for 1 min . \n the amplified rt - pcr products were subjected to electrophoresis on 2% agarose gels and stained with ethidium bromide . \n the gel was placed in gel doc system ( perkinelmer , usa ) for visualization . \n the data were analyzed using software spss , version 13.0 ( chicago , il , usa ) . \n they were analyzed for appropriateness between the observed and expected genotypes and hardy - weinberg equilibrium . \n one - way analysis of variance was assessed by anova followed by tukey 's test . \n the correlation of htert expression with clinical parameters was assessed by spearman 's signed rank test . \n the rt - pcr expression was found using color deconvolution program in imagej image analysis system ( software , national institutes of health , bethesda , md , usa ) . \n the frequencies of ag and aa genotypes in the mpo gene polymorphism were more common in the ap subjects when compared to the controls [ figure 2 ] . \n however , there were no significant differences between the cp subjects and controls regarding mpo gene polymorphism either in terms of allele frequency or genotype frequency . \n line graph showing the level ( % ) of a / a and a / g genotype the prime used for the detection of m - rna htert expression was showing the bands in the all tissue biopsy samples of the test groups against gapdh which was used as internal control but not detected in the control group [ figure 3 ] . \n the relative htert m - rna expression in group iii was significantly higher than that of group ii ( p < 0.0001 ) [ table 1 ] . \n table 2 shows spearman 's ranked correlation between htert expression versus clinical parameters in chronic periodontitis and aggressive periodontitis . \n expression of htert m - rna expression of htert in aggressive periodontitis group in comparison to control group and chronic periodontitis group spearman 's ranked correlation between of htert expression versus clinical parameters in chronic periodontitis and aggressive periodontitis \n it is well - recognized that poor oral hygiene alone can not account for periodontal tissue destruction as some individuals are at relatively high risk for tissue destruction than others . \n hence , investigators put forward the idea that a constitutional factor , probably of genetic origin might play a part . according to a genetic study , approximately 50% of the population variance for disease \n an investigation was done to correlate the mpo-463g / a polymorphism with ap and cp and it shows that this polymorphism is associated with an increased risk of ap in the test groups . \n the role of mpo in inflammatory diseases has been supported by genetic studies reporting an association with the-463g / a polymorphism located in the promoter region of the mpo gene . \n recently , meisel et al . have reported an association between mpo-463g / a polymorphism and periodontal disease . \n they examined more than 3000 subjects and found that females with gg genotype were 50% more susceptible to periodontal disease . \n apparently , this was due to mpo released by reactive neutrophils damaging the cells . according to the study , \n it was stated that through mpo g / a base change , mrna expression and mpo level were decreased . \n however , mpo production was increased by the g allele in subjects with mpo-463g / a polymorphism . \n atzeni et al . did not find any association between the -463g / a mpo promoter polymorphism and susceptibility to and clinical expression of behcet 's disease . \n many studies provide strong evidence that the polymorphism does result in a difference in mpo activity that affects disease susceptibility . \n thus , mpo protects against microbial invasion , while in inflammatory disease states it unintentionally contributes to cell damage . \n however , the assessment of mpo as a biological marker requires knowledge of its biological variations , which are poorly documented . the precise mechanisms underlying the relationship of the mpo polymorphism and periodontal disease remain unclear . \n mpo protein is mainly expressed at high levels in neutrophils , monocytes and some reactive microglial . \n the g allele is the wild type with normal mpo expression , while the a allele is a low - expression allele . \n there were no significant differences between the cp subjects and controls regarding mpo-463a / g gene polymorphism either in terms of allele frequency or genotype frequency of mpo-463a / g . \n however , either in terms of allele frequency or genotype frequency of mpo-463a / g there was significant differences between the ap subjects and the controls . \n importantly , we found that the mpo-463aa genotype or a allele had a role in susceptibility to ap . \n somatic human cells show a strictly limited growth potential and enter senescence after a determined number of cell divisions due to progressive telomere shortening . \n telomeric lengthening by telomerase ( htert mainly ) is the main mechanism of telomere homeostasis in man . \n transient elevation in telomerase levels has been found in inflammatory conditions like silicosis of lung and rheumatoid arthritis . this enzyme is present constitutively in normal human cells and organs with a high turnover rate like testes and spleen and in high amounts in activated t and b lymphocytes . in the present study , \n htert was observed to be in elevated levels in both the forms of periodontitis ( 83.61 2.94 in cp and 104.27 6.06 in ap as against nil in healthy control ) . \n chronic inflammation observed in periodontitis is marked by the presence of antigen presenting cells like dendritic cells and t and b lymphocytes which have a long life span and possess the telomerase . \n these cells have been demonstrated to infiltrate in the gingival tissue of cp and ap subjects . \n suggested that the activation of the t cell and b cell receptors by mitogens and phytohemagglutinins increases the telomerase levels by many folds . \n since sustained activation of t and b cells occurs in cp and ap , this could be a reason for the telomerase up - regulation . \n moreover , the involvement of lymphocytes and monocytes in cp and ap results in the production of many cytokines such as il-2 and il-6 . \n these cytokines up - regulate telomerase through the il-2 receptor and signal transducer and activator of transcription 3 signaling mechanisms in t lymphocytes and monocytes , respectively . b and t lymphocytes , \n the major antigen - specific lineages of the immune system , require extensive cell division and clonal expansion for their functions . \n it can down - regulate p53 , conferring an anti - apoptotic phenotype to epithelial cells . \n 2005 , recently found that p-53 down - regulation is associated with telomerase up - regulation . \n it is possible that intracellular colonization of p. gingivalis in oral and sulcular epithelial cells in cp may indirectly up - regulate the telomerase . \n periodontal pockets have lowered oxygen tension and were more hypoxic than the healthy gingival sulcus . \n anderson et al . found that hypoxia can stimulate telomerase expression by unknown mechanisms . in the present study , the gingival tissue samples of 10 healthy controls , 10 subjects of cp and 10 subjects of ap were subjected to evaluate the htert - m - rna expression by rt - pcr . \n the m - rna expression of htert was undetectable in the gingival tissue of the control group by rt - pcr . \n a possible reason for the absence of the telomerase in healthy gingiva could be the presence of plenty of fibroblasts which are telomerase negative cells and a diminished number of stem cells which are telomerase - positive cells . \n the presence of htert expression in the gingival tissue of cp and ap subjects might be due to b cell and t cell infiltration . \n the possible reason for higher htert gene expression in cases of ap as compared to subjects of cp might be due to an increased host response and elevated amount of chronic inflammatory cells like b and t cells in cases of ap . \n the different association of ap and cp with this gene polymorphism may help to explain their differing etiopathogenesis . \n our data suggest that mpo-463g / a may be associated with increased risk of ap . \n the level of tissue htert was elevated in ap subjects as compared to cp and healthy control groups .", "role": "user" }, { "content": "background : myeloperoxidase ( mpo ) is a lysosomal enzyme found in the azurophilic granules of polymorphonuclear leukocytes and is able to mediate inflammatory tissue destruction in aggressive and chronic periodontitis ( cp ) . \n human telomerase is a multi subunit ribonucleoprotein enzyme concerned with telomeric lengthening and homeostasis in man and has been found to be elevated in inflammatory conditions such as rheumatoid arthritis and periodontitis . \n the aim of this study was to explore in aggressive periodontitis ( ap ) subjects : ( i ) the role of mpo-463g / a gene polymorphism and ( ii ) the level of telomerase expression . \n these parameters have been compared with the subjects of cp and that of the healthy controls.materials and methods : a total of 45 subjects of the age group 2050 years and free from any known systemic disease were included in the study . \n they were divided into three groups \n group i - periodontally healthy control ( n = 15 ) , group ii - cp ( n = 15 ) and group iii - ap ( n = 15 ) . peripheral blood samples and gingival tissue samples \n were collected for mpo gene polymorphism and telomerase expression , respectively , for detection by reverse transcriptase polymerase chain reaction.results:the frequencies of ag and aa genotypes in the mpo gene polymorphism were more common in the ap subjects when compared to the controls . \n the m - rna expression of human telomerase reverse transcriptase ( htert ) was undetectable in the gingival tissue of the control group . \n its expression in ap subjects was significantly higher than that of cp group ( 83.61 2.94 in cp and 104.27 6.06 in ap ) ( p < 0.0001).conclusions : our data suggest that mpo-463g / a may be associated with increased risk of ap . \n the level of tissue htert was elevated in ap subjects as compared to cp and healthy control groups .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the altered activity of enos gene , in the form of polymorphism , may lead to no deficiency and may result in cardiovascular complications like , hypertension , myocardial infarction , coronary artery disease and heart failure ( 1 ) . \n several polymorphisms have been identified in the enos gene . among them , the glu298asp ( g894 t ) , 786t > c and the 27 bp vntr , located in the exon 7 , the promoter ( regulatory region ) and intron 4 , respectively are of prime and functional importance . besides \n , they are also most widely studied owing to the reason of being associated with the increased risk of cardiovascular complications . \n given the high incidence of cardiovascular complications world - wide , another key regulator of blood pressure , the renin angiotensin aldosterone system ( raas ) , also imparts a noteworthy role in maintaining the water - electrolyte balance through the aldosterone hormone , secreted by the adrenal cortex of the adrenal gland ( 2 ) . \n numerous polymorphisms have been identified in the cyp11b2 gene ( 3 ) . among them , the promoter region polymorphism , viz . \n , c-344 t is most widely studied and is of paramount importance owing to its regulatory activity in inducing the production of steroidogenic factor-1 , the transcriptional regulatory protein ( 4 ) . \n apart from its function in the regulation of aldosterone activity , this gene has a direct effect on the cardiovascular system as well . in much the same way , another key player , \n angiotensin converting enzyme ( ace ) mediates the constriction of blood vessels thereby increasing blood pressure . \n ace is a zinc metallopeptidase which helps in the conversion of angiotensin i to angiotensin ii and is a part of the rennin angiotensin system ( ras ) . \n the ace gene located on chromosome 17q23 has an i / d polymorphism that comprises an insertion ( i)- which represents the presence of 287 bp alu and deletion ( d ) -which denotes the absence of the same 287 bp alu repeat in the intron 16 of the ace gene ( 5 ) . \n thei / d polymorphism has been linked to cardiovascular ( 6 ) and chronic renal diseases ( 7 ) . \n the i / d and d / d genotypes are determined by the insertion or absence of 287 bp alu sequence in the intron 16 . \n the dd genotype has been found to be a risk factor in cardiovascular diseases like hypertrophic cardiomyopathy , myocardial infarction and ventricular hypertrophy . \n the products of nitric oxide synthase ( nos ) , angiotensin converting enzyme ( ace ) and renin angiotensin system ( ras ) play a significant role in determining the structure and function of the blood vessel wall . \n polymorphisms in enos , ace and ras are independently associated with the propensity to cardiovascular events ( 8) . \n normal pregnancy is accompanied by intense haemodynamic fluctuations that chiefly comprise and mediate improved vasodilation ( 9 ) . \n increased endothelium - dependent flow - mediated vasodilation is a typical characteristic feature during normal pregnancy . \n this in turn is portrayed by the reduced systemic vascular resistance , which may be triggered by nitric oxide ( no ) ( 10 ) . with ample evidence provided world - wide with respect to the polymorphisms of enos , ace and aldosterone synthase genes shown to be associated with the hypertensive disorders of pregnancy , especially preeclampsia , population - based polymorphism studies clearly set out to overcome other associated complications of the same owing to the heritable nature of the allelic variations ( 11 , 12 ) . in spite of straightforward clinical diagnosis in most cases and the availability of effective drugs and therapeutic regime for preeclampsia , \n various factors contribute to a delay in diagnosis which lead to an increased maternal - foetal morbidity and mortality globally and result in 40% of births to be delivered before 35 weeks of gestation ( 13 ) . given the high incidence reported even among the developed nations globally , the foetal - maternal mortality rate is still very high , and no wonder preeclampsia continues to be the leading cause of complications during pregnancy , vulnerable both to the mother and the growing foetus . from an epidemiological standpoint , numerous studies have also revealed that preeclampsia is an ailment with a strong familial predisposition , which in turn differs as per geographical location , socioeconomic status and racial ethnicity . \n the data thus generated among normal pregnant women in turn could be used for extrapolating and estimating the anticipatory outcome as a result in the due course ( 13 ) . \n furthermore , the earlier pharmacogenetic data on clinically significant genes encoding the drug metabolizing enzymes ( phase i and ii ) and drug transporters from our team , executed among the south indian population , provides possible evidence and exceptionally supports the phenomenal inter - ethnic variability existing among the south indian population with that of the other global population ( 1416 ) . \n however , given this circumstance , studies on the effect of enos , ace and cyp11b2 polymorphisms on preeclampsia or any other hypertensive disorders of pregnancy have not been done so far in south indian or in any of the native indian population . \n hence , the current study intended to assess and estimate the frequency of enos ( 786t > c , glu 298asp , intron 4 vntr ) , ace ( intron 16 ins / del ) and cyp11c2 ( 344c > t ) genotypes , alleles and haplotypes among normal pregnant women in a population of south india . \n furthermore , the purpose of the study was to determine the inter - ethnic variability of allele frequencies of the above genes among the south indians with the hapmap and other populations from previously published reports . in delivering this information , the current study in turn offers a primary understanding for a prospective and an additional pharmacogenetic examination of the candidate gene polymorphisms . \n this in turn would further augment preceding molecular epidemiological investigation , for a better and a clear - cut understanding on the influence of these variants on the incidence and progression of preeclampsia or any other hypertensive disorders of pregnancy . \n unrelated healthy women of tamilian origin who underwent uncomplicated term pregnancies ( n=303 ) , between the age of 18 and 32 years were included in the study . \n the subjects , taking into account their family history for the past three generations and staying in tamil nadu and speaking the local language , confirmed their tamilian status . \n besides , subjects who used medications which were known to significantly interact with the normotensive effect of the candidate genes were excluded from the study . in addition , subjects with significant liver and kidney dysfunctions and chronic tobacco chewers were also excluded from the study . after explaining the purpose and details of the study protocol , written informed consent \n five milliliters of the umbilical cord blood was drawn from the vein of the umbilical cord at the time of labor and collected into the tubes containing 100 l of 10% ethylenediaminetetraacetic acid ( edta ) . \n after centrifugation for 10 min at 1500 g , the plasma was separated and discarded , and the remaining red blood corpuscles with the buffy coat were stored at 20c until dna extraction . \n thereafter , genomic dna was extracted from the umbilical cord blood samples by the standard phenol - chloroform extraction procedure . \n the extracted dna was analyzed quantitatively and qualitatively by biophotometer plus ( eppendorf ag 22331 , hamburg germany ) . \n each dna sample was diluted to an optimal concentration of 50 ng/l , and further stored in aliquots at 4c , suitable for downstream analysis . \n ( g894 t ) and 786 t > c alleles were identified and analyzed by polymerase chain reaction -restriction fragment length polymorphism ( pcr - rflp ) . on the other hand , \n the 27 bp direct repeat in intron 4 vntr region was determined by polymerase chain reaction ( pcr ) alone as described elsewhere ( 17 ) with minor modifications . \n the details of the primers used for amplification , with the annealing temperature and cyclic conditions and the enzymes used for the rflp analysis are summarized in table 1 . \n the amplified pcr products for enos glu298asp and 786t > c were checked for amplification on 1% agarose gel and the restriction enzyme digested products were electrophoresed and visualized on 8% and 12% polyacrylamide gels , respectively . \n the amplified pcr product for enos glu 298asp ( 894g > t ) polymorphism resulted in a 206 bp amplicon and the same was checked with agarose gel electrophoresis . after restriction digestion with mboi ( new england biolabs ) , \n bands were observed at 119 and 87 bp for homozygous variant type , 206 , 119 and 87 bp for heterozygous variant type and a single band at 206 bp for normal type on 8% polyacrylamide gel . \n similarly , the amplified pcr product of enos 786t > c polymorphism resulted in a 223 bp amplicon and after restriction digestion with ngomiv ( new england biolabs ) , bands were observed at 115 and 108 bp for homozygous variant , 223 , 115 and 108 bp for heterozygous variant type and a single band at 223 bp for normal type on 12% polyacrylamide gel . on the other hand , the amplified pcr products of the enos 27 bp direct repeat on intron 4 vntr region were directly resolved on 7% low melting agarose , and the fragments were visualized by ethidium bromide staining and ultraviolet transillumination . \n the intron 4 vntr genotypes were observed as 4a homozygous ( 4a/4a ) type with 393 bp , heterozygous type ( 4a/4b ) with 393 and 420 bp and 4b homozygous type ( 4b/4b ) with 420 bp . \n details of primers , pcr conditions and restriction digestion used for genotyping enos , cyp11b2 and ace gene polymorphisms the cyp11b2 promoter polymorphism ( 344c > t ) was detected by pcr - rflp method as described elsewhere ( 16 ) . \n the details of the primers used for amplification , with the annealing temperature and cyclic conditions and the enzymes used for the rflp analysis are summarized in table 1 . \n the amplified pcr product was checked for amplification on 1% agarose gel and the restriction enzyme ( haeiii , new england biolabs ) digested products were electrophoresed and visualized on 8% polyacrylamide gel . \n after restriction digestion , bands were observed at 274 , 138 and 126 bp for homozygous variant type , 274 , 203 , 138 , 126 and 71 bp for heterozygous variant type and 203 , 138 , 126 and 71 bp for normal type . the presence or absence of 287 bp fragment in intron 16 of ace gene was determined by allele specific pcr method ( 5 ) . \n the details of the primers used for amplification , with the annealing temperature and cyclic conditions are summarized in table 1 . \n amplification was done using forward and reverse primer which binds to the ace gene sequence and the amplified pcr products were analyzed by 2% agarose gel electrophoresis . \n the sizes of the different fragments obtained were 490 bp ( ii ) , 190 bp ( dd ) , and 490 and 190 bp ( i d ) . \n the samples reported as homozygous deletion ( dd ) in this assay were retyped using a third insertion specific primer . \n this was especially done to rule out the possibility of mistyping individuals due to preferential amplification of the deletion fragment over the longer insertion fragment ( 18 ) . \n the data analysis was executed using graphpad instat 3 statistical software ( graphpad software inc . , san diego , ca , usa ) . \n genotype frequencies in the study population were checked for hardy - weinberg equilibrium ( hwe ) scopes by comparing the observed and expected frequencies by using hwe calculator . \n the deviation of the genotype distribution from hwe was measured by chi - square test . \n differences in allele frequencies between tamilian and other ethnic populations were assessed by fisher s exact and chi - square tests . \n linkage disequilibrium among pairwise enos snps was measured using d0 value , and frequency of haplotypes consisting of multiple snps found in the same gene ( enos ) was estimated with expectation - maximization algorithm using haploview software version 4.2 . \n the current study was ethically approved and executed in accordance with the institute ethics and research committee guidelines of jipmer , pondicherry , india . \n unrelated healthy women of tamilian origin who underwent uncomplicated term pregnancies ( n=303 ) , between the age of 18 and 32 years were included in the study . \n the subjects , taking into account their family history for the past three generations and staying in tamil nadu and speaking the local language , confirmed their tamilian status . \n besides , subjects who used medications which were known to significantly interact with the normotensive effect of the candidate genes were excluded from the study . in addition , subjects with significant liver and kidney dysfunctions and chronic tobacco chewers were also excluded from the study . after explaining the purpose and details of the study protocol , written informed consent \n five milliliters of the umbilical cord blood was drawn from the vein of the umbilical cord at the time of labor and collected into the tubes containing 100 l of 10% ethylenediaminetetraacetic acid ( edta ) . \n after centrifugation for 10 min at 1500 g , the plasma was separated and discarded , and the remaining red blood corpuscles with the buffy coat were stored at 20c until dna extraction . \n thereafter , genomic dna was extracted from the umbilical cord blood samples by the standard phenol - chloroform extraction procedure . \n the extracted dna was analyzed quantitatively and qualitatively by biophotometer plus ( eppendorf ag 22331 , hamburg germany ) . \n each dna sample was diluted to an optimal concentration of 50 ng/l , and further stored in aliquots at 4c , suitable for downstream analysis . \n the enos glu298asp ( g894 t ) and 786 t > c alleles were identified and analyzed by polymerase chain reaction -restriction fragment length polymorphism ( pcr - rflp ) . on the other hand , \n the 27 bp direct repeat in intron 4 vntr region was determined by polymerase chain reaction ( pcr ) alone as described elsewhere ( 17 ) with minor modifications . \n the details of the primers used for amplification , with the annealing temperature and cyclic conditions and the enzymes used for the rflp analysis are summarized in table 1 . \n the amplified pcr products for enos glu298asp and 786t > c were checked for amplification on 1% agarose gel and the restriction enzyme digested products were electrophoresed and visualized on 8% and 12% polyacrylamide gels , respectively . the amplified pcr product for enos glu 298asp ( 894g > t ) polymorphism resulted in a 206 bp amplicon and the same was checked with agarose gel electrophoresis . \n after restriction digestion with mboi ( new england biolabs ) , bands were observed at 119 and 87 bp for homozygous variant type , 206 , 119 and 87 bp for heterozygous variant type and a single band at 206 bp for normal type on 8% polyacrylamide gel . \n similarly , the amplified pcr product of enos 786t > c polymorphism resulted in a 223 bp amplicon and after restriction digestion with ngomiv ( new england biolabs ) , bands were observed at 115 and 108 bp for homozygous variant , 223 , 115 and 108 bp for heterozygous variant type and a single band at 223 bp for normal type on 12% polyacrylamide gel . on the other hand , \n the amplified pcr products of the enos 27 bp direct repeat on intron 4 vntr region were directly resolved on 7% low melting agarose , and the fragments were visualized by ethidium bromide staining and ultraviolet transillumination . \n the intron 4 vntr genotypes were observed as 4a homozygous ( 4a/4a ) type with 393 bp , heterozygous type ( 4a/4b ) with 393 and 420 bp and 4b homozygous type ( 4b/4b ) with 420 bp . \n details of primers , pcr conditions and restriction digestion used for genotyping enos , cyp11b2 and ace gene polymorphisms \n the cyp11b2 promoter polymorphism ( 344c > t ) was detected by pcr - rflp method as described elsewhere ( 16 ) . \n the details of the primers used for amplification , with the annealing temperature and cyclic conditions and the enzymes used for the rflp analysis are summarized in table 1 . \n the amplified pcr product was checked for amplification on 1% agarose gel and the restriction enzyme ( haeiii , new england biolabs ) digested products were electrophoresed and visualized on 8% polyacrylamide gel . after restriction digestion , \n bands were observed at 274 , 138 and 126 bp for homozygous variant type , 274 , 203 , 138 , 126 and 71 bp for heterozygous variant type and 203 , 138 , 126 and 71 bp for normal type . \n the presence or absence of 287 bp fragment in intron 16 of ace gene was determined by allele specific pcr method ( 5 ) . \n the details of the primers used for amplification , with the annealing temperature and cyclic conditions are summarized in table 1 . \n amplification was done using forward and reverse primer which binds to the ace gene sequence and the amplified pcr products were analyzed by 2% agarose gel electrophoresis . \n the sizes of the different fragments obtained were 490 bp ( ii ) , 190 bp ( dd ) , and 490 and 190 bp ( i d ) . \n the samples reported as homozygous deletion ( dd ) in this assay were retyped using a third insertion specific primer . \n this was especially done to rule out the possibility of mistyping individuals due to preferential amplification of the deletion fragment over the longer insertion fragment ( 18 ) . \n the data analysis was executed using graphpad instat 3 statistical software ( graphpad software inc . , san diego , ca , usa ) . \n genotype frequencies in the study population were checked for hardy - weinberg equilibrium ( hwe ) scopes by comparing the observed and expected frequencies by using hwe calculator . \n the deviation of the genotype distribution from hwe was measured by chi - square test . \n differences in allele frequencies between tamilian and other ethnic populations were assessed by fisher s exact and chi - square tests . \n linkage disequilibrium among pairwise enos snps was measured using d0 value , and frequency of haplotypes consisting of multiple snps found in the same gene ( enos ) was estimated with expectation - maximization algorithm using haploview software version 4.2 . \n the current study was ethically approved and executed in accordance with the institute ethics and research committee guidelines of jipmer , pondicherry , india . \n the studied allele and genotype frequencies of enos , cyp11b2 and ace gene polymorphisms among the tamilian population are summarized in tables 2 and 3 , respectively . \n the observed frequencies of the studied polymor phisms did not diverge from the hwe ( p>0.05 ) . as shown in table 2 , the minor allele frequencies of the enos gene polymorphisms viz . \n , asp ( rs1799983 ) , c ( rs2070744 ) and 4a ( rs3138808 ) were found to be 12% , 21.6% and 21.1% , respectively . on the other hand , \n the minor allele frequencies of the cyp11b2 , ( t , rs1799998 ) and ace , ( del , rs4646994 ) gene polymorphisms as demonstrated in tables 3 and 4 were found to be 43.8% and 42.7% , respectively . of the studied snps , cyp11b2 ( rs1799998 ) and enos glu298 asp ( rs1799983 ) \n the allele and genotype frequencies of enos gene variants in tamilian population the allele and genotype frequencies of cyp11b2 and ace 287 \n\n bp \n\n alu i / d gene variant in tamilian population genotype and allele frequencies of enos glu298asp ( rs1799983 ) polymorphism observed in this study and compared with those reported in other ethnicities n= total number of subjects , ns= no significant difference ( p>0.05 ) , chb - han chinese in beijing , china , jpt - japanese in tokyo , japan a total of six different haplotype structures with a frequency of > 1% were generated from three enos ( rs 2070744 , rs3138808 , rs1799983 ) gene polymorphisms . among the haplotypes generated , the haplotype t-4b - g was the most common with the frequency of 64.4% . \n ensuing haplotypes were c-4a - g , t-4b - t , t-4a - g , c-4b - t and c-4b - g with frequencies of 15.5% , 8.3% , 5.7% , 3.8% and 2.4% , respectively . comparatively substantial ld pattern ( d=1 ) was observed between rs1799983 and rs3138808 . \n likewise , moderate ld ( d= 0.658 ) was detected between rs2070744 and rs1799983 ( figure 1 ) . \n linkage disequilibrium ( ld ) plot of the studied enos gene polymorphisms and the observed d values ( within the diagonal boxes ) among the south indian tamilian population . \n each square shows the pairwise ld relationship between two snps and the values inside the square denote d value . \n the color gradient from red to white reveals higher to lower ld ( d 1 - 0 ) \n the studied allele and genotype frequencies of enos , cyp11b2 and ace gene polymorphisms among the tamilian population are summarized in tables 2 and 3 , respectively . \n the observed frequencies of the studied polymor phisms did not diverge from the hwe ( p>0.05 ) . as shown in table 2 , the minor allele frequencies of the enos gene polymorphisms viz . \n , asp ( rs1799983 ) , c ( rs2070744 ) and 4a ( rs3138808 ) were found to be 12% , 21.6% and 21.1% , respectively . on the other hand , \n the minor allele frequencies of the cyp11b2 , ( t , rs1799998 ) and ace , ( del , rs4646994 ) gene polymorphisms as demonstrated in tables 3 and 4 were found to be 43.8% and 42.7% , respectively . of the studied snps , cyp11b2 ( rs1799998 ) and enos glu298 asp ( rs1799983 ) \n the allele and genotype frequencies of enos gene variants in tamilian population the allele and genotype frequencies of cyp11b2 and ace 287 \n\n bp \n\n alu i / d gene variant in tamilian population genotype and allele frequencies of enos glu298asp ( rs1799983 ) polymorphism observed in this study and compared with those reported in other ethnicities n= total number of subjects , ns= no significant difference ( p>0.05 ) , chb - han chinese in beijing , china , jpt - japanese in tokyo , japan \n a total of six different haplotype structures with a frequency of > 1% were generated from three enos ( rs 2070744 , rs3138808 , rs1799983 ) gene polymorphisms . among the haplotypes generated , \n t-4b - t , t-4a - g , c-4b - t and c-4b - g with frequencies of 15.5% , 8.3% , 5.7% , 3.8% and 2.4% , respectively . comparatively substantial ld pattern ( d=1 ) was observed between rs1799983 and rs3138808 . \n likewise , moderate ld ( d= 0.658 ) was detected between rs2070744 and rs1799983 ( figure 1 ) . \n linkage disequilibrium ( ld ) plot of the studied enos gene polymorphisms and the observed d values ( within the diagonal boxes ) among the south indian tamilian population . \n each square shows the pairwise ld relationship between two snps and the values inside the square denote d value . \n the color gradient from red to white reveals higher to lower ld ( d 1 - 0 ) \n endothelium maintains the vascular tone and plays a key role in regulation of blood flow and blood pressure . \n nitric oxide is a major vasodilator substance released by the endothelium and is a chief regulator of endothelial function . \n endothelial nitric oxide synthase ( enos ) helps in the formation of nitric oxide in the endothelial cells from its precursor , l - arginine ( 19 ) . \n abnormalities in enos enzyme that synthesizes nitric oxide in the endothelial cells can lead to the worst course of action and often result in cardiovascular diseases like hypertension , myocardial infarction , atherosclerosis , preeclampsia , etc . \n this study is the first of its kind to survey the distribution of numerous functionally important polymorphisms ( enos glu298asp , 4b/4a and 786t > c , ace i / d and cyp11b2 344c > t ) among healthy pregnant women . \n the population sample included in the study was a homogeneous collection of south indian tamilian women . \n furthermore , in this study , for the first time , the presence of a novel allele , viz . , the 27 bp intron 4 vntr in the enos gene was reported which has not been studied till date among tamilian population . \n on the whole , our conclusions displayed a substantial inter - ethnic inconsistency in the distribution of enos , ace and cyp11b2 genes variants . \n taking into account the existing allele and genotype frequencies of enos , cyp11b2 and ace genes of the current population , an extensive comparative analysis of the current data manifested a relatively higher frequency of glu298asp mutant allele when compared to the sub - saharan african population . in just the same way , the current existing data for the same allele was relatively lower in comparison to that of the caucasian race ( table 4 ) . \n , 786t > c , whose mutant allele was found to be comparatively higher than the japanese and afro - american populations was found to be reasonably lower than the sub - saharan and caucasian ethnics ( table 5 ) . \n this aside , the 27 bp intron 4 vntr polymorphism of the enos gene had a relatively higher frequency when compared to other populations of the world , although it appeared to be moderately lower than the tunisians and the germans ( table 6 ) . \n genotype and allele frequencies of enos 786t > c ( rs2070744 ) polymorphism observed in this study and compared with those reported in other ethnicities n= total number of subjects , ns= no significant difference ( p>0.05 ) , chb - han chinese in beijing , china , jpt - japanese in tokyo , japan , yri - yoruba in ibadan , nigeria , ceu , ceph - utah residents with ancestry from northern and western europe genotype and allele frequencies of enos intron 4 vntr ( rs3138808 ) polymorphism observed in this study and compared with those reported in other ethnicities n= total number of subjects , ns= no significant difference ( p>0.05 ) , chb - han chinese in beijing , china , jpt - japanese in tokyo , japan likewise , the mutant allele for the promoter region polymorphism of cyp11b2 gene , viz . \n , 344c > t was found to be significantly higher among the african population , but moderately high within north indians and other asiatic ethnic groups . in the same manner \n , it was also found to be moderately high among the caucasian ethnicity as well ( table 7 ) . \n genotype and allele frequencies of cyp11b2 -344c > t ( rs1799998 ) polymorphism observed in this study and compared with those reported in other ethnicities n= total number of subjects , ns= no significant difference ( p>0.05 ) , chb - han chinese in beijing , china , jpt - japanese in tokyo , japan , chd - chinese in metropolitan denver , colorado , gih - gujarati indians in houston , texas , asw - african ancestry in southwest usa , lwk - luhyain webuye , kenya , mkk - maasai in kinyawa , kenya , tsi - toscani in italia regarding the distribution of ace intron 16 alu ( ins / del ) polymorphism , in comparison with other racial groups of the world , it appears to be fairly alike with other world - wide ethnicities . \n however , there was a significantly higher frequency of the same among the omani arabs . \n nonetheless , there was a slightly moderate significance for the same among the caucasian population ( table 8) . among the variants of enos gene explored in this study , the minor allele frequency of rs1799983 ( asp ) was similar to those previously reported in north indian and other asiatic population ( 2128 ) . \n however , it was found to be significantly higher among the caucasian population ( p=0.0001 ) . on the other hand , \n the c allele frequency of rs2070744 was significantly higher than those displayed among chinese , japanese and other hapmap populations ( for all comparisons , p=0.0001 ) ( 28 ) . \n this aside , the intron 4 vntr ( rs3138808 ) polymorphism appeared to be considerably higher when compared to the columbians ( p=0.0004 ) . \n nevertheless , no such difference was detected with other major world populations ( 28 , 29 ) . \n genotype and allele frequencies of ace 287 bp alu i / d polymorphism observed in this study and compared with those reported in other ethnicities n= total number of subjects , ns= no significant difference ( p>0.05 ) , hp= himachal pradesh studies have shown that snps occurring in the enos gene leads to variations in response to the vascular endothelium with increased oxidative stress ( 19 ) . \n in addition , the glu298asp variant of the enos gene has been found to exhibit a significant role in coronary atherosclerosis ( 20 ) . besides , with the exponentially alarming increase in the incidence of preeclampsia \n , few reports have also substantiated the association of glu298asp variant polymorphism with a striking decrease in no levels eventually leading to its altered expression among preeclamptic women ( 21 ) . \n also significant is the fact that the c - glu - b haplotype may protect against the progression of pe by increasing the endogenous formation of no . \n , 786t > c , involves the replacement of a thymidine by cytosine at nucleotide 786 position of the regulatory region . \n the overall effect of this variation is that it reduces the promoter activity of the enos gene , thereby leading to an alteration in the production of nitric oxide ( 46 ) . among the japanese population , \n the homozygous subjects with 786t > c had a high risk of developing coronary spasm . \n studies have also shown that this snp was associated with the development of blood pressure among healthy adult males . \n furthermore , in the case of homozygous 786t > c variants , the promoter activity was reduced by 50% . \n this in turn led to an improper functioning of the l - arginine - no pathway causing endothelial dysfunction . \n these findings thus substantiate the significant role of enos gene in maintaining the structural integrity of the arterial wall ( 46 ) . in much the same way \n , the functional importance imparted by the 27 bp intron 4 vntr polymorphism of the enos gene can not be underestimated as well . \n it is located in the intron 4 region of the enos gene and consists of two alleles . \n out of the two alleles , the larger allele has five tandem repeat units of 27 bps ( first three has as and the last two \n however , the smaller allele has only four repeats ( first two as and last two \n these alleles are known as enos 4a and enos 4b for shorter and larger alleles , respectively . \n this polymorphism , however , is directly related to the change in the plasma nox levels ( 47 , 48 ) . \n this aside , also significant is the fact that cardiovascular complications are generally depicted as a multifactorial and polygenic disorder , predisposed by genetic and environmental factors ( 2 ) . \n , the rennin angiotensin aldosterone system ( raas ) , plays a crucial role in the production of the aldosterone hormone , which is chiefly associated with water - electrolyte balance . in the current study population , the minor allele frequency of 344c > t ( rs1799998 ) polymorphism in the cyp11b2 gene \n was found to be significantly lower than the japanese and african population ( p=0.0001 ) . \n however , it appeared to be reasonably somewhat significant among the north indians and chinese ( p0.001 ) . \n apart from its function in the regulation of the aldosterone activity , this gene may have direct effect on the cardiovascular system as well . \n the expression of this gene is regulated by the angiotensin ii and potassium ( 5 ) . \n of the three , the mutation c-344 t which occurs in the promoter region of the gene is known to be associated with high blood pressure and ischemic stroke among chinese population ( 49 ) . another report from our laboratory \n has also validated the notion that essential hypertension was associated with the cyp11b2 polymorphism ( c-344 t ) in a study conducted among south indian tamilian population ( 16 ) . \n in addition , it has also substantiated the fact that environmental and other risk factors must be taken into account while predicting the influence of genes on multifactorial diseases like arterial hypertension ( 49 ) . \n this apart , one can not ignore the fact about the substantial role rendered by genetic polymorphisms in raas for the progression of preeclampsia . \n also significant is the fact that at post - transcriptional level , mirna interacts with the targeted site within the 3-utr of the raas gene which in turn triggers the regulation of raas and the pathology of preeclampsia . \n although the results generated by several studies are controversial , it is nonetheless interesting in terms of prospective analytical implication ( 50 ) . \n likewise , the minor allele frequency of the 287 bp alu i / d polymorphism of the ace gene ( rs 4646994 ) as seen in the current study , was significantly higher among the omani arabs ( p=0.0001 ) and fairly marginally significant when compared with the caucasian groups ( p0.5 ) . \n various studies have revealed that this polymorphism in ace gene is responsible for different cardiovascular diseases like hypertension , myocardial infarction and renal diseases like nephropathy ( 51 ) . \n a significant association between homozygotes dd and hypertension has been reported in andhra population whereas no such association was reported in western indians ( 52 ) . \n this association is prominent and highly prevalent in men than in females according to the large number of studies conducted in indian as well as foreign populations . to further complicate the issue , ace \n i d polymorphism was also reported to be associated with coronary artery disease in a meta - analysis of 118 studies consisting of 43,733 coronary artery patients and 82,606 controls ( 53 ) . \n it was also reported that dd genotype and d allele result in an increased risk for hypertrophic cardiomyopathy and dilated cardiomyopathy ( 54 ) . \n the systolic blood pressure was reduced and the mean arterial blood pressure was greater in subjects with dd genotype when compared to other ace i / d genotypes on treatment with hydrochlorothiazide among 829 patients ( 55 ) . \n however , the effect of ace i / d polymorphisms on the progression of preeclampsia is still ambiguous and yet needs to be explored in detail . \n literature is inadequate in terms of the role of polymorphisms in this gene and their resultant risk to preeclampsia . \n although several studies have investigated the association of polymorphisms present in these genes ( enos , cyp11b2 and ace ) with hypertension , and other cardiovascular parameters , there are few or no reports available documenting the allele , genotype and haplotype frequencies of the same in south indian tamilian population among healthy pregnant women . \n india has a polygenic population and possesses an amazing amalgamation of various cultures and races . \n in fact , it accounts for more than one sixth of the world s population and holds more than two thousand ethnic groups of people . in other words \n , india constitutes a highly complex and colorful social mosaic . in spite of this broad range of cultural diversity and heterogeneity , \n it has a clearly distinguishable pattern , wherein sociocultural diversity is highly sustainable and strong ( 56 ) . to validate this notion , significant inter - ethnic differences in the distribution of enos , cyp11b2 and ace gene variants among various ethnic groups \n our study is the first epidemiological - based investigation to describe the distribution of three candidate genes like enos , yp11b2 and ace with their genotypes and haplotypes in an indian set - up among healthy pregnant women . \n extensive inter - ethnic inconsistency detected in the current study specifies the discrete genetic makeup of the south indian population . \n this in fact coincides with the indian genome variation consortium evaluation on the dravidian population ( 57 ) . \n new molecular conceptions propose newer possibilities of early diagnosis of elevated maternal and foetal risk during pregnancy . \n genetic predispositions in the form of single nucleotide polymorphisms in candidate genes of cardiovascular risk offer an effective means of early risk calculation . \n the outcome of this study paves way for future therapeutic value of these variants to be studied in a preeclamptic patient set - up . \n this in turn would pose a credible diagnostic potential for primary risk assessment to detect women who are susceptible to preeclampsia or other pregnancy related complications . \n moreover , this would further augment the potential remunerations for them , their offspring and the health care systems as a whole . \n in addition , even though ample studies substantiate the positive relationship in genetic mutations and increased risk for preeclampsia , additional large - scale examinations are required to evade the intervention from different variants .", "role": "user" }, { "content": "background : variants in the candidate genes enos , cyp11b2 and ace have been implicated as liable biomarkers that can predict complications like hypertension and preeclampsia . \n studies on the impact and distribution of these variants on healthy pregnancy have not been done so far in south indian or in any of the native indian population . \n examining these variants could lay a strong basis in understanding the genetic aspects of preeclampsia and further offer effective means in early risk assessment in a preeclampsia.methods:genotyping for 303 unrelated healthy women of tamilian origin who underwent uncomplicated term pregnancies was executed by pcr - rflp for enos , cyp11b2 and ace variants . \n haplotype assessment and pairwise linkage disequilibrium ( ld ) investigation were performed by haploview software.results:the prevalence of enos variants ( 786t > c , glu298asp and intron 4 vntr ) was 12% , 21.6% and 21.1% , respectively . \n the incidence of cyp11b2 ( 344 c > t ) and ace ( 287 bp alu i / d ) variants was found to be 43.8% and 42.7% . \n the observed frequencies of the studied polymorphisms did not diverge from the hwe ( p>0.05 ) . \n significant ld was observed between 3 enos gene polymorphisms . \n six different haplotype structures with a frequency of > 1% were generated from three enos variants . among the haplotypes generated , \n the haplotype t-4b - g was the most common with the frequency of 64.4% . \n there was a statistically significant inconsistency in the study population in comparison to other global races.conclusion:the outcome of this study could be used for investigating future therapeutic value of the variants in a preeclamptic set - up which could pose a credible diagnostic potential for primary risk assessment of women susceptible to preeclampsia / other pregnancy related complications .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: nanoparticles are being \n introduced , in some cases rapidly , into \n the consumer market but there is a fundamental lack of knowledge on \n their potential consequences for human and environmental health ( reviewed \n in refs ( 1 and 2 ) ) . \n the use of silver \n nanoparticles ( agnp ) has increased very significantly in recent years , \n with a current total global production estimated at 500 tonnes per \n year ( reviewed in ref ( 1 ) ) . \n very little empirical data are available on environmental levels \n of agnp but given their very significant production , it is likely \n that agnp are reaching the aquatic environment where they may impact \n on living organisms , as either particulates and/or as dissolved silver \n ions . \n the susceptibility of freshwater fish to the toxic effects \n of exposure \n to silver ions ( ag ) is well documented and acute toxicity \n is associated predominantly with ionic ag interactions \n at the gills , where they inhibit basolateral na / k - atpase activity . \n the toxicity of this metal contaminant is affected by ag speciation , \n which in turn is affected by a number of parameters including ionic \n composition and organic matter dissolved in the water . as a consequence \n of the decreased bioavailability of ag with increased ionic strength \n of the water , fish inhabiting freshwater environments are more susceptible \n to ag toxicity compared with marine fish species ( reviewed in ref ( 6 ) ) . a number of studies \n investigating the toxicity of agnp , in a range \n of fish species , \n have provided evidence for concentration - dependent \n toxicity ( reviewed in ref ( 1 ) ) . \n agnp have been shown to enter zebrafish embryos via the \n chorion pore canals and were reported to be present in the brain , \n heart , yolk and blood of developing zebrafish . in \n the study by asharani and colleagues , \n however , \n exposures to agnp were conducted at very high concentrations and the \n particles had been stabilized with starch or bsa to prevent agglomeration . \n the conditions adopted were likely to enhance uptake in those laboratory \n exposures , but they may not reflect environmental reality . in juvenile \n or adult fish , \n one of the main routes of uptake and toxicity for agnp \n appears to be via the gills , and adverse effects include on osmoregulation , \n similar to that reported for ionic silver . for \n agnp , \n the effect on na / k - atpase activity in \n gills has been attributed to the dissolution of silver ions from the \n particles , and/or to the presence of silver ions at the surface of \n the agnp . \n agnp have also been reported \n to reduce the ability of fish to extract oxygen from the water during \n progressive oxygen depletion , without \n causing morphological alterations on the gill . \n the \n mechanisms by which this specific effect of exposure to agnp occurs \n are unclear and may be due to damage of the gill surface caused by \n the presence of particulate matter and/or local dissociation of ag from the agnp trapped in the mucus surrounding the gill membrane . \n the biological processes affected by exposure to agnp , reported across \n a variety of organs , include induction of oxidative damage , alterations \n to the regulation of enzymes responsible for free radical scavenging , \n altered regulation of gene expression pathways involved in apoptosis , \n and disrupted regulation of the cellular machinery involved in storing , \n detoxification and metabolism of metals ( such as metallothionein 2 ) . \n the objective of this study was to investigate the molecular \n mechanisms \n of toxicity of agnp ( 10 nm ) in comparison with a micrometer sized \n counterpart ( ag bulk , 0.6 - 1.6 m ) and with ag , using \n a recently developed high - throughput ( ht-)supersage approach on an \n illumina ga ii platform and zebrafish \n ( embryos ) as a model organism . \n our data demonstrated that most transcriptomic \n alterations caused by exposure to agnp and its ionic and bulk counterparts \n were common across all treatments , supporting the hypothesis that \n the toxicity of agnp is principally associated with the toxicity of \n ag at the surface of the particles or dissolved in the \n water . \n we also identified some gene changes unique to each treatment , \n suggesting that there may also be some particle - specific effects . \n silver particles ( designated as agnp [ 10 nm ] , and ag \n bulk [ 0.61.6 m ] ) were purchased from nanostructured \n and amorphous materials inc . , \n houston , tx and silver with 2% hno3 was obtained from perkinelmer life and analytical sciences , \n shelton , ct . \n further details on the characterization of these particles \n and their dissolution in exposure water can be found in ref ( 13 ) and in the supporting information ( si ) . \n adult zebrafish \n ( wild - type wik strain , originally from the max planck institute , tubingen , \n germany ) for the provision of embryos were kept in aquaria at the \n university of exeter in 140 l mixed - sex stock tanks , as described \n in ref ( 18 ) . \n fish were \n allowed to breed naturally and eggs were collected in glass egg chambers , \n approximately 1 h postfertilization ( hpf ) . \n stock solutions for agnp , ag bulk \n and silver nitrate were made up in ultrapure water , and sonicated \n for 1 h to ensure dispersal of the particles . \n exposures were conducted \n in glass chambers , at 28 1 c with a 12 h light : dark photoperiod . \n immediately prior to the start of the exposures , glass chambers received \n 400 ml artificial water , prepared according to the iso \n 73463:1996 \n guideline , containing 5 g / l of \n 10 nm agnp , 5 g / l of ag bulk or 0.25 g / l of silver nitrate . \n these exposure \n concentrations were well below those causing overt toxicity , based \n on the mortality curves for the various forms of silver obtained under \n the same experimental conditions in our laboratory ( see si figure s1 ) . \n the dosing of ag bulk was chosen \n to be the same as that for the agnp ( in terms of mass ) , to allow us \n to test whether the size of the particles was a determinant of the \n effects seen . \n g / l was \n included to provide a likely worst case scenario for the highest dissolution \n of ag for the agnp and ag bulk exposures in the adopted \n exposure conditions , based on data from the literature suggesting \n that dissolution of agnp is variable but below 5% ( osborne et al 2012 \n reported this to vary between 0.1 and 2% in zebrafish embryo culture \n water ( 20 ) ) . \n our own experiments ( see si ) suggest that dissolution rates for agnp and \n ag bulk under our experimental conditions were 0.27% 0.15% \n and 0.27% 0.07% , respectively . \n exposures were initiated at \n 4 hpf and 585 99 eggs were deployed into each treatment chamber . \n unfertilized eggs were identified by visual inspection using light \n microscopy ( kyowa optical sdz pl , kyowa optical , japan ) and removed \n from the exposure chamber ( 22.8% of the total number of eggs were \n unfertilized ) . \n solutions were replaced every 12 h during the exposure \n period , and dead embryos were removed at the times of replacement \n of the exposure water . at 24 h and 48 h , three pools of 50 embryos \n were removed from each of the exposure tanks , immediately frozen in \n liquid nitrogen and stored at 80 c for analysis of gene \n expression . \n the experiment was terminated at 48 hpf . in order \n to verify the biological significance of the effect of all treatments \n on the oxidative phosphorylation pathway , we designed a study to evaluate \n the effects of exposure to a series of doses of ag on \n embryo oxygen consumption . \n zebrafish embryos were exposed to a range \n of concentrations of ag to include those expected to be \n present in the water following exposure to agnp , ag bulk and ag ( 0 , 0.031 , 0.062 , 0.125 , 0.250 , 0.500 , 1 , and 5 g \n exposures were initiated at 4 hpf and maintained \n for 48 h , and the average oxygen consumption per embryo was determined \n for two 24 h periods ( 024 h and 2448 h from the onset \n of the exposure ) . \n the full description of the methodology adopted \n for these procedures is given in the si . \n rna \n extraction was conducted on each pool of 50 embryos using the \n rnaeasy kit , according to the manufacturer s instructions ( qiagen , \n uk ) . \n the quality and concentration of the resulting rna were determined \n using a nanodrop nd-1000 spectrophotometer ( nanodrop technologies , \n wilmington , de ) , and an agilent bioanalyser 2100 ( agilent technologies , \n inc . , \n ht - supersage was conducted according to previously \n described methods and libraries were \n sequenced using an illumina genome analyzer ( ga ) ii platform . \n further \n details are given in the si . in total , \n over 16.9 million \n 36-bp sequences were obtained and processed , using the supersage data \n analysis procedure presented in figure 1 . \n a \n selection of tools from the fast - toolkit ( http://hannonlab.cshl.edu/fastx_toolkit/ ) and our own custom perl scripts were used , running under the nebc \n bio - linux environment . \n the fastq / a barcode \n splitter ( fastx - toolkit ) was used to separate the samples from each \n lane based on the 4 base barcodes . \n the barcodes were removed from \n the sequences using the fastq / a trimmer ( fastx - toolkit ) , before converting \n the sequences to fasta format using fastq - to - fasta ( fastx - toolkit ) . \n a perl script ( si , file s1 ) was used to \n remove all remaining adapter sequences after the last occurrence of \n catg ( nlaiii restriction site , used for sequence \n tag preparation ) in each of the sequences . \n fastx_collapser ( fastx - toolkit ) \n was used to collapse the sequences and calculate the frequency of \n unique sequence tags ( unitags ) in each library . \n unitags \n were mapped to all available zebrafish genes ( 28 491 genes ) \n in ensembl zv9 ( release 60 ; ( 22 ) ) using bowtie , with no mismatches allowed . \n counts of unitags \n that mapped to the same gene were summed and unitags that aligned \n with more than one gene were removed from the data set using the perl \n scripts provided in si file s2 . for each \n treatment , the counts of unitags representing each ( unique ) gene were \n normalized to 1 million tags . \n fold changes ( fc ) were determined for \n each gene by dividing the number of tags in the normalized silver \n treatment libraries by the number of tags in the normalized control \n libraries . \n fc values less than 1 ( down - regulated genes ) were transformed \n using the following formula : 1/fc , in order to center the \n fold change values around 0 . \n differences in gene expression between \n the silver treatments and the controls were determined using discoveryspace \n 4.0 , which implements the audic - claverie \n significance test to account for differences in sample size and p values were adjusted using a false discovery \n rate correction . \n genes that were found \n to be significantly altered as a result of the silver treatments ( adjusted p < 0.05 ) were further investigated . in order to visualize \n differences and similarities in gene expression between each of the \n silver treatments and the controls , \n scatter plots were produced using \n discoveryspace and correlation analysis ( pearson s ) was performed \n using sigmaplot 11 ( systat software uk ltd . ) . \n functional annotation analysis \n was performed on the lists of differentially \n expressed genes ( adjusted p < 0.05 ) for each treatment \n using the database for annotation , visualization and integrated discovery \n ( david v6.7 ; ) and using all genes that were \n found to be expressed in zebrafish embryos at 24 hpf ( 12 939 \n genes ) or 48 hpf ( 13 584 genes ) , respectively , as background . \n gene ontologies ( go ) for biological processes , cellular components \n and molecular function were considered significantly enriched when p < 0.05 . \n pathway analysis \n was conducted through \n the use of ingenuity pathways analysis ( ipa ; ingenuity systems , http://www.ingenuity.com ) , based on the lists of differentially \n expressed genes ( adjusted p < 0.05 ) for each of \n the treatments . \n enrichment of canonical pathways was determined using \n the ipa library of canonical pathways , with a p value cutoff of 0.05 \n ( adjusted for multiple testing using the fisher s exact test ) . \n similarly , enriched kegg pathways were determined using the lists \n of differentially expressed genes ( adjusted p < \n 0.05 ) and all expressed genes at 24 hpf and 48 hpf , respectively , \n as background using david . \n statistical \n analysis of \n the data for embryo survival and oxygen consumption were conducted \n within sigmaplot 11 ( systat software uk ltd . ) . \n changes in embryo survival \n caused by exposure to agnp , ag bulk or ag during the exposure \n experiments for molecular analysis were analyzed using chi - square \n tests . \n relationships between the concentration of ag and \n oxygen consumption were investigated using regression analysis . \n differences \n between treatment groups were determined using one way analysis of \n variance ( anova ) , followed by an all pair - wise multiple comparison \n procedure ( student newman keuls method ) . for these tests , \n data were considered to be significant when p < \n 0.05 . the raw reads and processed unitag \n frequency tables for each of the ht - supersage libraries have been \n deposited in ncbi s gene expression omnibus and are accessible through geo series accession number \n gse38125 . \n embryo mortality \n during the course \n of the exposures for generation of embryo samples for molecular analysis \n was 4.6 2.5% , which falls within that expected for zebrafish \n and within the guidelines for oecd standardized testing guidelines . \n there were no differences in embryo mortality \n rates between treatment groups ( p = 0.213 ) , confirming \n that all exposures were conducted at concentrations below those causing \n any overt toxicity . \n the number \n of sequences \n obtained for each library ranged from 1.2 million ( 48 hpf agnp ) to \n 2.2 million ( 24 hpf agnp ) and the abundance distributions of these \n sequence tags were generally consistent between all libraries ( si table s1 ) . in total , 13 680 994 \n sequences were taken further for analysis and these were represented \n by 606 259 unique sequence tags ( unitags ) . in total 99 683 \n unitags mapped to zebrafish genes , with 77 821 of these mapping \n to unique genes only ( 7 690 269 counts in total ) and \n representing 14 793 genes ( figure 1 ) . \n this is consistent with previous studies that reported a similar number \n of expressed genes in embryos at similar stages of development using \n zebrafish affymetrix microarrays ( arrayexpress database [ http://www.ebi.ac.uk/arrayexpress/ ] ; experiment i d : e - tabm-33 ) or rna - seq . \n approximately 80% of the genes were represented by more than one \n unitag ( see si figure s2 ) , consistent with \n other studies that are based on sage methods , which is likely the \n result of incomplete nlaiii digestion during the \n library preparations , alternative polyadenylation and/or alternative \n splicing sites . \n statistical analysis of the gene expression \n data identified genes differentially expressed between the different \n treatments and the control , for both 24 hpf and 48 hpf ( summarized \n in si file s3 ) . \n a visual representation \n of the expression profiles of each treatment group compared to the \n respective control is presented in si figure \n s3 . \n there was a strong correlation between the levels of expression \n of genes in the controls compared with those in each treatment group \n ( r > 0.937 ) . \n the number of differentially expressed \n genes per treatment group , and the overlap between the differentially \n expressed genes for each treatment were consistent across all treatments , \n at both 24 h and 48 h of exposure ( with the exception of the treatment \n 24 h ag ; which showed a greater proportion of differentially \n expressed genes ; figures 2a , b , and c ) . \n a heatmap \n of the differentially expressed genes across the various silver treatment \n libraries is shown in si figure s4 , and \n demonstrates the consistency in gene expression across all treatments . \n the condition tree highlights the differences in gene expression profiles \n for the differentially expressed genes between the 24 h ag compared to all other treatments and between embryos collected at \n 24 hpf and 48 hpf . \n ( a ) . the number of differentially expressed genes ( adjusted p values < 0.05 ) as a result of the various silver treatments \n ( agnp , ag bulk and ag ) compared to the controls . percentages \n of up- and down - regulated genes for each of the silver treatments \n are indicated on the bars . \n venn - diagram showing the overlap \n between sets of differentially expressed genes obtained for each of \n the silver treatment libraries after 24 ( b ) and 48 ( c ) hours of exposure . \n some of the differentially expressed \n genes were found to be specific \n to each of the different treatments ( agnp 13 genes ; ag bulk \n 1 gene ; ag - 32 genes ) , reflecting gene responses \n distinct to the different treatment ( si table s2 ) . \n distinct genes were found to be differentially expressed \n at both time points for any one treatment and not present in the list \n of differentially expressed genes for the other treatments at any \n time point . \n we explored \n the biological significance of the changes in gene expression caused \n by exposure to agnp , ag bulk and ag in 24 hpf and 48 hpf \n embryos by determining the enrichment in go terms and canonical pathways \n using david and ipa . \n analyses were conducted based on differentially \n expressed genes , including all up- and down - regulated genes , to obtain \n a global overview of the biological effects of the three distinct \n treatments ( figure 3 , si figure s5 and file s5 ) . \n the most significantly over - represented \n go terms and kegg pathways ( ribosome and oxidative phosphorylation ) \n were common to all three treatments within each time of sampling , \n demonstrating a very significant overlap in the mechanisms of toxicity \n of the three forms or silver considered in this study . based on this \n overlap \n , it seems likely that the toxicity of agnp and ag bulk to \n zebrafish embryos is predominantly associated with the toxicity of \n free ag . \n kegg pathways over - represented in differentially expressed \n gene \n lists following exposure of zebrafish embryos to silver . over - representation \n analysis was conducted for gene lists differentially expressed between \n each treatment and its control ( adjusted p values \n < 0.05 ) , after 24 and 48 h of exposure , using the list of all expressed \n genes as a background , within david . \n the full data set for kegg pathway \n over - representation is presented in si , \n file s5 . \n the dissolution rates of agnp \n and ag bulk in our experiments were \n 0.27% 0.15% and 0.27% 0.07% , respectively . \n parallel \n studies in our laboratory , investigating the dissolution rates for \n agnp and bulk silver in embryo culture water , have found them to vary \n between 0.1 and 2% over a 48 h period . \n furthermore , very recently published data suggest that some silver \n particles ( 41.6 9.1 nm agnps at a concentration of 0.2 nm ) \n can penetrate the chorion through diffusion via the chorion canals and that once inside the chorion , the dissolution \n rate can be much higher compared to that observed in the exposure \n water . \n consequently , the amount of bioavailable \n ag in the agnp and ag bulk treatments would likely be \n sufficient to cause most of the changes in gene expression observed . \n for many of the genes significantly affected in all the exposures , \n the changes were more pronounced ( in terms of fold - change ) for the \n exposure to ag compared with those observed for agnp and \n ag bulk , and this is likely to be associated , at least in part , with \n the bioavailability of silver ions in each treatment . \n however , the \n pathways affected ( as assessed by the analysis of go and kegg pathway \n enrichment ( figure 3 , si figure s5 and file s5 ) ) remained common across all treatments . \n these \n changes are consistent with previous literature reporting effects \n of exposure to ag ( ions or nanoparticles ) on several biological processes \n across a series of model organisms . \n the \n most significantly enriched go terms for all treatments , both \n at 24 and 48 hpf were ribosome , translation and structural constituents \n of ribosome , for cellular components , molecular functions and biological \n processes , respectively . \n concurrently , the most enriched kegg pathway \n was ribosome ( figure 3 and si file s5 ) . \n these results align well with previous literature \n that report disruption to protein biosynthesis pathways in a range \n of organisms following exposure to agnp and ag . \n for example , rpl10a was down - regulated \n by 5.6 , 3.4 and 5.6-fold ( 24 h ) , and rpl18a down - regulated \n by 12.2 , 1.2 and 9.7-fold ( 48 h ) , following exposure to agnp , ag bulk , \n and ag , respectively . \n expression of several genes encoding \n components of the ubiquitin proteasome system were also altered across \n all treatments , ( at 24 and 48 h ) , indicating that protein degradation \n pathways were also altered by the treatments ( si file s3 ) . \n oxidative phosphorylation was affected \n consistently by the exposure \n to agnp , ag bulk , and ag at both time points analyzed \n ( figure 3 ) . \n this is a complex pathway that \n plays a key role in atp generation in aerobic organisms , and is comprised \n of a series of five complexes and other associated molecules that \n act in concert within the mitochondrial inner membrane . \n the gene expression \n profiles following 24 h of exposure to all forms of ag showed a down - regulation \n of many of the genes encoding for complex i , ii , iii and iv ( figure 4 and si file s6 ) . \n within \n the complexes some genes were up - regulated whereas others were down - regulated , \n in particular for complex i ( for ag and ag bulk ) . \n this \n complex is comprised of a large number of genes that form 14 central \n and 32 accessory subunits , encoded by both the mitochondrial and the \n nuclear genome , and that associate into three functional modules , \n that oxidize nadh , reduce quinone and pump protons across the membrane \n ( reviewed in ref ( 39 ) ) . \n our data may reflect a differential regulation of the various \n subunits and/or a differential regulation of the various functions \n of complex i. overall , following 24 h of exposure to all ag treatments , \n the gene expression data indicated a down - regulation of all complexes \n involved in oxidative phosphorylation , possibly with the exception \n of complex i for ag bulk ( figure 4 and si file s6 ) . \n this effect is consistent with previously \n reported observations reporting a down - regulation of this pathway \n following ag exposure in a human cell line , using biochemical methods . \n the degree to which these genes were regulated \n between the various treatments was consistent with predicted differences \n in the concentrations of bioavailable ag , which were expected \n to be highest for ag , followed by agnp and lowest for \n ag bulk . \n effects of the silver treatments on transcription of genes belonging \n to the mitochondrial dysfunction pathway . \n shades of green and red \n represent down - regulation and up - regulation of target genes , respectively . \n ( a ) effects of exposure to agnp for 24 h on the mitochondrial dysfunction \n pathway . \n ( b ) summary of the effects of exposure to all treatments \n on the mitochondrial dysfunction pathway for 24 h and 48 h. numbers \n in the table represent fold - change compared to the time - matched control . \n illustrations of the mitochondrial dysfunction and oxidative phosphorylation \n pathways for all six treatments are presented in si , file s6 . \n pathways were generated through the use of ingenuity \n pathways analysis ( ingenuity systems , www.ingenuity.com ) . \n data for embryos analyzed following \n 48 h of exposure to all ag \n treatments similarly showed significant alterations in the expression \n of genes encoding for proteins belonging to all complexes of the oxidative \n phosphorylation pathway . when taken together , \n the changes in gene \n expression suggest an up - regulation of these complexes , consistent \n with a recovery of the activity in this pathway , during the 2448 \n h period , in exposed embryos ( figure 4 and si file s5 ) . \n the changes in gene expression \n for constituents of the oxidative \n phosphorylation pathway suggested that ag may cause a down - regulation \n in metabolic rates and atp synthesis during the first 24 h of exposure , \n with a subsequent recovery from this effect at 48 h for all treatments . \n to further investigate the feasibility of this hypothesis , we conducted \n an experiment to investigate the effects of ag on the \n metabolic activity , measuring oxygen consumption as a proxy for aerobic \n respiration of exposed embryos . \n our data demonstrated that ag caused a decrease in oxygen consumption during the first \n 24 h of exposure ( r = 0.469 ; p < 0.001 ; figure 5 ) , with significant decreases \n in oxygen consumption in embryos exposed to 0.125 , 0.5 , and 5 g \n ag / l compared with those exposed to 0.031 g ag / \n l , and 5 g ag / l compared to the controls \n during the first 24 h of exposure ( one way anova followed by student newman keuls \n method ; figure 5a ) . \n this effect of ag on embryo oxygen consumption was no longer apparent for the second \n 24 h period ( between 24 and 48 h of exposure ( r = \n 0.114 ; p = 0.467 ; figure 5b ) , supporting the inhibitory effects of ag on \n oxidative phosphorylation ( and associated decrease in oxygen consumption ) \n during the first 24 h of exposure and subsequent recovery by 48 h. \n together , these data support previous studies that have reported inhibition \n of oxidative phosphorylation following exposure to silver nanoparticles \n and silver ions in a range of mammalian model systems . \n importantly , our data suggest that zebrafish embryos have the capacity \n to deploy compensatory mechanisms at concentrations of ag below those \n causing overt toxicity . \n groups of 5 embryos were exposed to seven concentrations of \n silver ions ( 05 g \n / l ) in isolated glass vials , and the \n oxygen consumption was measured for 024h ( a ) and 2448 \n h ( b ) exposure periods ( n = six groups of five embryos \n per treatment ) . \n there was a significant effect of the exposure to silver \n ions for the 024 h , but not for the 2448 h exposure \n periods ( one way anova , p < 0.001 , followed by \n an all pairwise comparison between the groups using the student newman \n letters above the box plots \n represent statistical significance , with treatments with different \n letters being significantly different from each other . \n the mechanisms by which exposure to ag caused the \n observed changes \n in the oxidative phosphorylation pathway are difficult to ascertain . \n recent evidence from mammalian studies has shown that pyruvate kinase , \n m2 ( pkm2 ) that catalyzes the rate limiting atp producing step of glycolysis , \n plays a key role in maintaining cellular redox homeostasis in cancer \n cells . \n this enzyme is specifically oxidized \n by h2o2 , resulting in a decrease of its activity , \n decreased pyruvate formation and increased flux of glycolytic metabolites \n into the pentose phosphate pathway . \n this pathway produces reduced \n nadph , a crucial source of reducing equivalents for fatty acid synthesis \n and for the glutathione , peroxiredoxin and thioredoxin systems , which \n play a key role in the detoxification of reactive oxygen species ( ros ) , \n providing cancer cells with a protective mechanism from intracellular \n ros ( reviewed in ref ( 45 ) ) . in contrast , normal mammalian cells express another pyruvate kinase \n isoform ( pkm1 ) , which is not susceptible to oxidation by hydrogen \n peroxide . \n interestingly , we did not see expression of this later isoform \n in either 24 h or 48 h embryos . instead , zebrafish embryos expressed \n two forms of the h2o2 sensitive isoform ( pkm2a and pkmb2 ) . \n the principal form of \n pkm measured was pkm2a ( the average counts per million \n in our data set were 226.0 14.0 for embryos analyzed at 24 \n h and 565.5 25.4 for embryos analyzed at 48 h ) . \n pkm2b was also expressed , but at much lower levels ( 0.9 0.6 for \n 24 h embryos and 40.4 8.4 for 48 h embryos ) . \n the fact that \n both the expressed forms of pkm in zebrafish are \n homologues to the human h2o2 sensitive form \n suggest that if the intracellular levels of h2o2 increase , zebrafish embryos may have the capacity to partially switch \n to the pentose phosphate pathway , as a mechanism of response to ros . \n increase in ros is likely to occur during exposure to ag , as demonstrated \n by the increase of gene markers for oxidative stress in our study , \n and in a number of other studies . \n one of the most significant changes in gene expression across the \n treatments was for alcohol dehydrogenase class-3 ( adh5 ) , which was 70.5 , 7.1 , and 125.0 fold up - regulated following exposure \n to agnp , ag bulk , and ag , respectively , at 24 h. similarly , \n after 48 h of exposure , adh5 was up - regulated by \n 151.0 , 22.8 , and 50.5 , as a result of exposure to agnp , ag bulk , and \n ag , respectively . \n alcohol dehydrogenases ( adh ) metabolize \n ethanol and other alcohols and aldehydes . in mammals , there are several \n classes of adh , and class i adh are responsible for the metabolism \n of ethanol and other small chain alcohols \n . class ii adh enzymes preferentially \n metabolize larger alcohols and aldehydes ( reviewed in ref ( 47 ) ) . in the zebrafish , enzymes \n structurally and functionally similar to the mammalian adhs have been \n identified \n . however , the affinity of these enzymes to alcohols appears \n to be less specialized than that for mammalian enzymes but the affinity of each enzyme for the various alcohols has not \n been studied in detail . \n in addition to their role in alcohol metabolism , \n adhs also convert nad+ to nadh , and this may act as a compensatory \n mechanism for potential reduction in nadh resulting from the inhibition \n of the pkm . \n the significance of the very pronounced increase in adh5 following exposure to all three forms of ag is , therefore , \n difficult to ascertain . \n we hypothesize that this could be associated \n with the effects of all treatments on the oxidative phosphorylation \n pathway that may have resulted in a shift toward anaerobic metabolism , \n with increased accumulation of alcohol within the cells , and detoxification \n by adh5 . \n analyses for differentially \n expressed genes across the different treatments and consistent over \n time ( to investigate for possible particle related effects ) identified \n 1 gene for ag bulk , 13 genes for the agnp treatment and 32 genes for \n the ag treatment , respectively ( si table s2 ) . these differences \n , however , would appear to be relative \n to the proportion of biologically available ag in the \n different treatments and may not only indicate unique mechanisms associated \n with each treatment but also be a function of the level of bioavailable \n ag . considering the uniquely expressed genes in \n the different treatments , for ag bulk , ets translocation variant 5 \n ( etv5a ) was 1.4 and 1.5-fold down - regulated at 24 \n h and 48 h , respectively . \n this gene is involved in the cellular response \n to oxidative stress ( go:0034599 ) and in the regulation of transcription , \n dna - dependent ( go:00063550 ) . \n we identified 13 genes that were \n specific to agnp . among these \n genes , \n cryptochrome 1a ( cry1a ) was strongly down - regulated \n both at 24 and 48 h of exposure ( 6.3 and 4.3 fold down - regulated , \n respectively ) . \n this gene acts as a potent repressor of clock function \n and mimics the effect of constant light to stop the \n circadian oscillator , and is induced by light . \n this finding suggests that the light availability to embryos \n exposed to agnp differed from that available to embryos in other treatments . \n despite the fact that we tested relatively low concentrations of agnp , \n it is possible that the suspended nanoparticles , and/or nanoparticles \n at the surface of the embryo , were acting as a barrier to light , and \n may have resulted in a difference in light availability to the embryos \n incubated in the agnp treatment . \n other genes responsive to agnp alone \n included the proteasome subunit beta type-1 ( psmb1 ) , a gene involved in protein catabolism ( 1.2- fold down - regulated \n following 24h of exposure and 1.3-fold up - regulated at 48 h of exposure ) \n and ribosomal protein s6 modification - like protein b ( zgc:92164 ; 1.7-fold and 1.5- fold up - regulated at 24 h and 48 h , respectively ) . \n together , these changes , although small in magnitude , indicate that \n the protein turnover in the agnp treatment may be increased compared \n to the other treatments ( in particular to ag bulk ) , suggesting that \n the potential damage caused by ros on cellular proteins is compensated \n through degradation and synthesis of new proteins . \n the genes \n present in this list belong to gene ontologies \n that overlap with those over - represented among the genes affected \n by the other treatments ( including oxidative phosphorylation and generation \n of precursor metabolites and energy ) . \n genes regulated included cyclic \n amp - dependent transcription factor atf-4 ( atf4b1 ; \n 2.3 and 2-fold down - regulated at 24 h and 48 h , respectively ) ; a gene \n involved in gluconeogenesis and regulation of transcription and probable \n atp - dependent rna helicase ddx56 ( ddx56 ; 4.3 and \n 4.6-fold down - regulated at 24 h and 48 h , respectively ) , a gene involved \n in ribosome biogenesis . \n this adds to the evidence that the genes unique \n to this treatment reflect responses to higher levels of biologically \n available ag associated with this treatment . to \n summarize , \n we have applied sequencing - based transcription - profiling \n to investigate the mechanisms of toxicity of agnp , compared to its \n ionic and bulk counterparts , in exposed zebrafish embryos , and provide \n mechanistic evidence for the hypothesis that the toxicity of agnp \n is principally associated with the presence of bioavailable ag . \n all ag treatments resulted in an inhibition of the oxidative \n phosphorylation pathway at 24 h of exposure , potentially due to the \n increase in ros within mitochondria . \n unique gene responses in the \n different treatments also supported that differences for responses \n in the transcriptome could be caused by the differences in bioavailability \n in ag between the treatments . \n however , a gene response \n unique to agnp was identified that may have resulted from alterations \n in light availability to the developing embryos , demonstrating that \n not all changes in gene expression observed can be explained by the \n effects of ag alone , and that particle - associated effects \n may also contribute to the toxicity of agnp . \n our work suggests \n that the predominant adverse effects of agnp \n appear to be associated with the toxicity of ag . \n we would \n suggest that the risk assessments for agnp should have a strong focus \n on understanding the bioavailability of ag originating \n from agnp , and the toxicology of ag , to establish what \n the levels of exposure and health consequences are likely to be in \n vulnerable environmental compartments .", "role": "user" }, { "content": "silver \n nanoparticles cause toxicity in exposed organisms and are \n an environmental health concern . the mechanisms of silver nanoparticle \n toxicity , however , remain unclear . \n we examined the effects of exposure \n to silver in nano- , bulk- , and ionic forms on zebrafish embryos ( danio rerio ) using a next generation sequencing approach \n in an illumina platform ( high - throughput supersage ) . \n significant alterations \n in gene expression were found for all treatments and many of the gene \n pathways affected , most notably those associated with oxidative phosphorylation \n and protein synthesis , overlapped strongly between the three treatments \n indicating similar mechanisms of toxicity for the three forms of silver \n studied . \n changes in oxidative phosphorylation indicated a down - regulation \n of this pathway at 24 h of exposure , but with a recovery at 48 h. \n this finding was consistent with a dose - dependent decrease in oxygen \n consumption at 24 h , but not at 48 h , following exposure to silver \n ions . \n overall , our data provide support for the hypothesis that the \n toxicity caused by silver nanoparticles is principally associated \n with bioavailable silver ions in exposed zebrafish embryos . \n these \n findings are important in the evaluation of the risk that silver particles \n may pose to exposed vertebrate organisms .