Datasets:

clinicalnlplab

/

PubmedSumm_train

like 0

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: suspicious clinically occult breast lesions are found frequently as a result of widespread mammographic screening programs of asymptomatic women .13 some 1520 % of these lesions are malignant , and their removal should be preceded by a radiographically guided localization procedure to assure an accurate and low tissue volume biopsy .4,5 several techniques have been developed as a diagnostic and therapeutic tool . wire - guided localization ( wgl ) is presently the most commonly used localization method for non - palpable breast lesions .68 however , the ideal technique should involve precise localization , avoid the excessive surgical resection of healthy breast tissue , improve the rate of free margin , not discomfort the patient and decrease operative time . although wgl has been shown to accurately localize the lesions , the technique has some disadvantages . the placement of the wire is difficult in dense breast tissue .9 the wire may be displaced during surgery . for surgical excision with free margins , the surgeon must follow the wire through healthy tissue until the lesion is found , and this causes the extensive removal of healthy breast tissue . furthermore , migration or rupture of the wire leads to a small risk of pneumothorax , and the discomfort of the patient and injuries for both the surgical team and the pathologist are other restrictions of the procedure .1012 radioguided occult lesion localization ( roll ) is a new method for the localization and resection of non - palpable breast lesions .1315 the approach involves the intratumoral injection of a small amount of nuclear radiotracer under guidance by ultrasonography or stereotactic mammography . radioactivity allows for the radiolabeling of the lesion and subsequent surgical excision guided by a handheld gamma ray detection probe . during the last decade , roll has gained popularity on account of several advantages associated with a reduced excision volume , more accurate centricity of a lesion within the surgical specimen , better cosmetic results and a higher percentage of tumor - free margins .1619 in addition , in recent studies investigating the feasibility of roll for lesion localization , the method was shown to be a simple , fast and accurate technique . however , although roll has been used for more than 10 years , there are a small number of reports in the literature investigating the superiority between roll and wgl .2022 because most of these studies are non - randomized and included a limited patient number , we present a prospective randomized study comparing roll with wgl for non - palpable breast lesions . we aimed to compare roll with wgl for non - palpable breast lesions in terms of the clearance of excision margins , weight of the excised specimen , duration of the procedure , operative time and perioperative complication rate . between june 2007 and may 2009 , a total of 115 consecutive patients who were undergoing excisional biopsy for non - palpable breast lesions detected by mammogram or ultrasonograph , and who required a pathologic diagnosis of these lesions , were enrolled in this study . the study was approved by the local ethics committee at the university hospital , mersin , turkey . a total of 7 patients , including 2 patients with diffuse microcalcifications , 2 patients with multicentric lesions , 1 patient whose wire dislodged during patient transfer and 2 patients who refused to participate were excluded from the study . the remaining 108 patients were assigned randomly to roll patients whose non - palpable breast lesions were localized by roll and followed by surgical resection ( roll group , n = 56 ) or wgl patients whose non - palpable breast lesions were localized with a wire hook and followed by surgical resection ( wgl group , n = 52 ) . randomization was performed according to a computer - generated list before lesion localization by an independent computer consultant . tumor localization was conducted by two breast radiologists and one nuclear medicine physician , and surgical procedures were performed by two breast surgeons . for cases randomized to the roll technique , 99mtc - labeled colloidal human serum albumin was injected directly into the breast lesion , or around the lesion , with a 1520 gauge needle under ultrasound ( us ) or stereotactic guidance 424 hours before surgery . colloidal kites were prepared using mbq 99mtc pertechnetate in 34 cc saline solution ( human albumin nanocolloid ; sentiscint , medi - radiopharma ltd , hungary ) . four patients underwent surgery in 4 hours , using 7.4 mbq ; and 10.5 mbq of radiopharmaceutics was used in those awaiting surgery for 24 hours . the site of isotope injection was confirmed by direct visualization under us or by the presence of the tip of the needle within the target area under stereotactic control . the location of the lesion was identified and marked on the skin to facilitate intraoperative identification by the surgeon . in the preoperative room before anesthesia , a gamma - detecting probe ( europrobe / eurorad / euromedical / french ) measuring the radioactivity in counts per second was used ; the hotspot area with maximum radioactivity corresponded to the site of the lesion . an incision was made in the skin projection over the hotspot area on a cosmetic basis . the probe was used repeatedly to confirm the location of the hotspot during the excision and check the position of the lesion . the limit of excision was determined by guidance of the frequency and intensity of the radioactivity . following excision of the lesion , the excised specimen was sent to the radiology department for radiographic confirmation of the presence of the lesion . when no residual activity was shown in the cavity , , a single hooked wire was used under mammographic or us guidance . with kopan 's hook system , if the entrance of the wire into the skin was near the hooked lesion , an incision was made on a cosmetic basis next to the wire entrance through the skin ; otherwise , if the entrance of the wire into the skin was far away from the hooked lesion , an optimum incision was made . after the complete removal of all surgical specimens , verified by mammographic or ultrasonographic study , hemoclips were placed on the four corners of the biopsy area and the wound was closed . clearance margins 1 mm and 5 mm were accepted for invasive cancer and ductal carcinoma in situ ( dcis ) respectively . patients ' characteristics , radiological abnormalities , radiological localization technique , localization time , operation time , weight of the excised specimen , clearance margins , pathological diagnosis , perioperative complications and hospital stay were recorded . categorical variables including radiological abnormalities , radiological localization technique , clearance margins , pathological diagnosis and perioperative complications were analyzed using the chi - square method , and continuous variables including age , localization time , operation time , weight of the excised specimen were analyzed with the student t - test or mann whitney u - test . the roll group included 1 male and 55 female with a mean age of 45 years ( range 2561 years ) , whereas the wgl group consisted of 52 females with a mean age of 47 years ( range 3472 years ) . there was no significant difference in the age of the patients between the two groups ( p = 0.15 ) . a total of 24 patients presented with a non - palpable image showing a mass , microcalcifications were present in 29 patients , and asymmetric density in 3 patients in the roll group , compared with 22 , 24 and 6 patients for the wgl groups respectively . however , there were no statistically significant differences between the two groups regarding radiological abnormalities ( p = 0.51 ) . thirty - one roll patients were localized with us and 25 by stereotactic technique ; this compared with 21 and 31 patients , respectively , in the wgl group , and there was no significant difference between the two groups in terms of the radiologic localization technique ( p = 0.13 ) . the localization time was significantly reduced with the roll group compared with 15 min and 23 min for wgl groups ( p = 0.001 ) . the localization time lasted a median of 18 min with mammography and 13 min with us in the roll group , compared with 30 min and 13 min for the wgl group . localization time was significantly decreased in roll patients when a mammography was used ( p = 0.001 ) . localization time was not different between the two groups when us was used ( p = 0.783 ) . the roll technique resulted in 100 % retrieval of the lesions and the wgl technique resulted in 98 % retrieval , as shown by the radiologic confirmation ( mammography or us ) of the breast specimen ( p = 0.503 ) . in 3 patients from the roll group ( 5.3 % ) , the lesionwas not confirmed by imaging the surgical specimen in the first excision , but performing a wider excision with a gamma probe guide resulted in the retrieval of the lesion during the same surgical procedure . a surgical field examination after lesion resection found no significant activity in all cases . in the wgl group , 4 patients needed intraoperative re - excision , and in one patient ( 2 % ) the lesion was not confirmed radiologically even though wider excision was made . the duration of surgical excision was 31 min on average ( range 15105 min ) in the roll group and 43 min on average ( range 20120 min ) in the wgl group . the length of the surgical procedure was significantly reduced with roll ( p = 0.001 ) . lesion localization by steorotaxy increased the duration of surgery compared with lesion localization with us ( p = 0.05 ) . the weight of the excised specimen was significantly lower in the roll group than in the wgl group : 14 g ( 2100 g ) versus 28 g ( 3175 g ) respectively ( p = 0.001 ) . no difference was found in the complication rate between the two groups ( p = 0.213 ) . in the roll group , twelve ( 21 % ) patients in the roll group and 14 ( 27 % ) in the wgl group had a cancer diagnosis , and the difference was not significant ( p = 0.505 ) . in the roll group , final pathological diagnosis showed invasive ductal carcinoma for 3 patients , dcis for 6 patients , dcis with invasive components for 2 patients and mucinous carcinoma for 1 patient . in the wgl group , final pathological diagnosis showed invasive ductal carcinoma for 2 patients , dcis for 7 patients , invasive lobular carcinoma for 1 patient and tubular carcinoma for 1 patient . the most frequent benign diagnosis was florid - type epithelial hyperplasia and fibrocystic changes . among cancer patients , a significantly larger number of wgl patients ( 6/14 ; 42.9 % ) had involved margins compared with 1/12 ( 8.3 % ) roll patients ( p = 0.05 ) . the patient with involved margins in the roll group had a mastectomy , which was her preference . three of the six patients with involved margins in the wgl group had to be offered a mastectomy because of the extensive nature of dcis . the clinical , radiological and pathological features of patients are presented in table 1 . among cancer patients with clear margins ,1 patient in the roll group and 2 patients in the wgl group had a mastectomy , which was their preference . the main goal of the successful management of non - palpable breast lesions is accurate preoperative localization for correct surgical biopsy . a hooked wire inserted under radiographic or us guidance has been the technique used most often to localize and remove occult breast lesions . because of several disadvantages of wire localization , new localization methods have been investigated . roll was developed as a new localization technique in 1997 , and the technique has been shown to be highly satisfactory and reliable for the localization of occult breast lesions ; it became routinely used at some institutes .14 clinically controlled trials have recommended radioguided surgery as an important tool in the removal of non - palpable breast lesions , as a simple , fast and feasible method that can be implemented in the clinical routine of patients with non - palpable breast lesions .13,1723 precise localization is the most important factor in the accurate surgical removal of clinically occult breast lesions . gennari et al. ,23 in their study with the roll technique , found that a suspicious lesion was found in 99.1 % of cases . de cicco et al. 16 concluded that roll enables the surgeon to remove occult breast lesions easily and reliably . the results in our series are similar to those studies , detecting suspicious lesions in 100 % of cases and finding the lesion within the surgical specimen in all cases with the roll technique . some studies that compared roll with wgl showed that roll was more precise than the hook wire procedure .13,21 in the present study , we did not find a difference between roll patients and wgl patients regarding the localization of the lesion . as mentioned below , we found roll as effective as wgl for the localization of occult breast lesions . the us or stereotactic method was used for localization in both roll and wg patients . in agreement with the literature , in the present study , without no significant difference between the radiologic localization of the occult lesions , the localization timewas significantly decreased with roll compared with wgl .13,21 in rampaul et al. 's 21 study , surgical and radiological difficulty was assessed using a likert scale , and roll was shown to be an easier procedure to perform than wgl both radiologically and surgically . similarly , in the present study , the duration of surgery was significantly reduced with the roll procedure . the use of a handheld probe allowed the surgeon to identify the hotspot easily in three dimensions . the probe is used as often as necessary during surgery to check the position of the lesion , and this makes the operation quicker . moreover , the radiological guided wire placement is a technically difficult procedure , particularly in dense breast tissue . moreover , when a hook wire is used , the surgeon must follow the path of the wire , which might not be a practical route for reaching the lesion . andsome 1520 % of patients who underwent a diagnostic biopsy of a non - palpable breast lesion showed malign findings . similar to the literature , in the present study , 21 % patients in the roll group and 27 % in the wgl group had a cancer diagnosis . surgical excision for non - palpable breast lesions requires a balance between excising a high rate of free tumor margins and a low rate of healthy tissue resection . in previous studies , surgical excision with hooked wire guidance has been reported with a high rate of 50 % involved margins .24 on the other hand , in comparison with hooked wire localization , the roll technique has shown a lower incidence of second surgery for involved margins due to better centering of the lesions and higher rates of free tissue margins .13,19,25 in the study by nadeem et al. ,13 a larger number of inadequate excisions were recorded with wgl , as 43 % of wgl patients had 1 mm safety margins versus 17 % in the roll group . similarly , in the present study among cancer patients , a significantly lower number ( 8.3 % ) of roll patients had involved margins compared with wgl patients ( 42.9 % ) . the roll technique associated with the intraoperative macroscopic examination of margins allows a low re - excision rate and spares normal breast tissue for an optimal surgical technique . if the pathologist was present in the operative room , checking for immediate margin involvement by the tumor might improve these results . compared with the literature , the specimen weight in our study is similar and the specimen weight in patients treated with wgl is larger than in patients treated with the roll procedure .13,19,21 recent series have confirmed better cosmetic results associated with smaller breast volumes excised with the roll technique .13,21,25 in our study , we did not evaluate the cosmesis , but it is suggested from other series that improved cosmesis might be associated with a smaller specimen weight volume excised . the other rationale for improved cosmetic results was that the roll procedure allowed an esthetic incision into the skin . although serious complications were described for the wgl procedure in the literature , there were no serious complications in the roll procedure . only a 15 % incorrect placement rate of the radiotracer has been described in the literature for the roll procedure .16,19,21 on the other hand , in the present study , there were no serious complications in either group , except for seroma and hematoma . in the present study , the roll technique has proved as reliable and effective as wgl in localizing non - palpable breast lesions . the roll technique appears to be superior to wgl in terms of localization time and duration of surgery , and it provides a higher percentage of tumor - free margin despite a lower average specimen weight . therefore , we suggest roll as an effective alternative to wgl in localizing occult breast lesions .\noutput:\n" }, { "from": "agent", "value": "aim : this prospective randomized clinical study was conducted to compare radioguided occult lesion localization ( roll ) with wire - guided localization to evaluate optimum localization techniques for non - palpable breast lesions.methods : a total of 108 patients who were undergoing an excisional biopsy for non - palpable breast lesions requiring pathologic diagnosis were randomly assigned to the roll group ( n = 56 ) and wire - guided localization group ( n = 52 ) . in the study , patients ' characteristics , radiological abnormalities , radiological technique of localization , localization time , operation time , weight of the excised specimen , clearance margins , pathological diagnosis and perioperative complications were assessed.results : there were no differences between the two groups in terms of age , radiological abnormalities and localization technique ( p = non - significant for all ) . roll techniques resulted in 100 % retrieval of the lesions ; for the wire - guided localization technique , 98 % . both localization time and operation time were significantly reduced with the roll technique ( p = significant for all ) . the weight of the specimen was significantly lower in the roll group than in the wire - guided localization group ( p = significant ) . the overall complication rate and pathological diagnosis were similar for both groups ( p = non - significant for all ) . clear margins were achieved in 91 % of roll patients and in 53 % of wire - guided localization patients , and the difference was significant.conclusions : the present study indicated that the roll technique is as effective as wire - guided localization for the excision of non - palpable breast lesions . in addition , roll improved the outcomes by reducing localization and operation time , preventing healthy tissue excision and achieving clearer margins ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: melorheostosis is a benign bone dysplasia affecting predominantly the appendicular skeleton and adjoining soft tissues . the diagnosis can be established on plain radiographs alone and advanced imaging modalities can be avoided . we hereby report a rare case of melorheostosis affecting the foot with a review of the role of various imaging modalities in diagnosis of this rare bone dysplasia . we present the case of a 29 years old man who was diagnosed with melorheostosis affecting his left foot . the patient presented to the outpatient department of our tertiary care referral hospital with complains of pain in the left ankle and foot with imaging and evaluation done at a primary center . the radiograph revealed an irregular , longitudinal extraosseous hyperostosis along the body of the calcaneum and the metacarpals which was consistent with the classical radiological description of melorheostosis . the purpose of this case report is to review the features of this rare disorder affecting the foot , on multiple imaging modalities and emphasizing the role of conventional radiology in its diagnosis . melorheostosis is a benign bone dysplasia affecting predominantly the appendicular skeleton and adjoining soft tissues . melorheostosis is derived from greek : melos = limb , rhein = to flow , ostos = bone . it is diagnosed as incidental radiographic finding in a patient who usually presents as chronic limb pain , swelling and rarely limitation of joint movement . it occurs sporadically and shows typical segmental distribution which has led to the understanding that it is a non - hereditary condition which most probably represents mixed sclerosing dysplasia with disturbance of endochondral and intramembranous ossification it commonly affects the lower extremity more than the upper . it has been characteristically described as a flowing hyperostosis resembling dripping candle wax as an incidental radiograph finding . the diagnosis can be established on plain radiographs alone and advanced imaging modalities can be avoided . we hereby report a rare case of melorrheostosis affecting the foot with a review of the role of various imaging modalities in the diagnosis of this rare bone dysplasia . a 29 yrs old male presented to the outpatient department of our hospital with complains of pain in the left ankle and foot for the past 6 months . on local examinationa radiograph of the foot was ordered which revealed irregular , longitudinal extraosseous hyperostosis appearing along the body of the calcaneum and predominantly the 3rd and 4th metatarsals which was consistent with the classical radiological description of melorheostosis - periosteal hyperostosis along the cortex of long bones , resembling the dripping or flowing of candle wax ( fig . l. classical appearances of melorheostosis affecting the left foot : anteroposterior and lateral radiograph demonstrates dense cortical and extra - cortical bone formation along the lateral aspect of the calcaneum and the 3rd and 4th metatarsal . the dripping candle wax appearance ) . the patient had been referred to our tertiary care centre from a primary health centre where he was already investigated with bone scan , computed tomography and mri . computed tomography revealed cortical hyperostosis of the calcaneum and metatarsals with hyperdense exuberant sclerotic lesions along the medial aspect of the calcaneum ( fig .2 . computed tomography shows cortical hyperostosis of the calcaneum and metatarsals with hyperdense exuberant sclerotic lesions along the medial aspect of the calcaneum encroaching into the medullary space characteristic of melorheostosis ) . on magnetic resonance imaging , these lesions appeared hypointense with thickened cortices on all imaging sequences confirming the sclerotic and hyperostotic nature of the tissue ( fig .3 : axial coronal and sagittal images showing thickened cortices which were hypointense all imaging sequences confirming the sclerotic and hyperostotic nature of the tissue , associated narrowing of the marrow canal was noted . the patient was treated with a course of analgesics and he responded well with decrease in the intensity of the pain . classical appearances of melorheostosis affecting the left foot : anteroposterior and lateral radiograph demonstrates dense cortical and extra - cortical bone formation along the lateral aspect of the calcaneum and the 3rd and 4th metatarsal . the dripping candle wax appearance computed tomography shows cortical hyperostosis of the calcaneum and metatarsals with hyperdense exuberant sclerotic lesions along the medial aspect of the calcaneum encroaching into the medullary space characteristic of melorheostosis mr imaging : axial coronal and sagittal images showing thickened cortices which were hypointense all imaging sequences confirming the sclerotic and hyperostotic nature of the tissue , associated narrowing of the marrow canal was noted . no other marrow or joint abnormalitymelorrheostosisis a rare benign , sclerosing mesodermal dysplasia that affects the skeleton and adjacent soft tissues , with an incidence of 0.9 cases per million affecting both sexes equally . it was first described by leri and joanny in 1922 who described it as hyperostose en coule i.e. flowing hyperostosis resembling candle wax . the most accepted theory is the classic theory of murray and mccredie which linked melorheostosis with thescleretomes and proposed that it might be the result of a segmental sensory lesion due to specific infection , insult , or injury to a segment or segments of the neural crest during embryogenesis . recently , hellemens et al have demonstrated that a loss - of - function mutation in lemd3 ( on chromosome 12q ) is associated with osteopoikilosis , bos , and melorheostosis . it predominantly affects the appendicular skeleton particularly the long bones of the upper and lower extremities , the lower limb being affected more commonly . there is a predilection for the diaphyseal and the epiphyseal regions of the long bones . a review of literature revealed that very few cases affecting the foot have been reported so far . the classical radiographic appearance is that of flowing cortical hyperostosis along one side of the shaft of the long bone resemblingmelting wax flowing down the side of a candle as described by moore et al . however , this classical textbook description is not seen in all cases . in one of the largest case seriesso far by freyschmidt et al , describing 23 patients with the disorder , the various radiological presentations included : osteoma - type ( 7cases ) , myositis ossificans type ( 1 case ) , osteopathiastriata - type ( 6 cases ) , classic ( 5 cases ) , and mixed type ( 4 cases ) . the common differential diagnoses of the radiographic appearance include chronic osteomyelitis , myositis ossificans , osteopetrosis , osteopoikilosis , osteopathiastriata and infantile cortical hyperostosis . bone scintigraphy demonstrates intense asymmetric cortical radionuclide uptake that may cross articulations to involve adjacent bones . owing to their hyperostotic nature , it can rarely be associated with soft tissue masses . a study by judkiewicz et al . described the appearance of these associated soft tissue masses as heterogeneous signal intensity on all mri images due to a mixture of mineralized , non - mineralized fibrovascular tissue with variable collagen content and fat . interestingly , these masses showed mild to moderate post contrast enhancement simulating aggressive neoplastic lesions . in one of the cases , the soft tissue findings were more conspicuous than the osseous changes of melorheostosis leading to an erroneous diagnosis of sarcoma . melorheostosis is a rare disorder and only a few cases affecting the foot have been described . although it is a benign dysplasia , it can cause significant morbidity . as clinical radiologists , awareness of the various clinical and radiological presentations can significantly contribute to the appropriate management of these patients . our case report describes one such uncommon case affecting the foot and highlighting the imaging features of this benign dysplasia on various imaging modalities . although advanced imaging with ct and mri complements the finding of convention radiography , if used as a primary imaging modality mri can lead to overdiagnosis of this benign condition as an aggressive neoplastic lesion ; reiterating the importance of conventional radiography in the diagnosis . in bone neoplasms , imaging by ct , mri and pet scans are used primarily to determine its extent and spread ; not for diagnosis , except as complementary to conventional radiography in few perplexing cases . if used for diagnosis without conventional plain radiography , erroneous diagnosis of malignant neoplasm would be made for benign bone lesions like melorheostosis , thereby leading to wrong and aggressive management . thus , conventional radiography forms the main stay in diagnosis of bone neoplasms and awareness of the diverse manifestation of bone neoplasms will significantly contribute to appropriate management .\noutput:\n" }, { "from": "agent", "value": "introduction : melorheostosis is a benign bone dysplasia affecting predominantly the appendicular skeleton and adjoining soft tissues . the diagnosis can be established on plain radiographs alone and advanced imaging modalities can be avoided . we hereby report a rare case of melorheostosis affecting the foot with a review of the role of various imaging modalities in diagnosis of this rare bone dysplasia.case report : we present the case of a 29 years old man who was diagnosed with melorheostosis affecting his left foot . the patient presented to the outpatient department of our tertiary care referral hospital with complains of pain in the left ankle and foot with imaging and evaluation done at a primary center . the radiograph revealed an irregular , longitudinal extraosseous hyperostosis along the body of the calcaneum and the metacarpals which was consistent with the classical radiological description of melorheostosis . the ct , mri and bone scan findings corroborated our primary diagnosis.conclusion : the purpose of this case report is to review the features of this rare disorder affecting the foot , on multiple imaging modalities and emphasizing the role of conventional radiology in its diagnosis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the tiny protrusions emerging from dendrites known as dendritic spines are the primary subcellular locations of excitatory synapses in the mammalian central nervous system . dendritic spines are typically ~ 1 - 2 m in length and 0.51 m in width of the spine head , with diverse morphologies , such as mushroomlike , stubby , and thin spines . these structures are mainly supported by the f - actin cytoskeleton . thus , f - actin cytoskeletal proteins and regulators are important factors for generating dendritic spines . many membrane proteins and adaptor and signaling molecules are also involved in controlling dendritic spine formation and maintenance . the most popular mechanism is that dendritic filopodia serve as precursors for dendritic spine formation . interestingly , filopodia are ubiquitously found on various cell types . in contrast , dendritic spines are neuron - specific structures . thus , the transition from filopodia to spines should be controlled by neuron - specific factors . these proteins or responses directly or indirectly regulate f - actin rearrangement and dynamics to promote dendritic spine formation . studies of cytoskeleton - associated cortactin - binding protein 2 ( cttnbp2 ) and heparan sulfate transmembrane proteoglycan ( hspg ) syndecan - 2 serve as examples for these two categories , respectively . cttnbp2 is a neuron - specific cytoskeleton - associated protein and that is enriched at dendritic spines of mature neurons . although syndecan - 2 is widely expressed in many cell types , it is highly concentrated at synapses in neurons . syndecan - 2 cooperates with other proteins to trigger neurotransmission through a neuron - specific signal to induce dendritic spine formation . genomic analyses of patients with autism spectrum disorders ( asds ) indicated that both cttnbp2 and syndecan - 2 were associated with asds . additionally , neurofibromin , cask , and vcp coordinate with syndecan - 2 to control dendritic spinogenesis and were also associated with neurological disorders . these findings suggest that these genes are critical for neuronal function , likely through their regulation of dendritic spine formation . in this review , we will summarize the functions of these proteins in dendritic spinogenesis and use these proteins as examples to discuss how neuron - specific molecules coordinate with ubiquitously expressed proteins to generate neuron - specific signals for dendritic spine formation . syndecan - 2 is a type i membrane protein with a heparan sulfate modification at its ectodomain ( figure 1 ) . in mammals , the syndecan protein family contains four members , syndecan - 1 , syndecan - 2 , syndecan - 3 , and syndecan - 4 . in rodent brains , syndecan - 2 and syndecan - 3 are the two major syndecans expressed in neurons with differential distribution ; syndecan - 2 is highly concentrated at synapses , while syndecan - 3 is distributed along the axonal shaft . syndecan - 2 is involved in cell - cell and cell - matrix interactions through its heparan sulfate modification . it can also bind growth factors , such as fibroblast growth factor ( fgf ) and epidermal cell growth factor , and it acts as a coreceptor for these growth factors . syndecan - 2 is broadly and dynamically expressed in several tissues and cell types . during neural development , its expression gradually increases concurrent with synapse formation . in mature neurons , such as cultured rat hippocampal neurons at 18 days after plating in vitro ( div ) or latermore importantly , overexpression of syndecan - 2 in immature rat hippocampal cultured neurons , such as 1 - 2 div , when endogenous syndecan - 2 is not yet expressed , dendritic filopodia are massively induced at 4 - 5 div and dendritic filopodia are then transformed to dendritic spines at 8 - 9 div . those dendritic spines are expected to be functional , as they are adjacent to the presynaptic marker synaptophysin based on confocal microscopy . syndecan -2-induced dendritic spinogenesis serves as a model to explore the mechanisms underlying the initiation of dendritic spinogenesis ( namely , dendritic filopodia formation ) , the transition from filopodia to spines , and dendritic spine maturation and maintenance . the ectodomain of syndecan - 2 heparan sulfate modification is involved in cell - cell and cell - matrix interactions . its transmembrane domain is required for homodimerization or oligomerization , which is critical for the protein - protein interactions of syndecan - 2 . the cytoplasmic domain of syndecan - 2 contains only 32 amino acid residues ( figure 1 ) . although it is short , it is divided into three motifs , conserved domain 1 ( c1 ) , the variable region ( v ) , and conserved domain 2 ( c2 ) . the c1 and c2 motifs are conserved among different syndecans , while the sequences of the v regions vary ( figure 1 ) . the c1 motif is essential for syndecan -2-induced dendritic filopodia formation of rat hippocampal cultured neurons , as the syndecan - 2c1 mutant completely loses the ability to promote filopodia formation and spine formation at 5 as well as 9 div . the c2 is required for the dendritic filopodia - spines transition and dendritic spine maintenance . expression of the c2 deletion mutant syndecan - 2c2 at 2 div promotes dendritic filopodia formation at 5 div . however , those filopodia are unable to transform into dendritic spine at 9 div . these analyses indicate that the function of syndecan - 2 in dendritic spinogenesis can be separated into two sequential steps , namely , filopodia and spine formation , which are controlled by two distinct motifs in syndecan - 2 . because both c1 and c2 motifs are short and lack recognizable enzymatic domains , syndecan - 2 binding partners have been identified to determine its molecular mechanism underlying dendritic spine formation . several direct binding partners ( summarized in table 1 ) have been identified for the c1 domains of syndecan - 2 , including neurofibromin and ezrin . , the interactions between syndecan - 2 and neurofibromin and cask have been shown to be relevant in dendritic spine formation . because the cytoplasmic tail of syndecan - 2 is very short , it is unlikely that a single syndecan - 2 molecule can simultaneously interact with all of its binding partners . because the c1 and c2 motifs are involved in two sequential processes , it is likely that neurofibromin and cask sequentially interact with syndecan - 2 . alternatively , it is possible that because syndecan - 2 forms at least a dimer through its transmembrane domain , different syndecan - 2 molecules in dimers or oligomers separately interact with neurofibromin and cask . this would suggest that syndecan - 2 , neurofibromin , and cask form a single large complex . neurofibromin encoded by the neurofibromatosis type i ( nf1 ) gene is characterized by its rasgap - ( ras gtpase activating protein - ) related domain ( grd ) ( figure 2 ( a ) ) . similar to syndecan - 2 , neurofibromin is widely expressed in different cell types , though its expression level is much higher in the nervous system . nf1 is one of the most common human inherited disorders featured by changes in skin pigmentation , benign tumor growth , and learning difficulty . in addition to its ras activity , neurofibromin can increase camp concentration by activating adenylate cyclase . although the molecular mechanisms are less clear , the grd and c - terminal region of neurofibromin are required for camp pathway activation ( figure 2 ( a ) ) . both gs - dependent and gs - independent pathways are involved in neurofibromin - regulated adenylate cyclase activation . the camp pathway has been shown to be involved in learning and memory in drosophila and dendritic spine formation in the mammalian nervous system . in a yeast two - hybrid screen using different fragments of neurofibromin as baits , syndecan - 2 was identified as a neurofibromin binding partner . one is the jn fragment corresponding to amino acid residues 13571473 in the grd of human neurofibromin ; the other is the pn fragment containing amino acid residues 26192719 ( figure 2 ( a ) ) . in addition to biochemical studies demonstrating the direct interaction between syndecan - 2 and neurofibromin , fluorescence immunostaining further demonstrated the colocalization of syndecan - 2 and neurofibromin at synapses in cultured hippocampal neurons . moreover , both nf1 knockdown and haploinsufficiency reduce the density of dendritic spines in both rat hippocampal and mouse cortical cultured neurons and in brains , consistent with a function of neurofibromin in regulating dendritic spine formation . one study examined syndecan - 2 downstream signaling for triggering filopodia formation . using a panel of inhibitors to suppress various kinase activities , protein kinase a ( pka ) was identified to be required for syndecan -2-induced filopodia formation . combined with the analysis using different motif deletion mutants of syndecan - 2 , we found that the c1 motif of syndecan - 2 is essential for pka - dependent filopodia formation . because neurofibromin interacts with the c1 motif and also activates the camp pathway , cultured hippocampal neuronswere then used to investigate whether neurofibromin mediates syndecan -2-induced filopodia formation . both nf1 knockdown and jn fragment expression , which acts as a dominant - negative to disrupt the interaction between endogenous neurofibromin and syndecan - 2 , thus , neurofibromin mediates the signal from syndecan - 2 to the camp pathway to initiate dendritic spinogenesis . because filopodia are supported by f - actin bundles , the syndecan -2-neurofibromin - camp pathway has to induce f - actin polymerization and bundle formation to promote dendritic filopodia formation . the ena ( enabled ) / vasp ( vasodilator - stimulated phosphoprotein ) protein family is a group of f - actin regulators that initiate actin polymerization and bundling . pka phosphorylation promotes ena / vasp protein activity to regulate the f - actin cytoskeleton . upon syndecan - 2 overexpression , ena / vasp phosphorylation increases , consistent with camp pathway activationmoreover , disruption of ena / vasp activity impairs syndecan -2-induced dendritic filopodia formation . in summary , these studies indicate that syndecan - 2 overexpression enhances the ability of neurofibromin to activate the pka pathway , which then induces the ena / vasp activity to promote f - actin bundling and filopodia formation . although the pka pathway is required for dendritic filopodia formation , increased intracellular camp concentrations alone can not induce dendritic filopodia formation , suggesting that other factor ( s ) are involved . from an immunoprecipitation - mass spectrometry study , valosin - containing protein ( vcp , also known as p97 ) was identified as a neurofibromin - binding protein . the entire d1 and d2 atpase domains of vcp are required for the interaction with the leucine - rich domain ( lrd ) of neurofibromin . vcp is a causative gene of inclusion body myopathy associated with paget 's disease of bone and frontotemporal dementia ( ibmpfd ) . in addition , vcp mutations are associated with asds and amyotrophic lateral sclerosis . a combination of human genetic studies , mouse genetic models , and cultured hippocampal and cortical neurons have indicated that neurofibromin interacts with vcp and guides vcp to promote dendritic spinogenesis . the roles of vcp and neurofibromin in dendritic spine formation may account for the neural phenotypes in patients with mutations in the nf1 and vcp genes . however , it is still unclear how vcp regulates dendritic spine formation . to fully address the molecular regulation of neurofibromin and vcp in dendritic spinogenesis , the function of the syndecan -2-neurofibromin interaction in dendritic spine formation is summarized in figure 2 ( b ) . mutations in the human cask gene result in x - linked mental retardation and microcephaly with pontine and cerebellar hypoplasia . cask belongs to the membrane - associated guanylate kinase ( maguk ) family and functions as a scaffold protein to interact with more than two dozen cellular proteins . it is widely distributed in neurons , including synapses , dendrites , axons , and soma . at synapses , pontine explants and rat hippocampal cultured neurons , cask knockdown impairs synapse formation at the pre - and postsynapse , respectively . at presynaptic sites , it binds the membrane protein neurexin and other scaffold proteins , such as mint1 , mlin7 , and liprin , to control presynaptic button formation . cask uses its pdz domain at the postsynaptic site to interact with the c2 motif of syndecan - 2 . in cultured hippocampal neurons , expression of the pdz alone of cask or the c - terminal tail of syndecan - 2 that disruptsthe interaction between endogenous cask and syndecan - 2 reduces dendritic spine density , narrows spine heads , and shortens spine length at 18 div , suggesting that the cask - syndecan - 2 interaction is critical for dendritic spine formation . to investigate whether cask is involved in dendritic spinogenesis initiation or dendritic spine stabilization , a time course study using a knockdown approach in cultured hippocampal neuronsthe time window of 1518 div covering the initiation toward maturation of dendritic spinogenesis was used for analysis . at 15 div , wild - type dendritic spines are immature , long , and thin , and they are present at a low density . as they mature at 18 div , dendritic spine density increases , spine length decreases , and spine width increases . compared to control neurons , cask knockdown does not affect spine density , length , or size at 15 div , suggesting that cask is not critical for dendritic spinogenesis initiation . at 18 div , the data indicate that cask is important for dendritic spine maturation , likely by linking the membrane protein syndecan - 2 to the f - actin cytoskeleton via protein 4.1 to stabilize dendritic spines ( figure 3 ) . in human embryonic kidney hek293 cells , syndecan - 2however , these filopodia can not mature into spines . because neurofibromin and cask are also expressed in hek293 cells , the aforementioned studies can not explain why syndecan -2-induced dendritic spines are only present in neurons . a neuron - specific factor must be present to control dendritic spine formation . because neurotransmission is a neuron - specific event andbecause dendritic filopodia are able to receive neurotransmission signals from presynaptic buttons , neurotransmission seems a likely factor that triggers the filopodia - spines transformation in a neuron - specific manner . indeed , egta treatment to chelate extracellular calcium or ap5 treatment to block nmdar activity , a major neurotransmitter gated calcium channel , impairs the endogenous filopodia - spines transition at 1517 div and syndecan -2-induced filopodia - spines transition at 59 div . in syndecan -2-overexpressing neurons , intracellular calcium concentration is increased compared to control neurons at 5 div . this increase is due to nmdar - regulated calcium influx because ap5 treatment effectively reduced the intracellular calcium concentration induced by syndecan - 2 . the c2 motif of syndecan - 2 is required for syndecan - 2 overexpression - induced calcium influx , suggesting that the interaction with cask is involved in calcium influx . previous studies have shown that cask interacts with mlin7 via the l27 domains in both proteins and that mlin7 interacts with the c - terminal tail of nmdar subunit 2b ( nmdar2b ) through its pdz domain . the interaction between syndecan - 2 , cask , mlin7 , and nmdar2b facilitates nmdar localization to the tips of dendritic filopodia , where nmdar may be activated by presynaptic stimulation , namely , glutamate , and induce calcium influx . disruption of the syndecan - 2 , cask , mlin7 , and nmdar complex by overexpressing the interacting domains impairs nmdar filopodial distribution , calcium influx , and the filopodia - spines transition , suggesting that syndecan - 2 triggers calcium influx via the cask - mlin7 - nmdar complex and induces the filopodia - spines transition ( figure 3 ) . the morphological feature of the filopodia - spines transition is dendritic spine head enlargement and spine length shortening . calcium is known to regulate f - actin dynamics in dendritic spines , and gelsolin is a calcium - activated f - actin regulator . gelsolin deficiency impairs filopodial retraction of developing neurons and inhibits activity - dependent f - actin remodeling in mature dendritic spines . it is also critical for the filopodia - spines transition induced by the syndecan -2-cask - mlin7 - nmdar complex , as gelsolin knockdown maintains syndecan -2-induced protrusions at the filopodial stage . it is possible that other calcium regulated f - actin regulators also act downstream of syndecan - 2 to control the filopodia - spines transition . more investigations are required to further elucidate the regulation . through its interactions with intracellular binding partners , the ubiquitously expressing protein syndecan - 2 modulates the f - actin cytoskeleton , triggers neurotransmission , and promotes neuron - specific synapse formation . from dendritic filopodia formation , filopodia - spines transition to dendritic spine maturation , syndecan - 2 interacts with different binding partners to control f - actin behaviors . syndecan - 2 first activates the pka pathway via neurofibromin to promote f - actin polymerization and bundling for dendritic filopodia formation . it recruits nmdar to filopodial tips through its interaction with the cask - mlin7 complex and increases the postsynaptic responsiveness to presynaptic stimulation . calcium influx induces f - actin cytoskeleton rearrangement to allow for the morphological change from filopodia to spines . to further promote dendritic spine maturation and maintenance , syndecan - 2 binds to the protein 4.1 through interactions with cask . throughout the entire process , neuron specificity falls within nmdar - mediated calcium influx , which induces f - actin cytoskeleton remodeling to result in morphological changes to the dendritic spine . these studies provide a comprehensive example of how a neuron - specific ion channel coordinates with other adhesion molecules and synaptic proteins to control dendritic spine formation . to identify a neuron - specific f - actin regulator involved in dendritic spinogenesis , we searched the database and literature and focused on cortactin - binding protein 2 ( cttnbp2 ) . cttnbp2 gene encodes a brain - specific protein that interacts with the sh3 domain of cortactin through its proline - rich domain . cortactin promotes and stabilizes f - actin branching and thus plays a critical role for dendritic spine morphological maintenance . because cortactin is a ubiquitously expressed protein , its function in controlling dendritic spinogenesis must be regulated by a neuron - specific factor . the specific expression of cttnbp2 in the brain makes it a good candidate to control cortactin in dendritic spinogenesis . furthermore , de novo mutations in the cttnbp2 gene have been repeatedly identified in asd patients . in a genomic analysis covering 3871 asd patients , results indicated that cttnbp2 is a high - confidence risk factor for asds with a false discovery rate less than 0.05 % . these genetic data support a critical role for cttnbp2 in brain development and function . in the expression tag sequence ( est ) database ( http://www.ncbi.nlm.nih.gov/ ) , three variants have been identified as cttnbp2 transcripts , namely , cttnbp2 - short ( cttnbp2 - s ) , cttnbp2 - intron ( cttnbp2 - i ) , and cttnbp2 - long ( cttnbp2 - l ) . based on the nucleotide sequence , the first 625 predicted amino acid residues are shared among all variants . using an antibody against the common region of the cttnbp variants , immunoblotting revealed that the short form of cttnbp2 is the predominant protein product in brains . it is still unclear whether the cttnbp2 - i and cttnbp2 - l variants play any role in neurons . therefore , mutation analysis of asd patients is meaningful when the mutation was located within the cttnbp2 - s variant sequences . seven de novo asd mutations in the cttnbp2 gene have been identified in the exons encoding cttnbp2 - s . to further explore the association of cttnbp2 with asd , these mutations should be investigated in detail to determine their effects on cttnbp2 molecular function and neuronal morphogenesis . analysis of the amino acid sequence of cttnbp2 - s predicts a coiled - coil domain at the n - terminal region and proline - rich domain at the c - terminus . the n - terminal coiled - coil domain mediates cttnbp2 - s homooligomerization and heterooligomerization of cttnbp2 - s and the striatin family . both endogenous cttnbp2 - s and overexpressed myc - tagged cttnbp2 - s were found to be highly concentrated at dendritic spines in mature cultured hippocampal neurons . immunofluorescence analysis of adult brains also indicated that cttnbp2 - s colocalized with f - actin puncta in vivo , presumably to dendritic spines . cttnbp2 - s is critical for dendritic spine formation , as cttnbp2 knockdown right before dendritic spinogenesis at 12 div reduces spine density and spine head width measured at 18 div . consistent with the morphological changes , the frequency of mepsc ( miniature excitatory postsynaptic synaptic current ) is lower in cttnbp2 knockdown neurons at 18 div . in addition to dendritic spine formation , cttnbp2 - s is involved in dendritic spine maintenance , as cttnbp2 - s knockdown in mature neurons , such as 20 div , still reduces dendritic spine density at 26 div . cortactin is required for cttnbp2 - s 's regulation of dendritic spinogenesis , as a cttnbp2 - s mutant that can not interact with cortactin can not rescue cttnbp2 knockdown - induced spine deficiency . moreover , fluorescence recovery after photobleaching ( frap ) analysis indicates that cttnbp2 - s regulates cortactin mobility in mature dendritic spines . in the presence of cttnbp2 - s , the data suggest that cttnbp2 - s retains cortactin in dendritic spines and controls dendritic spine formation and maintenance . the striatin protein family contains three mammalian members , namely , striatin , zinedin , and sg2na . they function as b - type regulatory subunits of protein phosphatase 2a ( pp2a ) to control pp2a subcellular location and substrate specificity . striatin protein distribution to synapses is mediated by its interactions with cttnbp2 - s through the n - terminal coiled - coil domains of both cttnbp2 - s and striatin family members . , cttnbp2 - s regulates f - actin dynamics and pp2a signaling at dendritic spines . in cos cells , exogenous cttnbp2 - s was unexpectedly associated with the microtubule cytoskeleton in addition to the cortactin - f - actin cytoskeleton . cell - matrix interactions influence the cytoskeleton association of cttnbp2 - s . in cos cells , cttnbp2 - scttnbp2 - s gradually shifts its preference to the microtubule cytoskeleton when establishing cell - matrix interactions . cttnbp2 - s is highly concentrated at dendritic spines in mature neurons where cttnbp2 - s interacts with f - actin cytoskeletons . in the premature stageswhen dendritic spines have not yet formed , cttnbp2 - s is already expressed and forms puncta attached on microtubule bundles along the dendritic shaft . the mid domain is required for the association of microtubule , and the n - terminal coiled - coil domain is involved in cttnbp2 - s oligomerization . oligomerization allows the cttnbp2 - s oligomer to contain multiple microtubule binding sites to induce microtubule bundling . during the dendritic extension stage , cttnbp2 - s knockdown or disruption of microtubule bundling by overexpression of the n - terminal coiled - coil domain or mid domain impairs dendritic arborization . the studies suggest that , in addition to controlling the f - actin cytoskeleton , cttnbp2 - s regulates microtubule stability to influence dendrite morphology . the dual roles of cttnbp2 - s in controlling f - actin and the microtubule cytoskeletons require further investigation . as a neuron - specific morphology regulator and a high - confidence risk factor for asdsfor instance , what is the molecular mechanism regulating the association between cttnbp2 - s and f - actin and microtubules ? are the associations of cttnbp2 - s with f - actin and microtubules mutually exclusive ? alternatively , can cttnbp2 - s act as a bridge to link f - actin and microtubules ? only cultured hippocampal neurons have been examined in functional studies of cttnbp2 - s . in the future , in vivo studies should be considered . particularly , to address the association of cttnbp2 with asds , a mouse genetic model is required . the impact of cttnbp2 asd mutations on the molecular function of cttnbp2 - s , brain development , and cognition must be studied to further understand the biological significance of cttnbp2 . although hundreds of genes are involved in dendritic spine formation , they should be either neuron - specific or directly or indirectly controlled by or linked to neuron - specific signaling or proteins to specifically regulate dendritic spine formation in neurons . in this review , syndecan -2-induced dendritic spine formation and the role of cttnbp2 - s in controlling neuronal morphology provide two distinct examples of how neuronal morphology can be regulated in a neuron - specific manner . understanding these regulations is crucial for basic research and for understanding neurological disorder etiology , which could contribute to potential therapeutic treatments of the diseases .\noutput:\n" }, { "from": "agent", "value": "dendritic spines are the location of excitatory synapses in the mammalian nervous system and are neuron - specific subcellular structures essential for neural circuitry and function . dendritic spine morphology is determined by the f - actin cytoskeleton . f - actin remodeling must coordinate with different stages of dendritic spinogenesis , starting from dendritic filopodia formation to the filopodia - spines transition and dendritic spine maturation and maintenance . hundreds of genes , including f - actin cytoskeleton regulators , membrane proteins , adaptor proteins , and signaling molecules , are known to be involved in regulating synapse formation . many of these genes are not neuron - specific , but how they specifically control dendritic spine formation in neurons is an intriguing question . here , we summarize how ubiquitously expressed genes , including syndecan - 2 , nf1 ( encoding neurofibromin protein ) , vcp , and cask , and the neuron - specific gene cttnbp2 coordinate with neurotransmission , transsynaptic signaling , and cytoskeleton rearrangement to control dendritic filopodia formation , filopodia - spines transition , and dendritic spine maturation and maintenance . the aforementioned genes have been associated with neurological disorders , such as autism spectrum disorders ( asds ) , mental retardation , learning difficulty , and frontotemporal dementia . we also summarize the corresponding disorders in this report ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: an excellent orthodontic treatment result with optimal occlusion and ideal intercuspation , overjet and overbite is often jeopardized by tooth size discrepancies ( tsds ) or problematic tooth anatomy . a tsd conventionally has been described as a relative excess of tooth structure in one arch in relation to the other arch . there have been several studies suggesting methods of defining and measuring tsd , but the best known study of tooth size disharmony in relation to treatment of malocclusion was by bolton who evaluated 55 cases with excellent occlusions and developed two ratios for estimating tsd by measuring the summed mesiodistal widths of the mandibular to the maxillary anterior teeth ( anterior ratio 77.21.65 % ) and the total width of all lower to upper teeth from first molar to first molar ( overall or total arch ratio 91.31.91 % ) . one way for clinicians to get a better feel for the clinical significance of a discrepancy is to focus more on the actual size of the discrepancy than on the bolton 's ratios alone . he also suggested that a quick check for anterior tsd can be done by comparing the size of upper and lower lateral incisors . for posterior tsd , he recommends that a quick visual check be done by comparing the size of upper and lower second premolars , which should be of approximately equal size . many studies have been carried out to determine the prevalence of tsd in various populations . this is because orthodontists have realized the importance of this subject . mclaughlin , trevisi and bennett have suggested it to be referred to as the seventh key of normal occlusion . the aims and objectives of the present study were to investigate the following : what percentage of a representative north indian orthodontic population has a tsd?how much tsd matters clinically in millimeters?is simple visual estimation a good method for clinical use ? how much tsd matters clinically in millimeters ? is simple visual estimation a good method for clinical use ? pretreatment study casts of 150 orthodontic patients reporting to the department of orthodontics , pdm dental college , bahadurgarh , were used in this study ; 81 study casts were of males and 69 were of females and the sample included random selection of malocclusion . the following inclusion criteria were used in the selection of the study models : good quality study models.all the permanent teeth were fully erupted and present , from right first permanent molar to the left first permanent molar.no extraction or interproximal stripping was performed.no obvious interproximal or occlusal wear of teeth . all the permanent teeth were fully erupted and present , from right first permanent molar to the left first permanent molar . the following were the exclusion criteria : broken study models.gross restorations , build - ups , crowns , onlays , class ii amalgams or composite restorations that affect the tooth mesiodistal diameter.congenitally missing impacted and grossly carious teeth . gross restorations , build - ups , crowns , onlays , class ii amalgams or composite restorations that affect the tooth mesiodistal diameter . measurement was made directly on the study models by using the electronic digital calipers accurately to 0.01 mm with fine tips to improve the access into the interproximal distance [ figure 1 ] . the width of each tooth was measured from its mesial contact point to its distal contact point at its greatest interproximal distance from first molar to the first molar with the calipers held perpendicular to the long axis of each tooth . contact points were defined as the points on the approximate surfaces which should be touching when the teeth were perfectly aligned . each sample was measured by two operators ( rs and sk ) and the average value was recorded . all the measurements of each tooth from first molar to first molar were then transferred to the data sheets . the overall sum of maxillary and mandibular teeth ( 6 to 6 ) and the sum of the anterior maxillary and mandibular teeth ( 3 to 3 ) were calculated using microsoft excel program . the total and anterior ratios were determined by bolton 's formula : calibration of the mesiodistal widths of teeth from study cast bolton 's ratios were used as guidance in this research ( 91.31.91 % for the total ratio and 77.21.65 % for the anterior ratio , respectively ) . for comparison with the measurements , simple visual estimation of tsdwas also carried out in accordance with proffit 's suggestions . each investigator ( rs and sk ) each of them measured 10 study casts twice which were randomly selected from the main study group with a week between the measurements . after the measurements corresponding to the sum of mesiodistal widths for the 6 maxillary and mandibular anterior teeth and 12 maxillary and mandibular teeth were obtained , their distribution was evaluated and all the data were demonstrated to come from a normally distributed population . pearson correlation coefficient was used to measure the intra - operator reproducibility and inter - operator reproducibility . student 's paired t - test was used for the assessment of the systematic error ( the mean difference between the repeated measurements ) and the random error ( the standard deviation of the difference ) . to determine whether there were gender differences in the incidence of the tooth size ratios and discrepancies , an independent - sample t - test was performed . statistical analyses were carried out using statistical package for social sciences ( spss ) version 10.0 . each investigator ( rs and sk ) was tested for their intra - examiner reproducibility of the method of measurement . each of them measured 10 study casts twice which were randomly selected from the main study group with a week between the measurements . after the measurements corresponding to the sum of mesiodistal widths for the 6 maxillary and mandibular anterior teeth and 12 maxillary and mandibular teeth were obtained , their distribution was evaluated and all the data were demonstrated to come from a normally distributed population . pearson correlation coefficient was used to measure the intra - operator reproducibility and inter - operator reproducibility . student 's paired t - test was used for the assessment of the systematic error ( the mean difference between the repeated measurements ) and the random error ( the standard deviation of the difference ) . to determine whether there were gender differences in the incidence of the tooth size ratios and discrepancies , an independent - sample t - test was performed . statistical analyses were carried out using statistical package for social sciences ( spss ) version 10.0 . the intra - examiner systematic and random errors for both examiners are detailed in table 1a ( sk ) and table 1b ( rs ) . there was no significant difference found between the two examiners and the correlation coefficient was also relatively high . intra - examiner reproducibility observer sk intra - examiner reproducibility observer rs inter - examiner reproducibility observers sk and rs table 3 summarizes the mean for male and female , mean differences and statistical comparisons of the tooth size ratios . it shows that there was no significant sexual dimorphism for any of the parameters ; therefore , the sexes were combined for all other analyses . descriptive comparison for male and female tables 4a and b compare the sample with bolton 's original samples . the mean ratios for the orthodontic patients of the present study were slightly higher than bolton 's value and had a larger range than his sample of excellent occlusion . graph 1 shows the distribution of anterior tooth - width ratios in this study categorized by bolton 's original means and standard deviations ( sd ) .24 % of the sample had anterior tooth - width ratios greater than 2 sd from bolton 's mean ( 22 % greater than + 2 sd and 2 % less than 2 sd ) . this shift to the right compared with bolton 's results demonstrates relatively more mandibular tooth width . for the overall ratio , the percentage falling more than 2 sds from bolton 's mean was 8 % of the sample ( 2 % greater than + 2 sd and 6 % less than 2 sd ) . comparison of bolton 's study and the present study : anterior ratio comparison of bolton 's study and the present study : overall ratio anterior bolton 's ratios : the distribution ( percentage ) of subjects in this study categorized by the standard deviations of bolton 's original study overall bolton 's ratios : the distribution ( percentage ) of subjects in this study categorized by the standard deviations of bolton 's original study graphs 3 and 4 show the percentages of subjects in terms of the upper and lower corrections in millimeters which would be required to give the mean ratio for bolton 's original sample . in these figures , a negative ( ) sign on the x axis indicates relative tooth size deficiency and the correction is to be done by increasing the tooth structure , whereas the positive ( + ) sign indicates relative tooth size excess requiring correction by reducing the tooth structure . for the anterior analysis [ graph 3 ] , 36 % of the sample needed upper correction more than 1.5 mm and 24 % needed upper correction more than 2 mm while the corresponding figures for the lower arch were 32 % and 14 % , respectively . for anterior arch correction , the white columns ( required upper arch correction ) are all taller on the negative side of the graph , suggesting maxillary tooth deficiency , and it is vice versa on the positive side , suggesting mandibular tooth excess . for total arch correction , the white columns ( required upper arch correction ) are almost similar on the negative and positive sides of the graph than the corresponding black columns ( required lower arch correction ) . for the total arch analysis [ graph 4 ] , 46 % of the sample needed upper correction more than 1.5 mm and 36 % needed upper correction more than 2 mm while the corresponding figures for the lower arch were 46 % and 32 % , respectively . this indicates for the tooth arch relative tsds are almost equally distributed amongst the maxillary and mandibular arches . percentages of subjects by upper and lower correction in millimeters for anterior correction percentages of subjects by upper and lower correction in millimeters for total ( whole arch ) correction table 5 summarizes the sensitivity and specificity results of this study . the caliper measurements were taken as the best estimate of the true ( gold standard ) bolton 's ratio . for all discrepancies , there was low sensitivity ( 17.94 % for 1.5 mm , 39.21 % for 2 mm and 45.45 % for 3 mm ) and higher specificity ( 85.7 % for 1.5 mm , 78.29 % for 2 mm and 75.8 % for 3 mm ) . sensitivity and specificity tests for tsd more than 2 mm and 3 mm , comparing visual judgment ( eyeball estimation ) with digital calipers measurementthe intra - examiner systematic and random errors for both examiners are detailed in table 1a ( sk ) and table 1b ( rs ) . there was no significant difference found between the two examiners and the correlation coefficient was also relatively high . intra - examiner reproducibility observer sk intra - examiner reproducibility observer rs inter - examiner reproducibility observers sk and rstable 3 summarizes the mean for male and female , mean differences and statistical comparisons of the tooth size ratios . it shows that there was no significant sexual dimorphism for any of the parameters ; therefore , the sexes were combined for all other analyses . the mean ratios for the orthodontic patients of the present study were slightly higher than bolton 's value and had a larger range than his sample of excellent occlusion . graph 1 shows the distribution of anterior tooth - width ratios in this study categorized by bolton 's original means and standard deviations ( sd ) .24 % of the sample had anterior tooth - width ratios greater than 2 sd from bolton 's mean ( 22 % greater than + 2 sd and 2 % less than 2 sd ) . this shift to the right compared with bolton 's results demonstrates relatively more mandibular tooth width . graph 2 shows the same data for the overall ratio . for the overall ratio , the percentage falling more than 2 sds from bolton 's mean was 8 % of the sample ( 2 % greater than + 2 sd and 6 % less than 2 sd ) . comparison of bolton 's study and the present study : anterior ratio comparison of bolton 's study and the present study : overall ratio anterior bolton 's ratios : the distribution ( percentage ) of subjects in this study categorized by the standard deviations of bolton 's original study overall bolton 's ratios : the distribution ( percentage ) of subjects in this study categorized by the standard deviations of bolton 's original study graphs 3 and 4 show the percentages of subjects in terms of the upper and lower corrections in millimeters which would be required to give the mean ratio for bolton 's original sample . in these figures , a negative ( ) sign on the x axis indicates relative tooth size deficiency and the correction is to be done by increasing the tooth structure , whereas the positive ( + ) sign indicates relative tooth size excess requiring correction by reducing the tooth structure . for the anterior analysis [ graph 3 ] , 36 % of the sample needed upper correction more than 1.5 mm and 24 % needed upper correction more than 2 mm while the corresponding figures for the lower arch were 32 % and 14 % , respectively . for anterior arch correction , the white columns ( required upper arch correction ) are all taller on the negative side of the graph , suggesting maxillary tooth deficiency , and it is vice versa on the positive side , suggesting mandibular tooth excess . this indicates relative tooth size excess in the mandibular arch as a consistent feature . for total arch correction , the white columns ( required upper arch correction ) are almost similar on the negative and positive sides of the graph than the corresponding black columns ( required lower arch correction ) . for the total arch analysis [ graph 4 ] , 46 % of the sample needed upper correction more than 1.5 mm and 36 % needed upper correction more than 2 mm while the corresponding figures for the lower arch were 46 % and 32 % , respectively . this indicates for the tooth arch relative tsds are almost equally distributed amongst the maxillary and mandibular arches . percentages of subjects by upper and lower correction in millimeters for anterior correction percentages of subjects by upper and lower correction in millimeters for total ( whole arch ) correction table 5 summarizes the sensitivity and specificity results of this study . the caliper measurements were taken as the best estimate of the true ( gold standard ) bolton 's ratio . for all discrepancies , there was low sensitivity ( 17.94 % for 1.5 mm , 39.21 % for 2 mm and 45.45 % for 3 mm ) and higher specificity ( 85.7 % for 1.5 mm , 78.29 % for 2 mm and 75.8 % for 3 mm ) . sensitivity and specificity tests for tsd more than 2 mm and 3 mm , comparing visual judgment ( eyeball estimation ) with digital calipers measurementthe importance of tsds in orthodontic diagnosis has been widely reported in the literature and accepted by the orthodontic community because the relationship between the upper and lower dentitions is related to orthodontic finishing excellence . the prevalence of tsds in this sample was high and serves as an indicator of how important it is to perform a thorough diagnosis before orthodontic treatment . in this study , we found that 60 % of the total sample presented with anterior tsds and 36 % with overall tsds , greater than 1 sd using the bolton analysis parameter . originally , bolton suggested that the ratio greater than 1 sd from his reported mean values indicated the need for diagnostic consideration . more recently , clinically significant tooth size ratio discrepancy has generally been defined as 2 sd outside bolton 's published mean ratios . by using this definition , an anterior ratio below 73.9 % or above 80.5 % and the total ratio below 87.5 % or above 95.1 % would be considered clinically significant . the present study found 24 % of the sample had anterior tsds greater than 2 sd from bolton 's mean , which coincided with many others , as demonstrated in table 6 . it is also clear from table 6 that all studies have found a lower percentage of cases falling outside bolton 's sd for the overall ratios than for the anterior ratios . graphs 1 and 2 show that for the anterior discrepancy there was a greater mandibular excess than that of maxillary teeth , whereas the overall discrepancy was almost equally divided amongst maxillary or mandibular excess . the finding for the anterior ratio is similar to those reported by freeman et al . they stated that the overall discrepancy was equally likely to be an excess in the maxilla or the mandible , whereas the anterior discrepancy was nearly twice more likely to be a mandibular excess than a maxillary excess . summary of studies of the prevalence of tooth size discrepancy , defined in terms of bolton 's original standard deviations in clinical practice , any correction for tsd may be based on the ratio in percentage terms , but is carried out in absolute millimeters of change in tooth widths . however , considering that recently values falling outside 2 sd are considered clinically significant , we observed the millimeter values corresponding to 2 sd and found all the values to be greater than 2 mm . therefore , 2 mm is considered a clinically significant discrepancy when considering bolton 's measurements in millimeters . othman and harradine have also considered a 2 - mm threshold as clinically significant , stating that a value of 1.5 mm is only an occlusal discrepancy of 0.75 mm per side and this may be considered too small a potential occlusal error to be clinically significant . hence , taking this level as a significant discrepancy , the current study revealed [ graphs 3 and 4 ] that for the anterior arch ratio , 24 % of patients required correction through upper arch adjustment or 14 % if the lower arch is adjusted , and for the total arch ratio , the corresponding figures are 36 % and 32 % , requiring correction through upper and lower arch adjustment . observing graphs 3 and 4 which demonstrate the tsd in millimeters , it is clear that the black columns showing mandibular correction are all taller on the positive side , showing mandibular excess in majority of the anterior tsd cases , whereas for overall tsd , both the white and black columns are almost equal in height and distribution on the positive and negative sides . this implies that the discrepancy is equally distributed amongst both the arches in overall tsd cases . table 5 reveals that simple eyeballing of study models is a poor method of assessing tsd in a representative sample of orthodontic patients . better specificity was observed , but approximately 2025 % of those estimated not to have a discrepancy did have a significant discrepancy . it can be concluded that the ability of visual judgment to detect a lack of bolton discrepancy is higher than the ability to detect a significant bolton discrepancy , but that this method is highly unreliable . the findings from the present study suggest that a large number of orthodontic patients in our population possess a bolton tsd . these will influence treatment goals and results as many of these patients are undergoing or going to have orthodontic treatment or had already undergone orthodontic treatment . bolton tooth size analysis should be used for every orthodontic patient before initiation of treatment . identifying such a discrepancy before final tooth alignment would prove beneficial in both treatment planning and final expectations of both the clinician and the patient . in clinical practice , any correction for tsd may be based on the ratio in percentage terms , but is carried out in absolute millimeters of change in tooth widths . however , considering that recently values falling outside 2 sd are considered clinically significant , we observed the millimeter values corresponding to 2 sd and found all the values to be greater than 2 mm . therefore , 2 mm is considered a clinically significant discrepancy when considering bolton 's measurements in millimeters . othman and harradine have also considered a 2 - mm threshold as clinically significant , stating that a value of 1.5 mm is only an occlusal discrepancy of 0.75 mm per side and this may be considered too small a potential occlusal error to be clinically significant . hence , taking this level as a significant discrepancy , the current study revealed [ graphs 3 and 4 ] that for the anterior arch ratio , 24 % of patients required correction through upper arch adjustment or 14 % if the lower arch is adjusted , and for the total arch ratio , the corresponding figures are 36 % and 32 % , requiring correction through upper and lower arch adjustment . observing graphs 3 and 4 which demonstrate the tsd in millimeters , it is clear that the black columns showing mandibular correction are all taller on the positive side , showing mandibular excess in majority of the anterior tsd cases , whereas for overall tsd , both the white and black columns are almost equal in height and distribution on the positive and negative sides . this implies that the discrepancy is equally distributed amongst both the arches in overall tsd cases . table 5 reveals that simple eyeballing of study models is a poor method of assessing tsd in a representative sample of orthodontic patients . better specificity was observed , but approximately 2025 % of those estimated not to have a discrepancy did have a significant discrepancy . it can be concluded that the ability of visual judgment to detect a lack of bolton discrepancy is higher than the ability to detect a significant bolton discrepancy , but that this method is highly unreliable . the findings from the present study suggest that a large number of orthodontic patients in our population possess a bolton tsd . these will influence treatment goals and results as many of these patients are undergoing or going to have orthodontic treatment or had already undergone orthodontic treatment . bolton tooth size analysis should be used for every orthodontic patient before initiation of treatment . identifying such a discrepancy before final tooth alignment would prove beneficial in both treatment planning and final expectations of both the clinician and the patient .24 % of the sample had anterior and 8 % had overall ratios greater than 2 sd from bolton 's mean . it would seem prudent to routinely perform the tooth size analysis and include the finding into orthodontic treatment planning.tsds are better expressed in terms of the millimeters required for correction . a threshold of 2 mm is recommended.simple visual inspection is a poor method of detecting tsd .24 % of the sample had anterior and 8 % had overall ratios greater than 2 sd from bolton 's mean . it would seem prudent to routinely perform the tooth size analysis and include the finding into orthodontic treatment planning . tsds are better expressed in terms of the millimeters required for correction . a threshold of 2 mm is recommended .\noutput:\n" }, { "from": "agent", "value": "objective : to determine the prevalence of tooth size discrepancy ( tsd ) in a representative orthodontics population , to explore how many millimeters of tsd is clinically significant and to determine the ability of simple visual inspection to detect such a discrepancy.materials and methods : the sample comprised 150 pretreatment study casts with fully erupted and complete permanent dentitions from first molar to first molar , which were selected randomly from records of the orthodontic patients . the mesiodistal diameters of the teeth were measured at contact points using digital calipers and the bolton 's analysis was carried out on them . simple visual estimation of bolton discrepancy was also performed.results : in the sample group , 24 % of the patients had anterior tooth width ratios and 8 % had total arch ratios greater than 2 standard deviation ( sd ) from bolton 's means . for the anterior analysis , correction greater than 2 mm was required for 24 % of patients in the upper arch or 14 % in the lower arch . for the total arch analysis , correction greater than 2 mm was required for 36 % of patients in the upper arch or 32 % in the lower arch.conclusion : bolton 's analysis should be routinely performed in all orthodontic patients and the findings should be included in orthodontic treatment planning . 2 mm of the required tooth size correction is an appropriate threshold for clinical significance . visual estimation of tsd has low sensitivity and specificity . careful measurement is more frequently required in clinical practice than visual estimation would suggest ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: barbados , one of the english speaking caribbean countries , has both public and private facilities providing health care to its population . there is a comprehensive publicly funded ( tax - funded ) and delivered health care , including the primary health care and tertiary health care at the hospital , prescription drugs and some dental care . a range of primary health care services including both the curative care and preventative care are delivered through a chain of tax - funded polyclinics across the country and are free of any charges for all of its citizens at the point of delivery . there is a single tax - funded tertiary care hospital in this country which provided the entire range of free inpatient care including investigations and medications to all its citizens . barbadians also have a choice of availing private health care services , on payment , available through the individual physicians private office or group private offices spread over the entire country . an accumulating literature documents the importance of a strong primary care infrastructure within a health services system especially in the context of the changing health care needs of children . health systems that are better organized around a primary care base achieve better health outcomes and greater population satisfaction at lower costs than health systems more focused on specialty services . in the united states , areas with more primary care physicians have lower rates of hospitalization for conditions that are sensitive to primary care interventions , lower death rates from major causes , and lower infant mortality . a recent report by the institute of medicine , usa , reinforces the importance of strong primary care as a critical feature of the health services system . commitment by the government of barbados for ensuring equitable distribution and continuous improvement in the quality affordable primary health care to all its citizens in the face of economic constrains is an ongoing policy concern . the relative role of the public and the private health care providers in the primary health care of children in this country has never been explored . in this operational research study , we critically examine the available resources in the public and the private primary health facilities in this country . we describe the utilization of the public and the private facilities by the children of this country including the demographics of the children utilizing the public primary health care facilities as well as the profile of the presenting illnesses . the report highlights the strength and challenges of public funded and the private health care provisions . these information will be necessary for making any policy decisions for further strengthen the public primary pediatric care in this country . the majority of the data for this paper was drawn from the reports of a professional consultancy service commissioned by the ministry of health ( moh ) , government of barbados to strengthen the primary health care for the children at its health centers the polyclinics . as a part of this initiative , a need assessment survey of all the polyclinics across this countrythe major objectives of this need assessment were to evaluate the existing health care service provisions and its utilization and to assess the existing manpower and material resources at these polyclinics . data were also collected from the private sector primary care setting which included private offices of individual or group of doctors . data from emergency care settings of both the public sector and the private sector were excluded . the lead consultant visited all of the polyclinics and met individually as well as collectively with the medical and the nursing staff at the polyclinics . the medical officer of health and the senior public health nurse , who are responsible for the overall management of the 8 polyclinics in this country were interviewed using a semi - structured questionnaire . several open ended questions were used to facilitate open discussions on the various issues in the context of pediatric services at these polyclinics . interviews covered all aspects of the pediatric primary care delivery and the existing infrastructure for the delivery . doctors engaged in private practice and who provided primary care were identified form the listing of the registered medical practitioners in this country . data form the private sector primary care providers were collected by telephonic call to the offices . the data collected from the polyclinics included the data on the available resources such as the number of physicians and nurses attending to children , availability of other support medical team such as nutritionist , physiotherapist , speech therapist , psychologist , and medical social workers . data were also collected on the available services in term or curative care services , preventative care services , and rehabilitative services . a third category of collected data included service utilizations such as number and demographics of children attending the well - baby and immunization clinic , acute care clinic and any follow - up clinics . similar data were collected from the private office of the general practitioner 's ( gp 's ) ( doctors with mbbs as their highest medical degree ) and the pediatricians who provided primary care to children in the private settings . an analysis and discussion on all the available data was conducted to develop a comprehensive community health care service utilization and resources inventory , to identify the needs in the priority area for improving and strengthening the primary pediatric care at the polyclinics . total available professional manpower hours were calculated using the following formulae : total available physician hours = p 570.85 p = number of persons available for professional duties ( moh were counted as 0.5 due to the fact that they have administrative duties assigned to them , which takes up nearly half of their working time ) working days a week = 5 days . daily work time of 8 h a day 1 h breaks for lunch = 7 h. effective work time factor = 0.85 ( the proportion of working time actually spent at work after subtracting the 0.15 or 15 % of the time is lost to vacation 6 weeks a year and sick leave 2 weeks a year for each of the physicians at the polyclinics ) . data were stored in a password protected microsoft access database and were analyzed using microsoft excel for generation of tables and graphs . proportion and 95 % confidence interval ( ci ) were calculated using binomial distribution and results were corrected for continuity . associations between categorical variables will be assessed for statistical significance by chi - square test . the total population of barbados is 287,733 with an under 16 year 's population of 58,455 , according to the 2012 census . in the public sector , there are 8 polyclinics and 2 satellite health centers spread across the length and breadth of this island state that provide primary health care to the children as well as the adults of this country . the polyclinics have a range of services including well child health clinic , antenatal clinic , and the general practice clinics ( for both the children and the adults ) , whereas the satellite centers only have general practice clinics with limited services ( for both the children and the adults ) . in the private sector , primary health care is delivered through the 76 private office ( 57 gps and 19 pediatricians ) of the individual physicians and 11 ( 9 gps and 3 pediatricians ) grouped private practices . table 1 shows the range and the quantity of primary health care services for children that are available in the public sector ( at the polyclinics and the satellite centers ) and in the private sector in barbados . all 8 polyclinics have immunization / well children clinic which is the only service entirely dedicated to child health . these clinics are managed by the public health nurses and provide immunizations covered under the expanded immunization program as well routine growth and development assessment for children under 5 years . each of the polyclinics and the satellite centers have daily gp clinics , where children of all ages are attended to by gp 's . although , the gp clinics attend to both adults and children , there is a dedicated physician for children . nutritionist 's services are available at all of the 8 polyclinics but 1 ; however , there is no dedicated nutritionist service for children and the nutritionists attend to both the adults and children when referred to that service . rehabilitative services such as physiotherapy , occupational therapy , and speech therapy are available at two of the polyclinics on three - half days a week at each . there are no dedicated follow - up clinics for chronic diseases in children except for an asthma clinic at one of the polyclinics . there is no pediatric / specialist service of any kind ( except the basic general nutritional , dental , and eye services mentioned above ) available at any of the polyclinics . where a specialist consultation is necessary , patients are referred to the pediatric department at queen elizabeth hospital ( qeh ) for appointment . there is provision for home visits at all of the polyclinics ; however , most of these polyclinics are able to provide only 48 % ( 2464 requests in 2011 , 1173 visits made ) of the desired home visits for newborns . all of the polyclinics have a public pharmacy for dispensing medications prescribed by the physicians at the polyclinics free of any charges . none of the polyclinics have laboratory support for routine investigations . whenever