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: ankylosing spondylitis ( as ) is a chronic inflammatory disease of the axial spondyloarthritis ( spa ) family with prominent involvement of the spine and sacroiliac joints resulting in formation of syndesmophytes that progressively lead to bony ankylosis of the spine . \n other musculoskeletal features suggestive of as include peripheral arthritis and enthesitis , whereas extra - articular features are uveitis , cardiac diseases including valve insufficiency and heart blocks , lung disease such as upper pulmonary lobe fibrosis , gastrointestinal disease which is mostly subclinical inflammatory bowel disease , retroperitoneal fibrosis , and skin disease . the global prevalence of as varies between 0.02% and 0.35% . the risk and progression of as are determined by both genetic and environmental factors . among genetic factors , \n the human leukocyte antigen- ( hla- ) b27 is the strongest one even though the overwhelming majority of these genes are outside the major histocompatibility ( mhc ) molecules along with other hla - b alleles . \n the initial presentation usually occurs between the ages of 3045 years , with a sex ratio of 3.4 : 1 ( males : females ) . as progression results in reduced functional capacity which is further worsened by comorbidities especially cardiovascular diseases and osteoporosis [ 79 ] . to limit as progression , \n a large array of pharmacological treatments are currently used , nonsteroidal anti - inflammatory drugs being the mainstay and tumor necrosis factor inhibitors ( tnfi ) the best suitable alternative in nonresponsive patients unless there is an absolute contraindication [ 10 , 11 ] . \n vitamin d is a secosteroid hormone that contributes to calcium and phosphorus metabolism for healthy bone mineralization . \n vitamin d includes vitamin d2 ( derived from plants ) and vitamin d3 ( derived from animals ) as well as vitamin d metabolites . \n most of the data from this paper focus on vitamin d3 ( also known as cholecalciferol ) given that vitamin d3 appears to be more effective than vitamin d2 ( also known as ergocalciferol ) . in humans , ~90% of vitamin d arises from endogenous synthesis by conversion of 7-dehydroxycholesterol into previtamin d by ultraviolet b radiations and then to vitamin d by a nonenzymatic transformation . considering that vitamin d is biologically inactive , it is activated in a two - stage hydroxylation process : first , hepatic hydroxylation that results in 25-hydroxyvitamin d ( 25[oh]d ) and , second , hydroxylation of 25(oh)d in the kidneys , resulting in 1,25-(oh)2d which is the active form of vitamin d [ 12 , 14 ] . \n recent insights have shed light on supplemental roles of vitamin d. for instance , functional laboratory studies have shown the involvement of vitamin d in modulation of immune and inflammatory reactions . \n along the same lines , epidemiological studies involving patients with numerous chronic inflammatory diseases including rheumatism have repeatedly suggested its implication in the occurrence and worsening of those diseases [ 1215 ] . \n with respect to the relatively short half - life of 1,25(oh)2d ( ~4 hours ) , vitamin d status is best monitored by 25(oh)d which is the major circulating form of vitamin d with a long half - life ( 2 - 3 weeks ) . \n 25(oh)d status has been defined by various groups in the literature . whatever the definition chosen is , levels of 25(oh)d defining vitamin d deficiency / insufficiency are retained on the basis of either a clinical or a biological parameter . \n notably , the fracture risk in elderly subjects is the main suggestive clinical parameter whereas biological criteria are elevated serum parathyroid hormone and increased bone turnover markers . in clinical practice , definitions commonly used are those provided by both the institute of medicine ( iom ) and the endocrine society . according to both groups , \n vitamin d deficiency is defined as 25(oh)d below 20 ng / ml , insufficiency as 25(oh)d of 2129 ng / ml , and sufficiency as 25(oh)d of 30100 \n although there is much excitement about vitamin d in the context of systemic inflammation and immune reactions and as has been associated with low 25(oh)d in observational studies [ 1820 ] , the benefits of a putative treatment with vitamin d in as patients beyond bone health are still theoretical . \n notably , whether or not all as patients should be screened and treated for vitamin d deficiency and specific treatment regimens remain unknown . \n moreover , can that treatment positively influence the course of as and related comorbid conditions beyond bone health ? \n this review will examine in the existing literature if systematic screening and treatment for vitamin d deficiency in all as patients are realistic . \n serum levels of 25(oh)d have been determined in as patients and compared with healthy subjects in a number of cross - sectional studies ( table 1 ) [ 18 , 19 , 2128 ] . \n the swedish study by klingberg et al . found no difference in serum 25(oh)d of 203 as patients compared with 120 healthy subjects in the late winter season . \n nevertheless , there were significantly more users of vitamin d supplements in the as group compared with healthy controls , what may have masked any difference . \n by contrast , a recent systematic review summarizing evidence from eight cross - sectional studies totalizing 555 as patients compared with 557 healthy controls found over all studies serum mean 25(oh)d of 22.8 14.1 ng / ml in as patients and 26.6 12.5 ng / ml in healthy controls . furthermore , 25(oh)d levels were significantly higher in healthy controls ( 3.8 0.8 ng / ml , p < 0.01 ) . \n experimental studies have shown that 1,25(oh)2d acts through the nuclear vitamin d receptor ( vdr ) which is found in most tissue cells including inflammatory cells , especially in macrophages , dendritic cells , and b as well as t lymphocytes . \n 1,25-dihydroxyvitamin d can promote monocyte - to - macrophage differentiation and induce the production of immunosuppressant cytokines ( e.g. , prostaglandin e2 ) . \n conversely , 1,25(oh)2d is a potent downregulator of proinflammatory cytokines and chemokines , namely , tumor necrosis factor alpha ( tnf- ) , interleukin-1 ( il-1 ) , interleukin-6 ( il-6 ) , interleukin-17 ( il-17 ) , and interleukin-23 ( il-23 ) [ 31 , 32 ] . \n furthermore , 1,25(oh)2d can impair macrophage - related antigen presentation by reducing the expression of class ii mhc molecules upon their surface . \n 1,25-dihydroxyvitamin d is also capable of inhibiting monocytes ' maturation and differentiation into dendritic cells ( dc ) . \n this results from downregulation of nuclear factor kappa b and subsequent t helper ( th ) 1 response suppression . \n 1,25(oh)2d may affect the dc / t cell interaction via action on costimulation molecules , thus decreasing the production of proinflammatory cytokines ( e.g. , il-1 and tnf- ) and membrane expression of class ii mhc molecules . \n in addition , 1,25(oh)2d upregulates cd4+cd25+t regulatory cells ( treg ) probably by increasing the production of fox - p3 and interleukin-10 ( il-10 ) [ 33 , 34 ] . besides \n for instance , in the case of b cells , acknowledged effects of 1,25(oh)2d are mostly limited to downregulation of their proliferation , differentiation to plasma cells , and immunoglobulin production . \n concerning effector t cells , their immune response is suppressed both directly by inhibition of t cell proliferation and indirectly via dc inhibition and blockade of dc / t cell interaction . \n suppression of t cell proliferation results in downregulation of th1 and th17 responses and stimulation of th2 responses raising blood levels of anti - inflammatory cytokines ( e.g. , il-10 ) . \n altogether , 1,25(oh)2d may modulate immune reactions by altering immune cells production of proinflammatory / anti - inflammatory cytokines and by impairing their interactions ( figure 1 ) . \n vitamin d deficiency has been associated with as [ 20 , 29 , 35 ] . \n however , there is only indirect evidence to support a putative role for 1,25(oh)2d in the inception of as so far . indeed , as is a classic inflammatory arthritis characterized by excess production of proinflammatory cytokines , especially tnf- , il-6 , il-17 , and il-23 . \n il-6 is largely involved in the production of acute phase reactants including c - reactive protein ( crp ) and initiation as well as maintenance of inflammation . \n besides , adaptive t cell immunity ( especially th17 and cd8 t cell responses ) is crucial for initiation and progression of as [ 4 , 5 ] . \n regarding 1,25(oh)2d as a major contributor in immune responses that may largely alter the production of the aforementioned proinflammatory cytokines as well as antigen presentation ( largely involved in t cell response ) and so downregulate th1 and th17 immunity , one can speculate that in case of vitamin d deficiency excess immune responses might not be prevented and as features would hence occur and evolve [ 4 , 5 , 30 ] . \n the relationship between as disease activity and vitamin d deficiency is conflicting in epidemiological studies as yet . while some studies have demonstrated a significant negative correlation between as disease activity markers and vitamin d deficiency [ 18 , 19 , 22 , 25 , 27 ] , \n other studies have not found any correlation [ 21 , 22 , 24 , 36 ] . of note , \n disease activity markers have extensively been assessed in all those studies , from less sensitive and specific disease activity markers including crp and erythrocyte sedimentation rate ( esr ) to more specific markers , that is , bath as disease activity index ( basdai ) and bath as functional index ( basfi ) . \n even though most of those studies that did not find any correlation had risk of type 2 statistic errors , the correlations found were weak in most of the other studies . furthermore , none of those studies completely adjusted for important confounding factors . \n moreover , most studies reported results of 25(oh)d using mean standard deviation ; meanwhile , 25(oh)d is not a normally distributed variable . \n consequently , results from currently available meta - analyses need to be further explored [ 20 , 29 , 37 ] . taken collectively , causation is not currently proven despite some evidence for increased risk of as in subjects with vitamin d deficiency . \n there is overwhelming evidence from genetic , microbiological , molecular , and immunological studies supporting the crucial role of klebsiella microbes in the initiation and perpetuation of as through the molecular mimicry or cross - reactivity pathogenic processes . \n for instance , ( i ) klebsiella microbes were isolated more frequently from the bowel of patients with active as and their isolations were associated with clinical exacerbations of the disease ; ( ii ) elevated levels of anti - klebsiella antibodies were observed in the sera and jejunum fluids of as patients when compared with matched healthy controls ; ( iii ) molecular similarity was identified between klebsiella nitrogenase reductase and hla - b27 and between klebsiella pullulanase and collagen types i , iii , and iv ; and ( iv ) in vivo cross - reactivity and cellular binding and in vitro cytotoxic activities of anti - klebsiella antibodies were observed in patients with as . \n anti - klebsiella antibodies are therefore implicated in the inflammatory processes leading to as through cross - reaction with self - antigens in joints . \n as 1,25(oh)2d inhibits b cell differentiation into plasma cells and downregulates immunoglobulin production , especially igm and igg , it may reduce the proinflammatory effects of anti - klebsiella antibodies in as . \n this is an established and frequently undiagnosed and untreated complication of as prevalent in up to 62% patients . \n the high risk of osteoporosis and related vertebral fractures seen in as patients is determined by multiple factors including chronic inflammation , reduced motion in relation to pain and stiffness , and drug intake [ 36 , 4042 ] . \n vitamin d deficiency is a common risk factor for osteoporosis in the general population . in the as population \n , the prevalence of osteoporosis seems particularly high in subgroups of patients with lower 25(oh)d compared to as patients with normal 25(oh)d levels [ 22 , 27 ] . \n nevertheless , the true relationship between vitamin d deficiency and osteoporosis in as patients still eludes researchers . \n indicated low 25(oh)d to be a predictive factor for low bone mineral density ( bmd ) and an independent relationship was found between low 25(oh)d and bone turnover markers in a dutch cross - sectional study involving 128 as patients . in a comparative study involving 70 male as patients and 140 controls , hmamouchi et al . found a significant negative correlation between serum levels of 25(oh)d and basfi ( r = 0.22 , p < 0.001 ) \n basfi was positively correlated with crp and esr ( r = 0.39 , p < 0.05 and r = 0.36 , p < 0.05 , resp . ) . \n in addition , basfi was positively correlated with lumbar spine bmd and femoral total bmd ( r = 0.31 , p < 0.001 and r = 0.32 , p < 0.001 , resp . ) . \n briefly , this study suggested that vitamin d deficiency might indirectly lead to osteoporosis via upregulation of inflammatory activity . \n along the same lines , lange et al . observed that high disease activity in as is associated with impaired vitamin d metabolism and excess bone resorption . \n similarly , obermayer - pietsch et al . suggested that fok1 polymorphism of the vdr gene is intimately associated with inflammatory activity , bone metabolism , and bmd . \n altogether , vitamin d deficiency in as patients might indirectly and continuously enhance bone resorption via perpetration of inflammatory activity . \n as patients have a 1.61.9-fold increased risk for cardiovascular diseases ( cvd ) compared with the general population . \n known determinants of this high cardiovascular risk are traditional cvd risk factors ( hypertension , dyslipidemia , diabetes , smoking , and obesity ) , chronic inflammation , and disease - modifying antirheumatic drugs ( dmards ) . \n it is noteworthy that vitamin d deficiency is a newly acknowledged risk factor for cvd in the general population . \n indeed , vitamin d deficiency might be associated with endothelial dysfunction and subsequent atherosclerosis , as well as hypertension . \n this has been attributed to stimulation of the renin - angiotensin - aldosterone system and enhancement of proinflammatory and prothrombotic status . \n regarding the fact that vitamin d deficiency may be associated with the occurrence and worsening of systemic inflammation in as and that as is related with a high risk for cvd , it is conceivable that vitamin d deficiency could increase the risk of cvd in as patients . \n to date , screening for vitamin d deficiency is strongly recommended only in groups of people with confirmed high risk for vitamin d deficiency in whom response to optimization of vitamin d status is expected [ 13 , 16 ] . \n these include patients with underlying conditions ( rickets , osteomalacia , osteoporosis , chronic kidney disease , hepatic failure , malabsorption syndromes , hyperparathyroidism , granuloma - forming disorders , and some lymphomas ) or taking medications that interact with vitamin d metabolism ( antiseizure medications , glucocorticoids , aids medications , ketoconazole , and cholestyramine ) , obese subjects , pregnant and lactating women , and older adults with history of falls or nontraumatic fractures as well as african - american and hispanic adults and children . \n while it is certain that supplements with vitamin d may be beneficial in as patients presenting with either of the aforementioned conditions , current evidence does not support systematic supplementation with vitamin d of the whole as population . \n indeed , a strategy that would recommend systematic screening of all as patients for vitamin d deficiency has not been proven feasible or cost - effective . \n in addition , whether such a strategy will be beneficial in terms of important health outcomes beyond skeletal benefits is still a matter of debate . \n however , numerous available epidemiological studies have suggested that sufficient 25(oh)d level may be beneficial in reducing the risk of as [ 20 , 29 , 37 ] . even though this is not the guarantee for cost - effectiveness of as prevention and treatment by vitamin d supplementation \n , we would suggest systematic screening of vitamin d deficiency for all as patients and treatment with vitamin d in case of vitamin d insufficiency / deficiency or if the patient has either of the ascertained risk factors for vitamin d deficiency . focusing on the immunomodulatory role of vitamin d , systematic supplementation with vitamin d of all as patients ( irrespective of their vitamin d status ) \n might be considered an effective add - on dmard ( alongside nsaids and tnfi ) to reduce disease activity and comorbidities if proven effective for this indication in the future . \n both vitamin d2 and vitamin d3 can be used for the treatment and prevention of vitamin d deficiency . \n daily vitamin d requirements for the prevention of vitamin d deficiency vary in normal individuals by age , sex , and physiological state ( lactation , pregnancy ) [ 13 , 16 ] \n . there is no universal consensus regarding these requirements at present and clinical practice is generally based on both the institute of medicine ( iom ) and the endocrine society recommendations [ 17 , 18 , 46 ] . \n several recent studies have suggested that the recommended dietary allowances for treatment and prevention of vitamin d deficiency of the iom may not be realistic , especially for patients who have underlying conditions or are taking drugs that affect vitamin d metabolism . \n hence , the recommended treatment regimens for vitamin d deficiency summarized in table 2 are from the endocrine society clinical practice guideline . \n vitamin d may be administered every day or once a week and therapy often begins with a loading dose for many weeks followed by a maintenance dose for many years . \n notably , vitamin d treatment usually appears beneficial after up to six years of treatment without discontinuation . \n of course , obese adults as well as patients receiving drugs that affect vitamin d metabolism require at least two to three times more vitamin d than doses provided here . in patients with hyperparathyroidism \n , vitamin d should be prescribed as needed ; and in patients with granuloma - forming diseases , close monitoring of calcium during vitamin d therapy is necessary given the increased sensitivity for vitamin d and the risk of toxicity \n . currently , there are no specific caveats guiding either on 25(oh)d target value or on appropriate treatment regimen for vitamin d deficiency in the as population . as a result , only as patients with concurrent ascertained risk factors for vitamin d deficiency or those with confirmed vitamin d deficiency / insufficiency might be treated with vitamin d following the endocrine society guidelines in absence of thorough evidence - base supporting specific treatment modalities for as patients . in brief , future studies should focus on vitamin d treatment regimens specific to the as population if proven necessary . \n vitamin d therapy is usually safe and its toxicity is extremely rare due to the wide therapeutic index of vitamin d treatment , the tightly regulated synthesis of 1,25(oh)2d , and the characteristics of the adipose tissue which stores and slowly releases vitamin d [ 13 , 16 , 47 , 48 ] . although granulomatous disorders and 24-hydroxylase deficiency as well as williams syndrome increase sensitivity to vitamin d and potential toxicity , excessive vitamin d intakes ( especially from food supplements ) raising blood levels of 25(oh)d above 150 ng / ml ( as suggested by the endocrine society ) are the main cause of vitamin d toxicity [ 13 , 16 , 4850 ] \n . symptoms of vitamin d toxicity mainly arise from hypercalcemia and include headaches , nervousness , arthralgia , loss of appetite , nausea , vomiting , constipation , frequent urination , excess thirst , kidney stones , and itching . \n broadly , vitamin d toxicity ( via hypercalcemia ) is mainly responsible for systemic complications involving the skeleton , the nervous system , the digestive system , the cardiovascular system ( with increased cvd risk ) , and kidneys ( with the formation of nephrolithiasis ) as well as water exchange [ 48 , 51 ] . \n treatment of vitamin d toxicity consists of cessation of vitamin d intake and correct rehydration as well as administration of diuretics to increase urinary excretion of calcium [ 13 , 16 , 48 ] . \n despite the fact that vitamin d toxicity often appears anecdotal , it should not be ignored . \n therefore , caution should be exercised when vitamin d is systematically administered to as patients at large given the uncertainties regarding appropriate doses and in order to avoid toxicity . \n according to the existing literature , it is not recommended to systematically screen and treat as patients for vitamin d deficiency . \n based on current guidelines , only as patients with confirmed risk factors for vitamin d deficiency would benefit from such a strategy . while experimental studies conclude that vitamin d is an immunomodulatory and anti - inflammatory molecule , human studies of vitamin d in relation to as are still inconclusive . \n is vitamin d deficiency really causative for as or does it simply reflect enhanced systemic inflammation and poor health status in as patients ? \n any suggested additional effect of vitamin d beyond bone protection thus remains theoretical and we lack strong evidence that can help make specific guidelines in either the scope of vitamin d testing or ideal treatment modalities . \n nevertheless , there remains considerable interest for vitamin d supplementation in the treatment of as . \n future longitudinal prospective studies and well - designed randomized controlled trial need to clarify whether vitamin d supplementation can be used as add - on dmard to influence or modify as and related comorbidities beyond its role in bone health . if proven effective , threshold values and personalized therapeutic regimes as well as treatment duration should be assessed and adopted .", "role": "user" }, { "content": "beyond its role in calcium and phosphorus metabolism for healthy bone mineralization , there is increasing awareness for vitamin d contribution in modulation of immune reactions . given that ankylosing spondylitis ( as ) is a chronic inflammatory disease involving excess immune / inflammatory activity and posing great therapeutic challenges , it is conceivable to claim that vitamin d treatment may be a safe and effective treatment to influence or modify the primary disease and its related comorbidities . nevertheless , consistent body of research supporting this hypothesis is still lacking . in this paper , we examine whether systematic screening and treatment for vitamin d deficiency are feasible at present . \n we will review the immunomodulatory role of vitamin d and its contribution in initiation and progression of as , as well as how they would determine the occurrence of comorbid conditions . \n our conclusion is that despite the overwhelmed interest about vitamin d treatment in as patients , systematic screening and treatment for vitamin d deficiency of all as patients are not feasible as yet . \n this stresses the need for further extensive well - designed research to prove vitamin d efficacy in as beyond bone protection . and \n if utility is proven , personalized treatment regimes , duration of treatment , and threshold values for vitamin d should be provided .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: studies have shown that homeless adults experience high disease burden and mortality rates , are frequent ed users , and have high health care expenditures . because the canadian population is aging \n , there is a proportionate rise in the population of aging homeless adults , likely resulting in increased hospital utilization . \n homeless adults also have poor access to primary care physicians ( pcps ) , resulting in increased use of hospitals for episodic care that would otherwise be accomplished in a pcp office . by extrapolation \n , homeless adults with access to primary care would hypothetically have a lower magnitude of frequent ed visits compared to homeless adults with no access to primary care . \n nonetheless , they present a concerning group as they are marginalized , in generally poor health for their age , and proportionately consume higher health - care resources due to chronic and complicated health problems and a lack of age appropriate community services that together lead to negative outcomes \n . as they age , homeless adults are considerably more vulnerable to the unforgiving environmental and social conditions of life on the street . \n a recent population - based study from homeless shelters in oakland , california , has shown that homeless adults in their 50s have more geriatric conditions amenable to treatment than those two decades older who are stably housed . \n it is evident that services that address geriatric conditions are needed for older homeless adults living across diverse environments such as homeless shelter or hotel , or those living transiently with family / friends . \n one impediment to caring for homeless persons in the canadian universal health - care system has been the financial disincentives for physicians . \n encounters with homeless patients may last longer than an average visit because of the complexity of their bio - psychosocial problems . \n not surprisingly , hwang et al . have shown that physicians were reimbursed for about half of the clinical encounters for homeless individuals , which suggests a need for special arrangements for physician remuneration . \n although the contemporary canadian physician is moving toward an alternate form of payment plan , in a primarily fee - for - service system , the delivery of care to this vulnerable group may be problematic due to the high proportion of patients without valid health insurance , as well as other administrative logistical barriers , thus making the ed a more accessible and navigable care location instead of the conventional primary care system . \n specifically , some homeless older adults utilize the ed for routine care as they have difficulty with the logistics required to access and/or following through on scheduled primary care appointments . \n logistical challenges can be as simple as the lack of a phone to make calls to pcps and , in turn , receive communications from the provider . although identification or \n i d clinics now exist to facilitate the acquisition and renewal of expired health insurance cards , attending the clinic can in itself pose a challenge . \n the use of ed for non - acute reasons is problematic from a health services planning perspective . \n it is challenging for both the homeless adults and the already over - burdened hospital system . due to the previously reported high morbidity and mortality rates in this disadvantaged group , we hypothesized that homeless adults older than age 50 were higher utilizers of ed than their younger counterparts . \n this was a retrospective analysis of homeless adults who presented at the three eds in the city of hamilton ( ont . ) for the study period . \n the participating eds were located at three inner city hospitals , situated within the urban downtown area , and represented by hamilton general hospital ( hgh ) , juravinski hospital ( jh ) , and st . \n homeless at the time of the ed visit during the study period of 24 months ( from january 1 , 2012 to january 1 , 2014 ) . \n homeless was defined as any patient living on the street , in a homeless or temporary shelter , or whose housing status was other or unknown . \n provincial codes denoting persons of no fixed address were utilized as search strings to identify homeless ed users . \n the criteria for inclusion was that subjects be aged 18 years or older , were homeless at the time of their index ed visit , and had at least one ed visit at one / more of the three ed centres during the study period . \n all patients selected for the study had an index ed care visit occurring within the study period . \n we used electronic medical records ( emrs ) and the electronic database national ambulatory care reporting system ( nacrs ) administrative database to access information on visits to eds at three academic urban hospitals . \n the following information was abstracted : demographic information , total number of ed visits , total number of ed visits by adults of no - housing status , access to a pcp , existence of home address vs. no - housing status , health characteristics ( including psychiatric disorders ) as determined by the reason for visit and other diagnoses , and resource intensity weight ( riw ) score used as a proxy to determine the degree of resource utilization and medical acuity of ed visits by the population of interest . \n this study was approved by the mcmaster university ( the academic affiliate of all three medical centres ) institutional ethics review board . \n the primary outcome was ed utilization as defined by frequency of ed visits within a 30-day period . \n for this study , frequent ed visits were defined as two or more ed visits occurring within 30 days following the index ed care encounter . \n descriptive analyses generating means and standard error of the mean ( sem ) for continuous data and proportions for categorical data were conducted . \n population was stratified by sex and age categories , riw score , and access to a pcp , and means were compared across these categories using anova ; the analyses also compared age groups ( age 50 years vs. age > 50 years ) . \n to analyze the overall disease severity and medical acuity in these homeless patients , we used riw index . in the canadian medical system , each patient that accesses hospital care has a riw assigned to it . \n the riw value is derived from an algorithm that considers and assigns a weight to all of the patient s discharge diagnoses for overall medical / surgical complexity . \n higher riw numbers indicate a more complex and resource intensive patient , suggesting a more medically / surgically ill patient . \n all of these statistical analyses were done using sas version 9.4 ( sas institute inc . , cary , nc ) . \n this was a retrospective analysis of homeless adults who presented at the three eds in the city of hamilton ( ont . ) for the study period . \n the participating eds were located at three inner city hospitals , situated within the urban downtown area , and represented by hamilton general hospital ( hgh ) , juravinski hospital ( jh ) , and st . \n homeless at the time of the ed visit during the study period of 24 months ( from january 1 , 2012 to january 1 , 2014 ) . \n homeless was defined as any patient living on the street , in a homeless or temporary shelter , or whose housing status was other or unknown . \n provincial codes denoting persons of no fixed address were utilized as search strings to identify homeless ed users . \n the criteria for inclusion was that subjects be aged 18 years or older , were homeless at the time of their index ed visit , and had at least one ed visit at one / more of the three ed centres during the study period . \n all patients selected for the study had an index ed care visit occurring within the study period . \n we used electronic medical records ( emrs ) and the electronic database national ambulatory care reporting system ( nacrs ) administrative database to access information on visits to eds at three academic urban hospitals . \n the following information was abstracted : demographic information , total number of ed visits , total number of ed visits by adults of no - housing status , access to a pcp , existence of home address vs. no - housing status , health characteristics ( including psychiatric disorders ) as determined by the reason for visit and other diagnoses , and resource intensity weight ( riw ) score used as a proxy to determine the degree of resource utilization and medical acuity of ed visits by the population of interest . \n this study was approved by the mcmaster university ( the academic affiliate of all three medical centres ) institutional ethics review board . \n the primary outcome was ed utilization as defined by frequency of ed visits within a 30-day period . \n for this study , frequent ed visits were defined as two or more ed visits occurring within 30 days following the index ed care encounter . \n descriptive analyses generating means and standard error of the mean ( sem ) for continuous data and proportions for categorical data were conducted . \n population was stratified by sex and age categories , riw score , and access to a pcp , and means were compared across these categories using anova ; the analyses also compared age groups ( age 50 years vs. age > 50 years ) . to analyze the overall disease severity and medical acuity in these homeless patients , we used riw index . in the canadian medical system , each patient that accesses hospital care has a riw assigned to it . \n the riw value is derived from an algorithm that considers and assigns a weight to all of the patient s discharge diagnoses for overall medical / surgical complexity . \n higher riw numbers indicate a more complex and resource intensive patient , suggesting a more medically / surgically ill patient . \n all of these statistical analyses were done using sas version 9.4 ( sas institute inc . , cary , nc ) . \n table 1 describes the overall study population of 1,330 homeless adults ( aged 18 years ) who received acute care at the three major hamilton - based urban ed sites , with the population stratified into two age groups : older ( > 50 years ) and younger ( 50 years ) patients . in this sample , \n psychiatric diagnoses as the most responsible diagnoses for their ed encounters , including neurocognitive and alcohol use disorders , were found in 28% of homeless patients . \n repeat visit to the ed within a 30-day period from their index visit occurred in 22% of cases . \n the ed triage protocol of the study subjects included resuscitation ( 3% ) , emergent ( 20% ) , urgent ( 58% ) , less urgent ( 15% ) , and non - urgent ( 3% ) cases . \n main effects of anova analysis revealed that the riw score and patient age both differed by age ( p = .013 , p < .0001 , respectively ) , sex ( p = .014 , p = .004 , respectively ) and the interaction of both main effects ( p = .033 , p = .0003 , respectively ) . \n this analysis also revealed that the number of visits differed slightly by both age and sex , but was not associated with an interaction effect . \n computer - generated linear regression model in age and sex stratified population revealed that in women younger than age 50 ( n = 81 ) disposition ( namely , discharge and leaving the ed vs. admission status ) positively associated with riw score . in men younger than age 50 ( n = 359 ) \n disposition positively , while 30-day ed return negatively associated with riw score . in women above age 50 \n ( n = 188 ) disposition positively , while 30-day ed return negatively associated with riw score . in men above age 50 ( n = 694 ) disposition and age positively , while 30-day ed return and number of visits negatively associated with riw score ( table 1 ) . \n logistic regression revealed that appearing at sjhh - ed site ( or 0.655 ; 95% ci 0.5010.856 ) and being older than age 50 ( or 0.635 ; 95% ci 0.4690.861 ) both decreased the odds of these patients returning to that same er within 30 days of their index ed visit ( table 2 ) . \n specifically , as we moved from hgh site and jh site to sjhh site , there was a lower likelihood that homeless patients would return to ed within 30 days . \n conversely , logistic regression model in age and sex stratified population revealed that women older than age 50 ( n = 188 ) with access to a pcp were 3.3 times more likely to return to their ed within a 30-day period ( or 3.29 , 95% ci 1.218.94 ) ( table 3 ) , while men older than age 50 ( irrespective of pcp access ) were less likely to return to sjhh - ed vs. the remaining ed sites . \n the logistic model always contained site , age category , sex , number of visits , ed disposition , pcp access , and psychiatric disorders . \n table 1 describes the overall study population of 1,330 homeless adults ( aged 18 years ) who received acute care at the three major hamilton - based urban ed sites , with the population stratified into two age groups : older ( > 50 years ) and younger ( 50 years ) patients . in this sample , \n psychiatric diagnoses as the most responsible diagnoses for their ed encounters , including neurocognitive and alcohol use disorders , were found in 28% of homeless patients . \n repeat visit to the ed within a 30-day period from their index visit occurred in 22% of cases . \n the ed triage protocol of the study subjects included resuscitation ( 3% ) , emergent ( 20% ) , urgent ( 58% ) , less urgent ( 15% ) , and non - urgent ( 3% ) cases . \n main effects of anova analysis revealed that the riw score and patient age both differed by age ( p = .013 , p < .0001 , respectively ) , sex ( p = .014 , p = .004 , respectively ) and the interaction of both main effects ( p = .033 , p = .0003 , respectively ) . \n this analysis also revealed that the number of visits differed slightly by both age and sex , but was not associated with an interaction effect . \n computer - generated linear regression model in age and sex stratified population revealed that in women younger than age 50 ( n = 81 ) disposition ( namely , discharge and leaving the ed vs. admission status ) positively associated with riw score . in men younger than age 50 ( n = 359 ) disposition positively , while 30-day ed return negatively associated with riw score . in women above age 50 \n ( n = 188 ) disposition positively , while 30-day ed return negatively associated with riw score . in men above age 50 ( n = 694 ) disposition and age positively , while 30-day ed return and number of visits negatively associated with riw score ( table 1 ) . \n logistic regression revealed that appearing at sjhh - ed site ( or 0.655 ; 95% ci 0.5010.856 ) and being older than age 50 ( or 0.635 ; 95% ci 0.4690.861 ) both decreased the odds of these patients returning to that same er within 30 days of their index ed visit ( table 2 ) . \n specifically , as we moved from hgh site and jh site to sjhh site , there was a lower likelihood that homeless patients would return to ed within 30 days . \n conversely , logistic regression model in age and sex stratified population revealed that women older than age 50 ( n = 188 ) with access to a pcp were 3.3 times more likely to return to their ed within a 30-day period ( or 3.29 , 95% ci 1.218.94 ) ( table 3 ) , while men older than age 50 ( irrespective of pcp access ) were less likely to return to sjhh - ed vs. the remaining ed sites . \n the logistic model always contained site , age category , sex , number of visits , ed disposition , pcp access , and psychiatric disorders . \n in our study , two - thirds of homeless patients presenting to the ed sites were older than age 50 . \n however , the older homeless group was associated with less frequent ed use within a 30-day period compared with their younger counterparts . \n being older than age 50 also indicated a lesser likelihood to return to sjhh - ed vs. hgh and jh sites . \n hgh and jh locations have ed sites primarily specializing in medical or surgical services , whereas sjhh - ed provides additional city - wide emergency psychiatric services for adults . in this view , our findings may suggest a pattern of favouring access to those eds that offered primarily a medical / surgical acute care . \n these findings are remarkable , given the existing literature about older homeless patients that show increased rates of medical comorbidities , suboptimal health - care coverage and reduced access to a pcp . \n although all three eds were generally situated within the downtown locale , health differences and socio - economic determinants for area pockets were impossible to account for . \n the universal health - care system in canada aims to improve access , coordination of care , and outcomes for vulnerable populations . \n health care must be integrated with other resources to address the complex challenges presented by inadequate housing . \n prior research has shown that continuity of care with a regular pcp is associated with decreased episodic care at eds and decreased hospital care . a study by khandor et al . \n has shown that fewer than half of the homeless adults in a major urban centre in ontario had a pcp . \n not having a pcp was associated with increasing duration of homelessness , lack of proof of health insurance coverage , and having a chronic medical condition . whereas women in our study represented only 20% of the homeless group , interestingly , those women older than age 50 with access to a pcp more than tripled the ed revisits within a 30-day period when compared to those women younger than age 50 and/or without access to pcp , and men . \n increased efforts are needed in the hospital discharge planning to address the barriers to appropriate health care that persist in this population despite the provision of pcps . in our sample , \n 28% had a psychiatric diagnosis including neurocognitive and alcohol related disorders . in view of high co - morbidity of psychiatric disorders in homeless patients , mental health services in primary care designed for older homeless adults \n , under - recognition of psychiatric disorders , in general , in older patients at the primary care level was common . \n contributory factors included : short consultation times with physicians ; concentration solely on physical symptoms ; few patients presenting explicitly with psychiatric problems ; few decisions to treat or refer older patients with psychiatric illness ; and the general practitioners tendency to monitor or defer diagnosis and treatment decisions suggesting that planning for primary care services needs to adopt a flexible assessment model . \n assessment for geriatric syndromes is also important as these syndromes occur at increased rates among homeless older adults and many of the interventions can be effective . \n alternate payment methods and adequate funding for physician compensation is essential in maintaining a better tailored and consistent service delivery program for this vulnerable population . aging homeless adults in our sample have shown a lower likelihood of ed acute care utilization in comparison with their younger counterparts . \n it will be important to determine whether this is a sustained correlation or is unique to this study . \n riw scores showed a negative correlation with the number of ed encounters and recurrence of visits within 30 days from the index visit , suggesting that the more sick the homeless patients appeared to be , the less likely they were to return to ed for any care . in keeping with the previous research of increased morbidity and mortality rates in homeless adults , particularly in the older homeless group , only 18% of the ed visits in our sample constituted less- and non - urgent cases , indicating that the majority of visits likely encompassed a more severe pathology . despite this \n , older homeless adults were less likely to return to the ed within 30 days . \n exploring pathways to enhance the liaison between eds and existing community care teams , or to facilitate access to primary care upon hospital discharge , is crucial . \n as evidenced in our older female group , access to a pcp may not be enough to reduce ed utilization for acute care . \n health care must be integrated with other resources to address the complex challenges presented by inadequate housing . \n our study included all the urban ed centres in the study location , and therefore likely accounted for all ed visits city wide . \n we also relied on index housing status which was used as a static factor , however homelessness is often episodic , in addition to occurring along a spectrum . despite these limitations \n , this study still sheds light on the demographic and access to care factors for ed visits in a homeless population . \n future research examining homeless patients perspectives on ed utilization and barriers to utilization of primary care instead of ed would further advance the findings from this study . identifying those most at risk for frequent ed visits ( such as the younger homeless adults ) , as well as the most vulnerable groups at risk of inadequately accessing acute care ( such as the older homeless adults ) may ultimately help to identify patients requiring more targeted services . \n geriatric clinicians could play a significant role in evaluating and treating this aging disadvantaged population more comprehensively . while it is generally well understood that homelessness confers a unique set of health and wellness risks , the local ed usage patterns of this population are yet to be fully elucidated . \n this study has added to the limited body of knowledge about the degree of local health system pressure imparted by this group , given the impending tsunami of aging and its concomitant impact on the health - care system . \n despite larger numbers of older compared to younger homeless adults seeking acute care in the eds , those older sought less acute care within a 30-day period from their index ed encounter \n . a lower rate of repeat ed visits with increasing age remains concerning , because of previously reported high morbidity and mortality rates in this disadvantaged population and lack of adequate access to primary care . \n systems of care should devise comprehensive services that address the simultaneous medical ( systemic and psychiatric ) , social , and logistical needs of these patients . \n in particular , specialized multidisciplinary teams , including geriatricians , geriatric psychiatrists , pcps , nurses , social workers , and allied health - care professionals , can further play a significant role in evaluating and managing this vulnerable subgroup more comprehensively .", "role": "user" }, { "content": "backgroundhomeless adults frequently use emergency departments ( eds ) , yet previous studies investigating ed utilization by the older segment received little attention . \n this study sought to characterize older homeless adults who utilized local urban eds.methodsed encounters at three hospitals in hamilton ( ont . ) were analyzed , and demographic and clinical characteristics of the older homeless ( age > 50 ) vs. younger counterparts ( age 50 ) were compared during a 24-month period.resultsof all adults , 1,330 were homeless , of whom 66% were above age 50 . \n older homeless adults sought less acute care within 30 days from an index visit compared with their younger counterparts . \n non - acute illnesses constituted only 18% of triaged cases . \n older homeless women with access to a primary care physician ( pcp ) were 3.3 times more likely to return to ed within 30 days , whereas older homeless men ( irrespective of pcp access ) were less likely to return to ed.conclusionsdespite high homeless patient acuity , a lesser number of ed visits with increasing age remains concerning because of previously reported high morbidity and mortality rates . \n access to primary care may not be enough to reduce ed utilization . \n further research is needed to evaluate acute care interventions and their effectiveness in ed , and to identify homeless patients requiring more targeted services .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: serum samples : a total of 129 cow serum samples were obtained from three \n herds , a , b and c ( n=33 , 61 and 35 cows , respectively ) , in gifu prefecture , japan , in \n february 2009 . to measure the time - dependent changes in antibody titers , repeat \n serum \n samples were obtained each month from a total of 29 individuals of herd c. serum samples of \n 28 cattle were collected each month from july 2009 to march 2010 or until the cattle were \n removed from the farms . \n the 29 cows were separated into two groups ; eighteen cows showed positive for \n anti - ncsag1 antibody at the first blood sampling ( group i ) and eleven cows were negative \n ( group ii ) . in the sample collection period , 9 cattle in herd c showed seroconversion for \n anti - ncgra7 antibody during gestation . \n serum samples of three pregnant cattle in herd a were \n also collected from april 2012 to october 2012 . \n serum samples of the newborn calves and dams in herd a were also collected \n immediately after delivery but before the newborn calves suckled colostrums . \n these samples \n were used for analyzing dynamics of anti - ncgra7 antibody during gestation and estimating \n vertical transmission of the parasite to newborn calves . \n all blood samples were collected \n from the tail vein and centrifuged at 1,000 g for 10 min before the serum \n was collected and stored at 20c for later use . \n all animal experiments were approved by the \n animal research committee of the faculty of applied biological science , gifu university . \n measurement of n. caninum - specific antibodies by elisa : measurement of \n n. caninum - specific antibodies by elisa was carried out as described \n previously . \n briefly , ncsag1 and ncgra7 recombinant \n proteins were expressed in escherichia coli as glutathione s - transferase \n ( gst ) fusion proteins . \n fifty microliters of purified rncsag1 , rncgra7 and their control , \n gst , at a final concentration of 0.1 m were coated onto elisa plates . \n after blocking with pbs containing 3% skim milk ( pbssm ) , 50 l of each \n serum sample \n diluted to 1:250 with pbssm was added to duplicate wells , and the elisa plate \n was incubated for 1 hr at 37c . after washing with pbs containing 0.05% tween-20 , \n horseradish peroxidase conjugated goat anti - bovine total igg ( bethyl laboratories , \n montgomery , tx , u.s.a . ) diluted to 1:10,000 with pbssm was added to each well and incubated \n at 37c for 1 hr . after washing , 100 l 2,2-azinobis \n ( 3-ethylbenzothiazoline-6-sulfonicsulphonic acid ) substrate solution was added to each well . \n the absorbance at 415 nm was read after 1 hr of incubation at room temperature . \n absorbance \n values ( abs ) were determined as the difference in the mean optical density measured at 415 \n nm ( od415 nm ) between the recombinant antigen ( ncsag1 or ncgra7 ) and the gst protein . as an \n internal control , \n the od415 nm of standard neospora - negative sera produced \n by our laboratory ( n=9 ) was also measured for each \n elisa plate . \n absorbance values of samples were standardized by the following formula : standardized values=(abs of sample serum average of abs of negative sera)/standard \n deviation of abs of negative sera . \n when the standardized values were more than 3.00 , the sample was considered positive . statistic analysis : \n pearson s product - moment correlation coefficient was \n calculated to assess the correlation between anti - ncsag1 and anti - ncgra7 antibody \n titers . \n prevalence of anti - ncsag1 and anti - ncgra7 antibodies : to investigate the \n frequency of anti - ncgra7 and/or anti - ncsag1 antibody - positive individuals , we examined serum \n samples of 129 cows selected from three herds , a , b and c ( n=33 , 61 and 35 , respectively ) . \n in herds \n a , b and c , 63.6% ( 21/33 ) , 55.7% ( 34/61 ) and 45.7% ( 16/35 ) of cows were positive \n for anti - ncsag1 antibody , respectively . \n on the other hand , 6.1% ( 2/33 ) , 9.8% ( 6/61 ) and 2.9% \n ( 1/35 ) were positive for anti - ncgra7 antibodies . \n all anti - ncgra7 antibody - positive cows were \n also anti - ncsag1 antibody - positive ( fig . 1fig . \n 1.(a , b , c ) relationships between anti - ncsag1 and anti - ncgra7 antibody levels in \n individual cows from three herds a , b and c. ( d ) data for a total of 129 cows in a , b \n and c are shown . \n vertical and horizontal lines indicate standardized values of \n anti - ncsag1 and anti - ncgra7 antibodies , respectively . \n numeric characters inserted below \n indicate individual numbers in each area of the upper dot - blot graph . ) . in total , 7.0% ( 9/129 ) of cows were double positive for anti - ncsag1 and anti - ncgra7 \n antibodies , 48.1% ( 62/129 ) were were double negative for anti - ncsag1 and anti - ncgra7 \n antibodies , and 45.0% ( 58/129 ) were anti - ncsag1 and anti - ncgra7 antibody double - negative . \n no \n cows were identified as anti - ncsag1 antibody negative and anti - ncgra7 antibody positive \n ( fig . \n no clear correlation was observed \n between anti - ncsag1 and anti - ncgra7 antibody levels . \n the correlation coefficients between \n anti - ncsag1 and anti - ncgra7 antibody levels in herds a , b and c were 0.0081 \n ( p>0.05 ) , 0.37 ( p<0.01 ) and 0.44 \n ( p<0.05 ) , respectively . \n ( a , b , c ) relationships between anti - ncsag1 and anti - ncgra7 antibody levels in \n individual cows from three herds a , b and c. ( d ) data for a total of 129 cows in a , b \n and c are shown . \n vertical and horizontal lines indicate standardized values of \n anti - ncsag1 and anti - ncgra7 antibodies , respectively . \n numeric characters inserted below \n indicate individual numbers in each area of the upper dot - blot graph . \n dynamics of anti - ncsag1 and anti - ncgra7 antibodies : to investigate the \n dynamics of anti - ncsag1 and ncgra7 antibodies , serum samples were collected monthly from 29 \n cows in herd c , and the time - dependent changes in anti - ncgra7 and anti - ncsag1 antibody \n levels were observed between february 2009 and march 2010 . \n eighteen of 29 cows were positive \n for anti - ncsag1 antibody at the first blood sampling ( february 2009 for 17 cows and december \n 2009 for one cow ) ( group i ) , and eleven cows were negative ( february 2009 for all eleven \n cows ) ( group ii ) . \n all 18 cows in group i maintained anti - ncsag1 seropositivity throughout \n the investigated period ( february 2009 to march 2010 ) ( fig . \n 2.dynamics of anti - ncsag1 antibody levels in cows from herd c , ( groups i and ii ) . \n ( a ) \n time - dependent changes in the anti - ncsag1 antibody levels of cows . \n the dashed line indicates \n the positive boundary value ( 3.00 ) of the elisa . \n ( b ) standardized values of \n anti - ncsag1 antibody titer in each individual were summarized . \n the color of each box \n indicates the antibody titer according to the inserted legend symbols . \n an asterisk ( * ) \n indicates individuals that showed seroconversion for anti - ncgra7 antibody , as shown in \n fig . \n although the anti - ncsag1 antibody levels of 4 cows in group ii slightly exceeded \n the cutoff point during the study , a large increase in antibody levels was not observed in \n any cow in group ii ( fig . \n 2 ) . seven other cows in \n group ii maintained a negative status for anti - ncsag1 antibodies throughout the investigated \n period ( fig . \n these results indicated that the \n anti - ncsag1 antibody levels of each individual were constant , regardless of the timing of \n the sampling . \n dynamics of anti - ncsag1 antibody levels in cows from herd c , ( groups i and ii ) . \n ( a ) \n time - dependent changes in the anti - ncsag1 antibody levels of cows . \n the dashed line indicates \n the positive boundary value ( 3.00 ) of the elisa . \n ( b ) standardized values of \n anti - ncsag1 antibody titer in each individual were summarized . \n the color of each box \n indicates the antibody titer according to the inserted legend symbols . \n an asterisk ( * ) \n indicates individuals that showed seroconversion for anti - ncgra7 antibody , as shown in \n fig . \n 3.dynamics of anti - ncgra7 antibody levels in cows from herd c , ( groups i and ii ) . \n ( a ) \n time - dependent changes in the anti - ncgra7 antibody levels of cows . \n the dashed line indicates \n the positive boundary value ( 3.00 ) of the elisa . \n ( b ) standardized values of \n anti - ncgra7 antibody titer in each individual are summarized . \n the color of each box \n indicates the antibody titer according to the inserted legend symbols . \n an asterisk ( * ) \n indicates individuals that showed seroconversion for anti - ncgra7 antibody during \n gestation , as shown in fig . \n 4 . , anti - ncgra7 antibody levels of cows from group i were drastically changed during the \n investigated period . at the time of the first blood sampling , only one cow in group \n however , nine cows in group i showed seroconversion to \n anti - ncgra7 antibodies at some point during the investigated period ( fig . \n cows in group ii were negative for anti - ncgra7 antibodies \n during the majority period of the investigation , except for three cows that displayed a very \n slight excess of anti - ncgra7 above the cutoff point for a short period ( fig . \n clear seasonality of the seroconversion was not observed in \n either group i or ii ( fig . \n dynamics of anti - ncgra7 antibody levels in cows from herd c , ( groups i and ii ) . \n ( a ) \n time - dependent changes in the anti - ncgra7 antibody levels of cows . \n the dashed line indicates \n the positive boundary value ( 3.00 ) of the elisa . \n ( b ) standardized values of \n anti - ncgra7 antibody titer in each individual are summarized . \n the color of each box \n indicates the antibody titer according to the inserted legend symbols . \n an asterisk ( * ) \n indicates individuals that showed seroconversion for anti - ncgra7 antibody during \n gestation , as shown in fig . \n dynamics of anti - ncgra7 antibody during gestation : monthly collected blood \n samples from 9 cows that showed seroconversion for anti - ncgra7 antibody during gestation \n were analyzed to investigate the relationship between the term of pregnancy and the dynamics \n of anti - ncgra7 antibodies . \n time - dependent changes in \n anti - ncgra7 antibody levels in 9 cows from herd c and three cows from herd a are \n shown . \n . asterisks ( * and * * ) indicate individuals whose newborn calves were \n examined , as shown in fig . \n 5 , all the cows studied , except for the three cows from which serum could not be \n collected during the middle gestation period , showed seroconversion at the sixth and/or \n seventh month of pregnancy . \n time - dependent changes in \n anti - ncgra7 antibody levels in 9 cows from herd c and three cows from herd a are \n shown . \n . asterisks ( * and * * ) indicate individuals whose newborn calves were \n examined , as shown in fig . \n 5 levels of anti - ncsag1 and anti - ncgra7 antibodies of newborn calves : to \n examine the possibility that the seroconversion for anti - ncgra7 antibody during the sixth \n and/or seventh month of pregnancy reflected the recrudescence of latent parasites , we \n collected sera of 2 newborn calves in herd a ( dams are shown as a-1 and a-3 in fig . \n the sera of the newborn calves \n contained a high level of anti - ncgra7 antibody even before suckling any colostrum ( fig . 5fig . \n 5.levels of anti - ncsag1 and anti - ncgra7 antibodies of dams a-1 and a-3 and their \n newborn calves ( white and gray bars , respectively ) . \n the vertical line indicates \n standardized values of anti - ncsag1 and anti - ncgra7 antibody titers . \n the dashed line \n indicates the positive boundary value ( 3.00 ) of the elisa . \n serum samples of dams and \n newborn calves were collected just after birth and before suckling colostrums . ) . \n it is likely that the seroconversion of dams \n during the sixth and/or seventh month of pregnancy reflected the recrudescence of latent \n infection . \n in contrast to the newborn calves , both a-1 and a-3 dams were negative for \n anti - ncgra7 antibody in the calving month ( figs . 4 \n and 5 ) . \n levels of anti - ncsag1 and anti - ncgra7 antibodies of dams a-1 and a-3 and their \n newborn calves ( white and gray bars , respectively ) . \n the vertical line indicates \n standardized values of anti - ncsag1 and anti - ncgra7 antibody titers . \n the dashed line \n indicates the positive boundary value ( 3.00 ) of the elisa . \n serum samples of dams and \n newborn calves were collected just after birth and before suckling colostrums . \n the detection and elimination of chronically infected cows is important for preventing the \n endogenous vertical transmission of n. caninum . at the same time , to \n evaluate abortion risk caused by n. caninum , it is important to \n discriminate between active and latent infection . to determine appropriate deployment of \n elisa using relatively well - studied antigens , ncsag1 and ncgra7 , for the diagnosis of cattle \n neosporosis , we investigated the prevalence and dynamics of antibodies against these \n antigens . in our study , only a few cows were positive for anti - ncgra7 antibodies , while 55% \n of cows ( 71/129 ) were positive for anti - ncsag1 antibody . \n in addition , consistent with \n previous studies , anti - ncsag1 antibody levels of \n each individual were constant regardless of the timing of the examination . \n considering that \n the anti - ncgra7 antibody level increases during acute infection , it is likely that the majority of anti - ncsag1-positive cows in the \n herds were in the latent phase . \n this suggests that elisa using anti - ncsag1 antigen is a \n promising tool for detecting latently - infected cattle and that examinations do not have to \n be too frequent , e.g. , once a year . \n in contrast , levels of anti - ncgra7 antibodies varied \n greatly over time , and a one - off elisa test would not be efficient for detecting anti - ncgra7 \n antibody within a herd . the usefulness of anti - ncgra7 antibodies as a marker of abortion \n risk has been reported previously , but repeated \n analysis at frequent intervals will be necessary to detect and measure anti - ncgra7 antibody \n accurately . in this study , we showed that positive conversion of anti - ncgra7 antibody \n occurred at the sixth and/or seventh month of gestation . \n these results strongly suggest that \n recrudescence from latent cysts does not occur in a random manner , but occurs specifically \n from the sixth to seventh month of gestation \n . this period must therefore be the optimal time \n point for the detection of anti - ncgra7 antibodies . during this study , \n the temporal increase in anti - ncgra7 \n antibody levels during gestation therefore suggest recrudescence of latently infected \n parasites without obvious symptoms in the dam . \n in addition , we showed that newborn calves \n born from such dams with anti - ncgra7 antibodies were serologically positive to the same \n antigen before suckling colostrums . considering that maternal antibody \n does not transfer to \n the fetus through the ruminant placenta , the results indicate that both of the newborn \n calves were infected in the uterus and that the antibodies were being produced by the fetus . \n it is strongly suggested that vertical transmission occurred to newborn calves from dams \n that had shown positive conversion for the anti - ncgra7 antibody during gestation . \n an \n increase in anti - ncgra7 antibody levels during gestation can be a marker for recrudescence \n of the parasite . \n such vertical transmission is a severe concern for the spread of the \n parasite , because congenitally infected calves remain persistently infected and can pass the \n infection on to the next generation . \n repeated \n examination , particularly during the sixth and seventh month of pregnancy , by elisa using \n the ncgra7 antigen can be a useful diagnostic tool to detect asymptomatic congenital \n infection with n. caninum . in this study \n , we described the dynamics of anti - ncsag1 and anti - ncgra7 antibodies in \n cattle with special reference to changes during the gestation period . \n measurement of \n antibodies against these two n. caninum antigens could be a valuable \n diagnostic tool for the control of cattle neosporosis .", "role": "user" }, { "content": "abstractbovine abortion caused by the apicomplexan parasite neospora caninum is \n a major economic problem in the livestock industry worldwide . \n our study measured the \n prevalence and temporal changes in levels of antibodies specific for two n. \n caninum derived antigens , ncsag1 and ncgra7 , to determine an appropriate \n strategy for serodiagnosis . \n using an enzyme - linked immunosorbent assay ( elisa ) , blood \n samples showed that 71 cows out of 129 were positive for anti - ncsag1 antibodies and that \n only nine cows were positive for anti - ncgra7 antibodies . by longitudinal sampling , \n it was \n revealed that positive and negative antibody conversion occurred frequently for \n anti - ncgra7 , but that anti - ncsag1 antibodies persisted for a long - term . \n these results \n indicate the usefulness of measuring anti - ncsag1 antibody levels for the detection of \n chronically infected cows . \n twelve cows showed positive seroconversion during pregnancy , \n nine of which showed seropositivity for anti - ncgra7 antibody at the sixth and/or seventh \n month of pregnancy ; serum samples were not obtained from the remaining three cows during \n this period . \n therefore , the optimal time for detection of anti - ncgra7 antibodies appears \n to be between the fifth and eighth month of pregnancy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in recent years , nursing staff shortages have become a major challenge for health care systems around the world , including iran . in 2008 , iranian hospitals needed approximately 220,000 nurses ; nonetheless , there were just about 90,000 nurses . \n this shortage is related to decreased satisfaction among nurses and posed a potential threat to the quality of patient care . in the study which was conducted in 12 countries in europe and the usa , \n the range of nurses burnout was from 10% in the netherlands to 78% in greece , job dissatisfaction was from 11% in the netherlands to 56% in greece , and intention to leave was from 14% in the usa to 49% in finland and greece . \n nursing shortages are a symptom of inadequate policies on recruitment and retention of nurses in the world . \n also , in a nationwide study , iranian nurses reported an average level of job satisfaction . \n another important challenge of iranian health care system is poor quality of patient care , which is influenced strongly by nurses motivation . \n nurses are the main group of the human resources in the health care and the quality of health care is highly dependent on an adequate recruit and supply of qualified and motivated nursing personnel . \n motivation is an important factor that influences nurses job satisfaction and their intention to work . \n therefore , understanding nurses motivators can enhance job satisfaction , quality of care , and productivity . \n identifying nurses motivators can help nurse mangers to find a way to motivate nursing staffs . \n but the focus of previous studies has been mainly on the association of job motivation with different variables such as evaluation outcomes , psychiatric nurses anger , job satisfaction , innovation , and individual and organizational factors . in general , \n therefore , psychologists have extensively studied about motivation and have provided theories about the reasons for motivation . \n motivation is defined as a process responsible for making the efforts strong , directed , and continuous to achieve the goals . in general , motivation originates from the needs that must be met . \n russell and swansburg believed that motivation is a concept used to describe an external condition stimulating a special behavior and internal responses revealing that behavior . \n many theories were applied to explain motivation at work , such as the needs theory ( maslow 1954 ; herzberg et al . \n 1959 ) , expectancy theory ( vroom 1964 ) , equity theory ( adams 1965 ) , and goal setting theory ( campbell and pritchard 1976 ) ; however , there is no single theory describing motivation comprehensively . \n it can be one of the possible reasons for the lack of consensus in an instrument to measure motivation . \n this study was conducted to identify the motivating factors among the hospital nurses of tehran university of medical sciences . \n this is a descriptive study in which the motivation of 310 nurses working at 14 hospitals of tehran university of medical sciences was evaluated in 2010 . \n nurses who had full - time work experience of at least 1 year in clinical practice in nursing and also had associate degree or higher educational qualification in nursing were included in the study . according to our given population size ( n = 2427 ) , \n however , to ensure obtaining an adequate sample size , with likelihood of 10% incomplete questionnaires , 330 questionnaires were delivered to nurses . \n the strata are formed based on members shared attributes or characteristics . in this study , each hospital was considered as a stratum and the samples were selected based on the proportion of the number of nurses in each hospital from the sampling frame . \n the researcher explained the purpose of the study and freedom for joining in the study to the potential participants . \n so , if the selected nurses did not wish to participate in the study or complete the delivered questionnaire , researchers selected the next nurse from the list . \n the analysis was done for the data of 310 nurses in the sample because 20 questionnaires were incompletely filled . \n demographic information questionnaire was used to measure the variables of age , gender , marital status , educational level , income status , work position , having overtime , and working in other hospitals . in spite of the availability of instruments to measure motivation \n , we developed a new questionnaire because of iranian hospitals context and socio - cultural differences . \n the instrument was developed by an extensive review of the literature including previous studies conducted in iran . \n after the initial draft of the instrument was developed , its content validity was evaluated by the nursing scholars who have experiences regarding the topic . in this stage , \n two items were omitted and a number of them were modified . also , the content validity index ( cvi ) was estimated and all items were approved based on their cvi > 0.85 . \n then , for face validity , the instrument was distributed to 10 nurses and their views on its simplicity and comprehensibility were taken and the required changes were made . \n after exploratory factor analysis , 30 items were reduced to 25 and classified into four factors : career development ( 7 items ) , job characteristics ( 9 items ) , job authority ( 5 items ) , and recognition ( 4 items ) . \n the factors were named after the item with the highest standardized factor loading within the domain . \n factor loadings and cronbach alpha coefficient for nursing motivation questionnaire for reliability , 30 nurses completed the instrument and the cronbach alpha coefficient was calculated as 0.81 . \n the items were scored on likert scale , with scores ranging from very low ( 1 ) to very high ( 5 ) . \n distribution of scores from the instrument and its factors was categorized based on the range of possible scores as follows : low ( 033% ) , medium ( 3366% ) , and high ( 66100% ) . \n also , to compare different factors , the mean score of each factor was obtained by dividing the sum of scores of each factor by the number of its items . \n statistical package for social sciences ( spss ) version 16.0 for windows ( spss inc . \n descriptive statistics and independent t - test , analysis of variance , tukey post - hoc test , chi - square and fisher 's exact test were used . a significance level of p < 0.05 was considered . \n the mean age of the participants was 35.07 years [ standard deviation ( sd ) = 7.46 ; range : 2253 ] . the length of the participants work experience ranged from 1 to 30 years , with a mean of 11.48 years ( sd = 7.25 ) . \n characteristics of the participants ( n=310 ) the motivation of most of the subjects in career development ( 52.6% ) and job authority ( 64.5% ) was at a medium level , while the motivation in job characteristics ( 61.3% ) was at a high level . \n half of the subjects had a high motivation in the factor of recognition . \n the findings of this study showed that the least mean of the factor score , considering the number of items , was 3.23 for career development , while the highest mean was 3.81 for job characteristics . \n scores of motivating factors and total motivation independent t - test showed that there was no statistically significant difference in the total motivation score between males and females ( p = 0.381 ) and in terms of being employed in other hospital or none ( p = 0.599 ) . \n also , independent t - test showed that total motivation of nurses who had overtime was higher than that of others ( p = 0.031 ) . \n also , the results of one - way analysis of variance ( anova ) showed that there was no difference in total motivation in terms of marital status and educational level . \n there was a statistically significant difference in the total motivation of nurses in terms of their positions ( p = 0.007 ) . \n tukey post - hoc test showed that the motivation of head nurses was significantly higher than that of staff nurses ( p = 0.005 ) . \n the mean score of total motivation among nurses who had inadequate income was significantly less than those who had adequate income ( p < 0.001 ) . \n the chi - square test showed no statistically significant relationship of career development with gender , working overtime , and working in other hospital . \n this factor had a statistically significant relationship to income ( p = 0.001 ) , age ( p = 0.035 ) , and work position ( p = 0.04 ) . \n fisher 's exact test showed that the factor job characteristics was significantly related to the work position ( p = 0.021 ) , job authority was only related to overtime ( p = 0.035 ) , and also recognition was significantly related to overtime ( p = 0.043 ) . \n the present study was conducted to identify the motivating factors among iranian nurses . in this study , \n the factors of career development , job characteristics , job authority , and recognition were considered as the aspects of motivation in nurses . \n shattuck et al . , in a systematic review , identified seven major motivational themes including financial rewards , career development , continuing education , hospital infrastructure , resource availability , hospital management , and recognition / appreciation . except two factors , career development and recognition / appreciation , which are completely similar with the themes identified in the mentioned review , \n the findings showed that the least mean score of motivation , considering the number of items , was related to career development , while the highest one was related to job characteristics . \n these results are comparable with the results of a study conducted by mahmoudi et al . , who reported the nature of work among the internal factors and supervision among the external factors as the most important factors of job motivation in iranian critical care nurses . \n in the mentioned study , the ability to serve the community and the value of nursing among people as work nature factors have had the highest effect on job motivation . \n several previous studies have identified accomplishing jobs , working independently , and attaining interpersonal relationships as the most important factors that motivate nurses . \n the findings showed that the motivation score of 55.5% of nurses was at a medium level . \n similarly , jodat et al . reported that nurses overall score for job motivation was moderate . \n also , this finding could be compared with the findings of the study conducted by taghavi larijani et al . \n , in which the motivation of 65% of iranian nurses working in medical - surgical wards was reported as low . \n this controversy can be explained by the difficulties confronted by nurses in the iranian health care system . \n iranian hospitals deal with challenges including inadequate staffing , limited equipments available to nursing care , lack of authority to change practice , and organizational cultures rewarding routine and task - based practice . \n low levels of motivation among nurses are important in view of the fact that the largest subgroup of human resources in the health care system consists of nurses . \n it becomes even more important considering that staff 's motivation is a predictor of their productivity , and the studies conducted on productivity of iranian nurses show that only 7.5% of iranian nurses have shown the desired productivity . \n one of the main challenges in providing good - quality nursing care in iran and around the world is shortage of nurses . \n studies show that this shortage has a domino effect in nurses loss of knowledge and motivation , exhaustion , burnout , and severe stress . furthermore , job stress , lack of autonomy , and nurse \n physician collaboration are the most important factors that contributed to nurses job dissatisfaction and retention in the nursing literature . \n reported that job motivation of nurses is an important factor in the intent of nurses to leave nursing . \n the findings of the present study showed a significant relation of age , work position , and the income status with the first factor ( career development ) , work position with the second factor ( job characteristics ) , and finally , working overtime with the third and fourth factors ( job authority and recognition , respectively ) . \n several researchers have shown a positive significant association between the age of nurses and their job motivation . \n although there was no significant association between gender and total motivation score in this study , franco et al . \n reported that female health workers in jordan had lower ratings to motivational determinants , and there were almost no differences related to gender or age in georgia . \n found that nurses younger than 30 years were more motivated than older nurses , and higher university degrees were related to higher motivation in nurses . \n de cooman et al . stated that male and female nurses are motivated for similar characteristics of nursing . in a study by the mixed method in which the motivation of non - medical staff of tanzania was examined , \n the findings showed that though non - financial factors are of great importance for motivation , financial satisfaction is a prerequisite of any intervention for increasing the motivation by non - financial motivators . \n also , the study of lambrou et al . showed the managerial position was associated with job characteristics among greek nurses . \n the importance of the supervision factor becomes less while the importance of the factor of appreciation and recognition is increased . \n this means that the sample covered nurses who work in public university hospitals in tehran , the capital and largest city of iran ; therefore , future study should be conducted to have a clear understanding about the motivating factors among nurses in public / private sectors of urban / remote areas . \n in addition , the questionnaire of this study was developed by the authors and used for the first time ; hence , its criterion validity including concurrent and predictive validity should be evaluated in future studies . \n our findings showed that the factor of career development had the maximum potential ability to inspire nurses in their profession . \n so , it is necessary that nursing managers pay more attention to use the element of mentioned factors such as effective supervision , encouragement , and job enrichment . \n however , other motivating factors including job characteristics , job authority , and recognition should not be neglected to motivate nurses . \n specifically , the findings of this study imply that the importance of the factor of job characteristics , such as the use of various and high - level nursing skills , feedback , and critical thinking , as the first ranked motivating factor in the motivation of nurses needs to be emphasized . \n moreover , the medium level of motivation in participants indicates the necessity of paying more attention to the motivating factors to improve motivation in nurses . \n the results of the current study can be used in programs designed to improve nurses work motivation .", "role": "user" }, { "content": "background : one of the most important challenges of iranian health care system is quality of care , and it is assumed that motivated nurses are more ready to provide better care . \n there are limited studies investigating iranian nurses motivations ; however , factors which motivate them have not been studied yet . identifying the motivating factors \n enables nurse managers to inspire nurses for continuous quality improvement . \n the aim of this study was to identify motivating factors for iranian hospital nurses.materials and methods : this is a cross - sectional descriptive study in which 310 nurses working at 14 hospitals of tehran university of medical sciences were selected by proportionate stratified random sampling . \n data were collected in 2010 by a researcher - developed questionnaire . \n descriptive statistics and independent t - test , analysis of variance , tukey post - hoc test , chi - square and fisher 's exact test were used for statistical analysis by statistical package for social sciences ( spss ) version 16.results:the mean score of motivation was 90.53 10.76 ( range : 59121 ) . \n four motivating factors including career development ( 22.63 5.66 ) , job characteristics ( 34.29 4 ) , \n job authority ( 18.48 2.79 ) , and recognition ( 15.12 2.5 ) were recognized . \n the least mean of the motivation score , considering the number of items , was 3.23 for career development , while the highest mean was 3.81 for job characteristics.conclusions:the findings showed that motivation of nurses was at a medium level , which calls for improvement . \n the factors that have the greatest potential to motivate nurses were identified in this study and they can help managers to achieve the goal of continuous quality improvement .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: femoral neck fractures in the elderly are associated with high morbidity and mortality.1 the optimal treatment remains controversial.2 the fractures can be caused by low - energy trauma . \n hemiarthroplasty using modular head partial prostheses is a common surgical procedure used to treat elderly patients with femoral neck fractures . \n these prostheses can be inserted with or without bone cement.3 hemiarthroplasty4 contributes to early ambulation and good functional recovery . \n however , controversy persists as to whether cemented or uncemented hemiarthroplasty is preferable for elderly patients . while femoral neck fractures treated via cemented hemiarthroplasty may be less prone to periprosthetic fracture and prosthetic loosening , they are also more likely to trigger embolisms and decreased cardiac output during insertion of the bone cement.5 conversely , although uncemented hemiarthroplasties are associated with higher rates of postoperative prosthesis loosening , they require shorter operation times and are associated with less intraoperative blood loss . \n treatment of a displaced femoral neck fracture is currently determined by the mobility and functional demands of the patient . \n cementing the prosthesis affords more secure fixation and may result in less postoperative midthigh pain and a reduced long - term revision rate ( loosening is less).6 for decades , the optimal treatment choice has been debated , and whether cemented is better than uncemented hemiarthroplasty remains uncertain . \n many studies have suggested that cemented hemiarthroplasty reduces the risk of residual pain and affords better functional results.2,7 a few studies found that uncemented implants yield the same clinical results as cemented implants when used to treat displaced femoral neck fractures.2,6,8 nonetheless , the postoperative rate of prosthesis loosening is higher after uncemented hemiarthroplasty.6 the purpose of this controlled trial was to compare the results of hemiarthroplasty using a cemented9 or press - fit uncemented implant,10,11 focusing on the following three research aims : 1 ) are any differences in intraoperative events detectable ? ; 2 ) are there any differences in functional outcomes and quality of life at 1 year ? ; and 3 ) are the rates of postoperative morbidity and mortality similar between the two groups ? \n this retrospective multicenter study was performed at osmaniye state hospital , bozok university faculty of medicine , kayseri training hospital and modern dnyam hospital after bozok university faculty of medicine ethics committees approved the study ( no 23/03 ) . \n a total of 136 hip fracture patients were treated with a cemented or cementless hemiendoprostheses from 2006 to 2012 . \n institutional permission was granted for the use of relevant medical records and anesthetic data . during the study period , \n we reviewed the records of all patients admitted with femoral neck fractures and who died as inpatients following surgery . \n we recorded demographic variables , dates of admission and surgery , types of fracture , medical comorbidities , medications used , type of implant used , seniority levels of the operating surgeon and the anesthetist , hemodynamic status immediately before and after cement application and in recovery , and time and cause of death . \n patient age , sex , number of associated comorbidities , and prefracture ambulatory status were all retrieved . \n general health status was defined by the number of major comorbidities including diabetes mellitus , congestive heart failure , cardiac arrhythmias , ischemic heart disease , previous cerebrovascular accidents , renal disease , parkinson s disease , hypertension , chronic obstructive pulmonary disease , and anticoagulation therapy . \n ambulatory status was classified using the barthel index of activities of daily living and the harris hip score . \n postoperative pain was assessed using the visual analog scale with responses ranging from 0 to 10 . \n postoperative complications were recorded . among them , three patients had an early revision operation , so they were excluded . \n comorbidity scores derived using guidelines of the american society of anesthesiologists were recorded prior to surgery . \n the surgeon performed cemented and cementless operations using the same surgical technique : patients were placed in the lateral decubitus position and longitudinal skin incisions centered over the greater trochanter were made in the lateral position . after removing the femoral head , the hip was gently flexed , adducted , and internally rotated . \n after cortical reaming was attained , broaches were precisely placed and the fit of each broach within the canal was assessed . \n adequate axial and rotational stability was assured ; no motion of the broach within the canal was permitted . \n next , the trial femoral stem was inserted and evaluated in terms of the responses to rotational and extraction forces . after inserting the predetermined ( carefully dimensioned ) femoral bipolar head , \n statistical analysis was performed using the ncss 2007 ( ncss , llc , kaysville , ut , usa ) statistical software . \n parametric tests were used to explore differences between variables that were normally distributed , and nonparametric tests were used to explore those that were not normally distributed . normally distributed variables were expressed as means standard deviations . \n student s t - test was used to compare normally distributed data and the mann \n the yates continuity correction test was applied , and pearson s correlation coefficients were calculated to examine the extent of the associations between variables . \n this retrospective multicenter study was performed at osmaniye state hospital , bozok university faculty of medicine , kayseri training hospital and modern dnyam hospital after bozok university faculty of medicine ethics committees approved the study ( no 23/03 ) . \n a total of 136 hip fracture patients were treated with a cemented or cementless hemiendoprostheses from 2006 to 2012 . \n institutional permission was granted for the use of relevant medical records and anesthetic data . during the study period , \n we reviewed the records of all patients admitted with femoral neck fractures and who died as inpatients following surgery . \n we recorded demographic variables , dates of admission and surgery , types of fracture , medical comorbidities , medications used , type of implant used , seniority levels of the operating surgeon and the anesthetist , hemodynamic status immediately before and after cement application and in recovery , and time and cause of death . \n patient age , sex , number of associated comorbidities , and prefracture ambulatory status were all retrieved . \n general health status was defined by the number of major comorbidities including diabetes mellitus , congestive heart failure , cardiac arrhythmias , ischemic heart disease , previous cerebrovascular accidents , renal disease , parkinson s disease , hypertension , chronic obstructive pulmonary disease , and anticoagulation therapy . \n ambulatory status was classified using the barthel index of activities of daily living and the harris hip score . \n postoperative pain was assessed using the visual analog scale with responses ranging from 0 to 10 . \n postoperative complications were recorded . among them , three patients had an early revision operation , so they were excluded . \n comorbidity scores derived using guidelines of the american society of anesthesiologists were recorded prior to surgery . \n the surgeon performed cemented and cementless operations using the same surgical technique : patients were placed in the lateral decubitus position and longitudinal skin incisions centered over the greater trochanter were made in the lateral position . after removing the femoral head , \n after cortical reaming was attained , broaches were precisely placed and the fit of each broach within the canal was assessed . \n adequate axial and rotational stability was assured ; no motion of the broach within the canal was permitted . \n next , the trial femoral stem was inserted and evaluated in terms of the responses to rotational and extraction forces . after inserting the predetermined ( carefully dimensioned ) femoral bipolar head , \n statistical analysis was performed using the ncss 2007 ( ncss , llc , kaysville , ut , usa ) statistical software . \n parametric tests were used to explore differences between variables that were normally distributed , and nonparametric tests were used to explore those that were not normally distributed . \n student s t - test was used to compare normally distributed data and the mann \n the yates continuity correction test was applied , and pearson s correlation coefficients were calculated to examine the extent of the associations between variables . \n the cemented and cementless groups did not differ significantly in terms of age , sex , number of major comorbidities , or prefracture ambulatory status ( table 1 ) . \n the average age of the 67 female and 66 male patients was 78.148.44 years ( range : 60110 years ) at the time of injury . \n the median time between injury and surgical treatment was 2.971.62 days . at the end of our follow - up evaluation , \n this fell to 15.6% in the second year , and 9.4% in the third year . \n the follow - up periods of the cemented and cementless groups did not differ significantly . \n the mean harris hip score of the group with cemented partial prostheses was 72.109.12 , and that of the group with cementless partial prostheses was 75.363.88 points ( no significant difference ; p=0.276 ) . \n the barthel activity and pain scores were better in the cemented group ( p=0.728 ) . \n thus , patients in both groups attained similarly good functional results . of all patients , 25.6% ( number [ n]=34 ) of patients were smokers and 82.7% ( n=110 ) had concurrent diseases . of all patients , 29.3% ( n=39 ) \n required intensive care , 32.3% ( n=43 ) experienced complications , and the mortality rate was 47.1% ( n=68 ) ( table 2 ) . \n two perioperative fat - embolic events were found in the cemented group and none in the uncemented group . \n osteoporosis , comorbidities , and increased levels of minor trauma increase the incidence and complicate the treatment of such fractures . \n although cemented hemiarthroplasty has been used to treat most of these cases worldwide , noncemented prostheses are gaining popularity . \n foss and kehlet12 concluded that randomized studies afforded only limited evidence that cementing the prosthesis may reduce the amount of postoperative pain and possibly improve mobility . \n although serious cement - related complications have been reported , we hypothesized that , relative to cemented hemiarthroplasty , noncemented hemiarthroplasty would yield similar technical and functional outcomes and complication rates , but it would be associated with shorter operation times . \n the literature abounds with early - stage success stories associated with the use of cemented bipolar hip replacements ; complications are relatively few and mortality rates are low.13 periprosthetic femoral fractures have been reported after uncemented hemiarthroplasty . \n elderly and/or frail patients benefit from bone cement ; this reinforces the osteoporotic proximal femur.13,14 elmaraghy et al15 suggested that cemented hemiarthroplasty had no effect on the formation of fat emboli . in another study , \n donaldson et al16 suggested that morbidity and mortality rates might be minimized by preferring cementless arthroplasty in high - risk patients . \n the reported risk of cement - related death is low but not negligible.17,18 although some uncemented hemiarthroplasties have yielded clinical results equivalent to those of their cemented counterparts , an increased risk of subsequent fracture is evident . \n the risk of periprosthetic fractures may also differ between cemented femoral stems differing in design.19 based on this theory , cementing the prosthesis could lead to higher mortality . \n however , the pooled results of our meta - analysis showed that perioperative mortality during fitting of a cemented prosthesis was 8.1% , and it was 8.3% for an uncemented prosthesis ; these prostheses were associated with 3-year mortalities of 48.4% and 45.5% , respectively . \n the low numbers of our cases and the shortness of follow - up times are the limitations of our study . \n the aim of this study was to explore whether the uncemented femoral stem used in this trial would perform similarly to a cemented stem . \n we examined differences in harris hip and barthel pain scores , femoral fractures , overall health outcomes , complications , rate of reoperation , and mortality rates .", "role": "user" }, { "content": "objectivescontroversy exists regarding the use of cement in hemiarthroplasty when treating a displaced femoral neck fracture in elderly patients . \n the primary hypothesis of this study was that the use of cement would afford better visual analog pain and activity scores in elderly patients.methodsthis study included 133 patients over 65 years of age admitted to our clinics from 2006 to 2012 for the surgical treatment of a displaced femoral neck fracture . \n all patients were treated via hemiarthroplasty . \n the patients ( 66 males , 67 females ; mean age : 78.16 years ; range : 60110 years ) were followed - up regularly . \n all patients were divided into one of two groups : group a was treated with cement ; and group b without . \n both groups were compared in terms of preoperative features ( demographics and associated diseases ) , pre- and postoperative complications , mortality rates , pain and activity levels , and hip scores . \n hospitalization time , average surgical duration , and time from fracture to operation were also recorded . \n mean follow - up duration was 30.9 ( range : 551 ) months.resultswe found no significant between - groups differences in terms of length of hospital stay , harris hip score , complications , or follow - up mortality rates . walking ability and pain scores were better in the cemented group in the early follow - up period . \n duration of surgery and perioperative mortality rates were somewhat lower in the cementless group , but the difference was not statistically significant.conclusionthe use of cement during hip hemiarthroplasty in patients over 65 years of age had no negative impact on mortality or morbidity . \n hemodynamic changes during cement application are important , but it is noteworthy that patients fitted with cemented endoprostheses had increased levels of activity and lower pain levels .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the prevalence of diabetes is high and increasing over the world . especially in developing countries \n , the total number of adults with diabetes will increase 69% from 2010 to 2030 . \n diabetes mellitus ( dm ) prevention is recognized as a major public health priority in developing nations . \n therefore , there is a great interest in identifying individuals at high risk of developing diabetes . \n currently , it is well known that risk scoring models and anthropometric measures could predict future incidence of dm [ 28 ] . for example \n , the finnish diabetes risk score and the framingham offspring study simple clinical model , based on more than 10 years follow - up , have been used as a tool to predict the risk for diabetes . \n however , it seems that the predictive value of risk scoring models is time - varying . \n stern et al . published a clinical model to predict diabetes risk using fasting glucose and other routine clinical data , including age , sex , and ethnicity . \n this clinical model predicted 7.5-year incidence of diabetes better than the 2 h glucose load during oral glucose tolerance test in mexican - american and non - hispanic white participants from san antonio heart study . \n had found that the validity of this clinical model to predict incident diabetes was inconsistent between 5 - 6 years and 10 years in japanese americans aged less than 55 . on the other hand \n , we do not know whether this phenomenon also exits in anthropometric measures , especially in chinese han nationality . to our knowledge , \n the duration of studies using anthropometric measures for predicting diabetes in chinese han nationality was mostly less than 15 years , and a little literature had been reported for more than 15 years . \n therefore , we compared the predictive ability of anthropometric measures for predicting dm incidence based on a 15-year prospective study in chinese adults . \n the study sample population was obtained from a chinese multi - provincial cohort study ( cmcs ) approved by the beijing institute of heart , lung and blood vessel diseases for the entire duration , a nationwide , multicenter prospective cohort study on cvd risk factors in the chinese . \n a total of 30121 chinese subjects aged 3564 and free of cvd at commencement was included by a multistage sampling method in which detailed information regarding the methodology had been previously reported [ 1315 ] . of these \n , 27003 subjects were recruited from 16 centers in 11 chinese provinces between 1992 and 1993 . at one of the centers ( sichuan , china ) , 711 individuals in an urban community located in chengdu , sichuan province , china , were included . \n the cohort also accepted a health examination in 2007 for a study supported by megaprojects of science research for the 11th five - year plan ( trends in the incidence of metabolic syndrome and integrated control in china ) with the same methods . \n twenty - four individuals were excluded from this analysis for being diagnosed with diabetes in 1992 . \n therefore , 687 individuals with complete data were available ( figure 1 ) . in 1992 , medicine doctors and nurses did a survey of cardiovascular disease ( cvd ) risk factors according to the multinational monitoring of trends and determinants in cardiovascular disease ( monica ) protocol . standardized questionnaire , physical examination , and laboratory tests were included in this survey . \n a standardized questionnaire was used for collecting information on subjects ' demographic characteristics , cvd risk factors , such as smoking status , alcohol consumption levels , physical activity , and family history of cvd . \n anthropometric measurements included height , weight , wc , and hip circumference measured while the patients were lightly clothed and without shoes after approximately 12 h of overnight fasting . \n measurements were conducted using a calibrated weighing scale , wall - mounted stadiometer , and tape measure . \n the results were recorded to the nearest 0.2 kg , 1 cm , and 0.5 cm . \n waist circumference ( wc ) was taken with the subject in a standing position , at the level midway between the lateral rib margin and the iliac crest . \n bmi was calculated using the following formula : weight / height ( kg / m ) . \n whpr was calculated as wc divided by hip circumference , and whtr as wc divided by height . \n blood pressure ( bp ) was measured in the right arm with subjects in a sitting position using a regular mercury sphygmomanometer after resting for 15 minutes . \n the three consecutive blood pressure readings were used for mean value of the bp . fasting plasma glucose ( fpg ) , fasting serum total cholesterol ( tc ) , low - density lipoprotein cholesterol ( ldl - c ) , high - density lipoprotein cholesterol ( hdl - c ) , and triglyceride ( tg ) were included . \n biochemistry parameters were measured at the laboratory of west china hospital ( chengdu , china ) . \n tc , tg , and fpg were all determined using the enzymatic method , while hdl - c was measured using the phosphotungstic acid / magnesium chloride precipitation method . \n the level of non - hdl cholesterol was calculated by subtracting hdl cholesterol from total cholesterol determined . \n the concentration of ldl - c was estimated using the friedewald formula , and very low - density lipoprotein cholesterol was calculated by subtracting serum ldl - c and hdl - c from tc [ 13 , 14 , 17 ] . \n this survey was approved by the ministry of health of china as well as the ethics committee of west china hospital of sichuan university . \n the study protocol conforms to the ethical guidelines of the 1975 declaration of helsinki as reflected in a priori approval by the institution 's human research committee . \n hypertension was defined as having systolic blood pressure ( sbp ) of at least 140 mm hg and/or diastolic blood pressure ( dbp ) of at least 90 mm hg and/or currently taking antihypertensive medications . \n diabetes mellitus was defined as one of the following at follow - up assessment : ( 1 ) fasting plasma glucose 7.0 mmol / l , ( 2 ) a positive response to the question , \n has a doctor ever told you that you have diabetes ? , or ( 3 ) current use of insulin or oral hypoglycemic agents . \n alcohol intake was defined as average intake of alcohol of at least 50 g / d . \n physical activity was defined as exercise one or more times per week , at least 20 minutes for each time [ 15 , 17 , 18 ] . \n continuous variables were expressed as the mean sd or median ( interquartile range ) as appropriate . \n differences of baseline characteristics between participants with and without diabetes were tested by independent t - test for normally distributed variables and by the nonparametric mann - whitney or wilcoxon test for skewed variables . \n this study population was stratified into quartiles of bmi , wc , whpr , and whtr . to assess the effects of baseline anthropometric measures on the new onset of diabetes , cox 's proportional hazards \n regression models were used to estimate the hazard ratios ( hrs ) of them , and the discriminatory power of anthropometric measures for diabetes was assessed by the area under the receiver operating curve ( aroc ) . \n the hazard ratios ( hrs ) were computed for quartiles 2 , 3 , and 4 as compared with the lowest quartile in different cox 's proportional hazards regression models . \n covariates including age , systolic blood pressure ( sbp ) , tg , hdl - c , and fpg were fitted as continuous variables in the multivariate analyses and alcohol intake , smoking , regular physical exercise , and family history of diabetes were fitted as categorical variables . \n the point represented the largest sum of sensitivity and specificity on the receiver operating curve ( roc ) was chosen to obtain these four measurements in predicting diabetes . \n 687 eligible subjects studied at baseline completed the 7 - 8 years and the 15-year follow - up . \n the incidence of diabetes was 2.8% ( n = 19 ) at 8 years and 10.8% ( n = 74 ) at 15 year . \n the percentage of self - reported history was 67.6% ( 50/74 ) during the 15-year follow - up . among the self - reported participants , 37 individuals were on antidiabetic drugs . \n for the other 24 diagnosed dm individuals , the average fpg was 9.5 mmol / l . \n mmol / l and the maximum and minimum were 16.2 mmol / l and 7.1 mmol / l , respectively . \n characteristics of participants at baseline were shown in table 1.compared with subsequent nondiabetic subjects , the demographic data in 1992 showed that subsequent diabetic subjects had a higher bmi , wc , hip circumference , whpr , whtr , fasting plasma glucose , and triglycerides at 7 - 8 years and 15-year follow - up ( all p < 0.001 , table 1 ) . the univariate cox 's proportional hazards regression analysis presented that these anthropometric measures ( bmi , wc , whpr , and whtr ) could statistically increase the risk for the new onset of diabetes with a 15-year follow - up ( table 2 ) . in the multivariate cox 's proportional hazards regression models , \n all measurements were significantly associated with risk of diabetes after adjustment for potential risk factors including age , sex , alcohol intake , smoking , regular physical exercise , family history of diabetes , and fpg . \n after further adjustment for sbp , tg , and hdl , the associations were reduced , but remained to be significant ( table 2 ) . \n figure 2 showed the cumulative incidence of dm in different anthropometric variables groups in multivariate cox - regression in model 2 . \n the areas under the roc curves were 0.668 ( 95% ci : 0.6310.703 ) for bmi , 0.781 ( 95% ci : 0.7480.811 ) for wc , 0.769 ( 0.7360.800 ) for whpr , and 0.768 ( 0.7340.799 ) for whtr at 7 - 8-year follow - up , respectively ( all p < 0.05 ) , while 0.668 ( 95% ci : 0.6010.734 ) for bmi , 0.701 ( 95% ci : 0.6410.760 ) for wc , 0.691 ( 95% ci : 0.6370.748 ) for whpr , and 0.715 \n ( 95% ci : 0.6570.774 ) for whtr ( all p < 0.05 , table 3 ) at 15-year follow - up . table 3 indicated that wc , whpr , and whtr were better than bmi for predicting incident diabetes at 7 - 8 years in chinese han nationality population from chengdu community . \n however , the four anthropometric measurements had no significant difference for predicting 15-year incidence of diabetes . \n the goal of the study was to assess whether bmi , wc , whpr , and whtr could predict future diabetes on the basis of data collected from a general chinese group during 15-year follow - up and to assess whether the validity of anthropometric measures to predict incident diabetes were stable as time goes by , especially in chinese han nationality . \n after adjusting for potential confounders , our findings showed that both general obesity measures ( bmi ) and central obesity measures ( wc , whpr , whtr ) could predict future diabetes in a chinese population after a long follow up . on the other hand , wc , whpr , and whtr were better than bmi for predicting incident diabetes at 7 - 8 years in chinese han nationality population from chengdu community . \n the four anthropometric measurements had not significant difference for predicting 15-year incidence of diabetes . in recent years \n , some studies showed a more close association between diabetes and central obesity measures than bmi [ 1923 ] , whereas other studies showed no significant differences between the obesity measures [ 2426 ] . \n meanwhile , meta - analysis studies also showed inconsistent results [ 27 , 28 ] . \n however , we reviewed literatures of previous prospective studies comparing bmi , wc , whpr , and whtr for predicting incidence of diabetes and found that many studies reporting a difference between the obesity measures did not use appropriate study statistical methods or that it did not investigate all indicators with data on only 1 or more of the 4 indicators ( i.e. , bmi , wc , and whpr ) with regard to the association with diabetes risk . \n more importantly , length of the follow - up periods might influence study results [ 2946 ] ( see supplementary table 1 available online at http://dx.doi.org/10.1155/2013/239376 ) . \n firstly , we compared the predictive ability of the four anthropometric measures for predicting dm incidence based on a 15-year prospective study in chinese adults . \n similar to our findings , in 610 years and 1115 years longitudinal follow - up groups in supplementary table 1 , the majority of trials had shown no significant difference between obesity measures . \n thought that different methods of collecting numbers of onset diabetes and obesity measures might result in this result . \n diabetes incidence was self - reported and anthropometric indicators were self - measured by the participants in the two studies . \n but , investigators from the san antonio heart study and epic - potsdam study , with similar methods , had demonstrated higher risk with wc or whpr than bmi in predicting diabetes incidence . \n our findings revealed that wc , whpr , and whtr were better than bmi for predicting incident diabetes at 7 - 8 years in the same population . \n however , the four indictors did not have a significant difference in our study at 15 years . \n a study reported that over 10 years , total fat mass and fat mass except subcutaneous fat increased , whereas body weight did not change . \n it was possible that many subjects tend to become abdominally obese rather than become totally obese during follow - up , and the impact of baseline body fat distribution on diabetes risk was weakened with lengthening of the follow - up period . on the other hand , racial and regional differences in the association between obesity and the risk for diabetes might also have influenced the results . \n although the prevalence of obesity is much lower in asia than in western countries , the prevalence of diabetes is similar between the two regions , and diabetes occurs in asians who are less obese . \n therefore , we reviewed studies that compared anthropometric measures in predicting risk of diabetes in chinese mainland [ 5053 ] ( supplementary table 2 ) . \n there might be a greater bias risk in data collection ( i.e. , potential detection bias ) , and the cross - sectional data showed only the association with present risk factor conditions but did not directly predict the future risk of dm . \n a long follow - up time was to avoid not only insufficiency of new onset diabetes cases in short - term follow - up that underestimated the predictive power of the measurement indexes but also potential detection bias in cross - sectional studies that exaggerate the statistical power of the indexes . \n taking into account the sample size , sex , and region , we can not extend our findings to general population . \n but we need to know that the length of follow - up period is a factor that can not be ignored . \n another advantage was that a standardized protocol was used and all anthropometric variables were collected using direct measurement by trained doctors and nurses rather than self - report . \n this limited the study , and we could not analyze the association between anthropometric measures with diabetes risk classified by gender . the results of our study may have limited statistical power ; but we still can get some clues . \n the second was the way to diagnose diabetes mellitus . during the investigation , taken into account the financing and feasibility , we had diagnosed diabetes by measuring fasting plasma glucose and patient self - reports rather than oral glucose tolerance test means . \n some individuals would have developed dm that was not detectable by changes in fasting glucose alone or by clinical history , leading to the underestimation of the experimental results . \n , our findings showed that anthropometric measures could predict diabetes with a long - time follow - up . \n however , the validity of anthropometric measures to predict incident diabetes may change with time . \n future researches may be warranted to assess whether this phenomenon still exists in mainland china with different duration of follow - up time in a large population .", "role": "user" }, { "content": "objective . to examine whether anthropometric measures could predict diabetes incidence in a chinese population during a 15-year follow - up . \n design and methods . \n the data were collected in 1992 and then again in 2007 from the same group of 687 individuals . \n waist circumference , body mass index , waist to hip ratio , and waist to height ratio were collected based on a standard protocol . to assess the effects of baseline anthropometric measures on the new onset of diabetes , cox 's proportional hazards \n regression models were used to estimate the hazard ratios of them , and the discriminatory power of anthropometric measures for diabetes was assessed by the area under the receiver operating curve ( aroc ) . results . \n seventy - four individuals were diagnosed with diabetes during a 15-year follow - up period ( incidence : 10.8% ) . \n these anthropometric measures also predicted future diabetes during a long follow - up ( p < 0.001 ) . at 7 - 8 years , the aroc of central obesity measures ( wc , whpr , whtr ) were higher than that of general obesity measures ( bmi ) ( p < 0.05 ) . \n but , there were no significant differences among the four anthropometric measurements at 15 years . \n conclusions . \n these anthropometric measures could still predict diabetes with a long time follow - up . \n however , the validity of anthropometric measures to predict incident diabetes may change with time .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: it is first described by malherbe and chenantais in 1880 as a calcified tumor originating from sebaceous glands and named as pilomatrixoma by forbis and helwig in 1961 . \n it is usually localized in the head and neck region and also on upper extremities . \n lesions located on the skin are usually bluish or reddish in color and could morphologically vary in bullous , anetodermic or perforated masses . \n recently , there has been only one dermoscopic study , which had focused on diagnosis of over skin located lesions . in this article , \n a 67-year - old female patient has been complaining of a painless , reddish mass on her right cheek . on dermatological examination , a nodular , \n well - marginated , and reddish lesion of 2 cm 2.5 cm in diameter was identified . \n dermoscopic evaluation demonstrated yellowish lobules on an erythematous background , surrounded by crown - like branching vessels [ figure 1a ] . \n ( a ) dermatoscopy showing yellowish lobules surrounded by crown like vessels ( gross tumor is seen in the right - upper corner of image , 10 ) . \n ( b ) bluish - white fishing net - like streaks is seen the entire image ( inset of gross tumor in the right - upper corner of image , 10 ) . \n ( c ) in the dermoscopic view , there are polymorphous vessels ( predominated linear irregular vessels ) , bluish areas ( left - middle side of image ) and ulcerations ( inset of gross tumor in the right - upper corner of image , 10 ) a 48-year - old male patient had a reddish nodule on his left eyebrow which had been growing slowly by 2 months . \n reddish , 1 cm 1 cm sized nodule with hairy surface was detected on the medial side of left eyebrow . \n dermoscopic examination revealed erythema and bluish - white streaks like a fishing net [ figure 1b ] . \n a 58-year - old male patient admitted with a reddish nodule on upper left side of the nose . \n physical examination revealed a reddish nodule on upper left side of nasal dorsum with an ulcerated area on its surface . \n dermoscopic examination demonstrated erythema , linear irregular vessels , hairpin like vessels , comma like vessels , ulceration , and bluish areas [ figure 1c ] . \n a 67-year - old female patient has been complaining of a painless , reddish mass on her right cheek . on dermatological examination , a nodular , \n well - marginated , and reddish lesion of 2 cm 2.5 cm in diameter was identified . \n dermoscopic evaluation demonstrated yellowish lobules on an erythematous background , surrounded by crown - like branching vessels [ figure 1a ] . \n ( a ) dermatoscopy showing yellowish lobules surrounded by crown like vessels ( gross tumor is seen in the right - upper corner of image , 10 ) . \n ( b ) bluish - white fishing net - like streaks is seen the entire image ( inset of gross tumor in the right - upper corner of image , 10 ) . \n ( c ) in the dermoscopic view , there are polymorphous vessels ( predominated linear irregular vessels ) , bluish areas ( left - middle side of image ) and ulcerations ( inset of gross tumor in the right - upper corner of image , 10 ) \n a 48-year - old male patient had a reddish nodule on his left eyebrow which had been growing slowly by 2 months . \n reddish , 1 cm 1 cm sized nodule with hairy surface was detected on the medial side of left eyebrow . \n dermoscopic examination revealed erythema and bluish - white streaks like a fishing net [ figure 1b ] . \n a 58-year - old male patient admitted with a reddish nodule on upper left side of the nose . physical examination revealed a reddish nodule on upper left side of nasal dorsum with an ulcerated area on its surface . \n dermoscopic examination demonstrated erythema , linear irregular vessels , hairpin like vessels , comma like vessels , ulceration , and bluish areas [ figure 1c ] . \n although it is widely used in diagnosis of melanocytic lesions , nonmelanocytic structures have also been observed recently . \n nonvascular , irregular , whitish formations ( 80% ) and streaks ( 70% ) were commonly observed . \n reddish homogenous zones ( 90% ) , hairpin like vessels ( 70% ) , linear irregular vessels ( 70% ) and dotted vessels ( 70% ) were identified as vascular structures . \n reported two studies which comprised of keratoacanthoma and squamous cell carcinoma patients and emphasized whitish unstructured zones on dermoscopy . \n in addition , white rings , targetoid hair follicles , central keratin accumulations and hairpin vessels are more likely to be seen in squamous cell carcinoma and keratoacanthoma . \n milky pink zones , linear irregular vessels and branching vessels were also demonstrated in merkel cell carcinoma . in case 1 , yellowish - white zones were surrounded by crown like shaped branching vessels . \n although streaks had n't been reported in cases out of pilomatrixoma , they could be seen in figures of some articles about merkel cell carcinoma . linear irregular vessel and \n two articles about merkel cell carcinoma which comprised of 10 and two cases also demonstrated these linear irregular vessels in all subjects . \n hairpin like vessels on the other hand , are commonly seen in nonmelanocytic lesions such as seborrheic keratosis , keratoacanthoma and squamous cell carcinoma . \n yellowish - white structures together with streaks , linear irregular vessels and hairpin like vessels are supportive dermoscopic findings of pilomatrixoma those are located on the skin however this is not enough for definitive diagnosis .", "role": "user" }, { "content": "pilomatrixoma is a benign soft tissue neoplasm originated from follicular matrix of hair and is also known as malherbe 's calcified epithelioma . \n some lesions are located on the skin and are usually misdiagnosed . \n a small number of patients had been dermoscopically examined . in this article , \n three patients of pilomatrixoma who had three different dermoscopic views were evaluated and discussed in concordance with the literature .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the timing when a neuron receives its incoming input has a great influence on how the input is processed and how it affects the postsynaptic neurons . on the other hand , \n an increase in the body size and the amount of information processed , as a result of evolution , inevitably required the expansion of the brain ( finarelli and flynn , 2009 ; jerison , 1955 , 1961 , 1973 ; laughlin and sejnowski , 2003 ) . \n this resulted in situations where the excitation of a presynaptic neuron needs to arrive within a fixed window of time at target neurons located at multiple remote sites at variable distances . \n such apparently paradoxical transmissions , in fact , take place in various regions of the brain . \n some representative examples of such isochronicity can be observed in olivocerebellar connections ( lang and rosenbluth , 2003 ; sugihara et al . , 1993 ) , transcallosal connections in the visual cortex ( innocenti , 1995 , 2009 ; \n innocenti et al . , 1994 ) , amygdalo - cortical pathways ( pelletier and pare , 2002 ) , and still others that will be discussed later on . \n intriguingly enough , these connections do not necessarily adopt the same strategy to accomplish isochronicity . \n recently , we found that the thalamocortical pathway also exhibits the isochronic property , but with a novel mechanism , which involves differential myelination along the axon ( salami et al . \n apparently this is an exquisite way of producing isochronicity and may apply to other systems . in this brief review , we will first survey how this is achieved in the thalamocortical pathway , and then discuss other isochronic pathways for comparison . \n neurons in the thalamus send axons to a wide area of the somatosensory cortex through different trajectories of various travelling lengths . \n nevertheless , we reported that action potentials in the thalamic cells arrive almost simultaneously at each target cortical cell in layer iv . by using thalamocortical slices in which connection from thalamus to cortex were kept intact , epsps were recorded from layer iv cells in response to the stimulation of multiple sites such as thalamus , white matter ( wm ) , and intracortical sites between wm and layer iv . \n this allowed us to measure the conduction velocity of each part of the axon while action potentials were travelling down the thalamocortical fibers . \n we found that the isochronicity in this system is achieved by changing the conduction velocity ( cv ) within the individual axons . \n the cv decreases significantly upon entering the gray matter by up to 10-fold ( salami et al . , 2003 ) . originating from the thalamus , \n the axons of relay cells run in a straight path through the striatum up to the wm , at which point each axon diverges widely . \n some ascend directly into the cortex up to layer iv , while others run in the subcortical wm for variable distances before ascending into the cortex . \n although the total distances travelled vary across pathways , the distance of the intracortical regions is almost the same . \n that is , all the projections target the same layer iv in a cortex that has uniform thickness . \n the total conduction time primarily depends on the time spent within the cortex ( gray matter ) . \n thus , the strategy of making the cv of longer and variable parts by far faster than that of shorter and constant parts is a way of eliminating the variability in traversed distances ( figure 1 ) . a schematic illustration of the thalamocortical pathway , showing regional differences in cv . by having a 10-fold faster cv from the vb to the wm ( red lines ) , \n most of the conduction time is spent on the intracortical regions ( dotted lines ) , whose length is generally constant due to the homogeneous structure of the cortex . \n vb : ventrobasal nucleus of thalamus , wm : white matter , hp : hippocampus , cp : caudate putamen , iv : layer 4 [ cited from salami et al . , pnas 100 , 61746179 ( 2003 ) ] . \n first , since cv is proportional to the square root of the axon diameter in unmyelinated axons , to have 10 times larger cv , axon diameter needs to be 100 times larger , which is most unlikely . \n thus , secondly , we suspected that the extent of myelin might cause the observed difference of cv . \n histological staining of the myelin revealed that the difference of myelination between the intracortical and extracortical ( wm ) regions played an important role in the generation of cv difference . \n developmentally , cv difference could be seen after the end of the 2nd postnatal week . at this time there is practically no myelination observed in the grey matter , while thalamus to white matter portions are already heavily myelinated ( salami et al . , 2003 ) . \n since this was only a light microscopic observation , em - level confirmation remains to be done , however . \n this intra - axonal , segmental difference is well - suited to influence the difference in cv . \n thus , we hypothesized that difference of myelination plays a major role in creating isochronicity . \n in other words , myelination is not merely insulation among neighboring cells , but is a method of regulating the timing of postsynaptic activations . a change in the cv along a given axon has been reported in other regions of the brain . \n the axons of retinal ganglion cells increase their cv from the optic nerve to the optic tract at the point of the optic chiasm , by increasing both their diameter and myelination ( baker and stryker , 1990 ) . similarly in the peripheral nervous system , a fibers supplying mechanoreceptors exhibit serious reduction in the cv upon entering the spinal cord ( traub and mendell , 1988 ) . \n in addition to sensory neurons , motoneurons of the ventral horn increase their sheath thickness and axon diameter upon exiting the spinal cord ( fraher , 1976 , 1978 ) . \n our results indicate that these changes in cv and the associated anatomical changes may well play a role in the regulation of activation timing . \n isochronicity has been reported in other regions of the brain . in rats , axons of the inferior olive innervate widely distributed regions of the cerebellar cortex . \n the conduction time to the different parts of the cerebellum is relatively invariant despite differences in path length . \n an earlier study has shown that longer fibers conduct faster than shorter ones due to differential axon diameters rather than differential myelination ( sugihara et al . , 1993 ) . \n a recent study challenged this view , claiming that myelination plays a primary role in generating a uniform olivocerebellar conduction time ( lang and rosenbluth , 2003 ) . \n interestingly , it has been questioned whether this invariance holds for larger animals , such as cats ( aggelopoulos et al . , 1995 ) , although even in this study the latency of olivocerebellar projections varied only by several milliseconds . \n isochronic property of transcallosal connections is one of the most intensively studied within the framework of the computational properties of axons by innocenti and his group ( innocenti , 1995 , 2009 ) . \n based on the simulation of action potential propagation determined by axonal diameter , these authors provided a detailed description of strategies for callosal connections to achieve synchronous activation of their targets ( innocenti et al . , 1994 ) . \n in the cortex , layer v pyramidal neurons project to various subcortical regions as well as to the contralateral side . \n one recent study showed that layer v pyramidal neurons in the ventral temporal lobe innervate diverse regions such as the caudate putamen , parietal cortex , amygdala , and thalamic nuclei on the ipsilateral side with isochronic spike delivery based on the differential cvs in each fiber branch ( chomiak et al . , 2008 ) . by combining the actual measurement of the axonal inner and outer diameters , with theoretical predictions based on partial myelination , the observation of chomiak et al . \n it may be worth mentioning that the same neurons send axons to the contralateral side through the corpus callosum , but the cvs were significantly slow and not isochronic with ipsilateral connections . \n the lateral amygdala is believed to play an important role in establishing fear memory in cooperation with the perirhinal cortex through hebbian synaptic interactions , where the timing of synaptic input is important . \n the perirhinal cortex is an elongated structure as compared to the rather small nucleus of the lateral amygdala . \n electrophysiological experiments have revealed that the lateral amygdala is isochronically connected with a large portion of perirhinal cortex ( pelletier and pare , 2002 ) , but the mechanism of this isochronic connection is yet to be elucidated . \n although brain and body sizes increase during development , the conduction times of certain connections remain constant . one study in humans \n has revealed that the somatosensory and motor conduction times remain constant even after 2 years of age , despite substantial increases in the axon length that occur with body growth ( eyre et al . , 1991 ) . \n experiments in animals investigated the rubrospinal tract in cats ( song et al . , 1995 ) , and revealed that the conduction time from the red nucleus to l1 reached the minimum adult level at p30 , when the spinal cord is only half the adult length . \n cv increased linearly from e59 to p30 ( from 134 m / s ) . since myelination of the rubrospinal tract \n was believed to have begun before e59 , the adult level conduction time was achieved mainly by myelination until p30 , then thereafter , axon diameter was increased so as to keep the constant conduction time as the axon length increased . \n thus , these authors proposed that compensatory interaction of myelination and axon diameter led to the isochronic conduction during development . in other systems , however , myelination is unlikely to be involved in isochronicity during development . \n the locus coeruleus ( lc ) in the dorsal pons sends axons widely throughout the brain including the frontal cortex , but latencies remain constant throughout life ( nakamura et al . , 1987 ) , even when the size of the brain increases to more than 2 times its original size . since axons of the lc consist of c fibers lacking myelin , \n one implication from these studies is that each pathway has its own conduction time , which might be determined by its function . \n myelination , axon diameter , and other factors such as the structure , or the number of spacing of ranvier nodes , and ion channel composition and/or its density , all of these would affect the cv , and conduction time may be employed to achieve its characteristic value . on the other hand , since the environment around a given neuron , or tissue , or whole individual continuously changes , a regulatory mechanism that changes in an input- or activity - dependent manner is desirable to adapt to the changing environment . \n myelination indeed changes in an experience- or input - dependent manner . in dark - reared mice , \n the number of myelinated axons in the optic nerve decreased ( gyllensten and malmfors , 1963 ) . \n similarly , premature eye opening in rabbit reduced the expression of myelin ( tauber et al . , 1980 ) . \n a diffusion tensor imaging study revealed that extensive piano practicing in childhood results in a thicker white matter , which is believed to be due to a change in myelination ( bengtsson et al . , 2005 ) . \n several lines of evidence have identified how action potentials regulate myelination . a specific pattern of neural activity was shown to lower the expression of l1-cam ( itoh et al . , 1995 \n ) that is necessary for myelin induction by oligodendrocytes ( barbin et al . , 2004 ) , as well as by schwann cells ( stevens et al . , 1998 ) . \n in addition , atp released from axon terminals as a result of neural activities facilitates the differentiation of oligodendrocytes through adenosine and p1 receptors . for astrocytes \n , atp causes the release of leukemia inhibitory factor ( lif ) , which then stimulates myelination by oligodendrocytes ( ishibashi et al . \n a classical view on myelin thickness is that the thickness of myelin sheath is closely related with the axon diameter . theoretically , optimal or fastest cv \n is provided when g - ratio is 0.65 , where g - ratio is defined as the axon diameter divided by total fiber diameter . \n although it is generally true that axons conforming to this g - ratio is widely observed , it is also true that there are still others with large variation in g - ratio around the mean , and considerable differences are seen between fibers ( berthold et al . , 1983 ) . \n in fact , optic nerve axons have uniform diameters , but exhibits five different cvs . \n similarly , as mentioned before , multiple cvs along the same fiber were reported from other studies ( baker and stryker , 1990 ; traub and mendell , 1988 ) . \n if as we discussed earlier , each pathway has its own conduction time , and if myelination changes in an input - dependent manner to adapt to environment , it seems reasonable to propose that the difference of the extent of myelination may be the result of adaptation whereby myelination influences its own conduction time . \n the issue of isochronicity has actually a long history and has been demonstrated also in invertebrates . among the oldest of these examples are the classical studies on the squid giant axons . \n conduction time of the giant axons between the stellate ganglia and the mantle musculature is such that activation of the whole mantle takes place synchronously , allowing effective escape to occur . \n this is achieved by faster cv for longer axons , by changing axon diameters ( young , 1939 ) exclusively . \n that is because invertebrates do not have myelination with which the cv could be enormously ( 100 times ) increased . in other words , \n it appears quite reasonable to think that vertebrates would exploit these strategies independently . in electric organs of a certain kind of fish , synchronous activation of electrocytes to produce larger electrical potentials \n is attained by two mechanisms ; first , same as squid axon , faster cv for longer pathways , and secondly , longer circuitous route for cells closer to the target ( bennett , 1970 ) . \n the avian auditory system is another similar example where circuitous routes are used to compensate for shorter distance . \n the conduction time between the cochlear nucleus and its ipsi- and contralateral nucleus laminaris is matched by lengthening the path to the ipsilateral nucleus , to create a delay line for detecting the differential timing of sound inputs to both ears for sound localization . in these cases , \n we have discussed above , such as olivocerebellar , amygdalo - perirhinal , and corticofugal from ventral temporal cortex , isochronous activations of target cells should have clear temporal advantages . \n however , at this point , how isochronicity is advantageous does not seem obvious in these systems . \n one interesting view is that the olivocerebellar system serves as an intrinsic timing device that is essential for motor co - ordination ( llinas , 1988 ) . \n this view is based on the observation that neurons in the inferior olive are connected by gap junctions and thus exhibit oscillatory activity . \n this is supposed to propagate to a wide territory of the cerebellar cortex , a process for which isochronicity is essential . \n thalamic cells also show oscillatory activities intrinsically ( contreras et al . , 1996 ) that could cause synchronization in the functionally related target cortical cells . \n isochronous or synchronous activation of group of cells distributed in distant cortical locations with zero phase - lag have been shown in visual cortex ( gray et al . , 1989 ) , and callosally connected areas ( engel et al . , 1991 ) \n these findings attracted attention as relevant to the problem of connecting features responsible for object recognition in the spatially fractured nature of sensory representation over the cortical mantle ( llinas et al . \n , 2002 ; singer , 1999 ) and providing the perception of unity ( von der malsburg and buhmann , 1992 ) . for such binding to work correctly \n , isochronous activation of related cells in the global cortical area would be a necessary condition . \n isochronous activation of thalamocortical as well as transcallosal connections provides a physiological and anatomical explanation for these observations . \n synchronous activities may also be appropriate for producing synfire chains ( abeles , 1991 ) . \n another possible explanation for the resultant isochronicity might be , as we discussed before , that each connection has its own characteristic conduction time for information to be correctly processed in the network . \n under such conditions , if postsynaptic target neurons are widely distributed , isochronous conduction will result . \n this is in some sense consistent with isochronicity in the developing brain as we described earlier . during development , \n once a pathway with a characteristic conduction time becomes functional , the specific conduction time presumably needs to be kept constant in spite of the increasing distances subsequent to growth of the body . \n the corpus callosum displays a significant variety in terms of myelination ( aboitiz et al . , 1992 ) . in rats , \n the fraction of myelinated fibers is zeroe at birth , then it gradually increases to 53% at 300 days post - conception ( seggie and berry , 1972 ) . \n similarly in humans , none of the callosal fibers are myelinated at birth , and in adults 30% of the fibers remain unmyelinated . \n in addition , analyses of fiber composition revealed a wide variety of fiber diameters and extent of myelination depending on the target area . \n callosal regions connecting prefrontal and temporoparietal association areas consist of small caliber with low myelinated fibers , whereas regions connecting primary and secondary sensorimotor areas include highly myelinated , large - caliber fibers ( aboitiz et al . , 2003 ) . \n consequently , the conduction time between two hemispheres varies from 30 ms via myelinated axons to as long as 300 ms via unmyelinated ones ( fields , 2008 ) . since callosal fibers connect a variety of cortical regions with various functions , conduction times for each functions are likely to be diverse . the extent of myelination , as well as axon diameter might help regulate the conduction time to its optimal value for communicating between hemispheres . \n this leads to another interesting question ; namely , how the conduction time of each pathway is determined in the network . \n overall , our understanding regarding the time devoted to each step in neural processing is still , unfortunately , severely limited . \n isochronic propagation of information in spite of variable neuronal distances eliminates the limitation of connectional distances , and is permissive for the expansion of the brain . \n this phenomenon is seen widely in various brain regions , and at several phylogenetic levels , as well as during development . \n isochronicity is achieved mainly by differential cvs , either within individual axons or among axons . \n it is suggested that the vertebrates obtained another option in generating differential cvs , that is , changing myelination , in addition to regulating axon diameters . \n the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .", "role": "user" }, { "content": "our brain contains a multiplicity of neuronal networks . in many of these \n , information sent from presynaptic neurons travels through a variety of pathways of different distances , yet arrives at the postsynaptic cells at the same time . \n such isochronicity is achieved either by changes in the conduction velocity of axons or by lengthening the axonal path to compensate for fast conduction . to regulate the conduction velocity , \n a change in the extent of myelination has recently been proposed in thalamocortical and other pathways . \n this is in addition to a change in the axonal diameter , a previously identified , more accepted mechanism . \n thus , myelination is not a simple means of insulation or acceleration of impulse conduction , but it is rather an exquisite way of actively regulating the timing of communication among various neuronal connections with different length .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: optical \n coherence tomography ( oct ) is a low - coherence interferometric \n imaging method which was developed in the 1990s prevalently in the \n area of biomedical diagnostics . \n it generates \n depth scans of samples in a contact - free , nondestructive manner . \n having \n become a standard method for ophthalmologic examinations , within the past decade also applications outside the medical field \n were found , as summarized in a recent review and with a special focus put on polymer science : in contrast to \n biological tissues , polymers usually do not contain water and therefore \n also light in the near - infrared ( nir ) region , which otherwise would \n be absorbed , can be used . with an nir light source at a central wavelength \n of 1550 nm , penetration depths in the millimeter range \n were obtained , \n qualifying oct as a method suited for investigations on a processing \n scale . in the current work , \n we investigate for the first time \n another \n specific application of oct , namely the monitoring of polymer crystallization . \n it is well - known that , upon processing , polymers \n form various structures depending on the prevalent thermal conditions , \n pressure , and deformation . at the same \n time \n , this morphology directly influences the mechanical and optical \n properties of the resultant plastic part . \n considerable research has \n therefore been dedicated to assessing the effect of processing parameters \n on the final properties . \n a number of methods \n are available , starting with the ex - situ analysis of microtome cuts , \n which is still a valuable tool for the characterization of solidified \n samples . \n this can only be accomplished by in - situ \n methods , e.g. hot - stage microscopy , polarimetry , various scattering methods ( light , neutron , and x - ray ) , \n rheo - optical techniques , or dilatometric \n measurements . with these methods , \n structure \n development can be monitored as a function of time , but usually they \n give only an integral or averaged measure of different processes occurring \n in the sample instead of depth - resolved information . \n an ingenious \n idea was presented by fernandez - ballester et al . , who used a set of shear experiments observed via synchrotron \n x - ray scattering and optical retardance to calculate the incremental \n contribution of different shear rates and \n thus in fact obtained depth - resolved \n information . however , apart from the fact that considerable effort \n is necessary to perform a set of synchrotron measurements , like many \n of the previously mentioned methods also this one experiences limits \n if the effects become too complicated , namely with multiple scattering \n in consequence of long shearing times . \n oct , as presented in \n this paper , represents a major advance over \n these conventional methods in two respects : first , it delivers both depth- and time - resolved information in real time out \n of a single measurement , and second , it is not restricted by advanced \n structure development . \n in fact , it even works the better the more \n reflective structures have been formed . \n oct thus enables to extend \n shearing times to more realistic , industrial processing conditions , \n being unaffected by heavy shearing conditions . \n to our knowledge , \n the present investigation represents the first \n time of flow - induced structure development being monitored in situ \n and in a depth - resolved way . \n the principle of oct is based \n on white light interferometry but uses broadband light sources in \n the near - infrared range ( 7001600 nm ) . \n most oct systems \n employ a michelson interferometer , where spatially coherent and temporally \n incoherent light emitted by a light source ( ls ) is split into a sample \n and a reference beam by a beam splitter ( bs ) , as shown in figure 1 . \n the reference beam is reflected by a mirror ( rm ) , \n while the sample beam is focused into the sample and reflected by \n interfaces in the sample , physically spoken by inhomogeneities in \n the refractive index . \n both reflected beams are then recombined at \n the beam splitter . the larger the difference in the refractive index , \n the more light is reflected . \n this gives rise to a measurable quantity , \n the reflectivity r , which is recorded as a function \n of the sample depth z. setup for a fourier - domain \n oct ( fd - oct ) . \n abbreviations : ls = light \n source , bs = beam splitter , rm = reference mirror , s = sample , dg \n = diffraction grating , and lc = line camera . \n the interferometric detection scheme of oct provides high \n sensitivity \n and a high dynamic range , so that extremely small reflections of 10 can be accurately measured even in case of absorbing or scattering media . \n two different \n approaches can be distinguished , namely time - domain \n ( td - oct ) and fourier domain ( fd - oct ) . \n the first one , td - oct , detects \n the recombined beams by a single photodetector . \n only photons contribute \n to the signal which are reflected at a certain depth of the sample \n where the sample path length matches the reference path length . \n the \n second approach , fd - oct , which is shown in figure 1 , analyzes the spectrum of the recombined beam in a spectrometer . \n a diffraction grating ( dg ) splits the beam into its spectral components , \n which are detected by a line camera ( lc ) . by fourier \n transform of \n the measured spectrum , an immediate complete depth - resolved reflectivity \n scan is obtained without the need for mechanical movement of the reference \n mirror . \n though more expensive due to \n the camera , this method is superior in terms of speed and signal - to - noise \n ratio when compared to td - oct \n . additionally , it enables rapid scanning \n at several adjacent positions , in order to create cross - sectional \n images . \n this is usually implemented by deflecting the sample beam \n to different positions on the sample via a small tilting mirror ( galvo \n scanner ) . \n an enhanced variant analyzes the polarization state \n of the reflected \n light , which renders the oct polarization - sensitive ( ps - oct ) . \n a pertinent system has for the first time been \n described by hee et al . ; it uses quarter - wave \n plates to illuminate the sample with circularly polarized light , whereas \n the light exiting the reference arm is rendered linearly polarized \n in 45. combined with the fd approach , a polarization - sensitive \n fourier domain oct ( ps - fd - oct ) is obtained as shown in figure 2 . \n extension of figure 1 for polarization \n sensitivity \n ( ps - fd - oct ) by adding additional components : p = polarizer , qwp = \n quarter - wave plate , pbs = polarizing beam splitter . \n the outgoing signal \n is split in two orthogonally polarized components and recorded by \n two line cameras , corresponding to data channels ch and ch+ ( parallel respectively crossed to the polarizer \n p ) . \n birefringence in the sample causes \n an additional optical retardation \n between the two orthogonal light components , calculated by \n the integral over the birefringence n experienced \n along the optical path until to a sample depth z:1with the analyzed \n beam crossing the sample \n twice ( before and after reflection ) , this optical retardation comes \n into effect twice . in general , the circular polarization of the sample \n beam is changed to elliptical . for detection , \n the signal is split \n by a polarizing beam splitter ( pbs ) in two orthogonally polarized \n components , corresponding to channels ch and ch+ . \n the index refers to the polarizer \n p and gives the parallel respectively the crossed component . \n the reflectivity \n is then obtained by adding the squared signals of both channels:2forming the ratio of both channels gives rise \n to a second quantity , the phase retardation calculated by3denoting the phase shift between \n the two orthogonal \n polarization components . the signals \n ch+(z ) and ch(z ) detected by the cameras are always positive . therefore , \n the calculated phase retardation oscillates between 0 \n and 90 with increasing optical retardation . the total \n phase shift can be calculated by unwrapping . for instance , one full oscillation from 0 to 90 and \n back to 0 corresponds to a total phase shift of 180. analogously , \n multiorder birefringence leading to phase shifts above 360 is \n detected by adding up the contributions of all full oscillations . \n since birefringence is steadily increasing during the experiment , \n phase retardation equally has to grow and the direction is unique . \n oct provides a lateral resolution rlat that is determined by the focusing of the laser spot size on the \n sample , i.e. , by the numerical aperture of the optical system:4with f as the focal length \n of a focusing lens and d the beam diameter . \n the axial \n ( depth ) resolution rax is independent \n of the lateral resolution and proportional to the square of the central \n wavelength c but inversely proportional to the spectral \n bandwidth of the light source:5spectrally broader light sources are therefore \n of advantage . \n a smaller central wavelength c is \n even more effective in improving the resolution but leads to stronger \n scattering and consequently reduces the penetration depth . \n thus , when \n choosing between sources with the same bandwidth , the one with longer \n central wavelength permits deeper penetration on the cost of axial \n resolution . \n with current light sources , axial resolutions in the micrometer \n range can be reached . \n a self - developed polarization - sensitive fourier \n domain oct apparatus ( ps - fd - oct ) is mounted on a shear system in order \n to directly observe crystallization in situ ( figure 3 ) . \n for the light source , a superluminescence diode ( exalos ) \n with a central wavelength of c = 1540 nm and a spectral \n bandwidth of = 55 nm is used , operating in the near - infrared \n range and providing a satisfactory penetration depth of more than \n 1 mm . according to eq 5 , the axial resolution is 19 m in air . assuming an \n average refractive index of n 1.5 for polymer \n materials , the axial resolution obtained within such samples improves \n to rax 13 m . a galvo scanner \n enables fast adjacent depth scans along vertical lines , so that cross - sectional \n in - situ images in a plane perpendicular to the extrusion direction \n are generated . \n spectral analysis is performed by diffraction gratings , \n from which the dispersed spectra are directed to ccd line cameras \n ( ingaas , sensors unlimited ) . \n the recorded spectra are numerically \n fourier transformed to obtain the depth - resolved information . \n our \n system is capable of recording four full cross sections ( 1000 \n 512 pixels ) per second for the in - situ measurements . \n top view of the experimental \n setup : ( a ) oct unit : rm = reference \n mirror , qwp = quarter - wave plate , bs = beam splitter , p = polarizer , \n pbs = polarizing beam splitter , gm = galvo mirror , dg = diffraction \n grating , lc = line camera . \n ( b ) shear unit : v1 , v2 = valves , w1 = front \n window , w2 = rear window . \n ( c ) transmission stage : qwp = quarter - wave \n plate , pbs = polarizing beam splitter , pd = photodiodes . \n the shear unit consists of an extruder , a relaxation \n line , and \n a slit die ( length 120 mm ) of large aspect ratio ( 10 mm 1 mm \n cross section ) , as described by liedauer et al . for short - term shearing experiments . by a special valve \n system ( v1 and v2 in figure 3 ) , \n box - like pressure \n profiles can be applied for extrusion . at the end of the die , \n two \n windows ( w1 and w2 ) are mounted through which the oct sample beam \n is directed . \n light that is reflected by the polymer sample goes back \n through the front window w1 and is analyzed in the oct system , generating \n a reflectivity and a phase retardation signal , both depth - resolved . \n the other portion of light is transmitted through the rear window \n w2 and is analyzed in analogy to former experiments with a polarized , \n monochromatic laser beam : a quarter - wave \n plate compensates for the optical retardation introduced by the sample \n quarter - wave plate , so that the light would be linearly polarized \n if no birefringence were found in the sample . \n subsequently , the signal \n is decomposed into two orthogonally polarized components by a polarization - sensitive \n beam splitter and registered by photodiodes ( ingaas amplified detectors , \n thorlabs ) . from the intensities registered at both diodes , the relative \n intensity of each component \n , one signal is assigned to the relative \n intensity at parallel polarizers i and the other one to the relative intensity at crossed polarizers i+ . \n both are correlated to the \n optical retardation by6provided that the optical \n retardation measured \n in transmission is entirely caused by the sample , i.e. , there is no \n contribution from the windows , it has to be equal to the optical retardation \n measured in reflection at the backside of the sample . \n therefore , this \n transmitted signal can directly be correlated to the phase retardation \n signal from oct . for the experiments \n presented in this paper , isotactic poly(propylene ) ( dm55pharm from \n borealis , linz / austria ) \n the granules are melted in the extruder \n and the die is filled with hot melt at 200 c . after a relaxation \n period of 15 min , the die is quenched with diethylene glycol to a \n temperature of 140 or 145 c ; at these temperatures , the material \n crystallizes only very slowly if left under quiescent conditions . \n after another 15 min for thermal equilibration , shearing is induced \n by resuming extrusion at a constant pressure of 175 or 200 bar for \n a defined period of time ranging from 0 to 200 s , and subsequent structure \n development is monitored by oct and by the transmission signal . \n after \n 40 min of isothermal structure development , the die is cooled to room \n temperature and the sample is extracted . \n microscopic analysis of microtome \n cuts as well as ex - situ oct performed on the bare sample is used for \n verification of the obtained morphology . during extrusion , \n a \n plug flow type of velocity profile develops , characterized by high \n shear rates close to the die walls and nearly zero shear rate in the \n central part of the sample , where flow velocity is highest ( figure 4a ) . using a cartesian coordinate system , \n there is \n one prominent axis x1 , given by the extrusion \n direction . for optical characterization , \n the other axes are x2 , which is the direction of the velocity gradient , and x3 , the neutral direction , which is perpendicular \n to the small side walls of the die . \n flow velocity v and shear \n rate \n profile in a slit die , with coordinate axes x1 and x2 . \n ( a ) plug flow type profile without solidification ; ( b ) cutoff \n profile after narrowing of the channel due to solidification at the \n die walls . \n shearing leads to the alignment \n of molecules in the x1 direction and therefore \n enhances crystallization ; especially \n for poly(propylene ) , it is well - known that different morphologies \n develop : with very high shear rates , so - called \n shish - kebabs are found , which are highly birefringent . with the shear \n rate profile decreasing and leveling off toward zero , \n also this morphology \n changes to a spherulitic one , as would be found under quiescent conditions . \n in between the fully spherulitic core and the highly oriented layer , \n a transition region \n is found which is usually called the fine - grained \n layer due to its appearance under the optical microscope . \n typical \n morphologies as observed on microtome sections under the polarization \n microscope are depicted in figure 5 . \n they have \n been cut in the x1x2 plane , so that this figure is analogous to figure 4 . \n morphologies of samples produced at 145 c and 175 \n bar , cut \n in the x1x2 plane . \n holes in the microtome cuts result from the final \n stage of crystallization due to the constraints built by the solidified \n surroundings . \n shearing times : ( a ) 50 , ( b ) 100 , ( c ) 150 , and ( d ) 200 \n s. naturally , as soon as some of \n the material has solidified on the \n die walls in form of one of these morphologies , the flow cross section \n deceases \n . however , by extruding at constant pressure , the shear rate \n profile in the still flowing part does not change . \n only the velocity \n profile is cut off , i.e. , its shape remains constant , but the boundary \n condition v = 0 is shifted with the solidification \n front toward the central part of the die ( figure 4b ) , leading to a reduced overall velocity . for oct measurements , \n the laser beam is aligned to the x2 axis , \n which therefore coincides with the sample \n depth , and is circularly polarized in the x1x3 plane . \n lateral scanning is \n performed in this experimental configuration along the x3 direction for in - situ oct , leading to images oriented \n in the x2x3 plane . for ex - situ oct \n , the lateral scanning direction can \n freely be chosen either in the extrusion direction x1 or perpendicularly as in in - situ oct . in both cases , \n the ellipticity of the reflected beam represents the corresponding \n anisotropy of the refractive index n1 n3 = n13 . \n in contrast , microtome cuts are prepared in the x1x2 plane , and accordingly \n the contrast of the transmission polarization microscopy arises from \n n12 . \n however , due to the radial \n symmetry of the individual crystalline structures in the x2x3 plane , both results \n can directly be compared and correlated to each other . \n flow - induced \n structure development \n can effectively be observed in a depth - resolved way in oct reflectivity \n images . \n figure 6 shows a sequence of in - situ \n images taken at different times ( 0 , 50 , 148 , 300 , 600 , and 1460 s ) \n after the beginning of shearing . \n the temperature was 140 c and \n the extrusion pressure 200 bar , leading to a wall shear rate of 25 \n s. with the shearing time being 150 s , the first \n three images are taken still during the shearing period . \n the two limiting \n bright lines in each image represent the interfaces between the windows \n and the polymer , which is enclosed in between them . \n the extrusion \n direction x1 is perpendicular to the image \n plane , the velocity gradient x2 vertical \n in the image plane , and the neutral direction x3 horizontal in the image plane . in - situ \n oct reflectivity \n images taken at different times t : a = 0 , b = 50 , \n c = 148 , d = 300 , e = 600 , and f = 1460 \n s after the beginning of shearing . \n temperature 140 c , extrusion \n pressure during shearing 200 bar , shearing time 150 s. a wall shear \n rate of 25 s was calculated . \n the growth of structures is clearly visible already in the \n second \n image , taken 50 s after the beginning of shearing . \n obviously , in the \n beginning crystallization does not proceed homogeneously along the \n neutral direction . \n only after the end of shearing , a more or less \n straight front is formed ( cf . \n the structures that \n develop are not necessarily permanent , especially as long as flow \n persists : it is a regular phenomenon that parts adhere to the wall \n for a while , but then are ripped off by flow again . \n flow must thus \n be attributed both a constructive as well as a destructive effect \n on structure development . with milder shearing conditions or \n no shearing at all , also other \n morphologies can be observed . as an example \n they have been obtained \n at a temperature of 140 c , an extrusion pressure of 175 bar , \n and a rather short shearing time of only 5 s. not all of these spherulites \n are in a fixed position yet ; especially those in the center of the \n sample are still moving . with such flowing particles the original \n model assumption of a flowing continuum is no longer valid , and also \n nonlinear flow patterns are observed . \n spherulites represent also rewarding \n objects for related oct techniques , as recently demonstrated for the \n example of polarization - sensitive full - field optical coherence microscopy \n ( ps - ff - ocm ) . \n features directly visible \n in oct reflectivity images : ( a ) spherulites , \n ( b ) voids , ( c ) linearly shaped structures . \n ( a ) and ( b ) were acquired \n in situ in a direction perpendicular to the extrusion direction ; ( c ) \n was recorded ex situ in extrusion direction . \n figure 7b shows voids , another feature \n visible \n in reflectivity . the refractive index within the voids ( n = 1 ) shortens the optical path length , so that the rear window appears \n shifted upward below them . \n this image is a good example for the advances \n obtained with oct : for measurements in transmission , voids represent \n strongly backscattering obstacles and destroy the measurement signal , \n so that analysis of such structures could not be performed at all . \n a further interesting feature is visible in the ex - situ oct image \n presented in figure 7c : in contrast to the \n typical in - situ images , where flow is perpendicular to the paper plane , \n this image was scanned in the extrusion direction , which is now horizontal . \n linear structures are clearly visible , prevalently close to the sample \n surface , which are most probably related to a shish - kebab structure \n or any other threadlike morphology generated by high shear rates . so far several phenomena \n have been shown for the first time to be directly observable in reflectivity \n images . furthermore , our equipment is also polarization - sensitive . \n in the resulting retardation images , the phase retardation as calculated \n by eq 3 \n for the sample in the melt state , there are no reflective \n points at all , and birefringence becomes visible only at the rear \n window , which represents a reflective interface throughout the whole \n experiment . \n figure 8 shows the development \n of phase retardation as a function of time , as detected at the rear \n window . for that purpose , \n the pixels forming the rear window have \n been extracted from ps - oct retardation images . \n each horizontal line \n corresponds to a different monitoring time , starting with shearing \n ( top line ) and ending 200 s after the beginning of shearing ( bottom \n line ) with intervals of 2 s. the experiment is the same as shown in \n figure 6 . \n ideally , retardation should change \n synchronously over the whole image width , which coincides with the \n neutral direction . \n however , the experiment shows some deviations ; \n they correspond to the nonuniformity of the crystallization process \n in figure 6 . \n still , three half - cycles in phase \n retardation change from blue ( 0 ) over red ( 90 ) back to \n blue and once again to red are clearly visible , corresponding to a \n total change of 270. for later times ( not shown in the figure ) , \n depolarization occurs , leading to some mixture of retardation values \n in a broader range . for determination of absolute values , the mean \n value of each line is taken . by this procedure , the time evolution \n of the total phase retardation can be calculated , which is shown in \n figure 8b . \n ( a ) phase retardation as a function of \n time , as detected at the \n rear window . for the graph , \n the respective pixels have been extracted \n from ps - oct retardation images and plotted as rows with time as the \n vertical coordinate . \n ( b ) phase retardation \n profile as a function of time , calculated by the mean values of each \n row in ( a ) . by summing up the phase retardation of each half - cycle , \n . an analogous change of retardation is found in \n the retardation \n images , but now as a function of sample depth . \n figure 9 shows an image and its phase retardation profile , again obtained \n by forming the average of all reflective points per line . \n phase retardation \n is clearly increased by the solidified structures , which therefore \n must be birefringent . \n the area in the center of the sample is nonreflective , \n so the profile does not show any relevant information here , but for \n the rear window the phenomenon can equally be observed . by using phase \n unwrapping and calculating the derivative of the unwrapped retardation \n over depth , even quantitative access to the birefringence depth profile \n is gained . \n ( a ) phase retardation as a function of \n sample depth , as directly \n visible in retardation images . \n ( b ) phase retardation profile as a function \n of sample depth , derived from the mean values of all significant points \n of each row in ( a ) . for the central , nonreflective part \n temperature 140 c , extrusion \n pressure during shearing 200 bar , shearing time 200 s , recorded 216 \n s after the beginning of shearing . with this ability to directly reveal information on the birefringence \n of structures , \n this is shown in figure 10 , where a weakly sheared sample ( 140 c , 200 bar , 25 s ) is directly \n compared to a heavily sheared sample ( 140 c , 200 bar , 150 s ) . \n the different morphology is clearly visible in the microtome cuts \n produced afterward from the solidified samples , exhibiting only a \n very thin highly oriented layer , but a broad fine - grained layer with \n mild shearing ( figure 10a ) . \n quite the opposite \n is seen in the strongly sheared sample ( figure 10c ) , which shows only a highly birefringent layer directly neighboring \n the spherulitic core morphology . in the ps - oct images analogous \n information \n is found : phase retardation changes from blue ( at the front window ) \n to cyan or green in the weakly sheared sample , corresponding to \n = 4560 , whereas in the strongly sheared sample \n it changes to red ( = 90 ) and then even back to green \n already shortly after the front window . \n the phase retardation profile \n ( figure 10b ) emphasizes the difference . from \n the slopes of the lines indicated in figure 10b \n , a mean value for the birefringence can be calculated with n 4 \n 10 and 3 10 for the \n fine - grained and the highly oriented structure , respectively . \n consequently , \n ps - oct enables differentiation between the two morphologies on the \n basis of their birefringence even in situ during the formation of \n such structures . \n comparison of ( a ) a weakly sheared sample ( 140 c , \n 200 bar , \n 25 s ) with ( c ) a heavily sheared sample ( 140 c , 200 bar , 150 \n s ) . for both measurements , a microtome cut and the front window region \n of the oct retardation image are shown . in \n ( b ) the respective phase \n retardation profiles are given , exhibiting different degrees of birefringence \n ( with lines as guide to the eye , indicating the initial slopes ) . \n in addition to \n the measurement by ps - oct , optical retardation was also monitored \n by analysis of the transmitted light . \n this information is in principle \n equal to the one obtained at the rear window ( cf . \n however , while ps - oct returns the phase retardation \n according to eq 3 , transmission measurements \n give the optical retardation via the relative intensity at \n crossed polarizers i+ and at parallel polarizers i according to eq 6 . by inserting the extreme \n values of = 0 or 90 the correlation of both methods \n becomes more obvious : for = 0 , i+ is 0 and i is 1 . \n for = 90 , both i+ and i reach \n a value of 0.5 ; i.e. , they show a crossover . \n consequently , figure 11 shows for validation a comparison of the mean \n value of the phase retardation , as obtained from the rear window , \n with the relative intensity signals registered in the transmission \n stage . \n those with the longer \n shearing times ( 150 and 200 s ) exhibit clear maxima in phase retardation , \n which correspond to = 90 , a value which is however not \n fully reached due to depolarization and averaging over lateral inhomogeneities . \n the maxima coincide perfectly with the first crossover in the relative \n intensities , as indicated by vertical lines . \n measurements with shorter \n shearing times ( 50 and 100 s ) do not reach a phase retardation approaching \n 90 , correspondingly avoiding a crossover in the relative intensities , \n too . with these results , ps - oct \n is proven to substitute also the transmission \n measurements , besides delivering in addition depth resolved information \n as shown in figure 10 . \n mean value of phase \n retardation from ps - oct ( top ) and relative \n intensities in transmission measurements ( bottom ) , both versus time \n with 0 = beginning of shearing . \n for the two longest shearing times , \n in phase retardation pronounced maxima are found which coincide with \n a crossover in the relative intensities , as indicated by the two vertical \n lines . \n for the shorter shearing times , due to the formation of more \n depolarizing structures neither a clear maximum in phase retardation \n nor a crossover in the intensities is found . \n temperature 145 c , \n extrusion pressure during shearing 175 bar , shearing times as indicated \n in the legend . in a qualitative comparison , \n the retardation and relative intensity \n curves in figure 11 run synchronously as long \n as shearing persists ; then they split . \n the first maximum in the phase \n retardation and crossover in the relative intensities is the earlier , \n the longer the shearing time ; i.e. more birefringent structures are \n formed , being also at the same time of less depolarizing nature , as \n indicated by the more pronounced maxima in both types of curves . \n the results presented \n above demonstrate for the first time that \n oct is ideally suited for monitoring in situ the growth of structures \n due to shearing or even in the quiescent melt . \n however , knowing there \n are different morphologies dependent on the local shear rate , the \n method seems for the chosen wavelength region indifferent with respect \n to the type of morphology . \n in fact , oct is sensitive in the reflectivity \n images on both the highly birefringent and the fine - grained \n layer , although slight differences in the degree of reflectivity can \n be detected in the ex - situ images , as shown in figure 12 : here , a microtome cut under the polarization microscope \n is compared with an ex - situ and an in - situ image of the same sample . \n the in - situ image has been taken at the end of the isothermal crystallization \n period , so that shear - induced structure development is basically finished \n and the image can be compared with the two others . \n all images have \n been scaled to equal size ; the red lines indicate the border of the \n structures visible in oct . \n comparison of ( a ) a microtome cut with ( b ) \n ex - situ and ( c ) in - situ \n oct reflectivity images . \n the structure detected in oct corresponds \n to both the highly oriented and the fine - grained layer , with a slight \n difference in the degree of reflectivity being detectable ( marked \n by arrows ) . by ps - oct , samples exhibiting \n exclusively either the fine - grained \n or the highly oriented layer can clearly be differentiated , as has \n been demonstrated by figure 10 , where the difference \n in the change of phase retardation is clearly visible . \n also , the agreement \n with measurements in transmission is evident ( figure 11 ) . \n for differentiation of the layers within the same sample , \n the depth resolution of the current setup is too low and values derived \n directly from ps - oct suffer considerable scattering . \n this is also \n a drawback of the reflectivity images shown , which becomes evident \n especially on comparison with the microscope . \n however , depth resolution \n depends strongly on the light source , as specified by eq 5 ; it might be crucially improved by measurements at a shorter \n wavelength . \n development of advanced light sources , especially with \n broader bandwidth , should therefore be able to further increase the \n potential of oct .", "role": "user" }, { "content": "by application of optical coherence \n tomography ( oct ) , an interferometric \n noncontact imaging technique , the crystallization of a supercooled \n poly(propylene ) melt in a slit die is monitored . \n both the quiescent \n and the sheared melt are investigated , with a focus on experiments \n where solidification and flow occur simultaneously . \n oct is found to \n be an excellent tool for that purpose since the resultant structures \n are strongly scattering , which is a prerequisite for application of \n that method . \n the resulting images enable for the first time to directly \n monitor structure development throughout the whole experiment , including \n final cooling to room temperature . by rendering the setup polarization - sensitive , \n information on the birefringence of the pertinent structures \n is obtained .