an investigation is necessary on a patient attending the polyclinics , then sampleprimary care services for children in the public and the private sector in barbados in the private sector , all gp 's in addition to the pediatricians provide primary care to the children . in all of the gp 's practice , both individual and group practice , both the adult and pediatric services are clubbed together and no separate records are maintained . analysis of the records showed that on an average 21.2 % ( range : 11.430.7 % ) of the services were utilized by children . only 51.9 % of gp 's provided immunization services while all of them provide acute care services to children and none provided any other services for children . in case of the pediatricians , all of them provided immunization / well child services , acute care services and follow - up services for chronic diseases ; however , there were no dedicated time slot for these different services except for a dedicated immunization clinic at 4 of the pediatrics private offices . no other primary care services for children such as nutrition , rehabilitation , eyes , or dental services were available through any of the pediatrician 's offices , although the nutritional , eye , and dental services could be obtained in the private offices of dentists and ophthalmologists on referral . available physicians and service utilization for the primary health care of children in the public sector and the private sector in barbados is shown in table 2 . of the 322 medical doctors providing direct clinical care in the community in this country , 144 ( 44.72 % ) are gps ( with their highest medical degree being mbbs ) . while in the public sectorall of the gp 's are assigned to see children from time to time , only 88 of the gp 's in the private see children in their practice . the majority ( 49/55 = 89.1 % ) of the physicians in the public sector working at the polyclinics are full time ( they do not hold any other employment ) . many of the physicians ( 29/106 = 27.4 % ) especially the pediatricians ( 9/18 = 50 % ) in the private sector are part time in that they are also employed in the public sector health care settings ( mainly at the qeh ) in some capacity . over all 87.5 % ( 95 % ci = 87.0 % , 87.9 % ) of all the immunizations were done at the polyclinics in the public sector . of the 109,414 estimated acute care visits from children to the primary care settings in barbados , 60.7 % ( 95 % ci = 60.4 % , 61.0 % ) were to the private office of the physicians in the private sector . only follow - up service available and utilized in the primary care settings were those for asthma at one of the polyclinics in the public sector and amounted to 466 visits for the year 2011 . available physicians and primary care service utilization in the public and the private sector in barbados profile of the clients visiting the primary care settings of the public sector and the private sector is shown in table 3 . in the public sector , 21,408 ( 59.5 % ; 95 % ci = 59.0 % , 60.0 % ) were under 5 years children while 14,562 ( 40.5 % ; 95 % ci = 40 % , 41 % ) were 5 years or older . the corresponding figures in the private care settings were 53738 ( 80.9 % ; 95 % ci = 80.6 % , 81.2 % ) and 12697 ( 19.1 % ; 95 % ci = 18.8 % , 19.4 % ) . these differences were statistically significant ( p 0.0001 ) . while 21,333 ( 59.3 % ; 95 % ci = 58.8 % , 59.8 % ) children in the public sector were repeat visitors for the year , 19,465 ( 29.3 % ; 95 % ci = 28.9 % , 29.6 % ) of those visiting the private sector were repeat visitors for the year . once again these differences in the proportion of visits that were repeat visits for that year were statistically significant ( p 0.0001 ) . in the private sector , 31.4 % of children attending for care had a health insurance . in all these cases , the health insurance to pay for the care by assigning the benefits to the physician at the time of the care and just paying the 20 % of the total cost upfront or they paid the whole cost upfront and then the insurance reimbursed 80 % of the approved cost . profile of clients visiting the primary health care settings of the public sector and the private sector in barbados the diagnoses profile for the children seen at the primary care setting of the public and the primary sector is shown in figure 1 . upper respiratory tract infection was the commonest over all diagnosis ( 31 % among 5 children and 20 % in children aged 5 or more ) for children visiting the polyclinics . the second commonest ( 18 % in 5 children and 8 % in children aged 5 or more ) reason for visit to the polyclinics was for issue of health certificates for healthy children going back to day care centers , preschool and schools . although the asthma ( 4.8 % ) and other allergic disorders such as the atopic dermatitis ( 4.6 % ) and allergic rhinitis ( 2.4 % ; clubbed in the others category ) accounted for just 11.8 % , 80.2 % were revisits for the year and 47.3 % had more than 2 visits for the year . diagnosis profile of children attending the primary health care setting of the private and the public sector in barbados , year 2012the most easterly island in the caribbean , barbados , is a small , densely populated , english speaking country , with an estimated 287,733 people ( 2012 estimated ) inhabiting its 431 km . its gross national income per capita is us $ 25670 ( 2012 ) and its total expenditure on health as a percentage of gdp stands at 6.3 % ( 2012 ) . in 2011 , barbados was designated as a developed country by the united nations development program , with a human development index score of 0.793 . very recent estimates place life expectancy at birth as 75 male / 81 female years , and the infant mortality rate as 13.3 / 1000 live births . under - fivebarbados has a pluralistic health care system whereby people have a choice to utilize the health services in the public sector free of charges at the point of delivery or in the private sector at a fee that is out of pocket or through a number of the health care insurance schemes available . the insurance payment can be assigned to the insurance company at the time of service or paid upfront by the client who later get it reimbursed from their insurance . the public health care system has historically been the largest providers of primary health care in this country . all of the physicians in the public sector have mbbs degree ( addressed as gp 's in this country ) , some of these physicians also have additional degree in public health . there is almost a parallel system of primary health care for children being provided by the physician in the private medical sector which includes gp 's ( physicians with mbbs degree and a further degree in general practice or family medicine ) , pediatricians ( physicians with mbbs degree and a further degree in pediatrics ) and the physicians with just the basic mbbs degree who are addressed as gp 's as well . the available total number of hours of primary care services ( including both the public sector and the primary sector ) for children in barbados stands at 1171 h / week or 5074.3 h / month [ table 1 ] . this figure translates into 15,223 consultation visits given a consultation time of 20 min / month . utilization of health services as most papers define it , visits / 1000 children per month . given the under 16 population of barbados at 58,455 , the available services for primary care for children can accommodate 260.4 visits / 1000 children . japan with a socialized system is the utilization of primary health services is at 167/1000 children , same figure as reported in the us . based on the published literature the round figure of 185 visits / month / 1000 children could be considered as a reasonable standard demand . when these figures on primary care utilization by children is applied to barbados with 16 years population of 58,455 therefore , the available service resources ( 15,223 consultation visits / month ) exceed the projected service demand ( 10,822 consultation visits / month ) . the proportion ( 144/322 = 44.7 % ) of all registered physicians who provide primary health care in this country is higher than 32 % reported from the north america and the organization for economic cooperation and development average of 26.9 % . this imbalance between the available physicians for primary care and specialty care will have to be address in order to strengthen the primary health care in this country . while none of the physicians in the public sector providing the primary care to the children are pediatrician , only one - sixth of the physicians in the private sector providing primary care to children are pediatrician . therefore , the majority of the primary health care for children is provided by the gp 's . the research on the need and the role of pediatrician in primary health care of children have been inconsistent . research seems to suggest that additional specialization by pediatricians translates into a unique practice style that may ultimately result in more efficient or effective care under certain circumstances . however , it is unclear whether the exclusive focus on children , rather than families , causes pediatricians to offer less holistic or comprehensive services than those provided by family practitioners . what is obvious from this audit is that despite the lack of qualified pediatrician 's service at the primary care level , the child health indicators such as the infant mortality rate and the under - five mortality rate in this country compares well with those of developed countries in the americas . the majority of the available primary care services , however , are for the immunization and acute curative care . there is gross deficiency of other preventative services in terms of nutritional services , rehabilitative , and follow - up services for chronic disorders of childhood in both the public and the private sector especially so in the private sector . there is a need to urgently address the imbalance or inequality in the service provisions both in the private sector and the public sector for any strengthening and further improvement in the overall primary health care of children in this country . it is also noteworthy , that while the private sector has nearly twice the amount of available services and service utilization for acute curative care , there is lack of both the preventative and rehabilitative services and utilization in this sector too . affordability of these services in the private sector may also be factor in its uptake by the persons in the lower socioeconomic strata . these differences in the primary care in the public and the private sector points to the fact that the public sector is critical to the overall availability holistic primary health care to this population as a whole and its affordability of the underprivileged section of the society in this country which forms a significant proportion of the population . therefore , it is even more imperative that the public sector needs to take lead in addressing these discrepancies . this study shows that , while under - five children accounted for the majority of visits in both the public and private sector , there was a significantly greater proportion of visits from under - five children in the private sector compared to the public sector [ table 3 ] . this is noteworthy especially since a large proportion of the under - five children visits to the public sector would have been for the immunizations as public sector is the provider for most of the immunization services . a possible explanation for the age distribution could be the higher trust , convenience and the quality of care in the private sector when it comes to the health issues of younger children . another notable finding from this study was a significantly higher proportion of revisits in a given year in the public sector compared to the private sector . the majority of these revisits both in the public and the private sector were for the asthma and other allergic disorders such as atopic dermatitis and allergic rhinitis . these findings strongly support the need for dedicated follow - up clinics in the public and the private sector . in thisregards , having locally developed rational and relevant guidelines and standard procedure manual would ensure uniform standard of care to these children . all these could be achieved at no additional cost of care , as these children are already utilizing the health care services at these polyclinics , and would be economically beneficial in the long - term . therefore , it would appear that when it comes to the question of seeing a physician for their illnesses , it seems that the parents choose the health care providers in the private sector which is perceived to provide better facility / expertise / accessibility and this could explain why less than a third of the total expected number of visits from children take place at the polyclinics . however , it is well established that immunization is one of the most cost effective intervention in health care system . therefore , form the public health perspective this is advantageous for the government in ensuring high coverage of vaccination in this country without having to bear the burden of entire health care cost . once again from the public health perspective , this is a pivotal role played by the primary care set in the public sector . the major limitation of this report is the inadequate rigor of the assessment of the resources and the health care utilization parameters . this was mainly due to the lack of availability of comprehensive record and statistics from both the public and the private sector . although , not a limitation directly linked to the design or methods of this study , lack of published operational research studies in the primary care setting such as the optimum number for physicians , need and number of pediatricians , nursing resources need and optimum number of visits in children for primary care of children in a given population was a major limitation for making useful and meaning full comparison in this report . available resources in terms of physicians and the preventative ( immunization ) and curative service provisions are more than adequate for the given population in this country . the primary health care service provisions and their utilization in the public and the private settings are complimentary . however , the rehabilitative and other health promotion services such as nutritionist is inadequate in both the public and private sector . the findings from this study support strong need for dedicated follow - up clinics for the common childhood diseases such as asthma and other allergic disorders in this country . also , these findings demonstrate the complimentary role of the public and the private sector in the primary health care of children in this country . there is a need for increased rehabilitative , health promotion and support services in both the public and the private sector , and the government should take the lead in strengthening these services in the public sector . the regular periodic audit would help to make its services client friendly , more efficient and economical . future research is needed for better characterization of clients in the public and the private sector . these will be useful in continuously updating policy and better planning of targeted primary health care provisions in this country .\noutput:\n" }, { "from": "agent", "value": "background : the major objectives of this study were to evaluate the existing primary health care service provisions in the public and private sector and utilization of the services , and to assess the existing manpower and material resources.methods : data were collected through interviews with the primary health care providers . data were also collected from the records maintained at the polyclinics and the ministry of health statistics . an analysis and discussion of all the available data was conducted to develop a comprehensive primary health care service utilization and resources inventory at the polyclinics . similar data were collected from the primary care providers in the private sector.results : in the public sector , there are 8 polyclinics that provide primary health care to the children . all the polyclinics have immunization services and curative acute care . some of the polyclinics have a range of services , including dental care , eye care , and rehabilitative care services that common to both adults and children . in the private sector , primary health care is delivered through the 76 private office and of the individual physicians and 11 grouped private practices . all of the private offices and group practices have curative acute care for children and some of the offices have immunization services . over all 87.5 % of all the immunizations were done at the polyclinics . over all 60.1 % of acute care visits were to the private sector and 39.9 % to the public sector . in the public sector , 59.5 % were under 5 years children while 40.5 % were 5 years or older . the corresponding figures in the private care settings were 80.9 % and 11.9 % . conclusions : the findings demonstrate the complimentary role of the public and the private sector in the primary health care of children in this country . while the private sector has a major role in the curative acute care of children , the public sector plays a pivotal role in the immunization services ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: since the early 21 century , the role of human resources ( hr ) in the health system has been recognized by international organizations such as the world health organization ( 1 ) . specialized and trained hr is the heart of any health system that ensures its life and survival ( 2 ) . in this regard , providing specialized hr in hospitals as the most pragmatic unit of health system ( 3 ) is of special importance , since it accounts for 50 to 80 % of expenditures in this sector ( 4 ) . nurses often account for the major part of hr in hospitals ( 5 ) , such that dehghan , cited by eastaugh has regarded 62 % of hospitals hr and 36 % of its expenditures related to nursing staff ( 6 ) . this group plays a major role in promotion of health in society , without whom the hospitals will not achieve their goals ( 5 ) . of sectors , the success of which depends on having efficient and vigorous nurses along with other medical staff , is the emergency department ( ed ) which is an essential and inevitable element of hospitals considering its vital role in providing immediate medical care for patients who require quick intervention at all times of the day ( 7 ) . due to the critical condition of patients referring to ed and hospitalization of over 28 % of them in various wards of a hospital , the quality of services provided in this department is regarded as a symbol of the general state of services provided in the hospital ( 8 ) . providing suitable and programmed hr , namely nursing staff for ed is definitely one of the major tasks of hospital administrators who should employ orderly and rational processes and systemic approaches to avoid shortage or surplus ( 9 ) ; since , on the one hand , hospitals encounter resource constraints and rising costs , and on the other hand , they should be accountable to medical requirements of patients and satisfy their expectations and requirements ( 6 ) . in this regard , since 1980 , many authors have investigated scheduling of various medical staff , including ed nurses , as such that the common objectives of all these studies are to determine the least number of nurses required along with patients satisfaction of emergency services provided , as well as to determine the number of nurses required per shift ( 10 ) . within recent decades , various tools including statistics , work measurement , simulation , queues and linear programming models have been used for scheduling problems of staff ( 11 ) as such that within the last two decades , the use of simulation models for programming and decision - making in the health sector has been extensively promoted and many of them have been used in the ed of hospitals ( 12 ) . in 2009 , ahmed and alkhamis provided a tool to support decision - making using a simulation system along with optimization , to determine the optimal number of physicians , laboratory technicians and nurses for a hospital in kuwait , in order to maximize the number of patients and reduce waiting time in ed , considering budget constraints . the main objective of this tool was to evaluate the effect of optimal allocation of staff on efficiency of provided services . results showed that the use of optimization model results in a 28 % increase in customers ( patients ) and a 40 % decrease in patients waiting time ( 13 ) . in thisregard , various studies have demonstrated the appropriateness of a linear programming ( lp ) model in optimal allocation of health system resources relative to other traditional methods . for instance , flessa ( 2000 ) and beaulieu et al . ( 2000 ) employed this method respectively for optimal allocation of resources in developing countries ( 14 ) and to schedule shifts for physicians and nurses in ed . results from employing this method showed a significant decrease in time and intended activity , and better scheduling in a 6 - month interval ( 15 ) . this widely used model is a set of techniques and methods derived from mathematics and other disciplines that is considerably effective in improving administrative decisions and finding optimal conditions and it can suitably solve problems like production planning , allocation of limited resources and inquiry control . managers who are interested in the quality of their decisions results , can not be indifferent , relative to this issue ( 16 ) . relative to other models including complex ones , this model is of more use due to being simple and feasible with data available in eds ( 11 ) . the ed of the educational hospital under study in bandar abbas , as the largest ed in the south of iran , admits a high number of patients from all counties of the province and even adjacent provinces for emergency services . therefore , timely provision of these services , proportional to patients needs , requires an adequate number of trained nurses . in addition , since the lp model is one of the widely used optimization methods for hr allocation proportional to the demand and workload , this study was conducted with the aim of estimating the optimum number of nurses using the lp model in the ed of the intended hospital . this was an applied study , conducted using the quantitative technique of linear programming ( lp ) . lp entails 3 main components of decision variables , objective function and constraints or limitations , and appropriate definition of decision variables is the first major step to extend the model . objective function shows the relations between variables and objective of the problem and it seeks for optimization . this study was conducted using available data in 2015 when there was the high admission rate of patients . statistical population was selected taking a census including all patients ( 3,342 patients ) referring to the ed of the educational hospital in bandar abbas in the above - mentioned period as well as nurses working in this ward ( 84 nurses ) . data collection was conducted using the hospital information system ( his ) for the number of patients , and the hospital hr database for data related to nurses . to verify the number of nurses working at ed being up - to - date at the time of this studyfurthermore , confidentiality of obtained data was confirmed and they were used only for research purposes . work shifts of the hospital under study were designed as two 6 - hour shifts ( 8 am to 2 pm and 2 pm to 8 pm ) and a 12 - hour shift ( 8 pm to 8 am ) . to determine the mean admission of patients with sufficient validity and planning of the lp model , a 24 - hour period of this wardwas divided into eight periods of 3 - hours according to table 1 . according to the study by ketabi and monzavi ( 11 ) , patients referring to ed require one of low , medium and high levels of care and duration of nursing services for each one of these levels is respectively 10 , 20 and 45 minutes . on average , in each period , 40 % of patients require low level nursing services , 20 % need medium level and 40 % need high level nursing services . to determine the optimum number of nurses for ed per various shifts of the hospital , data entered excel software and descriptive statistics indices were extracted . to design the lp model , the initial model was extracted using literature review and it was finalized by specialized counseling . then , using collected field data , the model was executed in winqsb software . this software is among the simplest and yet the most accurate of engineering software able to solve various problems in a simple environment as a software package , by easy data entry , various solving methods , analyzing all parameters and understandable output ( 11 ) . the number of patients referring to ed within the study period was 3,342 , and average admission of patients was 1,114 . considering the average number of customers in 3 - hour shifts as well as the time required to supply nursing services for each group of patients ( low , medium and high level care ) , and the percentage of patients who received low , medium and high level care , the number of nurses required to supply services for customers was obtained for each hour in table 2 . the objective function of this model was the minimum number of nurses required for the ed of the hospital . in addition , the objective function , decision variables and constraints are as follows : min z = x1 + x2 + x3 + x4 + x5 + x6 + x7 + x8 to determine decision variables , it is necessary to note that according to current shift schedule of the hospital as well as the times of this model , each shift can have nurses of various times , such that the morning shift ( 8 am2 pm ) could have nurses from the first period ( 8 am11 am ) and the second period ( 11 am2pm ) . in evening shift ( 2 pm8 pm ) , it was possible to have nurses from the third ( 2 pm5 pm ) and fourth ( 5 pm8 pm ) periods . furthermore , the night shift ( 8 pm8 am ) could entail nurses from fifth ( 8 pm11 pm ) , sixth ( 11 pm2 am ) , seventh ( 2 am5 am ) and eighth ( 5 am8 am ) periods . decision variables of above model were as follows : x1 : the number of nurses whose shift started at 8 am . x2 : the number of nurses whose shift started at 11 am ( null ) . x3 : the number of nurses whose shift started at 2 pm . x4 : the number of nurses whose shift started at 5 pm ( null ) . x6 : the number of nurses whose shift started at 11 pm ( null ) . x7 : the number of nurses whose shift started at 2 am ( null ) . x8 : the number of nurses whose shift started at 5 am ( null ) . time - constraints ( demand ) : according to these constraints , the number of nurses required for each period was as follows : c. 2 . supply constraints : this hospital encountered no constraints for supplying nurses in various work shifts . . constraints of non - negative variables : x1 , x2 , x3 , x4 , x5 , x6 , x7 , x80 after solving the model in winqsb software , the optimum number of nurses required for ed in three work shifts of the hospital was 48 nurses ( table 3 ) and considering that the third shift is a 12 - hour shift , the actual number of nurses required for a 24 - hour cycle was ( 48 + 14 ) = 62 nurses . if the current shifts of the hospitals are changeable and nurses are allowed to start their work in various shifts , a lower number of nurses will be required due to fewer constraints . in other words , in the solved model , since the third shift starts at 8 pm and continues to 8 am , 14 nurses whose presence is required from 8 pm to 11 pm are practically at work until 8 am and the cost of their surplus is imposed to the hospital . however , if nurses can start work from the middle of current shifts , in the case of re - solving the lp model , the number of nurses required for every shift and the objective function will change as follows : min z = x1 + x2 + x3 + x4 + x5 + x6 + x7 + x8 x1 : the number of nurses whose shift started at 5 am . x4 : the number of nurses whose shift started at 2 pm . x5 : the number of nurses whose shift started at 5 pm . x6 : the number of nurses whose shift started at 8 pm . x7 : the number of nurses whose shift started at 11 pm . x8 : the number of nurses whose shift started at 2 am . . constraints of time ( demand ) : based on these constraints , the number of nurses required in each time was as follows , based on new work shifts : c. 2 . supply constraints : none of the nurses were willing to start working at 2 am , x8 = 0 . . constraints of non - negative variables : x1 , x2 , x3 , x4 , x5 , x6 , x7 , x80 x1 = 17 , x2 = 0 , x3 = 17 , x4 = 0 , x5 = 14 , x6 = 6 , x7 = 6 in addition , the least number of nurses required at this state was z = 60 that compared to previous state , 2 fewer nurses were required . determining the optimum number of human resources in eds of hospitals has been investigated in several studies ( 11 , 1820 ) . based on results of these studies , considering the importance of this ward and the emergency nature of its functions , absence of an optimum number of human resources can directly affect the quality of activities performed in this ward as well as patients satisfaction . low number of human resources , namely nurses , can disrupt the quality and quantity of services provided in this ward , and result in crowding of patients and lack of receiving timely care . on the other hand , an excess number of nurses will result in imposition of excess expenses to the hospital and in addition , will make organization and coordination of them more difficult ( 19 , 20 ) . therefore , determining the optimum number of nurses is the main task of managers in this ward , and this study confirmed that its importance was similar to other studies . in this study , using an lp model , the optimum number of nurses was estimated to be 62 . this value in ketabi s study was 36 nurses , in sotodezadeh it was seven and in bayati s study it was three ( 11 , 18 , 21 ) . the estimated number of nurses in these studies is different depending on the type and size of the hospital , as well as the number of referring patients . in this study , this number is higher compared to similar studies , since the hospital under study is the largest hospital in the province and many patients from all over the province refer or are referred to the ed of this hospital . considering the number of nurses working in this ward ( 84 nurses ) , this number is higher than the optimum value and it clearly imposes extra expenses to the hospital . centeno ( 2003 ) who had employed simulation and lp in combination to determine the optimum number of ed nurses , showed that the number of nurses estimated , using these methods , is lower compared to the number of nurses calculated experimentally ( 10 ) , which complies with the results of present study . current hospital shifts impose many constraints in determining the optimum number of nurses . in this regard , by changing the number of shifts , the start point of each shift and its duration , employing sensitivity analysis in various studies including the present study , has sought to reduce these constraints to employ a variable number of nurses in shorter shifts and this will reduce the total number of nurses . in sensitivity analysis , the estimated number of patients was lower compared to the estimated number resulted from the lp ( 11 ) . this reduction in present study was two nurses and ketabi s study shows a reduction in required workforce of up to eight nurses ( 11 ) . therefore , flexibility in organizing work shifts and creating a culture of acceptance among nurses working at ed can assist allocating the optimum number of nurses that , while they are quantitatively adequate for each shift , no damage is imposed to the quantity and quality of services provided . like similar studies , results of this study showed that the lp model is employed as a practical model to determine the optimum number of nurses in many cases . in thisregard , ketabi stated that this model can not only determine the optimum number of nurses , but can also determine the number of nurses required for each work shift ( 11 ) . however , this model suffers from some limitations including being single - objective and an inflexibility that disables groups decision - making ( 22 ) . therefore , to solve optimization problems , including the optimum number of hr , it is suggested that an ideal programming model is used with the capability of selecting multi - objectives , flexibility in decision - making and considering preferences of various decision - making groups for multiple and sometimes contradictory objectives . considering the lack of access to accurate data of all months of the year and selecting only some months , as well as lack of access to complete data to estimate the time required to provide nursing services , and using data from similar studies , this study encountered some limitations . to remove them , it was attempted to use data of the months with the highest number of customers based on which the highest number of nurses was estimated . in addition , data from a relatively similar study was employed , to determine the time of providing nursing services as well as modeling assumptions . finally , it is suggested that accurate and complete data be provided , to create model assumptions according to the demands of the hospital and to employ flexible models to determine the optimum number of nurses . in summary , findings of this study showed that the estimated number of patients using the lp model was much lower than nurses working at the ed of the hospital under study . the functional significance of these findings is that by using scientific understanding of factors affecting allocation and distribution of nurses in ed and their flexible organization , the number of nurses can reach the optimum value . therefore , it is suggested to conduct shift scheduling using sensitivity analysis such that it is proportional to the demand of services in various hours of a day to satisfy demands and reduce the burden of hr expenses . finally , conducting a complementary study for quantitative optimization of nurses in all clinical wards of the hospital can be a suitable course for future studies on this issue .\noutput:\n" }, { "from": "agent", "value": "introductionnurses account for the majority of human resources in hospitals , as such that 62 % of the workforce and 36 % of hospital expenditures are related to nurses . considering its vital role in offering round - the - clock emergency healthcare services , an emergency department ( ed ) requires adequate nurses . therefore , this study was conducted to optimize the number of nurses in ed.methodsthis was an applied study conducted using a linear programming ( lp ) model in 2015 . the study population were selected by census who were all ed nurses ( n = 84 ) and patients referred to ed ( n = 3342 ) . to obtain the statistics related to the number of patients and nurses , the hospital information system and human resources database were employed respectively . to determine the optimum number of nurses per shift , lp model was created via literature review and expert advice , and it was executed in winqsb software.resultsbefore implementing the model , the number of nurses required for ed morning shift , evening shift , and night shift ( 2 shifts ) was 26 , 24 and 34 respectively . the optimum number of nurses who worked in ed after running the model was 62 nurses , 17 in the morning shift , 17 in the evening shift and 28 in the night shift ( 2 shifts ) . this reduced to 60 nurses after conducting sensitivity analysis.conclusionthe estimated number of nurses using lp was less than the number of nurses working in ed . this discrepancy can be reduced by scientific understanding of factors affecting allocation and distribution of nurses in ed and flexible organization , to reach the optimal point ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: during 20092010 , we analyzed conformational stability of prp from sheep tse isolates by using a conformational stability and solubility assay ( cssa ) that we developed ( 14 ) . we showed that cssa could reveal strain - specified prp conformational stability in sheep isolates because it enabled discrimination of nor98 from classical scrapie isolates ( 14 ) . scrapie isolates had gdnhcl1 / 2 values ( the concentration of guanidine hydrochloride able to dissolve half the insoluble prp aggregates in a brain homogenate ) of 2.0 mol / l2 .3 mol / l ; nor98 isolates were less stable ( 1.31.4 mol / l gdnhcl ) . we thus sought to determine the conformational stability of prp aggregates ( technical appendix ) derived from ch1641 and bse strains ( table 1 ) , including one ( tr316211 ) of the few ch1641 - like field isolates described so far ( 10,12,13 ) . two other ch1641 - like isolates ( 99454 and 99321 ) were found in a retrospective analysis of sheep scrapie cases in france . * prp , prion protein ; gdnhcl1 / 2 , guanidine hydrochloride at a concentration able to dissolve half the insoluble aggregates in a brain homogenate ; bse , bovine spongiform encephalopathy . classical scrapie included as control displayed a gdnhcl1 / 2 value ( 2.2 mol / l ) in the range of previously analyzed isolates . ch1641 ( provided by n. hunter , institute for animal health , edinburgh , scotland ) and ch1641 - like isolates showed conformational stabilities close to classical scrapie , with gdnhcl1 / 2 values of 2.02.8 mol / l . in contrast , prp from experimental sheep bse ( 15 ) clearly showed higher conformational stability , with gdnhcl1 / 2 values 3.8 mol / l ( table 1 ) . these results suggest experimental sheep bse might have a stronger resistance to denaturation than do most natural sheep scrapie isolates . because the discriminatory methods based on differential prp n - terminal proteinase k ( pk ) cleavage ( 11 ) do not enable a clear - cut discrimination of ch1641 - like from bse ( 12 ) , we investigated the potential of denaturation with gdnhcl as a further discriminatory strategy within the framework of the istituto superiore di sanit discriminatory wb ( 11 ) . to this aim , samples were untreated or treated with 3.5 mol / l gdnhcl before pk digestion and wb analysis with saf84 and p4 monoclonal antibodies ( figure 1 ) . this method was set up by analyzing representative scrapie , bse , and ch1641 samples ( figure 1 ) . as expected , bse and ch1641 were poorly detected by p4 , in contrast to classical scrapie . treatment with 3.5 m gdnhcl , however , nearly abolished pk resistance of prp from classical scrapie and ch1641 , but not from sheep bse , thus also enabling discrimination of ch1641 from bse . representative western blot showing the differential n - terminal proteinase k cleavage ( monoclonal antibodies saf84 vs. p4 ) and the susceptibility to denaturation of different transmissible spongiform encephalopathy isolates . samples are indicated according to table 2 : classical scrapie isolates ( sc1 , sc2 , sc3 , sc4 ) ; experimental ch1641 ( ch1 ) ; ch1641 - like isolates ( ch2 , ch3 , ch4 ) ; experimental sheep bovine spongiform encephalopathy by intracerebral transmission ( bs1 ) and oral transmission ( bs2 , bs3 , bs4 , bs5 ) ; natural goat isolate ( bs6 ) . all samples were pretreated ( + ) or not treated ( - ) with 3.5 mol / l guanidine hydrochloride for 1 h at 37c and then diluted to a final concentration of 0.35 mol / l guanidine hydrochloride , before digestion with proteinase k according to the istituto superiore di sanit discriminatory method . we then analyzed a larger set of samples ( table 2 ) , including natural bse in a goat ( figure 1 ) . these experiments confirmed the higher resistance to denaturation of bse samples , irrespective of the species , prp genotype , and route of inoculation , compared with all other samples ( figure 1 ) . when the antibody ratio and the denaturation ratio were measured and plotted as a scattergraph , classical scrapie , ch1641 , and bse isolates clustered into 3 distinct groups ( figure 2 , panel a ) : 1 ) scrapie isolates displayed antibody ratios 2 and denaturation ratios were 0.020.13 ; 2 ) ch1641 samples had antibody ratios 2 and denaturation ratios were 0.060.29 ; and 3 ) bse samples had antibody ratios 2 , but denaturation ratios were 0.51 . * blot lanes shown in figure 1 . a ) scattergraph of antibody ratio and denaturation ratio obtained from each sample in table 2 , showing discrimination of scrapie , ch1641 , ch1641 - like , and bovine spongiform encephalopathy ( bse ) samples . the antibody ratio is the saf84 / p4 ratio of the chemiluminescence signal relative to the saf84 / p4 ratio of the control scrapie loaded in each blot ( technical appendix ) . the denaturation ratio , obtained from the saf84 blot , is the ratio between the chemiluminescence signal with 3.5 mol / l and that with 0 mol / l . the vertical dashed line refers to the cutoff value of the antibody ratio , according to the istituto superiore di sanit discriminatory western blot ( antibody ratio 2 ) . the horizontal dashed line ( denaturation ratio 0.4 ) shows the separation of bse samples from all other transmissible spongiform encephalopathy sources . b ) scattergraph of proportions of diglycosylated and monoglycosylated prpres bands from samples in table 2 . classical scrapie samples are represented by black symbols , ch1641 by red symbols , and bse samples by blue symbols . glycoform profiles , i.e. , the relative proportion of diglycosylated , monoglycosylated , and unglycosylated prp fragments , have also been reported as a discriminatory criterion for the identification of bse in sheep ( 810 ) , as well as when compared with ch1641 ( 8,10 ) . with the istituto superiore di sanit wb method ( figure 2 , panel b ) , field scrapie isolates , including ch1641 - like isolates , were characterized by a lower diglycosylated - to - monoglycosylated glycoform ratio ( 0.48:0.350.58:0.25 ) than sheep bse ( 0.65:0.250.75:0.19 ) and the natural goat bse ( 0.70:0.22 ) . because the analysis of prp from sheep prion isolates by cssa showed an extremely high conformational stability of bse samples , we improved the istituto superiore di sanit discriminatory wb by including a pretreatment of brain homogenates with gdnhcl . our results show that the combined use of 2 independent molecular features , n - terminal cleavage by pk and resistance to denaturation , could indeed differentiate classical scrapie and ch1641 - like isolates from small ruminant bse . nonetheless , we observed some variability among the ch1641 - like samples , either when analyzed by cssa ( table 1 ) or by the discriminatory wb . as previously reported ( 12 ) , the antibody ratios of some ch1641 - like samples were close to the cutoff ( figure 2 , panel a ) . furthermore , the variable conformational stability observed by cssa was also reflected in the denaturation ratios measured by discriminatory wb , with 2 ch1641 - like samples showing a relatively higher resistance to gdnhcl than to all other scrapie samples . because of the limited number of ch1641 - like isolates , further studies are needed to evaluate their effective range of variability . this variability may be disappointing for discriminatory purposes , but it may also hinder the possible presence of subtle prp conformational ( and possibly strain ) variants in ch1641 - like isolates . the biologic similarities of ch1641 - like samples after transmission to ovine transgenic mice ( 13 ) and voles ( u. agrimi , unpub . nevertheless , ch1641 - like isolates induced a certain degree of prp molecular variability in both rodent models ( 13 ; u. agrimi , unpub . data ) , which might be related to the molecular variability in prp extracted from sheep brain . although based on a limited set of samples , our study supports the notion that ch1641 - like isolates can be convincingly discriminated from small ruminant bse on molecular grounds . furthermore , the high conformational stability of bse , when compared with that in classical scrapie , nor98 , and ch1641 - like isolates , suggests the potential of the new discriminatory wb here proposed for discriminating bse from other known small ruminant tses .