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: changes in balance , mobility , and muscle strength are associated with aging and interfere \n with performance of activities of daily living and functional capacity . \n functional \n activities such as walking remain critical in the elderly population because of loss of \n mobility and muscle strength , which may increase the risk of falls1,2,3 . \n muscle strength starts to decrease early in the life span , with losses of about 1215% per \n decade after 50 years of age4 , and this \n figure might be as high as 50% in people above 80 years of age3 . \n the importance of balance , mobility , and muscle strength to \n maintenance of functional capacity within the complex scenario of aging is already \n known5 . \n the older population may present \n with functional impairment earlier than 70 years of age because of the decline in different \n physical aspects . \n the decrease in temporal nature of many intricate physical aspects during \n the aging process needs to be identified as soon as possible to avoid important functional \n losses . \n knowledge concerning the functional profiles of age - stratified groups of elderly people \n would provide a better approach to the maintenance of functionality and the prevention of \n falls and functional dependency through public health programs . \n we intended to \n achieve this by comparing physical performance , balance , mobility , and muscle strength in \n age - stratified groups of elderly people . \n the study included 152 ( 56 men , 96 women ) participants ranging from 60 to 96 years of age . \n the inclusion criteria were \n subjects who were 60 years of age or older ; had a minimum score of 18 on the mini - mental \n state examination ( mmse ) , indicating normal cognitive status6 and had the capability to walk with or without any support \n accessories such as a cane or walker , excluding wheelchairs . \n the participants were recruited at the \n physiotherapy and geriatrics outpatient facility , hospital das clnicas da faculdade de \n medicina da usp and were divided into 3 age - stratified groups : g1 ( 60 to 69 years ) , g2 ( 70 \n to 79 years ) , and g3 ( 80 years or older ) . the same trained professional collected data from \n the participants for the clinical and sociodemographic characterization and performed all \n the assessments for each participant in the same sequence as bellow , with no time interval \n between them , taking from 25 to 45 minutes per participant . \n this cross - sectional , \n exploratory and descriptive study was approved by the local ethics committee , comisso de \n tica para anlise de projetos de pesquisa do hcfmusp ( cappesq , 0968/2007 ) . \n assessment of physical performance the short physical performance battery ( sppb ) was used \n to evaluate the static balance when standing , gait speed at a regular pace , and a movement \n consisting of sitting down and standing up7 . \n performance was measured by the time spent during each test , with \n scores ranging from 0 to 4 . the total score on the sppb \n is obtained by adding together the \n scores of each test ; it ranged from 0 ( the worst performance ) to 12 points ( the best \n performance ) . \n assessment of mobility the timed up and go ( tug ) test was used to assess functional \n mobility and dynamic function8 . \n an \n execution time of 10 seconds is assumed as the standard performance , while a time between 11 \n and 20 seconds indicates frailness or disability and a time of over 20 seconds indicates an \n important mobility injury . \n assessment of balance the berg balance scale ( berg ) was used to evaluate static and \n dynamic functional balance , with high specificity to predict people with an increased risk \n of falling by means of a scale of 14 items associated with specific functional tasks9 . \n the total score ranges from 0 to 56 points , \n representing the range of worst to best performance respectively . \n assessment of lower limb muscle strength leg press equipment was used to determine the \n maximum muscle strength using the one - repetition maximum ( 1-rm ) for triple extension of the \n lower limbs . \n the test was performed by progressive raising of load , beginning with \n approximately 50% of the load that would be used in the first attempt . the participant \n needed to perform the complete range of extension of the lower limb with no hyperextension \n of the knee to qualify the attempt . for each load tested , 3 qualified attempts were required \n to determine the load corresponding to the 1-rm . \n the minitab 15.1 software ( minitab , state college , pa , usa ) was used to perform statistical \n analysis . \n descriptive analysis was performed to characterize the 3 groups . to determine the \n differences between groups and gender , two - factor ( group and gender ) analysis of variance \n with tukey s test as a post hoc test or , when appropriate \n , the kruskal - wallis test with \n bonferroni correction was used to compare the 6 subgroups comprised of the 3 original \n age - stratified groups ( g1 , g2 and g3 ) divided by gender . \n the clinical and sociodemographic characteristic of the studied population are shown in \n table 1table 1 . \n the sociodemographic and clinical data of the study population ( n=152 ) by age \n groupgroupscharacteristics g1 ( n=53)g2 ( n=65)g3 ( n=34)gender n ( % ) female31 ( 58.5)42 ( 64.6)23 ( 67.6)male22 ( 41.5)23 ( 35.4)11 ( 32.4)anthropometric data ( meanstandard deviation)weight ( kg)71.213.368.313.060.311.8height ( cm)161.69.4156.49.5153.46.2bmi ( kg / cm)27.24.127.94.925.54.2marital status ( % ) single11.37.714.7married73.646.220.6widower15.144.658.8divorced-1.55.9schooling ( % ) illiterate1.96.2 - 1 to 7 years of study28.343.158.88 years of study15.112.317.69 to 10 years of study3.8 - 5.911 years of study18.910.82.9 > 11 years of study32.127.714.7comorbiditiesnumber of diseases3.11.93.72.13.52.1number of drugs3.42.84.94.14.92.9number of hospital admissions0.10.30.20.50.30.8falls ( meansd)number of falls 0.71.11.01.21.51.7 . \n female participants were predominant in the 3 groups ( g1=31 male , 53 female \n [ 58.49% ] ; g2=42 male , 65 female [ 64.61% ] ; g3=23 male , 34 female [ 67.64% ] ) . the descriptive \n statistics of the tests are shown in table \n 2table 2 . \n descriptive statistics of the sppb , berg , tug , and leg press teststestgroupgendermedian ( min - max)mean ( sd)sppbg1f11 ( 012)m11.5 ( 612)g2f11 ( 1012)m12 ( 712)g3**f9 ( 612)m12 ( 712)bergg1f56 ( 5056)m56 ( 3056)g2f52.5 ( 2956)m55 ( 4456)g3f47 ( 4756)m51 ( 4056)tug*g19.03 ( 0.31)g29.94 ( 2.67)g313.67 ( 6.79)leg press*g174.15 ( 25.41)g261.38 ( 24.30)g339.41 ( 21.12 ) * no interaction between group by gender , p>0.6 ; * * p=0.027 . \n * no interaction between group by gender , p>0.6 ; * * p=0.027 comparison by gender for the entire population ( g1 , g2 , and g3 ) using kruskal - wallis test \n showed differences in sppb and berg distributions ( sppb , p=0.016 ; berg , p=0.030 ) . \n pairwise \n comparisons after bonferroni correction showed differences between g1 and g3 ( sppb , p=0.001 ; \n berg , p=0.009 ) and g2 and g3 ( sppb , p=0.001 ; berg , p=0.009 ) for women . \n analysis of variance of leg press and square root of tug scores showed the effect of group \n ( tug , p=0.002 ; leg press , p<0.001 ) and gender ( leg press , p<0.001 ) . \n as no interactions \n between group by gender ( tug , p=0.494 ; leg press , p=0.556 ) were found , pairwise comparisons \n among levels of group were performed and showed that tug scores decreased in comparisons \n between g1 and g3 ( tug , p=0.001 ; leg press , p<0.001 ) and between g2 and g3 ( tug , p=0.020 ; \n leg press , p=0.008 ) . \n this study aimed to compare physical performance , balance , mobility , and muscle strength \n among 152 elderly volunteers from 60 to 96 years old divided in age - stratified groups . \n we \n used the sppb , berg , tug test , and leg press test to compare elderly people at their 60s , \n 70s and above 80s . \n the assessments were compared by gender for the entire population , and \n pairwise comparisons were used to show differences between groups . \n the results of our study showed that elderly people in their 60s and 70s had similar \n functional characteristics ( physical performance , balance , mobility , and muscle strength ) \n for both genders and that these characteristics started to decline in the elderly people in \n their 80s . \n the aging process leads to sarcopenia , with affects about 13 to 24% of elderly \n people in their 60s and 70s and more than 50% of the elderly in their 80s11 . \n these alterations of muscle tissues were \n associated with muscle stiffness , poor muscle recruitment , compromised balance , and \n compromised functional capacity12 , 13 . \n the prevalence of falls among elderly \n people in their 80s in brazil is higher than for elderly people in their 60s and 70s which \n may be caused by the decline in functionality14 . \n prevention programs have shown a positive impact on maintenance of \n functionality , and the practice of getting regular physical activity promotes physical \n fitness , functional autonomy , and healthy aging15 , \n 16 . \n the results of our study highlight \n the importance of applying specific programs to motivate elderly people in their 70s and 80s \n to become physically active and delay functional losses . women in their 70s show a significant decline in functionality ( physical performance and \n balance ) compared with men of the same age . \n elderly women display greater loss of muscle \n mass and muscle strength , and these losses predispose women to develop frailty syndrome . \n furthermore , there are more elderly women worldwide than men , and the physical disabilities \n occur frequently in women17 . \n thus , women \n have a higher life expectancy than men and are predisposed to losing the protective factor \n of social support for the prevention of functional and psychological disability . \n this study addressed important issues concerning physical decline to alert health \n professionals about the need for attention in prevention programs for elderly people . \n the \n practice of regular physical activity improves the level physical activity and helps elderly \n people to maintain and/or improve functional capacity , thus enabling healthy aging . \n it is recommended \n that further multidisciplinary studies be undertaken to check other components such as \n psychological issues . \n it \n is unknown if elderly people in their 60s and 70s have similar functional characteristics \n ( physical performance , balance , mobility , and muscle strength for both genders ) due to \n performance of exercises or not . \n future studies are needed to verify the influence of \n physical activities among age - stratified groups of elderly people .", "role": "user" }, { "content": "[ purpose ] the aim of this study was to verify the decline in functionality of elderly \n people . [ subjects and methods ] the study subjects comprised 152 individuals ( 96 women ; 56 \n men ) divided into 3 groups : g1 ( 60 to 69 years , n=53 ) ; g2 ( 70 to 79 years , n=65 ) ; and g3 \n ( 80 years or older , n=34 ) . \n physical performance , balance , mobility , and muscle strength \n were assessed using short physical performance battery ( sppb ) , berg balance scale ( berg ) , \n timed up and go ( tug ) test , and leg press test , respectively . \n comparison among \n age - stratified groups ( g1 , g2 and g3 ) and between genders were examined using analysis of \n variance with tukey s test as a post hoc test or the kruskal - wallis test with bonferroni \n correction . \n [ results ] sppb and berg scores decreased significantly in comparison between \n g1 and g3 , and between g2 and g3 in women . \n tug and leg press scores decreased \n significantly in comparison between g1 and g3 and between g2 and g3 . \n [ conclusion ] people \n in their 60s and 70s have similar functional characteristics ( physical performance , \n balance , mobility and muscle strength for both genders ) , and functionality starts to \n decline when people are in their 80s .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: hemiarthroplasty advocates indicate ease of implantation , reduced blood loss , a lower dislocation rate , and the ease of acetabular revision when compared with conventional total hip arthroplasty ( tha ) [ 13 ] . \n historically , surgeons have advocated the use of hemiarthroplasty for the treatment of degenerative arthritis , fracture , or avascular necrosis ( avn ) of the hip based primarily on relatively young patient age and the benefit of preserving the acetabular bone stock for future anticipated surgeries . with the availability of newer technologies such as hard on hard bearings ( metal on metal , ceramic on ceramic ) , highly cross - linked polyethylene , and resurfacing arthroplasties \n , one may consider whether hemiarthroplasty in younger patients is an operation of the past . \n many patients needing hip arthroplasty suffer from hip osteonecrosis , often historically referred to as avn , of the femoral head . \n the clinical diagnosis of osteonecrosis is often a general one associated with multiple other conditions and with many features of hip osteoarthritis ( oa ) in its late stages , thus making large patient series difficult to accumulate and even more difficult to compare . \n studies such as wroblewski et al . had a series of 49 patients identified with eleven distinct diagnoses within avn . \n there are some longer - term studies of implant use with a diagnosis of avn [ 2 , 3 , 6 , 7 ] . \n while conclusions in these studies mostly reflect lower failure rates and improved symptomatic results with tha , both conventional tha and bipolar arthroplasty have been successful . in younger and smaller patients , in an effort to maximize the polyethylene within the hemiarthroplasty cup to increase longevity , \n the acetabular cartilage and subchondral bone were often overreamed surgically to allow a larger articulating bipolar head . \n the historical literature suggests a higher rate of revision surgery in hemiarthroplasties primarily due to groin pain , progressive arthritis , and acetabular protrusion , while standard tha has a comparably higher rate of dislocations . \n not entirely clear , it has been reported that the revision or failure rate of tha is up to four times higher when comparing avn to osteoarthritis . \n hemiarthroplasty on the other hand has not been shown to have such a differing result based on etiology of the hip condition [ 5 , 6 , 9 ] . \n the literature supports long - term diminishing results with hip hemiarthroplasty as a rule but does not discern those with moderately diseased acetabulum from those who have minimally involved acetabular cartilage and well - preserved congruency nor does it differentiate surgical techniques of overreaming the acetabular subchondral bone and replacing it with a fixed arthroplasty cup versus assessing and preserving a pristine native acetabulum and its role in forming a congruent structural framework for a hemiarthroplasty . \n there is currently no consensus regarding the best arthroplasty for younger patients when the pathology appears to be limited involvement of the femoral head . in addressing hip osteonecrosis , \n the majority of surgeons appear to base surgical choices on the staging of the disease which has not been correlated with outcome [ 9 , 10 ] . \n the purpose of this study is to compare the results of hemiarthroplasty with total hip arthroplasty for selective patients with well - preserved acetabulum . \n this institutional review board - approved review involved a retrospective analysis of demographic , radiographic , and standardized outcome data concerning a cohort of 366 patients similar in age and gender receiving one of two types of hip arthroplasty . \n group 1 ( hemiarthroplasty group ) consisted of patients with one of three presurgical hip conditions : ( a ) early but painful hip osteoarthritis limited to focal chondrolysis of the femoral head , ( b ) early ( ficat stages ii and iii ) hip osteonecrosis without mri or visual evidence of acetabular involvement at the time of surgery , or ( c ) femoral neck fractures with pristine acetabular cartilage . \n these patients were selected at the time of surgery to receive a hemiarthroplasty ( all bipolar implants ) rather than a fixed cup ( tha ) based on the findings of a pristine acetabular articular cartilage surface and suction fit cup of a trial implant . the tight suction fit of the hemiarthroplasty implant trial at the time of surgery was felt to indicate well - preserved and congruous acetabular cartilage and subchondral acetabular bone . \n if a trial cup implant suction fit was not tight enough to shift the pelvis , a hemiarthroplasty was not performed ; the acetabulum was then prepared and tha performed . \n the hemiarthroplasty cohort included patients meeting the inclusion criteria with surgery performed between 1995 and 2007 accounting for 115 cases in 103 patients . \n forty - five patients were excluded due to inadequate followup and 8 patients were lost due to death unrelated to the prosthesis or arthroplasty procedure . \n diagnoses by procedure included 40 with avn ( ficat stages ii and iii , no stage four acetabular involvement ) , 9 fractures , and 12 patients with osteoarthritis visibly limited to focal involvement of the femoral head at the time of surgery . \n the average patient age was 56.5 years ( range 2490 ) ; 61% were females . \n the average patient followup in this group was ( 8.2 ) years ( range 215.6 ) . \n as a comparative group , group 2 ( tha group ) consisted of patients who received conventional tha performed by the same surgeon during a similar time period ( 1993 to 2001 ) . \n ninety - five patients were excluded due to inadequate follow - up data and 31 patients were lost due to death . \n diagnoses within the tha group included 141 osteoarthritis , 4 fractures , 31 avn ( ficat stage iv ) , 2 dysplastic , 2 with ra , and 2 hip fusions . \n the average patient age in this group was 59 ( range 2486 ) and 56% were females . \n implants used in both groups consisted exclusively of the zimmer natural hip press fit stem ( zimmer inc . , warsaw , indiana ) . \n all femoral heads used in group 1 were cobalt chrome and 26 mm in diameter . \n the 26 mm diameter head was chosen to maximize polyethylene thickness in this group of patients especially the ones with a small native acetabulum . \n the smallest bipolar cup used was a 42 mm outer diameter and this allowed for a 7 mm polyethylene articulating with a 26 mm cobalt chrome head . within the tha cohort , \n femoral heads were either 28 or 32 mm in diameter as needed to provide the largest head size possible for stability purposes and still preserve a minimum of 9 mm of polyethylene thickness . \n all patients receiving hemiarthroplasty had the same standard cobalt chrome shell design ( natural hip , zimmer inc . , \n warsaw , indiana ) and the average size was 48 mm ( range 4258 mm ) . \n patients receiving tha received an intra - op press - fit cup ( zimmer inc . , \n the average cup size was 53.7 mm ( range 4365 mm ) and screws were used in 42 tha cases as needed to secure the cup . \n postoperative care included ipsilateral immobilizer for 48 hours for dislocation precaution and weight bearing as tolerated . \n all patients underwent a venous thromboembolism ( vte ) risk assessment and received warfarin 5 mg daily in hospital post - op as long as the international normalized ratio ( inr ) was less than 1.5 ( prothrombin time 18 sec ) and at discharge either fixed - dose warfarin 2 mg per day for 30 days for the standard - risk vte patients ( without inr monitoring unless bleeding issues occurred ) or adjusted - dose warfarin with inr monitoring for the higher - risk vte patients . \n clinical and radiographic assessment was done pre - op and at 2 weeks post - op , 3 months , and annually . \n follow - up ap and lateral radiographs were assessed independently by a fellowship trained arthroplasty specialist ( coauthors b. burnikel , b. shirley and b. prather ) who did not perform the surgery . \n the data was analyzed using chi - square and fishers exact probability test ( = 0.05 ) . \n as seen in table 1 , the groups were similar regarding the relatively young age ( average 56 and 59 , resp . ) and gender though there was a trend towards more females in group 1 ( 61% versus 56% ) as well as preoperative and postoperative clinical assessment using the harris hip scoring ( hhs ) method . \n the preoperative hhs averaged 67.2 ( range 58 to 87 ) for group 1 and 67.7 ( range 25 to 87 ) for group 2 . \n postoperative hhs averaged 98 ( range 70 to 100 ) for group 1 and 99.3 ( range 75 to 100 ) for group 2 . \n there was a significant difference in reported thigh and/or groin pain as shown in table 2 . \n groin pain occurred in 10 patients in each cohort ( 16.4% of group 1 and 5.5% of group 2 ) . \n thigh pain was noted in 7 group 1 patients ( 11.5% ) and 4 group 2 patients ( 2.2% ) . aside from the patients in each group who eventually had revision surgery , \n the patients in both groups with residual thigh and or groin pain did not require pain medication stronger than over - the - counter anti - inflammatory medicines . \n two cups ( 1.9% ) in group 2 showed cup loosening with migration ( one with associated osteolysis ) and both eventually required revision surgery . \n as far out as 15-year followup , no cases of acetabular osteolysis or cup protrusion were found in group 1 ( see figures 1 and 2 ) . \n linear polyethylene wear greater than 2 mm was noted in 13 ( 7% ) of group 2 patients . \n polyethylene wear could not to be assessed in group 1 secondary to the overlying bipolar metal outer cup shell . on the femoral side , two patients had an undersized stem with subsequent subsidence and revision in group 1 . \n all of these patients had previously had hip surgery that deformed the proximal femur ( two with hip fracture pins and one with vascularized fibular graft for osteonecrosis ) . \n no osteolysis or subcalcar erosion was noted in group 1 . in group 2 , 6 ( 3% ) of the 182 cases had subcalcar erosion of the femur noted on ap and lateral radiographs . while this was not structurally compromising , it was felt to reflect secondary polyethylene wear osteolysis as it occurred only in the cases of liner polyethylene wear > 2 mm and may lead to compromised implant longevity . \n while there was a trend for more complications in group 2 , it did not reach statistical significance ( p value = 0.08 ) . \n of the patients in group 1 , 4 of the 61 patients ( 6.5% ) had recorded complications . \n the dislocation rate for the total hip arthroplasty group was significantly higher than the hemiarthroplasty group ( p = 0.04 ) . \n there was a trend towards a higher revision rate in group 2 ( 3.2% versus 8.2% ) but it did not reach statistical significance ( chi square 1.05 , p value = 0.25 ) . \n the group 1 survival rate at a mean of 8.2 years was 96.7% versus group 2 survival rate of 91.8% at a mean of 10.6 years . \n there were no revisions in the hemiarthroplasty group for - cup related problems in this series . \n the two revisions for undersized stems were in patients with prior surgeries with femoral canal deformities . \n the decreased mild thigh and groin pain in the tha group was significant but at what cost given the higher trend of other complications and revision surgery in this generally younger active patient population . \n cabanela and hanssen et al . compared the use of hemiarthroplasty to tha in patients with osteonecrosis of the femoral head and concluded that a fixed porous - coated acetabular component was associated with better symptomatic improvement and a lower failure rate . in their study , when tha was compared with hemiarthroplasty at a mean of 9.2-year followup , the results of both types of arthroplasty were generally satisfactory [ 6 , 7 ] . \n the implants and surgical techniques were completely different between the two groups and the rate of dislocation was higher in the total hip arthroplasty group . \n this finding has been noted in many other studies as well [ 1113 ] . however \n , none of the historical reports on hemiarthroplasty outcomes have addressed the issue of assessing the native acetabular condition to essentially allow a suction fit with the new hemiarthroplasty head at the time of surgery . frequently , the decision to proceed with hemiarthroplasty versus total hip arthroplasty is age based alone and in some reports the acetabulum was actually reamed to accept the hemiarthroplasty head . with the loss of the native acetabular cartilage and supportive subchondral bone , subsequent migration and protrusio of the hemiarthroplasty head in these cases \n however of those patients who failed , the acetabular revision more commonly required complex treatment . \n the hemiarthroplasty implant technique used in that study was to create a concentric acetabulum if one was not present and this is a key differentiating point from the cases presented in this report . \n it may be that the study by pellegrini illustrates that manipulation of the acetabulum to accommodate the bipolar head leads to an increased failure rate . \n in nontraumatic avn of the hip , the pathology begins in the femoral head and until subchondral collapse occurs the acetabulum may be unaffected structurally . often replacements occur prior to significant radiographic changes within the acetabulum . \n however , evaluation of the acetabular bone stock in patients with avn has shown differing results . \n some series reveal that histologic acetabular changes are a minimum when the femoral changes are ficat stage 1 or 2 . in a histological study by steinberg et al . \n evaluation of articular cartilage was performed in patients without radiographic acetabular changes yet revealed that all specimens had histologic changes within the cartilage . \n they indicated that only one specimen intraoperatively had pristine cartilage , but even this specimen had histologic changes consistent with oa . \n the steinberg study did not evaluate the acetabular bone stock but does lend itself to the historical trend of acetabular failure in hemiarthroplasty endoprosthesis as reported by others . \n one may question whether or not the histologic acetabular changes even in pristine hips translate into structural acetabular deficiencies and subsequent clinical hemiarthroplasty failure . \n many studies have shown that the short - term retention of components can be good but patients may be symptomatic . \n the original bateman hemiarthroplasty prosthetic device success was measured by whether or not the patient could walk at a similar or better than presurgical level . \n chan and shih however demonstrated nearly equivalent results comparing tha with hemiarthroplasty at medium - term followup and from their study proposed hemiarthroplasty as a viable option . \n most types of arthritis begin with inflammation of the joint and early degeneration of the cartilage that can not be detected radiographically . \n avn is most likely not different as a degree of degeneration would occur in the articular cartilage of the acetabulum after it had been subjected to a deformed femoral head or to the diseased cartilage of the femoral head [ 17 , 18 ] . \n kindsfater et al . in a study with direct comparison of bilateral hip arthroplasty ( tha and hemiarthroplasty in the same patient ) reveal similar findings to those longevity studies described thus far . \n patients preferred the tha side to the hemiarthroplasty at short- and long - term followup . \n the case series only involved 9 patients with followup being a limiting factor due to patient death . \n the series generally indicates tha to be the preferred treatment with a prosthetic survival rate of 95% at eight years . \n the arthroplasty treatment for limited hip disease remains challenging in a younger more active and physically demanding population , as well as patient populations prone to stability and compliance issues secondary to either geriatric senility or substance abuse . \n there are some who would not suggest hemiarthroplasty as a strong consideration , except for very clearly specified patients based on age and stage of disease . \n the data from this current report support that recommendation but further define the acceptable conditions to include the surgical findings of a pristine acetabulum and suction fit at the time of surgery rather than patient age as the primary consideration . \n newer bearing surfaces of hard on hard ( metal on metal and ceramic ) and highly crossed - linked polyethylene allowing for larger heads with less wear , resurfacing hip arthroplasty all have expanded the options for younger and more demanding patients . \n these newer technologies of the past decade have proven very encouraging in some aspects and yet have brought some very concerning issues to light in others such as early femoral neck fractures , ion particle concerns , pseudotumors , and ceramic fatigue fracture [ 21 , 22 ] . \n there are several limitations to this review that restrict its conclusions and may introduce bias . \n secondly , there are somewhat differing patient groups regarding degree of acetabular disease ( more advanced in the group 2 ) , and thirdly , a single surgeon performed both the surgery and subsequent clinical assessment . \n the strength of the study include the clear distinction of a well - formed preserved acetabulum with a high degree of congruency confirmed at surgery which has not been previously highlighted in prior reports and secondly , the objective independent radiographic assessment by other arthroplasty surgeons blinded to the patient 's clinical symptoms strengthens the review and supports the conclusion that the hemiarthroplasty group is not progressing into acetabular protrusio over time . \n the findings of this study confirm the historically reported higher incidence of thigh and groin pain in the hemiarthroplasty patient group compared with the traditional tha group . \n acetabular protrusion of the hemiarthroplasty head was not a clinical or radiographic issue nor was instability or early failure secondary to the acetabular bearing surface . \n thus , in selected patients with well - preserved surgical acetabular findings , the data from this review support considering hemiarthroplasty as a reasonable option to consider and discuss with patients who are willing to accept some thigh and groin pain in lieu of potentially avoiding other major problems of total hip arthroplasty in this challenging patient population .", "role": "user" }, { "content": "this is a retrospective review of 243 hip arthroplasties treated with either hemiarthroplasty ( 61 surgeries - group 1 ) or total hip arthroplasty ( 182 surgeries - group 2 ) . \n the mid- to long - term results of relatively similar , predominately young patient cohorts were assessed annually via radiographs and the harris hip scores for pain and clinical function . \n groin pain persisted in 16.4% of group 1 and 5.5% of group 2 ( p = 0.0159 ) . \n thigh pain persisted in 11.5% of group 1 and 2.2% of group 2 ( p = 0.0078 ) . \n complications in group 1 were 4/61 including 2 revisions with an overall survival rate of 96.7% versus group 2 complication rate of 29/182 with 15 revisions and an overall survival rate of 91.8% . \n there were no cases of acetabular protrusio in group 1 , but 2 cases ( 1% ) in group 2 had cup loosening or osteolysis . \n two cases were revised in group 1 ( 3.2% ) . both were undersized femoral stems . \n the fifteen revisions ( 8.2% ) in group 2 included loose stem ( 1 ) , instability ( 8) , infections ( 3 ) , cup loosening ( 2 ) , and accelerated polyethylene wear ( 1 ) . \n hemiarthroplasty has a higher incidence of thigh and groin pain but fewer complications compared with total hip arthroplasty .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: parents of participants gave written informed consent for participation of their children in the study . \n the study group consisted of seven patients ( four boys and three girls ) with gain - of - function mutations of the kcnj11 gene who were recruited to the polish registry of monogenic diabetes ( the team project ) . \n all patients transferred successfully to su and showed improved blood glucose levels ( 4 ) . \n the age of the patients at the time of transfer ranged from 5 to 21 years . \n clinical characteristics of the study group rudimentary neurologic testing was performed for all patients before and after introduction of su therapy , as described previously ( 3 ) . \n briefly , an assessment of mental and motor function was performed using medical records of developmental milestones during infancy and up to the age of 2 years . \n the wechsler preschool and primary scale of intelligence revised ( wppsi - r ) was used to assess mental development . \n attention deficit hyperactivity disorder was diagnosed according to criteria provided in the fourth edition of the american psychiatric association s diagnostic and statistical manual . \n electroencephalography ( eeg ) was performed using 32-channel digital eeg equipment ( elmiko , warsaw , poland ) , but only before su therapy . for recording , viewing , \n analysis , and archiving of eeg records , elmiko digitrack ( elmiko , warsaw , poland ) software was applied . \n the records were analyzed by a neurophysiologist and verified by the consultant in pediatric neurology . \n imaging studies were performed twice ( before and 6 months after switching from insulin to su ) in five individuals with the following mutations : h46 \n one patient with a g53d mutation was examined only before transfer to su and the patient with an e229 k mutation was only available after transfer . \n spect studies of brain perfusion were performed according to the european association of nuclear medicine procedure guidelines for brain perfusion spect using technetium 99 m ( tc)-labeled radiopharmaceuticals version 2 ( 5 ) after intravenous injection of tc ethyl cysteine dimer under resting conditions . \n spect scanning was performed using a dual - head camera infinia hawkeye ( ge medical system ) with a dedicated computer workstation ( xeleris ) . \n the neurogam , an application licensed by segami corporation , was used for qualitative and quantitative voxel analyses of brain perfusion in respective regions of interest . \n the serum glucose level was measured before and after spect examination ( range , 4.95.9 mmol / l ) . for all spect examinations , \n this was dictated by the fact that four of the patients were younger than age 9 years , patient pol32 had severe mental retardation , and patient pol23 had attention deficit hyperactivity disorder diagnosed . \n therefore , to reduce any variability attributable to patient anxiety or lack of cooperation , we obtained bioethics committee approval to perform these studies under short - term intravenous general anesthesia , including approval for collaborative patients older than 9 years of age to unify conditions of the study . \n both examinations were performed 1 h after intravenous injection of tc - ethyl cysteine dimer under resting conditions . to eliminate possible anatomical variability , we performed simultaneous magnetic resonance imaging examination and spect / magnetic resonance imaging digital fusion of images . \n we compared individual density counts for all regions of interest and , to make our results comparable with the reference range in children ( 6 ) , we computed cerebro - cerebellar indexes by dividing density counts of particular regions by those of the cerebellum . \n comparisons were made with the mann - whitney u test with a benjamini - hochberg procedure used for false discovery rate computation to correct for multiple hypothesis testing . \n human kir6.2 ( genbank nm000525 ; e23 and i337 ) and rat sur1 ( genbank l40624 ) were used . \n site - directed mutagenesis , synthesis of capped mrna , and preparation and culture of xenopus laevis oocytes were performed as previously reported ( 7 ) . \n oocytes were coinjected with 4 ng of sur1 mrna and 0.8 ng of wild - type ( wt ) or mutant kir6.2-g53d mrna and studied 14 days after injection . \n whole - cell ( wc ) currents were recorded using a two - electrode voltage - clamp in response to voltage steps of 20 mv from a holding potential of 10 mv in a solution containing the following ( mmol / l ) : 90 kcl , 1 mgcl2 , 1.8 cacl2 , and 5 hepes ( ph 7.4 with koh ) . \n the pipette ( external ) solution contained the following ( mmol / l ) : 140 kcl , 1.2 mgcl2 , 2.6 cacl2 , and 10 hepes ( ph 7.4 with koh ) . the intracellular solution contained the following ( mmol / l ) : 107 kcl , 11 egta , 2 mgcl2 , 1 cacl2 , 10 hepes ( ph 7.2 with koh ) , and mgatp as indicated . \n control solutions were alternated with test ( atp - containing ) solutions and current ( i ) is expressed as a fraction of the mean of that in control solution ( ic ) before and after atp application . \n atp concentration - response curves were fit to the following : i / ic = 1/[1+[(atp)/ic50]h ] , where [ atp ] is the atp concentration , ic50 is the atp concentration at which inhibition is half maximal , and h is the slope factor . \n rudimentary neurologic testing was performed for all patients before and after introduction of su therapy , as described previously ( 3 ) . \n briefly , an assessment of mental and motor function was performed using medical records of developmental milestones during infancy and up to the age of 2 years . \n the wechsler preschool and primary scale of intelligence revised ( wppsi - r ) was used to assess mental development . \n attention deficit hyperactivity disorder was diagnosed according to criteria provided in the fourth edition of the american psychiatric association s diagnostic and statistical manual . \n electroencephalography ( eeg ) was performed using 32-channel digital eeg equipment ( elmiko , warsaw , poland ) , but only before su therapy . for recording , viewing , \n analysis , and archiving of eeg records , elmiko digitrack ( elmiko , warsaw , poland ) software was applied . \n the records were analyzed by a neurophysiologist and verified by the consultant in pediatric neurology . \n imaging studies were performed twice ( before and 6 months after switching from insulin to su ) in five individuals with the following mutations : h46 l ( 3 ) , r201h , r50q , g53d , and v59 m . \n one patient with a g53d mutation was examined only before transfer to su and the patient with an e229 k mutation was only available after transfer . \n spect studies of brain perfusion were performed according to the european association of nuclear medicine procedure guidelines for brain perfusion spect using technetium 99 m ( tc)-labeled radiopharmaceuticals version 2 ( 5 ) after intravenous injection of tc ethyl cysteine dimer under resting conditions . \n spect scanning was performed using a dual - head camera infinia hawkeye ( ge medical system ) with a dedicated computer workstation ( xeleris ) . \n examinations were assessed by two independent experienced nuclear medicine reviewers ( m.g . , m.bi . ) \n the neurogam , an application licensed by segami corporation , was used for qualitative and quantitative voxel analyses of brain perfusion in respective regions of interest . \n the serum glucose level was measured before and after spect examination ( range , 4.95.9 mmol / l ) . for all spect examinations , \n this was dictated by the fact that four of the patients were younger than age 9 years , patient pol32 had severe mental retardation , and patient pol23 had attention deficit hyperactivity disorder diagnosed . \n therefore , to reduce any variability attributable to patient anxiety or lack of cooperation , we obtained bioethics committee approval to perform these studies under short - term intravenous general anesthesia , including approval for collaborative patients older than 9 years of age to unify conditions of the study . \n both examinations were performed 1 h after intravenous injection of tc - ethyl cysteine dimer under resting conditions . to eliminate possible anatomical variability , we performed simultaneous magnetic resonance imaging examination and spect / magnetic resonance imaging digital fusion of images . \n we compared individual density counts for all regions of interest and , to make our results comparable with the reference range in children ( 6 ) , we computed cerebro - cerebellar indexes by dividing density counts of particular regions by those of the cerebellum . \n comparisons were made with the mann - whitney u test with a benjamini - hochberg procedure used for false discovery rate computation to correct for multiple hypothesis testing . \n human kir6.2 ( genbank nm000525 ; e23 and i337 ) and rat sur1 ( genbank l40624 ) were used . \n site - directed mutagenesis , synthesis of capped mrna , and preparation and culture of xenopus laevis oocytes were performed as previously reported ( 7 ) . \n oocytes were coinjected with 4 ng of sur1 mrna and 0.8 ng of wild - type ( wt ) or mutant kir6.2-g53d mrna and studied 14 days after injection . \n whole - cell ( wc ) currents were recorded using a two - electrode voltage - clamp in response to voltage steps of 20 mv from a holding potential of 10 mv in a solution containing the following ( mmol / l ) : 90 kcl , 1 mgcl2 , 1.8 cacl2 , and 5 hepes ( ph 7.4 with koh ) . \n atp sensitivity was measured in inside - out patches at 60 mv . the pipette ( external ) solution contained the following ( mmol / l ) : 140 kcl , 1.2 mgcl2 , 2.6 cacl2 , and 10 hepes ( ph 7.4 with koh ) . \n the intracellular solution contained the following ( mmol / l ) : 107 kcl , 11 egta , 2 mgcl2 , 1 cacl2 , 10 hepes ( ph 7.2 with koh ) , and mgatp as indicated . \n control solutions were alternated with test ( atp - containing ) solutions and current ( i ) is expressed as a fraction of the mean of that in control solution ( ic ) before and after atp application . \n atp concentration - response curves were fit to the following : i / ic = 1/[1+[(atp)/ic50]h ] , where [ atp ] is the atp concentration , ic50 is the atp concentration at which inhibition is half maximal , and h is the slope factor . \n all patients had kcnj11 mutations , with four patients being classified as having idend and three as having permanent neonatal diabetes mellitus . \n none of the permanent neonatal diabetes mellitus patients had neurologic features . among idend children , one patient ( pol23 ) had attention deficit hyperactivity disorder and mild mental retardation diagnosed , one ( pol32 ) had moderate mental retardation and severe motor disability , and two patients had only mild mental retardation . only one ( pol23 ) showed significant improvement in mental and motor function with su therapy . this patient has been described previously ( 3 ) . \n figure 1a shows representative spect scans from the same idend patient , first when treated with insulin and then subsequently treated with su . \n a : representative spect scans of brain perfusion paired during insulin and su therapy for the patient with a v59 m substitution in kir6.2 ( neurogam software ) . \n b : hierarchical clustering heat map for average signal intensity in the indicated brain regions for patients with the specified mutations before and after transfer to su therapy . \n pearson correlation coefficients were used as distance measurements in this analysis and are shown as a dendrogram on the left side of the heat map . \n c : mean spect signal intensity in the left and right hemispheres of the cerebellum before and after initiation of su treatment . \n average scores of signal intensity for respective brain regions of interest in all tested patients were computed and subjected to hierarchical clustering using spearman r coefficient as a distance measure . \n significant changes in signal intensity after transfer to su therapy were restricted to the cerebellum . \n a marked improvement in paired observation comparisons for cerebellar perfusion was observed in all cases except for the patient with the r201h mutation ( 8) . the signal intensity was significantly higher for both the left ( p = 0.006 ; false discovery rate , 0.13 ) and right ( p = 0.01 ; false discovery rate , 0.13 ) cerebral hemisphere after introduction of su treatment ( fig . \n the mean signal change in all other regions did not exceed the range of 1.5 to 4.5% in signal intensity variation ( supplementary table 1 ) , which was within the range of intraindividual variability ( 5.96 and 7.20% , depending on the assessing radiologist ) and the range of assessor - dependent variability ( 4.55% ) . as scores for the cerebellum increased because of su treatment , the cerebro - cerebellar indexes proportionally decreased , reaching normal reference values for children 415 years of age ( supplementary table 2 ) . \n we also compared the effect of the patients ' mutations on katp channel inhibition by atp and metabolism . \n because all patients are heterozygotes , we simulated the heterozygous state by coexpressing sur1 with a 1:1 mixture of wt and mutant kir6.2 . \n for each mutation , we measured the magnitude of the wc katp current at rest after activation by the metabolic inhibitor azide and inhibition by the su tolbutamide . \n figure 2a c shows data obtained for the kir6.2-g53d mutation and table 2 gives the mean data for wt channels and all mutant channels . \n all mutations increased the ic50 for atp inhibition and the current magnitude in the presence of 3 mmol / l mgatp ( a physiological concentration ) ; the greatest reduction in atp block was found for the idend mutation h46l . \n the magnitude of the wc current in the absence of metabolic inhibition correlated with the clinical phenotype ; the largest currents were found for the most clinically severe mutations . \n a : mean sem for steady - state wc katp currents evoked by a voltage step from 10 to 30 mv before ( resting ) and after application of 3 mmol / l na - azide , and after application of 0.5 mmol / l tolbutamide ( tolb ) for oocytes injected with kir6.2 ( white ; n = 12 ) or a 1:1 mixture of kir6.2 and kir6.2-g53d ( black ; n = 24 ) mrna , plus sur1 mrna . \n b : mean sem for wc katp currents evoked by a voltage step from 10 to 30 mv under resting conditions and after application of 0.5 mmol / l tolb for oocytes injected with kir6.2 ( white ; \n n = 12 ) or a 1:1 mixture of kir6.2 and kir6.2-g53d ( black ; n = 24 ) mrna , plus sur1 mrna . \n currents are expressed as a percentage of the maximum current evoked by application of 3 mmol / l azide . \n c : mean sem for relationships between [ atp ] and katp current ( i ) , expressed relative to that in the absence of nucleotide ( ic ) , for kir6.2/sur1 ( wt , open circles , n = 16 ) , and hetkir6.2-g53d / sur1 ( hetg53d , closed circles ; n = 10 ) channels in the presence of mg . the lines are drawn to equation 1 , with the following parameters : wt ( ic50 = 25 mol / l , h = 1.1 ) and hetg53d ( ic50 = 83 mol / l , h = 0.8 ) . \n electrophysiological data for katp channels carrying the indicated mutation in kir6.2 ( kcnj11 ) studied in the heterozygous state \n all patients had kcnj11 mutations , with four patients being classified as having idend and three as having permanent neonatal diabetes mellitus . \n none of the permanent neonatal diabetes mellitus patients had neurologic features . among idend children , one patient ( pol23 ) had attention deficit hyperactivity disorder and mild mental retardation diagnosed , one ( pol32 ) had moderate mental retardation and severe motor disability , and two patients had only mild mental retardation . only one ( pol23 ) showed significant improvement in mental and motor function with su therapy . this patient has been described previously ( 3 ) . \n figure 1a shows representative spect scans from the same idend patient , first when treated with insulin and then subsequently treated with su . a : representative spect scans of brain perfusion paired during insulin and su therapy for the patient with a v59 m substitution in kir6.2 ( neurogam software ) . \n b : hierarchical clustering heat map for average signal intensity in the indicated brain regions for patients with the specified mutations before and after transfer to su therapy . \n pearson correlation coefficients were used as distance measurements in this analysis and are shown as a dendrogram on the left side of the heat map . \n c : mean spect signal intensity in the left and right hemispheres of the cerebellum before and after initiation of su treatment . \n average scores of signal intensity for respective brain regions of interest in all tested patients were computed and subjected to hierarchical clustering using spearman r coefficient as a distance measure . \n significant changes in signal intensity after transfer to su therapy were restricted to the cerebellum . \n a marked improvement in paired observation comparisons for cerebellar perfusion was observed in all cases except for the patient with the r201h mutation ( 8) . the signal intensity was significantly higher for both the left ( p = 0.006 ; false discovery rate , 0.13 ) and right ( p = 0.01 ; false discovery rate , 0.13 ) cerebral hemisphere after introduction of su treatment ( fig . \n the mean signal change in all other regions did not exceed the range of 1.5 to 4.5% in signal intensity variation ( supplementary table 1 ) , which was within the range of intraindividual variability ( 5.96 and 7.20% , depending on the assessing radiologist ) and the range of assessor - dependent variability ( 4.55% ) . as scores for the cerebellum \n increased because of su treatment , the cerebro - cerebellar indexes proportionally decreased , reaching normal reference values for children 415 years of age ( supplementary table 2 ) . \n we also compared the effect of the patients ' mutations on katp channel inhibition by atp and metabolism . \n because all patients are heterozygotes , we simulated the heterozygous state by coexpressing sur1 with a 1:1 mixture of wt and mutant kir6.2 . \n for each mutation , we measured the magnitude of the wc katp current at rest after activation by the metabolic inhibitor azide and inhibition by the su tolbutamide . \n figure 2a c shows data obtained for the kir6.2-g53d mutation and table 2 gives the mean data for wt channels and all mutant channels . \n all mutations increased the ic50 for atp inhibition and the current magnitude in the presence of 3 mmol / l mgatp ( a physiological concentration ) ; the greatest reduction in atp block was found for the idend mutation h46l . \n the magnitude of the wc current in the absence of metabolic inhibition correlated with the clinical phenotype ; the largest currents were found for the most clinically severe mutations . \n a : mean sem for steady - state wc katp currents evoked by a voltage step from 10 to 30 mv before ( resting ) and after application of 3 mmol / l na - azide , and after application of 0.5 mmol / l tolbutamide ( tolb ) for oocytes injected with kir6.2 ( white ; n = 12 ) or a 1:1 mixture of kir6.2 and kir6.2-g53d ( black ; n = 24 ) mrna , plus sur1 mrna . \n b : mean sem for wc katp currents evoked by a voltage step from 10 to 30 mv under resting conditions and after application of 0.5 mmol / l tolb for oocytes injected with kir6.2 ( white ; n = 12 ) or a 1:1 mixture of kir6.2 and kir6.2-g53d ( black ; n = 24 ) mrna , plus sur1 mrna . \n currents are expressed as a percentage of the maximum current evoked by application of 3 mmol / l azide . \n c : mean sem for relationships between [ atp ] and katp current ( i ) , expressed relative to that in the absence of nucleotide ( ic ) , for kir6.2/sur1 ( wt , open circles , n = 16 ) , and hetkir6.2-g53d / sur1 ( hetg53d , closed circles ; n = 10 ) channels in the presence of mg . \n the lines are drawn to equation 1 , with the following parameters : wt ( ic50 = 25 mol / l , h = 1.1 ) and hetg53d ( ic50 = 83 mol / l , h = 0.8 ) . \n electrophysiological data for katp channels carrying the indicated mutation in kir6.2 ( kcnj11 ) studied in the heterozygous state \n it is clear that the mutations that cause the most severe neurologic phenotype are those that show the largest resting wc katp currents . in order of functional severity , the mutations were as follows : h46l > g53d v59 m > r50q r210h \n e229 k > wt . patients with least severe mutations ( r50q , r201h , and e229 k ) did not show neurologic symptoms . the most pronounced changes in brain blood flow resulting from transfer from insulin to su treatment were observed in the cerebellum . \n all patients ( with the exception of the one carrying the r210h mutation ) showed an increase in cerebellar perfusion . \n the r201h patient had the highest cerebellar perfusion initially and this did not change after transfer to glibenclamide ; this pattern might be expected because this mutation is not a severe one . \n the g53d , v59 m , and h46 l mutations all cause neurologic problems , and patients with these mutations had a lower initial cerebellar perfusion with insulin , which increased to approximately the same level as for the r201h patient when administered su . \n this is consistent with the fact that they cause a more severe phenotype and therefore might be expected to cause worse perfusion with insulin therapy than the r201h mutation . \n the patient with r50q mutation showed unexpected results . despite the absence of neurologic symptoms and only a moderate impairment of channel function , \n the spect signal intensity with insulin therapy was the lowest and it showed the largest increase . \n it is possible that other confounding factors may influence cerebellar perfusion in this individual , but this remains to be determined . in pancreatic cells , \n an increased katp current would lead to membrane hyperpolarization and inhibition of insulin secretion . in neurons \n all currents were strongly blocked by tolbutamide , suggesting that if su is able to cross the blood brain barrier , then it should close mutant katp channels . \n the large changes in cerebellar perfusion are consistent with the fact that kir6.2 is strongly expressed within the cerebellum ( 9 ) . \n furthermore , when the v59 m gain - of - function mutation was selectively expressed in neurones in a genetically modified mouse model , the electrical activity of cerebellar purkinje cells was impaired ( 10 ) . \n these mice also showed motor problems , including impaired balance and coordination , as predicted if cerebellar function was impaired . \n purkinje cell electrical activity in brain slices from these mice was fully restored by a high dose of the su tolbutamide ( 10 ) . \n a key question is the extent to which su is able to target brain neurons in vivo . \n the increase in spect signal that we observed in patients treated with glibenclamide suggests the drug may be able to cross the blood \n we propose that glibenclamide closes katp channels in cerebellar neurons , thereby stimulating electrical activity , which in turn leads to an increase in blood flow and spect signal intensity . \n neurologic improvement observed in patients with kcnj11 mutations treated with su manifests as improved motor function ( 1113 ) and , in some cases , ameliorated cognitive function ( 3,14 ) . \n our finding of increased cerebellar perfusion in all patients after su therapy could explain the previously reported improvements of motor function in glibenclamide - treated patients ( 3,1114 ) . because all patients were walking before insulin replacement and detailed neurologic testing was not performed before transfer \n , we could not quantify the extent of motor improvement . despite the observed benefits , \n it should be noted that the long - term clinical consequences of this therapy remain unknown and the patients will require further follow - up evaluation . because spect examinations were performed under short - term anesthesia with ketamine , there was a slight risk that this drug affected the results of the study . \n however , because we focused on an individual patient s change in perfusion and the same kind of anesthesia was used on both occasions , we think it is unlikely that ketamine would influence the observed amelioration in cerebellum perfusion . \n no data are available that would suggest children with kcnj11 mutations exhibit a different reaction to ketamine than healthy children , suggesting a disease - specific bias also is not likely . \n although our study has several limitations such as a small sample size ( reflecting the rarity of this disease ) and the lack of objectively quantified motor performance in these patients , we believe that both the neuroimaging and electrophysiological studies shown in this study support the hypothesis of a cerebellum - related effect of su in idend . in view of clinically confirmed improvement in neurologic function ( 3 ) and the beneficial changes we observed in imaging studies , we conclude that su treatment in patients with idend syndrome caused by kcnj11 mutations may exert a beneficial effect on the developing brain and may improve cerebellar perfusion .", "role": "user" }, { "content": "objectiveactivating mutations in the kcnj11 gene , encoding the kir6.2 subunit of the katp channel , result in permanent neonatal diabetes mellitus . \n they also may cause neurologic symptoms such as mental retardation and motor problems ( idend syndrome ) and epilepsy ( dend syndrome ) . \n sulphonylurea ( su ) treatment is reported to alleviate both the neurologic symptoms and diabetes in such cases . \n the study aimed to establish the magnitude and functional basis of the effect of sus on the neurologic phenotype in children with idend using neuroimaging before and after insulin replacement with glibenclamide.research design and methodsto localize and quantify the effect of glibenclamide administration , we performed single - photon emission computed tomography in seven patients with different mutations in kcnj11 . in five patients , measurements before and after initiation of su treatment were performed.resultssignificant changes in single - photon emission computed tomography signal intensity after transfer to su therapy were restricted to the cerebellum , consistent with previous data showing high kir6.2 expression in this brain region . \n cerebellar perfusion improved for both left ( p = 0.006 ) and right ( p = 0.01 ) hemispheres , with the mean improvement being 26.7 7.1% ( n = 5 ) . \n no patients showed deterioration of cerebellar perfusion on su therapy . \n electrophysiological studies revealed a good correlation between the magnitude of katp channel dysfunction and the clinical phenotype ; mutant channels with the greatest reduction in adenosine 5-triphosphate inhibition were associated with the most severe neurologic symptoms.conclusionswe conclude it is likely that at least some of the beneficial effects of su treatment on neurodevelopment in idend patients result from improved cerebellar perfusion .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a staggering number of microbes reside in and upon the human body ( dethlefsen et al . , 2007 ) . \n our co - evolution with this microbiota has resulted in the integration of microbially derived developmental cues and metabolic capacities into human biology ( backhed et al . , \n the vast majority of the 10100 trillion microbial cells that inhabit the human body are found within the distal digestive tract . \n an altered intestinal microbiota composition has been linked to numerous pathologic states such as inflammatory bowel diseases and obesity in mouse models and in humans ( ley et al . , 2005 , 2006 ; frank et al . , 2007 ) . \n in some cases an etiological relationship between the microbiota and disease state has been established ( turnbaugh et al . , 2006 ; garrett et al . , 2007 ; vijay - kumar et al . , 2010 ) . \n thus , human biology and health are intimately intertwined with the biology of our microbial inhabitants . \n ongoing large - scale sequencing efforts are providing a comprehensive sequence - based definition of this intestinal microbiota ( qin et al . , 2010 ) . \n typically two bacterial phyla dominate the healthy western adult intestine , the firmicutes and bacteroidetes compose > 90% of the bacterial cells . \n proteobacterium and bifidobacterium and a handful of other bacterial phyla make up the remainder of the community , along with members of archaea and eukaryota . despite the limited representation of bacterial phyla , at finer scales of phylogenetic resolution , such as species and strain , \n the intestinal microbiota is highly diverse and exhibits substantial compositional variability between people , and thus represents an individualized fingerprint . \n in addition to inter - individual variability , the microbiota exhibits temporal variability , likely due to the numerous factors that continually perturb this dynamic microbial ecosystem , such as changes in host diet and introduction of orally acquired pathogens . \n the tremendous foundation of microbiome sequencing data is propelling human microbiota studies into a second phase focused on function and mechanism . \n recently published metagenomic data highlight the overlap and conservation of core functionalities within the intestinal microbiome of different individuals ( turnbaugh et al . \n this similarity embedded within the combined genomes of different consortia reveals that each person 's gut is endowed with a core set of genes ( a core microbiome ) that carry out functions common to the human intestine . \n this new phase of investigation , which is focused on the emergent properties of the host microbial super - organism , is attracting biomedical scientists from diverse fields , including virologists . \n the ability of an orally acquired pathogen to cause disease is dependant upon multiple steps that the microbiota may influence . \n a pathogen must navigate through the dense community of microbes , gain access to the epithelial surface , and manage the ensuing immune response . \n commensal microbes present significant competition for nutrients ( sonnenburg et al . , 2006 ) , secrete microbicidal proteins ( corr et al . , 2007 ) , and elicit host responses that are fundamental to the development and maintenance of the mucosal innate and adaptive immune system ( cebra , 1999 ; hooper et al . , 2001 ; \n despite this seemingly inhospitable environment , pathogens can gain access to host tissue and cause disease . \n the role of the intestinal microbiota in reducing host susceptibility to enteric bacterial pathogens is commonly referred to as colonization resistance , although the underlying mechanisms are poorly understood . \n the increased susceptibility of oral antibiotic - treated mice or humans to enteric infection nicely illustrates the potential impact of microbiota perturbation on pathogen emergence ( pavia et al . \n , 1990 ; barthel et al . , 2003 ; doorduyn et al . , 2006 ; lawley et al . , 2009 ) . \n furthermore , treating infectious diarrheas with live microbial supplements ( i.e. , probiotics ) has proven successful in decreasing the duration of symptoms , but the mechanisms of action and whether such treatment is more effective for certain causative agents ( e.g. , bacterial vs. viral ) remain obscure ( servin , 2004 ; vandenplas et al . , 2007 ; guandalini , 2008 ; allen et al . , \n together , these data support that alterations in host - associated microbial communities can impact an ensuing interaction with a pathogen . \n the gut microbiota influences the status of the host immune system during development and throughout life . \n the host typically maintains a dynamic and attenuated physiological state of inflammation in the mucosa that is tuned to the membership of the adjacent microbial community ( cebra , 1999 ) . \n for example , in an experimental model of chemically induced intestinal epithelial injury , cell damage is exacerbated in the absence of a microbiota or if the mice are deficient in myd88 , an adaptor protein critical for toll - like , receptor - mediated recognition of the commensal microbiota ( rakoff - nahoum et al . , 2004 ) . \n similarly , salmonella - induced inflammation becomes more severe in the absence of an intestinal microbial community ( stecher et al . , 2005 ) . \n antimicrobial protein secretion ( hooper et al . , 2001 ) , induction of secretory iga ( moreau et al . , 1978 ; shroff et al . , 1995 ) , th1:th2 bias ( mazmanian et al . , 2005 ) , and recruitment of the myeloid and lymphoid cell lineages to the gut ( cebra et al . , 1998 ; \n therefore , aspects of mucosal and systemic immunity are similar in concept to a rheostat , with the microbiota playing a significant role in modulating the set - point . \n the concept that microbial modulation of the immune system can alter pathogen susceptibility is illustrated in a mouse model of latent herpesvirus infection . in this model , \n the latent virus is capable of elevating steady state levels of ifn- , effectively altering the set - point of the immune system and decreasing the host susceptibility to intracellular bacterial pathogens ( barton et al . , 2007 ) . \n the increased resistance to listeria monocytogenes and yersinia pestis of mice harboring latent herpesvirus implies that such dormant viruses ( most humans possess several such herpesviruses ) may be viewed as symbionts with mutualistic potential . \n these data are also suggestive that these same principles may apply to the microbiota : specifically , host immune status may be modulated by commensal microbes prior to pathogen exposure to alter host resistance to infection . since the vast majority of infections begin at the mucosal surface , it is not surprising that pathogen susceptibility may be impacted by the presence or absence of resident microbes that are capable of influencing local and systemic aspects of immunity . \n segmented filamentous bacteria ( sfb ) , an intestinal resident of mice , were recently identified as necessary and sufficient to induce th17 development in the gut ( ivanov et al . , 2009 ) . \n in this same study , the presence of sfb proved critical in minimizing the inflammation caused by a colitis - inducing bacterial pathogen , citrobacter rodentium . similarly , alteration in host susceptibility to respiratory infection following intestinal exposure to a specific microbe has been reported . in an experimental model of cryptococcus \n neoformans - induced pulmonary eosinophilia , the th2-driven pathology can be abrogated by prior introduction of c. rodentium into the digestive tract ( williams et al . , 2006 ) . c. rodentium inflammation induces a th1-response , which reduces the th2-skewing and c. neoformans - associated pulmonary inflammation . \n this protective effect is lost if mice are colonized with a mutant strain of c. rodentium that is deficient in the intimin receptor , and therefore is incapable of attaching to the host colonic epithelium and unable to induce a th1 response . \n similarly , multiple studies have illustrated the ability of either chronic or acute parasitic infection in the intestine to influence immune responses in the lung , specifically decreasing allergic airway inflammation ( wilson et al . \n the ability of a group of clostridium species to induce regulatory t - cells in the colon and decrease the severity of colitis and ige responses in a mouse model further affirms the role of gut microbes in modulating aspects of mucosal and systemic immune function ( atarashi et al . \n in addition to acting through the immune system , the intestinal microbiota may impact pathogens more directly . the emergence of bacterial pathogens , such as clostridium difficile and salmonella spp . , during or shortly after antibiotic treatment \n , suggests the loss of inhibitory effects of the microbiota upon antibiotic - induced disruption . \n several bacterial pathogens , such as salmonella and citrobacter , appear to subvert the host immune response within the intestine causing persistent microbiota disruption thus aiding their own proliferation ( lupp et al . , 2007 ; \n competing for nutrients , physically obstructing access to the mucosa , and producing antimicrobial proteins have all been proposed as mechanisms that contribute to colonization resistance ( stecher and hardt , 2008 ) . \n the bacteriocin , abp118 , produced by a lactobacillus salivarius strain , is capable of killing l. monocytogenes , and its production in vivo is required to protect the host in a murine model of oral listeria infection ( corr et al . , 2007 ) . \n this example provides a glimpse of the type of warfare that can take place amongst and between permanent and transient gut residents . \n alternatively , egg hatching of trichuris muris , a nematode that invades the intestinal epithelium of mice , is enhanced in the presence of the microbiota - derived microbes in vitro , and t. muris burden is decreased after antibiotic knock - down of the microbiota ( hayes et al . , 2010 ) . \n the ability of multiple pathogens to infect in the absence of apparent microbiota disruption ( i.e. , not all orally acquired pathogens require antibiotic treatment to emerge and cause disease ) suggests that several infectious agents may be adapted to and benefit from the microbiota in a normal state . \n in general , the microbiota may enhance viral infection , reduce viral infection , or have no effect on viral infection . in instances when the microbiota influences viral infection , it may be via direct mechanisms , such as virion modification , or indirect mechanisms , such as host cell modification . \n direct effects of the microbiota on viruses are likely to occur locally , whereas indirect effects may occur locally or systemically . \n several studies have shown that the microbiota has the potential to reduce viral infection and disease . \n first , germ - free mice have enhanced susceptibility to influenza a virus ( dolowy and muldoon , 1964 ) , coxsackie b virus ( schaffer et al . , 1963 ) , and friend virus ( mirand and grace , 1963 ) , which suggests that the microbiota directly or indirectly limits disease in mice with a conventional flora . \n second , while dengue virus is a blood - borne pathogen in mammals , it initiates mosquito infection through the enteric route . \n interestingly , dengue virus replication is enhanced in the midguts of antibiotic - treated mosquitoes , which suggests that the insect microbiota limits viral replication . \n these effects may occur indirectly via microbiota - mediated anti - viral immune activation through the toll pathway ( xi et al . , 2008 ) . \n third , adenovirus replication is inhibited by defensins , which are antimicrobial peptides produced by the host in response to the microbiota ( gropp et al . , 1999 ) . \n defensins directly bind adenovirus virions and limit replication in vitro ( smith and nemerow , 2008 ) . \n therefore , the microbiota may limit adenovirus infection through induction of host defense mechanisms , although the effects of defensins on enteric viruses in vivo is unknown . \n conversely , several studies have shown that microbial products can indirectly enhance viral replication and disease . \n first , persistence of mouse mammary tumor virus is enhanced by lipopolysaccharide ( lps ) , a component of gram - negative bacteria . \n lps activates the innate immune pathways culminating in il-10-mediated tolerance and viral persistence in mice ( jude et al . \n second , theiler 's murine encephalitis virus - induced replication and disease in the central nervous system is enhanced by treatment with lps . \n these effects likely occur through indirect mechanisms involving increased inflammation in the central nervous system , which promotes viral replication ( pullen et al . , 1995 ) . \n in future work , it will be important to determine whether native microbiota - derived lps , rather than experimentally administered lps , is sufficient to promote viral infection . \n third , human immunodeficiency virus ( hiv ) pathogenesis and progression to acquired immunodeficiency syndrome ( aids ) is enhanced by lps - mediated chronic immune activation from microbial translocation through the intestinal wall ( brenchley et al . , 2006 ) . \n therefore , the microbiota may indirectly enhance progression to aids through indirect immune activation mechanisms . when considering effects of the microbiota on viruses , it is important to be mindful of the evolutionary potential of viruses , particularly rna viruses . \n viruses have error frequencies up to a million - fold higher than bacteria or mammals and likely evolved to replicate in their respective niches , including niches containing a microbiota . \n thus , the hypothesis that some viruses will generally fare worse in the absence of the microbiota with which they have evolved will be important to test using microbiota - deficient mice . \n clearly , it is important to understand how the microbiota influences viral infections , but what are the major questions to address ? the questions will be shaped by virus type . \n for example , the intestinal microbiota may have direct and indirect effects for enteric viruses that directly encounter them in the intestinal lumen ( enterovirus , rotavirus , norwalk virus , astrovirus , etc . ) . \n however , the intestinal microbiota may also impact non - enteric viruses through indirect mechanisms . \n several viruses encounter host microbiota at other body sites , such as skin and the genital tract ( hiv , papilloma virus , herpes simplex virus , etc . ) . \n therefore , microbiota may affect a wide variety of viruses through diverse mechanisms ( figure 1 ) . \n potential roles that commensal microbes within the intestine may play in host susceptibility to virus . \n ( a ) a commensal may inhibit a virus ( top left panel ) directly ( a ) , or indirectly at a local site ( b ) , or at a peripheral site such as the lung ( c ) . \n conversely , this same commensal may promote viral infectivity ( lower left panel ) via these same mechanisms , such as directly activating the virus ( a ) , recruiting leukocytes that promote / permit viral replication ( b ) , or setting systemic immune parameters that are permissive for viral replication at a distant site ( c ) . \n ( b ) other commensals may have opposite effects on the same viruses , and alterations in microbiota composition or functional state may shift the balance in favor of the first or second scenario . \n the first step is to determine the impact of the microbiota on various viruses by depleting the microbiota and quantifying viral replication and pathogenesis . \n mouse models will be very useful for these experiments , provided that there is an appropriate mouse model for the virus of interest . \n mice are naturally resistant to many pathogens , including viruses , often requiring the use of immunodeficient or neonatal mice for pathogenesis studies . \n microbiota depletion can be accomplished with broad - spectrum antibiotic treatment or the use of germ - free animals . \n antibiotic treatment is an attractive option since it is relatively simple and inexpensive and can be used with any animal model . however , in antibiotic - treated animals , microbiota clearance is incomplete , the ratios of various species are altered , and the antibiotics can indirectly alter the host via microbiota - independent effects ( rakoff - nahoum et al . , 2004 ) . \n another negative is that antibiotic - mediated microbiota clearance requires 1 week or more , and since neonatal mice are required for some viral pathogenesis models , the antibiotic model is not ideal . \n germ - free mice are completely microbiologically sterile , eliminating background and allowing recolonization with specific microbes to examine specificity of microbiota effects . \n however , germ - free mice require highly specialized facilities , are expensive , and a limited number of germ - free mouse strains are available . \n additionally , germ - free mice have immature immune systems and altered intestinal physiology , which may complicate interpretation of experiments ( smith et al . , 2007 ) . \n a combination of experiments with antibiotic - treated mice and germ - free mice may be necessary to paint a complete picture of microbiota effects on viruses . \n retrospective and/or prospective studies on humans treated with antibiotics and their incidence of viral infections may also be useful in evaluating microbiota effects on viruses . \n once the impact of the microbiota has been established for a given virus , the second step is to determine whether effects occur through direct or indirect mechanisms . \n the microbiota may directly alter the infectivity of viral particles through virion modification or processing . \n it is also possible that virions may hitchhike on motile bacteria to access host cells . \n for example , the microbiota may promote or limit viral replication by altering innate and/or adaptive immune responses , changing the susceptibility of host cells , or altering viral receptor expression . \n a variety of experimental systems will be useful to determine the nature of microbiota effects on viruses . \n for example , direct effects of microbiota on virions can be examined through in vitro mixing experiments and infectivity assays . \n indirect microbiota effects on viruses mediated by innate immune responses can be examined in mouse strains lacking components of the innate response . \n the specificity of microbiota effects can be examined by colonizing germ - free mice with specific types of bacteria to determine whether a particular type of bacteria is sufficient to affect the virus of interest . \n together , these types of experiments will reveal the basics of microbiota virus interactions and will provide information for detailed mechanistic studies in the future . \n it is clear that the microbiota provides a major source of biological variation between individuals , and it is a contributor to numerous biological processes . \n microbiota plasticity , which is significantly greater than that of our own genome , may be harnessed to modulate aspects of human health , such as optimizing resistance to certain pathogens . \n the link between microbiota perturbation and enteric pathogen emergence illustrates that investigation into the factors that govern microbiota stability could have great significance for humans . alternatively , \n if certain members of the microbiota , or certain functions encoded within the microbiota , are co - opted by viruses and are required for invasion of host tissue , this set of interactions presents new therapeutic targets . \n the possibility of leveraging the microbiota 's role in infectious disease as a platform to alter the course of infections presents many important questions . \n can we rationally and reproducibly manipulate the composition and function of our intestinal microbiota ? can this manipulation be performed in ways that prevent or ameliorate human disease ? to address these questions , it is critical to lay a foundation of basic research that will establish the fundamental principles that govern this complex set of interactions . \n highly controlled studies in model system are needed to establish how the gut microbiota may be manipulated rationally through the use of orally administered microbes ( probiotics ) , dietary supplementation ( prebiotics ) , and/or microbiota - targeted small molecules to optimize host resistance to infectious disease . as we expand our understanding of pathogens that possess diverse routes of invasion , tropisms , and/or toxins , and we investigate how this biology intersects with the host microbiota interaction , strategies for using this information to improve human health \n for example , interferon ( ifn ) signaling is an important part of the immune response to many viral infections ; however , this system is a target for inhibition by many viruses . identifying a microbiota manipulation ( e.g. , dietary change or probiotic administration ) that induces \n a mild anti - viral - like ifn response suggests a strategy for pre - conditioning the host immune response to provide increased resistance during periods of heightened vulnerability ( e.g. , in infancy or during epidemics ) . tuning the immune rheostat to desired set - points using microbial exposure ( i.e. , colonization status ) provides a promising avenue that may have broad applicability . \n identification of biomarkers of these host responses , which can be surveyed in feces , urine , or blood , will enable these responses to be tracked and appropriately altered . \n the ability to modulate the status of the mucosal immune system has implications for improving the efficacy of oral vaccination campaigns . \n one such example is the global effort to eradicate wild poliovirus , which has stalled in recent years due to the failure of oral polio vaccines to achieve seroconversion of children in developing nations . in the indian states of uttar pradesh and bihar , less than 71% of children \n are protected against type 1 poliovirus despite an average of 15 oral doses of trivalent vaccine per child before 5 years of age ; 85% protection is achieved with 10 average doses across the rest of india ( grassly et al . , 2006 ) . \n this failure in protection is seen in several developing regions of the world with poor sanitation and has been linked to diarrhea and the presence of enteric viruses ( myaux et al . , 1996 ) . \n these studies lend further evidence that the status of the mucosal immune system and/or stability of the microbiota dictates responsiveness to newly encountered agents ( whether vaccines or pathogens ) and places additional importance on pursuing a mechanistic understanding of how the relationship between the microbiota and mucosal immune system may be optimized to reduce viral disease and to improve the efficacy of oral vaccines . \n a logical and likely extension of personal genomes is the personal microbiome , elucidating the genes encoded by the core species or taxa within an individual 's intestine . with ever the increasing understanding of how the biology of host and microbiota integrate , \n these two sets of dna sequences will offer insight into current or looming pathologies by identifying potential deleterious combinations of polymorphisms in the genes of host and microbiota . \n the microbiome offers a set of genes much more amenable to manipulation compared to our human genome . a prerequisite for incorporating the microbiota into personalized , preventative medicine is to attain a mechanistic understanding of microbiota function and to understand how microbes within the intestine affect the resistance and susceptibility to pathogens ( nicholson et al . , 2005 ; zaneveld et al . , \n the rational manipulation of our microbial self will soon be a reality , and it is imperative to understand which manipulations will promote human health . \n the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .", "role": "user" }, { "content": "many infections start with microbial invasion of mucosal surfaces , which are typically colonized by a community of resident microbes . \n a growing body of literature demonstrates that the resident microbiota plays a significant role in host susceptibility to pathogens . \n recent work has largely focused on the considerable effect that the intestinal microbiota can have upon bacterial pathogenesis . \n these studies reveal many significant gaps in our knowledge about the mechanisms by which the resident community impacts pathogen invasion and the nature of the ensuing host immune response . \n it is likely that as viral pathogens become the focus of studies that examine microbiota host interaction , substantial effects of resident communities exerted via diverse mechanisms will be elucidated . here \n we provide a perspective of the exciting emerging field that examines how the intestinal microbiota influences host susceptibility to viruses .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: sheehan 's syndrome ( ss ) is one of the commonest causes of hypopituitarism in underdeveloped and developing countries . \n it occurs as a result of ischemic pituitary necrosis due to severe postpartum hemorrhage.[13 ] although a small percentage of patients with ss may present as abrupt onset acute hypopituitarism immediately after delivery , most patients have a mild disease and go undiagnosed and untreated for years together.[46 ] the spectrum of clinical presentation of ss is extremely varied and ranges from non - specific complaints such as weakness , fatigue , and anemia to severe pituitary insufficiency resulting in coma and death . as in other types of hypopituitarism , \n other associations include anemia , pancytopenia , and cardiac abnormalities like cardiomyopathy.[810 ] ss presenting as acute kidney injury ( aki ) is rare . \n only few cases have been reported in the literature and most are precipitated by rhabdomyolysis.[1113 ] we report a case of aki in a middle- aged female with ss who recovered dramatically after being started on intravenous steroids and volume replacement . \n our case suggests that besides hypothyroid myopathy leading to rhabdomyolysis and consequently compromised renal function and aki , chronic adrenal insufficiency can also predispose to the risk of aki . \n a 56-year - old woman was referred to our hospital with a 45 day history of nausea , two episodes of vomiting , and few episodes of loose motions , followed by oliguria at home . \n she denied any history of fever , dysentery , abdominal pain , trauma , muscle pain , or change in color of urine . \n she also denied history of any drug intake . on enquiring , the patient gave history of longstanding ill health in the form of generalized weakness , easy fatigability , cold intolerance , constipation , hair loss , and weight gain starting after her last child birth some 22 years back . \n last delivery was a full - term normal delivery conducted by a local midwife at her home . \n she denied any history of profuse bleeding or blood transfusion during her last peripartum period . \n however , she had lactation failure and had menstrual cycles for a few months before complete cessation of menses after her last delivery . \n physical examination revealed an ill - looking , dehydrated patient with pulse of 54 beats/ minute , blood pressure of 90/60 mm hg without any postural drop , respiratory rate of 18/ minute , and oral temperature of 97.6f ( 36.4c ) . \n the patient had mild pallor , dry tongue , coarse and dry skin with non - pitting edema of the lower extremities . \n hypopigmented area was seen around right nasal orifice and there was loss of lateral eyebrows . \n central nervous system examination revealed slow mentation in the form of delayed response to verbal commands . \n examination of motor system did not reveal any focal neurodeficit , but deep tendon jerks were markedly delayed . \n kidney function test was deranged with initial urea of 71 mg / dl ( normal value 2040 mg / dl ) and serum creatinine of 4.5 mg / dl ( normal value 0.51.5 mg / dl ) . \n muscle enzymes were slightly elevated with creatine phosphokinase ( cpk ) being 168 1u / l ( normal value 1070 \n arterial blood gas and electrolyte analysis revealed ph of 7.31 , pco2 of 27 mm hg , bicarbonate of 13 mmol / l , serum sodium 130 mmol / l , and potassium of 3.6 mmol / l . \n chest x - ray was normal and 12-lead ecg revealed sinus bradycardia with low - voltage qrs complex . \n routine urine examination revealed pus cells 45 , rbcs 23 , absent albumin and casts . \n renal ultrasound revealed relatively small - sized kidneys ( right 8.5 3.2 cm , left 8.7 3.4 cm ) with increased echogenicity , with maintained corticomedullary differentiation bilaterally . \n the diagnosis of panhypopituitarism most likely secondary to ss associated with acute renal failure was made on the basis of her past medical history of failure to lactate post her last child birth with gradual cessation of menses , peripheral signs and symptoms of hypothyroidism , and abnormal biochemical and hormone profile . \n basal anterior pituitary hormones and serial kidney function tests during admission the patient was given intravenous fluids in the form of dextrose normal saline with close monitoring of urine output , replacement therapy in the form of intravenous hydrocortisone 50 mg intravenously 6 hourly , and levothyroxine given orally at a starting dose of 50 mcg/ day . \n on repeating renal function tests and other biochemical tests , there was dramatic improvement in serial renal function parameters . \n with improvement in the general condition of the patient , intravenous antibiotics were stopped in view of absence of fever and negative septic screen . \n she was shifted to oral prednisolone 5 mg twice daily , while levothyroxine was continued at a dose of 50 mcg / day . \n she was discharged on the same medication on 10th day of admission and was advised to taper prednisolone to 5 mg/ day after 2 weeks . \n four weeks after discharge , the patient had general sense of well - being with better appetite and renal function had normalized with creatinine 0.64 mg/ dl and serum urea 23 mg / dl . \n the patient was subjected to magnetic resonance imaging ( mri ) brain with sellar and parasellar focus which revealed empty sella with normal rest of the brain parenchyma [ figure 1 ] . \n mri pituitary sagittal view showing pituitary fossa filled with cerebrospinal fluid and stalk touching the base of pituitary floor ; features suggestive of empty sella \n the present report describes a 56-year - old woman with ss who presented with acute renal insufficiency owing to depletion of intravascular volume secondary to gastroenteritis . \n the chronic hypocortisol state has increased the predisposition to renal injury which was precipitated by mild acute gastroenteritis . \n ss , first described by hl sheehan in 1937 , classically refers to postpartum hypopituitarism due to pituitary necrosis occurring during severe hypotension or shock secondary to massive bleeding at or just after delivery . \n the frequency of ss has gradually decreased especially in developed countries , as a result of improved obstetric care including treatment of hemodynamic complications with rapid blood transfusion and/or intravenous fluid replacement . \n it , however , continues to be the most common cause of hypopituitarism in underdeveloped and developing countries . \n enlarged pituitary volume , small sellar size , prothrombotic nature of pregnancy , and autoimmunity have been suggested to play a role in the pathogenesis of ss in women who suffer from severe postpartum hemorrhage . on the other hand , \n the spectrum of clinical presentation of ss is quite variable and ranges from non - specific symptoms such as weakness , fatigue , and anemia to severe pituitary insufficiency resulting in coma and death . \n clinical manifestations of ss may change from one patient to another , as hormonal deficiency varies from loss of one trophic hormone to classical panhypopituitarism.[157 ] failure of postpartum lactation is the most consistent feature of patients with ss and failure of regaining menstrual flow postpartum is the most common symptom of ss . despite the failure to menstruate , \n gonadotrophin reserve may still be preserved in some patients and these patients can even conceive spontaneously . \n another important clinical presentation in ss is related to secondary hypothyroidism and patients may present with weight gain , cold intolerance , tiredness , aches and pains , and muscle disorders ranging from elevation of muscle enzymes to frank rhabdomyolysis and renal failure.[1113 ] our patient also had severe central hypothyroidism as was evident from history , examination , and hormone tests . \n adrenal insufficiency in ss can be catastrophic and can range from non - specific complaints to hypotension , sallow skin , and severe adrenal crisis , particularly under stressful conditions such as infection . \n only few cases have been reported in which aki was caused by rhabdomyolysis.[1113 ] aki has been defined as rapid decline in kidney function , as measured by rising serum creatinine or decline in urine output ( oligo / anuria ) \n . introduced by acute kidney injury network , specific criteria exist for diagnosing aki . our case presented with rapid deterioration of renal function in the form of oliguria together with rise in serum creatinine , thus meeting the criteria for aki . \n although , as stated earlier , aki can occur in ss , hypothyroid myopathy is the most common etiological factor.[1113 ] hypothyroid myopathy is usually manifested by delayed relaxation of tendon reflexes , muscle stiffness , proximal muscle weakness , myalgia , muscle cramps , and occasional elevated muscle enzymes , however , rhabdomyolysis is rare . \n rhabdomyolysis can occur spontaneously or is precipitated by hypoxemia , hypotension , sepsis , or vigorous exercise . \n the exact cause of rhabdomyolysis in hypothyroidism is unclear , but both impaired glycogenolysis and oxidative mitochondrial metabolism have been implicated.[1113 ] although our patient had subtle features of hypothyroid myopathy as revealed by history , examination , and lab evaluation , there was no evidence of rhabdomyolysis . \n the most probable cause of aki in our patient was chronic hypocortisolemia as renal function in our patient rapidly improved after initiation of intravenous hydrocortisone ; an association between adrenal insufficiency and disturbed renal function has been demonstrated repeatedly . \n a study was done by christine waterhouse and henry keutmenn in 1947 , in which kidney function of 13 patients with adrenal insufficiency was studied . \n it was concluded that there is reduction in effective vascular bed in the kidney , resulting in decreased renal plasma flow with concomitant decrease in the rate of glomerular filtration . besides \n , it has been found that cortisol has major effects on hemodynamics and absence of cortisol causes decrease in cardiac index with an inadequate response of systemic vascular resistance to maintain the mean arterial pressure . in summary , a middle - aged woman with ss presented with aki which reversed completely with conservative management including glucocorticoids .", "role": "user" }, { "content": "sheehan 's syndrome occurs as a result of ischemic pituitary necrosis secondary to severe postpartum bleeding . \n it is one of the most common causes of hypopituitarism , characterized by variable clinical presentation . \n acute kidney injury occurs rarely in sheehan 's syndrome and most of the cases have been found to be precipitated by rhabdomyolysis . \n we here present a case of sheehan 's syndrome with acute kidney injury where theprecipitating cause was chronic hypocortisolemia . \n we believe this is the first reported case of sheehan 's syndrome in which acute kidney injury was precipitated by adrenal insufficiency .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a standard way of reporting treatment outcomes has been a concern for surgeons for decades [ 1 , 2 ] . \n recently , dindo and clavien and sokol and wilson initiated a discussion in the world journal of surgery regarding the definition of perioperative morbidity . \n the surgical community has generally recognized a semantic definition of postoperative complications as any deviation from the ideal postoperative course that is not inherent in the procedure and does not comprise a failure to cure as pronounced by dindo and clavien . \n however , the dispute has just partly touched the practical challenges related to registration and systematization of perioperative morbidity . in spite of wide acceptance of the need for a standardized taxonomy , \n herein we try to contribute to a more complete understanding of the term perioperative morbidity . in 1992 , \n clavien and co - authors made a first significant attempt to standardize approaches to assessment of perioperative morbidity . in 2004 , this classification was revised by dindo and co - authors and in 2009 by strasberg and co - authors [ 8 , 9 ] . the last revision was named accordion severity grading system of surgical complications \n ( later referred as the accordion classification ) ; however it has once again received minor amendments made by porembka and co - authors [ 9 , 10 ] . during the last two decades \n this clavien - dindo - strasberg classification system has received a wide application ( the classification has been cited in 2815 publications in accordance with the google school citation engine report on february 2013 ) and has enabled comparison of surgical outcomes from different institutions with improved accuracy and therefore has enabled a better communication between surgeons around the world . \n however , what the accordion classification ( as well as earlier versions of clavien - dindo - strasberg classification ) defines as surgical complications are in fact only postoperative complications . \n thus this classification has two principal shortages : it disregards intraoperative events and contributes to confusing terminology due to the uncertainty of the term surgical [ 1113 ] . \n it is obvious that events occurring during the postoperative period may have a major impact on the patient well - being . \n however , significant intraoperative events should be also recorded and reported even if they do not lead to postoperative morbidity or do not impact the postoperative well - being of the patient . in the aviation industry , these events are called a near miss and reported and discussed in order to understand how to identify an error and prevent recurrent errors in the future . similarly , the point of reporting adverse events in surgery includes the primary need to reduce their occurrence . \n information about intraoperative events could contribute to refinement of surgical strategy , tactics , and techniques as well as adjustment of medication protocols supporting surgical intervention . \n this point is especially relevant in the evaluation of new surgical techniques or assessment of the operative progress of junior surgeons . \n when intraoperative adverse events confer postoperative burden to the patients , these events achieve complication status which could be verified during the postoperative period \n . however , direct cause - effect relationship between a specific intraoperative event and the subsequent postoperative complication can often be difficult to assess . \n in fact , many postoperative complications do not relate to any single particular intraoperative adverse event per se , but most often are a consequence of a series of errors without consequence which accumulate and ultimately result in a complication . \n conversely , intraoperative events do not necessarily lead to adverse postoperative patient status , so the term intraoperative unfavourable incident reflects the nature of this phenomenon . \n by contrast postoperative complications , whether they are directly associated with earlier intraoperative unfavourable incident or not , have always negative impact on patient well - being . the term surgical complication applied in the accordion classification \n may be regarded by many surgeons as an incident resulting in a complication caused by technical failure of the operative intervention , in contrast to the so - called medical complications , but authors of the classification meant the both types of postoperative complications [ 1820 ] . \n therefore the term surgical complication will contribute to confusing interpretation of perioperative morbidity and postoperative complications in particular . \n the term perioperative adverse events comprising both intraoperative unfavourable incidents and postoperative complications could be regarded as better alternative . \n this term was first applied in the early 1990s in anaesthesiology research [ 21 , 22 ] . later on surgeons adapted the term perioperative adverse events . \n however only since the middle of 2000s use of this term has been expanding in surgical sciences [ 2326 ] . \n in fact both postoperative complications and intraoperative unfavourable events may be related to either technical surgical or medical ( general or anaesthesia related ) unfavourable events . \n we , as many other surgeons , have felt that the best way to report perioperative adverse events by means of combined application of two appraisal tools the satava approach to grade intraoperative unfavourable incidents together with the modified clavien - dindo - strasberg classification of postoperative complications [ 2731 ] . \n however if this concept of morbidity assessment in surgery should be systematically described and accepted worldwide , it will enable surgeons to achieve a new refined and concise standard of reporting of perioperative adverse events . \n such an approach to systematization of this concept and refinement of perioperative adverse events reporting is presented herein . \n the expression perioperative adverse events appears to be more appropriate than perioperative complications as it is more comprehensive ( including the consequences of both symptomatic postoperative complications and intraoperative unfavourable incidents ) . \n we have avoided using the term perioperative morbidity , since morbidity by definition is a term describing illness in an individual , which not necessarily will be the case following an intraoperative unfavourable incident . \n thus though the use of the term perioperative adverse events in order to describe both intra- and postoperative unfavourable events are strongly recommended , the term perioperative complications can be used as well . \n we elaborated a classification of intraoperative unfavourable incidents on the basis of the satava approach to surgical error evaluation ; it established the ability to grade intraoperative unfavourable incidents to be generalized to any type of surgical intervention ( table 1 ) . \n we suggest a revision for clarifying and refining the accordion classification ( table 2 ) . \n in 2005 , satava proposed a simple approach to grade surgical errors during operation : grade i : an error without consequence or near miss ; grade ii : an error with immediate identification and correction , also referred to as recovery ; grade iii : an error that is unrecognized that leads to a significant consequence or complication . \n the most critical issue is to develop clear , concise , unambiguous definitions of known intraoperative errors , using quantitative metrics whenever possible . \n the author primarily used this system to grade errors occurring during simulation of a laparoscopic operation to evaluate the development of surgical skills of trainees . however this approach is suited very well to grade any intraoperative unfavourable incident . \n we propose the following grading of intraoperative unfavourable incidents on the basis of satava approach to surgical error evaluation ( table 1 ) . \n grade i. incidents managed without change of operative approach and without expected further consequences for the patient . \n this includes minor injury of adherent or adjacent organs and minimal change of intraoperative tactics and cases with blood loss over normal range . \n the incident may pass unrecognized or be recognized , but not to be significant enough to result in a postoperative sequelae . \n these accidents are rare if ever reported and are the equivalent of a near miss . \n examples \n intraoperative bleeding of 700 ml during laparoscopic adrenalectomy in adults.minor small bowel perforation during surgical manipulations at laparoscopic liver resection with immediate closure by endoscopic suturing.small injury to the colon during surgical manipulations of a distal resection of the pancreas with immediate closure by suturing . the immediate identification of such incidents permits full recovery of the patient.clipping of a lower pole artery during laparoscopic pyeloplasty with no postoperative sequelae.ligating a segmental branch of the right hepatic artery rather than the cystic artery during laparoscopic cholecystectomy , with a resulting minimal elevation of hepatic enzymes but no consequences to the patient . \n laceration of liver parenchyma during other procedures.thermal injury to the gastric serosa upon division of the short gastric vessels during a laparoscopic fundoplication . \n minor small bowel perforation during surgical manipulations at laparoscopic liver resection with immediate closure by endoscopic suturing . \n small injury to the colon during surgical manipulations of a distal resection of the pancreas with immediate closure by suturing . \n clipping of a lower pole artery during laparoscopic pyeloplasty with no postoperative sequelae . ligating a segmental branch of the right hepatic artery rather than the cystic artery during laparoscopic cholecystectomy , with a resulting minimal elevation of hepatic enzymes but no consequences to the patient . \n thermal injury to the gastric serosa upon division of the short gastric vessels during a laparoscopic fundoplication . \n this includes cases requiring limited resection of intraoperatively injured organs or cases with blood loss which is appreciably over normal range . for laparoscopic / thoracoscopic / endoscopic surgery , it includes intraoperative incidents requiring conversion . \n examples \n intraoperative bleeding of 1200 ml during laparoscopic adrenalectomy managed without conversion.bowel devascularisation during adhesiolysis at laparoscopic liver resection requiring limited bowel resection.conversion to conventional laparotomy to manage intraoperative incident ( excluding conversion to limited hand assisted procedures).laceration of the spleen or splenic vessels , necessitating a nonscheduled splenectomy.division of spermatic cord during inguinal dissection resulting in reduced fertility.while not optimal care , the immediate identification of such errors permits immediate remediation of the error , usually without significant long - term complications but with or without minor near - term consequences . intraoperative bleeding of 1200 ml during laparoscopic adrenalectomy managed without conversion . \n conversion to conventional laparotomy to manage intraoperative incident ( excluding conversion to limited hand assisted procedures ) . \n these incidents are often associated with unequivocal errors which are not recognized during surgery ; therefore the correction is delayed . \n some serious incidents could be recognized during surgery but may be too hard or impossible to manage without significant consequences for patient . \n examples \n any common bile duct injury not recognized until postoperative period.catastrophic intraoperative bleeding which is difficult to manage and which requires major blood transfusions / autotransfusions which can cause postoperative multiorgan failure.injury of renal artery resulting in necessity to remove a healthy kidney during adrenalectomy.stapling of the superior pulmonary vein during inferior lobectomy , requiring pulmonectomy.any bowel injury not recognized until the postoperative period.any type of surgical instrument ( sponge , forceps , etc . ) left behind in the abdominal cavity following laparotomy . \n any common bile duct injury not recognized until postoperative period . \n catastrophic intraoperative bleeding which is difficult to manage and which requires major blood transfusions / autotransfusions which can cause postoperative multiorgan failure . \n any type of surgical instrument ( sponge , forceps , etc . ) left behind in the abdominal cavity following laparotomy . \n first , the original version of the clavien - dindo - strasberg classification included a prolonged postoperative hospital stay as a grading factor , but it was excluded in the revision made by dindo and co - authors in 2004 [ 7 , 8 ] . \n furthermore worldwide tendency to shortening of postoperative stay and clear association between long postoperative stay and postoperative complications have become more prominent [ 35 , 36 ] . \n we suggest accounting a doubling of postoperative length - of - stay as grade 1 complication per se if it is caused by medical reasons . \n for example a postoperative stay twice as long as anticipated due to excessive postoperative chylous ascites after pancreatoduodenectomy should be considered as grade 1 complication in spite of the fact that usual postoperative ascites is considered an unavoidable sequelae and not a complication . \n if researchers would use the median value of postoperative stay length at the same institution for that disease and procedure as a reference value , the influence of institution traditions and health care system on severity grading will be largely levelled out . \n second , many surgeons and researches are prone to simplify grading of postoperative complications dividing them in two groups , major and minor [ 37 , 38 ] \n . such classification can be confusing and introduce uncertainty ; definitions are required as has been suggested by the somewhat complicated 6-grade system of the accordion classification . \n therefore it would be proper to systemize grades i iii as minor complications , and grades iv vi as major complications . \n this boundary could be controversial , but the necessity of a reoperation under general anaesthesia is usually associated with major postoperative complications . the formal division to mild ( grade i ) , moderate ( grade ii ) , and severe ( grade iii \n vi ) , which is described in the accordion classification , appears to differ from the subjective perception of practicing surgeons . \n intervention under general anaesthesia ( as mentioned in the accordion classification ) defining grade iv could be interpreted differently and therefore requires refinement . \n the need for artificially pulmonary ventilation during patient anaesthesia could be added in parentheses to clarify a boundary . \n for example , a case where the patient is subject to a postoperative gastroscopy to manage a complication requiring only intravenous patient sedation should be regarded as grade iii ; need for intubation would define grade iv . \n fourth , the accordion classification is argued to be based on a therapy used to treat complication . \n however the classification does not involve cases when an intervention was done due to suspicion of a postoperative complication . \n it is quite controversial whether one should consider this event as a complication of a grade corresponding to usual therapy or to not consider such case a complication at all . \n it may be more appropriate to not consider such events as complications because they may be a result of misinterpretation of patient medical condition . \n for example , a patient who had a liver resection is subject to a diagnostic laparoscopy ( under general anaesthesia with intubation ) on the 2nd postoperative day for suspicion of bile leakage ( peritonism , fever , and leukocytosis ) which was not confirmed ; the patient recovered uneventful . \n this case could be regarded as grade 1 complication due to manifestation of feber . \n fifth , the accordion classification did not define an exact time period during which one should consider an event occurrence as a postoperative complication . \n the standard of 30 days ( or up to discharge if patient stays longer in the hospital ) has received a wide acceptance in the surgical community for perioperative mortality and can be regarded as the time frame for inclusion as a postoperative complications as well [ 39 , 40 ] . \n despite the tremendous advance of evidence - based medicine , inconsistency in reporting perioperative adverse events is common both in research and hospital records . \n severity grading was used in only one - third of large ( over 100 patients ) randomized controlled studies in surgery from 1990 to 2001 . \n moreover all instances represented only a simple division to subcategories of minor and major usually without accurate definition of the boundary between them [ 37 , 38 ] . even now many studies are published without appropriate grading of perioperative complications \n ; however in the last few years it has been becoming more common to apply severity grading in surgical research [ 41 , 42 ] . \n a considerable number of surgeons are becoming aware of good scientific principles and are applying a severity grading to perioperative morbidity . \n it seems that in the near future this concept will become a prerequisite of good academic research in the field of surgery . \n new surgical techniques can have a higher rate of perioperative morbidity during their introduction , due to the learning curve . \n this primarily applies to a higher rate of intraoperative unfavourable incidents rather than to postoperative complication . \n pragmatically , the moderately increased perioperative adverse events during introduction of new techniques are being accepted as the consequence of advancing the state of the art of surgery . \n in essence this is the cost that the surgical community bears for the sake of the further progress in surgery to the benefit of future patients and society as a whole . \n the new science of medical and surgical simulation is not sophisticated enough yet to ameliorate this cost , and the use of animal training is decreasing due to ethical issues [ 43 , 44 ] . \n international legal guidelines and regulations in regard to surgery are in quite an immature state , but this topic has recently received increasing interest . once a requirement to the unified reporting of perioperative morbidity and acceptability of moderately increased perioperative morbidity for new techniques should be prescribed in international guidelines for good clinical practice . \n we admit that in order to get overall picture of outcomes of surgical treatment , researchers should report key outcome parameters in addition to the careful standardized reporting of perioperative adverse events . \n classifications of both intraoperative incidents and postoperative complications are to a large extent universal , covering the needs of mainstream general and gastrointestinal surgery ; nevertheless the classification may still have some limitations in the case of application to some specific areas of surgery . in such circumstances , \n a clarifying modification , which still holds standardized grading principles , could represent a sensible solution and play an important role . \n however it is not possible to set a threshold for every potential complication in every classification system . \n the most important feature of a good classification system is to establish quantitative definitions which allow the least possible subjectivity to a researcher to interpret the classification and thus to enable the most objective unified grading of the severity of an intraoperative unfavourable incident or postoperative complication . \n application of clear , unambiguous , and user - friendly terminology is a requisite for a good classification . \n the proposed approach to systematization of perioperative adverse events utilizing the combined application of two appraisal tools , that is , the elaborated classification of intraoperative unfavourable incidents on basis of the satava approach to surgical error evaluation together with the modified accordion classification of postoperative complication , appears to be an effective tool for comprehensive assessment of surgical outcomes . \n this concept was validated in several studies analysing perioperative adverse events in regard to various procedures in general , gastrointestinal , endocrine , urologic , and paediatric surgery [ 2931 , 4753 ] .", "role": "user" }, { "content": "background . \n morbidity is a cornerstone assessing surgical treatment ; nevertheless surgeons have not reached extensive consensus on this problem . \n methods and findings . \n clavien , dindo , and strasberg with coauthors ( 1992 , 2004 , 2009 , and 2010 ) made significant efforts to the standardization of surgical morbidity ( clavien - dindo - strasberg classification , last revision , the accordion classification ) . \n however , this classification includes only postoperative complications and has two principal shortcomings : disregard of intraoperative events and confusing terminology . \n postoperative events have a major impact on patient well - being . \n however , intraoperative events should also be recorded and reported even if they do not evidently affect the patient 's postoperative well - being . the term surgical complication applied in the clavien - dindo - strasberg classification \n may be regarded as an incident resulting in a complication caused by technical failure of surgery , in contrast to the so - called medical complications . \n therefore , the term surgical complication contributes to misinterpretation of perioperative morbidity . \n the term perioperative adverse events comprising both intraoperative unfavourable incidents and postoperative complications could be regarded as better alternative . in 2005 , satava suggested a simple grading to evaluate intraoperative surgical errors . \n based on that approach , we have elaborated a 3-grade classification of intraoperative incidents so that it can be used to grade intraoperative events of any type of surgery . \n refinements have been made to the accordion classification of postoperative complications . \n interpretation . \n the proposed systematization of perioperative adverse events utilizing the combined application of two appraisal tools , that is , the elaborated classification of intraoperative incidents on the basis of the satava approach to surgical error evaluation together with the modified accordion classification of postoperative complication , appears to be an effective tool for comprehensive assessment of surgical outcomes . \n this concept was validated in regard to various surgical procedures . \n broad implementation of this approach will promote the development of surgical science and practice .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: atherosclerosis is the primary cause of cerebrovascular and coronary artery disease through slowly progressive lesion formation and luminal narrowing of arteries . \n this vascular remodeling leads to thrombotic complications including acute coronary syndrome , myocardial infarction , and stroke . \n atherosclerosis is well known to be an inflammatory disease , and the underlying pathology is characterized by a persistent inflammatory process of the arterial wall . with increasing prevalence of risk factors such as hypertension , diabetes , and obesity , \n it is critical to control vascular inflammation in order to decrease mortality and improve public health . to solve this problem , peroxisome proliferator - activated receptor ( \n ppar- belongs to the nuclear receptor family of ligand - activated transcription factors , which also include the steroid and thyroid hormone receptors . \n ppar- forms heterodimers with the retinoid x receptor ( rxr ) and activates transcription by binding to a specific dna element known as the ppar response element ( ppre ) . in the absence of ligand , ppar - rxr heterodimers bind a number of corepressors , including nuclear receptor corepressor and the silencing mediator of the retinoid and thyroid hormone receptors , to suppress the target genes . in the presence of selective ligands \n , ppar- undergoes a conformational change facilitating the dissociation of corepressors and the recruitment of co - activators , leading to transcriptional activation of the target genes [ 5 , 6 ] . to date , a variety of endogenous and synthetic ligands in addition to its co - activators have been detected ( table 1 ) . \n ppar- is known to have four splice isoforms : ppar-1 , 2 , 3 , and 4 . \n ppar-1 and 2 have been identified in mouse , whereas in humans and other species , at least two other isoforms , ppar-3 and 4 , have also been detected . \n ppar-3 and 4 encode the same protein as ppar-1 , which is expressed in endothelial cells ( ecs ) , vascular smooth muscle cells ( vsmcs ) , macrophages , and cardiomyocytes . on the other hand , \n the thiazolidinedione ( tzd ) class of synthetic ppar- ligands reduces peripheral insulin resistance and has been widely used to treat type 2 diabetes mellitus . \n for instance , several reports using high - fat diet - induced obese mice demonstrated that ppar- agonists had beneficial effects on improving insulin resistance and inflammation [ 1013 ] . \n in addition , recent large clinical studies have demonstrated that a ppar- agonist had beneficial effects not only on glycemic control but also in preventing atherosclerotic disease [ 1417 ] . \n the lines of evidence derived from study of ec specific ppar- null mice [ 1820 ] and from virus - mediated constitutive expression of ppar- in human ecs have also shown important roles of ppar- on atherogenesis . increasing evidence \n has demonstrated that ppar- plays important roles in the immune system , since ppar- is expressed in inflammatory cells such as macrophages , t cells , b cells , and dendritic cells . \n these results suggest that ppar- activation is an important regulator in vascular inflammation and is expected to be a therapeutic target in the treatment of atherosclerotic complications ( figure 1 ) . \n the present paper focuses on the role of ppar- in vascular inflammation beyond its beneficial effects on glycemic control and discusses the potential therapeutic roles of regulating ppar- activation . \n ppar- has been detected in rodent macrophages , and human macrophages in atherosclerotic lesions . differentiated macrophages \n show two acquired phenotypic characteristics , the classically activated ( m1 ) phenotype and the alternatively activated ( m2 ) phenotype . \n m1 activation is triggered by stimulation such as by bacterial lipopolysaccharide ( lps ) and is associated with the production of proinflammatory cytokines including interferon- ( ifn- ) and interleukin-12 ( il-12 ) , which are linked to t helper 1 ( th1 ) immune responses . \n in contrast to m1 , m2 activation is triggered by il-4 and il-13 , which are linked to th2 responses . \n m1 macrophages produce a number of proinflammatory cytokines and express a high level of reactive oxygen species ( ros ) , having antimicrobial activity . on the other hand , \n m2 macrophages generate anti - inflammatory products and are involved in pathogen sequestration , wound healing , and phagocytosis of apoptotic cells [ 28 , 29 ] . \n the balance between these two subsets is thought to be important in regulating vascular inflammation . \n in vitro studies \n have demonstrated that ppar- agonists attenuated the gene expression and secretion of proinflammatory cytokines associated with m1 macrophages in human monocytes , such as tumor necrosis factor- ( tnf- ) , il-1 , and il-6 , and reduced the activity of macrophages including the transrepression of nuclear factor kappa b ( nf-b ) . \n in addition , troglitazone and rosiglitazone , ppar- agonists , inhibited monocyte chemotactic protein 1 ( mcp-1)-directed monocyte migration through modulation of matrix metalloproteinase-9 ( mmp-9 ) and tissue inhibitor of matrix metalloproteinase-1 ( timp-1 ) production . \n these results suggest that ppar- activation may be involved in vascular inflammation through regulating macrophage activation . \n ppar- has been also reported to be an invaluable transcriptional regulator of monocyte phenotypic differentiation . \n crosstalk between ppar- and il-4 signaling is thought to be important for m2 macrophage polarization [ 32 , 33 ] . in macrophages , \n il-4-mediated signaling activates the transcription factor , signal transducers , and activators of transcription 6 ( stat6 ) , resulting in upregulation of the expression of ppar- , ppar- coactivator-1 ( pcg-1 ) , and arg1 . \n increased pcg-1 enhances stat6 action on these genes and other genes relating to mitochondrial biogenesis , oxidative metabolism , and m2 differentiation . \n additionally , other recent studies have demonstrated that ppar--deficient macrophages were resistant to m2 polarization and promoted insulin resistance [ 29 , 34 ] . \n have demonstrated that ppar- ligands induced the differentiation of human monocytes into macrophages and enhanced the transcription of a scavenger receptor for oxidized low - density lipoprotein ( oxldl ) , cd36 . \n in addition , oxidized lipids inside the oxldl particle , including 9-hydroxyoctadecadienoic acid ( 9-hode ) and 13-hode , enhance ppar- activation . \n thus , ppar- activation in the presence of oxidized lipids could lead to a positive feedback loop to promote foam cell formation [ 37 , 38 ] . on \n the other hand , in vivo studies revealed that tzd treatment could increase macrophage cd36 expression , but did not enhance foam cell formation , suggesting that ppar- could activate other pathways that enhance cholesterol efflux and reduce intracellular cholesterol level . \n the enhancement of cholesterol efflux was mediated by the cholesterol - phospholipid transporter abca1 , which is an indirect target gene of ppar- via liver x receptor [ 39 , 40 ] . \n these results suggest that ppar- activation couples oxldl uptake to cholesterol efflux , thus enhancing the removal of oxldl from the vessel wall . \n ppar- is expressed in t cells , and its expression is increased in activated t cells . \n it is reported that ppar- activation modulates the expression of proinflammatory th1 cytokines in cd4-positive lymphocytes . \n for instance , 15-deoxy--prostaglandin j2 ( 15d - pgj2 ) , an endogenous ppar- ligand , and tzds reduced il-2 secretion from murine t cell clones and inhibited il-2 production and phytohemagglutinin - inducible proliferation in human t cells in a dose - dependent manner . \n in addition , ppar- activators inhibited the expression of proinflammatory cytokines such as interferon- ( ifn- ) , tnf- , and il-2 , leading to attenuation of human monocyte cd64 expression and human endothelial cell major histocompatibility complex class ii induction . in a well - established mouse colitis model \n , it is reported that tzds attenuated intestinal inflammation , at least in part , due to immune deviation away from th1 and towards th2 cytokine production . th17 cells and a proinflammatory cytokine , il-17 , secreted by them have been reported to be involved in the pathogenesis of atherosclerotic disease . \n recently , klotz et al . have indicated that ppar- activation can regulate the differentiation and function of th17 cells , a newly identified t cell subset . \n ppar- activators could suppress the differentiation of th17 cells by inhibiting the upregulation of retinoic acid receptor - related orphan receptor t ( rort ) , the key transcriptional factor of th17 differentiation , in response to th17 cell - promoting cytokines , such as tgf- and il-6 . \n therefore , ppar- activation selectively suppressed th17 cell differentiation , but not the differentiation of th1 , th2 , or regulatory t cells ( treg ) . \n pharmacologic activation of ppar- prevented removal of the silencing mediator for retinoid and thyroid hormone receptors corepressor from the rort promoter in t cells , thus interfering with rort transcription . \n both t cell - specific ppar- knockout and endogenous ligand activation revealed the physiological role of ppar- in continuous t cell intrinsic control of th17 differentiation . \n cd4+cd25 + tregs also play an important role in the pathogenesis of atherosclerosis and are expected to be a novel therapeutic target to attenuate atherosclerosis and stabilize vulnerable plaques . \n the ppar- ligand , ciglitazone , enhanced the conversion of effector t cells to tregs in vitro and had an enhancing effect on both natural and inducible tregs . \n moreover , lei et al . have demonstrated that ppar- activation with endogenous and synthetic ligands together with transforming growth factor- ( tgf- ) elicited foxp3 deoxyribonucleic acid ( dna ) methylation through potent downregulation of dna methyltransferases ( dnmts ) such as dnmt1 , 3a , and 3b , and induced potent and stable foxp3 , resulting in the generation of functional inducible tregs . \n b cells play an important role in atherosclerosis and are thought to have atherogenic and antiatherogenic effects according to their subtype . \n mature b cells are categorized into three subtypes according to their surface antigens : conventional b2 b cells , b1 b cells , and marginal zone b cells . \n the conventional b2 b cell plays an important role in adaptive immunity by producing specific antibodies to cognate antigens . \n the b1 b cell , which is found primarily in serosal cavities such as the peritoneal and pleural cavities , is important in innate immunity and responsible for production of natural igm antibodies . the marginal zone b cell in splenic tissue plays a role in first - line defense against circulating blood - borne antigens . \n b1 b cells are thought to have a protective effect against atherogenicity [ 52 , 53 ] . on the other hand \n , it seems that b2 b cells are involved in atherosclerosis , since native conventional b2 b cells can differentiate into two effector b cells , so - called be1 and be2 b cells . \n be1 b cells produce th1 cytokines including inf- , il-2 and il-12 , whereas be2 b cells secrete il-4 , il-6 and il-10 , which are th2 cytokines . \n it is reported that these cytokines secreted by be cells enhance immunomodulation during chronic inflammation . \n however , the detailed role of be1 and be2 b cells in atherosclerosis remains to be elucidated . \n recently , regulatory b cells that produce il-10 have been recognized as an important component of the immune system [ 5559 ] . \n regulatory b cells secrete il-10 , and this may lead to suppression of both th1 and th2 polarization and inhibition of proinflammatory cytokine production from macrophages and dc . the role of regulatory b cells in atherosclerosis also remains to be elucidated , but they may attenuate the progression of atherosclerosis . \n most studies of the effect of ppar- activation on b cells focus on the apoptotic effect of endogenous and synthetic ligands on normal or b lymphoma cells . \n recent reports demonstrated that detailed roles of ppar- and rxr agonists in ppar- agonist - induced apoptosis of b cells were activation of mitogen - activated protein kinases ( mapks ) , inhibition of nuclear factor - kappa b ( nf-b ) , and cd40 activation [ 6266 ] . on the other hand , a recent paper by garcia - bates et al . \n they demonstrated that activated b cells have upregulated expression of ppar-. in addition , nanomolar levels of ppar- ligands , such as 15d - pgj2 and rosiglitazone , enhanced b cell proliferation and significantly stimulated plasma cell differentiation and antibody production . \n the simultaneous addition of nanomolar concentrations of the rxr ligand , 9-cis - retinoic acid , and ppar- ligands to cpg - activated b cells resulted in additive effects on b cell proliferation , plasma cell differentiation , and antibody production . \n this result suggests that ppar- activation may also regulate the function and differentiation of b cells . \n however , the link between ppar- activation and b cell function in atherosclerosis is still unclear . \n dc contributes to chronic vascular inflammation , leading to atherosclerosis and its complications [ 6870 ] . \n in fact , a number of dc has been observed in atherosclerotic lesions of mouse models [ 7173 ] and in human advanced plaques [ 7476 ] . in normal conditions \n , dc is professional antigen - presenting cell that presents many kinds of endogenous and exogenous antigens to t cells , providing an important link between innate and adaptive immune responses . \n additionally , many lines of evidence have demonstrated that dc contributes to the pathogenesis and progression of atherosclerosis [ 6870 ] . \n dc accumulates in the intima of atherosclerotic lesions through vascular cell adhesion molecule-1 ( vcam-1 ) and cx3c chemokine receptor 1 ( cx3cr1 ) during low - grade chronic inflammation [ 72 , 78 ] . \n dc may differentiate from ly6 monocytes that cx3cr1-dependently patrol arterial vessels , but can also differentiate from ly6 monocytes , which seem to be preferentially recruited . in intimal proliferation of dc , granulocyte macrophage colony - stimulating factor ( gm - csf ) is thought to be important [ 79 , 80 ] . \n excess lipoproteins deposited in the arterial wall accumulate within lipid - loaded cd11c dc , contributing to early - stage plaque formation . \n dc also regulates t cell activation in the vessel wall and influence helper t cell responses , with lipoprotein being able to contribute to dc maturation and activation . \n for instance , conventional dc ( cdc ) can participate in interaction with t and natural killer t cells , which results in increased production of ifn- , il-17 , and tnf- from t cells . \n activation of cd36 and toll - like receptors ( tlrs ) in cd11b+cd11c+ dc and cdc by lipids results in increased secretion of various dc - derived cytokines , such as il-6 , il-12 , and tnf- . \n plasmacytoid dc ( pdc ) has been shown to produce amounts of type i ifns ( ifn- and ) , which play a proatherogenic role . \n ppar- is expressed in murine and human dc , and ppar- activation has been shown to be involved in dc function [ 8390 ] . \n ppar- ligands inhibited the production of il-12 and several cytokines such as chemokine ( c - x - c motif ) ligand 1 ( cxcl1 ) and chemokine ( c - c motif ) ligand 5 ( ccl5 ) [ 85 , 86 ] . \n moreover , ppar- inhibited the maturation of dc and attenuated the expression of cd1a , cd40 , cd80 , cd83 , and chemokine ( c - c motif ) receptor 7 ( ccr7 ) [ 85 , 88 , 90 ] . \n these results indicate that ppar- activation by synthetic ligands reduced the ability of dc to stimulate lymphocyte proliferation and to prime antigen - specific t cell responses . \n neutrophils , as well as macrophages , lymphocytes , and dc , also play crucial roles in atherogenesis [ 91 , 92 ] . neutrophils and their mediators have been detected in mouse and human atherosclerotic lesions [ 9395 ] . \n an increased number of circulating neutrophils are also observed in pathological conditions such as hyperlipidemia . \n neutrophils are recruited into atherosclerotic lesions via specific chemokine receptors , including ccr1 , 2 , 5 , and cxcr2 . \n oxldl may induce the transmigration of neutrophils and release of ros and granule proteins from neutrophils , which trigger monocyte recruitment and extravasation directly or indirectly through upregulation of adhesion molecules on endothelial cells . \n in addition , apoptotic neutrophils sustain monocyte recruitment via various find - me and eat - me signals . \n several lines of evidence have demonstrated the presence of ppar- in neutrophils , and have shown a suppressive effect of ppar- activation by endogenous and synthetic ligands on neutrophil infiltration in various animal models of inflammation [ 98103 ] . a recent study by napimoga et al . reported that administration of 15d - pgj2 , an endogenous ppar- ligand , decreased leukocyte rolling and adhesion to inflamed mesenteric tissue by a mechanism dependent on no . \n specifically , pharmacological inhibitors of no synthase ( nos ) abrogated the 15d - pgj2-mediated suppression of neutrophil migration to the inflammatory site . \n moreover , inducible nos mice were not susceptible to 15d - pgj2-mediated suppression of neutrophil migration to inflammatory sites compared with their wild type . \n in addition , 15d - pgj2-mediated suppression of neutrophil migration appeared to be independent of the production of cytokines and chemokines , since their production was not significantly affected in the carrageenan - injected peritoneal cavity . \n these findings demonstrated that 15d - pgj2 suppresses inflammation - initiated neutrophil migration in a mechanism dependent on no production in mesenteric tissue . \n however , the detailed role of neutrophil regulation by ppar- ligands in atherosclerosis remains to be elucidated and further studies are needed . \n as described above , ppar- activation is expected as a therapeutic target for improving cardiovascular risk factors . however , its safety is controversial in clinical use , since several reports pointed out an increase in risk of ischemic cardiovascular events with ppar- agonists . \n meta - analysis of randomized controlled trials has suggested that rosiglitazone , one of tzd , increased risk of ischemic cardiovascular events [ 105 , 106 ] . in contrast , meta - analysis of clinical trials of another tzd , pioglitazone has also reported the possibility of an ischemic cardiovascular benefit by pioglitazone ; however , both tzds are reported to increase the risk of congestive heart failure . \n recently , meta - analysis of observational studies that directly compared the risk of cardiovascular outcomes for rosiglitazone and pioglitazone among patients with t2 dm has demonstrated that the use of rosiglitazone was associated with significantly higher odds of congestive heart failure , myocardial infarction , and death compared with that of pioglitazone . \n however , whether any meaningful difference exists in the magnitude of risk between two tzds is still unclear . \n the european medicines agency has recommended the suspension of marketing authorization for rosiglitazone , whereas the us food and drug administration has allowed the continued marketing of rosiglitazone with additional restrictions . \n further studies are required to understand these contradictory effects of ppar- agonists in the future . \n vascular inflammation - induced atherosclerosis is one of the most worrying common problems throughout the world . \n as described above , ppar- has a wide range of roles in the pathogenesis and progression of atherosclerosis via regulation of inflammatory cells , including monocytes / macrophages , lymphocytes , dendritic cells , and neutrophils . \n although regulation of ppar- activity may not alter the underlying cause of the disease , it may regulate pathological conditions , resulting in clinical benefit . \n several recent experimental and clinical findings have supported the potential utility of regulating ppar- activity as a therapeutic approach for atherosclerosis . \n further accumulation of experimental and clinical evidence on the relationship between ppar- and vascular inflammation may contribute to solving this problem .", "role": "user" }, { "content": "vascular inflammation plays a crucial role in atherosclerosis , and its regulation is important to prevent cerebrovascular and coronary artery disease . \n the inflammatory process in atherogenesis involves a variety of immune cells including monocytes / macrophages , lymphocytes , dendritic cells , and neutrophils , which all express peroxisome proliferator - activated receptor- ( ppar- ) . \n ppar- is a nuclear receptor and transcription factor in the steroid superfamily and is known to be a key regulator of adipocyte differentiation . increasing evidence from mainly experimental studies \n has demonstrated that ppar- activation by endogenous and synthetic ligands is involved in lipid metabolism and anti - inflammatory activity . \n in addition , recent clinical studies have shown a beneficial effect of thiazolidinediones , synthetic ppar- ligands , on cardiovascular disease beyond glycemic control . \n these results suggest that ppar- activation is an important regulator in vascular inflammation and is expected to be a therapeutic target in the treatment of atherosclerotic complications . \n this paper reviews the recent findings of ppar- involvement in vascular inflammation and the therapeutic potential of regulating the immune system in atherosclerosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the concept of mild cognitive impairment ( mci ) is classified , in older subjects , as a more deficient state than expected for their age and sociocultural level , but not severe enough to define it as dementia . \n this state is often characterized as the prodromal phase of several dementia pathologies;1 and so , its early diagnosis is of major importance in the implementation of adapted care . \n executive functions ( ef ) are among cognitive functions that are rapidly altered in mci subjects.2,3 several studies have reported that an early ef deficit in subjects with mci can predict the occurrence of dementia pathologies.4,5 ef includes a group of cognitive processes ( mental inhibition , planning , mental flexibility , updating , control abilities ) that enable a subject to adapt to a new and/or complex situation.6 mental flexibility , a dominant cognitive function in most cognitive models,7 is defined as the ability to go from one cognitive task to another . among the neuropsychological tests that evaluate this cognitive function , the trail - making test ( tmt)8 is the most - used clinically , because it can be administered quickly and it evaluates several aspects : visual conception , visuospatial abilities , visuomotor coordination , divided attention , and alternation tasks.9 tmt also has good power to predict the development of dementia,4 which justifies its use for the detection of cognitive impairment in older subjects . \n many other neuropsychological tests that evaluate ef are used in the diagnosis of mci.10,11 however , most of these tests have numerous limitations ( the problem of novelty , lack of sensitivity and specificity , patient cognitive reserve , etc).12,13 this recent observation underscores the need to find new detection indicators for cognitive impairment . with this in perspective , a new approach associates walking performance of older subjects with the presence and/or appearance of cognitive impairment . \n in fact , numerous longitudinal studies have reported that a reduction in walking speed is associated with the occurrence of negative events , such as cognitive decline14 and dementia of the alzheimer type15 or non - alzheimer type.16,17 gait and cognition , long studied separately , appear to be closely linked , beginning in the early stages of dementia.18 indeed , the association of motor and cognitive impairment in subjects with mci is strongly associated with a high risk of developing subsequent dementia.19,20 this new approach supposes the existence of a direct link between ef performances ( mental inhibition , working memory , etc ) and single- and dual - task walking abilities . \n this relationship has been shown in healthy older subjects21,22 and in subjects with dementia.23 moreover , several studies have revealed that tmt score is strongly correlated with overall physical abilities,24 as measured in functional tests24,25 and walking performance in complex situations.2629 at the same time , studies in the literature have reported several adaptations of tmt to locomotion , creating original and complex walking tasks.3032 in 2008 , persad et al showed , through one of these tests , called the walking trail - making test ( wtmt ) , that subjects with dementia and mci with dysexecutive syndrome differentiated themselves from other older subjects by locomotor performance that was significantly more altered.31 in this context , new walking tests that included spatial navigation were developed for early detection of cognitive impairment in an ageing population.33 we demonstrated that an adaptation of the stroop test to walking , by analysis of dual - task locomotor performances , made early detection of dysexecutive - type cognitive impairment possible in patients who no longer had diagnoses of mci , but were considered as blmci.33 the aim of this study was to determine if the analysis of walking variables during an adaptation of tmt to locomotion ( wtmt ) is an effective means to detect cognitive impairment . \n our study population was made up of 15 young subjects ( mean age : 21.12.2 years [ 2030 years ] ) and 35 older adults ( mean age : 75.36.8 years [ 6585 years ] ) . \n this population included young adults , healthy older subjects , and subjects with mci from high socioprofessional categories ; all subjects had college graduate education levels . \n the healthy older subjects were recruited from cultural associations ; the young subjects were students . \n mci patients were evaluated by a geriatrician or a neurologist ( in memory centers ) and fulfilled the criteria established by petersen ( 2004).1 these subjects presented a memory complaint or had cognitive impairment , identified by neuropsychological tests . \n they also had an absence of functional impairment and , of course , an absence of dementia.1 the cognitive work - up used to determine cognitive performance enabled us to identify a group of 26 healthy subjects : 15 young healthy ( yh ) subjects , 11 older healthy ( oh ) subjects , and 15 mci subjects , divided into subgroups according to petersen s criteria ( six subjects with isolated impairment of mci amnestic functions [ amci ] ; three subjects with non - amnestic mci , with isolated impairment of executive functions [ namci ] ; and six subjects with multiple domain mci cognitive impairment with dysexecutive symptoms [ mdmci ] ) . \n we noted and differentiated nine subjects who were not diagnosed with mci , but whose ef test performances were consistently at the threshold of pathologic levels . \n ( blmci).33 inclusion criteria were : to be willing to actively participate in the study , live in a non - institutional environment , and be able to get around on an everyday basis without technical assistance . \n exclusion criteria were : uncorrected visual impairment , a neurologic pathology ( parkinson s disease , stroke , etc ) , orthopedic surgery of the lower limbs , depression , and the taking of medications that could influence posture and/or gait . \n all subjects consulted with a doctor , to verify inclusion and exclusion criteria . prior to inclusion in the study \n the subjects first underwent an evaluation of cognitive functions by a neuropsychologist , using the mini - mental state examination34 and the frontal assessment battery.35 each subject was assessed using the stroop color - word test , the wechsler adult intelligence scale ( wais ) iii , the clock - drawing test , and the corsi block - tapping test . \n the dominant cognitive function in our study was mental flexibility , which was tested using the tmt.8 the tmt is a paper and pencil test that consists of linking targets as quickly as possible , in numeric order in part a , ( ie , 125 ) , and alternating between numbers and letters in part b ( ie , 1a2b3c).8 it evaluates visual perception abilities , perceptual / motor speed , and speed processing in part a , and mental flexibility in part b. delta tmt ( tmt ) ( tmt b \n tmt a ) is considered the best indicator of ef performance.9 finally , we performed a motor evaluation of single - task , spontaneous walking for 10 minutes , in a normal environment on a pressure - sensitive , portable walkway ( length : 793 cm ; width : 61 cm ; height : 0.6 cm ) ( gaitrite , cir systems inc , sparta , nj , usa ) . in order to derive a value representative of single - task locomotor abilities , \n subjects were asked to walk five times , at a spontaneous pace , from which walking speed , frequency , cycle time , and time in double support were calculated . \n the wtmt is an adaptation to walking of a traditional neuropsychological test , the tmt . \n we used an experimental protocol similar to that of persad,31 by reproducing the different stages proposed by those authors ( figure 1 ) . in the wtmt - n part \n first , the subject is asked to walk on 20 numeric targets , in increasing order ( ie , 120 ) . in the wtmt - a part , the wtmt - n includes 20 other , associated targets , considered as distraction targets . \n these targets , which the subject must avoid during the test , have been added to provide an attentional aspect to the walking test . \n finally , the third part , called wtmt - b , evaluates mental flexibility abilities . for this test \n , subjects are asked to walk on targets , alternating between numbers and letters , while avoiding the 20 distraction targets ( ie , 1a2b3c ) . \n the main modification of the tmt , relative to the 2008 study by persad et al , is that our targets were drawn on a removable cloth support of five - meter length , which covered the eight - meter electronic walkway . \n this device , therefore , provided a recording of all of the wtmt walking variables . in order to study locomotor performances , we selected four spatiotemporal walking variables : speed , frequency , double support time , and cycle time . in this circumstance , the carpet is black and the targets are white , in order to increase contrast and reduce the risk of instability that is linked to the treatment of information . indeed , in 1991 , \n lord et al demonstrated that reduction of ability to distinguish characters with low contrast was a strong predictor of the risk of falling.36 the subjects received the following instruction , to perform the two tasks as best they could : walk as fast as possible and do the wtmt exercise without making any mistakes . \n each condition had a familiarization and learning phase ( over a distance of 2 meters ) , which was repeated until the subject understood the task to be accomplished ( a maximum of three repetitions were allowed ) . during the test , \n the result was considered to be positive when the subject touched the correct targets with his or her foot . \n each condition was filmed using a webcam ( 640 480 pixel resolution ) that was synchronized with the electronic walkway , in order to detect errors accurately . \n this video camera was placed in front of the electronic walkway , in line with the anteroposterior axis of travel . \n we noted the number of errors the subjects made on the test ( expressed in percentages of subjects who made the fewest errors ) . \n our study population was made up of 15 young subjects ( mean age : 21.12.2 years [ 2030 years ] ) and 35 older adults ( mean age : 75.36.8 years [ 6585 years ] ) . \n this population included young adults , healthy older subjects , and subjects with mci from high socioprofessional categories ; all subjects had college graduate education levels . \n the healthy older subjects were recruited from cultural associations ; the young subjects were students . \n mci patients were evaluated by a geriatrician or a neurologist ( in memory centers ) and fulfilled the criteria established by petersen ( 2004).1 these subjects presented a memory complaint or had cognitive impairment , identified by neuropsychological tests . \n they also had an absence of functional impairment and , of course , an absence of dementia.1 the cognitive work - up used to determine cognitive performance enabled us to identify a group of 26 healthy subjects : 15 young healthy ( yh ) subjects , 11 older healthy ( oh ) subjects , and 15 mci subjects , divided into subgroups according to petersen s criteria ( six subjects with isolated impairment of mci amnestic functions [ amci ] ; three subjects with non - amnestic mci , with isolated impairment of executive functions [ namci ] ; and six subjects with multiple domain mci cognitive impairment with dysexecutive symptoms [ mdmci ] ) . \n we noted and differentiated nine subjects who were not diagnosed with mci , but whose ef test performances were consistently at the threshold of pathologic levels . \n ( blmci).33 inclusion criteria were : to be willing to actively participate in the study , live in a non - institutional environment , and be able to get around on an everyday basis without technical assistance . \n exclusion criteria were : uncorrected visual impairment , a neurologic pathology ( parkinson s disease , stroke , etc ) , orthopedic surgery of the lower limbs , depression , and the taking of medications that could influence posture and/or gait . \n all subjects consulted with a doctor , to verify inclusion and exclusion criteria . prior to inclusion in the study \n the subjects first underwent an evaluation of cognitive functions by a neuropsychologist , using the mini - mental state examination34 and the frontal assessment battery.35 each subject was assessed using the stroop color - word test , the wechsler adult intelligence scale ( wais ) iii , the clock - drawing test , and the corsi block - tapping test . \n the dominant cognitive function in our study was mental flexibility , which was tested using the tmt.8 the tmt is a paper and pencil test that consists of linking targets as quickly as possible , in numeric order in part a , ( ie , 125 ) , and alternating between numbers and letters in part b ( ie , 1a2b3c).8 it evaluates visual perception abilities , perceptual / motor speed , and speed processing in part a , and mental flexibility in part b. delta tmt ( tmt ) ( tmt b \n tmt a ) is considered the best indicator of ef performance.9 finally , we performed a motor evaluation of single - task , spontaneous walking for 10 minutes , in a normal environment on a pressure - sensitive , portable walkway ( length : 793 cm ; width : 61 cm ; height : 0.6 cm ) ( gaitrite , cir systems inc , sparta , nj , usa ) . in order to derive a value representative of single - task locomotor abilities , \n subjects were asked to walk five times , at a spontaneous pace , from which walking speed , frequency , cycle time , and time in double support were calculated . \n the wtmt is an adaptation to walking of a traditional neuropsychological test , the tmt . \n we used an experimental protocol similar to that of persad,31 by reproducing the different stages proposed by those authors ( figure 1 ) . in the wtmt - n part \n first , the subject is asked to walk on 20 numeric targets , in increasing order ( ie , 120 ) . in the wtmt - a part , the wtmt - n includes 20 other , associated targets , considered as distraction targets . \n these targets , which the subject must avoid during the test , have been added to provide an attentional aspect to the walking test . \n finally , the third part , called wtmt - b , evaluates mental flexibility abilities . for this test , \n subjects are asked to walk on targets , alternating between numbers and letters , while avoiding the 20 distraction targets ( ie , 1a2b3c ) . \n the main modification of the tmt , relative to the 2008 study by persad et al , is that our targets were drawn on a removable cloth support of five - meter length , which covered the eight - meter electronic walkway . \n this device , therefore , provided a recording of all of the wtmt walking variables . in order to study locomotor performances , we selected four spatiotemporal walking variables : speed , frequency , double support time , and cycle time . in this circumstance , the carpet is black and the targets are white , in order to increase contrast and reduce the risk of instability that is linked to the treatment of information . indeed , in 1991 , \n lord et al demonstrated that reduction of ability to distinguish characters with low contrast was a strong predictor of the risk of falling.36 the subjects received the following instruction , to perform the two tasks as best they could : walk as fast as possible and do the wtmt exercise without making any mistakes . \n each condition had a familiarization and learning phase ( over a distance of 2 meters ) , which was repeated until the subject understood the task to be accomplished ( a maximum of three repetitions were allowed ) . during the test , \n the result was considered to be positive when the subject touched the correct targets with his or her foot . \n each condition was filmed using a webcam ( 640 480 pixel resolution ) that was synchronized with the electronic walkway , in order to detect errors accurately . \n this video camera was placed in front of the electronic walkway , in line with the anteroposterior axis of travel . \n we noted the number of errors the subjects made on the test ( expressed in percentages of subjects who made the fewest errors ) . \n our aim was to detect the possible existence of executive function impairment from wtmt walking characteristics only . \n the ascendant hierarchic classification method , or cluster analysis ( ward s method,37 euclidean distance ) , makes it possible to regroup subjects , according to their functional similarities , from the spatiotemporal parameters of walking . the differences between groups formed by the cluster analysis method , \n be it wtmt or cognitive and functional tests , were studied using analysis of variance ( anova ) , followed by a post hoc tukey s test . \n the correlation coefficient between tmt and single - task walking speed and the correlation coefficient between tmt and wtmt were studied using pearson s r coefficient . \n statistical analysis was performed using statistica version 9 software ( statsoft inc , tulsa , ok , usa ) . \n finally , when one attempts to detect a syndrome from a test , one determines the sensitivity and specificity values for this test . for our experimental conditions , sensitivity and specificity values for the detection of the mci syndrome by wtmt \n were calculated using the following formulas : low performance refers to the motor performance of the group with the largest deficit in the wtmt , and high performance refers to the group with the best gait parameters in navigational tasks.33 \n wtmt cluster analysis ( figure 2 ) includes the subjects locomotor performances for the entire test . \n classification by the ascendant hierarchic method revealed three distinct branches , with a euclidean distance of < 20 and a reunification at 50 ( figure 2 ) . \n the r ratio calculation38 distinguished three , apparently different , walking abilities for the entire test . \n we studied the morphological and psychobehavioral characteristics ( age , cognitive ability ) of the subjects in each group ( figure 3 ) . \n overall , the subjects in group 2 were much younger than those in groups 1 and 3 , and the subjects in group 1 had significantly more ef deterioration ( frontal assessment battery ; tmt ) than the subjects in groups 2 and 3 ( table 1 ) . \n more precisely , group 1 mainly included older subjects presenting a decline in ef ( namci , mdmci ) , or cognitive fragility of the dysexecutive type ( blmci ) , including 17 older subjects ( five older , 12 very elderly ) : two healthy , six mdmci , five blmci , three namci , and one amci , whereas group 2 was made up of 15 subjects ( 14 young , one older ) : 14 young and healthy , and one amci . \n it was made up of 18 subjects ( one young , 12 older , five very elderly ) : ten healthy , four blmci , and four amci . \n the wtmt detected dysexecutive syndrome ( namci and mdmci ) with 100% sensitivity and 80% specificity . \n this test also made it possible to detect ef fragility , beginning at the blmci stage , with 78% sensitivity and 90% specificity . \n we first observed that the subjects in group 1 walked more slowly than the subjects in group 2 during the single - task walking test , and that there was not a significant difference between the subjects in groups 2 and 3 ( table 1 ) . on the other hand , during the wtmt , the locomotor performances of group 1 subjects were significantly worse than those of group 3 , whose performances were worse than those of group 2 ( table 1 ) . \n this impairment in locomotor abilities during wtmt was observed by reductions in walking speed ( f=78.7 ; p<0.001 ) and walking frequency ( f=76.4 ; p<0.001 ) , and by increases in cycle time ( f=113.3 ; p<0.001 ) and percentage in double support ( f=47.6 ; p<0.001 ) ( table 1 ) . \n lastly , the number of subjects making errors was higher in group 1 than in the other groups ( p=0.009 ) ( table 1 ) . \n finally , as for the link between cognitive and motor abilities , performance in tmt was significantly correlated with wtmt walking speed ( r=0.54 , p<0.05 ) , but not with single - task walking speed ( r=0.10 ) . \n wtmt cluster analysis ( figure 2 ) includes the subjects locomotor performances for the entire test . \n classification by the ascendant hierarchic method revealed three distinct branches , with a euclidean distance of < 20 and a reunification at 50 ( figure 2 ) . \n the r ratio calculation38 distinguished three , apparently different , walking abilities for the entire test . \n we studied the morphological and psychobehavioral characteristics ( age , cognitive ability ) of the subjects in each group ( figure 3 ) . \n overall , the subjects in group 2 were much younger than those in groups 1 and 3 , and the subjects in group 1 had significantly more ef deterioration ( frontal assessment battery ; tmt ) than the subjects in groups 2 and 3 ( table 1 ) . \n more precisely , group 1 mainly included older subjects presenting a decline in ef ( namci , mdmci ) , or cognitive fragility of the dysexecutive type ( blmci ) , including 17 older subjects ( five older , 12 very elderly ) : two healthy , six mdmci , five blmci , three namci , and one amci , whereas group 2 was made up of 15 subjects ( 14 young , one older ) : 14 young and healthy , and one amci . \n it was made up of 18 subjects ( one young , 12 older , five very elderly ) : ten healthy , four blmci , and four amci . \n the wtmt detected dysexecutive syndrome ( namci and mdmci ) with 100% sensitivity and 80% specificity . \n this test also made it possible to detect ef fragility , beginning at the blmci stage , with 78% sensitivity and 90% specificity . \n we first observed that the subjects in group 1 walked more slowly than the subjects in group 2 during the single - task walking test , and that there was not a significant difference between the subjects in groups 2 and 3 ( table 1 ) . on the other hand , during the wtmt , the locomotor performances of group 1 subjects were significantly worse than those of group 3 , whose performances were worse than those of group 2 ( table 1 ) . \n this impairment in locomotor abilities during wtmt was observed by reductions in walking speed ( f=78.7 ; p<0.001 ) and walking frequency ( f=76.4 ; p<0.001 ) , and by increases in cycle time ( f=113.3 ; p<0.001 ) and percentage in double support ( f=47.6 ; p<0.001 ) ( table 1 ) . \n lastly , the number of subjects making errors was higher in group 1 than in the other groups ( p=0.009 ) ( table 1 ) . \n finally , as for the link between cognitive and motor abilities , performance in tmt was significantly correlated with wtmt walking speed ( r=0.54 , p<0.05 ) , but not with single - task walking speed ( r=0.10 ) . \n the aim of this study was to determine if the wtmt could detect people with early - stage ef impairment . \n cluster analysis broke down the subjects into groups according to the similarities of the different walking variables . \n we noted that the groups were differentiated at both locomotor and cognitive levels . in this study , we did not note any walking variables to analyze subjects locomotor performances , but we did study the locomotor abilities of each subject during the wtmt . in the literature , one can observe that several walking variables , and not one alone , can reveal an alteration in dual - task locomotor performance.23,39 moreover , some authors have associated an alteration in cognitive functions with a reduction in walking speed.21,22,40,41 therefore , we think that integrating several walking variables in the statistical analysis reinforces the results . \n the wtmt is characterized as a complex walking task , requiring the subject to plan his / her walking in a defined space , according to a goal . \n the aim is to use walking tests that are more related to spatial navigation than to stereotyped walking in a straight line , in which the subject is able to pace his / her walking frequency depending on the cognitive task.42 detailed study of the spatiotemporal variables of walking during the wtmt revealed three distinct groups . \n group 1 subjects had the lowest performances in the wtmt and walked with cautious gaits during the test ( ie , they greatly reduced their walking speeds , significantly increasing their times in double support ) . \n group 3 subjects had intermediate locomotor performances that were between those of groups 1 and 2 , but were significantly different from each . error analysis showed that , on average , one out of two older subjects committed at least one error during the wtmt ( table 1 ) . \n therefore , group 1 subjects had the lowest performances in both domains ( physical and cognitive ) . in the literature , \n several authors have studied the performance of the elderly on the wtmt.30,31 alexander et al observed that the locomotor performances of wtmt subjects depended on their age . \n we agree with their first results because , in this study , the subjects who had the best wtmt performances were in group 2 , which was essentially made up of young adults ( 14 out of 15 subjects ) , whereas groups 1 and 3 were composed of older subjects ( > 65 years old ) . \n these results are different from those of another test that we recently developed ( the walking stroop carpet ) ; in this study , healthy older subjects were grouped with young subjects.33 the wtmt has been identified in the literature as a test that is sensitive to the alteration of cognitive functions.31 in order to study the relationship between gait and cognition in this population , we analyzed the cognitive profiles of the subjects in groups 1 and 3 . \n analysis of the different mci subgroups , according to petersen s classification ( 2004 ) , revealed that all of the mci subjects with a dysexecutive - type syndrome ( namci or mdmci ) were in group 1 ( nine out of nine subjects ) , whereas the amci subjects were mainly in group 3 ( four amci subjects out of six ) . in our study population , \n the wtmt was able to detect the dysexecutive syndrome with 100% sensitivity and 80% specificity . \n persad et al ( 2008 ) reported similar results , since the group with ef alteration ( namci and alzheimer patients ) had wtmt - b performances that were significantly more altered than the group of subjects without ef alteration ( amci and healthy subjects).31 this strong relationship between ef impairment and reduction in walking abilities can be found in the literature , in particular , in studies of tmt performance . \n first of all , many authors have reported that low tmt performances are associated with a reduction in the overall physical abilities of older subjects,25 of subjects with mci,43 and even as a predictor of early morbidity.24 moreover , analysis of walking abilities has revealed that older subjects whose tmt performances were the poorest also presented a reduction in complex walking exercises , such as the figure - of - eight walk test,28 a seven - meter walk , with obstacles.26,27 in the present study , we found the same relationship , since the tmt score was significantly correlated with walking speed during the wtmt , but not with single - task walking speed . \n this relationship between cognitive and locomotor abilities does not appear to be linked with amnestic abilities.21,31,44 in this study , the amci and healthy older subjects were classified into the same groups according to their locomotor performances . \n one can suppose , therefore , that amnestic abilities do not have an impact on wtmt performance . thorough clinical analysis of the older population revealed the presence of blmci : subjects who presented neuropsychological test performances that were consistently on the verge of the pathological threshold.33 we noted that some blmci subjects were classified by their wtmt locomotor performances ( five out of nine subjects ) in the same group ( group 1 ) as the mci subjects with ef impairment ( figure 3 ) . \n we can suppose that a complex walking exercise , such as the wtmt , makes it possible to detect subjects who were not diagnosed as mci by traditional neuropsychological tests , but who , nevertheless , presented common impairments ( alterations of locomotor abilities during complex walking , and reduction in ef performances ) . \n the wtmt has the ability to detect early ef ( ie , the blmci stage ) with 78% sensitivity and 90% specificity . \n these values are slightly inferior to those obtained with the walking stroop carpet.33 we suppose that blmci subjects who present a major modification in walking variables during wtmt are more at risk to evolve towards an mci state , even to dementia . indeed , several authors have reported that subjects with mci who have an abnormal gait during dual - task or complex walking situations are more at risk of developing dementia.1820,45 these hypotheses suggest , once again , that walking impairment could play an important role in the diagnosis of dementia and that , even before the mci stage , we can detect , through complex walking tests , older subjects who are likely to deteriorate at a cognitive level . \n these differences in detection abilities , between our tests and those currently used , can be explained by the numerous limitations presented by traditional neuropsychological tests . \n indeed , the performances of neuropsychological tests to evaluate ef vary according to numerous parameters , such as a lack of novelty , diagnostic variations dependent on threshold values,46 and the taking of medications.13 moreover , the older subjects who participated in our study had high levels of education and were from high socioprofessional categories . therefore , it is probable that these subjects had sufficient cognitive reserve to respond to traditional neuropsychological tests . \n on the other hand , we can suppose that this cognitive reserve would be negatively affected in a complex walking situation or when great attention is required.47 \n detailed study of the spatiotemporal variables of walking during the wtmt revealed three distinct groups . \n group 1 subjects had the lowest performances in the wtmt and walked with cautious gaits during the test ( ie , they greatly reduced their walking speeds , significantly increasing their times in double support ) . \n group 3 subjects had intermediate locomotor performances that were between those of groups 1 and 2 , but were significantly different from each . \n error analysis showed that , on average , one out of two older subjects committed at least one error during the wtmt ( table 1 ) . \n therefore , group 1 subjects had the lowest performances in both domains ( physical and cognitive ) . in the literature , \n several authors have studied the performance of the elderly on the wtmt.30,31 alexander et al observed that the locomotor performances of wtmt subjects depended on their age . \n we agree with their first results because , in this study , the subjects who had the best wtmt performances were in group 2 , which was essentially made up of young adults ( 14 out of 15 subjects ) , whereas groups 1 and 3 were composed of older subjects ( > 65 years old ) . \n these results are different from those of another test that we recently developed ( the walking stroop carpet ) ; in this study , healthy older subjects were grouped with young subjects.33 the wtmt has been identified in the literature as a test that is sensitive to the alteration of cognitive functions.31 in order to study the relationship between gait and cognition in this population , we analyzed the cognitive profiles of the subjects in groups 1 and 3 . \n analysis of the different mci subgroups , according to petersen s classification ( 2004 ) , revealed that all of the mci subjects with a dysexecutive - type syndrome ( namci or mdmci ) were in group 1 ( nine out of nine subjects ) , whereas the amci subjects were mainly in group 3 ( four amci subjects out of six ) . in our study population , \n the wtmt was able to detect the dysexecutive syndrome with 100% sensitivity and 80% specificity . \n persad et al ( 2008 ) reported similar results , since the group with ef alteration ( namci and alzheimer patients ) had wtmt - b performances that were significantly more altered than the group of subjects without ef alteration ( amci and healthy subjects).31 this strong relationship between ef impairment and reduction in walking abilities can be found in the literature , in particular , in studies of tmt performance . \n first of all , many authors have reported that low tmt performances are associated with a reduction in the overall physical abilities of older subjects,25 of subjects with mci,43 and even as a predictor of early morbidity.24 moreover , analysis of walking abilities has revealed that older subjects whose tmt performances were the poorest also presented a reduction in complex walking exercises , such as the figure - of - eight walk test,28 a seven - meter walk , with obstacles.26,27 in the present study , we found the same relationship , since the tmt score was significantly correlated with walking speed during the wtmt , but not with single - task walking speed . \n this relationship between cognitive and locomotor abilities does not appear to be linked with amnestic abilities.21,31,44 in this study , the amci and healthy older subjects were classified into the same groups according to their locomotor performances . \n one can suppose , therefore , that amnestic abilities do not have an impact on wtmt performance . \n thorough clinical analysis of the older population revealed the presence of blmci : subjects who presented neuropsychological test performances that were consistently on the verge of the pathological threshold.33 we noted that some blmci subjects were classified by their wtmt locomotor performances ( five out of nine subjects ) in the same group ( group 1 ) as the mci subjects with ef impairment ( figure 3 ) . \n we can suppose that a complex walking exercise , such as the wtmt , makes it possible to detect subjects who were not diagnosed as mci by traditional neuropsychological tests , but who , nevertheless , presented common impairments ( alterations of locomotor abilities during complex walking , and reduction in ef performances ) . \n the wtmt has the ability to detect early ef ( ie , the blmci stage ) with 78% sensitivity and 90% specificity . \n these values are slightly inferior to those obtained with the walking stroop carpet.33 we suppose that blmci subjects who present a major modification in walking variables during wtmt are more at risk to evolve towards an mci state , even to dementia . indeed , several authors have reported that subjects with mci who have an abnormal gait during dual - task or complex walking situations are more at risk of developing dementia.1820,45 these hypotheses suggest , once again , that walking impairment could play an important role in the diagnosis of dementia and that , even before the mci stage , we can detect , through complex walking tests , older subjects who are likely to deteriorate at a cognitive level . \n these differences in detection abilities , between our tests and those currently used , can be explained by the numerous limitations presented by traditional neuropsychological tests . \n indeed , the performances of neuropsychological tests to evaluate ef vary according to numerous parameters , such as a lack of novelty , diagnostic variations dependent on threshold values,46 and the taking of medications.13 moreover , the older subjects who participated in our study had high levels of education and were from high socioprofessional categories . \n therefore , it is probable that these subjects had sufficient cognitive reserve to respond to traditional neuropsychological tests . on the other hand \n , we can suppose that this cognitive reserve would be negatively affected in a complex walking situation or when great attention is required.47 \n our study showed that this test provides early detection of cognitive impairment , but did not give us values for clinical diagnostic use . \n it would be of interest to define a threshold value that would enable a clinician to decide on the presence of cognitive impairment and to make a diagnosis . \n such a decision value , with confidence intervals , defined according to walking speed , could be studied in a broader population , in order to improve clinical diagnosis . \n our population is small , with regard to statistical treatment , because this study was based on only 36 older subjects and 15 young subjects . \n in addition , 27 out of the 32 subjects in groups 1 and 2 were women . \n moreover , these tests should be performed on a larger population that includes alzheimer patients , in order to determine whether they present the same motor performances as dysexecutive - type mci subjects , or if they make up a new group in the cluster analysis . \n the monitoring of this population within the framework of a longitudinal study would make it possible to increase statistical power and to confirm previously developed clinical hypotheses . \n new walking tests , such as the wtmt , come close to everyday acts , in which walking situations are navigational situations , punctuated with sensory conflicts and interferences provoked by mental operations . \n the wtmt also detects older people with cognitive fragility ( blmci ) , who are likely to deteriorate . \n this test requires low - cost equipment , which makes it possible to test a large proportion of a population .", "role": "user" }, { "content": "backgroundexecutive function impairment ( in particular , mental flexibility ) in the elderly , and in patients with mild cognitive impairment ( mci ) , is strongly correlated with difficulties in performing complex walking tasks . \n the aim of this study was to determine if the adaptation of a neuropsychological test ( the trail - making test ) , to evaluate executive functions during walking , can be an early detection tool for cognitive impairment.methodsfifty subjects ( 15 young , 20 older , presumably healthy , and 15 mci ) were first evaluated for cognitive functions ( mini - mental state examination , frontal assessment battery , and trail - making test ) and motor functions ( 10-meter walking test ) . \n all subjects then performed a spatial navigation , or a complex walking test ( the walking trail - making test : [ wtmt ] ) , and their spatiotemporal walking variables were analyzed using cluster analysis.resultsfollowing evaluation of wtmt locomotor performance , cluster analysis revealed three groups that were distinctly different in age and cognitive abilities : a group of young subjects , a group of healthy older subjects , mci subjects with amnestic impairment , and a group of mci subjects with executive function impairment . \n the wtmt enabled early detection , ( ie , borderline mci ) of dysexecutive impairment , with 78% sensitivity and 90% specificity.conclusionthe wtmt is of interest in that it can help provide early detection of dysexecutive cognitive impairment .