\noutput:\n" }, { "from": "agent", "value": "sheep ch1641 - like transmissible spongiform encephalopathy isolates have shown molecular similarities to bovine spongiform encephalopathy ( bse ) isolates . we report that the prion protein prpsc from sheep bse is extremely resistant to denaturation . this feature , combined with the n - terminal prpsc cleavage , allowed differentiation of classical scrapie , including ch1641 - like , from natural goat bse and experimental sheep bse ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the conventional methods of bone repair which commonly are used , including autografts and allografts , have their own shortcomings . autografts are limited in terms of the availability of materials and may result in donor site morbidity . using allografts may be more desirable in some cases but the possible immune reaction and infection transmission limit their application . to overcome these limitations , various synthetic bone substitutes made of metal , ceramics , polymers , etc . , have been introduced to accelerate and improve the process of bone regeneration , though their safety , effectiveness , and efficacy remain uncertain . recently , with the increasing number of invasive surgical procedures especially in the fields of orthopedics and dentistry , the bone repair techniques using new materials are getting more popular . the new materials which are used should help us to reduce the operation time , scar size , postoperation pain , and also improve patient recovery . chitosan is a chitin - derived polymer which is produced by the deacetylation of chitin . these shells which were regarded as garbage in past times are a valuable source of chitin . many biomedical applications , including wound healing , bandage , skin grafting , hemostasis , hemodialysis , drug delivery , preventing dental plaque , hypertension control , calcium absorption , bilirubin absorption and cholesterol control , have been identified for improving by using chitosan . several desirable properties have been described for chitosan , including high osteoinductivity , osteointegratability , easy application , and gradual biodegradability that make it a good candidate for bone regeneration . some researchers have studied effects of chitosan compounds on animal bone repair . histopathological effects of chitosan on the bone regeneration process in wistar rats are presented in this study . , a chitosan powder was obtained from capsules made by springleaf co. ( sydney , australia ) . the contents of 20 capsules were removed to special plastic bags and sterilized by gamma radiation of 13 - 15 kgy . fifteen adult male wistar rats weighing 300 - 350 g were randomly assigned to one of three study groups : 1 - , 2 - , and 4 - week groups . the rats got anesthetized by a mixture of 2 % xylazine hydrochloride and 10 % ketamine hydrochloride . their legs were disinfected using the ethanol 70 % spray and shaved in the areas over tibias . the tibias were exposed through skin incisions and the periosteum was removed by a fine elevator . a 3 - 4 mm deep microdrill hole was then created in the upper part of each tibia using a microsurgery straight hand piece driven by surgic xt plus micromotor ( nsk , kanuma , japan ) with 3 - mm round burs ( xemax surgical product inc . , constant irrigation with cold sterile normal saline was applied to prevent thermal necrosis and wash away bone debris . the defects of right leg tibias were filled in by a sterilized chitosan powder mixed with a drop of rat blood and those of the left ones were left unfilled to serve as controls . the rats then were transferred to a warm room to recover from anesthesia and allowed an unrestrained activity in cages . they received 0.2 ml of ketoprofen via subdermal injection daily for 3 days as an analgesic and also 0.5 ml of floxacine for infection control . at 1 , 2 , and 4 weeks postoperation , the rats in respective groups were sacrificed by putting them into a container of diethyl ether 97 % . after fixation was completed , the legs were cut at 5 mm above and under the surgery site including the surrounding tissue and skin . those parts containing the hard tissue ( bone ) need to be decalcified for block preparation and sectioning . this step was performed by placing the samples in nitric acid 10 % for 24 hrs . the presence of water in the tissue prevents the penetration of the preparing material ( paraffin ) into the tissue . so in order to dehydrate the tissue , samples were placed in alcohol 50 % , 70 % , and 90 % and absolute alcohol and then were placed in xylol to substitute for alcohol ( dehydration process ) . in the infiltration step , samples were place in molten paraffin ( 50c ) . from the samples embedded in paraffin , serial microscopic sections of 3 - 4 m thick were prepared using a leica microtome ( leica microsystems , wetzlar , germany ) . then the slices from the repaired bone cavity were stained with hematoxylin and eosin for microscopic examination . the slices were studied using an olympus microscope ( olympus optical co. , ltd , tokyo , japan ) in a high - power field ( 400 ) . two slices from each defect were examined and graded by an expert pathologist for bone regeneration ( grades 1 - 3 ) , assessing inflammation ( grades 0 - 3 ) , foreign body reaction ( + / ) , bone vitality ( + / ) , and remained chitosan ( low , medium , high ) . bone regeneration was graded 1 if woven bone was seen , 2 if both woven and lamellar bones were seen , and 3 if just lamellar bone was seen . inflammation was graded as based on the number of infiltrative cells seen in a visual field , from 0 to 3 . the decision on foreign body reaction was made based on the presence of multinuclear giant cells . bone vitality was signed as positive if there were osteocytes inside lacunae . to test the hypothesis that chitosan accelerates bone repair , differences in bone regeneration between the intervention and control specimenswere analyzed by the kappa test , among 1 - , 2 - and 4 - week groups using spss version 11 ( spss inc . , chicago , il , usa ) . a p value less than 0.05 was considered as significant . fisher 's exact test was used to determine if the intervention groups were significantly different from the control group in terms of inflammation and bone regeneration against inflammation . the proposal of this study got approved by the ethics committee of shahid sadoughi university of medical sciences . fifteen adult male wistar rats weighing 300 - 350 g were randomly assigned to one of three study groups : 1 - , 2 - , and 4 - week groups . the rats got anesthetized by a mixture of 2 % xylazine hydrochloride and 10 % ketamine hydrochloride . their legs were disinfected using the ethanol 70 % spray and shaved in the areas over tibias . the tibias were exposed through skin incisions and the periosteum was removed by a fine elevator . a 3 - 4 mm deep microdrill hole was then created in the upper part of each tibia using a microsurgery straight hand piece driven by surgic xt plus micromotor ( nsk , kanuma , japan ) with 3 - mm round burs ( xemax surgical product inc . , constant irrigation with cold sterile normal saline was applied to prevent thermal necrosis and wash away bone debris . the defects of right leg tibias were filled in by a sterilized chitosan powder mixed with a drop of rat blood and those of the left ones were left unfilled to serve as controls . the rats then were transferred to a warm room to recover from anesthesia and allowed an unrestrained activity in cages . they received 0.2 ml of ketoprofen via subdermal injection daily for 3 days as an analgesic and also 0.5 ml of floxacine for infection control . at 1 , 2 , and 4 weeks postoperation , the rats in respective groups were sacrificed by putting them into a container of diethyl ether 97 % . after fixation was completed , the legs were cut at 5 mm above and under the surgery site including the surrounding tissue and skin . those parts containing the hard tissue ( bone ) need to be decalcified for block preparation and sectioning . this step was performed by placing the samples in nitric acid 10 % for 24 hrs . the presence of water in the tissue prevents the penetration of the preparing material ( paraffin ) into the tissue . so in order to dehydrate the tissue , samples were placed in alcohol 50 % , 70 % , and 90 % and absolute alcohol and then were placed in xylol to substitute for alcohol ( dehydration process ) . in the infiltration step , samples were place in molten paraffin ( 50c ) . from the samples embedded in paraffin , serial microscopic sections of 3 - 4 m thick were prepared using a leica microtome ( leica microsystems , wetzlar , germany ) . then the slices from the repaired bone cavity were stained with hematoxylin and eosin for microscopic examination . the slices were studied using an olympus microscope ( olympus optical co. , ltd , tokyo , japan ) in a high - power field ( 400 ) . two slices from each defect were examined and graded by an expert pathologist for bone regeneration ( grades 1 - 3 ) , assessing inflammation ( grades 0 - 3 ) , foreign body reaction ( + / ) , bone vitality ( + / ) , and remained chitosan ( low , medium , high ) . bone regeneration was graded 1 if woven bone was seen , 2 if both woven and lamellar bones were seen , and 3 if just lamellar bone was seen . inflammation was graded as based on the number of infiltrative cells seen in a visual field , from 0 to 3 . the decision on foreign body reaction was made based on the presence of multinuclear giant cells . to test the hypothesis that chitosan accelerates bone repair , differences in bone regeneration between the intervention and control specimens were analyzed by the kappa test , among 1 - , 2 - and 4 - week groups using spss version 11 ( spss inc . , chicago , il , usa ) . a p value less than 0.05 was considered as significant . fisher 's exact test was used to determine if the intervention groups were significantly different from the control group in terms of inflammation and bone regeneration against inflammation . the proposal of this study got approved by the ethics committee of shahid sadoughi university of medical sciences . all 30 rat tibias ( 15 with chitosan powder and 15 controls ) in three stages ( 1 , 2 , and 4 weeks after operation ) were blindly studied by a pathologist . the kappa test on both chitosan and control samples indicated that bone defects filled with the chitosan powder showed a significantly faster healing process compared to those of control ones at 1 week ( p = 0.01 ) and 4 weeks ( p = 0.038 ) after operation , whereas this difference was not statistically significant between the two groups after 2 weeks ( p = 0.197 ) . one week after the surgery , no woven bone was seen in either the chitosan or control specimens [ figure 1 ] , but 2 weeks and 4 weeks postoperation , more woven bone was observed in the chitosan specimens compared to that in the control specimens [ figures 2 and 3 , respectively ] . our results indicated that there was fibrosis in 4 specimens in the chitosan group after 1 week , while this number decreased to 2 after 2 weeks , and there was no case of fibrosis in the case group after 4 weeks . there was no fibrosis after 1 week in the controls and this number increased to 4 after 2 weeks , and to 3 after 4 weeks in controls . regarding the observation of the granulation tissue , it was seen in one of the cases in the chitosan group , and in five control cases after 1 week , while there were no cases in both groups after 2 and 4 weeks [ table 1 ; figures 2 and 3 ] . inflammation grading was made on the basis of the number of infiltrative cells in the high - power field of microscopic studies of the specimens . various grades of inflammation were seen in all three stages of the study . statistical analysis usingthe kappa test interestingly showed no significant difference in inflammation between the chitosan and control specimens [ table 2 ] . just 2 ( out of 15 ) chitosan specimens showed reaction to foreign bodies at 2 and 4 weeks after surgery identified by the presence of multinucleated giant cells , but the other specimens showed no reaction . the amount of chitosan remained in the micro - drilled defects was also assessed visually by a pathologist and was graded as low , moderate , and high . four weeks after surgery , the remained chitosan in four specimens was assessed and found to be low , and just one specimen was graded as moderate in this classification . micrographs of the tibia 1 week after surgery in a case ( left ) and a control ( right ) subject . ( a ) chitosan particles , ( b ) bone marrow , ( c ) microdrilled defect , ( d ) fibrous tissue , ( e ) granulation tissue with inflammatory cells micrograph of the tibia 2 weeks after surgery in case ( left ) and control ( right ) groups . ( a and e ) woven bone , ( b ) tibia bone , ( c ) bone marrow , ( d ) chitosan particles micrograph of tibia 4 weeks after surgery in case ( left ) and control ( right ) groups . ( a ) woven bone and surrounding connective tissue , ( b ) remaining chitosan bone healing status of case ( chitosan ) and control specimens at three different stages comparing inflammation severity between chitosan and control specimens at three different stagesan ideal material for bone regeneration , as indicated by prior studies , should be biocompatible , biodegradable , easy to apply , and effective on bone repair . since chitosan has been shown by shin et al . , and other researchers to possess these properties , we studied its effectiveness on bone defect healing in micro - drilled tibias in rats . it is important for bone replacement materials to be highly adaptable to the bone defects . we used chitosan in the form of powder to fill in the bone defects and remain there for local absorption . also to comparethe treated bone healing with those of untreated , the defects in the control bones were left unfilled . our study is different from the others in terms of using pure chitosan instead of chitosan compounds and also applying it in a powder form to achieve good adaptation to bone defects . chevrier et al . , showed in their study that chitosan increases vascularization and induces granulation tissue generation . the achieved results at 1 week postoperation showed granulation tissue in all control specimens , while in the chitosan group fibrosis of various degrees was seen . this trend of a faster bone regeneration process could be seen in subsequent stages . at 2 weeks postoperation , a mixture of woven bone and fibrous tissue ( with superiority of the woven bone ) was seen in treated defects , whereas in untreated ones , the fibrous tissue was dominant . , four weeks after surgery , woven bone was seen in all chitosan - treated specimens , whereas just two specimens in the control group developed woven bone . it has been observed that chitosan , a natural biopolymer which is derived from chitin , and some of its derivatives , such as chitosan dihydrochloride , may act as wound healing accelerators , bone substitutes , antimicrobial agents , and may show hemostatic activities . it is documented that these substances are biodegradable and nontoxic . recently , chitosan composites have been widely used in bone tissue engineering due to their unique properties such as low foreign body reactions , biocompatibility , and their moldability . chitosan can act as a hydrating agent and can be processed into different forms such as scaffolds , nanoparticles , and gels . it is also believed that the chitosan composite improves the mechanical strength of the scaffold material . mathews et al . , proposed that chitosan can increase mineralization by upregulating the associated genes as a mechanism for the osteogenesis of this substance . boynueri et al . , in their study found that the chitosan gel combined with the demineralized bone matrix / collagenous membrane or even alone is useful for periodontal regeneration although spin - neto et al . , found that these substances were not able to promote new bone formation in critical size defects which were made in rat 's calvaria . in their study found that chitosan tubes have a favorable compatibility with the bone tissue and promote bone regeneration and may accelerate bone formation stimulated by recombinant human bone morphogenetic protein - 2 . in another study , budiraharjo et al . , found that hap - coated cmcs scaffolds can act as osteogenic scaffolds for the stimulation of bone healing . geffre et al . , compared the osteoinductivity of purified chitosan cap and the conventional form and found that the former substance had a lower osteoinductivity potential . inflammation was associated with chitosan group in higher degrees than the control group in all three stages of the study . reaction to the foreign body was seen in two cases of chitosan - treated defects , and both of them were accompanied by sever inflammation . this reaction could be due to the dislocation of the chitosan powder or some other clinical manifestation . the remaining chitosan at 4 weeks postoperation was less than that at 1 and 2 weeks which shows a proper descending trend . this decrease could be mainly due to local absorption by the surrounding tissues , though we could not rule out the probability of physical withdrawal from the filled - in site during the time . . these differences could be due to variation in techniques , animal subjects , or type of the bone selected . we used chitosan in a pure powder form whereas other studies used it as compounds with some other materials like hydroxyapatite and calcium sulfate . bone mass , blood perfusion of the repairing bone , and also the species of the animal used as subjects are important parameters when considering the final results of such studies . this study shows that chitosan is effective in bone regeneration in the micro - drilled rat tibia . considering the osteoinductivity of chitosan , it can be used to promote bone repair in situations where rapid bone regeneration is of high importance or there is a lack of normal osteogenesis due to systemic disorders . some more studies with different animal subjects and techniques are needed to approve safety and long - term effects of this material .\noutput:\n" }, { "from": "agent", "value": "background : chitosan compounds have been shown to be suitable bone replacement materials . to evaluate the accelerating effects of chitosan on the bone regeneration process and assessing its histopathological adverse effects , we conducted this study on rat tibias.materials and methods : in a laboratory experimental study , micro - drilled bone defects were created in the upper tibia of each leg in 15 adult male rats . the defect in the right leg , filled by the chitosan powder , was compared with the untreated defect in the left leg in each rat at 1 , 2 , and 4 weeks after surgery . bone repair and inflammation in each specimen was blindly graded by a pathologist . reaction to the foreign body and the amount of the remaining chitosan were studied in chitosan - treated specimens at the three stages of the study.results : bone repair was significantly faster in the chitosan group , 1 week ( p = 0.01 ) and 4 weeks ( p = 0.038 ) after surgery , while the difference was not significant at the 2 - week stage ( p = 0.197 ) between chitosan and control groups . chitosan - induced inflammation was not significant in any stage of the study . reaction to the foreign body was seen in one case at 2 weeks and one case at 4 weeks postoperation.conclusion : chitosan significantly accelerated the bone regeneration process in rat tibias . regarding its biocompatibility and osteoinductivity , it can be studied as a biomaterial in human bone healing ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: when afflicted by hydatid disease , humans are accidental intermediate host for the cestode parasite echinococcus granulosus . once lodged in the liver , the hydatid cyst grows steadily at a rate dependent on the resistance offered by the surrounding tissues . initially asymptomatic , clinical complaints arise as a result of compression of the adjacent organs due to the growing cyst or complications like rupture , infection or fistulisation . though , occasionally hydatid cysts are known to regress spontaneously , in the overwhelming majority , therapeutic intervention is necessary . conservative management in the form of medical therapy or percutaneous aspiration of cyst have been described . a variety of surgical procedures have been described using conventional open techniques , including pericystectomy , de - roofing the cyst with omentoplasty , marsupialisation and liver resection . but one of the chief concerns during surgical treatment of hydatid cyst remains the possibility of cyst rupture and spillage and its containment . this poses a two - fold danger - an immediate one of anaphylactic reaction as the hydatid fluid is highly allergenic and a delayed risk of dissemination of the disease in the peritoneal cavity . the difficulty in containing spillage , should it occur , during laparoscopic management is much greater than in open conventional surgery . this factor has always been a deterrent to surgeons from widely adopting laparoscopic surgery as the mode to treat this disease . we describe the correct technique to utilize a specialised hydatid trocar system , designed to allow spillage - free evacuation of hydatid cysts and also enable intra - cystic inspection for residual daughter cysts and cyst - biliary communications . this is a retrospective review of all cases of hydatid cyst presenting to us for management between january 2007 and december 2011 . laparoscopic management was offered to all patients diagnosed with hydatid cyst , except those in segments vii and upper viii of the liver , totally intrahepatic cysts ( small cysts , with no surface protruding beyond the liver ) and patients unfit for surgery under general anaesthesia . the patients were evaluated clinically and routine laboratory tests were carried out including liver function tests . all patients were subjected to an initial screening ultrasonography followed by a computed tomography ( ct ) scan of the abdomen . in patients with features of obstructive jaundice and cholangitis , patients were started on albendazole in a dose of 10 mg / kg body weight for 1 month pre - operatively and then posted for surgery . after surgery , two more cycles of albendazole were administered in the same dosage , each cycle lasting 4 weeks with a gap of 1 week between the two cycles . all patients were operated under general anaesthesia in a modified lithotomy position so that the thighs were parallel to the body , with the table in a reverse trendelenburg position . the operating surgeon stood between the legs of the patient , the camera surgeon on the right side of the patient and the assistant surgeon on the left side of the patient . apart from the standard laparoscopic equipment , for hydatid cyst surgery , certain special provisions are made . two powerful suction machines are required in the operation theatre . ideally , two separate camera systems and monitors ( one for the laparoscopic view and one for the intracystic view ) would be needed . two laparoscopes are needed - a 30 one for the laparoscopic view and a 0 one for the intracystic view . care should be taken that the scope used for the intracystic view is not inserted laparoscopically to avoid anaphylactic reaction from the contaminating hydatid fluid . the hydatid trocar system , also known as the palanivelu hydatid system ( om surgicals , mumbai , india ) consists of a canula and trocar set , which have been modified for the purpose of this particular surgery . in addition , it has a 10 mm outlet for attaching the suction pipe , labelled a in the photograph . its tip is faceted and each facet bears a fenestration , labelled e. its shaft also has two fenestrations , labelled d , opposite to each other approximately in the middle of its length . at its other end , there is an attachment for connecting the suction apparatus , labelled c in the photograph . depending on the size of the cyst , the camera port is placed supra - umbilically in the midline . an additional port may be required for retraction of gall bladder , which is placed in the right flank . the hydatid trocar is inserted over the most prominent non - dependent part of the hydatid cyst . once the hydatid trocar canula system is introduced inside the abdominal cavity , the trocar is removed and the canula is advanced till its surface is in firm contact with the cyst surface [ figure 3a ] . a gauze piece soaked in 0.5 % cetrimide solution is arranged around the hydatid canula on the liver surface . the outlet a is connected to a suction machine which is turned on , creating a firm vacuum seal between the canula and the hydatid cyst [ figure 3b ] . the trocar is inserted inside till its tip just touches the cyst wall without penetrating it . its outlet c is connected to another suction machine which is turned on [ figure 3c ] . with a firm thrustcyst contents flow into the hollow trocar through the fenestrations e and are suctioned away [ figure 3d ] . part of the cyst contents will flow through the trocar into the canula via the mid - shaft fenestrations at d and are suctioned off through the canula outlet a [ figure 3e ] . when the flow lessens , a regular 10 mm suction canula is introduced through the hydatid canula and further cyst contents are evacuated [ figure 3f ] . when no further material is coming , the carbon dioxide insufflation is attached to the hydatid canula at b and gas is allowed to flow at a pressure setting of 2 - 3 mm of hg . a 0 scope is introduced into the cyst and the interior of the cyst wall is inspected to confirm that it is denuded of all germinal epithelium [ figure 4 ] . if remnant daughter cysts are seen , the canula is stabilized such that its end is directly over the cysts ; the scope is withdrawn and replaced with a suction canula . by repeating this manoeuvre patiently , then the cyst is filled with 0.5 % cetrimide solution ( if the initial fluid was clear and bile - free ) , which is allowed to remain inside for 10 minutes and then suctioned off . correct use of the hydatid trocar canula thereafter , the hydatid canula is removed ; the cyst wall is opened up and excised , placed in a specimen bag and removed . if any such are identified , they are overrun with interrupted sutures of 3 - 0 polyglactin 910 . the cavity is packed with omentum , which is held in place by stitches taken to liver edge . patients are started liquids orally after 12 hours and discharged once they are afebrile and with nil drainage . patients were called for follow - up at 7 days , 30 days , 6 months and yearly thereafter . a total of 16 patients were eligible to be included in this analysis . there were six males ( 37.5 % ) and 10 females ( 62.5 % ) . the average age of the patient was 37.6 years ( range : 23 - 58 years ) . of the total , 14 patients ( 87.5 % ) had a rural agrarian background while two patients ( 12.5 % ) were coming from an urban setting . the commonest presenting complaint was abdominal pain or heaviness , exacerbated by meals , a symptom reported by 11 ( 68.8 % ) of the patients . an upper abdominal swelling or mass was noticed only by 5 patients ( 31.3 % ) . one patient had features of cholangitis with pain , fever and jaundice while one patient ( 6.3 % ) was diagnosed while being investigated for unrelated complaints . the right lobe of the liver was involved in 12 cases ( 75 % ) , the left lobe of liver in four cases ( 25 % ) and cyst - biliary communication was diagnosed pre - operatively in one patient ( who had presented with features of cholangitis ) . all patients were started on albendazole orally and were scheduled for surgery a month later . the duration of surgery ranged from 55 min to 120 min ( mean : 86 minutes ) . post - operatively , port site infection was reported in three patients ( 18.8 % ) . the range of hospital stay was from 3 days to 15 days ( average : 6.8 days ) . out of the 16 patients , 13 ( 81.3 % ) have remained in regular follow - up . hydatid disease is an endemic entity in several parts of the indian sub - continent . the life - cycle of the parasite is such that human infestation is likely in areas where they live in proximity to the intermediate hosts ( sheep , goat , etc ) as well as the definitive hosts ( dogs ) . however , in areas where there is a population of stray dogs , adults as well as children coming in contact with infected strays can get infested with the parasite . this may explain the reason for the disease in two of our patients who belonged to an urban background with no history of contact with livestock but contact with stray dogs was present in both these cases . in our study , however , a few studies have shown the parasite to have equal predilection for either sexes . the disease is known to progress asymptomatically for several years due to the slow growth of the cyst , before manifesting with symptoms related to pressure effects on surrounding organs , infection or rupture . rupture of the cyst into the biliary tree releases the daughter cysts into the biliary system , causing obstruction , jaundice and infection , as was seen in one of our patients . both ultrasonography and ct scan are reported to be highly effective in diagnosing liver hydatid disease . these modalities can even detects signs of overt or impending rupture and cyst - biliary communication . finding has also been noted by other researchers . amongst the agents available for medical treatment , albendazole is by far the most popular due to its greater absorption and penetration . it has a well - defined role as an adjunct to surgery , to reduce post - operative recurrence , as also in disseminated disease and inoperable cases . at our institute , it is a standard practice to give all patients a 3 months course of albendazole , preferably posting the patient for surgery after completion of the first month of drug therapy . while surgery has established itself as the definitive therapeutic modality for this disease , laparoscopic surgery has its own limitations . minimal invasive surgery is not suitable for cysts located intra - parenchymally in the liver , or located in the posterior segments of the right lobe of livers or in recurrent disease due to the extensive adhesions involved . large calcified cysts will not collapse by simple drainage and partial excision , but may require pericystectomy . such radical procedures are associated with higher intra - operative blood loss , prolonged operative time and higher post - operative morbidity . multiple cysts can be managed individually , as long as their surfaces are accessible to the hydatid trocar canula or they are interconnected . the main concern in laparoscopic drainage of hepatic hydatid cyst is regarding spillage of hydatid fluid . to reduce this possibilitythe device that we utilize , the palanivelu hydatid system , allows maintaining a seal while draining the cyst , preventing any leakage of cyst fluid . it also allows complete evacuation of the cyst and its contents and facilitates intra - cystic inspection of the cyst . the affectivity of the device can be gauged from the fact that we did not encounter a single case of anaphylaxis or delayed abdominal recurrence , both evidence of spillage while draining the cyst , in our series . we carry out intracystic inspection of the hydatid cyst by inserting the scope into the hydatid canula and expanding the cyst wall using insufflation at a pressure of 2 - 3 mm of hg . this manoeuvre has been described in a previous paper by palanivelu et al . , and we confirm its efficacy in allowing inspection of the intracystic contents and clearance of remnant germinal epithelium and daughter cysts . we also perform omental packing of the cyst to reduce dead space and problems associated with it . the patient presented with features of obstructive cholangitis and was treated with initial endoscopic retrograde drainage of common bile duct with evacuation of pus and daughter cysts and subsequent laparoscopic drainage of hydatid cyst . this condition occurs when the rupture is present on the sides , the cyst wall as well as the adjoining biliary channel with interchange of contents . patients with such frank intrabiliary rupture may not always have biliary obstruction but may simply have presence of bile in the cyst before surgical intervention . acarli also describes a simple cyst - biliary communication in with the rupture is only on the side of the biliary channel while the cyst wall is intact . in such cases , when the cyst wall is punctured and it collapses , the bile may then leak into the remnant cavity . in these patients , an observant surgeon sees that after introducing the drainage channel into the cyst , the initial effluent is colourless hydatid fluid and bile staining appears after some time . in several cases , there may not be any overt bile staining per operatively but minor biliary leak may appear in the drainage tube in the post - operative period , almost always responding to conservative management . this explains the presence of bile - stained effluent in the drainage tube in two of our patients , both of which stopped spontaneously . the post - operative morbidity rate has been reported in a range varying from 6 % to 47 % . in our series , the post - operative morbidity , in addition to the two cases of minor biliary leakage , consisted of three cases of port site infection . all the cases were managed conservatively . except for one case of biliary leak , which persisted for 12 daysrecurrence can be local due to incomplete evacuation of the cyst or abdominal due to spillage of cyst contents during evacuation . recurrence rate with cyst evacuation and omentoplasty has been reported in the range of 6 - 25 % . radical surgeries like total pericystectomy or hepatectomy are associated with lower recurrence rates but higher complications . while none of the patients in our series show evidence of recurrence , one has to remember the slow growth rate of the cyst and absence of symptomatology in early disease . this implies that these patients require prolonged follow - up with yearly ultrasonography as late manifestation of recurrence is known . hydatid cyst of the liver is a condition commonly encountered in several parts of the country . using proper instrumentation and correct technique , it is possible to treat most of these parasitic cysts using minimal invasive techniques both safely and effectively .\noutput:\n" }, { "from": "agent", "value": "introduction : this study was undertaken to demonstrate the efficacy of the hydatid trocar canula system for safe and effective treatment of hepatic hydatid cysts.materials and methods : all cases presenting to our centre for treatment of hydatid cyst of the liver with certain exceptions were considered for laparoscopic management using the specifically designed hydatid trocar canula system . the technique of surgery and the step wise sequence of deployment of the device are described.results : since january 2007 , 16 patients compromising six males and 10 females underwent this procedure at our centre . the average age of the patients was 37.6 years and all of them had a single cyst . the average duration of surgery was 86 minutes . none of the cases suffered intraoperative mishap like spillage or anaphylaxis . till date , follow - up has been maintained in 81.3 % of the patients and no recurrence has been detected.conclusion : the correct use of the hydatid trocar canula system allows for spillage - free and complete evacuation of hepatic hydatid cysts ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: on january 24 , 2014 , the european commission and the world organisation for animal health received reports from lithuanian authorities of 2 cases of asf in wild boars . one of the infected animals was found in salcininkai and the other in varena , 5 km and 40 km , respectively , from the belarus border ( 7 ) . then , on february 14 and 17 , 2014 , reports of 2 cases of asf in wild boars were received from northeastern poland ( sokolka county , podlaskie province ) . one of the infected animals in poland was found in the municipality of szudzialowo ; the other was found in kruszyniany , a forest area ( 8 ) . the 2 wild boars in poland were found dead 900 m and 200 m , respectively , from poland s border with belarus . asfv - positive clinical samples ( spleen , kidney , lung , bone marrow ) from the 4 infected wild boars were sent to the european union reference laboratory for asf , centro de investigacin en sanidad animal ( cisa - inia ) , madrid , spain , for confirmatory testing and genetic characterization . after the presence of asfv was confirmed in samples , initial genetic characterization was performed by using standardized genotyping procedures on virus dna extracted directly from homogenized tissues and from bone marrow samples . these analyses included the c - terminal end of the p72 gene , the full sequence of the p54 gene , and the central variable region within the b602l gene ( 9 ) . we also included in the study 21 genotype ii asfvs that were isolated from wild and domestic pigs in russia and the caucasus region during april 2007june 2013 ( table ) . * crv , central variable region ; dp , domestic pig ; ewb , european wild boars . we compared the nucleotide sequences obtained from the p72 - and p54 - based pcrs with those of previously described representative isolates ( 10 ) . minimum evolution trees , rooted at the midpoint , were constructed by using mega v6 .0 ( http://www.megasoftware.net/ ) with the p - distance nucleotide substitution model . the 2014 asfvs from lithuania ( lt14 / 1482 , lt14 / 1490 ) and poland ( pol14 / sz and pol14 / krus ) clustered , as expected , within p72 genotype ii ( figure 2 ) and showed 100 % nucleotide identity with all compared asfv isolates from eastern europe across the 478 - bp c - terminal p72 gene and the 558 - bp full length p54 gene . we obtained the same result by sequencing the central variable region within the b602l gene , revealing 10 copies of amino acid tetramer repeats that were 100 % identical and unique to those of the asfv circulating in the caucasus regions since 2007 ( 11 ) . minimum evolution ( me ) phylogenetic tree of african swine fever virus ( asfv ) isolates from lithuania and poland based on the c - terminal end of the p72 coding gene relative to the 22 p72 genotypes ( labeled i - xxii ) , including 88 nt sequences . the tree was inferred by using the me method ( http://www.megasoftware.net/mega4/webhelp/part_iv___evolutionary_analysis/constructing_phylogenetic_trees/minimum_evolution_method/rh_minimum_evolution.htm ) following initial application of a neighbor - joining algorithm . the percentage of replicate trees 50 % in which the associated taxa clustered together by bootstrap analysis ( 1,000 replicates ) is shown adjacent to the nodes . the robustness of the me tree was tested by using the close - neighbor - interchange algorithm at a search level of 1 . squares indicate asfv isolates from lithuania and poland that were genotyped in this study ; circles indicate asfv isolates during 20072013 from the caucasus region . although the central variable region has proven useful for resolving epidemiologic complexities at the genotype ( 12 ) , country ( 13 ) , and region levels , additional genome markers are required to determine the origin and to map the spread of closely related asfv isolates circulating in eastern europe . thus , we designed a set of primers , named eco1a ( 5 - ccatttatcccccgctttgg - 3 binding site 172,270172,290 ) and eco1b ( 5 - tcgtcatcctgagacagcag - 3 binding site 172,616172,626 ) , to amplify a 356 - bp fragment located between the i73r and i329l genes and characterized by the presence of trs ( 14 ) . primer binding sites were based on the genome of the asfv from georgia ( genbank accession no . fr682468 .1 ) . using the same reaction conditions as used for full p54 gene amplification ( 10 ) and an annealing temperature of 60c , we generated 367 - bp amplicons from isolates from ukraine , belarus , lithuania , and poland . the estimated size of the remaining isolates from eastern europe that were included in the study was 356 bp ( data not shown ) . nucleotide sequence analysis of the pcr products revealed that the size difference was caused by the insertion of an additional trs ( ggaatatata ) at nt 136 ( figure 3 ) . partial nucleotide sequence alignment of the intergenic region between i73r and i329l in african swine fever virus ( asfv ) isolates from eastern and central europe , including a virus isolated in 2007 in georgia ( georgia2007 ; genbank accession no . the mutation that results in the insertion of a single nucleotide internal repeat sequence ( ggaatatata ) in the asfvs from belarus , ukraine , lithuania , and poland is indicated by gray shading . current available molecular data derived by using standardized genotyping procedures ( 9 ) have indicated the presence of only 1 asfv variant . that variant belongs to p72 genotype ii , which has been circulating in eastern european countries since the introduction of asfv into georgia in 2007 ( 11 ) . in agreement with those findings , results from our analysis of the 3 independent regions included in the classical genotyping showed that sequences for asfv isolates from lithuania and poland were 100 % homologous with those for asfvs from eastern europe . however , the long - term presence of asfv in russia and the caucasus regions and the rapid spread of the virus to neighboring countries highlight the need for finding additional asfv genome markers capable of discriminating among circulating virus isolates so that we may better determine their source and evolution . the whole - genome sequence analysis of asfv has identified some regions that contain tandem repeat arrays that have proven useful for discriminating between closely related asfvs ( 15 ) . thus , the approach described in our study focused on analysis of the trs in the intergenic region between the i73r and i329l genes at the right end of the genome ( 14 ) . the results showed that the viruses from poland and lithuania had a trs insertion identical to that present in asfv isolates from belarus and ukraine . this trs insertion was absent in the remaining viruses from eastern europe , including those obtained in tver oblast , russia , in 2012 and in georgia in 2007 . these molecular data , together with the epidemiologic findings , confirmed that the asfvs detected in poland and lithuania most probably originated from belarus . however , knowledge of the epidemiology of asf and a full understanding of the evolution and spread of asfv in this region require additional sequence analysis of asfvs currently circulating in russian regions bordering belarus and ukraine . our results show the genetic variability among asfvs circulating in eastern europe and describe a new method that can be useful for distinguishing between closely related asfv isolates . such genetic data are essential for determining the source and studying the evolution of asfv isolates and to fully elucidate the spread of asfv in the eastern and central european countries .