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: activation of the cellular arm of the immune system is seen as the first biological event after administration of immunotherapy , and consequently , measurement of such a response ( mostly t - cell response ) is of great interest . \n a variety of bioassays exist for immune monitoring , including the enzyme - linked immunosorbent spot ( elispot ) assay and cytometry - based tests such as intracellular cytokine staining , hla - peptide multimer staining , and the carboxyfluorescein succinimidyl ester assay ( 2427 ) . \n even though the fundamentals of these assays have been well established , a plethora of different laboratory protocols is used ( 24,27,28 ) . \n substantial variability in results among laboratories exists in multicenter trials , which hampers data reproducibility and prevents meaningful comparisons among studies ( 28 ) . \n for example , in the first cic - cri elispot proficiency panel , 36 laboratories used the elispot assay to analyze the same donor peripheral blood mononuclear cell sample for a t - cell immune response , resulting in spot counts ranging from nondetectable to strongly positive ( figure 1 ) . \n the challenge is the absence of a quality control measure for t cell based assays that can be used as a gold standard ( 29 ) , which has prevented the field from establishing t - cell response as a biomarker for immunotherapy trials and conducting reliable investigations of its relationship with clinical outcomes ( 30 ) . \n high variability of results for the enzyme - linked immunosorbent spot ( elispot ) immune response assay . \n identical peripheral blood mononuclear cell samples from the same patient were sent to 36 different laboratories experienced with elispot methodology . \n the image shows the spot count results in microtiter plates in which each well represents the result of one laboratory . \n each spot in this assay represents a single t - cell capable of reacting against a defined target antigen . \n these results reflect the outcome of the first elispot proficiency panel , which identified sources of variability among laboratories . under the auspices of cic - cri and c - imt , \n two large international immune monitoring proficiency panel programs were initiated in 2005 ( 2022 ) . \n their goals were to provide an external quality assurance process for laboratories conducting immune monitoring in clinical trials and to harmonize assay performance . \n harmonization of clinical trial conduct and data collection as established through the international conference on harmonization for good clinical practice had previously proven to be a highly successful model for improving clinical development procedures ( 31 ) . \n proficiency panels are quality control experiments in which the same patient samples are tested across multiple laboratories , using their respective protocols , and the results are centrally evaluated ( 32 ) . \n the cic - cri proficiency panel program is led by a scientific steering committee and involves a central laboratory for accrual of peripheral blood mononuclear cells , shipping logistics , and independent central data analysis . \n peripheral blood mononuclear cell samples and antigens , pretested and defined for their response status , are sent to all participating laboratories , where they are tested for response under the local conditions . \n more than 80 laboratories from 14 countries have participated , encompassing the academic , nonprofit , biotech , and pharmaceutical sectors , and the united states department of defense ( 20,22 ) . \n the objective of the first elispot panel was to identify sources of variability among assay procedures . \n the second panel adjusted these sources of variability while keeping the respective laboratory protocols intact . \n this adjustment led to a substantial reduction in variability : the percentage of participants unable to detect all responders ( six responders among eight samples ) was reduced from 47% to 14% , and the percentage of participants unable to detect 50% or more of all responders ( outliers ) dropped from 11% to 0% ( figure 2 ) . \n the combined panel results led to initial elispot harmonization guidelines ( table 2 ) ( 20 ) , which synchronize key variables across laboratories and substantially influence assay outcome but do not impose standardization of assays on individual laboratories . \n the introduction of these guidelines is central to this harmonization to provide general assistance for the conduct of the individual assay protocol in the context of standard operating procedures ( eg , exclusion of apoptotic cells , use of pretested serum for background reduction , and quality control during the computerized spot evaluation ) ( table 2 ) ( 20 ) . \n confirmatory findings from a parallel experiment were published by the c - imt proficiency panels ( 21 ) . as the use of serum is a crucial variable for elispot assays , a separate elispot proficiency panel focused on serum use and showed that serum - free medium for incubation of cells can be as effective as qualified serum - supplemented medium , thus addressing this crucial variable for assay protocols as part of the harmonization guidelines ( 33 ) . \n initial harmonization guidelines for the enzyme - linked immunosorbent spot ( elispot ) immune response assay * harmonization guidelines can be used by each individual laboratory performing an immune response assay in the context of standard operating procedures ( sops ) and without adopting a standard assay protocol . through general steps such as use of pretested serum [ or serum - free media ( 33 ) ] , exclusion of apoptotic cells from the analysis , human auditing of the computerized assay read out procedure , and training of operators on the laboratory sops , quality of assays can be substantially improved . \n effect of assay harmonization on data variability of the enzyme - linked immunosorbent spot ( elispot ) assay . in the cancer immunotherapy consortium of the cancer research institute elispot proficiency panel , \n grey bars represent the first panel round and stippled bars the second panel round . in the first panel \n round , 47% of panelists missed detection of at least one response correctly , and 11% of panelists failed to detect at least three responses correctly ( characterized as an outlier \n based on the first panel results , harmonization criteria were given to panelists , and the testing was repeated in the second panel ( stippled bars ) . \n elispot performance improved , with only 14% of panelists missing at least one responder and zero outliers . \n the first round of the hla - peptide multimer - staining panel of cic - cri allowed the formulation of initial harmonization guidelines ( 22 ) , which will likely reduce assay variability . \n these recommendations are 1 ) the use of more than two colors for staining , 2 ) the collection of more than 100 000 cd8 t cells , and 3 ) the use of a background control sample to set appropriate analytical gates ( data points of interest ) ( 22 ) . \n the second cic - cri panel round focused on confirmation of these guidelines , as well as assessment of the influence of specific protocol steps on final results . \n however , the results demonstrated that the use of standardized reagents and protocols alone does not lead to the desired performance among panelists . \n the ongoing second panel allows free choice of reagents and protocols but requires compliance with evolving minimum guidelines based on the results of the first panel . \n the clinical trial application of immune assays was addressed by an international working group , the cancer vaccine clinical trial working group ( 8) , which proposed that immunoassays in clinical trials should be performed at least at three different time points throughout any study one baseline and two follow - up time points . \n assays should be established , reproducible , and technically ( not clinically ) validated in the respective laboratories ( according to the harmonization criteria for respective assays ) . \n at least two assays should be used in parallel to demonstrate the same findings ( eg , elispot and hla - peptide multimer staining ) , which is particularly important if developmental decisions ( eg , moving a new agent into more advanced trials ) would be based on immune response data from such assays . moreover \n , the cutoff values for an immune response should be identified prospectively to define the change necessary for a response and to define the proportion of study patients needed for a positive study outcome . \n in addition , a separate initiative is under way to provide a publication framework for the results from immune monitoring trials . \n this project , named miata ( minimal information about t - cell assays ) , is currently undergoing a public consultation process to obtain community feedback ( 28 ) . \n overall , only when the issue of current assay variability is adequately addressed can cellular immune response become a reliable parameter in clinical trials and may be more reliably studied for its relationship with clinical outcomes . \n for decades , investigators have relied on modified who criteria ( 34 ) or , more recently , recist ( 35,36 ) to assess clinical activity of anticancer agents . \n these standard criteria were designed to capture effects of cytotoxic agents and depend on tumor shrinkage to demonstrate activity . \n however , the response patterns seen with immunotherapeutic agents extend beyond those of cytotoxic agents and can manifest , for example , after a period of stable disease in which there is no tumor shrinkage or after initial tumor burden increase or appearance of new lesions ( eg , tumor infiltrating lymphocytes ) ( 15,3740 ) . \n this potential delayed detection of clinical activity on radiographic assessment may reflect the dynamics of the immune system the time required for t - cell expansion followed by infiltration of the tumor and a subsequent measurable antitumor effect . \n for example , some reported clinical experiences with cancer vaccines ( 3739 ) demonstrated that patients with stable disease or progressive disease may have subsequent tumor regression , whereas others may show initial mixed responses , with regression in some lesions while other lesions remain stable , progress , or first appear . in these studies , \n patients with measurable tumor burden decrease had more responses that did not fit currently accepted response criteria than conventional responses ( eg , 5/6 and 4/5 unconventional out of all recorded responses ) ( 3739 ) . \n such patterns have been noted by many investigators ; however , they were inconsistently included in publications or were not systematically captured because of the absence of suitable response criteria ( 8) , which , in turn , did not allow for their clinical significance to be adequately studied ( 8) . it has become evident that recist or who criteria may not offer a complete description of the response to immunotherapeutic agents , and either adjusted or new criteria are needed ( 8) . similar to the immune response assays discussed above , the cancer vaccine clinical trial working group addressed the topic of clinical endpoints and potential delayed detection of clinical activity in a series of workshops . \n the main conclusions were that the appearance of measurable clinical activity at the tumor site may take longer for immunotherapies than for cytotoxic therapies ; responses to immunotherapies may occur after conventional progressive disease ( tumor burden increase ) ; discontinuation of immune therapy may not be appropriate in some cases , unless progressive disease is confirmed ( as is usually done for recist - based response ) ; there should be allowance for clinically insignificant progressive disease ( eg , small new lesions in the presence of other responsive lesions ) ; and durable stable disease may represent clinical benefit . \n such elements might be included in new antitumor response criteria that adapt standard criteria to the unique characteristics of immunotherapy ( 8) . \n building on these recommendations , a novel set of response criteria based on who and recist were evaluated in a series of large multinational studies ( 17,41,42 ) , including 487 patients with advanced melanoma participating in the bristol - myers squibb and medarex clinical trial program for ipilimumab , a fully human monoclonal antibody that blocks ctla-4 . in these studies , \n four distinct response patterns were detected : immediate response , durable stable disease , response after tumor burden increase , and response in the presence of new lesions ( figure 3 ) . \n the first two patterns are conventional ( figure 3 , a and b ) , whereas the latter two ( figure 3 , c and e ) are novel and specifically recognized with immunotherapeutic agents . \n photographs of a case study of the first novel tumor response pattern ( figure 3 , d ) show that tumor burden initially increases ( day 84 ) and then decreases ( day 112 ) to a complete response ( day 503 ) . \n importantly , all patterns ( conventional and new ) seem to be associated with favorable survival compared with patients with progressive disease by who criteria ( 43,44 ) . to create a process , which systematically captures all observed response patterns , \n clinical response patterns observed with anti - cytotoxic t lymphocyte associated protein 4 immunotherapy ( ipilimumab ) . \n immunotherapy patterns of response depicted as a continuous variable of relative change of tumor burden ( % ) over time . \n tumor burden is described through the sum of the perpendicular diameters ( spd ) of all measurable lesions ( baseline and new ) at each time point . a and b ) conventional response patterns : ( a ) immediate response ; ( b ) durable stable disease with possible slow decline in tumor burden . \n c and e ) novel immunotherapy response patterns : ( c ) increase in total tumor burden followed by response . \n ( d ) clinical images corresponding to pattern ( c ) : tumor burden on the skin at baseline ( day 0 ) is increased at first follow - up ( day 84 ) and subsequently declines ( day 112 ) to a complete response ( day 503 ) ( courtesy of dr k. harmankaya ) . \n e ) the second novel pattern shows a response in the presence of new lesions ; existing lesions present at baseline ( blue ) and new lesions ( red ) are added to define the total tumor burden ( green ) . despite new lesions \n yellow triangles indicate dosing with immunotherapy ; horizontal lines indicate standard thresholds for response or progression . \n in particular , they allow for the assessment of tumor burden as a continuous variable , which considers index lesions identified at baseline together with new lesions as they may occur after treatment start . \n measurability is defined as 5 5 mm or more on helical computer tomography scans . \n the sum of the perpendicular diameters ( spd ) of index lesions at baseline is added to that of new lesions to calculate total tumor burden according to the following formula : thus , percentage changes in tumor burden between assessment time points describe the size and growth kinetics of total measurable tumor burden over time . \n response categories under irrc are defined as immune - related complete response ( ircr ) , immune - related partial response ( irpr ) , immune - related stable disease ( irsd ) , and immune - related progressive disease ( irpd ) using the same thresholds to distinguish between categories as defined under standard who criteria ( table 3 ) . \n decrease in total measurable tumor burden is assessed relative to the baseline tumor burden , that is , spd of all index lesions at baseline . \n the response category irpd should be confirmed at two consecutive time points as already done for irpr or ircr . \n overall , immune - related response based on two or more tumor assessments is derived as shown in table 3 . \n derivation of overall immune - related response in solid tumors * after wolchok et al . \n ircr = immune - related compete response complete disappearance of all index and new measurable lesions ; irpr = immune - related partial response \n decrease in tumor volume 50% relative to baseline ; irsd = immune - related stable disease not meeting criteria for ircr or irpr , in absence of irpd ; irpd = immune - related progressive disease \n index lesions are measurable ( > 5 5 mm ) , and non - index lesions are not measurable ( < 5 5 mm , ascites , bone lesions , etc . ) . \n changes are assessed relative to baseline and include measurable lesions only ( > 5 5 mm ) . assuming response and progression are confirmed by a second assessment at least 4 weeks apart . using irrc , \n the appearance of new lesions alone does not constitute irpd if they do not add to the tumor burden by at least 25% . \n patients with new lesions but an overall tumor burden decrease qualifying for partial response ( 50% decrease ) or qualifying for stable disease ( < 50% decrease to > 25% increase ) are considered to have irpr or irsd , respectively ( same percentage changes including new lesions ) ( table 3 ) . \n these new patterns are considered clinically meaningful because they appear to be associated with favorable survival ( 43,44 ) . \n importantly , early increase in the size of lesions , which may be attributable to the infiltration of lymphocytes , does not preclude an ircr , irpr , or irsd from being obtained at the next consecutive time point . \n if a patient is classified as having irpd , confirmation by a second scan in the absence of rapid clinical deterioration is required . \n thus , the definition of confirmation of progression represents an increase in tumor burden of at least 25% compared with baseline at two consecutive time points at least 4 weeks apart . \n it is recommended that this confirmation be done at the discretion of the investigator in the context of the patient s tumor type , disease stage , and clinical status because awaiting a response after tumor burden increase may not be appropriate for patients with rapid symptomatic progression accompanied by a decline in performance status . \n in summary , the development of irrc may provide a novel and long - needed tool for clinical trials to assess signs of activity of immunotherapies . because data obtained with ipilimumab ( 43 ) suggest an association of immune - related response patterns with favorable patient survival \n , these criteria may identify important clinical patterns otherwise characterized as progressive disease by who criteria . \n further prospective evaluation of irrc in immunotherapy trials is required to confirm their clinical utility . \n in contrast to chemotherapy , for which an early clinical effect is possible , immunotherapies often demonstrate delayed clinical effects ( 12,14,17,4649 ) . for example , figure 4 shows the overall survival outcome for a study of sipuleucel - t immunotherapy vs placebo in advanced prostate cancer ( 12 ) , where the separation of kaplan meier curves occurs after approximately 8 months after random assignment . in randomized trials , \n in which immunotherapies are compared with either placebo or inactive controls , kaplan meier survival curves may be superimposable for a time before separation is observed . generally , if there is such a delayed separation , the statistical power to differentiate the entire curves is reduced ( 1,9,50 ) . \n delayed separation of survival curves of sipuleucel - t immunotherapy vs placebo in advanced prostate cancer , where the separation of kaplan meier curves occurred after approximately 8 months after random assignment . \n all rights reserved . to better understand possible lessons from existing datasets of phase iii immunotherapy trials \n , a workshop of the cic - cri in 2006 reviewed all publicly accessible data from such trials . \n this analysis suggested the possibility of a delayed separation of kaplan meier curves for immunotherapeutic agents ( mostly cancer vaccines ) ( 1 ) , including melacine in stage ii melanoma ( 46 ) , vitespen in advanced melanoma ( 47 ) , vitespen in stage ii / iii renal cell carcinoma ( 48 ) , sipuleucel - t ( 12 ) ( figure 4 ) , prostvac - vf ( 14 ) in advanced prostate cancer , and the anti - ctla-4 antibody ipilimumab in advanced melanoma ( 17,49 ) . \n a separation of curves in these trials was observed after 48 months or later following random assignment . \n however , such kinetics may differ among agents and disease settings , thus requiring individual investigation . \n the survival analysis methods commonly used to design and analyze two - arm randomized clinical trials do not have a provision for data demonstrating a delay in the separation of kaplan meier curves . \n these methods assume that the ratio of the arm - specific hazard rates ( risks for patients to experience events ) is a constant over time ( proportional hazards assumption ) and is necessary when using the standard formula for computing the number of events required for the final analysis of a trial ( 51 ) . \n furthermore , the log - rank test has optimal properties under proportional hazards , and cox regression models assume proportional hazards . under these assumptions , the hypothesized hazard ratio ( hr ) , \n describing the difference in survival between the study arms , applies immediately after random assignment , and the event rates at all times will have the same ratio to differentiate between the arms . \n initially , the hazard rates are equal , and therefore , the hazard ratio is 1.0 , and the kaplan meier curve estimates will be indistinguishable ( if an inactive comparator is used ) . \n subsequently , the hazard rates become unequal and the curves will separate . for practical purposes , \n it is assumed for this discussion that the hazard rates after the delayed clinical effect eventually become proportional . \n thus , the events occurring before the time when the hazard rates become unequal will not differentiate the study arms . as a consequence , computation of the required number of events for final analysis under proportional hazards assumptions will lead to a statistical power insufficient for a trial with a delayed separation . depending on the timing of the delay \n alternative methods should be considered to compute the required number of events for final analysis when delayed separation is expected ( 1,9 ) . \n a variety of methods including simulation and numerical integration of a proposed theoretical hazard function can be used . \n simulation is attractive because it may also account for other deviations from usual trial planning assumptions . \n however , any method used to compute the required number of events will require careful scrutiny and validation . \n another critical element for the computation of the number of events is the timing ( quantification ) of the delayed effect . \n ideally , the quantification used to compute the required events will come from previous randomized trials , possibly in the phase ii setting ( 9 ) . \n the following example illustrates the practical implications of the delayed separation on study statistical power , number of events , and study duration . \n figure 5 illustrates the mathematical form of a delayed separation , with a hazard ratio of 0.7 after the separation . \n the control arm has an exponential survival distribution with median survival of 18 months ( red dashed curve ) . \n the form of the delayed separation is specified by a hazard ratio function ( hr(t ) , solid grey line ) that has value 1.0 for the first 3 months and then decreases linearly between 3 and 6 months to become 0.7 after 6 months . the experimental arm survival distribution ( solid blue line ) \n is the result of mathematically blending the control arm survival distribution function and the hazard ratio function . \n the survival distributions in figure 5 can be used to illustrate the consequences of delayed separation . \n the following additional specifications are made : 1:1 random assignment , n = 600 , accrual time 18 months , two - sided type i error probability .05 , statistical power of 90% , and use of the log - rank statistic . under proportional hazards ( no delayed separation ) , \n 331 events are required for final analysis and are projected to occur at 2.85 years . with a delayed separation to 3 months \n as specified , 331 events would result in a statistical power estimate of only 62.7% . \n using simulations that take into account delayed separation , it is found that 90% statistical power requires 510 events and would not be realized until 5.66 years . \n the control arm has an exponential survival distribution with median survival of 18 months ( red dashed curve ) . \n the form of the delayed separation is specified by a hazard ratio function ( hr(t ) , solid gray line ) that has the value 1.0 for 3 months and then decreases linearly between 3 and 6 months to become 0.7 at 6 months and then remains constant . the experimental arm survival distribution ( solid blue line ) \n is the consequence of mathematically blending the control arm survival distribution function and the hazard ratio function . \n it is therefore recommended that the computations of the required events be based on a plausible specification of the timing of the delayed separation , the desired statistical power , use of the log - rank statistic , and the understanding that the trial will be overpowered if delayed separation is not observed or is less than that specified . \n the log - rank test is recommended for study planning and final analysis to avoid deviation from conventional methods , to avoid prespecification of parameters describing the delay ( 52,53 ) , and as a hedge against absence of a delay . \n the cost of using the log - rank statistic is some loss of optimal conditions if a delay is present . because immunotherapeutic agents may differ regarding presence and timing of delayed separation , randomized phase ii trials \n these must be carefully considered because the presence of a delayed separation will inflate the chances of a negative early interim analysis and of concluding futility because of projected results without a delayed separation . \n as our knowledge of immunologic and clinical science has evolved ( 47 ) , we have begun to address the unique characteristics of immunotherapeutic agents in clinical trials and to use more appropriate endpoints ( 8,9,10,43 ) . \n thus , they may induce cellular immune responses before influencing tumor burden or patient survival ( 8,9 ) . for adequate investigation of immunotherapies in clinical trials , \n a new development paradigm is needed , including adjustment of established endpoints to address this biology . \n the challenges around adequate clinical endpoint use in immunotherapy trials were addressed through community - wide workshops paired with comprehensive laboratory and clinical programs providing large datasets ( 8,9,17,2022,41,42 ) . the inability to use cellular ( t - cell ) immune response assays to define biomarkers and \n to investigate their relationship with clinical outcomes has its roots in highly variable and often nonreproducible assay results in multicenter trials ( 28,30 ) . \n as was demonstrated by several large international proficiency panels , the use of harmonized assays can reduce this variability ( 2022 ) and may help to build a general framework for assay use in multicenter clinical trials similar to what the international conference on harmonization / good clinical practice did for clinical protocols . \n furthermore , harmonized assays may allow investigation of the relationship between immune responses and clinical outcomes . \n correlation of immune response and clinical outcomes would certainly accelerate the learning process regarding the biological activity of immunotherapeutic agents in the clinic and help the early selection of promising candidates for advanced trials . \n as observed in many clinical trials , immunotherapy can induce novel patterns of antitumor responses distinct from those of chemotherapy , which are consequently not captured by the who or recist criteria . in a 5-year collaborative effort between academia and industry ( 8,44 ) , \n clinical observations were translated into new response criteria ( 43 ) , which more comprehensively capture all observed response patterns . \n the irrc provide a systematic description for phenomena such as mixed responses , in which new lesions appear while existing lesions shrink or in which some lesions shrink while others grow . through the new irrc system , \n immunotherapy patterns of response are described as tumor burden over time where tumor burden is the spd of all measurable lesions ( baseline and new ) . \n the irrc are generally based on the who and recist criteria and do not require a substantial departure from standard oncology practice . \n the novelty of the irrc lies in the measurement of new lesions , which are included in the overall tumor burden , allowing for it to be described as a continuous variable ( before and after conventional progression ) ( 9,44 ) . \n this response analysis bears similarities to a concept described for the investigation of cytostatic agents such as sorafenib , in which tumor size was described as a continuous variable ( 54 ) . \n histological evidence in cases in which biopsy material was available suggests that the appearance of new lesions or increase in the size of existing lesions may be the result of lymphocytic infiltration and may not represent true disease progression ( 40,55 ) . in these cases , \n the irrc provide a means of accounting for delayed changes in tumor burden through confirmation of progression at subsequent time points . \n this new confirmation of progression is similar to the confirmation routinely done for response and may enable the detection of a change in kinetics when initial tumor burden increase through lymphocytic infiltration is followed by a lymphocyte - induced tumor response ( delayed response ) . importantly , \n initial observations in advanced melanoma with anti - clta-4 antibody indicate an association of immune - related responses with favorable survival , suggesting that these criteria may identify patients with previously unrecognized benefit ( 43,44 ) . \n the clinical applicability of these criteria lies principally in the more comprehensive description of clinical signals of activity in early trials . \n consequently , the irrc offer an additional tool for investigating immunotherapies and are undergoing prospective validation . \n considering the time of translation of immunologic responses into clinical activity , the survival of patients may not be affected until some months after treatment start compared with chemotherapy . \n a resulting delayed separation of kaplan meier curves was observed in multiple randomized immunotherapy trials and was often not apparent until 48 months or more after random assignment ( 12,14,17,4649 ) . in patient populations with advanced cancers , \n a substantial number of events can occur in the time window before separation and thus lead to substantial loss of statistical power ( 1,9,50 ) . whereas it remains unclear whether past studies would have had a different outcome if delayed separation had been considered during trial planning , its consideration for future evaluations appears important . \n knowledge of survival kinetics may also allow better planning of interim analyses because if they are performed too early , they may give misleading results and conclude futility prematurely . \n in addition , immunotherapeutic agents may differ in the timing of delayed separation and should be tested in randomized phase ii trials to improve the planning for phase iii trials . \n use of modified statistical methods to characterize the hazard ratios before and after separation of survival curves allows improved planning of randomized trials in which a delayed separation of curves is expected . in summary , \n the described recommendations for improved clinical endpoints have the potential to positively alter the clinical investigation of cancer immunotherapy . \n \n funding for scientific meetings , workshops , and the immune monitoring proficiency panels was provided by the cancer immunotherapy consortium of the cancer research institute , a nonprofit organization . \n ", "role": "user" }, { "content": "unlike chemotherapy , which acts directly on the tumor , cancer immunotherapies exert their effects on the immune system and demonstrate new kinetics that involve building a cellular immune response , followed by changes in tumor burden or patient survival . \n thus , adequate design and evaluation of some immunotherapy clinical trials require a new development paradigm that includes reconsideration of established endpoints . between 2004 and 2009 , several initiatives facilitated by the cancer immunotherapy consortium of the cancer research institute and partner organizations systematically evaluated an immunotherapy - focused clinical development paradigm and created the principles for redefining trial endpoints . on this basis , a body of clinical and laboratory data was generated that supports three novel endpoint recommendations . \n first , cellular immune response assays generate highly variable results . \n assay harmonization in multicenter trials may minimize variability and help to establish cellular immune response as a reproducible biomarker , thus allowing investigation of its relationship with clinical outcomes . \n second , immunotherapy may induce novel patterns of antitumor response not captured by response evaluation criteria in solid tumors or world health organization criteria . \n new immune - related response criteria were defined to more comprehensively capture all response patterns . \n third , delayed separation of kaplan meier curves in randomized immunotherapy trials can affect results . \n altered statistical models describing hazard ratios as a function of time and recognizing differences before and after separation of curves may allow improved planning of phase iii trials . \n these recommendations may improve our tools for cancer immunotherapy trials and may offer a more realistic and useful model for clinical investigation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: correlation between obesity and cv risk was the subject of scientific debate in the last decade , since an obesity pandemic has been perceived in the world , especially in developed countries . \n there are 350 million obese people ( bmi 30 kg / m ) and more than a billion are overweight ( bmi 25 kg / m ) . according to data from the croatian health survey from 2003 , the prevalence of obesity was 22.3% , and overweight 61.4% . \n thus every fifth inhabitant is obese , and about 2/3 of men and > of women have body weight greater than normal . \n the correlation between obesity and type 2 diabetes , coronary disease , osteoarthritis and some malignancies is well documented . \n the death risk in obese people is increased 1.52-fold compared to their normal weight peers . \n cv diseases are the leading cause of death in croatia , accounting for 53.6% of total mortality , which is a huge public health problem . according to the mortality rate of these diseases per 100 000 inhabitants ; \n visceral obesity is a cv risk factor causally linked to arterial hypertension , insulin resistance , accelerated atherogenesis and coronary disease . \n various ai are used to measure obesity : bmi ( body mass index ) , wc ( waist circumference ) , whr ( waist - to - hip ratio ) , and wthr ( waist - to - height ratio ) . \n bmi indicates general obesity and was introduced by the who as a statistical measure of nutritional status . \n wthr could be the most accurate anthropometric index of visceral obesity since its value is influenced only by waist circumference [ 912 ] . \n crisic - fm ( cardiovascular risk and intervention study in croatia - family medicine ) isrctn31857696 is a national multicentric prospective , randomized , intervention - controlled cohort study on nutritional status and cv risk , conducted in 59 gps practices in croatia . \n the study included 2467 examinees aged 40 . to assess the correlation between ai of obesity and cv factor , total cv and stroke risk scores in a nationally representative sample of the croatian adult population registered with general practitioners ( gp ) . \n hypotheses were that we would observe differences in obesity and overweight across regions of croatia ( coastal / inland ) and by settlement size ( urban / rural ) and a higher predictive value of wthr for cv risk factors , total cv and stroke risk compared to others ( bmi , wc , whr ) . \n to assess the correlation between ai of obesity and cv factor , total cv and stroke risk scores in a nationally representative sample of the croatian adult population registered with general practitioners ( gp ) . \n hypotheses were that we would observe differences in obesity and overweight across regions of croatia ( coastal / inland ) and by settlement size ( urban / rural ) and a higher predictive value of wthr for cv risk factors , total cv and stroke risk compared to others ( bmi , wc , whr ) . \n this is a cross - sectional part of the crisic - fm study , conducted from may to july 2008 in 59 gp practices in croatia . \n a representative sample of gp practices was selected randomly by 4-stage stratified sampling method [ county , region ( coastal , inland , urban , rural and number of insured people in the gp s care in 2007 ] . \n the principal investigators of each stratum were initially selected from a random list . if the principal investigator refused to participate , the next gp on the list was invited . \n the list was created according to the location closest to the principal investigator , in the same stratum . \n gps enrolled the first 55 consenting patients aged 40 ( one per day ) , who visited the practice during the study period for whatever reason . \n exclusion criteria were communication disability ( dysphasia , aphasia ) , severe dementia or mental illness , and disease with estimated life expectancy of less than 6 months . \n the study was approved by the research ethics committee of the medical school of zagreb . \n a 140-item crisic - fm standardized questionnaire was developed for the purpose of the project and was validated in a pilot study . \n the measures analyzed were : height and weight ( the mean of 2 measurements on standardized anthropometric scales ) , waist and hip circumference ( by plastic coated , non - elastic tape ) , and seated arterial blood pressure ( the mean of 2 measurements performed by mercury sphygmomanometer ) . \n blood samples were taken for biochemical analysis ( total cholesterol , hdl and ldl , triglycerides , fasting blood glucose ) . \n diagnostic criteria of arterial hypertension , dyslipidemia and glycemia were based on the current guidelines of professional societies ( box 1 ) . \n the expected 10-year risk of fatal cv disease in primary prevention was calculated using the score chart for high risk countries and for stroke according to framingham risk score . \n men ; w women ; ldl low density lipoproteines ; hdl high density lipoproteines ; fbg fasting blood glucose . \n standard error of measurement was reduced by using identical standardized measuring instruments at all locations and by repeated measurements ( 2 ) . \n the test was used to measure associations between 2 categorical variables ( fisher s exact test for 22 tables ) . \n logistic regression analysis determined the odds ratio ( or ) and significance of the independent contribution of each ai in predicting cv risk . \n sensitivity and specificity of ai as an area under a curve ( auc ) for each cv risk factor were determined by receiver operating characteristic ( roc ) analysis . \n all statistical methods were performed using spss for windows ( 11.5 , spss inc . , chicago , il , 2002 ) , at a 95% level of significance ( p<0.05 ) . \n this is a cross - sectional part of the crisic - fm study , conducted from may to july 2008 in 59 gp practices in croatia . \n a representative sample of gp practices was selected randomly by 4-stage stratified sampling method [ county , region ( coastal , inland , urban , rural and number of insured people in the gp s care in 2007 ] . \n the principal investigators of each stratum were initially selected from a random list . if the principal investigator refused to participate , the next gp on the list was invited . \n the list was created according to the location closest to the principal investigator , in the same stratum . \n gps enrolled the first 55 consenting patients aged 40 ( one per day ) , who visited the practice during the study period for whatever reason . \n exclusion criteria were communication disability ( dysphasia , aphasia ) , severe dementia or mental illness , and disease with estimated life expectancy of less than 6 months . \n the study was approved by the research ethics committee of the medical school of zagreb . \n a 140-item crisic - fm standardized questionnaire was developed for the purpose of the project and was validated in a pilot study . \n the measures analyzed were : height and weight ( the mean of 2 measurements on standardized anthropometric scales ) , waist and hip circumference ( by plastic coated , non - elastic tape ) , and seated arterial blood pressure ( the mean of 2 measurements performed by mercury sphygmomanometer ) . \n blood samples were taken for biochemical analysis ( total cholesterol , hdl and ldl , triglycerides , fasting blood glucose ) . \n diagnostic criteria of arterial hypertension , dyslipidemia and glycemia were based on the current guidelines of professional societies ( box 1 ) . \n the expected 10-year risk of fatal cv disease in primary prevention was calculated using the score chart for high risk countries and for stroke according to framingham risk score . \n men ; w women ; ldl low density lipoproteines ; hdl high density lipoproteines ; fbg fasting blood glucose . \n standard error of measurement was reduced by using identical standardized measuring instruments at all locations and by repeated measurements ( 2 ) . \n descriptive statistical methods were used to describe participants demographic characteristics . the test was used to measure associations between 2 categorical variables ( fisher s exact test for 22 tables ) . \n logistic regression analysis determined the odds ratio ( or ) and significance of the independent contribution of each ai in predicting cv risk . \n sensitivity and specificity of ai as an area under a curve ( auc ) for each cv risk factor were determined by receiver operating characteristic ( roc ) analysis . \n all statistical methods were performed using spss for windows ( 11.5 , spss inc . , chicago , il , 2002 ) , at a 95% level of significance ( p<0.05 ) . \n we obtained data from 2467 participants ( 61.9% women , 38.1% men ; 69.3% inland , 30.7% coastal ; 26.0% rural , 74.0% urban ) . \n considering ai , 1918 ( 80% ) participants had an increased waist circumference , 225 ( 30.4% ) had increased whr , 1015 ( 42.1% ) were overweight , 875 ( 36.3% ) were obese , and 1933 ( 83% ) had increased wthr according to pre - ordained criteria . in comparing coastal / inland and urban / rural , there was a difference in bmi across regions and by the settlement size ( table 1 ) . \n chi - square test showed fewer obese people found in the coastal than in the inland areas ( p=0.032 ) . in rural areas \n there were more obese people ( p<0.001 ) , and more individuals with increased whr ( p=0.004 ) and increased wthr ( p<0.001 ) than in urban areas . \n systolic blood pressure 140 mm hg occurred more often in urban areas ( p<0.001 ) , and diastolic blood pressure > 90 mm hg occurred more often in inland ( p<0.041 ) areas . \n there was no difference in dyslipidemia , while hyperglycemia was found more often in the inland population ( p<0.001 ) ( table 2 ) . \n total cv risk according to score did not differ across the regions according to urbanization , whereas the framingham risk score was higher in inland than in coastal areas ( p<0.001 ) , and was higher in urban areas than in rural settlements ( p<0.001 ) . \n for all logistic regressions we made adjustments for age , sex , physical activity and smoking . among the ais , calculated bmi > 30 kg / m proved to be the best predictor for hypertension , diabetes and dyslipidemia ( table 3 ) and was a significant predictor for all cv risks in both regions , except for diabetes in the coastal area . \n wthr had a significant predictive value for 2 cv risks , hypertension and dyslipidemia ( table 3 ) , and was a significant predictor for all 3 cv risks in the coastal area , but only for hypertension in the inland area . \n considering the settlement size , wthr proved to be a good predictor for all 3 cv risks in urban areas , while in rural areas it was only significant for hypertension . \n none of the anthropometric indices showed any statistically significant independent contribution to the total cv risk by score , but bmi and wc did for stroke risk according to framingham ( table 3 ) . \n . however , for total cv risk according to score and stroke risk according to framingham , whr was the best predictor ( table 4 ) . \n we found that the prevalence of overweight and obesity differs across the regions and the settlements of croatia . \n our total sample included 36% obese people , compatible with data about populations registered with gps in most european countries . \n the greater prevalence of obesity in inland area may be explained by different patterns of diet in coastal and inland parts of croatia . \n the so - called mediterranean dietary pattern ( fish , vegetables , olive oil ) is more common in the coast areas . \n bmi is an index of general obesity , which does not take into consideration the distribution of subcutaneous and visceral adipose tissue in the body . \n it is not sufficiently specific or sensitive in elderly people and does not discriminate between people with weight gain at the expense of their muscle mass compared to those with increased weight due to adipose tissue . \n numerous studies have shown the greater importance of visceral obesity than general obesity because visceral obesity is strongly associated with cv risk . \n exclusive reliance on bmi in assessing obesity ignores the distribution and accumulation of abdominal fat , therefore the cv risk can easily be overlooked . \n x - ray densitometry , ct and mr are used for accurate measurement of abdominal adipose tissue accumulation , but they are expensive and unavailable in primary care . \n measuring subcutaneous fat using skinfold callipers shows too much variability in individual measurements and therefore it is not a reliable method . \n one disadvantage of wc is that it does not take into account individual differences in body height . on the other hand \n , whr can remain apparently within the normal range in case of proportional reduction in waist and hips . with constant body height \n , wthr is affected only by waist circumference increase . according to ncep - atp iii criteria for increased waist circumference , \n 80% of subjects in our sample were centrally obese , but only 30.4% had increased whr and 83% had increased wthr . \n this prevalence is greater than in most european countries , but it can be partly explained by the fact that gps are more often visited by sick people . \n this is an important message for gps who mainly care for adult patients , since cv diseases are the leading cause of death in croatia . according to 2008 data from the croatian institute for public health , 4 085 458 out of 4 437 \n 460 inhabitants of croatia ( 92.1% ) have been registered with a gp . according to logistic regression analysis of our data , bmi > 30 \n kg / m was the best predictor for hypertension , diabetes and dyslipidemia , and among visceral obesity ai , wthr 0.5 was the best for hypertension and dyslipidemia . \n bmi was not predictive of diabetes in the coastal region , while wthr was a predictor for all 3 cv risk factors in coastal and urban areas , and only for hypertension in inland and rural areas . \n although some ai showed the correlation with individual cv risk factors , none of them was associated with overall 10-year risk of fatal cv events according to score . \n however , the correlation showed in bmi > 30 kg / m and wc with 5-year stroke risk according to framingham . according to roc analyses , wthr had the greatest predictive value for 2 cv risk factors ( hypertension , dyslipidemia ) and whr for total cv risk by score and stroke risk according to framingham . estimated 10-year risk of fatal cvd using score is calculated only in primary prevention , for apparently healthy \n asymptomatic persons with no established cv disease , but with cv risk factor burden . such patients made up only 1/3 of the total sample . \n total 5-year framingham stroke risk is calculated not only for primary prevention sample , but also in secondary prevention in patients with established cv disease . \n the group of secondary prevention participants was 3 times more numerous in the study , which can explain attaining statistical significance more easily . \n in addition , the cut - offs are different 5% for score , and 10% for framingham . \n the results of investigating the correlation between individual ai with cv risk factors differ in some countries [ 2023 ] . \n they are conducted in specific ethnic groups with anthropometric features hardly comparable to the general european population . \n a few studies in this area were conducted in europe , showing different and controversial results . \n the german cross - sectional detects study demonstrated somewhat better prediction of wthr and wc for cv risk compared to bmi and whr . in turkey , wc in men and bmi in women proved to be predictive of arterial hypertension , while the greek attica study showed the highest correlation of wc with hypertension incidence compared to bmi and whr . \n even the meta - analysis of de koning et al . showed a significant correlation between wc , whr and cv risk : for each 1 cm increase in wc , the risk of future cv event is increased by 2% , and for each 0,0001 increase in whr by 5% . \n meta - analysis of 25 prospective studies done by lee found greater significance of wthr compared to bmi in discrimination of cv risk . \n in the context of the anthropometric evaluation of the population in care , the gp should use , in addition to bmi as an ai of general obesity , one of the indices of central obesity . among them , in our study wthr turned out to be the best predictor for hypertension and dyslipidemia . \n combination of bmi and wthr estimation could become a simple , inexpensive and applicable instrument for cv risk factors screening in the gp s daily work . \n first , the sample of subjects was patients registered with a gp , which does not entirely correspond to the general population sample ( those without health insurance or who do not visit a gp for other reasons could not be included ) . \n second , the usual limitation of every cross - sectional study is the existence of only a possible correlation between ai and cv risk factors , since the causal connection can not be directly determined by such a study design . \n first , the sample of subjects was patients registered with a gp , which does not entirely correspond to the general population sample ( those without health insurance or who do not visit a gp for other reasons could not be included ) . \n second , the usual limitation of every cross - sectional study is the existence of only a possible correlation between ai and cv risk factors , since the causal connection can not be directly determined by such a study design . \n the prevalence of general and central obesity is high in the population registered with a gp in croatia . by combined use of inexpensive and simple anthropometric indices ( bmi for general and wthr for abdominal obesity ) \n well - timed lifestyle and pharmacological intervention when indicated could prevent new and recurrent cv events in the population under the care of gps .", "role": "user" }, { "content": "summarybackgroundusefulness of anthropometric indices ( ai ) as predictors of cv risk is unclear and remains controversial.material/methodsto evaluate the correlation between ai and cv risk factors in the croatian adult population and to observe possible differences between coastal and inland regions and urban and rural settlements . \n crisic - fm ( isrctn31857696 ) is a prospective , randomized cohort study conducted in gp ( general practitioner ) practices in croatia . between may and july 2008 \n , 59 gps each recruited 55 participants aged 40 years , who visited a practice for any reason . \n height , weight , waist and hip circumference and blood pressure were measured . \n blood samples were analyzed in accredited laboratories.resultsout of 2467 participants ( 61.9% women , 38.1% men ) , 36.3% were obese , with fewer in coastal than inland areas . \n more obese people were in rural areas . \n logistic regression showed bmi was the most important predictor of hypertension , diabetes and dyslipidemia in both regions ( except for diabetes in the coastal area ) , and for urban and rural settlements ( except for diabetes in rural areas ) . \n wthr was a significant predictor for hypertension and dyslipidemia in the coastal ( but only for hypertension in the inland area ) , and in urban settlements ( in rural only for hypertension ) . \n none of the ai showed significant correlation with total cv risk , but wc and bmi did with stroke risk . \n receiver operating curve ( roc ) analyses showed that wthr was a better predictor than all other ai for hypertension and dyslipidemia.conclusionsresults encourage the use of bmi and wthr as important tools in predicting cv risk in gp s practice .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: currently , high - throughput screens are the gold standard.(1 ) these screens take advantage of well - developed biochemical assays , advanced robotics , and parallelization to test tens of thousands of compounds for potential target binding . \n unfortunately , high - throughput screening is often very expensive and time consuming , placing it beyond the reach of many scientists in both academia and industry . \n consequently , many researchers are turning increasingly to computational techniques for ligand identification and optimization . \n while some advanced computational techniques like thermodynamic integration,(2 ) single - step perturbation,(3 ) and free - energy perturbation(4 ) in some cases approach experimental assays in accuracy,(5 ) in practice these techniques are currently too time consuming and resource intensive for high - throughput applications . faced with this challenge , researchers have developed other computational techniques that sacrifice some accuracy for increased speed . \n these techniques , which include computer docking programs and their associated scoring functions , are typically not accurate enough to properly characterize any single ligand ; however , when applied to many thousands of potential ligands , they can enrich a pool of candidate compounds for true binders . \n recently , durrant et al . introduced a neural - network scoring function called nnscore(6 ) designed to aid the computational characterization of predocked small - molecule ligands . \n while the test cases included in the original nnscore paper demonstrated the utility of the program , the application examples were limited . \n the purpose of the current work is to further confirm that neural - network scoring functions are effective , even when compared to the scoring functions of state - of - the - art docking programs , such as autodock,(7 ) the most commonly cited program,(8 ) and autodock vina , thought to be two orders of magnitude faster.(9 ) additionally , we here present a second neural - network scoring function , nnscore 2.0 . to facilitate use , \n the database of receptor ligand complexes used in the current study has been described previously . in brief , \n crystallographic and nmr structures with corresponding experimentally measured kd values were identified using the moad(11 ) and pdbbind - cn online databases . \n these structures were then downloaded from the protein data bank.(14 ) published binding affinities are biased toward potent binders ; to compensate , we used autodock vina(9 ) to dock ligands from the national cancer institute s developmental therapeutics program ( dtp ) repository into the downloaded crystal structures . \n those compounds whose best - predicted pose had a docking score between 0 and 4 kcal / mol were retained as examples of weakly binding ligands . \n for the purpose of training the neural networks , these docked complexes were assumed to have kd values of 1 m. two computer docking programs , autodock vina ( vina)(9 ) and autodock 4.2 ( autodock),(7 ) were used to dock ligands into nine protein receptors obtained from the directory of useful decoys ( dud ) database.(15 ) in all cases , the docking - box dimensions and location provided by the database were used . \n vina default parameters were selected , as this program has limited user - specified options . \n in contrast , autodock has many modifiable parameters ; consequently , we used two autodock docking protocols for each ligand . one docking protocol , autodockfast , was designed to test lax parameters optimized for speed . \n parameter defaults were employed , except ga_num_evals was set to 2 500 000 , and ga_run was set to 10 . a second docking protocol , autodockrigorous , \n ga_num_evals was set to 10 000 000 , and ga_run was set to 50 . \n the vina - docked poses were reevaluated with the original version of nnscore.(6 ) the default 24 networks that come with the program were used . for each docked ligand , vina proposed several possible poses . rather than calculating the nnscore of the top vina - predicted pose alone , we rescored all poses and selected the best - scoring pose as judged by nnscore itself . \n operator characteristic ( roc ) curves(16 ) were used to judge the utility of the virtual screens . following docking , \n a moving cutoff was established , beginning at the best docking score and sweeping through to the worst . at each cutoff value , the selectivity ( se ) and specificity ( sp ) \n were calculated , as given bywhere tp is the true - positive rate , fn is the false - negative rate , tn is the true - negative rate , and fp is the false - positive rate . \n the roc curve was generated by plotting all pairs of ( 1 sp , se ) , and the area under this curve ( auc ) was calculated using the composite trapezoidal rule as implemented in scipy.(17 ) a common virtual - screening technique is to dock a large library of potential ligands into a receptor of interest and then to recommend the best - predicted small molecules for experimental validation . \n an enrichment factor describes how much better this set of recommended compounds performs than a set of equal size selected at random from the entire database . \n the enrichment factor is given bywhere e is the factor itself , hitsrec and inactivesrec are the number of true hits and inactive compounds among those recommended for experimental validation , respectively , and hitstotal and inactivestotal are the number of true hits and inactive compounds present in the entire compound database , respectively . for a given virtual screen , e is a simple function of the number of top - predicted compounds recommended for experimental testing . \n the new neural networks described in the current study are similar in many ways to those described previously(6 ) in that they are feed - forward networks created using the ffnet python package.(18 ) however , there are a number of important differences between nnscore 1.0 and nnscore 2.0 . for example \n , nnscore 1.0 characterizes receptor ligand complexes using five metrics in its attempts to identify potent ligands : close - contact ( receptor ligand atoms within 2 ) , semiclose - contact ( within 4 ) , electrostatic - interaction , ligand atom - type , and number - of - ligand - rotatable - bonds counts are all tallied . \n in contrast , the receptor ligand characterizations used by nnscore 2.0 are more numerous . \n first , vina 1.1.2 ( but not 1.1.1 ! ) correctly outputs the individual term values used to calculate vina docking scores . \n gauss 2 , and repulsion , a hydrophobic term , and a hydrogen - bond term . \n second , a recently published algorithm called binana(10 ) provides 12 distinct binding characteristics , ranging from the number of hydrogen bonds to rough metrics of active - site flexibility . \n binana counts the number of receptor ligand atoms that come within 2.5 of each other and tallies them by their autodock atom types . \n when this binding characterization was used as network input , the following atom - type pairs were permitted : ( a , a ) , ( a , c ) , ( a , cl ) , ( a , f ) , ( a , fe ) , ( a , hd ) , ( a , mg ) , ( a , mn ) , ( a , n ) , ( a , na ) , ( a , oa ) , ( a , sa ) , ( a , zn ) , ( br , c ) , ( br , hd ) , ( br , oa ) , ( c , c ) , ( c , cl ) , ( c , f ) , ( c , hd ) , ( c , mg ) , ( c , mn ) , ( c , n ) , ( c , na ) , ( c , oa ) , ( c , sa ) , ( c , zn ) , ( cd , oa ) , ( cl , fe ) , ( cl , hd ) , ( cl , mg ) , ( cl , n ) , ( cl , oa ) , ( cl , zn ) , ( f , hd ) , ( f , n ) , ( f , oa ) , ( f , sa ) , ( f , zn ) , ( fe , hd ) , ( fe , n ) , ( fe , oa ) , ( hd , hd ) , ( hd , i ) , ( hd , mg ) , ( hd , mn ) , ( hd , n ) , ( hd , na ) , ( hd , oa ) , ( hd , p ) , ( hd , s ) , ( hd , sa ) , ( hd , zn ) , ( mg , na ) , ( mg , oa ) , ( mn , n ) , ( mn , oa ) , ( n , n ) , ( n , na ) , ( n , oa ) , ( n , sa ) , ( n , zn ) , ( na , oa ) , ( na , sa ) , ( na , zn ) , ( oa , oa ) , ( oa , sa ) , ( oa , zn ) , ( s , zn ) , ( sa , zn ) . \n all juxtaposed receptor ligand atoms that did not correspond to these pairs were ignored . \n binana also sums the energy of the electrostatic interaction between receptor ligand atoms that come within 4 of each other and tallies this sum by atom - type pairs . \n when this characterization was used as input for the neural networks , the same atom - type pairs permitted for the 2.5 close - contact metric were again allowed , with the exception of ( cd , oa ) . \n additionally , the following atom - type pairs were also permitted for the electrostatic characterization : ( a , br ) , ( a , i ) , ( a , p ) , ( a , s ) , ( br , n ) , ( br , sa ) , ( c , fe ) , ( c , i ) , ( c , p ) , ( c , s ) , ( cl , mn ) , ( cl , na ) , ( cl , p ) , ( cl , s ) , ( cl , sa ) , ( cu , hd ) , ( cu , n ) , ( fe , na ) , ( fe , sa ) , ( i , n ) , ( i , oa ) , ( mg , n ) , ( mg , p ) , ( mg , s ) , ( mg , sa ) , ( mn , na ) , ( mn , p ) , ( mn , s ) , ( mn , sa ) , ( n , p ) , ( n , s ) , ( na , p ) , ( na , s ) , ( oa , p ) , ( oa , s ) , ( p , s ) , ( p , sa ) , ( p , zn ) , ( s , sa ) , ( sa , sa ) . all juxtaposed receptor ligand atoms that did not correspond to these pairs were again ignored . \n binana also counts the number of receptor ligand atoms that come within 4.0 of each other and tallies them by the autodock atom type . \n when this characterization was used as network input , the same atom - type pairs allowed for the electrostatic characterization were again permitted , except ( f , zn ) . \n additionally , ( a , cu ) and ( c , cd ) were also permitted . \n all juxtaposed receptor ligand atoms that did not correspond to these pairs were again ignored . in the original nnscore , \n a single hidden layer of five neurodes was employed . as preliminary analysis suggested that an expanded hidden layer might perform better \n , we use a single hidden layer of ten neurodes in nnscore 2.0 . as before , \n each of the neurodes of the input layer is connected to each of the neurodes of the hidden layer . \n the output layer consists of a single neurode corresponding to the predicted pkd . in contrast , the original nnscore was a binary classifier that only distinguished between good and poor binders . as before \n each neurode had a log - sigmoid activation function , given bywhere t is the input sum of the respective node . all input and output values were normalized using a linear mapping to the range ( 0.15 , 0.85 ) so that each variable was given equal importance independent of its magnitude . \n different paradigms were used to train the networks ; the number of inputs was varied , as was the training set used . \n the weights on the network connections were initially randomized and then optimized / trained by applying 10 000 steps of a truncated newton algorithm,(19 ) as implemented in scipy.(17 ) the scores used for analysis were obtained by taking the average predicted score of the top 20 trained networks . to judge the predictive accuracy of the neural networks , we first plotted the known vs the neural - network predicted pkd values . \n a linear regression was then performed , and the associated r value was used to judge goodness of fit . \n the current study , in which we expand upon our previous work developing a neural - network scoring function ( nnscore),(6 ) can be divided into two parts . \n first , we compare the accuracy of the nnscore,(6 ) autodock 4 ( autodock),(7 ) and autodock vina ( vina)(9 ) scoring functions by docking both known ligands and physically similar decoys into nine distinct protein receptors . \n second , we describe the development of a second neural - network scoring function called nnscore 2.0 . to compare the nnscore , autodock , and vina scoring functions , we turned to the dud database.(15 ) the dud database contains 40 protein targets , each with numerous known ligands . \n these decoys are not chosen at random ; they are rather carefully selected to be physically similar to the known binders . \n consequently , distinguishing between the ligands and decoys of the dud database using computational methods is likely to be more difficult than distinguishing between the active and inactive compounds present in large databases of diverse small molecules . \n this challenging set of compounds / receptors is thus useful for robustly testing novel scoring functions . of the 40 available dud targets , \n 9 were associated with over 100 known ligands : acetylcholinesterase ( ache ) ; cyclooxygenase-2 ( cox-2 ) ; dihydrofolate reductase ( dhfr ) ; epidermal growth factor receptor , tyrosine kinase domain ( egfr ) ; fibroblast growth factor receptor 1 , tyrosine kinase domain ( fgfr1 ) ; coagulation factor xa ( fxa ) ; p38 map kinase platelet - derived growth factor receptor kinase ( p38 ) ; -type platelet - derived growth factor receptor ( pdgfrb ) ; and tyrosine - protein kinase c - src ( src ) . \n all ligand and decoy molecules were docked into their respective structures using autodock and vina . \n two autodock docking protocols were used : autodockfast was designed to test autodock with lax docking parameters optimized for speed , and autodockrigorous was designed to test autodock with more thorough parameters . \n one technique is to calculate the area under a roc curve.(16 ) roc curves seek to simultaneously measure two important characteristics of a virtual screen : the ability to correctly identify true ligands and to discard decoys . \n the area under a roc curve ( auc ) is thought to correspond to the probably that a randomly picked known ligand will rank better than a randomly picked decoy molecule . \n if the auc is 0.5 , the screen has performed no better than selecting potential ligands at random . \n if the auc is 1.0 , the virtual screen is optimal . with the remarkable exception of dhfr , \n autodock performed poorly as judged by the roc auc , regardless of whether or not the autodockfast or autodockrigorous protocol was used ( table 1 ) . \n the auc of the autodock screens was generally less than 0.5 , meaning identifying true ligands by random selection would have been more effective . \n vina performed somewhat better , with an average auc of 0.58 over the nine proteins . \n the original nnscore algorithm , however , was the most effective , with an average auc of 0.64 . \n clearly the best scoring function for a given project is highly system dependent ; however , in the absence of specific evidence that would recommend a particular function , docking with vina and rescoring with nnscore is often the best choice . \n bold indicates that the given docking program / scoring function is best suited to the corresponding receptor . \n while roc curves are certainly useful metrics , in practice one is rarely interested in the results of an entire virtual screen from the best - predicted binder to the worst . \n often , researchers are more interested in only the best - predicted binders , the compounds that will ultimately be recommended for experimental validation . \n an enrichment factor is a useful metric that indicates how many times better a recommended set of docked compounds performs than a set of the same size selected at random from the entire small - molecule library . \n for example , suppose a library of 100 compounds containing 10 true ligands were docked into a receptor of interest . \n further suppose that the top 20 compounds were recommended for subsequent experimental validation ; among these , 5 were ultimately shown to be true ligands . \n given that 10% of the entire library contained true ligands , one would expect 2 of the 20 recommended compounds to be actives by chance alone . because 5 were in fact active , \n thus , for a given virtual screen , the enrichment factor can be expressed as a function of the number of top - predicted ligands selected for subsequent experimental validation \n . judged by this metric , the scoring function best suited for a given project appears to be highly system dependent . among the previously published scoring functions tested , nnscore 1.0 was arguably the best choice for docking into p38 , fgfr1 , fxa , and src . \n autodockrigorous appears to be best suited for docking into ache , egfr , pdgfrb , and dhfr . \n we note , however , that autodockrigorous is by far the slowest of the docking protocols tested . \n when a single processor is used to dock a single ligand , vina takes at most a few minutes , and rescoring a vina - docked pose with nnscore takes only seconds . in contrast , \n for projects where many thousands of ligands need be docked , vina docking with nnscore rescoring may be the most reasonable protocol ( figure 1 ) . \n enrichment factors are shown as a function of the number of top - predicted ligands recommended for experimental testing . \n nn1.0 corresponds to the original nnscore scoring function , nn2.0 corresponds to the nnscore 2.0 scoring function , adfast corresponds to autodock 4.2 using parameters optimized for speed , adrig ( adrigorous ) corresponds to autodock 4.2 using more rigorous parameters , and vina corresponds to autodock vina . \n as vina is a new docking program / scoring function , its reasonable performance against ache , cox-2 , dhfr , and pdgfrb , even in the absence of nnscore rescoring , is also noteworthy ( figure 1 ) . \n encouraged by the success and utility of the original nnscore , we have developed a second neural - network scoring function called nnscore 2.0 . the original nnscore function accepted as input a limited number of binding characteristics , including tallies of close - contact atoms , close - contact electrostatic - interaction energies , ligand atom types , and rotatable bonds . \n consequently , a far greater number of binding characterizations were considered when training the neural networks of nnscore 2.0 ( see the material and methods section ) . \n the original version of the scoring function was a binary classifier ; the output layer included two neurodes , where ( 1,0 ) represented strong binding and ( 0,1 ) represented weak binding . \n in contrast , nnscore 2.0 contains only one output neurode corresponding simply to the predicted pkd of binding . \n specifically , the number of input neurodes was varied according to the binding characteristics considered , and different subsets of a database of receptor ligand complexes that has been described previously were used for training and validation \n . a number of programs can analyze receptor ligand binding ; the output of these programs can potentially serve as the input for a neural - network scoring function . \n the first program , vina 1.1.2 ( but not 1.1.1 ! ) , can correctly output the individual terms used to calculate vina docking scores , without redocking . \n these values include three steric terms , labeled gauss 1 , gauss 2 , and repulsion , a hydrophobic term , and a hydrogen - bond term . \n second , a recently published algorithm called binana(10 ) provides twelve distinct binding characteristics , ranging from the number of hydrogen bonds to rough metrics of active - site flexibility . \n importantly , binana includes binding metrics similar to all those used in the original nnscore algorithm . \n to prevent overtraining , it is in theory best to use as few network inputs as possible while still maintaining the network s ability to accurately predict pkd . \n overtraining can occur when the networks manage to identify small quirks in the data set that allow for accurate prediction that is not generally applicable to other , albeit similar , data sets . by keeping the number of network inputs to a minimum , \n any inductive bias is likely to be based on true principles of molecular recognition . given that vina has been used successfully to identify novel ligands in the past ( see , for example , ref ( 20 ) ) , we first allowed the neural networks to consider vina output alone in attempting to predict the pkd values of 4284 receptor ligand complexes . \n one thousand neural networks were trained using the vina score and its five constituent terms as input ; a single score was then calculated for each receptor ligand complex by averaging the predicted pkd values of the 20 best - performing individual networks . \n we therefore initially trained 12 sets of 1000 neural networks , again using all the receptor ligand complexes of the database . as input , \n the networks of each set considered a different binana binding characteristic , always together with the six vina - derived terms . \n a single composite score for each receptor ligand complex was again determined by calculating the average score of the 20 best - performing individual networks . for each set of networks \n , an r value was obtained from a linear regression describing the correlation between predicted and known pkd values . \n the best set of inputs was considered to be that which led to the greatest improvement in r. once the best set of inputs was thus determined , 11 more networks were created using these same inputs plus an additional binana descriptor . \n this process was repeated in a stepwise fashion , adding with each round the binana characterization that had the largest impact on goodness of fit . \n the ability of the networks to accurately predict pkd values rose quickly when , in addition to the vina binding characteristics , the networks were also told about the receptor ligand atoms that came within 4 of each other and about the electrostatic energy between those atoms ; indeed , with only these characterizations , the r value rose above 0.95 . with the addition of other binding characteristics \n r values improve as the networks are allowed to consider additional binding site characteristics , suggesting the development of a genuine inductive bias based on learned principles of molecular recognition . \n the networks described in the previous section were trained on all the database receptor ligand complexes available ; there was no validation set , so it was not possible to assess for overtraining . \n we could not verify that the inductive bias was based on true principles of molecular recognition , rather than the random , isolated quirks of our particular data set . to test for overtraining , we partitioned the database of receptor ligand complexes into training and validation sets . \n training sets of 500 , 1000 , 1500 , 2000 , 2500 , 3000 , 3500 , and 4000 complexes were created by selecting crystallographic and docking - derived structures at random . for each training set , a corresponding validation set was created from the remaining crystallographic complexes only . \n the networks were subsequently trained on the complexes in the training set ; to determine predictive accuracy , the trained networks were then used to evaluate the complexes of the validation set , complexes that the networks had never seen before . \n each of the complexes in the validation sets was evaluated with vina , and the linear - regression r value of the correlation between the docking score and the pkd value was plotted in blue . as no training took place , this r was understandably independent of the training - set size . \n interestingly , simply feeding the vina score and its constituent five terms into the neural networks led to significant improvements in predictive accuracy ( figure 3 in green ) , suggesting that the neural networks may be better suited for combining these terms into a single score than is the weighted sum currently employed by vina.(9 ) the database of receptor ligand complexes was divided into multiple partitions of training and validation sets . \n the networks were trained on the complexes in the training set ; the r values shown correspond to predictions on the validation set . in blue , \n the r value associated with the correlation between the vina docking score and the known pkd . in green , the performance of the neural networks when only the vina score and its constituent five terms were considered . in red , the same , with tallies of receptor ligand close contacts ( 4 cutoff ) and electrostatic interactions also included . in light blue , the same , but with all vina and binana binding characterizations considered . \n additional networks that considered not only vina binding characteristics but also tallies of the receptor ligand atoms that came within 4 of each other and the electrostatic energy between those atoms fared even better ( figure 3 in red ) . \n furthermore , networks that considered all the vina and binana binding characteristics performed better still ( figure 3 in light blue ) . \n as the training - set size increased , the accuracy with which the networks predicted the pkd values of the complexes in the validation set improved ; as the networks were exposed to more examples of receptor ligand complexes , they became better able to predict the pkd values of complexes they had never seen . \n if anything , one wonders if the accuracy could have been improved even further had more examples of complexes with known binding affinities been available . \n additionally , the validation - set accuracy of the networks also improved as they considered more and more binding characteristics ; the inductive bias is likely based on an improved understanding of the principles of molecular recognition rather than overtraining . \n consequently , the 20 best networks trained on all the receptor ligand complexes of the database , using as input all vina and binana characteristics , were selected for further analysis and were subsequently incorporated into the published version of nnscore 2.0 . to verify that nnscore 2.0 can serve as a useful scoring function \n , we used the new neural networks to analyze the same dud data set described above . \n the original nnscore still performed best as measured by the roc - auc metric ( table 1 ) . \n however , nnscore 2.0 arguably performed better than any other scoring function tested , including nnscore 1.0 , when docking into cox-2 , pdgfrb , and dhfr . \n the current study confirms that no single docking program / scoring function is perfectly suited for all receptor systems . \n while the neural - network scoring functions arguably performed better on average , they were not consistently the best scoring functions for all systems . \n for example , the autodockrigorous docking protocol had a remarkable roc auc of 0.95 in the screen against dhfr , a performance superior to that of the neural - network scoring functions . however , in general the roc auc of the autodock screens was less than 0.5 , suggesting that selecting random compounds from the library would have been a better way of identifying true ligands . \n similarly , while nnscore 2.0 performed remarkably well against dhfr and other receptors , it performed poorly against targets like ache and fgfr1 . \n clearly , using known ligands ( positive controls ) to validate a docking program / scoring function for a given receptor is critical . \n only when a scoring function has been confirmed effective can a virtual screen of a diverse molecular library be reasonably undertaken . \n fortunately , the neural - network scoring functions here described appear to be well suited for many protein receptors . \n first , we confirmed that neural networks can be effective scoring functions by comparing nnscore(6 ) directly to autodock(7 ) and vina(9 ) using two different metrics for docking efficacy and nine distinct receptor systems . \n second , we developed a new neural - network scoring function called nnscore 2.0 . to facilitate use ,", "role": "user" }, { "content": "nnscore is a neural - network - based scoring function designed to aid the computational identification of small - molecule ligands . \n while the test cases included in the original nnscore article demonstrated the utility of the program , the application examples were limited . \n the purpose of the current work is to further confirm that neural - network scoring functions are effective , even when compared to the scoring functions of state - of - the - art docking programs , such as autodock , the most commonly cited program , and autodock vina , thought to be two orders of magnitude faster . aside \n from providing additional validation of the original nnscore function , we here present a second neural - network scoring function , nnscore 2.0 . \n nnscore 2.0 considers many more binding characteristics when predicting affinity than does the original nnscore . \n the network output of nnscore 2.0 also differs from that of nnscore 1.0 ; rather than a binary classification of ligand potency , nnscore 2.0 provides a single estimate of the pkd . to facilitate use , \n nnscore 2.0 has been implemented as an open - source python script . \n a copy can be obtained from http://www.nbcr.net / software / nnscore/.", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: familial adenomatous polyposis ( fap ) is an autosomal dominant syndrome , which is diagnosed by detection of adenomatous polyps over 100 leading up to colon cancer . \n hundreds and even thousands of polyps appear in the colorectal area during second and third decades in the patients with fap . \n approximately 10% of the patients with fap have polyps < 100 , and these transform into carcinoma during elder ages . \n fap appears as a result of germline mutation in adenomatous polyposis coli ( apc ) gene . \n about 6070% of apc mutations are micro - deletions , and 1015% are large deletion . \n individuals with same germline apc mutation may present different clinical findings due to the presumably environmental or other genetic factors [ 5 , 6 ] . \n we reported two different nucleotide substitutions of apc gene detected in the patients with fap phenotype in the same family . \n the proband was a 54-year - old male patient who was referred to department of general surgery because of progressing rectal bleeding , weight loss , diarrhea and constipation . \n an ulcero - vegetating mass was palpated on 2.5 cm distant to the anal verge by rectal palpation . \n polypoid lesions over 100 diffused along whole colon from terminal ileum were observed in the colonoscopy . \n low - grade dysplasia and tubulovillous adenoma were detected in the periampullary region in the pathological examination of stomach and duodenum samples obtained during endoscopic examination of the upper gastrointestinal tract . \n the patient has two daughters who are 24 and 18 years of age , respectively . \n more than 100 polyps diffused along the colon were observed in the elder daughter , whereas more than 10 polyps were observed in the younger daughter . \n low - grade dysplasia and tubular adenoma were detected in both daughters in the pathological examination of the polyps . \n the fap patient and his family were referred to department of medical genetics for genetic analysis . \n a detailed family history was obtained from the fap family , and the pedigree of proband 's family was drawn ( fig . 1 ) . \n was detected in exon 15 of the apc gene ( fig . 2 ) . \n mutations of p.his1172gln ( c.3516delt ) and p.met1413val ( c.4237 a > g ) change in exon 15 were detected in both daughters . \n apc gene mutation analysis was done to the mother to reveal whether p.met1413val ( c.4237 a > g ) change detected in the daughters is associated with clinical presentation of fap . \n same nucleotide change with the daughters , p.met1413val ( c.4237 a > g ) , was detected in the mother . \n figure 1:pedigree of fap family . affected family members are identified by filled symbols ; iii-8 proband [ p.his1172gln ( c.3516delt ) ] , iii-9 p.met1413val ( c.4237 a > g ) , iv-3 . \n the daughter with fap [ p.his1172gln ( c.3516delt ) and p.met1413val ( c.4237 a > g ) ] ; iv-4 the daughter with afap [ p.his1172gln ( c.3516delt ) and p.met1413val ( c.4237 a > g ) ] . \n pedigree of fap family . affected family members are identified by filled symbols ; iii-8 proband [ p.his1172gln ( c.3516delt ) ] , iii-9 p.met1413val ( c.4237 a > g ) , iv-3 . \n the daughter with fap [ p.his1172gln ( c.3516delt ) and p.met1413val ( c.4237 a > g ) ] ; iv-4 the daughter with afap [ p.his1172gln ( c.3516delt ) and p.met1413val ( c.4237 a > g ) ] . \n mutations in apc gene cause both classic fap and afap . sometimes , afap may imitate classic fap . in such case , \n mutation analysis is useful . because some mutations in the apc gene are associated with genetic heterogeneity , the type and severity of disease . \n however , apc mutation is not detected in 3050% of the patients with fap or afap phenotype . \n wide genomic deletions are observed in 1015% of the patients with negative classic fap mutations . \n , same apc deletion was detected in the proband and his daughter who presents classic fap phenotype as well as his daughter with afap phenotype . in the analysis conducted by tunca et al . on a turkish patient with colorectal cancer , \n deletion of nucleotide t in codon 1172 causes frameshift mutation and creates a premature stop codon . \n same apc gene mutations may cause different phenotypes of diseases by effect of environment and other genetic factors . \n similarly , the p.his1172gln ( c.3516delt ) mutation found in our family caused both fap and afap phenotypes as well as tubular adenoma on the periampullary region in the proband . \n a significant association was reported between codon 5641465 mutations and duodenal polyp and gastric adenoma in particular . \n the t deletion in codon 1172 in our proband caused fap phenotype as well as adenoma in the periampullary region . \n the nucleotide change in codon 1413 existing in the mother and both daughters was detected in patients with both non - fap , non - map ( muthy - associated polyposis ) and in the healthy controls in the study conducted by azzopardi et al . . \n since the mutation was detected in the symptomatic ( in both daughters ) and asymptomatic ( the mother ) individuals in the family , we believe that such nucleotide change is a polymorphic variant . consequently , the fap disease has a high incidence for development of cancer . \n along with common use of genetic tests in the clinical practice in the future , genotype phenotype correlation may be recognized better and useful for early diagnosis and prevention of familial cancer syndromes . \n ", "role": "user" }, { "content": "familial adenomatous polyposis ( fap ) is an autosomal dominant syndrome leading to colorectal cancer . \n this disease appears as a result of germline mutation in adenomatous polyposis coli ( apc ) gene . \n the aim of the present study is to report the association between two different nucleotide substitutions detected in a family with fap . in the proband , p.his1172gln ( c.3516delt ) \n was detected in exon 15 of the apc gene . \n furthermore , p.his1172gln ( c.3516delt ) and , in addition to this mutation , p.met1413val ( c.4237 a > g ) were detected in exon 15 in both daughters of the proband . \n however , we believe that single nucleotide change in codon 1413 may be a polymorphic variant and deletion t in codon 1172 of apc gene is associated with fap , attenuated fap and extracolonic fap involvement . along with common use of genetic tests in the clinical practice , genotype \n phenotype correlation may be recognized better and useful for early diagnosis and prevention of familial cancer syndromes .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: acute disseminated encephalomyelitis ( adem ) is a monophasic acute non - vasculitic inflammatory demyelinating disorder of the central nervous system characterized by diffuse neurologic signs and symptoms coupled with evidence of multifocal lesions of demyelination on neuroimaging . \n it was first described in the early 18 century as uncommon presentation of measles and small pox . \n little is known about the incidence throughout the world but in usa may be approximately 1.53/100,000 . \n adem is more common in the winter months and 80% of childhood cases occur in the first decade of life . \n mcalpine in 1931 described three sets of patients with adem : ( 1 ) post - vaccination , ( 2 ) after infectious fevers and ( 3 ) spontaneous . \n a number of recent reports of adem in children have confirmed the observations of mcalpine . \n the imaging studies are the cornerstone in confirming the diagnosis of adem using computerized tomography ( ct ) and the more sensitive magnetic resonance imaging ( mri ) for disclosure of the extent and number of lesions . \n others including electroencephalograms ( eeg ) , cerebrospinal fluid ( csf ) and virology studies also help in the diagnosis . \n several articles suggested that improved outcome of adem was attributable mainly to the use of intravenous gamma globulin , steroids and other immunosuppressive therapies . \n the objective of the present study is to clarify adem with an emphasis on the relationship of clinical features , microbiology , neuroimaging , and treatment to clinical outcome in 21 kuwaiti children with adem . \n this is a prospective study of patients with adem who were admitted to the pediatric departments in aladan and alfarawanya hospitals , kuwait , from january 2009 to january 2011 . during the period of the study , \n all patients who presented with acute neurological symptoms and signs were subjected to thorough history taking , complete physical and neurological examinations . \n all patients were subjected also to complete blood count with blood film , liver function tests , renal function tests , blood culture and sensitivity , creatinine phosphokinase , and cold agglutinin . \n csf examination was carried out for all the patients within the first 24 h of admission . \n csf examination included biochemistry , gram stain , cytology , latex agglutination , culture and sensitivity for bacteria , and virology studies . \n polymerase chain reaction ( pcr ) tests for enteroviruses , herpes simplex virus ( hsv ) , epstein - barr virus ( ebv ) , and mycoplasma pneumoniae were carried out for pharyngeal and nasopharyngeal swabs , blood and csf , whereas enzyme - linked immunosorbent assay for rotavirus ( in stool if there was concurrent history of diarrhea ) and immunoglobulin g ( igg ) and igm antibody tests for viruses and m. pneumoniae . in the case of antibody titers , igm - specific antibody levels , and rising igg - specific antibody levels \n spinal mri scans of the cervical , thoracic and lumbar cord were also performed for 13 patients who had spinal related neurological symptoms . \n clinical follow - up of all patients after discharge from hospital with brain and spinal mri scans for the degree of improvement , new lesions , and enhancement . \n the diagnosis of adem was based on the acute onset of neurologic signs and symptoms together with brain mri evidence of multifocal , hyperintense lesions on t2-weighted images . \n demographic data , clinical symptoms and signs , laboratory results , ct and mri findings , and treatment response were tabulated . \n demographic data , clinical symptoms and signs , laboratory results , ct and mri findings , and treatment response were tabulated . \n during the period of the study , 48 patients ( 26 males and 22 females ) presented with acute neurological symptoms and signs , among them 21 patients ( 12 male and 9 female ) fulfilled the diagnostic criteria for adem . \n the patients ranged in age from 2 years to 12 years with a mean of 7.5 years . \n the patients showed a seasonal distribution with 80.95% ( 17 of 21 ) presenting in winter and spring ( december to may ) . only one case ( 4.8% ) occurred in summer and 3 ( 14.3% ) in late fall . \n 57% of patients ( 12 of 21 ) had a history of upper respiratory tract illness mostly 4 weeks before presentation . \n one patient had a history of measles , mumps and rubella vaccine , and two patients had a history of acute gastroenteritis . \n demographic and clinical characteristics of the study population the most common presentation was motor deficits ( as ataxia , paraparesis , hemiparesis , and monoparesis ) . convulsions ( either generalized or focal or even status epilepticus ) followed by altered consciousness were the second and third common neurologic sign / symptom . \n one patient presented with eye aches and visual disturbances and another 2 patients presented with oculomotor nerve palsy . \n only one patient had urinary symptoms as transient retention of urine and two patients had sensory deficit . \n the white blood cell count ranged between 3200 and 29200/mm with a mean of 11,300 cells / mm . \n csf evidence of inflammation ( either pleocytosis or elevated protein ) was present in 16 patients ( 76.2% ) . \n the csf leucocytes count ranged between 0 and 1400 with a mean of 50.6 cells / mm . \n the csf protein ranged between 45 mg / dl and 2200 mg / dl with a mean of 89.7 mg / dl . \n initial laboratory studies in 21 patients with adem viruses were identified in only four patients . among twelve respiratory secretions obtained for fluorescent antibody testing , \n a definite microbiologic diagnosis of hsv and ebv was established in csf samples of three patients ( two for hsv and one for ebv ) . \n a possible diagnosis of m. pneumoniae disease was made in two patients with a history of upper respiratory tract symptoms . \n eeg were performed in 13 patients ; three showed generalized slowing , and two showed focal discharges . \n brain ct scan revealed lesions in only one patient who had scattered supratentorial mild hypodensities in the subcortical white matter and no associated mass effect . \n brain mri was performed in all patients with t1 , t2 , fluid attenuation inversion recovery ( flair ) , and gadolinium - enhanced t1 images . \n a total of 232 lesions were seen in the brain ( mean : 11.2 per patient ; range : 448 ) . \n most lesions were less than 1 cm but in some cases were up to 2 cm in diameter . \n initial t1 , t2/flair mri findings in 21 patients with adem 18 patients ( 85.7% ) had cortical and/or subcortical white matter lesions , which were bilateral and asymmetric in location and size . in three patients , predominantly unilateral involvement of the cortical gray and subcortical white matter was noted . as regards lobar location , \n 47.6% of these hyperintense lesions were frontal , followed by parietal ( 23.8% ) , temporal ( 19.1% ) , and occipital ( 9.5% ) . \n lesions were detected in the cerebral cortex in 76.1% , in subcortical white matter in 90.5% , in periventricular white matter in 61.9% , in deep gray matter ( basal ganglia or thalamus ) in 47.6% and in the brainstem in 38.1% of patients . \n follow - up mri scan was performed in all our patients at 3 month after discharge from the hospital and may be repeated up to 2 years after discharge from hospital according to the neurological status of the patient . in only 1 of 21 patients , the mri did not return to normal , whereas the other 20 patients mri scan findings improved both in number and in size of lesions . \n a repeat mri showed complete disappearance of previous lesions , but three new lesions appeared in different locations . \n this patient had no other neurological deficits and these new lesions disappeared on follow - up mri scan 18 months from the initial lesion . \n this patient had new hyperintense lesions on t2 flair in the cortical gray matter of the contralateral side with mild encephalomalacia in the right temporal lobe . \n however , a putative diagnosis of multiple sclerosis ( ms ) remains a consideration in both of the patients . \n patients stayed in the hospital for duration ranged from 7 days to 31 days with a mean of 14.3 days . \n twelve patients received prednisone at 2 mg / kg / d for 7 days and tapered over 10 days . \n three patients received high - dose intravenous methylprednisolone of 20 mg / kg / d within the 1 week of hospitalization for 5 days and tapered over 4 weeks . \n six patients received both steroids and intravenous immunoglobulin at 400 mg / kg / d for 5 days . \n antibiotics were given to all our patients , and acyclovir was given to 11 patients . \n anticonvulsants were administered to any patient who had seizures during the course of their illnesses and only one of them required long - term anticonvulsant medication . at discharge , \n all patients were completely conscious , but only five patients had mild neurologic deficits ( three patients with gait disturbances , one patient with paraparesis and one patient with resolving hemiparesis ) . \n sixteen patients did not have any neurological deficits at the time of discharge from the hospital . \n of the five patients who had neurological deficits at discharge , three of them were functioning normally without any deficits within the first 3-month follow - up and the other two patients had residual gait problems , which improved completely within 6-month follow - up . \n only one patient had transient urine retention without other neurological defects 9 months after initial presentation and his follow - up mri showed complete disappearance of previous lesions , but three new lesions appeared in different locations . \n follow - up mri scans showed mild encephalomalacia in the right temporal lobe and new hyperintense lesions on t2 flair in the contralateral cortical gray matter . \n brain ct scan revealed lesions in only one patient who had scattered supratentorial mild hypodensities in the subcortical white matter and no associated mass effect . these lesions were bilateral and asymmetric . \n brain mri was performed in all patients with t1 , t2 , fluid attenuation inversion recovery ( flair ) , and gadolinium - enhanced t1 images . \n a total of 232 lesions were seen in the brain ( mean : 11.2 per patient ; range : 448 ) . \n most lesions were less than 1 cm but in some cases were up to 2 cm in diameter . \n initial t1 , t2/flair mri findings in 21 patients with adem 18 patients ( 85.7% ) had cortical and/or subcortical white matter lesions , which were bilateral and asymmetric in location and size . in three patients , predominantly unilateral involvement of the cortical gray and subcortical white matter was noted . as regards lobar location , \n 47.6% of these hyperintense lesions were frontal , followed by parietal ( 23.8% ) , temporal ( 19.1% ) , and occipital ( 9.5% ) . \n lesions were detected in the cerebral cortex in 76.1% , in subcortical white matter in 90.5% , in periventricular white matter in 61.9% , in deep gray matter ( basal ganglia or thalamus ) in 47.6% and in the brainstem in 38.1% of patients . \n follow - up mri scan was performed in all our patients at 3 month after discharge from the hospital and may be repeated up to 2 years after discharge from hospital according to the neurological status of the patient . in only 1 of 21 patients , the mri did not return to normal , whereas the other 20 patients mri scan findings improved both in number and in size of lesions . \n a repeat mri showed complete disappearance of previous lesions , but three new lesions appeared in different locations . \n this patient had no other neurological deficits and these new lesions disappeared on follow - up mri scan 18 months from the initial lesion . \n this patient had new hyperintense lesions on t2 flair in the cortical gray matter of the contralateral side with mild encephalomalacia in the right temporal lobe . \n however , a putative diagnosis of multiple sclerosis ( ms ) remains a consideration in both of the patients . \n patients stayed in the hospital for duration ranged from 7 days to 31 days with a mean of 14.3 days . \n twelve patients received prednisone at 2 mg / kg / d for 7 days and tapered over 10 days . \n three patients received high - dose intravenous methylprednisolone of 20 mg / kg / d within the 1 week of hospitalization for 5 days and tapered over 4 weeks . \n six patients received both steroids and intravenous immunoglobulin at 400 mg / kg / d for 5 days . \n antibiotics were given to all our patients , and acyclovir was given to 11 patients . \n anticonvulsants were administered to any patient who had seizures during the course of their illnesses and only one of them required long - term anticonvulsant medication . \n at discharge , all patients were completely conscious , but only five patients had mild neurologic deficits ( three patients with gait disturbances , one patient with paraparesis and one patient with resolving hemiparesis ) . \n sixteen patients did not have any neurological deficits at the time of discharge from the hospital . \n of the five patients who had neurological deficits at discharge , three of them were functioning normally without any deficits within the first 3-month follow - up and the other two patients had residual gait problems , which improved completely within 6-month follow - up . \n only one patient had transient urine retention without other neurological defects 9 months after initial presentation and his follow - up mri showed complete disappearance of previous lesions , but three new lesions appeared in different locations . \n follow - up mri scans showed mild encephalomalacia in the right temporal lobe and new hyperintense lesions on t2 flair in the contralateral cortical gray matter . \n twenty one cases of adem were identified during a 2-year period in two general hospitals . \n our study showed a seasonal distribution of cases as 80.9% of cases occurred in winter and spring seasons , suggesting an infectious cause that is also reported in three other studies from usa , united kingdom and australia.[1012 ] in these three studies , a nonspecific infectious disease preceded the onset of adem in > 70% of cases , which is also close to our study in 61.9% of cases . \n many infectious agents , as mumps , rubella , influenza , measles , varicella , hsv , ebv , coxsackievirus mycoplasma , campylobacter , streptococcus , legionella , and rickettsia , have been implicated in adem . despite vigorous attempts to identify microbial pathogens in the present study , \n only six patients were identified to have infectious agents ( two with hsv , one with ebv , one with influenza virus type h1n1 and two with mycoplasma ) . \n the failure to identify microbiological agent suggests that the inciting agent or agents are unusual or can not be recovered by standard laboratory procedures . \n the list of potential winter / spring respiratory pathogens includes influenza , respiratory syncytial virus , and corona virus , but only influenza h1n1 is associated with the winter / spring respiratory illness pattern observed in the present report . \n corona virus has the ability to induce central nervous system ( cns ) demyelination in human and animals . \n no rota virus was isolated from any of our patients ; however , one report described the role of rotavirus in adem in two children with rotavirus diarrhea . a minority of children initially presenting with the clinical and neuroimaging features of adem may subsequently be considered as having ms . \n adem by definition is a monophasic illness ; if there any clinical or radiological recurrences beyond the first few months of the initial illness , ms should be considered . \n two patients ( 9.5% ) in the present study were suspected to have ms because of the recurrence . \n distinction between adem and ms at initial presentation can not be made , although some clinical , radiologic , and even biochemical features may point toward one or the other diagnosis . \n establishing the diagnosis of ms may require prolonged follow - up as the second attack of ms may occurs over a period of months to several years . \n so , clinical and radiological ( mri scan ) follow - up of children with adem beyond the first few months may help in the early diagnosis of ms as the early treatment of ms has been shown to prevent the progression of the disease . \n the present study also confirmed the overall good outcome observed in the american , british and australian reports.[1012 ] one hundred percent of children survived adem in our study and 76.2% of children were neurologically normal on discharge from the hospital and the other 23.8% were completely neurologically free within the 12 month follow - up [ table 1 ] . \n and there was no relation between relapse and weaning of steroid that had happened in the american study . \n high - dose steroid therapy was used in only 14.3% of the children in the present report , whereas 21% , 74% and 88% of children received high - dose steroids in the american , british , and australian studies respectively . \n although there were differences in treatment , but neurologic outcome , relapse rates , and mri findings at follow - up were similar . \n however , our study and the other three studies[1012 ] were designed to evaluate therapy , so it is difficult to assess the actual benefits of steroid therapy in adem . \n the present study demonstrated that adem in children occurs in winter / spring and closely follows an upper respiratory tract illness . \n mri studies demonstrate asymmetric lesions in the cortical and subcortical white matter of the brain . \n initial lesions may persist and new lesions may appear during the immediate recovery period . clinical outcome , in general , is favorable regardless of therapy .", "role": "user" }, { "content": "background : adem , although relatively uncommon , is probably under-recognized.objectives:to spotlight the clinical profile and therapeutic outcome of children with adem.materials and methods : this is a prospective study of patients with adem who were admitted to the pediatric departments in aladan and alfarawanya hospitals in kuwait , from january 2009 to january 2011 . \n clinical , microbiological and radiological data were analyzed.results:of 48 patients presented with acute neurological symptoms and signs , 21 patients fulfilled criteria for adem . \n 80.95% of cases were presenting in winter and spring , 57% of patients had a history of upper respiratory tract illness . \n the commonest presentations were motor deficits , convulsions and altered consciousness . \n csf virology studies showed herpes simplex virus ( hsv ) and epstein - barr virus ( ebv ) ( 3 patients ) whereas nasal and nasopharyngeal swab showed evidence of influenza h1n1 virus ( 1 patient ) . \n brain mri was performed in all patients and revealed multiple hyperintense supratentorial brain lesions on t2/flair images . \n 85.7% of patients had cortical and/or subcortical white matter lesions which were bilateral and asymmetric in location and size.conclusion:adem although rare must be considered in children with acute onset of neurological signs and symptoms and must be distinguished from any acute neurological insult .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the classical strategies employed in the search for genes that predispose to complex phenotypes are linkage and association . \n linkage studies require recruitment , of family units of varying size , and are not , practically feasible in the context , of pharmacogenetics . \n family - based association studies require smaller family units , but they too are not practical for pharmacogenetics , except , for studies conducted in pediatric populations . \n their advantages are considerable , the most , striking being the possibility of recruiting large samples that have sufficient , statistical power to investigate genetic variants of relatively small effect . \n large samples are particularly important if the effect of more than one gene is being studied in the same sample , and interactions among genes and between genes and the environment , are being sought . \n on the other hand , case -control designs are notoriously susceptible to the effects of ethnic stratification , which can lead to spurious results . \n if this population is overrepresented in the case or control group , a spurious finding will result , in which the allele is erroneously associated with the phenotype . \n the nature of the problem is illustrated in figure 1 , which shows the frequency of the gly allele of the dopamine d3 receptor gene ( drd3 ) scr9gly polymorphism in samples from several populations . \n these samples were included in a pooled and meta - analytic study of the drd3 ser9gly polymorphism as a risk factor for td . \n great variability in the frequency of the 9gly allele in the different samples included in the study is immediately evident , ranging from 30% to 40% among caucasians from different countries , and reaching 80% among african - americans . \n if the association of the drd3 gly 9 allele with td were tested without controlling for ethnicity in this pooled sample , made up of 317 patients with td and 463 patients without td , spurious results could easily arise . \n therefore , a stepwise logistic regression was employed so as to allow the confounding effects of ethnicity and also age and gender to be taken into account . \n td was significantly associated with drd3 \n gly9 allele carrier status ( x=4.46 , df=1 , p=0.04 ) over and above the effect , of ethnicity . \n similar positive effects were observed when controlling for age and gender ( x=5.02 , df=1 , p=0.02 ) . \n a meta - analysis was performed , which included all the samples in the pooled analysis , as well as data from additional published studies . the mantel - haenszel pooled odds ratio ( or ) for drd3 gly9 allele carrier status increasing susceptibility to td was 1.33 ( 95% confidence interval [ ci ] 1.04 - 1.70 , p=0.02 ) ( figure 2 ) . \n meta - analyses are less sensitive to stratification and admixture ( unless these are present in the samples included in the meta - analysis ) , since original data are not pooled and the unit , of analysis is studies and not individuals . the findings of our studies of the drd3 ser9gly polymorphism and td indicate that , when pooled pharmacogenetic analyses arc conducted on well - characterized samples , it is possible to control for the potentially artifactual effects of ethnicity . \n this is important , because it is essential to gather large samples for pharmacogenetic studies so as to have sufficient statistical power . \n the same general strategy was implemented to examine the association of the serotonin 5-ht2a receptor gene and td , and also to examine association of the 5-ht2c receptor gene with unipolar and bipolar affective disorder . \n when using ostensibly homogeneous samples , the genomic control method may be implemented to rule out population influences on the markers being studied . \n this involves genotyping additional markers that are putatively unrelated to the phenotype , and these are used to determine the degree of stratification that is present in the sample . \n it is often not taken into account , that genetic variants may have differing functional importance depending on the stage of the life cycle . \n this is obvious in the case of genes that predispose to disorders of later life such as alzheimer 's disease ( although the pathophysiological effects of variations in these genes may be manifested long before the clinical threshold is crossed ) . \n similarly , genes that , influence neurodevelopment in utero may be associated with susceptibility to schizophrenia that only becomes clinically manifest , in late adolescence . \n we have observed an age - related association of two serotonergic genes , the 5-ht2c \n ( htr2c ) and the 5-ht2a receptor ( htr2a ) with susceptibility to td . \n our finding with the 5-ht2a receptor has been replicated in a large multicenter study . \n in an earlier report \n ( figure 3 ) , we showed that scores on the abnormal involuntary movements scale ( aims , the hallmark of td ) were significantly related to the ser23 allele of the cys23ser polymorphism of the 5-htc receptor gene and to the 102c allele of the t102c polymorphism in the 5-ht2a receptor gene , in older but , not , younger patients . \n we sought , to replicate this finding the context of a multicenter study involving 635 patients , 256 of whom manifested td and 379 of whom did not . \n our initial analysis employed stepwise logistic regression as for our drd3 study and showed an overall association of the t102c polymorphism in the 5-ht1a receptor gene with td . \n we then analyzed the younger and older patients separately . in keeping with our finding in the jerusalem sample alone , \n the t102c polymorphism was significantly associated with td in the older patients only ( figure 4 ) . \n these replicated findings accentuate the importance of taking into account the possibility that pharmacogenetic effects may be age - related . \n thus , an association first , reported in an older sample may be missed if replication is sought , in a younger sample . \n this was the case with our initial report , of an association of the t102c polymorphism in the 5-ht2a receptor gene with td , which was initially not , replicated by basile et al who studied a sample more than two decades younger than ours . \n the age range of the pooled sample studied by lerer et al was wide enough to allow replication of the finding in the older subjects . \n pharmacogenetic phenotypes ( such as treatment outcome , onset , of therapeutic effect , rapidity of response , and adverse effects ) are complex traits to which background and demographic factors contribute , as well as factors related to the treatment . \n the genetic background is likely to be polygenic , with an as - yet unknown number of genes contributing a small proportion of the variance . \n one model is additive , the assumption being that , each gene contributes cumulatively to the phenotype , and that , the overall risk is a sum of these individual contributions . a second \n , more complex model postulates that the effects of certain genes are conditional on others , implying gene - gene interaction or epistasis . under this model \n , a specific allele of gene a will confer an effect , in the presence of a specific allele of gene b , but will not confer susceptibility in its absence . \n the situation is rendered more complex by the possibility that haplotypes made up of two or more variants may contribute additively or interactively to susceptibility . \n these considerations are applicable to td , which is a complex trait , related to drug treatment , to which several demographic and background factors contribute , most notably age , and with which several genes have been associated . as \n yet , there has been relatively little work in psychiatric pharmacogenetics on the combined effects of genes and on gene - gene interaction . \n these models have been tested on a limited basis in the context of susceptibility to td in samples that we and other investigators have studied ; the scope of such testing is constrained by the size of the samples . \n the additive effects of two genetic variants on susceptibility to td were first reported by scgman et al . \n patients who carried both the gly9 allele of the drd3 ser9gly polymorphism and the ser23 allele of the 5-ht2c cys23ser polymorphism showed evidence of an additive effect of the two risk alleles , both of which had been shown to separately increase risk for td . \n as shown in figure 5 , the highest , aims orofacial dyskinesia scores were observed in patients who carried both mutant risk alleles . \n studying gene - gene interaction and risk for td , segman et al examined the interactive contribution of a tc polymorphism in the promoter region of the cytochrome p450 17-hydroxylase gene ( cyp17 ) and the ser9gly polymorphism of drd3 that was previously shown to be associated with td . \n cyp17 variability could influence susceptibility to td because of effects on neuroprotective capacity or dopamine output through its role in the conversion of the neurosteroid , pregnanolone , to dehydroepiandrosterone ( dhea ) . a tc transition ( a2 allele ) in \n the 5 ' promoter region of the cyp17 gene creates an additional spl type ( ccacc box ) promoter site , resulting in a functionally relevant , increase in transcription rate . \n segman et al found that the tc polymorphism was not in itself associated with td . \n however , there was a significant excess of drd3 gly allele carriers among carriers of the cyp17 cc genotype with td compared with those without td ( 75.0% vs 14.3% ; x \n = 6.0 , df=1 , p=0.01 ) . \n significant differences were not observed among carriers of the cyp17tt genotype or cyp17tc genotypes with td and carriers of these genotypes without td . two way analysis of variance ( anova ) with age at first , antipsychotic treatment as covariate showed a significant main effect of drd3 genotype on aims total score ( f=14.9 , df=1 , 106 , p=0.0002 ) . there was no main effect , of cyp17 genotype on the aims score . \n there was a significant , interaction between drd3 and cyp17 genotype on aims total score ( f=4.2 , df=2 , 106 , p=0.02 ) . \n figure 6 shows adjusted mean aims scores ( derived from analysis of covariance [ ancova ] ) for the patients grouped according to drd3 and cyp17 genotype . \n posthoc newman - keuls tests showed that the highest aims total ( p<0.03 ) was in patients carrying the drd3 gly9 allele and the cyp17 cc genotype . another gene - gene interaction reported in relation to td involved drd3 and cytochrome p450 1a2 ( cyp1a2 ) . \n basile et al further found that , those patients who exhibited the risk genotype at , both drd3 ( gly9/gly9 ) and at cyp1a2 ( cc ) had the most , severe td , whereas those who had only one risk genotype ( gly9/gly9 or cc ) demonstrated intermediate severity of td . \n those patients who did not , have any risk genotypes at either locus demonstrated the lowest mean td severity scores on the aim 's scale ( p<0.00007 ) . \n a more recent report of gene - gene interaction conferring susceptibility to td concerns the functional ala9val polymorphism in exon 2 of the magnesium superoxide dismutase gene ( mnsod ) . \n mnsod is one of three isoforms of superoxide dismutase ( sod ) that are important , as antioxidants in protecting cells from the deleterious effects of free radicals . the ala9 variant , \n hori et al found a small but , significant increase in the wild type val allele in japanese schizophrenia patients with td , suggesting that the ala allele may be protective against , free radical damage in td . \n this finding was not , replicated by zhang et al in chinese schizophrenia patients with td . however , in a subsequent report zhang et al found that the val - val genotype was in fact associated with td , but . only in those patients who were carriers of the gly allele of the drd3 scr9gly polymorphism . \n we examined association of the ala9val polymorphism of mnsod with td in israeli schizophrenia patients and also tested for an interaction between this polymorphism and the drd3 ser9gly polymorphism ( segman et al , unpublished data ) . \n patients were grouped according to whether they were carriers of the ala allele of mnsod , the gly allele of drd3 , both , or neither . \n this grouping takes into account an effect , of drd3 gly to increase susceptibility and a protective effect , of mnsod ala and anticipates that patients carrying drd3 gly and lacking mnsod - ala will be most , susceptible to td and will have the most severe abnormal involuntary movements . \n the mnsod - val drd3-gly genotype combination was the most , frequent , among patients with td ( 64% ) and the mnsod - ala drd3-ser genotype ( 24% ) was the least frequent . among patients without , \n the most frequent genotype combination was mn.sod - ala\\ drd3-ser ( 76% ) and the least frequent , combination was mnsod - val drd3-gly ( 38% , x \n = 10.5 , df=3 , p=0.01 ) . \n table i shows that patients with the mnsod - val\\ drd3-gly genotype combination have the highest , aim 's total scores and patients with the mnsod - ala drd3-ser genotype combination have the lowest ( f=6.16 ; df=3 , 102 ; p=0.0007 ) . \n the aim of pharmacogenetic research is to develop clinically useful tests that will allow potential responders to a particular psychotropic agent to be identified prospectively , as well as those individuals likely to develop adverse effects . \n some of the reasons for this difficulty are applicable to drugs used to treat other complex disorders ; others are specific to psychotropic agents . \n the polygenic basis of pharmacogenetic traits is an issue of major importance . for most traits it , \n is unclear how many genes arc involved , and genes that have been implicated thus far in well - studied phenotypes such as td are of small effect . \n the or observed rarely exceed 2.0 , and for the most part , are less than 1.5 . \n it requires large samples to explore such small gene effects in the definitive fashion required for their inclusion in a pharmacogenetic test . \n large samples are also needed in order to tease apart , gene - gene and gene - environment interactions . \n recruitment , of large samples inevitably increases the likelihood of stratification , which can lead to spurious results and must be taken into account . \n a further consideration is that , background and demographic variables must be considered ( as pointed out in this paper for the role of age in the manifestation of certain gene effects in td ) as well as treatment - related variables such as medication dose , duration of treatment , and age at onset of treatment . \n furthermore , treatment outcome is frequently related to severity of illness , and this must , also be taken into consideration . \n thus , it , is clear that a model used to predict treatment outcome or susceptibility to adverse effects will be unavoidably complex , given the number of background and potential predicting variables that will need to be taken into account including gene - gene and gene - environment interactions . \n based on our previous work on the genetics of td , we have developed a preliminary model that takes into account the various , background , clinical and genetic factors that , we have studied ( scgman et al , unpublished data ) . \n we employed logistic regression and entered background and clinical variables known to influence susceptibility to td such as age , sex , cigarette - smoking , age at first , antipsychotic treatment , duration of antipsychotic treatment , antipsychotic dose in chlorpromazine units , and total score on the positive and negative syndrome scale ( panss ) . \n the genetic variables included were drd3 gly9 allele carrier status , mssod ala9 allele carrier status , htr2c ser23 allele carrier status , cyp17 genotype and htr2a genotype . \n interactions were also tested for inclusion , but none were retained in the final model . \n the overall model ( table ii ) was significant ( r=0.32 ; p=0.0005).the variables that , significantly predicted td within the model were age ( or=1.04 , p=0.047 ) , panss total score ( or=1.02 , p=0.014 ) , . \n drd3 gly9 allele carrier status ( or=4.39 , p=0.006 ) , and htr2a 102cc genotype ( or=4.18 , p=0.02 ) . \n mnsod ala9 allele carrier status and htr2c ser23 allele carrier status were retained in the overall model , but were not , significant . in this manner \n , 70.3% of cases could be correctly classified , compared with 60.2% prior to entry of the variables . \n . it is based on a single small sample of subjects , and may not , be generalizable to other samples and populations . while recognizing these limitations , the model does support the concept that a combination of background , clinical , and genetic variables could potentially be used to evaluate a priori the risk for td in patients treated with antipsychotic drugs that have the potential to induce this adverse effect . \n this approach could be extended to other pharmacogenetic phenotypes , and ultimately allow the development , of clinically viable pharmacogenetic tests that , will serve as the basis for a rational assessment of cost - benefit ratios in the choice of treatment with antipsychotics and other antipsychotic drugs .", "role": "user" }, { "content": "the core hypothesis underlying pharmacogenetics is that genetic factors play a significant role in the well - recognized differences between individuals in response to medication and susceptibility to adverse effects . \n if these genetic factors can be identified and understood , they may serve as predictors to guide clinicians in tailoring medication to the individual patient . \n recent developments in the field of antipsychotic drug treatment suggest that pharmacogenetics could play an important role , permitting the use of first - generation antipsychotics ( fgas ) for patients in whom the use of second - generation antipsychotics ( sgas ) is limited by efficacy considerations or adverse effects , in this paper , key issues that need to be taken into consideration in designing and interpreting pharmacogenetic studies of antipsychotic drugs are discussed against the background of data emanaling from studies on the genetics of tardive dyskinesia ( td ) , an important adverse effect of fgas . \n the issues considered include the advantages and potential pitfalls of case - control association studies of pharmacogenetic traits , the role of demographic factors such as age and gender , additive effects of genes , and gene - gene and gene - environment interaction . \n the prospects for implementation of pharmacogenetic testing in the clinic are considered in the context of a preliminary model that has been tested for prediction of susceptibility to td .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the art of body piercing is an age old process for the people in the developed countries . \n however , nowadays , it has evolved as a part of their fashion process and the ear being the most common body part pierced . \n although it is a routinely performed procedure , it is not without complications such as oedema , haematoma , infection and keloid formation . \n most commonly used in dental surgery , the laser scalpel is nowadays used almost in all procedures due to its safety , precision , ease of use , haemostasis , less post - operative pain and oedema and lesser scarring . in this article \n , we would like to describe a novel method of laser ear piercing using the diode laser . \n an 18-year - old female patient visited the plastic surgery outpatient department , with a desire to get an ear piercing . \n the patient already had pierced ear lobule and wanted a second piercing above the first one . \n after routine blood investigations had been done , the procedure was carried out in the department laser operation theatre . \n the chosen site for piercing was marked , and non - contact cooling was applied . after ensuring adequate cooling and local anaesthesia , doc medica diode laser ( doc medica srl , corso casale , torino , italy ) with a power of 2.0 w in continuous mode was used to make a tract from the anterior to posterior direction [ figure 1 ] . \n once the tract was made , a gold stud was introduced through the tract [ figures 24 ] . the same procedure was repeated on the opposite side . applying diode laser and making the tract from anterior to posterior direction \n golden ear studs being inserted through the tract with accuracy and hemostasis screw is tightened to the stud with proper visibility ear stud in place , at the exact place marked pre - operatively intraoperatively , it was noticed that there was very minimal bleeding . \n the probe was almost the same size as the earring stud , and the long tip was comfortably tunnelled to the other side . \n there was no need for any traction to the ear lobule and the anatomy was maintained , so the direction of the tunnel was made in the desired way . \n the patient was advised to apply an antibiotic ointment at the site of piercing every day for 1 week . \n the wire technique which necessitates serial dilatation of the tract until the suitably sized ear stud can be placed is a painful process . \n piercing guns used very commonly among jewellers did not gain much acceptance among doctors due to the higher incidence of infection . \n the most common technique used is the railroading method , wherein an 18-gauge needle is railroaded over a 26-gauge needle over which the tip of the earring is guided through . \n a newer method of ear lobe piercing was described by lamba and gupta , in which an 18-gauge bd insyte - w intravenous catheter was used for piercing . \n the co2 laser has been used for ear piercing by chang et al . in 2010 . \n the electric current is the pump source which produces photons which are conducted through a laser active medium . \n it is cheap , small in size and has a long flexible fibre cable which makes the diode laser scalpel easy to use . \n the use of diode laser for ear piercing has many significant advantages over the conventional techniques . \n the procedure can be carried out with topical local anaesthesia combined with various pre - cooling methods used in conventional laser therapy such as cold gel application and cryospray application . \n this avoids the need for an injection before the procedure and can be useful in children . \n the laser scalpel instantly ablates the tissues it cuts causing excellent haemostasis . in the ear , where there is \n rich blood supply and bleeding is a common problem , the use of laser scalpel for piercing holds this excellent advantage . \n this causes very minimal chances of post - operative perichondritis or wound infection reducing the chance for keloid formation . \n studies have shown that the use of piercing gun or 16-gauge cannula for piercing cause stripping of the perichondrium from the cartilage which is more at the exit site . \n this damage to the relatively avascular cartilage makes the ear more prone to infection . as the diode laser probe is precise , causing less tissue injury the chance of damage to cartilage is reduced greatly and hence the chance of post - procedure keloid formation is also reduced . \n chang et al . conducted a study in 2010 , comparing co2 laser and spring loaded gun for ear piercing . \n the study concluded that though there was pain intraoperatively when the laser was used for piercing , the post - operative pain was significantly lesser than when spring loaded gun was used . we have noticed that tip of the diode laser is almost of the same size of the earring studs and its penetrating property with minimal coagulation will be more ideal for the purpose . \n after the procedure , it was found to have numerous advantages compared to the conventional methods and the co2 laser method . \n the diode laser is a fast , safe , easy to use and highly effective way of ear piercing . \n the advantages we noticed while using the diode laser over conventional methods were more precision , minimal trauma with less chances of hypertrophy and keloids , no bleeding with coagulation effect of laser , less time taken compared to conventional method and less chance of infection due to thermal heat effect of laser . \n thus , we recommend its use for all ear piercings . there are no conflicts of interest . \n \n \n ", "role": "user" }, { "content": "earlobe piercing is a common office room procedure done by a plastic surgeon . \n various methods of ear piercing have been described . in this article , we describe a novel method of laser ear piercing using the diode laser . \n an 18-year - old female patient underwent an ear piercing using a diode laser with a power of 2.0 w in continuous mode after topical local anaesthetic and pre - cooling . \n the diode laser was fast , safe , easy to use and highly effective way of ear piercing . \n the advantages we noticed while using the diode laser over conventional methods were more precision , minimal trauma with less chances of hypertrophy and keloids , no bleeding with coagulation effect of laser , less time taken compared to conventional method and less chance of infection due to thermal heat effect of laser .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: tuberous sclerosis complex ( tsc ) is a rare autosomal dominant disorder first described by von recklinghausen in 1862 . in 1880 , bourneville coined the term sclerose tubereuse based on the pathologic features of the sclerotic tubers found in the postmortem investigation of patients with epilepsy and mental retardation , henceforth known as bourneville 's disease . \n tsc is classified as a phakomatosis ( neurocutaneous disorder ) and which is characterized by the presence of glial cell tumors arising in the cerebral hemispheres and retina . \n it is clinically characterized by the triad of epilepsy ( epi ) , intellectual disability ( loi ) , and adenoma sebaceum ( a ) , therefore , encompassing these features sherlock coined the term epiloia . \n the frequency of tsc has been estimated to be 1 in 10,000 live births and is about a third as common as neurofibromatosis type 1 . \n it is a multisystemic disorder which becomes perceptible only in late childhood , limiting the expediency for early diagnosis in infancy . here , \n we present a case report of a 26-year - old male patient with distinctive clinical , radiological , and histological features of tsc . \n a 26-year - old male patient presented with multiple growths in the upper and lower gums since 5 years . \n the patient noticed the growth for the past 5 years , which gradually increased in size to attain the present size . \n there was no history of pain or blood / purulent discharge associated with the growth . \n the patient was a known epileptic and hysteric since the age of 10 and under anticonvulsant and antidepressants . \n on general physical examination , multiple well - defined , reddish - brown sessile nodular growths were noted on the forehead , nose , and cheeks in a characteristic butterfly pattern and front and back trunk region - angiofibromas . \n similar sessile and firm nodular growths were noted in the upper and lower extremities of varying sizes , suggestive of periungual fibromas or kenen tumors . a well - defined roughened hypermelanotic patch was noted in the left shoulder girdle and the right lumbosacral region showing an orange peel appearance indicative of shagreen patch [ figure 1 ] . \n clinical photograph of the patient showing multiple well - defined , reddish - brown sessile nodular growths on the forehead , nose , and cheeks in a characteristic butterfly pattern , shagreen patch , and periungual fibromas on intraoral examination , similar well - defined , sessile , firm , and nodular growths were seen in the marginal and attached gingiva in the upper and lower anterior region of varying sizes . \n multiple hypoplastic enamel pits were noted in the occlusal aspect of posterior teeth [ figure 2 ] . based on the history and clinical findings , \n multiple gingival growths and hypoplastic enamel pits the patient was subjected to various radiological , hematological , and histopathological investigations . \n a radiopaque mass resembling tooth such as structure involving enamel , dentin , and pulp was seen in the periapical region of 21 , 22 regions suggestive of compound odontome . \n chest radiograph revealed inferior displacement of the left border of ventricle suggestive of left ventricular hypertrophy . \n axial computed tomographic sections of the brain showed hypodense areas measuring approximately 5 mm 5 mm in the subependymal regions of both ventricles indicating multiple calcified tuberous lesions ( subependymal nodules ) [ figure 3 ] . \n orthopantomogram , intraoral periapical radiographic view , chest radiograph , and axial computed tomography view hematological investigations were found to be satisfactory except for erythrocyte sedimentation rate which was found to be raised to 32 mm . \n henceforth , excisional biopsy of the gingival growth in 23 , 24 regions and cutaneous punch biopsy was performed . \n microscopically , hematoxylin and eosin - stained section of the intraoral tissue specimen showed a stretched out , hypoplastic stratified squamous epithelium overlying connective tissue stroma . \n the underlying connective stroma consisted of dense , thick collagenous bundles with hypocellularity comprising of few fibroblasts , mesenchymal cells , constricted blood vessels , and inflammatory cells . \n the epithelium appeared to be flattened and thinned out with the basal cells exhibiting an abundance of deeply stained melanocytes . \n underlying connective tissue was dense with collagen bundles , mesenchymal cells , and few nerve fiber bundles . \n there was no evidence of sebaceous glands or hair follicles [ figure 4a c ] . \n histopathological view ( a and b , 10 ; c , 40 ) based on all the clinical findings and investigations , a final diagnosis of tuberous sclerosis was confirmed . \n tsc is characterized by the development of unusual tumor - like growths ( hamartomas ) in brain , skin , retina , and viscera . \n the term tuberous sclerosis refers specifically to the presence of multiple sclerotic masses scattered throughout the cerebrum . \n the diagnosis of tsc is based on the identification of hamartomas in more than one organ system . \n the abnormal genes have been localized to one of two sites , the long arm of chromosome 9 ( 9q34 ) , designated as tsc 1 ( encoding hamartin ) , and the short arm of chromosome 16 ( 16p 13.3 ) designated as tsc 2 ( encoding tuberin ) . \n these gene products form a tumor suppressor complex which drives rheb ( ras homolog enriched in brain ) a member of ras superfamily into the inactive guanosine diphosphate - bound state . \n when rheb is in the guanosine triphosphate - bound active state , it stimulates the mammalian target of rapamycin ( mtor ) , an evolutionarily conserved protein kinase and a major effector of cell growth . \n the mutations in these genes result in constitutive mtor activation leading to the formation of various growths and hamartomas in various organs of the body . in a study conducted on 325 tsc individuals , \n 17% of the mutations were found in the tsc1gene , 50% in the tsc2gene , 4% unclassified variants , and 29% with no identifiable mutations . at the tuberous sclerosis consensus conference of 1998 , \n the clinical diagnostic criteria of tsc were revised and a new classification system based on major and minor findings was established . \n the presence of two major features or one major and two minor features was considered sufficient for a definitive diagnosis . \n the major features include ( a ) hypomelanotic macules ( 3 , at least 5-mm diameter ) , ( b ) angiofibromas ( 3 ) orfibrous cephalic plaque , ( c ) ungual fibromas ( 2 ) , and ( d ) shagreen patch . \n the minor features include ( 1 ) confetti skin lesions , ( 2 ) dental enamel pits ( 3 ) , and ( 3 ) intraoralfibromas ( 2 ) . \n the most common oral manifestations of tsc are fibromas , gingival hyperplasia , and enamel hypoplasia ( in almost 100% of these patients and is associated with an increased risk of caries ) . \n the other features include hamartomatous rectal polyps , nonrenal hamartomas , multiple renal and bone cysts , high arched palate , bifid uvula , cleft palate , delayed dental eruption , and presence of diastemas . \n our case presented with three major features facial angiofibromas , kenen tumors and subependymal nodules and two minor features \n the management of these patients is often multidisciplinary involving the neurosurgeon , neurologist , nephrologist , pulmonologist , cardiologist , ophthalmologist , and the genetic counselor . \n surgery including dermabrasion and laser treatment may be useful for the treatment of skin lesions . \n intervention programs including special schooling and occupational therapy may benefit individuals with special needs and developmental concern . \n drug therapy for some of the manifestations of tsc is currently in the developmental stage . \n the use of inhibitors of mtor in regression of various hamartomatous growths is a newer modality in the management of tsc \n . these patients must adopt measures for careful oral and dental hygiene with regular visits to the dentist in order to eliminate potential irritative factors and ensure the early diagnosis of any possible lesions . in the present case , \n the patient was advised to take his physician consultation for modification of the antiepileptic drug . at present , the daily dose of phenytoin is reduced from 400 to 300 mg as maintenance protocol . \n application of fluoride varnish in hypoplastic enamel pits was also performed and kept under periodic recall . \n the prognosis of tsc depends on the severity or multiplicity of organ involvement . about a quarter of severely affected infants \n however , in the case of individuals diagnosed late in life with few cutaneous signs , prognosis depends on the associated internal tumors and cerebral calcifications . \n the present case unambiguously exemplifies the systemic manifestations of tsc and its specific expression in the oral cavity . \n hence , in turn to establish an appropriate diagnosis , oral manifestations of the disorder must not be overlooked which implies the necessity for the level of awareness of tsc among oral practitioners . \n the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) \n has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . \n the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . \n the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) \n has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . \n the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . \n \n ", "role": "user" }, { "content": "tuberous sclerosis complex is an unusual autosomal dominant neurocutaneous syndrome characterized by the development of benign tumors affecting different body systems affecting the brain , skin , retina , and viscera . \n it is characterized by cutaneous changes , neurologic conditions , and the formation of hamartomas in multiple organs leading to morbidity and mortality . \n the most common oral manifestations are fibromas , gingival hyperplasia , and enamel hypoplasia . \n the management of these patients is often multidisciplinary involving specialists from various fields . here , \n we present a case report of a 26-old - year male patient with characteristic clinical , radiological , and histological features of tuberous sclerosis complex .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: transplantacija bubrega sama po sebi popravlja bubrenu funkciju , ali ne dovodi do potpunog oporavka . \n cilj ovog rada bio je da se odrede parametri oksidativnog i nitrozativnog stresa kao i parametri antioksidativne zatite u populaciji pacijenata sa presaenim bubregom sa stabilnom funkcijom grafta i bez klinikih znakova kardiovaskularne bolesti . \n je bio da se utvrdi povezanost meu ispitivanim parametrima i procene potencijalne raz - like izmeu svih ispitivanih biomarkera u odnosu na imunosupresivni protokol . \n je ukljueno 57 pacijenata sa pre - saenim bubregom i 31 kontrolni subjekt , koji su po godinama i polu odgovarali pacijentima sa presaenim bubregom . \n svi pacijenti ukljueni u istraivanje imali su transplantaciju bubrega najmanje 12 meseci pre poetka istraivanja i bili su na standardnoj imunosupresivnoj terapiji . \n u ovom radu odreivali smo reaktivne supstance tiobarbituratne kiseline ( tbars ) u plazmi i eritrocitima , uznapredovale produkte oksidacije proteina ( aopp ) , parametre nitrozativnog stresa ( asimetrini i simetrini dimetilarginin adma i sdma ) i antioksidativne zatite ( ukupne sh grupe i aktivnost katalaze ) . \n rezultati nae studije su pokazali znatno vie vrednosti parametara oksidativnog i nitrozativnog stresa kod pacijenata sa presaenim bubregom u odnosu na zdrave dobrovoljce ( p<0,01 osim za aktivnost katalaze u plazmi , kada je p<0,05 ) . \n je znaajnu pozitivnu korelaciju izmeu adma i sdma ( p<0,01 ) ; adma i nitrata ( p<0,05 ) ; sdma i nitrata ( p<0,05 ) ; izmeu parametara oksidativnog stresa u eksperimentalnoj grupi ; aopp i sh grupe ( p<0,05 ) , kao i tbars u plazmi i sh grupe ( p<0,01 ) , sdma i aopp ( p<0,05 ) ; sdma i tbars u plazmi ( p<0,05 ) ; sdma i sh grupe ( p<0,01 ) ; nitrata i sh grupe ( p<0,05 ) . \n nai rezultati nisu ukazali na statistiki znaajnu razliku u ispitivanim parametrima meu pacijentima na ciklosporinu a i takrolimusu . \n kidney transplantation improves long - term survival compared to maintenance dialysis and is the treatment of choice for patients with end stage renal disease ( 1 ) . \n the most frequent cause of late allograft loss is cardiovascular disease ( cvd ) which constitutes the leading cause of death ( 2 ) . \n in fact , when compared with the general population , renal transplant recipients show a four - fold greater risk for cvd and a two - fold higher risk for cardiovascular death ( 3 ) . \n renal transplant recipients mainly have a history of uremia and dialysis , usually associated with increased oxidative stress ( os ) , and therefore carry the burden of accelerated atherosclerosis already at the time of transplantation ( 4 , 5 ) . \n uremia itself could be a condition associated with increased os ( 6 ) or a pathological condition able to induce an accumulation of oxidant species ( 7 ) . \n reactive oxygen species ( ros ) highly induce tissue damage which results in accumulation of reactive aldehydes , lipid peroxidation , increased plasma thiol oxidation and dna damage ( 7 , 8) . the recovery of renal function after transplantation results in amelioration of the biomarkers of inflammation and os ( 4 ) \n . this improvement might be explicated by the restored clearance of uremic toxins , the regression of left ventricular hypertrophy and better nutritional status ( 9 ) . \n but various studies have shown that even after transplantation there is still imbalance between ros and antioxidative mechanisms that results in os ( 10 ) . \n ros may directly alter proteins which results in formation of oxidized amino acids ( 11 ) . \n proteolysis of proteins containing methylarginine residues results in an increased plasma concentration of asymmetric dimethylarginine ( adma ) ( 12 ) . \n adma is a competitive inhibitor of nitric oxide synthase ( nos ) and may be an intermediate mechanism whereby os impairs endothelial function ( 13 ) . \n finally , it has been demonstrated that adma predicts incident cardiovascular events in patients with renal diseases ( 14 ) . \n besides adma , there are also elevated plasma levels of symmetric dimethylarginine ( sdma ) in patients suffering from renal disease ( 15 , 16 ) . \n transplantation by itself reduces sdma levels , but its effect on adma is still questioned ( 17 , 18 ) . \n advanced oxidation protein products ( aopp ) are protein biomarkers for oxidative stress for patients with uremia ( 19 ) \n . plasma concentrations of aopp increase with the progression of chronic renal failure and are able to trigger the synthesis of inflammatory cytokines acting as inflammatory mediators in renal patients ( 20 ) . \n standard immunosuppressive therapy usually consists of triple drug therapy using three drug classes : calcineurin inhibitors ( cyclosporine or tacrolimus ) , antiproliferative agents and corticosteroids . \n some studies reported that increased levels of malondialdehyde are a consequence of immunosuppressive therapy and that os is induced mostly by cyclosporine a therapy ( 21 ) . \n the aim of the study was to evaluate parameters of oxidative stress ( os ) ; lipid peroxidation markers ; thiobarbituric acid - reactive substances ( tbars ) in plasma and red blood cells ( rbc ) , as well as advanced oxidation protein products ( aopp ) and nitrosative stress ( ns ) parameters ( adma , sdma and nox ) and antioxidative parameters ( total sh groups and catalase activity ) in a group of renal transplant recipients with stable graft function and no clinical signs of cardiovascular disease . \n we also aimed to determine the correlations among all these parameters and to evaluate potential differences in all the biomarkers with regard to the immunosuppression protocol . \n the study was conducted between march and november 2012 at the clinic for nephrology , dialysis and transplantation , clinical centre nis . during this period , \n 57 renal transplant recipients were enrolled , all of whom had undergone post - renal transplant surgery at least 12 months prior to enrollment and were on standard immunosuppressive therapy . \n the control group ( 12 men and 19 women ) , mean age 458.53 , was recruited from the medical staff who were age and sex matched with the renal transplant recipients . \n the study was approved by the ethics committee of medical faculty nis and informed written consent was obtained from each patient . \n the study included 38 men and 19 women , mean age 44.0811.32 years , with 4 years median time from transplantation ( range 124 years ) . \n regarding the type of transplantation , 26.02% were from a deceased donor and 73.97% were living donor related . among the patients , 32.88% were smokers . regarding the history of primary disease , 31.5% had diabetes mellitus ( type 1 + 2 ) and 86.3% had hypertension ( or had an antihypertensive therapy ) . \n the first group , 40.35% of patients , were treated with cyclosporine a ( 3 mg / d ) in combination with mmf ( 1.52 g / d ) and prednisone ( range 520 mg / d ) and the second group , 59.65% of patients , were treated with tacrolimus ( 0.050.1 mg / d ) with mmf and prednisone as a standard regimen . \n biochemical measurements were obtained using standard clinical laboratory methods and analyses performed on the erba xl600 , germany . \n c - reactive protein ( crp ) was measured using immunonephelometric assays ( olympus au400 ) . \n serum , plasma and isolated rbc were used for the determination of os and ns parameters . \n tbars content was assayed in plasma and rbc according to the methods of andreeva and jain , respectively ( 22 , 23 ) . \n the catalase activity was determined by the spectrophotometric method , based on the ability of hydrogen peroxide to form a stable stained complex with molybdenum salts ( 24 ) . \n the absorbance was read spectrophotometrically at 340 nm and compared with a solution of chloramine t dissolved in the same buffer . \n the data were expressed as mol / l of chloramine equivalents and related plasma total protein ( 19 ) . \n the amount of total ( protein and non - protein ) sulfhydryl ( sh ) groups was estimated in plasma by the spectrophotometric assay based on reduction of 2,2-dithiobisnitrobenzoic acid ( dtnb ) , the absorbance was read at 412 nm , and the results were expressed as mol / l ( 25 , 26 ) . \n after deproteinization , the production of no was evaluated by measuring nitrite and nitrate concentrations . \n nitrites were assayed directly spectrophotometrically at 543 nm , using the colorimetric method of griess ( griess reagent : 1.5% sulfanilamide in 1 mol / l hcl plus 0.15% n-(1-naphthyl ) ethylenediamine dihydrochloride in distilled water ) . \n adma and sdma were evaluated by high - performance liquid chromatography on an apparatus ( agilend ) using fluorimetric detection with fluorescence detection according to the method developed by paroni et al . ( 28 ) . \n characteristics of the study group were expressed as mean sd for normal distribution or median ( interquartile range ) for non - normal distribution , or with frequency and percentage for categorical data . \n clinical and biochemical data of the renal transplant recipients and the control group were compared by using student t - test for normally distributed data and mann - whitney u test for data that were not normally distributed . \n the relationship between two variables was determined by pearson s correlation coefficient ( r ) . \n all analyses were performed with spss statistical analysis software , version 10.0 ( spss , chicago , il , united states ) at a significance level set at p<0.05 . \n characteristics of the study group were expressed as mean sd for normal distribution or median ( interquartile range ) for non - normal distribution , or with frequency and percentage for categorical data . \n clinical and biochemical data of the renal transplant recipients and the control group were compared by using student t - test for normally distributed data and mann - whitney u test for data that were not normally distributed . \n the relationship between two variables was determined by pearson s correlation coefficient ( r ) . \n all analyses were performed with spss statistical analysis software , version 10.0 ( spss , chicago , il , united states ) at a significance level set at p<0.05 . \n clinical and biochemical data of the renal transplant recipients are presented in table i. significant differences were found between experimental and control group in bmi ( p=0.045 ) , hemoglobin ( p=0.043 ) , white blood cells ( p=0.006 ) , total cholesterol ( p<0.001 ) , ldl - cholesterol ( p<0.001 ) , triglycerides ( p<0.001 ) , urea ( p=0.043 ) and creatinine ( p<0.001 ) . \n table ii presents differences between oxidative and nitrosative stress parameters : plasma catalase ( p=0.013 ) , sh groups ( p<0.001 ) , aopp ( p=0.003 ) , adma ( p<0.001 ) , sdma ( p<0.001 ) , nitrates ( p=0.005 ) and tbars in plasma ( p<0.001 ) and in rbc ( p<0.001 ) . \n correlation analysis showed a significant positive correlation between adma and sdma ( r=0.650 , p<0.001 ) ; adma and nitrates ( r=0.453 , p=0.020 ) ; sdma and nitrates ( r=0.508 , p=0.008 ) . \n there was also a statistically significant positive correlation between os parameters in experimental group : aopp and sh groups ( r=0.401 ; p=0.038 ) and tbars in plasma and sh groups ( r=0.575 , p=0.001 ) ( table iii ) , sdma and aopp ( r=0.412 , p=0.037 ) ; sdma and tbars in plasma ( r=0.413 , p=0.036 ) ; sdma and sh groups ( r=0.537 , p=0.005 ) ; nitrates and sh groups ( r=0.376 , p=0.049 ) ( table iii ) . \n there was no significant difference in ns parameters ( adma , sdma and nitrates ) in the group of renal transplant recipients with respect to the immunosuppressive protocol ( table iv ) . \n finally , there was no significant difference in the measured os parameters between subgroups with respect to the immunosuppressive treatment ( cya vs. tac ) . \n the only significant increase was found in the concentration of sh groups in the group of patients treated with cyclosporine compared to patients treated with tacrolimus ( p=0.014 ) ( table v ) . \n transplantation per se ameliorates kidney function , but it does not recover it completely . renal transplant patients seem to have less oxidative stress compared with routinely dialyzed patients . \n however , factors such as immune response to allograft , ischemia reperfusion injury , opportunistic infections and immunosuppressive therapy may trigger os in these patients ( 29 , 30 ) . \n oxidative stress parameters , further , may have not been removed from plasma because of insufficient excretion and may continue to rediffuse in circulation ( 31 ) . \n in addition , there is some evidence that changes in plasma tbars levels are accompanied by an increase in renal tbars levels in rats with renal mass reduction suggesting that higher plasma ros levels could reflect local ros production in the kidneys , and it may be that in our model the kidneys are the main place of ros generation ( 32 ) . \n lipid peroxides degrade to reactive aldehydes such as mda that react with proteins , nucleic acids and lipids triggering off further tissue and organ damage ( 33 ) . in our model , \n renal transplant recipients had significantly increased concentrations of tbars ( both plasma and rbc ) and aopp ( in plasma ) , which was not only a result of their higher production , but may be attributed to their extensive half - lives and the ability to diffuse to various tissues ( 34 ) . \n the patients in our study showed a significant increase in aopp levels compared to the control and these results are opposite to the data about normalization of oxidative stress parameters after kidney transplantation ( 35 ) . \n our findings correlate with the results of some other investigators suggesting that continuous immunosuppressive therapy probably contributes to enhanced formation of aopp , even if the graft function is normal ( 36 ) . \n many studies have confirmed that plasma levels of adma in the healthy population are related to age , blood pressure , insulin resistance and carotid intima - media thickness ( 37 , 38 ) . \n these findings suggest that adma can be an early biomarker of atherosclerotic lesion and that it can be used for the assessment of cardiovascular risk ( 39 ) . \n we demonstrated that our experimental group , with no clinically present cardiovascular disease , also had higher concentrations of adma , indicating that they have increased risk for atherosclerosis and possibly declining renal function . \n a significant increase in plasma adma levels could inhibit no production with further development of cardiovascular disease ( 40 ) . \n nitrosative stress biomarkers were statistically higher in our experimental group , so we could propose that they are at higher risk of all the conditions connected with adverse vascular effects ( especially when taking into account that our study group already had some comorbidities associated with vascular wall damage , namely high blood pressure , smoking , diabetes and obesity ) ( 41 ) . \n increased plasma levels of adma have been demonstrated in patients with both kidney and heart failure and have been shown to decrease a few months after kidney transplantation , remaining still higher compared to healthy volunteers ( 4244 ) . \n adma has been proposed as a predictor of mortality in dialysis patients ( 45 ) . \n renal transplant recipients also demonstrate upregulation of the nitric oxide ( no ) system , probably by increased endothelial nitric oxide synthase ( nos ) gene expression and nitrite / nitrate levels ( 46 ) . \n adma levels are also associated with os and hypercholesterolemia through the reduction in ddah activity ( 47 , 48 ) . besides , in our previous article we demonstrated that adma may be a more significant marker in men with kidney allografts than in women , concerning oxidative stress control of its level and function ( 49 ) . \n sdma is almost completely excreted by the kidneys and correlates strongly with different parameters of renal function ( 50 ) . \n plasma sdma levels increase with creatinine and could be a better marker of renal dysfunction compared to this compound ( 51 ) . \n our renal transplant recipients had higher sdma levels than controls , indicating that they had worse renal function than the healthy population . \n in addition , it was demonstrated that sdma levels increased rapidly after total nephrectomy in healthy living related kidney donors and it was suggested that sdma could be an early biomarker of change in glomerular filtration ( 52 ) . \n oxidative stress is one of the main contributors to endothelial damage and toxic effects ( 53 ) . \n corticosteroids can inhibit the activation of nuclear factor kappa b ( nfkb ) , whose synthesis is stimulated by oxidative stress ( 54 ) . in an animal model , \n the use of prednisone had a protective role , by increasing the synthesis of catalase , dismutase and glutathione peroxidase and reducing mda concentration in the glomeruli , suggesting that corticosteroids are a class of immunosuppressive drugs that provide nephroprotection , the effect opposite to calcineurin inhibitors ( 55 ) . \n both calcineurin inhibitors increase the production of ros in cultured rat renal mesangial cells and their administration results in the production of ros in glioma cells , which constitutes the side effects of these drugs ( 56 , 57 ) . \n oxidative stress after kidney transplantation is mostly associated with a higher tbars concentration , which represents a direct link with cyclosporine a therapy ( 58 ) . \n tacrolimus is a calcineurin inhibitor associated with tissue protection from the ischemia / reperfusion phenomenon particularly when administered before ischemia ( 59 ) . \n tacrolimus also inhibits the activation of nfkb , which is strongly connected with the generation of ros ( 60 ) . \n some animal models showed no effects of tacrolimus on oxidative stress , and in in vitro models tacrolimus reduced the induction of os ( 61 , 62 ) . in line with this \n , we demonstrated that there was no significance in all the evaluated parameters of oxidative or nitrosative stress among the groups of patients treated with tacrolimus or cyclosporine a. similar findings were obtained in the early post - transplant period and in patients with post - transplant hypertension ( 46 , 63 ) . in a group of patients with stable renal function administration of cyclosporine \n a was associated with high levels of mda and those treated with tacrolimus had significantly lower mda levels , but our findings do not support these results ( 58 ) . \n possible explanation for our results may be the fact that both drugs are similarly metabolized by the cyp3a4 member of the cytochrome p450 superfamily and therefore have similar levels of cellular damage . \n we did not confirm a significant difference in the values of aopp between the patients in relation to therapy . \n the concentration of sh groups was the only parameter that was higher in the patients receiving cyclosporine a , which conforms to the findings of a positive correlation between cyclosporine therapy and hyperhomocysteinemia ( 64 ) . \n the results of our study demonstrated that in the group of patients with stable graft function and no overt cardiovascular disease the levels of oxidative and nitrosative stress were significantly increased compared to the healthy population . \n transplantation probably decreases their levels , but they do not reach the normal range even if the graft function is normal . \n we did not confirm a statistically significant difference in the levels of oxidative and nitrosative stress parameters evaluated between the patients treated with cyclosporine a or tacrolimus . \n continuous immunosuppressive therapy contributes to enhanced formation of ros after transplantation , but the particular type of calcineurin inhibitor , probably due to the similar metabolic pathway , does not seem to have an impact . finally , we could suggest that the post - transplant immunosuppression therapy should focus on the nephrotoxicity of the medication ( or some other criteria ) , rather than their influence on oxidative stress or impaired arginine metabolism .", "role": "user" }, { "content": "summarybackgroundthe aim of the study was to evaluate parameters of oxidative and nitrosative stress as well as antioxidative parameters in a group of renal transplant recipients with stable graft function and no clinical signs of cardiovascular disease . \n we also aimed to determine the correlations among these parameters and to evaluate potential differences in all the biomarkers with regard to the immunosuppression protocol.methodswe enrolled 57 renal transplant recipients and 31 controls who were age and sex matched with the renal transplant recipients . \n all of the patients included in this study had post - renal transplant surgery at least 12 months earlier and were on standard immunosuppressive therapy . in this study , we determined thiobarbituric acid - reactive substances in plasma and red blood cells and advanced oxidation protein products , nitrosative stress parameters ( asymmetric and symmetric dimethylarginine \n adma and sdma ) , and antioxidative parameters ( total sh groups and catalase activity).resultsthe results of our study demonstrated that the levels of oxidative and nitrosative stress were significantly increased compared to the healthy population ( p<0.01 except for plasma catalase activity p<0.05 ) . \n correlation analysis showed significant positive correlations between : adma and sdma ( p<0.01 ) ; adma and nitrates ( p<0.05 ) ; sdma and nitrates ( p<0.05 ) ; between os parameters in the experimental group ; aopp and sh groups ( p<0.05 ) and tbars in plasma and sh groups ( p<0.01 ) , sdma and aopp ( p < 0.05 ) ; sdma and tbars in plasma ( p<0.05 ) ; sdma and sh groups ( p<0.01 ) ; nitrates and sh groups ( p<0.05).conclusionthere was no significant difference in oxidative and nitrosative stress parameters with respect to the immunosuppressive protocol .