\noutput:\n" }, { "from": "agent", "value": "african swine fever virus ( asfv ) was first reported in eastern europe / eurasia in 2007 . continued spread of asfv has placed central european countries at risk , and in 2014 , asfv was detected in lithuania and poland . sequencing showed the isolates are identical to a 2013 asfv from belarus but differ from asfv isolated in georgia in 2007 ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: all bats submitted to the texas department of health rabies laboratory for rabv testing from 1996 to 2000 ( n = 3,989 ) were used in this study . all bats were either identified upon receipt or frozen and saved for future speciation . a key based on external characteristics of adult bats from the bats of texas ( 4 ) species identifications were confirmed by comparing specimen data with the more detailed descriptions in that book . brain tissues from rabv - positive bats were tested by direct immunofluorescence ( centocor , malvern , pa ; chemicon , temecula , ca ) for their reaction with mabs against the nucleoprotein of the rabv ( 5 ) . mabs were provided by cdc and have been used extensively to identify rabvv ( 1,610 ) . rna in brain material was extracted with trizol , according to the manufacturer s instructions , then reverse transcribed and amplified by polymerase chain reaction using primers 10 g and 304 ( 11 ) . amplicons purified by using the wizard tm minipreps dna purification system ( promega , madison , wi ) were sequenced with the abi prism dna sequencing kit ( pe applied biosystems , foster city , ca ) , according to manufacturer s instructions . automated fluorescence sequencing was performed on an applied biosystems 310 dna sequencer ( pe applied biosystem ) . nucleotide sequence from a 302 - bp region of the rabv nucleoprotein ( bp 1175 to 1476 ) was aligned with pasteur rabv , genbank accession no . nucleotide sequence for texas bat samples was compared to the 17 genetic lineages of rabv identified for bat samples in a cdc repository ( genbank accession nos . a phylogenetic analysis of the sequence data was conducted by using the programs dnadist , neighbor , seqboot , and consense in the phylip package , version 3.5 ( 14 ) . graphic representation of the phylogenetic analysis was obtained with the program treeview ( 15 ) . during the 5 - year study period , more than 96 % ( n = 3,830 ) of all bats submitted from 1996 to 2000 were easily speciated ; 159 ( 3.8 % ) were too decomposed , damaged , or immature for reliable identification to species or were inadvertently discarded before identification was complete . this dataset includes representatives from 19 of the 32 species found in texas ; also included are desmodus rotundus from the fort worth zoo and one or two species of fruit bats . tadarida brasiliensis was the most common species submitted for testing , followed by lasiurus borealis . rare submissions include mormoops megalophylla , myotis austroriparius , m. californicus , m. ciliolabrum , m. thysanodes , m. yumanensis , antrozous pallidus , and nyctinomops macrotis . the prevalence of rabv in the submitted samples remained fairly constant ; prevalence ranged from 8.9 % in 1998 to 12.4 % in 1997 with an average prevalence of 11 % . l. cinereus had the highest average positivity rate ( 26.3 % ) followed by t. brasiliensis ( 16.4 % ) ; this finding is in agreement with results of a recent study of the continental united states ( 16 ) . n. humeralis had the lowest average positivity rate ( 0.7 % ) ( table 1 ) . mab reaction patterns have been identified , and the complete n gene sequence is available from genbank for the rabv associated with t. brasiliensis , l. borealis , l. cinereus , l. intermedius , and eptesicus fuscus ( table 2 and figure ) . adequate material was available for examination of 407 of 416 rabies - positive samples ( 19962000 ) from these five bat species in texas by antigenic analysis ; 402 of 407 samples had reaction patterns that were expected for the species . genetic analysis was used to confirm the antigenic typing result of 14 of the 407 samples typed by antigenic methods ; other texas samples included in the analysis are two samples not submitted to the texas department of health , seven samples from 1986 to 1995 , and 10 samples from bat species not commonly found rabid in texas . p , positive ; n , negative ; w , weakly positive . genetic lineages of rabies virus in texas bat populations . lineages were determined by using the unweighted pair group method using arithmetic averages ( upgma ) method on the basis of 302 nucleotides of nucleoprotein gene sequence . representatives of each lineage were deposited in genbank under the following accession numbers : 31 , af394876 ; 26 , ay039224 ; 24 , af394886 ; 23 , af394883 ; 22 , ay170247 ; 29 , ay208163 ; 28 , af394878 ; 9 , ay208164 ; 5 , ay208165 ; 1 , af394887 . mab reaction pattern 1 described the rabv in 331 of 332 samples from t. brasiliensis . mab reaction pattern 2 was found in 1 of 332 samples , suggesting interspecific infection through contact with l. borealis ; however , no rabv genetic material could be amplified from the t. brasiliensis sample displaying reaction pattern 2 . reference samples from t. brasiliensis collected in texas in 1984 , 1993 , and 1998 clustered in lineage 31 with virus from t. brasiliensis collected across the range of these bats in the united states . mab reaction pattern 1 was found in 1 of 46 samples , suggesting interspecific infection through contact with t. brasiliensis ; however , the finding was not confirmed by genetic analysis . this sample , txlb 5770 , clustered in lineage 26 with reference samples of l. borealis collected in texas in 1986 and virus from l. borealis collected elsewhere in the eastern united states . l. cinereus samples displaying reaction pattern 3 ( n = 4 ) clustered in lineage 23 with l. cinereus samples collected across the range of these bats in the united states . one l. cinereus sample ( txlc4259 ) differed in its reaction with the mab panel ( 1 - n , 12 - w , 19 - n , 7 - w , 13w ) , but genetic analysis showed the sample clustered with other l. cinereus samples in lineage 23 . the reaction pattern of the two exceptional l. intermedius samples was not known to be associated with any bat species . because the cdc repository contains only florida l. intermedius samples , seven texas l. intermedius samples of reaction pattern 4 were submitted for genetic analysis . five of the seven samples clustered in lineage 29 , a lineage new to the cdc repository and not in genbank . two of the seven samples clustered in lineage 28 with l. intermedius samples from florida . the two texas l. intermedius samples with unrecognizable mab patterns ( 1 - w , 12 - n , 19 - n , 7 - w , 13 - n ; 1n , 12 - w , 19 - n , 7 - w , 13 - p , respectively ) clustered in lineage 29 ( txli5768 ) and lineage 23 ( txli4260 ) by genetic analysis . this sample was unavailable for genetic analysis , but a 1994 texas e. fuscus sample ( txef4250 ) with reaction pattern 5 rabv shared 99 % identity with rabv samples from western big brown bats in lineage 1 ( shown as representative samples from colorado and arizona ) . the remaining 11 rabies - positive samples from texas bats were collected from m. velifer , l. seminolus , l. ega , or n. humeralis . because no mab reaction patterns or genetic lineages have been established for these species , 10 of 11 samples were typed by antigenic and genetic methods . the mab reaction pattern for one sample from n. humeralis was determined , but the sample was unavailable for genetic analysis . sample txmv4267 displayed reaction pattern 1 and also clustered with other samples from t. brasiliensis in lineage 31 in the genetic analysis . the mab reaction pattern of sample txmv4270 is not known to be associated with any bat species ( 1 - n , 12 - n , 19 - n , 7n , 13 - p ) , but the genetic analysis showed an association with l. cinereus in lineage 23 . mab reaction pattern 2 was found in txmv4258 ; however , genetic typing indicated lineage 5 , a lineage new to the cdc repository . lineage 5 was also found in sample txmv4256 , which had displayed an mab reaction pattern not known to be associated with any bat species ( 1 - n , 12 - p , 19 - n , 7 - w , 13 - p ) . no other samples of lineage 5 exist in the cdc repository , and the repository contains only one other sample from m. velifer ( from california ) . the california m. velifer sample clustered with t. brasiliensis samples in lineage 1 ( not shown ) . the n. humeralis samples ( n = 3 ) had previously unrecognized yet identical reaction patterns ( 1 - n , 12 - p , 19 - n , 7 - p , 13 - n ) , as did two reference samples from this species collected in 1995 . two of the 1998 n. humeralis samples ( txnh4267 and txnh4269 ) and two reference samples ( txnh3011 and txnh3012 ) indicated lineage 9 , a lineage new to the cdc repository ; that repository contains only one other sample of a lineage 9 rabv , an m. austroriparius from florida ( not shown ) . the only additional rabv sample from n. humeralis in the repository , also from florida , clustered with l. borealis samples in lineage 26 ( not shown ) . the two rabv samples from l. seminolus displayed mab pattern 2 , associated with l. borealis . both samples ( txls4274 and txls5769 ) clustered with rabv from l. borealis in lineage 26 . three additional samples from l. seminolus in the cdc repository ( all from florida ) also clustered with l. borealis samples ( not shown ) . the l. ega sample ( txle4266 ) displayed a unique mab pattern ( 1 - p , 12 - n , 19 - n , 7p , 13 - p ) and clustered in lineage 22 with three samples from l. ega bats from arizona . four additional samples from l. ega in the cdc repository did not contain a lineage 22 rabv . these samples contained lineages 1 and 23 , which suggests infection through contact with t. brasiliensis and l. cinereus , respectively . for those laboratories without genetic typing capability , antigenic analysis with mabs offers a rapid , simple , and inexpensive means of typing rabv for epidemiologic surveys . our study suggests mab typing can be useful for large - scale surveys in which hundreds to thousands of virus samples originate from only one or two bat species and the question is simply do we find in these species the rabvv that we expect to find ? all but 5 of 407 samples from t. brasiliensis , l. borealis , l. cinereus , l. intermedius , and e. fuscus tested in this study displayed the mab patterns expected for the species . surveys that rely solely on antigenic typing underestimate the true diversity of rabv in bat populations and may oversimplify rabies transmission cycles . for example , antigenically identical samples from both l. borealis and l. intermedius segregate as two different genetic lineages ( figure ) ( 13 ) . this pattern of divergence does not correlate with time or the area in which either species was collected and must reflect some as - yet unknown aspect of natural history that partitions and segregates virus populations . these findings suggest not only that genetic typing offers a more precise identification of a rabvv but also that genetic analysis of rabv may help us better understand how the natural history of the host drives viral evolution . the observed genetic diversity among the 23 samples sequenced for this study was unexpectedly large for such a small sample set . two lineages ( 5 and 29 ) consisted solely of texas samples ; lineage 9 had been identified previously in only one other sample ( an m. austroriparius from florida ) ; and lineage 22 had been identified previously only in l. ega samples from arizona . the small number of samples in these four lineages does not allow designation of reservoir status for these species , but the genetic diversity in the rabv in texas reflects the diversity of bat species in the southwestern united states and suggests that many , if not all , bat species transmit distinctive rabv . identification of the species association of different variants of rabv could lead to valuable information about routes of virus transmission and mechanisms by which rabv persists in different bat populations .\noutput:\n" }, { "from": "agent", "value": "bats submitted to the texas department of health ( 19962000 ) were speciated and tested for rabies virus antigen by direct immunofluorescence microscopy . antigenic analysis of rabies virus positive specimens was performed with monoclonal antibodies against the nucleoprotein of the virus ; atypical or unexpected results were confirmed by genetic analysis of nucleoprotein sequence ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: transmembrane beta - barrel ( tmb ) proteins form a beta - barrel as a single beta - sheet joined at its edges . the sheet is all - next - neighbor ( 1 ) , meaning all paired strands are adjacent in sequence . the architecture can be described as the repeating pattern , where up means towards the extracellular side : n - term , [ up - strand , outer loop , down - strand , periplasmic hairpin ] n , c - term . proftmb , originally published in ( 2 ) provides a prediction of residues in these four states ( example figure 1 ) . it exploits statistical features of tmbs including enrichment of beta - and gamma - hairpins in the periplasm , lengths of outer loops , hydrophobic belt , and follows several design ideas from other hidden markov model ( hmm ) - based tmb predictors ( 3,4 ) . atypical gram - positive bacteria called mycolata , which have thicker mycolic acid containing outer membranes . users submit one or more fasta - formatted protein sequences . for each sequence , proftmb builds a psi - blast profile and runs the prediction , attempting to find the best fit of the protein to its tmb - based architecture , indicated as a z - value . results are always returned on a webpage , and take 4 min per 500 - residue protein . in the case of more than one sequence , an email of the results url is sent . if the query protein receives z - value 4.0 , proftmb provides a four - state ( upward - strand , downward - strand , outer loop , periplasmic loop ) per - residue prediction . graphical output consists of color - coded four state posterior probability plots and amino acid sequence ( figure 1 ) . amino acid color indicates the final prediction , and usually corresponds to the state with maximum posterior probability , but with corrections based on context shown with lighter - weight font [ described in decoding section of the supplementary data of ( 2 ) ] . while we did not quantify confidence levels for per - residue prediction , higher z - values tend to have fewer corrected residues and greater contrast in state posterior probabilities . in the example shown ( figure 1 ) , ompa from escherichia coli [ pdb : 1g90 ( 5 ) chain a ] this result is expected , given proftmb was trained on very similar sequences . in most predictions on real tmbs , also , most strand and loop states have the best state close to probability 1 . in the second example shown ( figure 2 ) , heme acquisition system protein a from serratia marcescens , of the gammaproteobacteria class ( gram - negative ) illustrates a false positive prediction . in fact , the structure [ pdb : 1b2v ( 6 ) ] consists of a seven - stranded beta - sheet against four - helices . notice that predicted strands four , five and six have poor contrast in posterior probability , indicating a poor fit to the proftmb model . finally , proteins shorter than 140 or longer than 1392 residues receive z - value 10000 ( data not shown ) . the lower length of 140 is a conservative estimate of the smallest possible tmb , while the upper bound reflects the limit of our test set for z - value calibration . occasionally , proftmb will assign z - value less than four to a known tmb . unfortunately , in such a case , the fact that it is a tmb ca n't be used to help produce a reliable per - residue prediction since proftmb derives the prediction from sequence alone . this occurred in about 15 % of the cases in our test set ( see performance evaluation in methods tab on website ) . in our original paper ( 2 ) we used psi - blast profiles run with options h 1 ( e - value cutoff for inclusion in next pass ) and j 2 ( number of iterations ) , and did not explore the effect of different profiles on proftmb accuracy , either for whole protein or per - residue prediction . since then , we have run 8-fold jackknife tests ( leave one out , seven in ) on the original swiss - prot sequence versions of eight pdb structures ( settmbfull : 1a0s_p , 1af6_a , 1bt9_a , 1fep_a , 1prn , 1qd5_a , 1qj9_a , 1qjp_a ) . we built sets of psi - blast profiles with 30 different combinations of settings h { 1 , 0.1 , 0.01 , 0.001 , 0.0001 , 0.00001 } and j { 2 , 3 , 4 , 5 , 6 } and used each set in a separate jackknifed test . the original q2 accuracy , with settings h 1 j 2 was 86.0 % , while the best settings , h 0.0001 j 2 achieved 87.3 % q2 accuracy . as a result , we changed the defaults to h 0.0001 j 2we have not estimated the effects of psi - blast settings on whole - protein prediction yet . currently , z - value and resulting estimated accuracy and coverage are calibrated from our original sequence - unique set called setroc , containing a representative set of proteins from swiss - prot . as sequence databasesare updated , we will periodically re - calibrate z - values . a cluster plot and resulting accuracy versus coverage curve can be found in thepredictions on 78 gram - negative proteomes are available in the download section , updated since original publication as follows . first , length - adjusted bits score was replaced by z - value , which gives slightly improved discrimination on our test set ( unpublished data ) . second , per - residue predictions were re - run using updated psi - blast profiles , with option h 0.0001 rather than h 1 . third , the model architecture now explicitly includes begin and end states , representing the beginning and end of the amino acid sequence . the proftmb software is a general profile - hmm allowing specification of model architecture , encoding and decoding . the training data , consisting of eight tmb sequences with hand - annotated per - residue labeling based on their 3d structures , is available as well . interested users may download and compile the c++ source code and use proftmb with the original training data or modify it . we make it available in the spirit of reproducibility , and encourage interested readers to contact the authors for more detailed advice . true positive output example . proftmb prediction for ompa from e.coli [ pdb : 1g90 ( 5 ) chain a ] , a true tmb . note that predicted strands have high contrast between state probabilities for a majority of their length . heme acquisition system protein a ( hasa ) from serratia marcescens [ pdb : 1b2v ( 6 ) ] , a secreted hemophore with architecture beta - alpha - beta ( 6 ) - alpha ( 2 ) according to scop ( 7 ) . predicted strands four , five and six show poor contrast in state probabilities and\noutput:\n" }, { "from": "agent", "value": "proftmb predicts transmembrane beta - barrel ( tmb ) proteins in gram - negative bacteria . for each query protein , proftmb provides both a z - value indicating that the protein actually contains a membrane barrel , and a four - state per - residue labeling of upward - and downward - facing strands , periplasmic hairpins and extracellular loops . while most users submit individual proteins known to contain tmbs , some groups submit entire proteomes to screen for potential tmbs . response time is about 4 min for a 500 - residue protein . proftmb is a profile - based hidden markov model ( hmm ) with an architecture mirroring the structure of tmbs . the per - residue accuracy on the 8-fold cross - validated testing set is 86 % while whole - protein discrimination accuracy was 70 at 60 % coverage . the proftmb web server includes all source code , training data and whole - proteome predictions from 78 gram - negative bacterial genomes and is available freely and without registration at ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the prevalence of palpable thyroid nodules has been estimated to be around 37 % , while the prevalence on nonpalpable nodules , detected by thyroid ultrasound or incidentally discovered by mri or carotid doppler ultrasound , is much higher ( 2076 % ) . moreover , 2048 % of patients with a palpable nodule have another nodule detected by ultrasound . once a thyroid nodule has been detected , further investigations are required , like fine - needle aspiration ( fna ) , thyroid function test , or scintigraphy . once the diagnosis has been made , the patients may be referred to surgery , radioiodine therapy , laser / radiofrequency ablation , or follow - up . in patients residing in iodine deficient areas , a medical treatment with levothyroxine may be advised . in aace - ame - eta guidelines for thyroid nodules , it is indicated that the optimal time interval for patients follow - up is 618 months , in lack of specific studies that address this issue . given the high prevalence of thyroid nodules and the number of patients with cytologically benign nodules with a normal thyroid function that periodically should be checked by ultrasound and thyroid function tests , it is easy to understand the global impact on the health care system deriving from such disease . the aim of this study is to ascertain an optimal time interval of consultations , in order to guarantee an effective monitoring , but avoid an excessive and useless execution of consultations , function test , and ultrasound , for a benign disease that is also often asymptomatic . we retrospectively selected patients who in 2007 - 2008 had their first visit for thyroid disease and had been diagnosed with euthyroid unimultinodular goiter and had cytological benign exam and completed their follow - up for five years ( 2012 - 2013 ) , with at least 3 visits during this period ( baseline , 60 months , and at least one other visit in between ) . as per our institutional protocolpatients are submitted to fna in case of nodules greater than 10 mm , irrespective to presence or absence of characteristics of malignancy and in case of nodule smaller than 10 mm , just in presence of characteristics of malignancy . then , from the initial population of thyroid patients we excluded those with hypothyroidism , hyperthyroidism , drugs interfering with thyroid function ( as listed in the ata / aace guidelines ) , and positive thyroid antibodies ( when available ) ; we also excluded those patients who , after their initial workup , underwent thyroid surgery , radioiodine therapy , or ethanol ablation , were lost at follow - up , had nodules smaller than 5 mm , and were submitted to suppressive therapy with levothyroxine . from such selected population , the following data were recorded : sex , age , tsh , number of nodules , diameter of the nodule in case of uninodular goiter , and diameter of the major nodule in case of multinodular goiter ; for the aim of the study , we considered in five - year follow - up the following events as relevant : appearance of new nodules larger than 10 mm ; appearance of new nodules smaller than 10 mm with characteristics of malignancy ; increase in nodule diameter greater than 50 % from baseline ; appearance of dyspnea , dysphonia , dysphagia , and local discomfort ; execution of a fna on the same nodule already examined at baseline or on a new nodule ; any other situation that indicates surgery or any other treatment that excluded the patient from follow - up ; development of thyroid dysfunction . ultrasounds were performed with a 7.5 mhz linear probe ( logiq 7 ge or mylab25 gold esaote ) by three endocrinologists with consolidated experience in thyroid ultrasound ; the three diameters ( anteroposterior , transverse , and longitudinal ) of each nodule were usually reported ; the major of the three diameters was always reported and used for the present study . permission for this review and analysis was granted by the investigational review board at the v. fazzi hospital . results are presented according to patient and nodule , respectively , and compared using a t - test or a test , as appropriate . of these , 555 were hypothyroid , 98 were hyperthyroid and treated with antithyroid drugs , 75 underwent radioiodine treatment for graves ' disease or plummer adenoma , 100 underwent thyroid surgery for compressive symptoms or malignancy , 527 had nodules smaller than 5 mm , were lost at follow - up , or had less than 3 visits , 100 had chronic autoimmune thyroiditis in euthyroidism , 25 were treated with ethanol ablation for cystic nodules , and 43 underwent suppressive therapy with levothyroxine for nodular goiter . this latter group of patients spontaneously chose to be treated with levothyroxine , after exhaustive explanation ; the treatment was not assigned on medical decision basis ; then , the exclusion of this group should not represent a bias in analysis of results . then , the study population consisted of 249 patients with euthyroid uni - / multinodular goiter , with benign fna . characteristics of study population are described in table 1 . a total of 82 events occurred in 65/249 patients ( 26.1 % ) in 5 - year follow - up period . the events were the following : 38 new nodules , 23 increase of nodule diameter 50 % in respect to baseline , 5 increase of nodule diameter 50 % but appearance of local discomfort with compressive symptoms , 6 thyroidectomies ( with 2 having incidentally discovered micropapillary cancer at histological exam ) , 5 repetitions of fna on the same nodule detected at baseline , and 5 fna on new nodules . the reaspiration of the 5 nodules was done in those who had an increase of diameter 50 % in respect to baseline and diameter 20 mm . in 18/65 patients we recorded more than one event ( e.g. , increase of nodule diameter 50 % and fna ) . no patients developed thyroid dysfunction , nor was the appearance of metastatic lymph nodes observed . of the 5 nodules that were reaspirated , no false - negative fna was detected . none had a spontaneous reduction of thyroid nodule greater than 50 % in respect to baseline .71.9 % of events ( 59/82 ) were detected at 24 - and 36 - month follow - up visits ( p 0.01 ) ; appearance of new nodules and increase of nodule 50 % represent 50 % of all events that occurred in 5 - year follow - up ( p 0.01 ) ( figure 1 ) . given the high prevalence of benign nodular disease in the general population , an optimal management of such disease would be useful in order to adequately monitor the patients , while minimizing useless consultations , thyroid function test , and ultrasounds . data of the present study show that , of all the possible events considered , 72 % were detected between 2 and 3 years after the initial evaluation and that it is almost unnecessary to reevaluate the patients in 12 months . indeed , this is the first study where in a 5 - year follow - up patients were strictly and regularly followed up in this time period and , differently from other studies , all the possible events that may occur in the natural history and management of a thyroid nodule were considered . several retrospective studies investigated the natural course of benign thyroid nodules and the possible usefulness of a reaspiration , trying to help the clinician in managing these patients . in a 5 - year follow - up study , brander et al . found that , of 34 benign individual nodules , about one - third had grown and one - fourth had diminished or disappeared and , in 12 % of cases , new nodules were detected ; of those who underwent another fna , no false - negative case was diagnosed . in a japanese study , kuma et al . reexamined 134 patients 10 years after the first assessment ; results showed that in a considerable number of cases nodules shrank or disappeared and in about 20 % they enlarged , and all but one were confirmed to be benign at cytological exam . another investigation from germany that collected either functioning or nonfunctioning benign nodules showed that half of the nodules increase by 30 % at 3 years . an increase by at least 15 % was detected in 89 % of nodules after a 5 - year follow - up and , of those who were reaspirated for significant increase of volume , just 1/74 was revealed to be malignant . data from the same study demonstrated that nodules with greater cystic content were less likely to grow than solid nodules . the abovementioned studies are hardly comparable because of differences in follow - up time , criteria used to define nodule enlargement , other than ethnic differences , or environmental factors like daily iodine intake ; but taking data together , one can conclude that the natural course of benign thyroid nodules is characterized by a slow and progressive growth , and another common finding is that false - negative results have been found to be quite rare in all the records . a debated issue in this field involves the usefulness of reaspirating a nodule that has been classified as benign at the first evaluation . in a study by lucas et al . published 20 years ago , 116 female patients underwent repetition of fna after 1 year of the first fna . the authors detected no changes in the size or consistency of patients ' nodular goiters , and no false - negative case was revealed . few years later , a series composed of 45 patients who underwent one or two fna after the first benign diagnosis showed no false - negative result , and all the seven patients who underwent thyroidectomy for compressive symptoms revealed a benign histological exam . then , in terms of follow - up for patients with a diagnosed benign thyroid nodule , a pivotal point to be addressed is when and in which cases the repetition of fna may be indicated . a study by rosrio and purisch consisting of 895 nodules put in evidence that the repetition of fna is useful in detecting false - negative cases , when the nodule shows characteristics of malignancy at ultrasound rather than when it grows . this concept was more recently confirmed by a multicentre study stating that evaluating 700 nodules initially diagnosed as benign showed that false - negative results were found in 13 % of cases ( depending on the centre ) and that the likelihood of a cytologically benign nodule with suspicious us characteristics being malignant was higher than that of one without suspicious us ( 4.7 % versus 0.8 % ; p 0.05 ) . the same low rate of false - negative fna was demonstrated by the studies by torre and oertel , while we have to be reminded that , in about 2/3 of cases , false - negative results pertain to nodules larger than 30 mm . finally , a more recent study by nou et al . suggests that because thyroid malignancies appear adequately treated despite detection at a mean of 4.5 years after initial falsely benign cytology , the authors suggest repeating thyroid nodule evaluation 24 years after the first fna . although the selection of patients and the outcome of our study and the study by nou et al . are different , our data allow reaching similar conclusions , suggesting a long term follow - up . in clinical practice , the interval time of 2 - 3 years suggested by the abovementioned results should anyway take into account the us characteristics of nodules . in the evaluation of data , we did not consider the nodule 's features like echogenicity , shape , margins , or vascularity , which are of pivotal importance when planning patient 's follow - up . in conclusion , in a population of patients with uni - / multinodular goiter and benign fna , about 1/4 develops a further event after initial work - out in 5 - year follow - up . in half of the cases , appearance of a new nodule or an increase bythe vast majority of new events were observed at 24 - and 36 - month follow - up visits these results confirm that a patient diagnosed with benign nodular goiter may be safely followed up at 2 - 3 - year interval time . this lapse of time seems to be longer than the 618 months suggested by current guidelines and , if routinely implemented , would hesitate in dramatic savings for the health care system , without entailing additional risks for the patient 's health .\noutput:\n" }, { "from": "agent", "value": "to determine an optimal time for follow - up of benign thyroid nodules , we retrospectively evaluated 249 euthyroid patients with uni - multinodular goiter , who underwent annual visit , and significant events that occurred in 5 years ' time were registered . a significant event ( appearance of new nodule , increase of nodule diameter > 50 % , appearance of compressive symptoms , thyroidectomy , repetition of fna on the same nodule , and execution of fna on new nodule ) occurred in 26.1 % of patients , with more than one event occurring in the same patient in 27.7 % of cases . the majority of events ( 71.9 % ) were observed at 24 - and 36 - month follow - up visit . these results suggest that a patient diagnosed with benign nodular goiter may be safely followed - up at a 2 - 3 - year interval time ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: kidney disease manifests clinically as elevated albumin excretion rate ( aer ) , impaired glomerular filtration rate ( gfr ) , or both , and is a cause of substantial morbidity and mortality in type 1 diabetes ( t1d ) . in early cohort studies , up to 40 % of patients with t1d developed macroalbuminuria ( aer 300 mg / 24 h ) , and up to 75 % of these patients progressed to end - stage renal disease ( esrd ) within 10 years ( 1,2 ) . moreover , the presence and severity of kidney disease have been consistently and strongly associated with increased risks of cardiovascular disease ( cvd ) and death ( 3,4 ) . a large body of evidence demonstrates that hyperglycemia contributes to the damage of target organs , including the kidney ( 5 ) . moreover , poor glycemic control has been consistently associated with increased risk of developing kidney disease in t1d ( 2,6 ) . the diabetes control and complications trial ( dcct ) tested the hypothesis that intensive diabetes therapy ( int ) aimed at lowering glucose concentrations as close as safely possible to the normal range would reduce the risk of developing microalbuminuria ( aer 40 mg / 24 h ) , macroalbuminuria , and other complications of t1d , compared with conventional therapy ( con ) ( 7 ) . the epidemiology of diabetes interventions and complications ( edic ) study the observational study following the dcct has examined and continues to examine the extent to which the effects of int observed during the dcct are durable ( 8 ) . in addition , the edic has examined the long - term effects of int on related outcomes , such as impaired gfr and hypertension , as well as the evolving clinical course of kidney disease in t1d . this article summarizes the most important published dcct / edic findings related to kidney disease . the dcct enrolled 1,441 people with t1d from 19831989 to determine the effects of int on the long - term complications of diabetes ( 7,9 ) . the primary prevention cohort was characterized by diabetes duration 15 years , aer 40 mg / 24 h , and no retinopathy by fundus photography . the secondary intervention cohort was characterized by diabetes duration 115 years , aer 200 mg / 24 h , and at least one microaneurysm in either eye ( but no more than moderate nonproliferative retinopathy ) . for both cohorts , serum creatinine 1.2 mg / dl or creatinine clearance 100 ml / min / 1.73 m was required for eligibility . hypertension , defined as systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or treatment with antihypertensive medications , was an exclusion criterion . participants were randomly assigned to receive int or con , as described in detail elsewhere ( 7,9 ) . subsequently , all surviving participants were invited to join the observational edic , which continues today . during edic , mean hba1c levels , which were separated by 2 % during dcct , became similar for the two original dcct treatment groups ( 8 ) . aer was measured yearly during dcct and every other year during edic using supervised 4 - h urine collections ( 10,11 ) . urine albumin was measured at the dcct / edic central biochemistry laboratory ( cbl ) at the university of minnesota using a fluoroimmunoassay ( interassay coefficient of variation 8.4 % ) . serum creatinine was measured annually throughout dcct / edic at the cbl ( interassay coefficient of variation 3 % ) . all results were calibrated to national institute of standards and technology isotope dilution mass spectrometry assigned values ( 12 ) . the chronic kidney disease epidemiology collaboration equation was used to estimate gfr from calibrated serum creatinine , age , sex , and race ( 13 ) . hypertension was defined as two consecutive study visits with systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or the use of antihypertensive medications ( 14 ) . the effects of dcct int on aer , estimated gfr , and hypertension were tested according to intention to treat . hazard ratios ( hrs ) were estimated using cox proportional hazards models , which incorporated death as a competing risk when evaluating impaired gfr as the outcome ( 12 ) . risk reduction associated with int was calculated as ( 1 hr of int vs. con ) 100 % . proportion of effect explained by dcct hba1c was the proportion of int effect explained by statistical adjustment for the treatment group difference in dcct mean hba1c . cumulative incidence of microalbuminuria or macroalbuminuria by diabetes duration was quantified using a nonparametric estimator that allows for interval - censored observations ( 15,16 ) . of the 1,441 dcct participants , 680 ( 47 % ) were female and 1,390 ( 96 % ) were caucasian . at dcct baseline , mean ( sd ) age was 26.8 ( 7.1 ) years and mean ( sd ) duration of diabetes was 5.9 ( 4.2 ) years . measures of kidney disease were predominantly normal : median ( interquartile range ) aer was 11.5 ( 7.218.7 ) mg / 24 h and mean ( sd ) serum creatinine concentration was 0.68 ( 0.14 ) mg / dl . aer was 40 mg / 24 h for 1,365 participants ( 95 % ) and 40200 mg / 24 h for 76 participants ( 5 % ) . during the dcct , among the 1,365 participants with baseline aer 40 mg / 24 h at baseline , int reduced the risk of developing incident microalbuminuria ( aer 40 mg / 24 h ) by 39 % ( 95 % ci 2152 % ) ( table 1 ) ( 7 ) . significant effects were observed for participants in both the primary and secondary intervention cohorts , with risk reductions of 34 % ( 256 % ) and 43 % ( 2158 % ) , respectively ( 17 ) . effects of int on the development of microalbuminuria and macroalbuminuria during the dcct and during edic years 18 during edic years 18 , among participants who did not develop microalbuminuria during the dcct , participants previously assigned to dcct int continued to experience a lower risk of incident microalbuminuria ( risk reduction 59 % [ 95 % ci 3973 % ] ) ( 8 ) . the effects of int on microalbuminuria during the dcct and edic were largely explained by group differences in mean dcct hba1c ( table 1 ) . during the dcct , int reduced the risk of macroalbuminuria ( aer 300 mg / 24 h ) by 54 % ( 95 % ci 2974 % ) ( table 1 ) ( 7 ) . this effect was significant among participants in the secondary prevention cohort ( 15 vs. 36 cases , risk reduction 56 % [ 95 % ci 1876 % ] ) but not in the primary prevention cohort , where few cases were observed ( 3 vs. 6 cases , risk reduction 44 % [ 95 % ci 124 to 86 % ] ) ( 17 ) . during edic years 18 , among participants who did not develop macroalbuminuria during the dcct , participants previously assigned to dcct int had an 84 % lower risk of developing incident macroalbuminuria ( 95 % ci 6792 % ) ( 8 ) . as with microalbuminuria , the effects of int on macroalbuminuria were largely explained by group differences in mean dcct hba1c ( table 1 ) . from dcct baseline through edic year 16 , 70 participants developed impaired gfr , defined as a sustained estimated gfr 60 ml / min / 1.73 m on two consecutive study visits ( 12 ) . cumulative incidence curves by treatment assignment began separating 10 years after dcct randomization ( fig . / edic follow - up , participants assigned to dcct int had a 50 % lower risk of developing impaired gfr ( 95 % ci 1869 % ) . cumulative incidence of impaired gfr ( sustained estimated gfr 60 ml / min / 1.73 m ) by dcct treatment group , accounting for death as a competing risk . reproduced with permission from de boer et al . adjustment for dcct mean hba1c fully explained the effect of int on impaired gfr . in parallel , adjustment for updated mean aer explained 90 % of the effect of int on impaired gfr ( 12 ) . relative risk reductions for more advanced stages of gfr loss were similar in magnitude to those for estimated gfr 60 ml / min / 1.73 m ( table 2 ) . however , these risk reductions were not all statistically significant , likely due to small numbers of events . int reduced the risk of a composite outcome of impaired gfr or death , demonstrating that beneficial effects on impaired gfr were not attributable to a possible competing risk of death . effects of int on the development of impaired gfr during the dcct / edic from dcct baseline through edic year 12 , 630 participants developed incident hypertension ( fig . however , int during the dcct reduced the risk of incident hypertension during edic follow - up . over combined dcct / edic follow - up , int reduced the risk of hypertension by 20 % ( 95 % ci 621 % ) . adjustment for treatment group differences in dcctparallel analyses suggested that aer explained a smaller portion of the effect of int on hypertension and that weight gain with int slightly blunted the effect on hypertension that would have otherwise been seen ( 14 ) . cumulative incidence of hypertension ( two consecutive study visits with systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or the use of antihypertensive medications ) by dcct treatment assignment . reproduced with permission from de boer et al . the detailed long - term data collected during dcct / edic have enabled assessment of the clinical course of kidney disease in t1d . these analyses suggest that int has modified the clinical course of kidney disease and have allowed further characterization of disease progression in this population . thirty years after diabetes diagnosis , the cumulative incidences of microalbuminuriaand macroalbuminuria were lower among participants assigned to int versus con . the 30 - year cumulative incidence of microalbuminuria , defined for the observational analyses as sustained aer 30 mg / 24 h to be consistent with recent guidelines ( 18,19 ) , was 25 or 38 % among participants assigned to int or con , respectively ( fig . similarly , the 30 - year cumulative incidence of macroalbuminuria or worse , defined for this analysis as aer 300 mg / 24 h or serum creatinine 2 mg / dl , was 9 or 25 % , respectively ( 16 ) . cumulative incidence of persistent microalbuminuria ( aer 30 mg / 24 h on two consecutive study visits ) in the dcct / edic , by duration of t1d and dcct treatment assignment . reproduced with permission from de boer et al . ten years after developing persistent microalbuminuria , 28 , 15 , and 4 % of participants went on to develop macroalbuminuria , impaired gfr , and esrd , respectively ( fig . however , 40 % of participants with incident microalbuminuria regressed to persistent aer 30 mg / 24 h. lower hba1c was associated with more favorable renal outcomes after microalbuminuria diagnosis . cumulative incidence of long - term renal outcomes after the development of persistent microalbuminuria ( aer 30 mg / 24 h on two consecutive study visits , defining time 0 ) among 325 participants in the dcct / edic . normoalbuminuria ( aer 30 mg / 24 h on two consecutive study visits ) , macroalbuminuria ( aer 300 mg / 24h ) , impaired gfr ( estimated gfr 60 ml / min / 1.73 m on two consecutive study visits ) , and esrd are evaluated as parallel outcomes and are not mutually exclusive . macroalbuminuria was more strongly associated than microalbuminuria with gfr loss in the dcct / edic . mean rate of change in estimated gfr was 5.7 % per year ( 95 % ci 4.56.8 % ) in subjects who developed macroalbuminuria , compared with 1.2 % per year ( 1.21.3 % ) with aer 30 mg / 24 h and 1.8 % per year ( 1.61.9 % ) in subjects with microalbuminuria ( 20 ) . moreover , macroalbuminuria was associated with a more than a 15-fold increase in risk of developing impaired gfr ( hr 15.3 [ 95 % ci 8.926.3 ] ) . additional work has identified genetic predisposition , male sex , obesity , blood pressure , inflammation , vitamin d deficiency , and dyslipidemia as risk factors for the development and progression of kidney disease in dcct / edic ( 15,2128 ) . in edic , higher aer and higher blood pressure were associated with greater common and internal carotid intima - media thickness , a greater prevalence and severity of coronary artery calcium , reduced compliance of the aorta , and greater left ventricular mass ( 2932 ) . moreover , during the combined dcct / edic , microalbuminuria and macroalbuminuria were associated with nearly threefold increased risks of clinical cvd events ( hr 2.93 [ 95 % ci 1.854.65 ] and 2.57 [ 1.364.88 ] , respectively ) ( 33 ) . adjustment for treatment group differences in microalbuminuria and macroalbuminuria explained a minority of the beneficial effect of int on risk of clinical cvd events . of the 1,441 dcct participants , 680 ( 47 % ) were female and 1,390 ( 96 % ) were caucasian . at dcct baseline , mean ( sd ) age was 26.8 ( 7.1 ) years and mean ( sd ) duration of diabetes was 5.9 ( 4.2 ) years . measures of kidney disease were predominantly normal : median ( interquartile range ) aer was 11.5 ( 7.218.7 ) mg / 24 h and mean ( sd ) serum creatinine concentration was 0.68 ( 0.14 ) mg / dl . aer was 40 mg / 24 h for 1,365 participants ( 95 % ) and 40200 mg / 24 h for 76 participants ( 5 % ) . during the dcct , among the 1,365 participants with baseline aer 40 mg / 24 h at baseline , int reduced the risk of developing incident microalbuminuria ( aer 40 mg / 24 h ) by 39 % ( 95 % ci 2152 % ) ( table 1 ) ( 7 ) . significant effects were observed for participants in both the primary and secondary intervention cohorts , with risk reductions of 34 % ( 256 % ) and 43 % ( 2158 % ) , respectively ( 17 ) . effects of int on the development of microalbuminuria and macroalbuminuria during the dcct and during edic years 18 during edic years 18 , among participants who did not develop microalbuminuria during the dcct , participants previously assigned to dcct int continued to experience a lower risk of incident microalbuminuria ( risk reduction 59 % [ 95 % ci 3973 % ] ) ( 8 ) . the effects of int on microalbuminuria during the dcct and edic were largely explained by group differences in mean dcct hba1c ( table 1 ) . during the dcct , int reduced the risk of macroalbuminuria ( aer 300 mg / 24 h ) by 54 % ( 95 % ci 2974 % ) ( table 1 ) ( 7 ) . this effect was significant among participants in the secondary prevention cohort ( 15 vs. 36 cases , risk reduction 56 % [ 95 % ci 1876 % ] ) but not in the primary prevention cohort , where few cases were observed ( 3 vs. 6 cases , risk reduction 44 % [ 95 % ci 124 to 86 % ] ) ( 17 ) . during edic years 18 , among participants who did not develop macroalbuminuria during the dcct , participants previously assigned to dcct int had an 84 % lower risk of developing incident macroalbuminuria ( 95 % ci 6792 % ) ( 8 ) . as with microalbuminuria , the effects of int on macroalbuminuria were largely explained by group differences in mean dcct hba1c ( table 1 ) . from dcct baseline through edic year 16 , 70 participants developed impaired gfr , defined as a sustained estimated gfr 60 ml / min / 1.73 m on two consecutive study visits ( 12 ) . cumulative incidence curves by treatment assignment began separating 10 years after dcct randomization ( fig . / edic follow - up , participants assigned to dcct int had a 50 % lower risk of developing impaired gfr ( 95 % ci 1869 % ) . cumulative incidence of impaired gfr ( sustained estimated gfr 60 ml / min / 1.73 m ) by dcct treatment group , accounting for death as a competing risk . adjustment for dcct mean hba1c fully explained the effect of int on impaired gfr . in parallel , adjustment for updated mean aer explained 90 % of the effect of int on impaired gfr ( 12 ) . relative risk reductions for more advanced stages of gfr loss were similar in magnitude to those for estimated gfr 60 ml / min / 1.73 m ( table 2 ) . however , these risk reductions were not all statistically significant , likely due to small numbers of events . int reduced the risk of a composite outcome of impaired gfr or death , demonstrating that beneficial effects on impaired gfr were not attributable to a possible competing risk of death . from dcct baseline through edic year 12 , 630 participants developed incident hypertension ( fig . the incidence of hypertension was similar in int and con treatment groups . however , int during the dcct reduced the risk of incident hypertension during edic follow - up . over combined dcct / edic follow - up , int reduced the risk of hypertension by 20 % ( 95 % ci 621 % ) . adjustment for treatment group differences in dcctparallel analyses suggested that aer explained a smaller portion of the effect of int on hypertension and that weight gain with int slightly blunted the effect on hypertension that would have otherwise been seen ( 14 ) . cumulative incidence of hypertension ( two consecutive study visits with systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or the use of antihypertensive medications ) by dcct treatment assignment . reproduced with permission from de boer et al . the detailed long - term data collected during dcct / edic have enabled assessment of the clinical course of kidney disease in t1d . these analyses suggest that int has modified the clinical course of kidney disease and have allowed further characterization of disease progression in this population . thirty years after diabetes diagnosis , the cumulative incidences of microalbuminuriaand macroalbuminuria were lower among participants assigned to int versus con . the 30 - year cumulative incidence of microalbuminuria , defined for the observational analyses as sustained aer 30 mg / 24 h to be consistent with recent guidelines ( 18,19 ) , was 25 or 38 % among participants assigned to int or con , respectively ( fig . similarly , the 30 - year cumulative incidence of macroalbuminuria or worse , defined for this analysis as aer 300 mg / 24 h or serum creatinine 2 mg / dl , was 9 or 25 % , respectively ( 16 ) . cumulative incidence of persistent microalbuminuria ( aer 30 mg / 24 h on two consecutive study visits ) in the dcct / edic , by duration of t1d and dcct treatment assignment . reproduced with permission from de boer et al . ten years after developing persistent microalbuminuria , 28 , 15 , and 4 % of participants went on to develop macroalbuminuria , impaired gfr , and esrd , respectively ( fig . however , 40 % of participants with incident microalbuminuria regressed to persistent aer 30 mg / 24 h. lower hba1c was associated with more favorable renal outcomes after microalbuminuria diagnosis . cumulative incidence of long - term renal outcomes after the development of persistent microalbuminuria ( aer 30 mg / 24 h on two consecutive study visits , defining time 0 ) among 325 participants in the dcct / edic . normoalbuminuria ( aer 30 mg / 24 h on two consecutive study visits ) , macroalbuminuria ( aer 300 mg / 24 h ) , impaired gfr ( estimated gfr 60 ml / min / 1.73 m on two consecutive study visits ) , and esrd are evaluated as parallel outcomes and are not mutually exclusive . reproduced with permission from de boer et al . macroalbuminuria was more strongly associated than microalbuminuria with gfr loss in the dcct / edic . mean rate of change in estimated gfr was 5.7 % per year ( 95 % ci 4.56.8 % ) in subjects who developed macroalbuminuria , compared with 1.2 % per year ( 1.21.3 % ) with aer 30 mg / 24 h and 1.8 % per year ( 1.61.9 % ) in subjects with microalbuminuria ( 20 ) . moreover , macroalbuminuria was associated with a more than a 15-fold increase in risk of developing impaired gfr ( hr 15.3 [ 95 % ci 8.926.3 ] ) . sixty - one percent of participants who developed impaired gfr first developed macroalbuminuria . additional work has identified genetic predisposition , male sex , obesity , blood pressure , inflammation , vitamin d deficiency , and dyslipidemia as risk factors for the development and progression of kidney disease in dcct / edic ( 15,2128 ) . in edic , higher aer and higher blood pressure were associated with greater common and internal carotid intima - media thickness , a greater prevalence and severity of coronary artery calcium , reduced compliance of the aorta , and greater left ventricular mass ( 2932 ) . moreover , during the combined dcct / edic , microalbuminuria and macroalbuminuria were associated with nearly threefold increased risks of clinical cvd events ( hr 2.93 [ 95 % ci 1.854.65 ] and 2.57 [ 1.364.88 ] , respectively ) ( 33 ) . adjustment for treatment group differences in microalbuminuria and macroalbuminuria explained a minority of the beneficial effect of int on risk of clinical cvd events . in the dcct / edic , int resulted in substantial , durable reductions in the risks of microalbuminuria , macroalbuminuria , impaired gfr , and hypertension . for microalbuminuria and macroalbuminuria , beneficial effectsmoreover , during edic follow - up , the incidences of microalbuminuria and macroalbuminuria continued to be lower among participants previously assigned to dcct int , with risk reductions during edic years 18 that were even greater than those observed during the dcct itself . for impaired gfr and hypertension , beneficial effects of int were not observed during the dcct , but significant effects became apparent during long - term edic follow - up . the cumulative incidences of microalbuminuria and macroalbuminuria 30 years after diagnosis of diabetes were substantially lower among participants assigned to int versus con , providing further evidence that early int alters the clinical course of kidney disease in t1d . the term metabolic memory has been used to describe the differences in outcomes that persist or even expand after the original separation in chronic glycemia , based on treatment assignment , has disappeared . the persistent effects of int on microalbuminuria and macroalbuminuria during edic years 18 are striking examples of this phenomenon . the subsequent beneficial effects of int on impaired gfr and hypertension represent the long - term consequences of int . clinically , the important implication is that int applied early in the course of t1d has strong and long - lasting effects to reduce the long - term risks of kidney disease . importantly , the dcct / edic evaluated the effects of int on each of the two most important clinical features of diabetic kidney disease , int is the only intervention that has been demonstrated to reduce the risks of developing both albuminuria ( microalbuminuria or macroalbuminuria ) and impaired gfr in t1d . this emphasizes the importance of hyperglycemia in the pathophysiology of kidney disease in t1d and the primary role for glucose control in preventing both major manifestations of diabetic kidney disease in this population . the beneficial effects of int on the risks of microalbuminuria , macroalbuminuria , and impaired gfr were fully attenuated by statistical adjustment for hba1c . interestingly , in parallel , the beneficial effects of int on the risk of impaired gfr were also fully attenuated by statistical adjustment for aer . this suggests that a common set of disease mechanisms leading from hyperglycemia to both albuminuria and impaired gfr is interrupted by int . additional observations from the dcct / edic suggest that other mechanisms also contribute to the development of microalbuminuria , macroalbuminuria , and impaired gfr , and that these mechanisms may vary by disease manifestation . most participants who developed microalbuminuria did not go on to develop impaired gfr , and most but not all participants who developed impaired gfr first developed macroalbuminuria . blood pressure , obesity , and other metabolic factors appear to influence the development of kidney disease in t1d , in addition to hyperglycemia . these risk factors may offer additional treatment options to prevent and treat kidney disease in t1d , in addition to intensive glucose control . higher aer and blood pressure were associated with increased risks of cvds , including carotid atherosclerosis , coronary atherosclerosis , stiffening of the aorta , and left ventricular hypertrophy . taken together with similar observations in other cohorts ( 34,35 ) , these results suggest a central role for kidney disease in the macrovascular complications of t1d . the beneficial effects of int on kidney disease and blood pressure would therefore be expected to yield subsequent reductions in the risks of cvd . statistical modeling suggested that reductions in aer explained a minority of the beneficial effects of int on clinical cvd events , but such mediation analyses can underestimate the impact of covariates . future studies will further evaluate the impact of kidney disease on cvd in the dcct / edic , including the extent to which reductions in kidney disease with int affect risk of cvd over long - term follow - up . strengths of the dcct / edic include its randomized , controlled design with substantial separation in hba1c achieved by treatment assignment ; the detailed longitudinal characterization of diabetes complications ; and the unusually long duration of follow - up , particularly for a clinical trial . these strengths were made possible by dedicated research staff , consistent sponsor support , and , most important , the invaluable contributions of the dcct / edic participants . low numbers of esrd and cvd events have limited analyses of these outcomes to date . continued follow - up of the dcct / edic cohort will facilitate further examination of these events in the future . in conclusion , int applied early in the course of t1d resulted in clinically important , long - lasting reductions in the incidence of kidney disease . these benefits , combined with congruent reductions in the risks of retinopathy , neuropathy , cvd , and other diabetes complications , serve as a cornerstone of recommendations to control glycemia in t1d .\noutput:\n" }, { "from": "agent", "value": "objectivekidney disease manifests clinically as elevated albumin excretion rate ( aer ) , impaired glomerular filtration rate ( gfr ) , or both , and is a cause of substantial morbidity and mortality in type 1 diabetes ( t1d ) . the diabetes control and complications trial / epidemiology of diabetes interventions and complications ( dcct / edic ) study tested whether intensive diabetes therapy ( int ) aimed at lowering glucose concentrations as close as safely possible to the normal range reduces the risks of kidney disease and other diabetes complications.research design and methodsin the dcct , 1,441 participants with t1d were randomly assigned to int or conventional diabetes therapy ( con ) for a mean duration of 6.5 years . subsequently , participants have been followed for 18 years in the ongoing observational edic . standardized longitudinal measurements of aer , estimated gfr , and blood pressure were made throughout the dcct / edic.resultsduring the dcct , int reduced the risks of incident microalbuminuria ( aer 40 mg / 24 h ) and macroalbuminuria ( aer 300 mg / 24 h ) by 39 % ( 95 % ci 2152 % ) and 54 % ( 2974 % ) , respectively . during edic years 18 , participants previously assigned to dcct int continued to experience lower rates of incident microalbuminuria and macroalbuminuria , with risk reductions of 59 % ( 3973 % ) and 84 % ( 6792 % ) , respectively . beneficial effects of int on the development of impaired gfr ( sustained estimated gfr < 60 ml / min / 1.73 m2 ) and hypertension became evident during combined dcct / edic follow - up , with risk reductions of 50 % ( 1869 % ) and 20 % ( 621 % ) , respectively , compared with con.conclusionsin the dcct / edic , int resulted in clinically important , durable reductions in the risks of microalbuminuria , macroalbuminuria , impaired gfr , and hypertension ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the dayside polar cap boundary regions , including cusp and lowlatitude boundary layer ( llbl ) , are special regions in the magnetosphere through which plasma , momentum , and energy from the solar wind can have direct access to the upper atmosphere . typically , a significant amount of poynting flux and soft particle precipitation is deposited in these regions . it creates such a unique window in the geospace environment for the solar windmagnetosphereionosphere coupling and plays an important role to the precise specification of the upper atmosphere state during both quiet and active times . however , the size of these regions is small , for example , the cusp is typically 12 in geomagnetic latitude ( mlat ) , and the location is variable . it is very challenging to clearly identify them from the data and to precisely simulate it in the global models . using both satellite data and groundbased radar observations , the cusp can be identified in several different ways . defense meteorological satellite program ( dmsp ) satellites have polar sunsynchronous orbits at about 840 km . based on the particle observations on dmsp , newell and meng , newell et al . , and newell and meng showed that in the cusp the characteristic energy of electrons and ions is smaller than 200 ev and 2700 ev , respectively . the total energy flux of electrons and ions is larger than 610 kev / cm s sr and 110 kev / cm s sr , respectively . the statistical average size is 2.5 h in local time and 12 in mlat , which is centered near noon local time and 7080 mlat . combining multispacecraft observations with groundbased observations , the cusp structures have been examined systematically and it was reported that lower energy ions arrive at higher latitudes since lowest energy particles reflect at the edges of the cusp and highest energies penetrate deepest due to the converging magnetic field [ trattner et al . , the dayside polar cap boundary is quite complex and includes different regions , such as the llbl , the plasma mantle , and the cusp . those regions are very close to each other , and sometimes , it becomes very tricky to distinguish one from another . while the cusp proper has been suggested as be a more limited region of the cleft ( ionospheric signature of llbl ) localized near noon , the clear distinction between the two regions has been identified through the distribution and energy flux [ newell and meng , 1988 ] . note that this paper is not to discuss or alter the dmsp particle classification on the dayside , which has been well documented [ newell and meng , 1988 ; newell et al . the purpose of this work is to study the relationship between the particle precipitation and poynting flux in those regions . the identification for different regions in newell and meng based on the dmsp particle data is adopted through using the online spectrogram viewer developed by the johns hopkins university applied physics laboratory ( jhu / apl ) . due to the geomagnetic energy inputs , the neutral density in the thermosphere shows a substantial enhancement in the dayside polar cap boundary , which has been observed by the champ satellite [ lhr et al . , 2004 ; rentz and lhr , 2008 ; rentz , 2009 ; lhr and marker , 2013 ] . typical enhancements at 400 km altitude are 20 % above background with a width of a few hundred kilometers , but in extreme cases more than 50 % has also been observed . to figure out the mechanism for the large neutral density enhancement in such a small region , simulations have been conducted using different models [ schlegel et al . , 2005 ; demars and schunk , 2007 ; zhang et al . , 2012 ; deng et al . , 2013 ; sheng et al . , the theoretical study conducted in deng et al . with the global ionospherethermosphere model ( gitm ) illustrated that poynting flux and soft particle precipitation have comparable influences on the neutral density in the dayside polar cap boundary regions . the combined influence of poynting flux and soft particle precipitation causes a more than 50 % increase in the neutral density at 400 km , which is consistent with champ observations in extreme cases . in gitm simulations , poynting flux and soft electron precipitation coincided with each other all the time . they have been added in the model at the same time and in the same location . however , more observational evidence is needed to confirm the methodology and the correlation between the two types of energy inputs . a previous study reported that more than 80 % of the birkeland current boundaries do not correspond to particle precipitation boundaries [ de la beaujardiere et al . ,1993 ] , which indicates that the electromagnetic energy inputs may not coincide with particle energy inputs in the polar region . meanwhile , watermann et al . showed that the current cusp , associated with intense smallscale magnetic field variations , may cover both the particle cusp and the llbl . both poynting flux and soft electron precipitation have been observed commonly in the dayside polar cap boundary regions . certainly , different positions including totally overlapping , partially overlapping , and totally displaced can result in quite different consequences in the thermosphere and ionosphere . in order to improve our understanding of the neutral density enhancement around the cusp region , the relative position of poynting flux and soft particles is very important . in this study , through analyzing both particle data and deduced poynting flux data from dmsp satellite observations , the relationship between poynting flux and soft particle precipitation in the dayside polar cap boundary regions has been examined closely . the results unveil that a complex correlation and a systematic study of the geospace environment are needed to fully understand these phenomena . dmsp observations of both particle precipitation and poynting flux during several storm periods in 2004 and 2005 have been studied . the soft particle energy flux was calculated from the special sensor precipitating plasma monitor ( ssj ) on the dmsp spacecrafts . the ssj data set provided by the air force research laboratory consists of 1 s cadence electron and ion particle fluxes between 30 ev and 30 kev . the poynting flux is obtained from the vector cross product of the electric field and perturbation magnetic field measured by the dmsp satellites ( s = e b / 0 ) [ e.g. , kelley et al . , 1991 ; gary et al . , 1994 , 1995 ] . an example of poynting flux calculated from the dmsp f15 measurements along the satellite trajectory has been shown in knipp et al . . the dmsp spacecraft are in polar orbits and fixed in local times , sampling the ionospheric plasma at about 840 km . the electric field is deduced from the ion drift velocity measured by the special sensor ionospheric plasma drift / scintillation meter ( ssies ) monitor and the simultaneous magnetic field obtained from the 1 s fluxgate data of special sensor magnetometer through the equation of e = v b. the resolution is at 4 s , and the corresponding space resolution is close to 30 km . the perturbation magnetic field is the difference between the measured and international geomagnetic reference field ( igrf ) values of magnetic fields at the spacecraft locations , b = b measureb igrf [ huang and burke , 2004 ] . the ion drift meter ( idm ) of the ssies monitor measures horizontal crosstrack and vertical components of plasma drifts in the spacecraft frame , and the retarding potential analyzer ( rpa ) measures ion temperatures and the ram component of plasma drift [ rich and hairston , 1994 ] . the crosstrack component has been further processed from the spacecraft frame to the corotating frame . the quality flags for both rpa and idm data include 1 for good data , 2 for questionable data which should be used with caution ,3 for bad data , and 4 for data with undetermined quality . as shown in figure 1 , the quality flags for the v x ( ram drift or parallel velocity ) ion flow measured by the rpa are mainly 2 or 3 , which mean questionable or bad data . meanwhile , dmsp f13 satellites are primarily in a dawndusk local time orientation , and the contribution of ram drift to the poynting flux is relatively small . to be cautious , the poynting flux in our resultsis calculated from v y ( horizontal cross track ) and v z ( vertical cross track ) ion flows measured by the idm . therefore , the quality of idm data directly influences the quality of the poynting flux . ( a ) dmsp f13 crosstrack ion drift in the northern hemisphere during 02:1502:37 ut on 24 july 2004 . s and e denote the starting and ending times for the dmsp satellite crossing , which we look at closely in figure 2 . ( b ) the dmsp measurements along the satellite trajectory shown in figure 1a . ( first to third panel ) the ion drift in the ram ( v x ) , crosstrack ( v y and positive for antisunward ) , and vertical ( v z and positive for upward ) directions . ( fourth panel ) the number density of both h ( blue ) from rpa and total ions ( black ) from sm . ( fifth panel ) the reduced poynting flux from both electric and magnetic fields measurements . only good and undetermined ion drift data have been used for the poynting flux calculation . the diamond shows the estimation when only the crosstrack ( v y ) and vertical ( v z ) ion drifts are included . interestingly , the quality flag of the ion drift data around the cusp region has often been denoted as 4 , undetermined . the reason is that around the cusp region the electric field is very variable and the standard deviation of the ion drift during the 4 s period can be larger than the average . when the satellite encounters the cusp region , the rpa processing algorithm can not handle such a variable situation and no composition information can be deduced from the rpa . however , the ssies thermal plasma instruments are designed to work in a predominately o plasma condition , and once the percentage of light ions ( h and he ) goes above 15 % , the data are not reliable . since there is no value for the fractional amount of o from rpa , we have no direct way to determine if the idm data are good or bad , so these data are flagged as 4 , undetermined . nevertheless , undetermined idm data are not necessarily bad data , and the ion drift may still produce reliable data . figure 1 ( right , fourth panel ) shows the total plasma density from scintillation meter ( sm ) and h density from rpa along the satellite trajectory . while during the interval between s and e ( start and end points of the segment of the satellite trajectory ) the data become sparse , the average percentage of h is close to 2.2 % , which indicates that the plasma is composed almost 98 % of heavier o ionsmeanwhile , the convection pattern shown in figure 1 ( left ) is antisunward flows at the high latitudes and sunward flows at lower latitudes , which is quite reasonable . therefore , the idm data with flag 4 ( undetermined ) around cusp are treated as useful data after a close examination of the composition and convection pattern . figure 2a shows the d s t index and solar wind conditions during 2126 july 2004 , including interplanetary magnetic field ( imf ) , solar wind bulk speed in the sunearth direction ( v x ) , and the bulk plasma density ( n ) . the minimum of the d s t index was close to 130 nt , which indicates a moderate storm period . the red vertical line marks the starting time for the segment of the dmsp satellite trajectory shown in figure 2b . clearly , the period with cusp crossing we investigated happened between two storm periods . the solar wind data are from omniweb data set , in which all the original solar wind data have been time shifted to the bow shock nose ( bsn ) . an additional 20 min time shift has been enclosed in the solar wind conditions to take into account of the polar region electrodynamics responding time to the solar wind conditions at bsn . figure 2b shows the dmsp f13 satellite trajectory around the the dayside polar cap boundary regions in the northern hemisphere . s and e denote the starting and ending times for the segment of the dmsp satellite trajectory . the location is very close to the typical location of the cusp , near noon time and close to 75 mlat . figure 2c illustrates the dmsp measurements along the satellite trajectory shown in figure 2b , including total energy flux for both ions ( black ) and electrons ( red ) , average energy of the particles , differential energy flux of electrons and ions , and estimated poynting flux . as shown in figure 2c ( third and forth panels ) , both soft electron and soft ion particle precipitations have enhanced significantly in the llbl and cusp . figure 2c ( first and second panels ) shows that during that period the total energy flux and average energy of electrons and ions satisfy the criteria for the llbl and cusp . the location is close to noon and 75 mlat , the typical location of dayside polar cap boundary . the line in figure 2c ( fifth panel ) shows the variation of poynting flux along the satellite trajectory . clearly , the poynting flux also increased in the llbl and cusp with the maximum of 10 mw / m . since the temporal resolution of poynting flux data set derived from dmsp observations is 4 s , which is equivalent to 30 km in distance , lots of smallscale structures can be identified in both particle data and poynting flux . in general , the enhancements of soft particle precipitation and poynting flux overlapped with each other in this particular case , so we name it as a match case . ( a ) d s t index and solar wind conditions during 2126 july 2004 , including interplanetary magnetic field ( imf ) , solar wind speed in the sunearth direction ( v x ) , and plasma density ( n ) . the red vertical line marks the starting time for the segment of dmsp satellite trajectory shown in figure 2b . the solar wind data are from omniweb data set , in which all the original solar wind data have been time shifted to the bow shock nose ( bsn ) . only a 20 min delay has been enclosed in the solar wind conditions to take into account of the responding time of the electrodynamics in the earth 's polar region to the solar wind conditions at bsn . ( b ) dmsp f13 satellite trajectory around the dayside polar cap boundary regions in the northern hemisphere . s and e denote the starting and ending times for the dmsp satellite trajectory . ( c ) the dmsp measurements along the satellite trajectory shown in figure 2b , including total energy flux ( kev / cm s sr ) for both ions jei ( black ) and electrons jee ( red ) , average energy of the particles avge , differential energy flux of electrons e e and ions e i , and estimated poynting flux s ( mw / m ) . figure 3 shows the geomagnetic and solar wind conditions and dmsp f13 measurements during 1114 april 2005 . the dmsp crossing happened at the beginning of the second active period , when imf b z slightly turned to southward . the major difference between this event and the event shown in figure 2 is the displacement between poynting flux enhancement and the soft particle precipitation enhancement . as shown in figure 3c , both soft electrons and soft ions increased significantly between 69 and 73 mlat , which is marked as llbl and mantle . the poynting flux also increased to 30 mw / m , but the location was between 73 and 74 mlat , which is inside of boundary plasma sheet region . actually , the poynting flux enhancement was located at 1 higher latitude than the soft particle precipitation enhancement . the same as figure 2 but for measurements along dmsp f13 trajectory on 13 april 2005 . large soft particle precipitation and large poynting flux in the cusp have been observed , but complete knowledge of the relative location of different energy inputs in this region is still lacking . the behaviors and dynamics in other dayside polar cap boundary regions is even less understood . in this study 29poynting flux and soft particle precipitation enhancements match well in 23 crossings and have a clear displacement in 6 crossings . interestingly , the dmsp measurements show both match and nonmatch cases , which open some new questions about the correlation between the two different energy inputs in the polar cap boundary . for example , under what conditions the large particle precipitation is accompanied with or without a large poynting flux in the dayside polar cap boundary regions ? since the satellite measures the parameters along the satellite trajectory , the spacial and temporal variations can not be separated from one single satellite measurements . does the nonmatch case really represent a spatial displacement or a temporal delay between poynting flux and soft particle precipitation ? why does the poynting flux enhancement happen poleward of the soft particle precipitation enhancement in the nonmatch case ? certainly , more comprehensive study is needed before answering those questions . meanwhile , it brings some additional challenge to the ionosphere / thermosphere models to simulate the ionosphere / thermosphere in the dayside polar cap boundary region precisely since it is not clear when these two energy inputs should be overlapped with each other and when they should not . different relative distributions of energy inputs will result in significant difference in the ionosphere / thermosphere response . f13 cusp crossing list the possible mechanisms for the displacement we propose include the variation of the imf conditions and the energy transfer between the poynting flux and the particle precipitation . for the first mechanism , the hypothesis is that when the imf conditions especially the b y component change , the ion convection pattern and particle precipitation may change accordingly but under different paces , which results in the displacement between them . to examine this mechanism , the imf conditions in 10 min interval centered on the starting time ( marking as s in the satellite trajectory ) of the satellite crossings for both match and nonmatch cases have been plotted out in figure 4 . each caseif the points in the same style cluster together , it indicates that the imf conditions are very stable . otherwise , they vary with the time during the 10 min time window . the comparison between figures 4a and figure 4b shows no systematic difference of solar wind variation between match and nonmatch cases . all nonmatch cases happened in the b y negative condition and more than half were in the b z positive condition , but more data are needed to confirm this feature and to approve the first mechanism . another possible mechanism is the energy conversion of poynting flux to the particle kinetic energy flux when they are propagating along the magnetic field from magnetosphere into upper atmosphere , since the parallel electric fields generated by the alfven waves is a possible acceleration mechanism of auroral particles [ hasegawa , 1976 ; thayer and semeter , 2004 ] . sounding rockets have observed similar displacement between these two energy inputs previously [ evans et al . , 1977 ; kletzing et al . , the confirmation needs the comparison of simultaneous measurements in the magnetosphere and upper atmosphere and kinetic simulations as well . the solar wind imf variations during the 10 min time window centered on the starting time ( marking as s in the satellite trajectory ) of the satellite crossings for both ( a ) match and ( b ) nonmatch cases . each case is represented by the same point style . figure 2a shows the d s t index and solar wind conditions during 2126 july 2004 , including interplanetary magnetic field ( imf ) , solar wind bulk speed in the sunearth direction ( v x ) , and the bulk plasma density ( n ) . the minimum of the d s t index was close to 130 nt , which indicates a moderate storm period . the red vertical line marks the starting time for the segment of the dmsp satellite trajectory shown in figure 2b . clearly , the period with cusp crossing we investigated happened between two storm periods . the solar wind data are from omniweb data set , in which all the original solar wind data have been time shifted to the bow shock nose ( bsn ) . an additional 20 min time shift has been enclosed in the solar wind conditions to take into account of the polar region electrodynamics responding time to the solar wind conditions at bsn . figure 2b shows the dmsp f13 satellite trajectory around the the dayside polar cap boundary regions in the northern hemisphere . s and e denote the starting and ending times for the segment of the dmsp satellite trajectory . the location is very close to the typical location of the cusp , near noon time and close to 75 mlat . figure 2c illustrates the dmsp measurements along the satellite trajectory shown in figure 2b , including total energy flux for both ions ( black ) and electrons ( red ) , average energy of the particles , differential energy flux of electrons and ions , and estimated poynting flux . as shown in figure 2c ( third and forth panels ) , both soft electron and soft ion particle precipitations have enhanced significantly in the llbl and cusp . figure 2c ( first and second panels ) shows that during that period the total energy flux and average energy of electrons and ions satisfy the criteria for the llbl and cusp . the location is close to noon and 75 mlat , the typical location of dayside polar cap boundary . the line in figure 2c ( fifth panel ) shows the variation of poynting flux along the satellite trajectory . clearly , the poynting flux also increased in the llbl and cusp with the maximum of 10 mw / m . since the temporal resolution of poynting flux data set derived from dmsp observations is 4 s , which is equivalent to 30 km in distance , lots of smallscale structures can be identified in both particle data and poynting flux . in general , the enhancements of soft particle precipitation and poynting flux overlapped with each other in this particular case , so we name it as a match case . ( a ) d s t index and solar wind conditions during 2126 july 2004 , including interplanetary magnetic field ( imf ) , solar wind speed in the sunearth direction ( v x ) , and plasma density ( n ) . the red vertical line marks the starting time for the segment of dmsp satellite trajectory shown in figure 2b . the solar wind data are from omniweb data set , in which all the original solar wind data have been time shifted to the bow shock nose ( bsn ) . only a 20 min delay has been enclosed in the solar wind conditions to take into account of the responding time of the electrodynamics in the earth 's polar region to the solar wind conditions at bsn . ( b ) dmsp f13 satellite trajectory around the dayside polar cap boundary regions in the northern hemisphere . s and e denote the starting and ending times for the dmsp satellite trajectory . ( c ) the dmsp measurements along the satellite trajectory shown in figure 2b , including total energy flux ( kev / cm s sr ) for both ions jei ( black ) and electrons jee ( red ) , average energy of the particles avge , differential energy flux of electrons e e and ions e i , and estimated poynting flux s ( mw / m ) . figure 3 shows the geomagnetic and solar wind conditions and dmsp f13 measurements during 1114 april 2005 . the dmsp crossing happened at the beginning of the second active period , when imf b z slightly turned to southward . the major difference between this event and the event shown in figure 2 is the displacement between poynting flux enhancement and the soft particle precipitation enhancement . as shown in figure 3c , both soft electrons and soft ions increased significantly between 69 and 73 mlat , which is marked as llbl and mantle . the poynting flux also increased to 30 mw / m , but the location was between 73 and 74 mlat , which is inside of boundary plasma sheet region . actually , the poynting flux enhancement was located at 1 higher latitude than the soft particle precipitation enhancement . the same as figure 2 but for measurements along dmsp f13 trajectory on 13 april 2005 . large soft particle precipitation and large poynting flux in the cusp have been observed , but complete knowledge of the relative location of different energy inputs in this region is still lacking . the behaviors and dynamics in other dayside polar cap boundary regions is even less understood . in this study 29poynting flux and soft particle precipitation enhancements match well in 23 crossings and have a clear displacement in 6 crossings . interestingly , the dmsp measurements show both match and nonmatch cases , which open some new questions about the correlation between the two different energy inputs in the polar cap boundary . for example , under what conditions the large particle precipitation is accompanied with or without a large poynting flux in the dayside polar cap boundary regions ? since the satellite measures the parameters along the satellite trajectory , the spacial and temporal variations can not be separated from one single satellite measurements . does the nonmatch case really represent a spatial displacement or a temporal delay between poynting flux and soft particle precipitation ? why does the poynting flux enhancement happen poleward of the soft particle precipitation enhancement in the nonmatch case ? certainly , more comprehensive study is needed before answering those questions . meanwhile , it brings some additional challenge to the ionosphere / thermosphere models to simulate the ionosphere / thermosphere in the dayside polar cap boundary region precisely since it is not clear when these two energy inputs should be overlapped with each other and when they should not . different relative distributions of energy inputs will result in significant difference in the ionosphere / thermosphere response . f13 cusp crossing list the possible mechanisms for the displacement we propose include the variation of the imf conditions and the energy transfer between the poynting flux and the particle precipitation . for the first mechanism , the hypothesis is that when the imf conditions especially the b y component change , the ion convection pattern and particle precipitation may change accordingly but under different paces , which results in the displacement between them . to examine this mechanism , the imf conditions in 10 min interval centered on the starting time ( marking as s in the satellite trajectory ) of the satellite crossings for both match and nonmatch cases have been plotted out in figure 4 . each caseif the points in the same style cluster together , it indicates that the imf conditions are very stable . otherwise , they vary with the time during the 10 min time window . the comparison between figures 4a and figureall nonmatch cases happened in the b y negative condition and more than half were in the b z positive condition , but more data are needed to confirm this feature and to approve the first mechanism . another possible mechanism is the energy conversion of poynting flux to the particle kinetic energy flux when they are propagating along the magnetic field from magnetosphere into upper atmosphere , since the parallel electric fields generated by the alfven waves is a possible acceleration mechanism of auroral particles [ hasegawa , 1976 ; thayer and semeter , 2004 ] . sounding rockets have observed similar displacement between these two energy inputs previously [ evans et al . , 1977 ; kletzing et al . , the confirmation needs the comparison of simultaneous measurements in the magnetosphere and upper atmosphere and kinetic simulations as well . the solar wind imf variations during the 10 min time window centered on the starting time ( marking as s in the satellite trajectory ) of the satellite crossings for both ( a ) match and ( b ) nonmatch cases . the dayside polar cap boundary is a special region including cusp and llbl , through which a significant amount of poynting flux and soft particle precipitation are deposited in the upper atmosphere . commonly , the enhancement of poynting flux and the enhancement of soft electron precipitation have been measured in these regions , but no detailed study has been conducted previously to examine the correlation between the two different energy inputs in the dayside polar cap boundary . the analysis of dmsp observational data revealed a complex relationship between them . while in some cases , poynting flux and soft electron precipitation enhancements match very well , in others a clear displacement can be identified . in the 29 cusp crossings investigated , the ratio between nonmatch and match cases is close to 1:4 . in nonmatch cases , poynting flux enhancement can happen in a higher latitude than soft particle precipitation and the displacement can be as large as 1 in mlat . the possible mechanisms for the displacement we propose include the variation of the imf conditions and the energy transfer between the poynting flux and the particle precipitation , but more data are needed to confirm them .