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 32-year - old woman with scs presented for consultation in court regarding documentation concerning her injuries related to a traffic accident she had experienced . \n she had received scs implantation at another hospital several months earlier as treatment for crps i of the left lower extremity . \n her chronic pain syndrome stemmed from the unfortunate complications of a previous pedestrian traffic accident in which she was struck on the backside by a car . \n lumbar spine x - rays and mri were within normal limits , but she suffered from allodynia , hyperalgesia , motor weakness and temperature fluctuations at that time . despite extensive physical therapy , anxiolytic therapy , several local anesthetic blocks , four sympathetic blocks , transcutaneous electric stimulation and adjunctive pharmacological management , her condition failed to improve . during the early period of scs implantation , her pain was reduced to an acceptable level , but when she presented for consultation at our hospital , she clearly required pain relief . \n the electrodes entered the l3 - 4 interspace , and the end of the electrode was located in the epidural space at the t9 - 10 . \n the generator was then implanted in the anterior abdominal wall . at the time of her visit to our pain clinic \n , she was receiving propranolol hcl 20 mg , mirtazapine 30 mg and tramadol hcl 50 mg twice a day , along with buspirone hcl 15 mg , solifenacin succinate 5 mg , mefenamic acid 250 mg , ethyl loflazepate 1 mg and sodium tianeptine 12.5 mg daily . during various checkup tests , we found that her urine beta - hcg was positive , which is the case in women of childbearing age . \n thus , her serum beta - hcg was checked , revealing that it was 150.19 miu / ml . \n immediately , we consulted the obstetric department , and eventually pregnancy was diagnosed , but ultrasonographic visualization did not rule out the possibility of ectopic pregnancy , a tubal abortion state or , less likely , early pregnancy . \n however , she quit her therapy at our hospital and transferred to a hospital closer to her home for the management required . \n upon her discharge , we informed her that there were no animal or human studies regarding possible teratogenic effects or fetal / maternal risk of using scs at the time of conception , pregnancy , or labor . \n we also explained that despite all the risks , pregnancy is possible if she desired and recommended that a good outcome requires a multidisciplinary team approach , including obstetrics , neonatology , pain medicine and anesthesia , as was used in an early pregnancy . \n management of patients with chronic pain syndromes during pregnancy can be challenging , particularly in the presence of scs . \n the safety and effects of scs during pregnancy have not been established , and pregnancy is a relative contraindication according to the fda and the manufacturers of the related devices . \n various meta - analysis and reviews of the effects of scs have not included this group of patients . \n however , scs is increasingly used to manage chronic pain in a female in her reproductive years may present . \n child - bearing women who had scs become or choose to become pregnant despite these policies . \n reviewing the literature in english , we found four case reports of scs in pregnancy . in the first case , \n a 31-year - old woman with cervical scs of crps ii allowed potentially teratogenic painkillers to be discontinued before conception . \n the cervical scs electrode end was in the epidural space at the c2 - 3 interspace , and the generator was implanted in the upper gluteal region instead of the abdomen owing to the patient 's concern of discomfort during pregnancy and the risk of damage if a caesarean section was necessary . \n this patient had a full - term safe vaginal delivery despite the scs being turned off the time of labor and delivery . \n the disadvantages of using teratogenic analgesics were overcome by scs . in the second case , a 37-year - old woman with cervical scs of crps i presented for epidural analgesia for labor . \n the electrodes entered the c7-t1 interspace and the ends of electrodes were located in epidural space at the c3 level . \n the spinal cord stimulator continued to function well throughout the entire process . a year and a half later , \n particularly interesting , the same patient presented again to their labor and delivery unit for another delivery . \n the third case involved a 31-year - old woman with the cervical scs of crps ii . \n she developed severe pain at the side of her abdomen at the junction between the electrode and the lead extender . \n this is different from the previously reported cases in that the generator was implanted in the anterior abdominal wall . \n she developed new severe pain at the side of the abdomen at the junction between the epidural lead and the lead extender . \n therefore , the lead extender was surgically cut with the generator switched off during the 28th week of gestation under local anesthesia . \n the last case , a 35-year - old woman with lumbar scs for lumbosacral pain was admitted for an urgent caesarean section . she had a mallampati score of iii and poor dentition with loose teeth . \n the electrodes were inserted at l2 - 3 and located at t8 and the generator was implanted in the left upper buttock . \n a caesarean delivery was planned , and spinal anesthesia was therefore performed below the scs leads at the l4 - 5 level . \n the patient received a lumbar scs implantation with crps i. she experienced a missed abortion 6 weeks after the procedure . \n there were no significant changes in the symptoms of crps or in the pattern of pain during pregnancy or after the abortion . \n first , her medications for chronic pain at that time may have been the cause . \n the patient was receiving propranolol , mirtazapine , tramadol , solifenacin succinate , mefenamic acid ( category c ; excretion into breast milk unknown ) , buspirone hcl ( category b ; is not excreted in breast milk ) , ethyl loflazepate , and sodium tianeptine ( not available ) . for category c drugs \n , it is known that \" animal studies show some fetal risk but or no animal / controlled studies have been done . \n \" hence , there is a considerable possibility that these drugs may have been the cause of the abortion . \n secondly , a literature search on the use of scs in humans during pregnancy retrieved only one study . \n significantly elevated human placental lactogen and estriol serum levels were found as having a correlation to the onset of therapy at a specific week of gestation . \n the overall miscarriage rate is reported as 15 - 20% , which implies that 15 - 20% of recognized pregnancies result in miscarriage . \n the number of cases of scs implantation continues to grow , and it is important to realize that there is always the chance to encounter a pregnant patient . the possibility of missed abortion , as mentioned previously , and other considerable facts related to pregnancy and delivery must be realized and kept in mind . concerning the implantation of scs , special attention must be paid for child - bearing woman . \n the generator is implanted posterior in the flank area away from the belt line or in the buttock area to avoid abdomen pain . \n if the patient complains of severe pain at the junction between the electrode and the lead extender , simple division of the electrode distal to the junction will resolve the problem . \n there is little guidance available regarding the perioperative anesthetic management of patients with scs , but experience with deep brain stimulators , which use a similar technology , may be relevant [ 15 - 17 ] . \n artifacts on electrocardiography have been noted during scs , deep brain stimulation and transcutaneous nerve stimulation . \n the current location of the electrode , lead extender and generator is ascertained by previous radiographs to assess the need for any special measures if neuraxial anesthesia is indicated . \n potential risks include damage to the electrodes due to the spinal or epidural needle , introducer or catheter . \n although regional techniques are currently widely accepted , if possible general anesthesia is considered to be a better method in patients with scs . \n surgical diathermy or electrocautery can damage the lead insulation , cause temporary suppression of the neurostimulator output , and lead to reprogramming of the neurostimulator . \n monopolar diathermy should be avoided when possible in the presence of scs , as painful electrical shocks have been reported ; such shocks have not been described with generator turned off or when bipolar diathermy is used . \n bipolar diathermy appears to be safe if all components are distant from the implanted equipment . above all \n , a good outcome requires a multidisciplinary team approach , including obstetrics , neonatology , pain medicine and anesthesia , as was used in an earlier pregnancy in our case . \n this will allow sufficient time to proceed to the next steps before any potentially urgent situation . \n we believe that there must be a guideline concerning the treatment of chronic pain in patients expecting a future pregnancy . \n these patients must be informed that scs device implantation can replace the disadvantages of using teratogenic analgesics . in addition , postpartum follow - up , with special emphasis on the scs function , must be documented . \n informed consent should be obtained regarding the possibility of disrupting the function of the scs and due to infection risk . \n postoperatively , the clinical efficacy of scs should be checked by the neurostimulator as any device or programming issues can be identified in this manner . \n most importantly , cautious follow up visits to the obstetric department throughout the pregnancy are absolutely necessary . in conclusion , scs is not recommended in pregnancy because the effects of scs on pregnancy and nursing mothers have not been studied . \n however , many female patients suffering from chronic pain may expect future pregnancy , and we think that they must be informed about the possibility of pregnancy and the effects of the scs device implantation during the course of their pregnancy . we also hope that this report will elicit the interest of physicians to report other cases involving the conception , pregnancy , and labor management of patients with spinal cord stimulators in order to confirm the safety of this modality under these circumstances .", "role": "user" }, { "content": "spinal cord stimulation ( scs ) is used to manage chronic pain syndromes and it is accepted a cost - effective therapy . \n child - bearing women who had scs become or choose to become pregnant despite these policies pregnancy is a relative contraindication . \n a 32-year - old woman had scs as a treatment for the crps i of the left lower extremity . during various check up tests , we happen to find out that her serum beta - hcg was positive and confirmed pregnancy . \n scs is not recommended in pregnancy because the effects of scs on pregnancy and nursing mothers had not been confirmed . \n however , many female patients suffering from chronic pain may expect future pregnancy and we think that they must be informed about the possibility of pregnancy and the effects of scs device implantation in the course of pregnancy . \n first of all , a good outcome requires a multidisciplinary team approach , including obstetrics , neonatology , pain medicine and anesthesia , as was used from an early pregnancy . \n unfortunately , she had a misabortrion after 6 weeks .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: spinal cord injury ( sci ) initiates a series of cellular and molecular cascade events and that a combination of secondary injury factors leads to a progressive neuronal injury . \n it is generally accepted that , among the secondary injury factors , inflammation is the major one and plays a central role in regulating the pathogenesis of sci [ 2 , 3 ] . \n attenuation of the early inflammatory response after sci may limit the extent of tissue injury and the consequent disability [ 46 ] . \n the proinflammatory cytokine tnf- , which is upregulated immediately after sci , can enhance vascular permeability . \n hence , tnf- is considered as a proinflammatory cytotoxic cytokine . and tnf- is primarily responsible for initiating the cascade of other cytokines in the classic immune response [ 6 , 8 ] . \n inflammatory cells can release matrix metalloproteinases ( mmps ) , especially mmp-9 , which can penetrate the bbb . \n mmp-9 is upregulated in leucocytes entering the spinal cord , directly facilitating their extravasation , and promoting the tissue damage that they caused [ 9 , 10 ] . \n it might be a vascular permeabilizing factor and is a key determinant in secondary tissue damage after sci . \n nuclear factor erythroid 2-related factor 2 ( nrf2 ) , a leucine zipper redox - sensitive transcription factor , is a pleiotropic regulator of cell survival mechanisms . under the normal condition \n , nrf2 is sequestered in the cytoplasm by a cytosolic regulatory protein named keap1 . under condition of oxidative or xenobiotic stress , nrf2 translocates from the cytoplasm to the nucleus and sequentially \n binds to a promoter sequence called the antioxidant response element ( are ) , resulting in the expression of antioxidant and cytoprotective genes that attenuate tissue injury [ 1214 ] . \n recent studies have demonstrated that nrf2 plays a broad role in modulating acute inflammatory response . \n nrf2 plays a protective role in cigarette smoke - induced emphysema , dextran sulfate sodium- ( dss- ) mediated colitis , inflammation - mediated colonic tumorigenesis , and allergen - mediated airway inflammation . \n our previous studies have shown that nrf2 played an important role in protecting traumatic brain injury- ( tbi- ) induced secondary brain injury by regulating inflammatory cytokines and attenuating the pulmonary inflammatory response and nf-b activation after tbi [ 12 , 19 ] . \n we have found that sci could induce the activation of nrf2-are pathway in spinal cord tissue ( data not shown ) , just as pomeshchik et al . showed . \n therefore , it is reasonable to postulate that nrf2 plays an important role in limiting the spinal cord inflammatory response after sci . in the present study \n , we evaluated the effect of nrf2 genotype on the activation of nf-b , tnf- , and mmp-9 in spinal cord after sci . \n our experiments were conformed to the guide for the care and use of laboratory animals by national institutes of health ( nih publications no . \n 80 - 23 ) and approved by the animal care and use committee of nanjing university . \n male icr mice ( 2832 g ) were housed at 23 1c in humidity - controlled animal quarters with 12 hours light / dark cycle , and with ad libitum access to food and water throughout the study . \n homozygous wild - type nrf2 ( + /+ ) and nrf2 ( /)-deficient mice were generated from inbred heterozygous nrf2 ( + / ) mice . \n genotypes of nrf2 ( + /+ ) and nrf2 ( / ) mice were confirmed by pcr amplification of genomic dna isolated from the blood . \n pcr amplification was carried out by using three different primers , 5-tggacgggactattgaaggctg-3 ( sense for both genotypes ) , 5-cgccttttcagtagatggagg-3 ( antisense for wild type ) , and 5-gcggattgaccgtaatgggatagg-3 ( antisense for lacz ) . \n age- and weight - matched adult male mice ( 68 weeks , 2832 g ) were separated into four groups ( n = 42 per group ) : group i , sham wild - type ( nrf2 + /+ ) ; group ii , injured wild - type ( nrf2 + /+ ) ; group iii , sham - deficient ( nrf2 / ) ; group iv , injured - deficient ( nrf2 / ) \n . the mice of sham and injured groups were subjected to identical anesthetic alone or experimental sci , respectively . \n the mouse compression model of sci established as described previously used to study spinal cord injury in mice . \n briefly , the animals were anesthetized with sodium pentobarbital ( 50 mg / kg , ip ) . \n a longitudinal skin incision was made to expose the spine between t8 and t10 vertebral body levels , and the paravertebral muscles of the thoracic - level ( t8t10 ) vertebrae were removed . \n laminectomy was performed at the t8t10 level , using an operating microscope ( m500-n , laica , germany ) . in sham - operated mice \n , the muscles and skin wound was then closed . in order to cause an acute - compression injury \n , we used a vascular clip ( with 10 g force , kent scientific corporation , ins 14120 , usa ) to injure the cord at t9 by bilateral compression for 1 minute . \n after surgery , the animals were given a subcutaneous saline injection ( 1 - 2 ml ) immediately . \n they were left to recover on a warm pad until thermoregulation and the righting reflex was re - established . \n the rectal temperature was monitored and was kept at 37 0.5c ( with physical cooling if required ) throughout the experiment . \n as described , animals received manual bladder expression twice daily until urinary retention was relieved . at 24 hours following sham operation or sci , thirty mice in each group \n were sacrificed for spinal cord segments collection to assay nf-b activity , tnf- , and mmp-9 . \n briefly , mice were deeply anaesthetized with pentobarbital sodium ( 80 mg / kg ) and were transcardially perfused with cold saline ( 4c ) , and then the tissue segments containing the lesion ( 1 cm on each side of the lesion ) were rapidly removed and stored at liquid nitrogen immediately . six mice of each group were sacrificed at 48 hours after operation for assays of spinal cord water content of spinal cord segments . \n the last six mice in each group were evaluated by histopathology at 24 hours after sci . \n they were perfused with cold saline ( 4c ) , followed by 4% neutral - buffered formalin . \n spinal cord segments containing the lesion ( 0.5 cm on each side of the lesion ) were taken , stored overnight in 4% neutral - buffered formalin , then were paraffin embedded , and cut into 5 m - thick sections . \n tissue sections ( thickness 5 m ) were deparaffinized with xylene , stained with hematoxylin / eosin ( h&e ) , and studied using light microscopy ( eclipse e100 , nikon , japan ) . \n the spinal cord water content was measured as previously described . at 48 hours after sci , spinal cords were removed from t7 to t11 vertebral body levels , weighed , heated at 98c for 48 hours , and reweighed . \n damaged neurons were counted and the histopathologic changes of the gray matter were scored on a 6-point scale [ 23 , 24 ] : ( 0 ) , no lesion observed ; ( 1 ) , gray matter contained 1 to 5 eosinophilic neurons ; ( 2 ) , gray matter contained 5 to 10 eosinophilic neurons ; ( 3 ) , gray matter contained more than 10 eosinophilic neurons ; ( 4 ) , small infarction ( less than one - third of the gray matter area ) ; ( 5 ) , moderate infarction ( one - third to one - half of the gray matter area ) ; ( 6 ) , large infarction ( more than half of the gray matter area ) . \n the scores of all the sections from each spinal cord were averaged to give a final score for an individual mouse . \n nuclear protein extraction followed the method described by jin et al . in our laboratory . \n protein concentration was determined using a bicinchoninic acid assay kit with boving serum albumin as the standard ( pierce biochemicals , rockford , ill , usa ) . \n emsa was performed using a commercial kit ( gel shift assay system ; promega , madison , wis , usa ) following the methods described in detail elsewhere . \n consensus oligonucleotide probe ( 5-agttgaggggactttcccaggg-3 ) was end labeled with [ -]-atp ( free biotech . , \n nuclear protein ( 20 g ) was preincubated in a total volume of 20 l in a binding buffer , consisting of 10 mmol / l tris - hcl ( ph 7.5 ) , 1 mmol / l mgcl2 , 0.5 mmol / l nacl , 4% glycerol , 0.5 mmol / l edta , 0.5 mmol / l dtt , and 2 g poly di - dc for 20 minutes at room temperature . \n after addition of the 1 l p - labled oligonucleotide probe , the incubation was continued for 20 minutes at room temperature . after adding 1 l of gel loading buffer , \n the reaction was stopped , and the mixture was resolved by electrophoresis on 4% nondenaturing polyacrylamide gel in 0.5tbe buffer ( tris - borate - edta ) at 390 v for 1 hour at 4c . \n the gel was dried and exposed to x - ray film ( fuji hyperfilm , tokyo , japan ) at 70c with an intensifying screed . \n total rna was extracted from mouse spinal cord segments with ezgene tissue rna miniprep kit ( biomiga , inc . , san diego , ca , usa ) according to the manufacturer 's instructions . \n the cdna was synthesized using reverse transcription system ( promega corporation , madison , wi , usa ) and oligo dt from 2 g of total rna . \n the cdna was then amplified by pcr using various primer sets as follows : tnf- , 5-acggcatggatctcaaagac-3 , and 5-ggtcactgtcccagcatctt-3 ; mmp-9 , 5-ctactctgaagacttgccg-3 , and 5-ccatacagtttatcctggtc-3 ; -actin , 5-agtgtgacgttgacatccgta-3 , and 5-gccagagcagtaatctccttct-3 [ 19 , 27 ] . \n pcr products were detected by agarose gel electrophoresis in 2% nusieve agarose gels ( fmc , usa ) and visualized by ethidium bromide staining . \n the intensity of the bands was quantified using imagej program , and the ratios of each gene product to -actin product were used as indices of tnf- and mmp-9 mrna expression . \n portions of spinal cord tissues were homogenized as previously described in pbs containing 2 mmol / l of phenylmethylsulfonyl fluoride ( pmsf , sigma chemical co. ) , 1 mg / l pepstatin a , 1 mg / l aprotinin , 1 mg / l leupeptin , and phosphate - buffered saline solution ( ph 7.2 ) and centrifuged at 12,000 g for 20 minutes at 4c . \n the supernatant was then collected and total protein was determined by using the bradford method . \n tnf- protein was quantified using elisa kits specific for mouse according to the manufacturers ' instructions ( diaclone research , france ) and a previous study of our laboratory . \n the cytokine tnf- content in the spinal cord samples was expressed as pg per milligram total protein . \n spinal cord tissues were homogenized in ripa buffer ( 1% np40 , 0.5% sodium deoxycholate , 0.1% sds , 1 mm edta , 1 mm egta , 1 mm na3vo4 , 20 mm naf , 0.5 mm dtt , 1 mm pmsf , and protease inhibitor cocktail in pbs ph 7.4 ) . \n the homogenate was centrifuged at 1050 g ( 4c ) for 10 min , and microsomal fraction was subsequently centrifuged at 17,000 g ( 4c ) for 20 minutes . \n fifty micrograms of the resulting cytosolic protein extracts were heat denatured in laemmli sample loading buffer , separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis , and electrotransferred onto a nitrocellulose membrane . for immunoblotting , \n membranes were blocked with 5% nonfat dry milk in saline buffer overnight , at 4c , and then incubated with primary anti - mmp-9 antibody ( 1 : 500 , calbiochem , darmstadt , germany ) for 2 hours at room temperature in 1pbs , 5% w / v nonfat dry milk , and 0.1% tween-20 ( pmt ) . \n the membranes were washed three times for 5 minutes in pmt and the secondary incubations were performed with horseradish peroxidase - linked antirabbit igg ( 1 : 5000 , jackson immunoresearch , west grove , pa , usa ) . \n positive signals were visualized using enhanced chemiluminescence ( ecl ; amersham biosciences , bucks , united kingdom ) , and serial exposures were made to radiographic film ( fuji hyperfilm , tokyo , japan ) . \n densitometric analysis of the blots was performed with the image analysis program imagej . to ascertain that blots were loaded with equal amounts of proteic lysates \n 2% sds , 62.5 mm tris - hcl , ph 6.7 ) at 50c for 30 minutes , then washed , blocked , and reprobed overnight at 4c with mouse anti--actin monoclonal antibody ( 1 : 5000 ; sigma ) . \n we used gelatin zymography analysis to show mmp-9 activity of spinal cord tissue at 24 hours after sci . \n samples of spinal cord , prepared from the epicenter , were quickly frozen at 80c . each sample was weighed and homogenized ( 1 : 4 w / v ) in lysis buffer containing 50 mm tris - hcl , ph 7.4 , 150 mm nacl , 5 mm cacl2 , 0.2 mm nan3 , and 0.01% triton . \n equal amounts of the supernatant were analyzed by gel zymography as described previously on 10% sds - polyacrylamide gels copolymerized with substrate ( 1 mg / ml gelatin ) . \n the proteins were renatured by incubation in 2.5% triton x-100 and then incubated in substrate buffer ( 50 mm tris - hcl , ph 8.5 , 5 mm cacl2 ) for 2436 hours at 37c to enable the mmp-9 to cleave the gelatin . \n after rinsing in water , each gel was stained with coomassie blue for 4 hours and destained in 50% methanol . \n the results were analyzed by one - way anova followed by a student - newman - keuls test for multiple comparisons . \n similar water content of spinal cord tissue was detected in both sham - operated nrf2 ( + /+ ) and nrf2 ( / ) mice . at 48 hours after sci , water content of spinal cord significantly increased in both injured nrf2 ( + /+ ) and nrf2 ( / ) mice compared with the sham - operated mice , respectively . \n however , the pathological change was severer in nrf2 ( / ) mice than that in nrf2 ( + /+ ) mice ( 0.85 0.03 versus 0.78 0.02 , p < .05 , figure 1 ) . \n the degree of the spinal cord injury at the perilesional area was evaluated at 24 hours after sci . \n significant damage to the spinal cord was observed in the sci mice than that in the sham - operated mice in both nrf2 ( + /+ ) and nrf2 ( / ) mice . \n notably , the histological injury was severer in nrf2 ( / ) mice than that in nrf2 ( + /+ ) mice at 24 hours after sci ( 5.3 0.08 versus 4.2 0.13 , p < .01 , figure 2 ) . \n as shown in figure 3 , low nf-b banding activity was detected in sham - operated mice of both genotypes . \n sci induced activation of nf-b in the spinal cord in both nrf2 ( + /+ ) and nrf2 ( / ) mice . \n nrf2 ( / ) mice showed an increased susceptibility to sci - induced activation of nf-b than their wild - type nrf2 ( + /+ ) counterparts ( 3.80 0.07 versus 2.30 0.05 , p < .01 , figures 3(a ) and 3(b ) ) . \n the mrna levels of two inflammatory gene products , tnf- and mmp-9 , were measured by rt - pcr . \n similar mrna expression levels of them were detected in the spinal cord samples of both sham - operated groups . at 24 hours after sci , increased mrna expression levels in spinal cord , including tnf- and mmp-9 , were detected in both injured nrf2 ( + /+ ) and nrf2 ( / ) mice compared with the sham - operated mice , respectively . \n higher mrna expression levels of tnf- were found in nrf2 ( / ) mice than in nrf2 ( + /+ ) mice ( 2.01 0.05 versus 0.97 0.05 , p < .01 , figures 4(a ) and 4(b ) ) . \n similarly , significant difference of mmp-9 mrna level was also observed between nrf2 ( / ) mice and nrf2 ( + /+ ) mice ( 0.99 0.07 versus 0.78 0.04 , p < .01 , figures 4(c ) and 4(d ) ) . \n the protein expression level of tnf- in the spinal cord samples of both sham - operated nrf2 ( + /+ ) and nrf2 ( / ) mice was also similar . at 24 h after sci , higher spinal cord tissue protein expression levels of tnf- were detected in both injured nrf2 ( + /+ ) and nrf2 ( / ) mice compared with their respective sham - operated mice . \n similarly , higher protein expression levels of tnf- were found in nrf2 ( / ) mice than in nrf2 ( + /+ ) mice ( 3966.60 122.67 versus 3424.04 79.66 , p < .05 , figure 5 ) . \n there is no difference on mmp-9 expression in the spinal cord samples between sham - operated nrf2 ( + /+ ) and nrf2 ( / ) mice , as shown by the immunoreactive band migrating at ~92 kda . at 24 hours after sci , significant upregulation of mmp-9 expression levels was detected in both injured nrf2 ( + /+ ) and nrf2 ( / ) mice compared with their respective sham - operated mice . \n higher mmp-9 expression levels were found in nrf2 ( / ) mice than in nrf2 ( + /+ ) mice ( 0.98 0.03 versus 0.88 0.02 , p < .01 , figures 6(a ) and 6(b ) ) . \n the activity of mmp-9 in spinal cord tissue was measured by gelatin zymography analysis . in the spinal cord samples of both sham - operated nrf2 ( + /+ ) and nrf2 ( / ) mice , \n the activity of mmp-9 was similar . at 24 h after sci , higher activity of mmp-9 was detected in both injured nrf2 ( + /+ ) and nrf2 ( / ) mice compared with their respective sham - operated mice , while the activity change was severer in nrf2 ( / ) mice than in nrf2 ( + /+ ) mice ( 27922.79 1185.68 versus 22666.08 1316.41 , p \n in this study , we found that the mice lacking nrf2 function have significantly enhanced secondary spinal cord injury characterized by increased spinal cord edema and severer inflammatory response . increased sci - induced nf-b activation and expression of the inflammatory cytokines , tnf- and mmp-9 , were observed in the spinal cord of nrf2 ( / ) mice compared to nrf2 ( + /+ ) mice . in addition , higher level of mmp-9 activity was found in the spinal cord of nrf2 ( / ) mice than that in nrf2 ( + /+ ) mice after sci . \n to our knowledge , the findings in this study suggest for the first time that nrf2 plays a protective role against sci - induced second spinal cord injury , possibly by limiting the inflammatory response in the spinal cord after sci . \n activation of nf-b signaling pathway has been shown to be central to the pathophysiology of spinal cord inflammatory response induced by sci , and nf-b can be activated by lesion - induced oxidative stress and cytokines [ 6 , 30 ] . \n the functional importance of nf-b in inflammation is based on its ability to regulate the promoters of multiple inflammatory genes . \n animal sci models have shown to have infiltration of inflammatory cells , endothelial activation and injury leading to increased vascular permeability , edema formation , and accumulation of inflammatory mediators . \n mmp-9 is produced by neutrophils and endothelia , facilitating leukocytes diapedesis which may be a vascular permeabilizing factor . in spinal cord injury , mmps , \n including mmp-9 , contribute to early secondary pathogenesis by disrupting the blood spinal cord barrier and promoting inflammation . \n tnf- is a major initiator of inflammation and is released early after an inflammatory stimulus . \n there is evidence that tnf- also plays an important role in the recruitment of inflammatory and immune cells to the injured site . \n moreover , the infiltration of immune and inflammatory cell to sci sites is a major contributor to secondary degeneration . \n consistent with other studies , we show that tnf- and mmp-9 were also upregulated during sci , spinal cord water content at the injury site increased at 2 days after sci , and significant damage to the spinal cord was observed in the tissue from sci mice [ 9 , 22 , 24 ] . \n nrf2 has been reported to be the key regulator of the expression of a group of antioxidant and detoxification enzymes and is considered to play an important role in modulating inflammation in a variety of experimental models [ 38 , 39 ] . \n also , the nrf2 signaling pathway has been shown to modulate nf-b activation and expression of nf-b - dependent genes including mmp-9 . in our past studies , the results suggested that nrf2 plays an important role in protecting tbi - induced secondary brain injury , possibly by limiting the cerebral upregulation of nf-b activity , proinflammatory cytokine after tbi . \n recently , pomeshchik et al . showed that sci could induce nrf2-are pathway activation in spinal cord , just as our laboratory has found ( data not shown ) . \n also in vitro , phase ii enzyme inducers can promote the expression of antioxidative enzymes through nrf2 and show neuroprotective potential on motor neuron survival in traumatic spinal cord injury . in the present study , nrf2 ( / ) mice \n were shown to have severer spinal cord edema , more nf-b activity , more inflammatory cytokine tnf- , and mmp-9 expression in spinal cord after sci compared with their wild - type nrf2 ( + /+ ) counterparts . \n taken together , these studies showed that nrf2 may play an important protective role in limiting the spinal cord inflammatory response after sci . although numerous in vivo studies have reported that nrf2 plays a critical role in counteracting the inflammation in a variety of experimental models [ 15 , 16 , 25 ] , the precise mechanism underlying this network is still unclear . \n several lines of evidence indicate that nrf2 interferes with inflammatory signaling pathways by inhibiting nf-b activation through the maintenance of cellular redox status . \n oxidative stress from reactive oxygen species ( ros ) was considered as a major pathway of secondary injury in sci . \n activation of the nf-b signaling pathway has been shown to be responsive to excess ros and is important in the generation of inflammation . \n nrf2 has been shown to play an important role in limiting ros levels and thereby affects the redox - sensitive nf-b signaling pathway involved in inflammation [ 14 , 40 ] . \n augmentation of cellular antioxidative or detoxification systems via activation of nrf2-regulated enzymes results in decreased inflammatory cytokine production via inactivation of nf-b . \n this constitutes a possible anti - inflammatory mechanism for the attenuated inflammatory response and tissue damage seen in spinal cord from nrf2 ( + /+ ) mice but not nrf2 ( / ) mice after sci . \n in conclusion , the present study showed that nrf2 ( / ) mice are more susceptible to sci - induced spinal cord edema , nf-b activity , inflammatory tnf- production , and mmp-9 expression , which then contributed to exacerbated spinal cord injury after sci . \n these findings raise the possibility that nrf2 might be a new therapeutic target for the treatment of sci .", "role": "user" }, { "content": "matrix metalloproteinase-9 ( mmp-9 ) plays an important role in the acute periods of spinal cord injury ( sci ) , and its expression is related to the inflammation which could cause the disruption of the blood - spinal barrier ( bbb ) . \n nuclear factor erythroid 2-related factor 2 ( nrf2 ) is a key transcription factor that plays a crucial role in cytoprotection against inflammation . \n the present study investigated the role of nrf2 in upregulating of nuclear factor kappa b ( nf-b ) activity , tumor necrosis factor- ( tnf- ) , and mmp-9 after sci . \n wild - type nrf2 ( + /+ ) and nrf2-deficient ( nrf ( / ) ) mice were subjected to an sci model induced by the application of vascular clips ( force of 10 g ) to the dura after a three - level t8-t10 laminectomy . \n we detected the wet / dry weight ratio of impaired spinal cord tissue , the activation of nf-b , the mrna and protein levels of tnf- and mmp-9 , and the enzyme activity of mmp-9 . \n nrf2 ( / ) mice were demonstrated to have more spinal cord edema , nf-b activation , tnf- production , and mmp-9 expression after sci compared with the wild - type controls . \n the results suggest that nrf2 may play an important role in limiting the upregulation of nf-b activity , tnf- , and mmp-9 in spinal cord after sci .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: this report describes a rare case of crossed fused renal ectopia ( cfre ) in a cat . a mature intact male persian cat presented with bloody nasal discharge and ascites . \n diagnostic studies revealed an ectopic left kidney fused with an orthotopic right kidney and a concurrent feline infectious peritonitis ( fip ) infection . \n the fip was responsible for clinical signs in this cat , while clinical signs associated with cfre were not obvious . despite receiving intensive treatment , the cat died . \n to the best of our knowledge , this is the first report of l - shaped cfre in a cat . \n in addition , this report describes the ct features of l - shaped cfre in a cat . \n crossed fused renal ectopia ( cfre ) is a rare type of renal dysplasia causing the kidneys to fuse so that both are located on the same side of the body . in humans \n , cfre occurs in approximately 1 out of 20007500 births , and occurs more often in men . \n however , it has rarely been reported in veterinary medicine . to date , only one case in a cat has been reported . \n cfre is thought to result from aberrant migration and crossing of the midline of the metanephric blastema and the ureteral bud , leading to fusion of the kidneys within the pelvis . \n most cfres in humans are asymptomatic and found either accidentally during an autopsy or diagnostic investigation for concurrent diseases . however , in humans with symptomatic cfre , complications are observed in approximately 50% of cases and include nephrolithiasis , infection and hydronephrosis . although primary treatment for cfre is not necessary for most cases , awareness for this disease is critical in cats requiring any surgical intervention in the urinary system , as aberrant blood supply to a cross - fused kidney is common . \n this case study describes the ultrasound and ct findings of a rare form of cfre in a cat . \n a mature intact male persian cat ( unknown age ; weighing 3.1 kg ) presented with a haemorrhagic nasal discharge and ascites . \n the cat was rescued a month before the presentation , so its past history was unknown . owing to a haemorrhagic nasal discharge , the cat was treated in a local veterinary clinic for several days but did not respond to therapy , which included antibiotics ( doxycycline , 5 mg / kg po q12h ) . \n there were no records for vaccination and anthelmintic treatment . at presentation , the cat was adult , emaciated ( body condition score 1/5 ) and hypotensive ( systolic blood pressure 100 mmhg , measured by doppler method at the right forelimb ) . \n the cat was dehydrated ( positive skin turgor test , > 2 s capillary refill time , pale membrane ) . \n no particular abnormalities were found during a physical examination , with the exception of dehydration and haemorrhagic mucopurulent discharge in both nostrils . \n the cat was negative for feline herpesvirus , feline calicivirus , feline leukaemia virus / feline immunodeficiency virus and feline panleukopenia , based on pcr testing ( idexx laboratories , sungnam , korea ) . \n a complete blood cell count showed mild hypochromic anaemia ( haemoglobin 7.3 g / dl [ reference interval { ri } ] 916 g / dl ; red blood cell count 4.59 m/l [ ri 611 m/l ] ) and mild leukocytosis with lymphopenia ( white blood cell count 13.3 k/l [ ri 511 k/l ] ; lymphocytes 0.7 k/l [ ri 1.57 k/l ] ) , while blood chemistry revealed hyperglobulinaemia ( 5.2 g / dl [ ri 2.85.0 g / dl ] ) with severely decreased albumin / globulin ratio ( 0.5 [ ri 0.82.0 ] ) . \n urinalysis , including urine culture and sediment tests , showed no particular abnormalities with a urine specific gravity of 1.035 . \n thoracic radiography revealed a mild , diffuse pulmonary infiltration mixed with an alveolar and interstitial pattern in the left cranial lung lobe . \n based on findings on thoracic radiography and nasal cytology , bacterial pneumonia was strongly suspected . \n further diagnostic tests such as tracheal wash or bronchioalveolar lavage were not attempted owing to the cat s clinical condition . \n an abdominal ultrasound examination showed free fluid in the body cavity and cross - fused kidneys located on the right side from the midline , indicating an ectopic left kidney fused with an orthotopic right kidney ( figure 1a , b ) . \n a repeated renal ultrasound revealed that the ureters of both kidneys were dilated , suggesting the presence of hydronephrosis ( figure 1c , d ) . \n volume rendering of ct images showed crossed fused renal ectopia on the right side and the presence of two right renal arteries from the descending aorta entering the medially facing hilum of the fused kidneys ( figure 2a , b ) . \n a dorsal plane image showed an ectopic left kidney placed horizontally anterior to the l4 and l5 vertebrae that was fused with the lower pole of a normally placed right kidney , indicating l - shaped cfre ( type e ; figure 2c ) . \n the renal dimensions ( parenchymal thickness ) of the superiorly ( right ) and tandemly ( left ) situated kidneys were 27 36 ( 8.8 ) mm and 26 32 ( 8.1 ) mm , respectively ( figure 2c ) . \n the ureter of the left ectopic kidney crossed over the midline , while ureterovesical junctions were normally located ( figure 2d ) . \n ( a , b ) ultrasonography showing the upper pole of the left kidney and the lower pole of the right kidney fused with each other . \n ( c , d ) the proximal portion of ureters in both kidneys were dilated . \n lprk = lower pole of right kidney ; uplk = upper pole of left kidney ; ur = ureter . \n ( a , b , d ) volume rendering images and ( c ) dorsal multiplanar reformatted ct images in the nephrographic and excretory phase of the affected cat . \n ( a , b ) volume rendering images show crossed fused renal ectopia on the right side and the presence of two right renal arteries ( arrow ) from the descending aorta entering the medially facing hilum of fused kidney . \n ( c ) dorsal plane image shows ectopic left kidney placed horizontally anterior to l4 and l5 vertebrae is fusing with the lower pole of the normally placed right kidney . \n ( d ) the ureter of the left ectopic kidney crosses the midline and ureterovesical junctions are normally located a sample of abdominal fluid was collected with ultrasound guidance . \n cytological examination of this sample revealed a protein - rich fluid ( 4.8 g / dl ) consisting of macrophages and non - degenerate neutrophils , suggesting a feline infectious peritonitis ( fip ) infection . \n the sample was submitted for pcr confirmation of feline coronavirus infection and was found to be positive . \n based on diagnostic studies , the cat was diagnosed with left - to - right cfre complicated with fip and respiratory tract infection . \n therapy was directed to manage the clinical signs associated with fip and bacterial pneumonia , as there was no evidence that a pre - existing cfre contributed to clinical signs in this cat . \n the cat was treated with doxycycline ( 5 mg / kg po q12h [ vibramycin ; pifzer ] ) , cefotaxime ( 40 mg / kg iv q8h ; kyungnam ) and prednisolone ( 1 mg / kg po q12h [ solone ; handong ] ) with occasional nebulisation therapy ( aminophylline 100 mg in saline 10 ml solution for 1520 mins q8h ) for 1 week . however , clinical signs worsened with this intensive treatment and the cat died . \n based on anatomical variations , six types of cfre have been reported in humans : inferior crossed fusion ; sigmoid or s - shaped kidney ; lump kidney ; disc kidney ; l - shaped kidney ; superior crossed fusion ( figure 3 ) . \n a modified classification divides cfre into : ( 1 ) crossed ectopia with fusion ; ( 2 ) crossed ectopia without fusion ; ( 3 ) solitary crossed ectopia ; and ( 4 ) bilateral crossed ectopia . in most human cases of cfre , \n the inferior cfre with left - to - right crossover is the most frequent type of cfre , which is characterised by fusion of the ectopic left kidney to the lower pole of the orthotopic right kidney . \n a previous human study found that cfre is twice as prevalent in men than in women . \n similar to human studies , the affected cat in this study was male and had cfre characterised by an inferior crossed fusion . \n ( a ) inferior crossed fusion ; ( b ) sigmoid or s - shaped kidney ; ( c ) lump kidney ; ( d ) disc kidney ; ( e ) l - shaped kidney ; and ( f ) superior crossed fusion . modified from sharma et al \n although > 50% of human patients with cfre are asymptomatic at first presentation , cfre that is symptomatic is clinically significant because approximately 50% of symptomatic cfre patients have complications , including nephrolithiasis , hydronephrosis and infections . as observed in humans , suggestive findings of hydronephrosis ( ie , ureteral dilation ) were seen in a renal ultrasound in this cat , although there were no clinical signs ( eg , polyuria / polydipsia ) directly related to cfre . \n however , in this case , it was difficult to determine whether the cat did not previously show clinical signs related to renal diseases because the owners rescued it 1 month before presentation . \n hydronephrosis is a common complication in humans with cfre and may occur as a result of pelviureteric junction obstruction . \n human studies have shown that entrapment of the ureter in the isthmus and vesicoureteral reflux were responsible for the development of hydronephrosis and pyelonephritis . \n common diagnostic tests in humans with cfre include urography ( ie , anterograde or retrograde ureterogram ) , abdominal ultrasound and ct scans . \n the characteristic findings of renal ultrasound in humans with cfre are an anterior and/or posterior notch in the kidney with two ureters entering into the urinary bladder , an abnormal arterial supply and venous drainage , calyceal distortion , hydronephrosis and urolithisasis . in our case , these characteristic findings were not clearly visible , except findings suggestive of hydronephrosis ( ie , ureteral dilation ) in an abdominal ultrasound examination . on the abdominal ultrasound examination , the ectopic left kidney was fused with the orthotopic right kidney . \n we were unable to define the exact type of cfre and to identify abnormalities in vascular supply and ureteral drainage . \n the ct scan clearly revealed the fusion of the left ectopic kidney with the lower pole of the orthotopic right kidney , making an l - shaped kidney . \n the l - shaped cfre is a rare type of cfre in humans , and has never been reported in cats . \n the most common type of cfre is inferior crossed fusion cfre , in which the ectopic left kidney is positioned inferiorly and the orthotopic right kidney is positioned superiorly . \n a ct scan also provided images of the vascular supply and ureteral drainage to the urinary bladder in this case . \n interestingly , two arteries from the descending aorta branched into each of the fused kidneys . \n furthermore , each ureter from the ectopic left and orthotopic right kidneys was present and connected to the urinary bladder , as normally expected . \n it is not uncommon for humans to have more than one renal artery and atypical configurations of the vascular supply . in this case , \n although no specific guidelines for the management of cfre in humans have been proposed , it often causes recurrent upper urinary tract infections ( utis ) and obstructions . in such cases , \n pyeloplasty for relieving pelviureteric junction obstructions and reimplantation of the ureter for preventing vesicoureteral reflux would be necessary . \n a subcutaneous ureteral bypass device could be an option for cats with cfre with recurrent upper urinary tract obstructions . \n because there was no diagnostic evidence of uti and severe obstruction in this cat , surgical therapy was not further considered . \n hypertension has been reported in humans with cfre and may occur as a result of an aberrant arterial supply to fused kidneys . \n more detailed angiographic studies may be beneficial to identify anomalies in the arterial supply in those cases . \n doppler evaluation of the renal artery has been performed in humans to identify renal artery stenosis or kinking of an artery as potential causes of renal hypertension . \n one feline case of cfre has been reported and was associated with renal failure and hypertension , although the cat had the most common type of cfre ( ie , an ectopic left kidney fused with an orthotopic right kidney ) . \n however , the cat in this case was hypotensive at the first presentation as a result of dehydration and was never hypertensive during hospitalisation . \n in our case , there was no direct evidence that pre - existing cfre contributed to the clinical signs , even though findings suggestive of hydronephrosis were observed during a renal ultrasound . \n most clinical signs observed in this cat were consistent with those of fip complicated by respiratory tract infection . \n the cat was hypotensive ( owing to dehydration ) and had no evidence of urinary problems in laboratory tests . \n we believe that cfre may have been asymptomatic in this cat , unlike a previously reported case . in humans , \n many cases of cfre have been found with other congenital malformations affecting the urogenital , gastrointestinal and musculoskeletal systems . however , \n cfre is a rare congenital anomaly and is readily detectible on a renal ultrasound and ct scan . \n as it is often associated with recurrent utis and obstructions , practitioners should include this anomaly as a case of a recurrent uti or pelvic dilation in cats .", "role": "user" }, { "content": "case summarythis report describes a rare case of crossed fused renal ectopia ( cfre ) in a cat . a mature intact male persian cat presented with bloody nasal discharge and ascites . \n diagnostic studies revealed an ectopic left kidney fused with an orthotopic right kidney and a concurrent feline infectious peritonitis ( fip ) infection . \n the fip was responsible for clinical signs in this cat , while clinical signs associated with cfre were not obvious . despite receiving intensive treatment , \n the cat died . \n a post - mortem examination was not performed because the owners declined approval.relevance and novel informationto the best of our knowledge , this is the first report of l - shaped cfre in a cat . \n in addition , this report describes the ct features of l - shaped cfre in a cat .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: myocardial infarction , a leading cause of heart failure , precipitates dyssynchronous cardiac motion contributing to organ decompensation . \n crt , through biventricular pacing , has advanced the management of heart failure . despite overall benefit , \n a culprit underlying unfavorable response to crt is the infarction - provoked scarburden . to address refractory dyssynchrony , \n reparative strategies are increasingly considered . boosting the repair capacity of the human heart , through stem - cell based interventions , \n proof - of - concept studies offer initial evidence that transplantation of stem cells may salvage the infarcted myocardium and synchronize failing ventricles . \n translation of reparative resynchonization principles into practice will require optimization of the regenerative intervention and stratification of patients most likely to benefit . \n the relationship of injury , aberrant wall motion and responsiveness to intervention is yet to be delineated . \n establishing best practices is paramount in designing safe and effective protocols tailored to individual patients . by harnessing the potential of regenerative medicine , \n stem - cell biotherapy emerges as a potential means to restitute collapsed mechanics in the failing myocardium as a complement to standard of care . \n cardiac dyssynchrony , triggered by disruption in coordinated wall motion , contributes to organ failure and poor outcome . \n post - infarction , the inhomogeneity across infarcted versus non - infarcted regions generates an environment conducive to development of cardiac dyssynchrony . \n cardiac resynchronization therapy relies on biventricular pacing , and is integral in managing dyssynchronous heart failure . yet \n a nonviable myocardium is inadequately resynchronized by pacing , and dyssynchrony stands uncorrected . restoration of normative impact may require a tissue - reparative strategy . \n the notion of reparative resynchronization was recently formulated highlighting the prospect of stem - cell based structural and functional repair . \n preclinically , targeted implantation of stem cells into epicenters of cardiac dyssynchrony translates long term in tissue repair and resynchronization . \n clinically , in acute or chronic ischemic heart disease , patients appear to benefit from stem - cell therapy demonstrating on follow - up reduced dyssynchrony . \n stem - cell based resynchronization emerges as a biotherapeutic strategy to address primary defects in myocardial pathodynamics underlying heart failure post - infarction , meriting further exploration and validation . \n cardiac dyssynchrony , triggered by disruption in coordinated wall motion , contributes to organ failure and poor outcome . \n post - infarction , the inhomogeneity across infarcted versus non - infarcted regions generates an environment conducive to development of cardiac dyssynchrony . \n cardiac resynchronization therapy relies on biventricular pacing , and is integral in managing dyssynchronous heart failure . yet \n , the infarction - provoked scar may impede a favorable response to pacing regimens . a nonviable myocardium is inadequately resynchronized by pacing , and dyssynchrony stands uncorrected . \n the notion of reparative resynchronization was recently formulated highlighting the prospect of stem - cell based structural and functional repair . \n preclinically , targeted implantation of stem cells into epicenters of cardiac dyssynchrony translates long term in tissue repair and resynchronization . \n clinically , in acute or chronic ischemic heart disease , patients appear to benefit from stem - cell therapy demonstrating on follow - up reduced dyssynchrony . \n stem - cell based resynchronization emerges as a biotherapeutic strategy to address primary defects in myocardial pathodynamics underlying heart failure post - infarction , meriting further exploration and validation .", "role": "user" }, { "content": "cardiac dyssynchrony refers to disparity in cardiac wall motion , a serious consequence of myocardial infarction associated with poor outcome . \n infarct - induced scar is refractory to device - based cardiac resynchronization therapy , which relies on viable tissue . \n leveraging the prospect of structural and functional regeneration , reparative resynchronization has emerged as a potentially achievable strategy . in proof - of - concept studies , \n stem - cell therapy eliminates contractile deficit originating from infarcted regions and secures long - term synchronization with tissue repair . \n limited clinical experience suggests benefit of cell interventions in acute and chronic ischemic heart disease as adjuvant to standard of care . a regenerative resynchronization option for dyssynchronous heart failure thus merits validation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: recognizing an effusion in a symptomatic knee is an important finding in many rheumatologic conditions . \n it is not always easy to determine if a knee effusion is present on physical examination , especially if the effusion is small or the patient is obese . \n ultrasound is a safe , quick , and accurate method to identify a knee effusion . \n a study was conducted to determine if after a brief musculoskeletal ultrasound workshop , fourth - year medical students with little ultrasound experience could learn to scan and identify anatomical landmarks in the knee , and determine if an effusion was present . \n twenty - one fourth - year medical students volunteered to participate in the study . \n the group attended a thirty - minute didactic powerpoint presentation consisting of a brief introduction of the physics of ultrasound , the anatomy of the knee , ultrasound scanning techniques of the knee and a review of normal and abnormal ultrasound images , including knee effusions . \n after the presentation , students observed a faculty member performing a suprapatellar longitudinal scan of the knee of a cadaver that had previously been injected with normal saline to produce a small effusion in the suprapatellar bursa . \n the students then had approximately 15 minutes of supervised scanning on three cadavers which had been injected with saline to give varying degrees of knee effusions . \n students were taught to identify the femur , the quadriceps tendon , the patella , and a suprapatellar bursa effusion , if present . \n after the instructional session , each student was individually observed scanning a cadaver different from the practice cadavers . \n the knees of the test cadaver had previously been injected with normal saline in the suprapatellar bursa to produce small ultrasound detectable effusions but with one effusion slightly larger than the other . on visual inspection of the knees , there was no evidence of effusion in either knee ( i.e. , no suprapatellar bulge sign ) . \n each student was observed for the proper scanning technique of the suprapatellar longitudinal view of each knee . \n the student was required to identify the quadriceps tendon , the patella , and the area of the suprapatellar bursa , and to state if an effusion was present and , if so , which knee had the larger effusion ( figure 1 ) . after the workshop and testing , the students had the opportunity to anonymously comment and rate the value of the workshop . \n four logiq e ( general electric healthcare ) hand - carried ultrasound machines with high - frequency ( 12 mhz ) linear probes were used for the demonstration , practice , and the testing . \n of the 21 students participating in the study , 11 had no prior hands - on experience with ultrasound and 19 of the 21 had no musculoskeletal ultrasound experience . \n all 21 students correctly performed suprapatellar longitudinal scans on both knees of the test cadaver . \n all students identified all anatomic structures correctly on both knees , and all students correctly identified the knee with the larger effusion . \n the first report of musculoskeletal ultrasound was in 1958 when dussik used ultrasound waves to evaluate articular and periarticular tissues . \n much has changed since that time with respect to the technology of ultrasound and its application to clinical medicine including rheumatologic diseases . \n hand - carried ultrasound machines are now available which produce high - quality digital images that rival the larger , more expensive ultrasound machines . \n these machines are also more user - friendly , making ultrasound easier to learn and less operator dependent . \n ultrasound has been successfully introduced into medical school curricula in various courses such as gross anatomy and physiology [ 35 ] . \n tshibwabma et al . reported a four - year experience with second - year medical students that used ultrasound to help learn musculoskeletal anatomy and physical examination skills . \n ultrasound education has been introduced across all four years of medical education in an integrated ultrasound curriculum . in the present study of 21 fourth - year medical students , it was demonstrated that in a relatively short period of time ( total time of less than one hour ) , all students learned the suprapatellar longitudinal scan of the knee and correctly identified all anatomical landmarks , the presence of an effusion , and the knee with the larger effusion . \n they performed well at this level despite the fact that just over half of them had no hands - on ultrasound experience prior to the workshop and 19 of the 21 students had no previous musculoskeletal ultrasound experience . \n the knee was chosen as the focus of the workshop because it is a common site of musculoskeletal pathology , and the ability to determine if an effusion is present can be critical in diagnosing and managing patients . \n ultrasound determined the location and size of an effusion which can also facilitate the aspiration of an effusion . \n septic arthritis and crystal - induced arthritis such as gout and pseudogout commonly involve the knee , and the early detection of a joint effusion and fluid aspiration are crucial to the diagnosis and management of these cases . \n thus , learning to scan a symptomatic knee for an effusion should prove highly beneficial for these future physicians . \n it should be noted that even though the study cohort of students quickly and accurately learned to identify a knee effusion by ultrasound , it is not the authors ' intent to suggest that ultrasound should replace the appropriate physical examination of the knee . \n ultrasound should be considered complementary to a good musculoskeletal physical examination and not a replacement for that examination . \n in fact , ultrasound can be a good teaching tool for the physical examination [ 6 , 9 , 10 ] . \n as day et al . have reported , medical students presently lack confidence in their musculoskeletal physical examination skills . \n because cadaver specimens were used and are difficult to physically manipulate , no attempt was made to assess the students ability to identify an effusion by physical examination in this study . \n in addition to ultrasound being a valuable teaching and clinical tool , virtually all studies involving medical students including this study have shown that the students enjoy the addition of the hands - on component of ultrasound to their educational experience . \n introducing ultrasound into musculoskeletal education , especially in teaching rheumatology , may generate interest in the subspecialty of rheumatology early in their training . \n this may be important considering the predicted rheumatology workforce shortages for the next two decades .", "role": "user" }, { "content": "twenty - one fourth - year medical students were given a brief lecture on ultrasound of the knee and fifteen minutes of supervised ultrasound scanning of three cadavers which had been injected with saline to give varying degrees of knee effusions . \n each student was then individually observed and required to scan both knees of a cadaver different from the practice cadavers and identify the patella , the femur , the quadriceps tendon and if a suprapatellar effusion was present , and which knee had the larger effusion . \n all twenty - one students correctly identified all anatomical structures , suprapatellar effusions , and which knee had the larger effusion . identifying a knee effusion can be an important clinical finding in diagnosing and managing a patient with knee complaints . \n fourth - year medical students can learn to identify knee effusions with ultrasound following a brief introductory lecture and hands - on scanning practice session .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: atherosclerosis , one of the major underlying causes of cardiovascular disease , is an inflammatory response in the walls of arteries largely due to the progressive accumulation of lipid and fibrous deposits in the vessel wall . \n when it happens in the arteries that feed the heart , it causes coronary artery disease . \n if it develops in the arteries that feed the brain , it results in stroke . \n numerous epidemiological studies have provided unquestionable evidence that plasma levels of cholesterol , especially low density lipoprotein cholesterol ( ldl - c ) , are positively correlated with the risk of atherosclerosis . \n ldl is produced as a metabolic by - product of very low density lipoprotein ( vldl ) , a triglyceride - rich lipoprotein produced exclusively by the liver . \n cholesterol is carried in the highly hydrophobic core of ldl particles in its esterified form . \n when plasma ldl - c concentrations are too high , such as in patients with autosomal dominant / recessive hypercholesterolemia , it slowly builds up in the inner walls of the arteries , becomes oxidized and promotes the accumulation of monocyte - derived macrophages . in turn , these take up lipoprotein cholesterol and form foam cells , consequently initiating atherosclerosis . \n the ldlr in the liver is the protein primarily responsible for removal of ldl from the circulation . \n the ldlr consists of 7 ligand - binding repeats ( lr1 - 7 ) at the n terminus followed by the so - called epidermal growth factor ( egf ) precursor homology domain ( fig . \n the clustered o - linked sugar region ( a threonine- and serine - rich region ) is followed by the transmembrane domain and a relatively short cytoplasmic tail that are located downstream of the egf precursor homology domain . \n lr3 to lr7 are important for the binding of apolipoprotein b-100 on the surface of ldl , while lr4 and lr5 are important for binding to apolipoprotein e on vldl surface . \n the egf precursor domain contains two cysteine - rich egf - like domains ( egf - a and egf - b ) followed by a -propeller domain / ywtd repeats and a third egf - like domain ( egf - c ) . \n these egf and ywtd repeats are required for lipoprotein release from the receptor in the endosome and recycling of the ldlr to the cell surface . \n the cytoplasmic tail of ldlr contains all the sequences required for receptor clustering in clathrin - coated pits and for internalization of the receptor . \n the crystallographic structure of the extracellular domain of the ldlr suggests that the extracellular domain of the cell - surface ldlr ( neutral ph ) adopts an extended linear conformation ( open conformation ) that favors interactions between the ligand binding repeats and ldl . upon ligand \n binding , the receptors are internalized via clathrin - coated pits and delivered to endosomes . in the low ph environment of the endosome , \n the ldlr undergoes a conformational change so that lr4 and lr5 form a physical interaction with ywtd in the egf precursor homology domain ( closed conformation , fig . \n the acid - dependent conformational change in the ldlr promotes the release of the bound ldl that is delivered to lysosomes for degradation ( fig . \n usually , each ldlr undergoes multiple rounds of internalization and recycling . a : ldl binds to the ldlr on the cell surface , \n b : the conformation of the ldlr is changed to a close conformation in the low ph environment of the endosome , which promotes the release of the bound ldl . \n mutations in the ldlr cause familial hypercholesterolemia ( fh ) , an inherited disorder associated with elevated circulating levels of cholesterol , specifically ldl - c , which causes tendon and skin xanthomas , arcus corneae and/or cardiovascular deposits and leads to increased risk in coronary heart disease and mortality . \n fh is the most common autosomal dominant hypercholesterolemia ( adh ) with a frequency of 1 in 500 people for heterozygous fh . \n ldlr mice fed a chow diet display total non - fasting plasma cholesterol levels that are about two - fold higher than wild type littermates . \n when fed a high fat / high cholesterol diet , ldlr mice show severely increased plasma levels of ldl - c , develop atherosclerosis , and are susceptible to obesity and diabetes . \n ldlr is transcriptionally regulated by the sterol regulatory element binding protein 2 ( srebp-2 ) . \n statins , currently the most prescribed lipid - lowering drugs , act by inhibiting 3-hydroxy-3-methylglutaryl - coa reductase that is the rate - limiting enzyme in de novo cholesterol synthesis , activating the sterol - dependent processing of srebp-2 pathway and increasing the level of the ldlr , which results in decreased de novo cholesterol synthesis and plasma ldl - c levels . \n the ldlr is also post - translationally regulated by proprotein convertase subtilisin / kexin - type 9 ( pcsk9 ) and inducible degrader of the ldlr ( idol ) . \n pcsk9 binds to ldlr and promotes lysosomal degradation of the receptor , while idol down - regulates ldlr via the polyubiquitination and lysosomal degradation pathway . in this review , \n we summarize the recent findings about the important roles of pcsk9 in regulating the expression of the ldlr . \n recently , a third form of adh was identified that is caused by selected missense mutations in pcsk9 . \n gain - of - function mutations of pcsk9 cause higher plasma ldl - c levels and lead to accelerated atherosclerosis and premature coronary heart disease . on the other hand \n , loss - of - function mutations result in low concentrations of ldl - c and protection from coronary heart disease . \n for example , african americans who are heterozygous for one of two nonsense mutations in pcsk9 ( y142x and c679x ) show a 30%-40% reduction in plasma ldl - c concentrations and an 88% reduction in coronary heart disease over a 15-year period . \n pcsk9 mice , as well as humans with pcsk9 loss - of - function mutations show increased sensitivity to statins . \n indeed , administration of monoclonal antibodies against pcsk9 to heterozygous fh patients significantly reduces their plasma levels of ldl - c . \n pcsk9 is a member of the subtilisin - like serine protease family that includes 7 basic amino acid - specific proprotein convertases ( pc ) : pc1 , pc2 , furin , pc4 , pc5/6 , pace4 , and pc7 , as well as two members , site-1 protease and pcsk9 , that cleave at the carboxyl terminus of non - basic residues . \n pcsk9 is a 692-amino acid secreted glycoprotein that consists of a signal sequence followed by a prodomain , a catalytic domain , and a cysteine- and histidine - rich c - terminal domain ( fig . \n pcsk9 is synthesized as a zymogen and undergoes autocatalytic cleavage in the endoplasmic reticulum ( er ) at the faq152sipk site ( fig . \n the cleaved n - terminal prodomain is tightly associated with the rest of the catalytic c - terminus and secreted together from cells , physically shielding the catalytic activity as the protein transits through the secretory pathway . \n sec24a is required for the transport of pcsk9 from the er to the golgi , while sortilin interacts with pcsk9 in the trans - golgi network and then facilitates its secretion . \n the expression of pcsk9 is high in the liver , intestine , kidney , and brain and regulated by the srebp2 pathway . \n pcsk9 is present in human plasma , and circulating levels of pcsk9 correlate with plasma levels of ldl - c but not hdl - c . \n overexpression of recombinant pcsk9 in the liver of mice causes a significant reduction in hepatic ldlr protein levels without any effect on its mrna levels and produces severe hypercholesterolemia . on the other hand , knockdown or knockout of pcsk9 expression in mice \n the natural gain - of - function mutation , d374y , has a significantly increased binding affinity for the ldlr and promotes ldlr degradation much more efficiently than the wild type protein , leading to a severe form of hypercholesterolemia . \n fh mutation , ldlr - h306y , binds pcsk9 with a higher affinity and exhibits enhanced sensitivity to pcsk9 . taken together , \n these findings demonstrate that the role of pcsk9 in homeostatic control of plasma ldl - c levels is dependent upon pcsk9-promoted degradation of the ldlr , thereby preventing clearance of ldl - c by the cells . \n pcsk9 contains a signal sequence followed by a prodomain , a catalytic domain , and a cysteine- and histidine - rich c - terminal domain . \n pcsk9 secretion : a : the protein is synthesized as a zymogen in the er and then undergoes autocatalytic cleavage between the prodomain and the catalytic domain . the cleaved prodomain is tightly associated with the catalytic domain . \n b : pcsk9 is transported to the golgi , where post - translational modifications , such as glycosylation and sulfation , occur . \n pcsk9-promoted ldlr degradation : ( 1 ) the catalytic domain and prodomain of pcsk9 bind to egf - a and ywtd repeats of the ldlr , respectively . ( 2 ) pcsk9-ldlr complex enters into cells via clathrin - dependent endocytosis and is delivered to the endosome . \n ( 3 ) pcsk9 strongly binds to the ldlr at the acidic endosomal environment , which blocks recycling of the ldlr to the cell surface . ( 4 ) pcsk9-ldlr complex is transported to the lysosome for degradation . \n studies in cultured cells and parabiotic mice demonstrated that pcsk9 promotes degradation of the ldlr extracellularly in an adaptor protein autosomal recessive hypercholesterolemia ( arh)-dependent manner in hepatocytes and lymphocytes . \n mcnutt et al . showed that pcsk9 causes degradation of the ldlr primarily through interaction with the receptor on the cell surface . \n however , overexpression of pcsk9 in cultured cells and mouse liver induces ldlr degradation intracellularly . \n recently , poirier et al . reported that , upon dose and incubation period , pcsk9 could act both intracellularly and extracellularly to promote ldlr degradation in cultured cells and mouse primary hepatocytes . \n in addition , pcsk9 's action on the ldlr is cell - type specific . increased plasma levels of pcsk9 in mouse through infusion of purified pcsk9 or transgenic overexpression in the kidneys preferentially promote ldlr degradation in the liver but not in the adrenal glands . \n consistently , the adrenal function of a human subject with no detectable plasma pcsk9 is normal . in cultured cells , \n expression of pcsk9 in some cell types , such as human hepatoma cells ( hepg2 and huh7 ) , dramatically reduces ldlr levels . on the other hand \n , pcsk9 appears to not affect ldlr expression in chinese hamster ovarian cells ( cho - k1 ) , monkey kidney cells ( cos-7 ) and rat liver cells ( mcardle rh7777 ) . \n recently , studies from mayer et al . showed that the c - terminal cysteine- and histidine - rich domain of pcsk9 directly interacts with annexin a2 , which subsequently inhibits pcsk9-promoted ldlr degradation . \n the high expression of annexin 2 in fibroblasts and cos-7 cells may account for pcsk9-resistance in these cells . on the other hand , the dissociation of pcsk9 for the ldlr after endocytosis may be responsible for the inability of pcsk9 to promote ldlr degradation in human skin fibroblasts sv-589 . \n secreted pcsk9-promoted degradation of the ldlr requires binding of pcsk9 to the ldlr and internalization of the receptor but does not require the proteolytic activity of pcsk9 . \n we have shown that pcsk9 interacts with the egf - a of the ldlr at the cell surface and binds the receptor with a much higher affinity at the acidic environment of the endosome ( fig . \n 2 ) . consequently , the receptor traffics from the endosome to the lysosome for degradation , rather than being recycled . \n binding of pcsk9 to ldlr interferes with the acid - dependent conformational change of the receptor but disrupting the ph - dependent conformational change in the ldlr is not sufficient to trigger ldlr degradation . \n in addition , we demonstrated that ywtd repeats and a minimum of three ligand - binding repeats in the ldlr that are not required for pcsk9 binding at neutral ph are essential for efficient ldlr degradation induced by pcsk9 . \n we also reported that the c - terminal domain of pcsk9 is essential for pcsk9-promoted degradation of the ldlr but is not required for binding to the ldlr at the neutral ph values . \n the x - ray crystallographic structure of pcsk9-ldlr complex shows that ywtd repeats of the ldlr interact with the prodomain of pcsk9 . \n several biochemical studies indicate that the negatively charged ligand binding repeats of the ldlr may interact with the positively charged c - terminal domain of pcsk9 in the acidic endosomal environment , to enhance pcsk9 binding ( fig . \n neither pcsk9 or the ldlr contains a lysosomal targeting signal . presently , the mechanism by which binding of pcsk9 to the ldlr reroutes the receptor to the lysosomes for degradation is not understood and is believed to be complex . \n phase iii clinical trials of the monoclonal antibodies against pcsk9 show impressive ldl - c - lowering effect of pcsk9 inhibition in heterozygous and homozygous fh patients , high - risk patients intolerant to statins , and patients with poor ldl - c - lowering response even with maximally tolerated statin dosages . furthermore , when adding to the statin therapy , pcsk9 inhibitors can markedly reduce cardiovascular events , such as myocardial infarction and ischemic stroke , with no significant adverse side effects . \n however , low plasma cholesterol levels have been linked to increased cancer incidence or mortality and higher hemorrhagic stroke risk . \n reported that statin treatments are associated with a 9% increased risk for incident diabetes . with approval of pcsk9 inhibitors \n in addition , all pcsk9 inhibitors currently under phase iii clinical trials are monoclonal anti - pcsk9 antibodies . given that the treatment of patients with hypercholesterolemia is lifelong and the antibody therapy requires injections of large amounts of antibodies to achieve clinical efficacy with extremely high production costs , the wide use of these drugs may be limited . \n thus , the need for more effective and more cost - efficient therapies to lower ldl - c is urgent . \n however , the molecular mechanisms of pcsk9-promoted ldlr degradation are not completely understood , which impedes the future design of pcsk9 specific small molecule inhibitors . \n crystallographic studies of pcsk9-egf - ab complex show that the interaction face between the catalytic domain of pcsk9 and the egf - a of the ldlr is relatively flat and big , making it impossible to design a specific inhibitor to block the interaction between pcsk9 and the egf - a of the ldlr . \n therefore , mechanistic studies of pcsk9-promoted ldlr degradation , such as identification of new interaction regions between pcsk9 and the ldlr and potential cofactors important for pcsk9-promoted ldlr degradation , are necessary .", "role": "user" }, { "content": "abstractatherosclerotic cardiovascular disease is the main cause of mortality and morbidity in the world . \n plasma levels of low density lipoprotein cholesterol ( ldl - c ) are positively correlated with the risk of atherosclerosis . \n high plasma ldl concentrations in patients with hypercholesterolemia lead to build - up of ldl in the inner walls of the arteries , which becomes oxidized and promotes the formation of foam cells , consequently initiating atherosclerosis . \n plasma ldl is mainly cleared through the ldl receptor ( ldlr ) pathway . \n mutations in the ldlr cause familiar hypercholesterolemia and increase the risk of premature coronary heart disease . \n the expression of ldlr is regulated at the transcriptional level via the sterol regulatory element binding protein 2 ( srebp-2 ) and at the posttranslational levels mainly through proprotein convertase subtilisin / kexin - type 9 ( pcsk9 ) and inducible degrader of the ldlr ( idol ) . in this review , we summarize the latest advances in the studies of pcsk9 .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: syphilis is a sexually transmitted disease caused by infection with the spirochete bacterium , treponema pallidum . until the 1980s \n however , the incidence of syphilis has since then increased worldwide . in particular risk groups , \n acquired syphilis can be divided into primary , secondary , latent , and tertiary stages . \n the inoculation of treponemes into tiny abrasions from sexual trauma can cause a chancre , a painless ulcer . while local immunity leads to healing of the ulcer , hematogenous dissemination of the treponemes results in secondary syphilis . \n secondary syphilis is characterized by multisystem involvement : typically , a skin rash , condylomata lata , mucosal lesions , and generalized lymphadenopathy . however , pulmonary involvement in patients with secondary syphilis is extremely rare . \n this is then followed by a latent phase and , if untreated , about 40% of patients will go on to develop the tertiary stage , characterized by gummatous , cardiovascular , and neurological involvement . \n , we report a case of secondary syphilis with pulmonary involvement in a patient presenting with multiple pulmonary nodules , initially suspected to be due to a metastatic carcinoma . \n a 51-year - old heterosexual male with no significant medical history presented with multiple pulmonary nodules on a plain chest radiograph . \n the nodules were detected during an evaluation for right pleuritic chest pain , fever , and myalgia that started 2 weeks earlier . \n a physical examination revealed a normal body temperature , normal breath sounds , no mucosal or genitourinary lesion , but an erythematous papular rash on the trunk , right cervical , and bilateral inguinal nontender , nonmovable lymphadenopathy was noted . \n laboratory tests showed no leukocytosis , normal alkaline phosphatase levels , and a normal urinary analysis . \n however , the erythrocyte sedimentation rate , > 120 mm / hr ( normal range , < 9 ) , high sensitivity c - reactive protein , 4.8 mg / dl ( normal range , < 0.3 ) , -glutamyl transpeptidase , 73 iu / l ( normal range , < 50 ) , and alanine aminotransferase , 55 iu / l ( normal range , < 50 ) were elevated . \n carcinoembryonic antigen , carbohydrate antigen 19 - 9 , and prostate specific antigen were within normal ranges \n a diagnosis of syphilis was suspected ; fluorescent treponemal antibody - absorption ( fta - abs ) and vdrl titers were assessed , resulting in reactive fta - abs immunoglobulin m , immunoglobulin g , and a 1 : 64 vdrl titer . a plain chest radiograph and computed tomography ( ct ) scan showed multiple variably sized nodules in both lungs , suggesting the possibility of a hematogenous metastatic malignancy ( fig . 1a ) . \n screening tests for malignancy including gastrointestinal endoscopies , bronchoscopy , and ct scans of the neck , abdomen , and pelvis revealed only cervical and pancreatic lymphadenopathy . \n positron emission tomography ct scanning was performed and showed hypermetabolic lesions , including the multiple pulmonary nodules , as well as the cervical and pancreatic lymph nodes , with no other organ involvement . \n the standardized uptake values of the pulmonary nodules were from 4.37 to 5.59 , strongly suggesting a malignancy ( fig . \n a pulmonary malignancy was suspected and percutaneous needle aspirations of the pulmonary nodules and inguinal lymph nodes were performed . \n additional history revealed that the patient had sexual contact with a prostitute 8 weeks previously and a painless genital ulcer developed about 6 weeks earlier , which disappeared spontaneously . \n a generalized erythematous papular rash appeared on trunk for 1 week that did not itch . \n thus , the history and laboratory findings were compatible with secondary syphilis . because pulmonary involvement in secondary syphilis is extremely rare and the radiological findings suggested malignancy , a pulmonary malignancy was still strongly suspected . \n thus , a video - assisted thoracoscopic surgical lung biopsy and cervical lymph node excisional biopsy were performed . \n histopathological examination of a pulmonary nodule showed central necrosis with abscess formation and the infiltration of plasma cells and lymphocytes , with fibrosis in the periphery , but no evidence of malignancy or other specific pulmonary diseases ( fig . \n 3 ) . clinical information and laboratory data , including the history , physical findings , and the reactive fta - abs and vdrl , supported a clinical diagnosis of secondary syphilis with multiple pulmonary nodules . \n thus , the patient was treated with 2.4 million units of benzathine penicillin g , injected intramuscularly . \n a follow - up chest ct scan after 1 month showed improved pulmonary nodules , which had nearly disappeared at 10 months ( fig . \n the vdrl titer decreased to 1 : 2 after 3 months and was nonreactive after 10 months . \n , one prior report denied the existence of parenchymal pulmonary disease in patients with secondary syphilis . in a study conducted between 1939 and 1944 \n however , nine cases of pulmonary involvement in secondary syphilis have been reported since 1966 . \n pulmonary lesions appeared as an infiltration , consolidation with pleural effusion , solitary pulmonary nodule , or multiple ill - defined nodules . \n however , this case differed from previous reports in that the appearance of the nodules was well defined , and mimicked hematogenous metastatic carcinoma . \n treponemal tests are treponemal antigen - based , such as the treponemal enzyme immunoassay , t. pallidum particle agglutination , or hemagglutination , and fta - abs \n the fta - abs test is generally accepted as the most sensitive and is considered the gold standard method of diagnosis . \n nontreponemal tests are cardiolipin - based , such as the rapid plasma reagin , or vdrl . \n these are still commonly used as screening tests ; they are cheap and easy to perform . after successful treatment of syphilis , \n . however , treponemal tests remain positive for life . in this case , the vdrl was reactive , and the fta - abs test confirmed the diagnosis of syphilis . \n vdrl titers decreased , from 1 : 64 to nonreactive , after benzathine penicillin g treatment . \n the diagnosis of secondary syphilis can be determined by history , the presence of the typical skin rash , and positive serological findings . however , the diagnosis of pulmonary involvement in secondary syphilis is difficult . \n differential diagnostic considerations should include primary or metastatic cancer , tuberculosis , mycotic or bacterial abscess formation , sarcoidosis , pulmonary infarction , collagen vascular disease , and bronchiectasis . in this case , because the multiple pulmonary nodules suggested metastatic cancer , a complete medical evaluation , including a biopsy , was performed . \n for the diagnosis of pulmonary involvement in secondary syphilis , the following criteria should be satisfied : 1 ) history and physical findings typical of secondary syphilis , 2 ) serological testing positive for secondary syphilis , 3 ) pulmonary abnormalities seen on radiographs , with or without associated symptoms , 4 ) exclusion of other pulmonary disease , by serological tests , sputum smears , cultures , and sputum cytology , and 5 ) therapeutic response of the radiologic findings to antisyphilitic therapy . in this case , each of these criteria was met , so pulmonary involvement in secondary syphilis was confirmed . \n treatment consists of a single dose of intramuscular benzathine penicillin g , 2.4 million units , for primary and secondary syphilis , as well as early latent syphilis . \n late latent and tertiary syphilis requires three doses of benzathine penicillin g , 2.4 million units , at weekly intervals . \n one reason for the re - emergence of syphilis is the increase in promiscuous sexual behavior , possibly associated with the successful introduction of highly active antiretroviral therapy that has to some degree reduced hiv - related phobia . \n clinicians should be reminded of this largely forgotten disease and know the proper therapeutic approaches , along with screening for other sexually transmitted diseases in patients with syphilis .", "role": "user" }, { "content": "syphilis is a sexually transmitted disease caused by treponema pallidum . \n the prevalence of this disease has recently increased worldwide . \n however , pulmonary involvement in secondary syphilis is extremely rare . a 51-year - old heterosexual male patient presented with multiple pulmonary nodules with reactive serology from the venereal disease research laboratory test and positive fluorescent treponemal antibody absorption testing . \n a hematogenous metastatic malignancy was suspected and an excisional lung biopsy was performed . \n histopathological examination showed only central necrosis with abscess and plasma cell infiltration , but no malignant cells . \n the patient reported sexual contact with a prostitute 8 weeks previously and a penile lesion 6 weeks earlier . \n physical examination revealed an erythematous papular rash on the trunk . \n secondary syphilis with pulmonary nodules was suspected , and benzathine penicillin g , 2.4 million units , was administered . \n subsequently , the clinical signs of syphilis improved and the pulmonary nodules resolved . \n the final diagnosis was secondary syphilis with pulmonary nodular involvement .", "role": "assistant" } ]