\noutput:\n" }, { "from": "agent", "value": "abstractobservations have revealed large poynting flux and soft electron precipitation around the cusp region , which have strong impacts on the polar ionosphere / thermosphere . simulations also confirmed that poynting flux and soft electron precipitation significantly change the neutral density and dynamics around the dayside polar cap boundary regions . however , no detailed study has been conducted to show if they should coincide with each other or not . our analysis of defense meteorological satellite program ( dmsp ) satellite data reveals a complex correlation between them . poynting flux and soft particle precipitation are coincident in some cases ( match cases ) , but a clear displacement between them can also be identified in others ( nonmatch cases ) . in the 29 cusp crossings from f13 we investigated , the ratio between nonmatch and match cases is close to 1:4 . in nonmatch cases , the displacement between the poynting flux enhancement and soft particle precipitation enhancement can be as large as 1 in geomagnetic latitude ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: during speciation in crop plants , many morphological changes evolved in response to continuous selection pressure . such characters are largely governed by genetic and epigenetic changes or are modulated according to ecological adaptations . the transition of wild progenitor species into modern elite cultivars through domestication entails evolutionary responses in which plant populations adapt to human selection . in response to this selectionmost plant species exhibit marked changes in a variety of phenotypes , most noticeably in traits consciously under selection ( e.g. , fruit size , yield , and evenness of maturation ) . as darwin profoundly recognized long ago , the study of the phenotypic variation between wild and domesticated plants presents an opportunity to generate insight into general principles of evolution , using the morphologically variable antecedent and descendant taxa . an example of how this concept has transformed our understanding is the realization that natural selection pressure , as well as adaptation under human selection , often led to unexpected and unexplained departures from predicted phenotypes . this mainly includes traits such as enhanced yield , enhanced apical dominance , reduced seed dormancy , perennial to annual habit , and relative susceptibility to pathogens , disease , and insect pests . however , the latter received the least attention during the process of agricultural evolution . the term agricultural evolution here , in fact , summarizes all of the changes accumulated in any wild plant form under natural selection , human - mediated artificial selection ( = domestication ) , and modern breeding practices ( figure 1 ) . from an evolutionary standpoint , these phenomena may be viewed as novel generators of variation in the tertiary gene pool comprised of domesticated and wild germplasms ( figure 1 ) . such variations occurred mostly at genetic level and provide the ability for a given species to evolve in response to the changing environmental conditions and stress factors . notwithstandingthe striking discoveries of the genetic basis of evolved morphological traits in crop plants , relatively little is understood about the manner in which gene networks and biological processes are associated with the more susceptible phenotypes of the elite forms . regardless of these rapidly accumulating insights , important questions remain about every stage of agricultural development . how do contemporary plant forms achieve diverse evolutionary trajectories separate from those of their progenitor ( s ) ? how do recently formed elite accessions of crop plants become compromised of different resistance traits ? to what degree has crop evolution via the process of domestication and concurrent breeding practices provided a stimulus for sustainable agriculture ? despite the domestication events followed by breeding practices across plant taxa , we do not know why agricultural evolution is so prevalent or conversely , why crop evolution is not universal if it confers some adaptive advantages and promotes species diversification . nordo we understand the dynamics that underlie the transformation of wild forms to domesticated forms in cryptic crops such as cotton and corn . it has been assumed that several agriculturally important traits such as resistance to abiotic and biotic stress conditions decreased significantly during evolution . for example , in domesticated accessions of the genus cajanus , reduced levels of resistance have been reported against herbivores , bacterial blight , and fungal diseases . among stress conditions , a reduction in drought tolerance , resistance to herbivory and pathogens , is the major threat to crop plants . it is difficult to understand what are the precise genetic underpinnings are that make a plant species vulnerable to drought , herbivores , and pathogens after passing through the evolutionary important mechanism of crop domestication ? surprisingly , what is the extent of reduction in resistance traits across crop plants , if the reduction in any particular resistance trait is proportional to another resistance trait ? the answer to these questions may not be consistent across plant taxa but may only hold true for a particular plant lineage . generally , domestication promotes heterozygosity leading to the more successful variants under selection pressure either through fixed hybridity or by polysomic inheritance . could it be assumed that domesticated accessions are in general more successful than their wild progenitors ? this is an exceedingly difficult question to answer , in large part because success is an ill - defined term that can refer to anything from short - term proliferation of individuals to long - term effects on lineage diversification . the susceptible nature of modern crop plant varieties in comparison to their wild progenitors could be one of the most apparent consequences of such a megaevent . or accelerated mutational activity in coresident genomes ( in case of polyploid crops ) in early generations led to a downgrade in the pathogenic and herbivore resistance of domesticated plant species . answering these and other questions will require comparisons of wild and domesticated forms by researchers from diverse disciplines such as ecology , population biology , and physiology . unfortunately , these important areas of biology have received far less attention than the genetics and genomics of selection . nevertheless , even in these better - studied areas much remains to be learned , and it is only by moving beyond the idiosyncrasies of a handful of model crop systems that emergent properties of selection can be detected . though crop plants are threatened by many stress conditions , most of the previous research has been focused on the study of genetic end of resistance to herbivory at the gene expression level , during the process of selection , and at the phenotypic level . the aim of this paper is to provide a broad , updated entry to the literature as well as to highlight the major unanswered questions in the field of crop evolutionary genetics . a primary concern of agricultural evolution biology is to investigate where , when , and how crop plants originated . vavilov 's center of domestication has been a valuable hypothesis as to where crops originated and where our sessile , agrarian cultures began . since then , we have made great strides in pinpointing where contemporary domesticated forms have arisen and from which wild species they are derived ( figure 2 ) . it has been believed that modern elite plant varieties with useful characters ( mostly hybrids ) for sustainable agriculture have been developed through ( i ) domestication and ( ii ) following research and breeding activities that were implemented by scientists and breeders worldwide ( table 1 ) ( reviewed by ) . however , it is essential to understand which has been the foremost drive largely in the phenomenon of agricultural evolution . the termdomestication is often used to describe the process by which wild becomes stabilized . from the standpoint of morphological transformation , domesticated forms are by definition wild species with certain traits highlighted under human selection ( figure 1 ) , showing character modifications including novel trait formation and subsequent segregation , for example , a reduction in grain shattering and seed dormancy in rice ; an increase in seed and pod size in vigna ; an increase in fiber length and quality in cotton ; changes in fruit size and shape in tomato ; increased apical dominance in maize ; and more . as darwin recognized , the study of the phenotypic variation between wild and domesticated plants presents an opportunity to generate insight into general principles of evolution , using morphologically variable antecedent and descendant in a comparative framework . this approach provides an intriguing perspective on the molecular genetics of human - mediated artificial selection . it is thus assumed that strong artificial selection coupled with introgression ( = crossing with the respective wild relative ) could drive the fixation of the most beneficial genes and their expression regulation in the process of crop domestication . the domestication process and introgression under modern breeding programs must have served as effective means to increase the genetic diversity of elite cultivars especially following the initial domestication bottleneck , and to produce cultivars adaptive to climatic conditions . but is it true for all domesticated crop plants ? can it be assumed that cereals with divergent genomic backgrounds experienced one or more domestication events in their evolutionary history ? to test this hypothesis , metagenome studies of population genetic structures of cereals , other important modern taxa and their wild progenitors of known origin , are required . instances of multiple independent domestications in cereals do not provide evidence for their clear ancestry ( e.g. , oryza , hordeum ) , and even if their respective wild progenitors were identified , the multiple origins of domesticated forms and their formation would mostly remain unknown . it has also been assumed that almost all crop plants have experienced repeated polyploidization of genomes in their evolutionary history with multiple - fold duplication of ancestral angiosperm ( flowering plant ) genes . polyploidy has influenced flowering plant diversification and provides raw material for the evolution of novelty by relaxing purifying selection on duplicated genes . however , following polyploidization , is the formation of multiple and independent domesticated forms a synchronized event across taxa ? it still remains unclear whether genetic polyploids such as wheat , unlike rice and barley , must necessarily undergo mutation in orthologous loci simultaneously . in fact , many domesticated plant forms appear to undergo one or more mutations in a single gene , and thus the probability of parallel and independent selection of orthologous chromosomal regions responsible for the key domestication transition is expected to be weak . domestication could , therefore , include all responses to plant evolution , including genetic and epigenetic effects , as reviewed recently . the domesticated forms are expected to undergo many of the genome - level megachanges both at structural and functional levels , such as sequence loss , structural rearrangements , and changes in the regulatory sequences , respectively . recent large - scale microarray studies on the comparison of wild and domesticated forms of selective plant species confirmed that global gene expression had been radically altered by domestication . such changes have certainly played an important role at the evolutionary scale as domesticated plant forms are not always achieved immediately , even in relatively simpler genomes , as reviewed by ; and inheritable changes can only occur often through mutations at genic and / or regulatory levels . for example , a qtl ( sh4 ) is responsible for the reduction of grain shattering in the wild rice and a loss of function mutation of vrs1 in six - rowed barley ; and a qtl is responsible for free - thrashing character in wheat . accordingly , what is the preference for such target genes to undergo mutations during selection process ? it is now evident that the genes involved in important domestication transitions are preferably regulatory sequences whose mutations can generate substantial phenotypic modifications serving as suitable targets for strong artificial selection in the key steps of crop evolution . regarding the magnitude of the changes that occurred throughout crop formation , it appears that breeding activities of crop plants are relatively of less radical change than the conversion of wild forms to the domesticated forms . if so , will the modern elite varieties derived through hybridization of two similar domesticated varieties / forms have less evolutionary resolution than those derived through hybridization with their wild progenitor species ? this is definitely an affirmative assertion and has also been validated across plant taxa with reduced genetic diversity in the breeding programs . thus , what may be the potential risks involved with such radical loss in the genetic diversity among elite cultivars ? it may also develop the weedy competitors of crop plants as well as their susceptibility to the diseases , pathogens , and herbivores leading to severe crop losses . but is there any correlation between operative stress condition and the niche of any plant population ? are there sufficient pieces of evidence for relatively less epidemic of any particular pathogen or pest population ? the bewildering possibility of such prevalence may destabilize the crop productivity as well as subsequent evolution . for example , despite low crop diversity among cereals initially , successful introgression of resistance to abiotic stress conditions , pathogens , and herbivores was deployed to maintain yield . in this scenario , what is the deadline for such incorporation of resistance traits in crops for sustainable agriculture ? the answer is still unclear but it may only be possible if ( i ) domestication , ( ii ) change from traditional landraces to modern breeding varieties , and ( iii ) their over and above decade field adaptation can work indefinitely ; for example , maize hybrids in the united states now have a useful lifetime of about 4 years , half of what it was 30 years ago . the advent of genomics has brought a bonafide improvement to the study of such regulatory regions and generation of molecular and expression data , knowledge , and tools which could be applied in modern breeding programs for exploitation of genes from tertiary gene pool ( figure 1 ) . to further understand the genetic basis of domestication , tremendous variationsfor example , in tomato , the genetic variation present in wild species has been investigated intensively for specific traits and is being exploited for tomato breeding . using dna technologies , the diversity of domesticated tomato is estimated to comprise 5 % of the genetic variation as compared to the rich reservoir in wild relatives . so far , even using sensitive molecular markers , very low polymorphism within the domesticated tomato gene pool has been identified , . a loss of genetic diversity revealed through sequence repeat markers was also observed from wild triticum tauschii to the landraces and subsequently to the elite germplasm . though the successful application of breeding programs has produced high - yielding crop varieties , ironically the plant breeding processes have threatened the genetic basis upon which the breeding depends . if assumed so , is the redundancy in the loss of diversity across taxa deleterious , or neutral ? what is the spectrum of consequences of having genes and mutations underlying domestication transitions ( colloquially calledare the answers to these questions consistent among plant lineages or between parallel domestication events ? nevertheless , intensive artificial selection does not inevitably lead to a loss of genetic diversity , and diversity can be compensated by the introgression of novel germplasm . one example of this is the development of novel rice variety , with the introgression of major qtl , sh4 , responsible for the reduction of grain shattering . herbivores ( insect pests ) are the major factor responsible for destabilizing crop productivity in agricultural ecosystems . herbivores have been recognized as a major constraint to crop production causing significant yield loss and quality degradation . in response to herbivory , plants have acquired inherent resistance against such pests ; however , the intensity of this resistance varies enormously between wild and domesticated forms . so , what could be the rationale for such large variations in the resistance levels ? it is believed that the alterations in herbivory resistance are a prominent outcome of genetic reduction within and between crop species . several studies have shown that massive expression changes accompany crop evolution ( under domestication and breeding practices ) . the magnitude of expression changes varied greatly between species influencing genetic diversity and resistance levels tremendously . however , do enough data exist at present to reveal general trends of reduced resistance to herbivory among domesticated forms across taxa ? it is evident in three wild relatives of chickpeas that are , cicer microphyllum , c. canariense , and c. macracanthus exhibiting significant reduction in leaf feeding , larval survival , and larval weight of neonate larvae of helicoverpa armigera in comparison to domesticated perennial accessions . the extent of suppression of damage is impressive in wild accessions as compared to the domesticated chickpeas . also , a comparison of global gene expression profiles in the wild and domesticated allotetraploid cotton gossypium barbadense has specifically addressed the transcriptional effects of domestication during development . several important genes and their functional categories related to resistance genes have been identified as downregulated in the domesticated form than its counterpart wild form supporting the assumption of reduced resistance properties of a plant species . furthermore , a comparison of wild and domesticated accessions of allopolyploid g. barbadense with their diploid progenitors ( g. arboreum and g. raimondii ; b. chaudhary & j. f. wendel , unpublished ) revealed significant transcriptional downregulation of resistance - related genes in the expression phenotype of the domesticated form . this is a clear indication of reduction in herbivore resistance traits during the domestication of an allopolyploid crop . since cotton allopolyploid species carry a and d genomes , derived from their diploid progenitors , it may also be argued that such a reduction in herbivory resistance may be the cumulative reduction occurred during both polyploid formation and domestication . however , following polyploid formation , many duplicated genes undergo transcriptional biases and do not behave as simple additive combinations of the parental genomes , but instead are maintained at the ancestral resistance levels at least in the wild forms . thus , the possibility of reduction in resistance levels during polyploid formation appears to be minimal and major reductions in resistance levels may have occurred during the domestication process . this lack of additivity in gene expression levels in most polyploid crop plants raises several fundamental questions on the consequences of the evolutionary dynamics of resistance gene expression following domestication . from a mechanistic standpoint , what is responsible for nonadditivity in gene expression , and why does this vary so much among resistance genes and between different genomic combinations ? why do such important genes from two diploid genomes demonstrate such a large disparity in the degree of suppression of the gene expression phenotype ? also from an evolutionary point of view , how does genomic evolution impact resistance gene expression variation during agricultural evolution ( domestication followed by the breeding practices ) , and what are the potential phenotypic effects of each of these sources of variation ? one of the most recent and spectacular revelations in crop plants is the identification of a number of molecular markers , and how these markers could be applied to identify and track target genes in a marker - assisted breeding program . molecular markers have also been applied to increase understanding of the mechanistic and biochemical basis of herbivore resistance , as shown thoroughly in maize , mungbean , potato , and in soybean . what are the putative regulatory genomic components and pathways providing resistance against herbivores , and at incredibly varied levels ? five qtls have been identified in arabidopsis known to regulate the glucosinolate - myrosinase system controlling the generalist herbivore trichoplusia ni than specialist feeding insect plutella xylostella identified five qtls in arabidopsis known to regulate the glucosinolate - myrosinase system controlling the generalist herbivore trichoplusia ni than specialist feeding insect plutella xylostella . this demonstration of the higher levels of genetic variation for resistance to the generalist and specialist herbivores has been further verified and expanded in several subsequent studies , including one in which several qtls from consistent resistance sources for leaf feeding insects swcb and faw were mapped on and observed to be located on chromosomes 6 , 7 , and 9 in corn . given the resistance to both of these insects , candidate genes were identified as mir cysteine proteinase gene family and the glossly15 gene controlling adult to juvenile transition . also in soybean , 81 qtls related to herbivory resistance were identified through meta - analysis , and the locations of true qtls were deduced with a confidence interval of 95 % . thus , could it be determined whether a genetic variant having a particular qtl or haplotype of a polymorphism is associated with the resistant traits ? to understand this contention , a number of herbivory - resistance qtls have been tested for nonrandom associations in the populations derived from a cross between resistant and susceptible parents determining their proportional contribution to the phenotype in wide array of crop species . rflp - based identification of herbivory - resistance qtls in maize revealed their strong association with antixenosis ( = a resistance mechanism employed by a plant to deter or prevent pest colonisation ) and antibiosis ( = an association of two organisms in which one is harmed or killed by the other ) resistance to corn earworm , and also in soybean . the herbivory resistance qtls discovered by rector et al . accounted for most of the genotypic variance for corn earworm resistance in the susceptible x resistant hybrids ; however , with some exceptions those could probably be addressed later with the help of soybean insect resistance qtl database . will the contemporary catalogues of genome - sequencing projects across plant systems support the identification of important herbivory resistance loci ? in result , it may definitely be assumed that future analyses based on whole - genome sequencing data will emphasize insect resistant ( ir ) qtls / ir genes identified earlier through marker - assisted selection . this will substantially reduce the time utilized for their adaptive inheritance through classical or precision breeding . until relatively recently , family - based qtl mapping and association mapping were the primary means of searching genes involved in crop evolution . considering these studies , because there is a complex correlation among different cellular traits considered important for a resistant phenotype , it becomes enormously difficult to identify such specific biochemical constituents . this observation suggests that variation in resistance traits is controlled by intricate genetic mechanisms , a suggestion further bolstered by demonstrations of resistance variation in maize synthetic hybrids , whose genomes have not undergone any subsequent selection . the mode of resistance is of great evolutionary interest , as it may often sporadically disappear under domestication and following breeding practices . so , what are such vital target genes , their chromosomal positions , and putative structural changes those cumulatively have influenced the loss of resistance potential ? will any type of stochastic mutations in the coding or noncoding regions lead to the differential loss of resistance potential among elite cultivars ? from an evolutionary perspective , it could be hypothesized that divergence in resistance potential at the genomic level may also preserve an extensive polymorphism , thus retaining additional raw material for subsequent evolutionary tinkering if exploited under breeding programmes . the domestication process increased a number of important traits required for agricultural innovations , though with few subsides . for example , the nascent crop - form ( representative from independent domestication events ) is more susceptible to herbivores as a result of having few important resistance loci , of which most were identified from their wild progenitor species . is such phenotypic transformation under domestication universally advantageous or has accompanied with the loss of anadditional benefit ? what is the spectrum of consequences of having a set of important genomic loci selected under human selection ? are the answers to these questions consistent among plant lineages and / or between independent and parallel domestication events within a single species ? traditional views maintain that domestication followed by breeding promoted the fixation of resistance loci , referred to as fixed heterozygosity . modern views also support that introgression of resistance loci can be advantageous and provide a primary source of genes / alleles with new functions . however , the identification of novel germplasm from the tertiary gene - pool is an enormously difficult task and it takes time for characterization . however , an inventive alternative is to carry out comprehensive genomic exploration of improved cultivars , primitive domesticated forms , and their wild progenitor species for the identification of candidate genes underlying resistance traits that show evidence of selection during domestication . with the latter approach , what are the confidence limits to forbid the possibility of the identified genes as false positives ? the use of multiple statistical tests can certainly reduce such misreadings . analysis of a large number of loci underlying resistance to herbivory in soybean showed that resistance is an outcome of a mixture of major and minor gene effects and is not random . some loci responsible for acquiring resistance to herbivory were underlying within regions having loci for the resistance against cyst nematode . classification of different soybean genotypes showing broad resistance has suggested important loci contributing to active synthesis and accumulation of products to stop ( = antixenosis ) , deter ( = antibiosis ) , and / or administer ( for which mechanism is not readily established ) herbivory . three qtls influencing resistance to corn borer species in maize have also been identified as overlapping with other genes of small effect in regulating the resistance phenotype , indicating the presence of pleiotropism or linkage between genes affecting resistance and other agronomic traits . recently , one major and three minor qtls in rice have been identified as showing resistance against green rice leafhopper along with defined microsatellites for marker - assisted selection . however , at present , relatively little is understood about the temporal dynamics of resistance to herbivory in different crop plants , and this requires the study of multiple genomes with the empirical reality of long - term resistance to herbivory . under classical models , plant resistance to herbivory and pathogens is proposed to be a primary phenotype mostly available in the wild ancestors . for instance , plant introductions ( pis ) in soybean with low agronomic quality have been demonstrated to be resistant against number of defoliating insects . such models agree with the theory predicting that domestication occurred by human - mediated exertion through artificial selection on a wild species , both positive and negative , over hundreds of generations resulting in the development of cultivable species . in general , wild plant forms resist attack by herbivores and pathogens mainly through constitutive and inducible defense mechanisms . the evolution and maintenance of the latter are now firmly accepted as an integral component of the plant defense mechanism against herbivores . however , the question remains when , where , and how induced resistance is deployed ? based on differences in the signaling pathways and spectra of effectiveness , the induced resistance could be categorized into ( i ) systemic acquired resistance ( sar ) occurring in the distal plant parts following localized infections and ( ii ) induced systemic resistance ( isr ) stimulated by nonpathogenic organisms and is regulated by jasmonic acid and ethylene . during crop evolution ( domestication followed by breeding practices ) , besides all evolutionarily relevant internal costs ( genetic or allocation ) of induced resistance , what are the other costs that may also be influencing the resistance phenotypes ? there has been rapid progress in the detection of other important components , such as ecological costs , which are the result of a plant 's interaction with its environment . therefore , the conceptual separation of genetic and environmental contributions throughout crop formation would help in our understanding of induced resistance . if artificial selection prevails all through generations at the genomic level , is the operation of such selection global or localized ? it may be argued that the evolutionary event such as domestication can affect the sequence variation at wide - reaching loci within a crop plant . in that scenario , what could be the limiting factors responsible for such proposed genetic erosion in an elite germplasm ? one explanation could be that selection in modern breeding programs instead acts on selected important loci controlling a variety of traits , concluding that selection in either case would significantly reduce species - wide polymorphism and make it more vulnerable to the stressful conditions . besides intensive selection in modern breeding programs , the narrow genetic base is often cited as a contributing factor to low diversity , at least in soybean . analysis of 111 fragments from 102 genes in four soybean populations showed evidence of a reduction in genetic diversity within and around the selected loci creating genetic bottlenecks . the reduction of genetic diversity at different loci could result in broad susceptibility to newly emerging diseases and herbivores , thereby threatening long - term food and feed security . one or multiple domestication events in the evolutionary history of soybean provide a discernible degree of diversity compensation that is up to a 50 % reduction , eliminating almost 81 % rare alleles present in the wild soybean ( g. soja ) , and even appear to undergo significant change in the allele frequency . could it be assumed that the most significant loss of diversity in modern cultivars occurred during domestication , or due to an unusually low level of initial genetic variability in the wild progenitor , or both ? it seems that the major loss of diversity occurred during domestication leading to the bottleneck where there was a loss of rare alleles present in the wild form and landraces . contrary to classical predictions that loci under selection pressure may be relatively free to acquire heritable changes , it has been shown among subspecies of maize and rice that single nucleotide polymorphisms encode radical changes in the regulatory regions preferentially preserved in the domesticated forms and evolve conservatively . any such change can lead to divergence in subgenomic expression components , for example , in allopolyploid crop plants . those in result may influence the quantitatively inherited traits such as resistance to herbivory . since wild plant forms have large genetic diversity that could be exploited for introgression of important traits in the modern varieties , it may be assumed that some sources of resistance have been left behind during plant domestication . however , it would be relatively difficult or even unsuccessful to introgress such traits into modern cultivars because this may increase the potential of inferior yield through linkage drag as also shown earlier . moreover , it will also be difficult because crops with antifeedants from wild may have toxicity and anti - nutritional angle . herethe author has a strong opinion that transgenic technologies may provide a radical solution to the herbivory as these avoid linkage drag and also the antifeedant angle . introduction of novel foreign genes into crop plants helps breeders to extend their germplasm with novel phenotypic traits . such required traits are often related to the control of abiotic and biotic stresses , increasing the crop yield and improving the product quality , which were hitherto difficult or not possible to breed using a conventional approach . given the toxicity of chemical pesticides , for the past two decades , a major emphasis has been on the control of herbivory through more rational strategies such as integrated pest management ( ipm ) . a component of ipm is the use of naturally available pesticides such as plant secondary metabolites and expression of heterologous proteins . transgenic crops with a modified single gene developed for herbivore resistance are immensely beneficial in economic , environmental , and health concerns , as recently reviewed , and understood to be second generation resistant crops ( detailed in next section ) . a number of genes have been discovered which are toxic or antifeedant to herbivores and could be of plant or bacterial origin . a major contribution of herbivory - proof crops is in the reduction in application of harmful insecticides sprays and subsequent increase in crop yield . for example , transgenic maize event mon863 developed using a wild type gene from bacterium bacillus thuringiensis ( bt ) , resistant to corn rootworm , was first commercialized in the usa in 2003 and successfully grown until recently . in such a scenario , the easiest way is to calculate the global adoption rates as a percentage of the global areas of principal crops ( i.e. , soybean , cotton , maize , and canola ) in which biotechnology is utilized . though , during last one decade , herbicide tolerance has consistently been the dominant trait , deployment of multiple genes for other traits such as resistance to herbivores is becoming increasingly important and most prevalent for sustainable agriculture . the best example of the dynamics of this very rapid adoption is the contemporary biotech maize for stacked traits . however , at the field level evaluation , the best - studied resistance to the herbivory phenomenon in the crops is the bt cotton , which has a documented reduction in pesticide application of more than 70 % in the developing countries , utmost domesticated in india , though results have been very variable . in 2009 , 5.6 million small and marginal resource farmers planted and benefited from ~ 8.4 mha of bt cotton , equivalent to 8.7 % of the total area under cotton cultivation in india . the corresponding adoption rate of biotech cotton has also been increased globally from 15.5 mha to 16.1 mha in the year 2009 . for soybean , the global hectarage of herbicide tolerant transgenics was 69.2 mha , ( up by 3.4 mha in 2009 ) , which leads this crop to be the largest gm crop grown worldwide . these examples illustrate two major contributions of the biotech approach to plant breeding : ( i ) enlarging the gene pool by including novel genes that breeders could not access by crossing techniques and ( ii ) modifying the genes by recombinant dna technologies to fine - tune transgene expression . the latter needs more emphasis and attention to achieve success in transgenic technologies for improved traits in the crop plants . what controls the level of a foreign gene expression in genetically modified plants ? any or all of the molecular mechanisms associated with cellular gene expression machinery could be involved . such a definition encompasses an array of molecular mechanisms at the transcriptional level including dna methylation , mrna decay , and small rna - mediated gene silencing or at translational level having protein misfolding , degradation or other modification , and nuclear / chromosomal context with respect to genomic location of transgene often referred to as position effect . it is generally assumed that because genes of prokaryotic origin are expressed poorly in higher organisms , such as plants , certain modifications in such genes are required in order to achieve optimal expression . this may include modification in the gc content ( as plants are comparatively gc rich than bacteria particularly bacillus spp . ) , and in codon usage , after the introduction of regulatory sequences and polyadenylation signals . this fact is well supported with a significant increase in the expression of a codon - modified bt cry1ac gene in comparison to the wild - type gene from bacterial origin . subsequently , by modifying codon usage , removing polyadenylation sequences , and other modifications in bt genes , a number of plants have been transformed against their target pests . but is this true only for bacterial genes ? can it be assumed that plant - derived genes with insecticidal potential such as protease - inhibitors , alpha - amylase inhibitor , lectins , and hemilectins do not require any modification for their optimal efficiency prior to the delivery into other crop systems ? under field conditions , reverse effects of transgenics were also recorded with ( i ) harmful effect on nontarget insects and ( ii ) target insect to develop resistance against insecticidal genes used . the first risk could be addressed by designing the synthetic genes to target the hypervariable regions of target insect genes , thereby avoiding their lethal effects on nontarget insect population . however , in the latter case , the potential hazard could only be equilibrated through achieving very high transgene expression in the transgenics through the system - specific codon usage modification of a gene , use of high strength constitutive promoters , position effect - based screening of large transgenic population , and following refuge strategy to delay the acquired resistance in the pest population . if transgenic technologies are so promising and successful over conventional breeding , what are the major constraints that delayed the worldwide cultivation of genetically modified ( gm ) crops ? here , one of the likely explanations may be the inappropriate resistance management strategies deployed so far for the commercially important crop plants . for rice , assessment of agricultural fields for productivity and health effects in china emphasized such issues and highlighted key concerns on policy implementation and resolution of trade barriers , which may also be true globally . clearly , much remains to be learned about such issues , as how should gm crops for herbivory resistance be synchronized for sustainable agriculture ? transgenic technologies are undoubtedly important for plant defense against stresses , and it has also been argued that they are useful for the incorporation of novel phenotypes into crop plants . existing single gene biotech crop studies may be extrapolated to a hypothetical case where full coverage of all target herbivores and plant diseases would be available in a genetic stock . as mentioned previously , biotech maize in usais the best example of the deployment of stacked multiple traits including bt genes ( one to control the european corn borer complex and the other to control rootworm ) and herbicide tolerance ( first commercialized in 2005 ) and continued to grow in 2009 . however , hints regarding gene pyramiding , exclusively for herbivory resistance , have also been emerging rapidly in last decade . in rice ( oryza indica ) , incorporation of two bt genes and one lectin gene showed the control of three major herbivores : rice leaf folder ( cnaphalocrocis medinalis ) , yellow stemborer ( scirpophaga incertulas ) , and the brown planthopper ( nilaparvata lugens ) , respectively . this indicates that , in rice , the long - term effect of multiple gene expression is an apparent enhancement of the resistance phenotype established by the synergistic effects of transgenes . also , two bt gene - transgenic cotton showed enhanced protection against helicoverpa zea in comparison to the single gene transgenics with any of the two genes studied . evidence from our research laboratory on cotton indicates that transgenic stock with two bt genes targeting two different lepidopteran insects shows significant improvement in the resistance trait against individual insects than do the respective single gene transgenics ( b. chaudhary and d. pental , unpublished data ) . this indicates that the gene combinations may have played a strong role in reserving a durable resistance phenotype . even without knowing the comprehensive specific mechanism ( s ) involved , there is clearly some association between the observation of high levels of protection against herbivores and the presence of multiple genes . however , for any particular trait such as resistance to herbivores , can only genes from similar origin be tagged for synergistic activity ? can it be assumed that genes from distant origin be grouped together for increased resistance phenotype ? the answer lies with the gut anatomy of phytophagous herbivore , which has different binding sites for toxic proteins that determine the spectrum of different lethal protein ( s ) activity and severity and provide clues for the use of diverse toxic genes to introgress herbivory resistance phenotype . the use of lectins , for example , galanthus nivalis agglutinin ( gna ) , with bt genes is very promising for increased insect resistance , with the ability of gna to serve as carrier protein for the delivery of insecticidal proteins ( in most cases bt toxins ) . what should be the major selection criteria for insecticidal proteins when used for gene pyramiding ? this may entail ( i ) toxic activity against wide spectrum of herbivores and ( ii ) nonhomology between or among concurrent toxins used . a well - studied example in second - generation insect - resistant transgenic plants is the use of novel vegetative insecticidal proteins ( vips ) , which are produced by bacillus thuringiensis during its vegetative growth along with bt crystal proteins . unlike bt crystal proteins known as - endotoxins , the full - length toxin gets activated proteolytically to a core toxin by proteases in the lepidopteran gut juice . since the mode of action , structure , and binding sites of vips are different from bt toxins in the insect gut epithelium , their use as potential insecticidal proteins for gene staking is very promising . transgenic cotton expressing two insecticidal proteins vip3a and cry1ab is estimated to be highly effective against two cotton herbivores , helicoverpa armigera and heliothis virescens . hence , it is assumed that enhanced resistance could be achieved by using two or more effective analogous insecticidal proteins . gene combination bt cry1ac and snowdrop lectin gna were also tested in cotton and showed resistance against insect pests heliothis armigera and aphis gossypii . also , the results from a comparison between single bt toxin tobacco transgenics and two gene transgenics having the bt gene and the cowpea trypsin inhibitor ( cpti ) gene showed the dominance of two gene products with enhanced insecticidal efficacy against cotton bollworm ( helicoverpa armigera ) . further , an evaluation of bt - cpti fusion protein was performed in brassica oleracea to study the insecticidal effect of this fusion protein on cabbage worm , which showed high activity of trypsin inhibitor , and the overall strong resistance to the common cabbage worm . the synergistic activity between unrelated genes seems very promising . having distinct binding sites of different bt genes in the mid - gut of herbivores , novel combinations of such genessince most of the activated bt toxins share a common three - domain structure with a similar mode of action , it is possible to develop a hybrid toxin through domain swapping . transgenic cotton and tobacco with a hybrid cry1ec toxin developed against polyphagus insect spodoptera litura resulted in extreme toxicity to all developmental stages of larval development . constructed a hybrid bt gene using truncated cry1ba gene as a scaffold and inserted part of the second domain of cryiia gene conferring resistance to both coleopteran and lepidopteran pests . these studies support the assumption that such a novel strategy may provide new avenues for resistance management studies involving multiple transgenes in crop plants . the pyramiding technology has been noted to provide excellent control of a broad range of herbivores and reinforces the argument that developed resistance in selected herbivores against one toxin will still be fully susceptible to other toxin molecules present in the plants ( reviewed by ) . if so , is gene pyramiding an enduring strategy for sustainable resistance ? given the insecticidal activity , it appears very clear that single gene transgenics in the field can not be sustained without an integrated approach . such approach will definitely delay or , with other components of ipm strategies , preclude the possible adaptation of herbivore - populations to resistant transgenic plants . as mentioned above , one strategy to delay the evolution of resistant herbivores is the stacking of multiple bt genes . however , major concerns with this approach are ( i ) limited insecticidal properties of bt genes to the target herbivores due to high specificity of bt toxins , ( ii ) the potential cross - resistance leading to the evolution of resistant herbivores and ( iii ) the restricted use of possible novel combinations of bt genes . a possible solution to the aforementioned problems may be either pyramiding of bt genes with another transgene having a different mode of action , as also discussed earlier , or by pyramiding the native herbivory resistance genes with selected bt transgenes ( reviewed in ) . in reference to the latter , walker et al. identified that when the ssr - based ir - qtl conditioning corn earworm resistance in soybean was combined with btcry1ac gene , it resulted in detrimental effects on the larval weights , and with the least foliage consumption . with these results , can it be assumed that the combined effects of endogenous resistance and transgene - based resistance are additive while having independent mode of action ( s ) ? genetic modification of cotton with the btcry1ab transgene with high terpenoid levels showed more resistance to tobacco budworm than transgenics with low terpenoid levels . however , transgenics developed in susceptible potato with btcry3a gene against colorado potato beetle larvae exhibit higher or at least similar mortality in the target herbivores as in the resistant potato line with leptine glycoalkaloids . in the latter scenario , a better strategy may be the identification of ir - qtls with the help of molecular markers , rather than with specific traits or compounds known to be associated with the resistance phenotype , as was earlier exampled in soybean , cotton , and potato . the native plant resistance is suggested to be advantageous also in the controlling of the resistant herbivore populations , as demonstrated in the case of tobacco budworm , providing the lethal dose required for resistance management strategy . thus , staking multiple bt genes along with the exploitation of native resistance through marker - assisted breeding will comprise complementary additive effects ameliorating the deployment of resistance management practices in the field . what are the key evolutionary attributes that make the conversion of wild germplasm to crop such a prevalent phenomenon ? are the most important evolutionary properties of modern crop plants due to contemporary breeding efforts per se , or is domestication , artificial selection , just as important ? in the opinion of a crop breeder , the end product is warranted by both . gene mutations occurred during selection , polyploidy , or artificial or natural hybridization and brought remarkable genetic variations . for management of stress conditions in crops , do parallel breeding efforts share similar genomic modifications or is it system / event specific , given the likelihood that different features of human - mediated selection may predominate among various lineages ? very important successes during domestication in terms of crop yield and quality with other agronomic aspects have been achieved , but with compromised resistance to the herbivores and diseases . all modern crop plants are protected against herbivores by using synthetic toxic chemicals , as has been the case for many years , and this often leads to the development of resistance in herbivores against such frequently used chemicals . to circumvent this problem , introgression of important traits from the wild gene poolhas been performed through classical breeding , but has met limited success due to incompatibility and numerous genetic and genomic differences among plant forms . such principal distinctions may be critical , in that the interactions established by the initial conditions propagate from the time of initial origin through periods of stabilization and long - term evolutionary outcome . based on the limited number of available examples , when gene transfer occurred in the nascent interspecific crosses , genetic engineering techniques had proven useful to overcome such problems . two potential benefits of genetic modification are precise transfer of foreign gene sequences and the evolution of adaptive transgressive traits . two potential benefits of genetic modification are precise transfer of foreign gene sequences and the evolution of adaptive transgressive traits . classic plant breeding programs are reinstated for heterozygosity and therefore may be more likely to experience locus - specific linkage with its evolutionary consequences . in contrast , a transgenic crop plant possesses a greater insertion of multiple alien genic sequences with immediate phenotypic effect and genetic novelty . indeed , experimental analysis of genetically modified crops for multiple traits suggests that pyramiding of favorable genes for individual trait may yield a super - crop with high returns . thus , the breadth of recurrently selected traits in the domesticated plants and the genetic transformation system together has a major effect on the creation and retention of evolutionary novelty in the crop system .\noutput:\n" }, { "from": "agent", "value": "transformation of wild species into elite cultivars through domestication entails evolutionary responses in which plant populations adapt to selection . domestication is a process characterized by the occurrence of key mutations in morphological , phenological , or utility genes , which leads to the increased adaptation and use of the plant ; however , this process followed by modern plant breeding practices has presumably narrowed the genetic diversity in crop plants . the reduction of genetic diversity could result in broad susceptibility to newly emerging herbivores and pathogens , thereby threatening long - term crop retention . different qtls influencing herbivore resistance have also been identified , which overlap with other genes of small effect regulating resistance indicating the presence of pleiotropism or linkage between such genes . however , this reduction in genetic variability could be remunerated by introgression of novel traits from wild perhaps with antifeedant and antinutritional toxic components . thus it is strongly believed that transgenic technologies may provide a radical and promising solution to combat herbivory as these avoid linkage drag and also the antifeedant angle . here , important questions related to the temporal dynamics of resistance to herbivory and intricate genetic phenomenon with their impact on crop evolution are addressed and at times hypothesized for future validation ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: there is a clear link between age and susceptibility to a wide range of diseases [ reviewed in ( niccoli and partridge 2012 ) ] and key among the age - related diseases that are rising in incidence is diabetes and metabolic syndrome . ageing has specific consequences on mammalian physiology , but it also interacts with genetic variation to result in disease . there are clear genetic influences in the majority of age - related pathologies , and to fully understand disease , and how to treat it , we must understand these interactions and the influence have on the pathogenesis of these diseases ( fig1major changes observed in important metabolic tissues due to ageing and their contributions to age - related disease major changes observed in important metabolic tissues due to ageing and their contributions to age - related disease metabolism and ageing are inextricably intertwined : reducing calorie intake has been demonstrated in a number of studies to improve longevity , with some additional benefits to health ( robertson and mitchell 2013 ; soare et al . these nutrient - sensing pathways appear to modulate ageing as a whole and reducing calorie intake activates target of rapamycin ( tor ) , and involves the sirtuin family of genes ( hall et al .2013 ) , resulting in an increased lifespan in several model organisms ( fontana et al . 2010 ; kapahi et al . 2010 ; hall et al . the intimate relationship between nutrient intake and longevity is now the subject of extensive investigations to identify potential health benefits of caloric restriction . however , whilst there are clear benefits in some model organisms , the health benefits of caloric restriction are less clear - cut in primates ( mattison et al . the level of calorie intake and its influence on ageing and health highlights the close link between metabolism and ageing , and given the range of changes in metabolism with ageing ( barzilai et al . the interrelationship between the ageing process ( es ) and metabolism is emphasised by the increased longevity in mice with a deletion of the insulin receptor ( ir ) substrate 1 gene ( selman et al . a clear distinction must be made between increasing lifespan and health span ; the former being an increase survival time and the latter a concept reflecting the concerns of health care professionals and researchers whose major concern is disease . increased longevity is not a panacea against all ills and long - lived individuals still succumb to common age - related disorders ( andersen et al . 2012 ) . the increase in lifespan that the human race has experienced over the last few decades to centuries resulted in a greatly increased disease burden and thus we still need to address pathologies on an individual basis to improve the condition of elderly patients and alleviate symptoms of these diseases . type 2 diabetes is the major metabolic disease associated with ageing populations , with incidence of disease typically occurring after 40 years and peaking between 60 and 74 years of age . the pathogenesis of type 2 diabetes is characterised by peripheral insulin resistance and impaired insulin secretion . type 2 diabetes itself increases the risk for multiple other age - related diseases such as cancer , stroke , atherosclerosis , cardiovascular diseases ( cvd ) , parkinson s disease , nonalcoholic fatty liver disease ( nafld ) and alzheimer s disease ( ad ) . ageing in turn can pre - dispose to diabetes and impaired glucose tolerance ( igt ) through effects on insulin secretion and insulin action . many factors contribute to this observed decrease in insulin secretion in ageing , including age - associated loss of sirt1 - mediated glucose - stimulated insulin secretion ( gsis ) ( ramsey et al .2008 ) , decreased beta - cell sensitivity to circulating incretins ( chang and halter 2003 ) , and age - associated decrease in mitochondrial function and increased oxidative stress . rodent models have been utilised to demonstrate elegantly the inability of older animals to increase insulin secretion in response to increased insulin demand , which is driven by insulin resistance ( van der heide et al . insulin secretion in the beta cell is the result of the uptake ( via glut2 ) and metabolism of glucose [ via glucokinase ( gck ) ] , resulting in the generation of atp ( mainly in the mitochondria ) , closure of the atp - sensitive potassium channels leading to membrane depolarisation and influx of calcium , a rise in intra - cellular calcium levels results in exocytosis of insulin granules . the age - related changes in this process and their relevance to igt and type 2 diabetes will be discussed briefly . sensing and uptake of glucose by the beta cell are the first step in insulin secretion ; glucose uptake in the beta cell is facilitated by the glucose transported glut2 with numerous studies demonstrating glut2 is essential for glucose uptake . loss of pancreatic - cell glut2 expression in humans is associated with hyperglycaemia and impaired gsis ( ohtsubo et al . 2005 ) . age - associated decrease in the expression of glut2 has been demonstrated in rodent models ( ihm et al .2007 ) ; however , reduced glut2 by itself can not explain the reduction in gsis in islets of goto kakizaki ( gk ) rats ( ohneda et al .1993 ) . after uptake , glucose undergoes oxidation resulting in the generation of atp , which in turn is required for insulin release . the oxidation of glucose is initiated by gck which catalyses the first and rate - limiting reaction in glycolysis . gene expression studies have shown gck levels were significantly increased in healthy aged rats ( frese et al .2007 ) suggesting a potential mechanism to overcome age - associated glucose intolerance and insulin resistance . increased atp / adp ratio in - cells results in depolarisation of beta - cell membrane and extracellular ca influx into the - cell . these changes are mediated through atp - sensitive katp channels and voltage - gated ca channels . studies in islets from 24 - month - old rats compared to 3 - month - old islets showed that raising the glucose concentration from 3 to 5.6 and 16.7 mm had no effect on k efflux and significantly diminished net uptake of ca . these data suggest that the decreased insulin secretory response during old age is in part due to inadequate inhibition of k efflux and diminished net uptake of ca ( ammon et al . elevation of cytosolic - free ca concentrations is required for the process of exocytosis of insulin which is the final step of insulin secretion . insulin is stored in large dense core vesicles ( ldcvs ) or insulin granules and is released via exocytosis a multistage process involving vesicle trafficking , docking and fusion with the plasma membrane . three main factors are involved with regulation of - cell mass , proliferation and apoptosis of - cells and islet neogenesis ( differentiation of a progenitor cell or transdifferentiation of pancreatic non -- cell to - cell ) . it has been shown that age correlates with decreased proliferation and enhanced sensitivity to glucose - induced - cell apoptosis ( maedler et al . ( 23 month old ) rats , increasing glucose concentrations decreased - cell apoptosis and increased - cell proliferation , whereas in old ( 78 month old ) islets , increasing concentrations of glucose resulted in a linear increase in - cell death and a decrease in proliferation . - cell mass can slowly expand in adult rodents in response to increased insulin requirements or during pregnancy ( parsons et al .1992 ) , with - cell proliferation and the capacity of the - cell to regenerate declining with age in mice ( tschen et al . young rodents respond to a high - fat diet ( hfd ) by increasing - cell mass maintaining glucose homoeostasis , whereas old mice by contrast do not display increases in - cell mass or proliferation and become diabetic . islet neogenesis that occurs during embryonic development and in very early post - natal life can lead to - cell mass expansion and has been shown to be important in increasing - cell mass in the adult during periods of increased insulin demand such as obesity ( butler et al . although the potential for - cell replication appears to decline substantially with age , the rate of islet neogenesis is not affected by ageing in humans ( reers et al . insulin action is the ability of insulin to bind to its receptors , the net physiological effect of which is ( 1 ) the regulation of glucose homoeostasis through increased glucose uptake and decreased hepatic glucose production ( via decreased gluconeogenesis and glycogenolysis ) and ( 2 ) increase in lipid synthesis in adipocytes and the attenuation of the release of free fatty acid ( ffa ) from triglycerides in fat . insulin resistance results when circulating levels of insulin are insufficient to regulate these process appropriately and it has been well documented that ageing is associated with a decline in insulin action ( defronzo 1981 ; rowe et al . 1983 ; chen et al .1988 ) which is thought to directly contribute to the high prevalence of igt and type 2 diabetes with age ( enzi et al . increase of visceral fat ( vf ) levels with ageing has been implicated in insulin resistance , cvd and type 2 diabetes . several studies suggest that vf increases throughout the lifespan of adults ( independent of race or sex ) and that increase is independent of increases in body weight ( borkan et al . experiments in which vf was extracted from 20 - month - old fischer 344 brown norway ( fbn ) rats prevented the progressive decrease in insulin action and delayed the onset of diabetes ( gabriely et al . impaired insulin action also leads to a marked increase in the rate of lipogenesis in adipose tissue and activation of hepatic gluconeogenesis in spite of already high circulating plasma glucose levels . this increased rate of lipolysis increases circulating ffa levels which exacerbates insulin resistance in the whole body . lowering ffa levels overnight normalises insulin sensitivity in obese non - diabetic individuals and significantly improves insulin sensitivity in obese diabetic patients ( santomauro et al . high ffa levels may provide a unifying mechanism for insulin resistance in obesity , type 2 diabetes , lipodystrophy and ageing ( samuel et al . 2010 ) . insulin resistance in the central nervous system ( cns ) has been show to play an important role in regulating whole - body glucose metabolism . like peripheral tissues ( such as muscle , adipose tissue and liver ) , insulin signalling molecules such as the ir and its substrates ( irs ) ablation of the ir in the cns alone results in a more severe impairment in peripheral glucose homoeostasis that mice - lacking ir in the peripheral tissues ( koch et al . studies have shown that intra - cerebroventricular administration of insulin was more effective at reducing food intake and body weight in 3 - month - old rats than in 8 - and 24 - month - old rats , indicating the development of hypothalamic insulin resistance with age in wistar rats ( garcia - san frutos et al . an ageing - associated increase in central and peripheral insulin resistance could therefore contribute to diabetes . obesity is one of the major risk factors for diabetes and metabolic disease , and fat distribution alters during the ageing process . obesity is defined by body mass index [ bmi = weight ( kg ) / height ( m ) ] , overweight is described as a bmi : 2529.9 kg / m and obese as a bmi 30 kg / m and is closely related to both percentage of body fat and total body fat ( who 2011 ) . obesity leads to metabolic imbalances , reduces life span and accelerated cellular processes similar to those of ageing ( ahima 2009 ) , such as deterioration of the structure and function of organs associated with oxidative stress , genetic instability and the disturbance of homeostatic pathways .20 % of cancers in the us over the last 25 years have been predicted to be caused by weight gain and obesity ( calle et al . the causal link between obesity and endometrial and oesophageal cancers has been suggested to be as high as 37 % ( international agency for research on cancer 2002 ) . worldwide obesity has nearly doubled since 1980 , who figures show in 2008 , more than 1.4 billion adults , 20 and older , were overweight .65 % of the world s population lives in countries where overweight and obesity kill more people than underweight , and more than 40 million children under the age of five were overweight in 2011 .44 % of the diabetes burden , 23 % of the ischaemic heart disease burden and between 7 and 41 % of certain cancer burdens are attributable to overweight and obesity ( who 2011 ) . body composition changes dramatically throughout life , total body weight increases until middle age ( 3050 years ) and slowly declines thereafter ( lutz et al . 2008 ) , total fat mass peaks in early or late middle age ( 4070 years ) resulting in an increase in percentage of body fat ( kuk et al . 2009 ) . by advanced old age ( 85 years ) , adipose tissue is redistributed from subcutaneous to visceral depots plus ectopic sites such as muscle , liver and bone marrow with important metabolic complications . manipulating adipose tissues abundance and distribution has profound effects on life span and age - related disease onset . adipose tissue is not solely responsible for energy storage , it also has important immune , endocrine , homeostatic and thermal actions ( bray and ryan 2006 ) , with different fat deposits acting in distinct roles . different fat depots undergo changes at differing rates with ageing , leading to fat redistribution from subcutaneous to visceral depots ( cartwright et al . abdominal fat increases , whilst subcutaneous fat ( especially from the lower body ) decreases . fat also accumulates in or around the heart , skeletal muscle and bone marrow , and increased vf is independently associated with mortality , insulin resistance , diabetes , cvd , cerebrovascular disease , heart failure , cognitive impairment and hepatic steatosis . the combination of glucose intolerance , insulin resistance , central obesity , dyslipidemia and hypertension constitutes metabolic syndrome ( morley 2004 ) . loss of subcutaneous fat may contribute to reduced leptin - mediated - oxidation of fatty acids , since leptin is produced primarily by subcutaneous fat with little production by vf ( kirkland and dobson 1997 ) . reduced - oxidation of fatty acids together with reduced capacity of subcutaneous fat to store triglycerides may contribute to increasing circulating ffas in old age . high ffa levels lead to lipotoxicity , with cellular stress response activation , and apoptosis ( eckel et al .2005 ) redistribution of excess circulating ffas may in turn contribute to insulin resistance and therefore be a central mechanism of metabolic syndrome . in the pancreas , ffas result in insulinopenia as they are highly toxic to pancreatic - cells ( bays et al . ffas also generate endothelial cell dysfunction and impair vasodilation additionally contributing to hypertension . in old age , even pre - adipocytes become susceptible to lipotoxicity , at concentrations at which pre - adipocytes from younger animals remain viable . these cells from older animalsaccumulate small lipid droplets characteristic of lipotoxicity and die due to apoptosis ( guo et al . ageing mice will lead to moderate obesity as in general mice are cage - bound , are relatively sedentary and have food ad libitum . however , common models used to study obesity are mice fed on a hfd or genetically modified mice predisposed to obesity such as the ob / ob mice ( mayer and jones 1953 ) . hfd generally consists of ~ 40 % fat content and induces rapid weight gain , and ob / ob mice become obese within a few weeks age ( wang et al .2014 ) . in both cases , mice are young and obese and thus missing important aspects of an ageing physiology . recent studies have demonstrated a difference in gene expression in fat deposits between young , obese mice and old , obese mice ( liu et al . the primary function of mitochondria is to produce atp through the process of oxidative phosphorylation and is unique among the cellular organelles as they contain their own genetic information mtdna , a double - stranded circular molecule of 16.5 kb encoding 13 proteins , 22 transfer rnas ( trnas ) and 2 ribosomal rnas in mammals . the 13 mtdna - encoded proteins are all components of the respiratory chain ( rc ) or the atp synthase . proper mitochondrial function is required for normal metabolism and health . among many contributing factors to ageing is the gradual decline of mitochondrial function with age leading to progressive tissue damage via oxidative stress . mutations in mitochondrial dna result in a variety of phenotypes including myopathies , neuropathies , diabetes , as well as premature signs of ageing and reduced lifespan ( larsson 2010 ; patti and corvera 2010 ; lee and wei 2012 ) . mitochondrial dysfunction occurs at an organ - specific level in many age - related diseases including type 2 diabetes and obesity . in both rodents and humans , both obesity and diabetesare associated with reduced expression of mtdna and reduced levels of oxidative phosphorylation in muscle , liver and adipose tissues ( larsson 2010 ) , with caloric restriction increasing mitochondrial biogenesis and maintaining mitochondrial function ( lee and wei 2012 ) . there is evidence that the number of mtdna mutations increases with age in humans ; for example , deletions in mtdna have been observed in the aged human cns , skeletal muscle and hepatocytes ( yen et al .2002 ) , whereas mtdna point mutations accumulate in ageing colonic crypts ( taylor et al . these mutations may arise as a consequence of unrepaired dna damage , for example , damage caused by ros or replication errors during normal mtdna synthesis ( larsson 2010 ) . the replication of mtdna occurs independently of the cell cycle ; therefore , a particular mtdna molecule may be replicated many times or not at all as a cell divides ( clayton 1982 ) . experimental data supporting a role for mtdna mutations in ageing were only recently obtained by the generation of mtdna mutator mice ( trifunovic et al . the mtdna mutator mice are homozygous for a knock - in mutation that leads to the expression of a proofreading - deficient catalytic subunit of mtdna polymerase ( polga ) , the expression of which causes excessive mtdna mutagenesis with the formation of 3 different forms of mtdna mutations : random point mutations , linear molecules with large deletions and molecules containing multimers of the control region . the mtdna mutator mice display a range of phenotypes similar to those observed with natural ageing , including kyphosis , anaemia , hair loss , alopecia , greying of the hair , hearing loss , cardiomyopathies , reduced fertility , weight loss and a shortened lifespan . evidence strongly suggests that the high mtdna mutation load in mtdna mutator mice leads to the synthesis of rc subunits with amino acid substitutions that cause instability of the rc complexes ( edgar et al . mtdna deletor mice which express a mutant - dominant version of twinkle , the replicative dna helicase in mitochondria , accumulate low levels of large - scale mtdna deletions . although these mice show progressive rc dysfunction and late - onset mitochondrial myopathy , they do not display a progeroid phenotype and have a normal lifespan . this would suggest that accumulation of mtdna deletions and progressive rc dysfunction may not be sufficient to accelerate ageing ( tyynismaa et al . 2005 ) . although mitochondrial dysfunction has been shown to directly affect ageing , cellular and metabolic alterations also contribute to the ageing process by promoting secondary changes in mitochondrial energy production or mitochondrial biogenesis . therefore , ageing phenotypes have been linked to aberrant mitochondrial biogenesis caused by impaired retrograde signalling regulated by nuclear genes and factors dependent of mitochondrial metabolism , for example , atp , ca , ros , no , nad / nadh . insulin / igf - 1 signalling ( iis ) and tor signalling pathways are the two main nutrient - sensing pathways that have been linked to the regulation of lifespan .2003 ; anderson et al . 2008 ; choi et al . 2008 ) and sirt1 ( finley and haigis 2009 ) are involved in the regulation of mitochondrial metabolism and lifespan . it should be noted , however , that pgc - 1 does not regulate basal mitochondrial biogenesis , but is also involved in increasing mitochondrial function on demand by activating the expression of certain nuclear - encoded genes ( lee et al . there is a need for future studies to determine the relative contributions of mitochondrial dysfunction , cellular bioenergetic deficiency or changes in mitochondrial ros production ( affecting oxidative damage and signalling ) to different age - related diseases . members of diverse drug classes undermine mitochondrial function , and routine screens need to be incorporated within the drug - development process to measure mitochondrial toxicity . assays for mitochondrial function , cell models that better report mitochondrial impairment , and new animal models that more faithfully reflect mitochondrial dysfunction in particular ageing are required . the harwell metabolic ageing screen may produce potentially important models for use in drug toxicity screening . as discussed a general consequence of ageing is obesity , although environmental factors such as diet and activity also play a significant role as well in the amassing of fat mass with age . generally with age2002 ) and longevity ( muzumdar et al . 2008 ) . increased adiposity , particularly vf , has been associated with an increased production of inflammatory cytokines ( sepe et al . these inflammatory cytokines are thought to be produced by pre - adipocytes ( harkins et al .2004 ; chung et al . 2006 ) and increased macrophage infiltration of adipose tissue is observed with ageing . in addition to the increased inflammatory environment associated with vf , the senescence associated secretory profile ( sasp ) ( salama et al .2014 ) contributes to an increased inflammatory milieu as part of the ageing physiology of mammals . the consequences of an increased systemic inflammation are far reaching as inflammation contributes to the pathophysiology of many age - related diseases such as osteoarthritis and neurodegenerative disease . thus , the aetiology of changes in the distribution of adipose tissue during ageing and the subsequent inflammaging are important factors in age - related disease . model organisms have made an immeasurable contribution to our understanding of genetic contributions to disease and the resultant pathogenesis , and will continue to do so . paramount among the model organisms has been the mouse , primarily because of the genetic tools that have been created and the homology of its biology to humans . however , the majority of mouse models are acute or early onset with significant pathology within a few months or even weeks and do not possess an aged physiology . the ageing process will impact on disease , and thus despite the clinical challenges we face being ageing population with late onset or chronic pathologies , many of the models used to study disease and in pre - clinical studies do not reflect the true nature of disease . in order to address the challenges that health services are now facing worldwide with an ageing population , and to better understand the interactions between genetic lesions and the ageing mammalian physiology , it is necessary to place mutations in an ageing context . dark samples are examples of challenges that have helped identify novel mutations resulting in disease phenotypes ( nolan et al . 2000 ; it is clear that substantial changes occur within the mammalian physiology during the ageing process and that these can result in , or contribute to , disease ( niccoli and partridge 2012 ) . to develop treatments and interventions , we must understand these interactions and the only way to do this is by ageing mutant mice , using the ageing physiology as a challenge to reveal mutations that result in age - related pathologies . this is often done on an individual basis in specific disease areas such as cancer and autoimmunity but has not been attempted as part of a forward genetics screen before . in addition to age - related disease , using age - challenged mutant mice will reveal the primary and secondary effects of chronic disease over time . the large - scale phenotype - driven screens , exemplified by enu mutagenesis and the international knock - out mouse programmes ( acevedo - arozena et al .2013 ) , are discovery platforms that have been eminently successful in identifying genetics lesions that result in a phenotype , thus defining novel disease - associated pathways and assigning novel functions to genes . by taking a broad - based phenotype - driven approach of mutant mice , no assumptions are made about the effects of a particular mutation and novel functions and phenotypes can therefore be associated to genes . enu - based screens are particularly powerful because they generate point mutations , better modelling the genetic variation seen in humans , and can result in a wide variety of effects on protein function , even isolating different functional domains . confirmation of a genetic basis of outliers is achieved by mapping of mutations , thus eliminating natural variation in phenotypes and , whilst successful , these are primarily early onset screens . we argue that to improve our modelling of age - related disease and to highlight genetic lesions that interact with an ageing physiology to result in age - related disease , it is necessary to carry out such phenotype - driven screens using ageing as a challenge . in addition to age - related disease , using age - challenged mutant mice will reveal the primary and secondary effects of chronic disease over time . metabolism is a particularly suitable area for such studies as outlined above ; there are many suitable and high throughput screens that will reveal phenotypes . not only are primary metabolic disorders relatively easy to detect using glucose and insulin tolerance tests , fasted glucose levels and body composition screens , but also co - morbidities such as diabetic nephropathy and retinopathy can be screened for in mice using clinical chemistry analysis and visual acuity screens . additionally , as the opportunity for exercise within standard caging conditions is limited , in general aged mice become obese . thus , aged mice are doubly challenged by age and obesity , all too familiar condition in patients . whilst progeroid diseases model an early ageing phenotype , these do not necessarily recapitulate the plethora of age - related pathologies . we are now undertaking an age - challenged phenotype - driven screen to identify genes and pathways that result in age - related pathologies using established phenotype - driven protocols ( nolan et al . 2000 ; rastan et al .2004 ; acevedo - arozena et al . 2008 ) with an ageing challenge . whilst primarily focussed on mutants revealing gene function that contributes to disease , there is also the potential to identify mutations that are advantageous and protect against the consequences of ageing . lifetime studies are confounded by expense but a detailed phenotypic pipeline may reveal mutations preventing obesity or other adverse conditions such as ageing and thus may represent mutations resulting in health benefits ( selman et al .2008 , 2009 ) . in order to address the lack of suitable models of age - related metabolic disease in particular type 2 diabetes and its associated complications mice from the harwell ageing screen ( has ) , a g3 recessive enu mutagenesis screen [ ageing g3 pedigrees to 18 months of age ( fig . males ( approximately 50 / pedigree ) are tested in a longitudinal study with body composition , clinical biochemistry markers and glucose tolerance followed over the lifespan of the animals . phenodeviants within pedigrees are snp mapped to identify candidate regions and the causative mutation identified by whole - genome generation sequencing ( wgs ) of the founder g1 male . gene identification without inheritance testing is paramount to the quick identification of causative genes in an aged mouse model.fig . c57bl / 6 j males are enu treated and breed to c3h / heh females to produce g1s . g2 females are mated with their g1 founder to allow the identification of recessive mutations in the g3 generation , which enter the phenotyping pipelines . each individual g3 mouse will carry a range of enu - induced mutations that will be homozygous , heterozygous or wild type for any given mutation . identifying multiple mice with the same phenotype allows the identification of the causative mutation by mapping as the enu - induced mutations will only be present in regions of the genome derived from the founder ( g0 ) strain , in this case c57bl / 6 j a schematic of the breeding scheme for the harwell ageing mutagenesis screen . c57bl / 6 j males are enu treated and breed to c3h / heh females to produce g1s . g2 females are mated with their g1 founder to allow the identification of recessive mutations in the g3 generation , which enter the phenotyping pipelines . each individual g3 mouse will carry a range of enu - induced mutations that will be homozygous , heterozygous or wild type for any given mutation . identifying multiple mice with the same phenotype allows the identification of the causative mutation by mapping as the enu - induced mutations will only be present in regions of the genome derived from the founder ( g0 ) strain , in this case c57bl / 6 j body composition is measured with echo mri at 3 , 6 , 12 and 18 months , early time points are included to identify early onset obesity models which can be followed over the progression of disease and to identify onset of metabolic disease over the lifespan of the mouse . as expected fat mass increases with age , however , potential advantageous body composition genes can be identified in pedigrees where mice remain lean . females in each cohort can additionally be tested if a body weight phenotype is identified within the males , to give additional statistical power . body composition is expressed as absolute lean and fat mass in grams and can be used to identify mice with increased lean mass as well as increased fat mass . data can also be expressed as percentage fat / lean mass to compensate for any observed differences in body size . fasted clinical chemistry analysis from tail bleeds is performed at 4 , 713 and 18 ( terminal ) months of age . routinely tests for fasted glucose and fructosamine ( glucose homoeostasis ) , total cholesterol and triglycerides ( lipid profile ) , alt ( liver function ) and creatinine ( kidney function ) are performed at 4 , 7 , and 13 months , with a full biochemical screen performed on the larger terminal sample . pedigrees with significantly elevated plasma glucose and / or fructosamine additionally undergo intra - peritoneal glucose tolerance ( ipgtt ) testing at 5 , 8 and 14 months of age , with fasted plasma insulin levels also measured . additional secondary phenotyping tests can be added to the screen if necessary in order to measure additional metabolic parameters , for example , whole - body oxygen consumption ( oxymax , clams ) , food intake and activity measured and urine collected . additional biochemical tests can also be added to the primary screen for pedigrees with suspected renal or liver disease . ageing results in a series of defined physiological effects that impact on metabolism and has direct effects on other important processes either directly or indirectly resulting in disease . to better understand the pathogenesis of disease , it is important to incorporate the ageing physiology into studies and more importantly into models of disease\noutput:\n" }, { "from": "agent", "value": "ageing can be characterised by a general decline in cellular function , which affects whole - body homoeostasis with metabolic dysfunction a common hallmark of ageing . the identification and characterisation of the genetic pathways involved are paramount to the understanding of how we age and the development of therapeutic strategies for combating age - related disease . furthermore , in addition to understanding the ageing process itself , we must understand the interactions ageing has with genetic variation that results in disease phenotypes . the use of model systems such as the mouse , which has a relatively short lifespan , rapid reproduction ( resulting in a large number of offspring ) , well - characterised biology , a fully sequenced genome , and the availability of tools for genetic manipulation is essential for such studies . here we review the relationship between ageing and metabolism and highlight the need for modelling these processes ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a total of 58 strains of v. cholerae o1 el tor isolated in calcutta before ( march december 1992 ; group i ) , during ( july november 1993 ; group ii ) , and after ( march 1994june 1995 ; group iii ) the v. cholerae o139 outbreak ( 8 ) were included in this study . these strains , belonging to ribotypes ri , rii , and riii , were maintained in brain - heart infusion broth supplemented with 15 % glycerol at 70c and grown when needed ( 8 ) . the 3 conserved sequence of class i integrons is characterized by antibiotic resistance gene qace1 and the sulfonamide resistance gene sul1 . to identify class i integrons , primers atcgcaatagttggcgaagt ( accession no . x12869 ) , specific for 3 cs ( 5 ) , were amplified in this region by polymerase chain reaction as described ( 5 ) . a 0.8 - kb product , found in 22 of the 58 isolates , was confirmed to be the 3 cs of class i integrons by sequencing ( table ) . to identify the gene cassette in the class i integrons , primers previously used to amplify the region between the 5 cs and 3 cs ( 5 ) were used . all 22 strains produced a 1.0 - kb amplicon , which on sequencing was found to contain the aada1 gene that confers resistance against aminoglycosides , streptomycin , and spectinomycin ( 4,5 ) . ( 8 ) a , ampicillin ; cf , ciprofloxacin ; fz , furazolidone ; g , gentamycin ; n , neomycin ; na , nalidixic acid ; s , streptomycin ; sm , sulfamethizole ; t , tetracycline ; tr , trimethoprim . a total of 17 out of the 22 class i integron - bearing strains belonged to the before period . the remaining five , though isolated after june 1993 , probably represented carry - over strains . these five strains belonged to the same ri ribotype as the other 16 strains from the before period ( table ) and had a ctx structure identical to the other strains with ri ribotype ( 8 ) . resistance of v. cholerae isolates to ampicillin ( 10 g ) , ciprofloxacin ( 5 g ) , furazolidone ( 50 g ) , gentamycin ( 10 g ) , neomycin ( 30 g ) , nalidixic acid ( 30 g ) , streptomycin ( 10 g ) , sulfamethizole ( 100 g ) , tetracycline ( 30 g ) , and trimethoprim ( 25 g ) were examined by using commercial discs ( hi media , bombay , india ) as described ( 1 ) . an overall increase in the number of strains with resistance to a greater number of antibiotics was seen in the isolates of the post - o139 period ; a fourfold increase in resistance against trimethoprim , a drug often used for the treatment of cholera in children and pregnant women , was noted . almost all strains , from all isolation periods , were uniformly resistant to streptomycin and sulfamethizole , but none were found to be resistant to tetracycline , gentamycin , or ciprofloxacin . none of the strains belonging to the ribotypes rii and riii , which were all isolated during and after the o139 outbreak , carried the aada1 gene cassette ( coding for aminoglycoside resistance ) ; however , they were all resistant to streptomycin . further , all of the strains were resistant to trimethoprim . since strains of v. cholerae , which harbor the sxt element , are resistant to streptomycin and trimethoprim ( 7 ) , we sought to determine if the resistance of the post - o139 strains to streptomycin and trimethoprim could be traced to an sxt element . colony hybridization of the 58 strains with a 0.8 - kb probe , specific for the sxt integrase gene ( 7 ) , showed that all trimethoprim - resistant strains from all isolation periods and all during and after streptomycin - resistant carried the sxt element ( table ) . further , five of these strains harbored both sxt and the aada1 gene cassette ( table ) . our survey thus suggested that while the streptomycin resistance of the strains isolated before the o139 outbreak was due to the aada1 gene cassette carried by the class i integrons , the sxt element was probably responsible for this phenotype in the post - o139 strains . since none of the strains harbored any plasmid and the resistance determinants present in the class i integrons and in the sxt element could account for only a few markers , other determinants of antibiotic resistance may exist . ( 4 ) found that the o1 strains isolated in vietnam in 1994 and after had the ribotype identical to that found in some of the o1 strains isolated in samutsakorn , thailand , during and after the 1993 o139 outbreak . both pre - and post - o139 isolates carried class i integrons with the aada2 gene cassette . this fact led dalsgaard et al . to conjecture that this distinct o1 strain might have been transferred between thailand and vietnam ( 5 ) . however , the possibility of its migrating from a third country could not be ruled out . the ribotype of the pre - o139 , o1 calcutta strains examined in this study was identical to that of the samutsakorn strains ( 4,5,8 ) . however , as can be seen from the data presented here , unlike the samutsakorn strains , these strains harbored aada1 gene cassette . the 3 conserved sequence of class i integrons is characterized by antibiotic resistance gene qace1 and the sulfonamide resistance gene sul1 . to identify class i integrons , primers atcgcaatagttggcgaagt ( accession no . x12869 ) , specific for 3 cs ( 5 ) , were amplified in this region by polymerase chain reaction as described ( 5 ) . a 0.8 - kb product , found in 22 of the 58 isolates , was confirmed to be the 3 cs of class i integrons by sequencing ( table ) . to identify the gene cassette in the class i integrons , primers previously used to amplify the region between the 5 cs and 3 cs ( 5 ) were used . all 22 strains produced a 1.0 - kb amplicon , which on sequencing was found to contain the aada1 gene that confers resistance against aminoglycosides , streptomycin , and spectinomycin ( 4,5 ) . sharma et al . ( 8 ) a , ampicillin ; cf , ciprofloxacin ; fz , furazolidone ; g , gentamycin ; n , neomycin ; na , nalidixic acid ; s , streptomycin ; sm , sulfamethizole ; t , tetracycline ; tr , trimethoprim . a total of 17 out of the 22 class i integron - bearing strains belonged to the before period . the remaining five , though isolated after june 1993 , probably represented carry - over strains . these five strains belonged to the same ri ribotype as the other 16 strains from the before period ( table ) and had a ctx structure identical to the other strains with ri ribotype ( 8 ) . resistance of v. cholerae isolates to ampicillin ( 10 g ) , ciprofloxacin ( 5 g ) , furazolidone ( 50 g ) , gentamycin ( 10 g ) , neomycin ( 30 g ) , nalidixic acid ( 30 g ) , streptomycin ( 10 g ) , sulfamethizole ( 100 g ) , tetracycline ( 30 g ) , and trimethoprim ( 25 g ) were examined by using commercial discs ( hi media , bombay , india ) as described ( 1 ) . an overall increase in the number of strains with resistance to a greater number of antibiotics was seen in the isolates of the post - o139 period ; a fourfold increase in resistance against trimethoprim , a drug often used for the treatment of cholera in children and pregnant women , was noted . almost all strains , from all isolation periods , were uniformly resistant to streptomycin and sulfamethizole , but none were found to be resistant to tetracycline , gentamycin , or ciprofloxacin . none of the strains belonging to the ribotypes rii and riii , which were all isolated during and after the o139 outbreak , carried the aada1 gene cassette ( coding for aminoglycoside resistance ) ; however , they were all resistant to streptomycin . further , all of the strains were resistant to trimethoprim . since strains of v. cholerae , which harbor the sxt element , are resistant to streptomycin and trimethoprim ( 7 ) , we sought to determine if the resistance of the post - o139 strains to streptomycin and trimethoprim could be traced to an sxt element . colony hybridization of the 58 strains with a 0.8 - kb probe , specific for the sxt integrase gene ( 7 ) , showed that all trimethoprim - resistant strains from all isolation periods and all during and after streptomycin - resistant carried the sxt element ( table ) . further , five of these strains harbored both sxt and the aada1 gene cassette ( table ) . our survey thus suggested that while the streptomycin resistance of the strains isolated before the o139 outbreak was due to the aada1 gene cassette carried by the class i integrons , the sxt element was probably responsible for this phenotype in the post - o139 strains . since none of the strains harbored any plasmid and the resistance determinants present in the class i integrons and in the sxt element could account for only a few markers , other determinants of antibiotic resistance may exist . ( 4 ) found that the o1 strains isolated in vietnam in 1994 and after had the ribotype identical to that found in some of the o1 strains isolated in samutsakorn , thailand , during and after the 1993 o139 outbreak . both pre - and post - o139 isolates carried class i integrons with the aada2 gene cassette . this fact led dalsgaard et al . to conjecture that this distinct o1 strain might have been transferred between thailand and vietnam ( 5 ) . however , the possibility of its migrating from a third country could not be ruled out . the ribotype of the pre - o139 , o1 calcutta strains examined in this study was identical to that of the samutsakorn strains ( 4,5,8 ) . however , as can be seen from the data presented here , unlike the samutsakorn strains , these strains harbored aada1 gene cassette . we had shown previously that the post - o139 , o1 strains isolated in calcutta could have migrated to guinea - bissau in africa ( 9 ) . further evidence has shown that this strain , which caused an outbreak in 19941995 , could have subsequently acquired class i integrons bearing the [ ant ( 3 ) - 1a ] gene cassette by a 150 - kb plasmid from an unknown source ( 10 ) . while the class i integron with aada1 gene cassettewas widely distributed among the pre - o139 o1 strains isolated in calcutta , it was mostly absent in the post - o139 o1 strains ( figure ) . this finding is in contrast to other studies involving the sxt element ; 80 % of all pre - o139 strains were devoid of sxt , whereas all post - o139 strains ( with the exception of a few carry - over strains ) had it ( figure ) . when the data presented in this paper are considered together with the information presented by others ( 4,5,8,10 ) , it appears that both pre - and post - o139 , o1 strains , isolated in calcutta , probably could have moved to other countries and became established there . distribution of class i integrons and sxt elements in vibrio cholerae el tor strains isolated before , during , and after the o139 outbreak .\noutput:\n" }, { "from": "agent", "value": "we examined the distribution of class i integrons and sxt elements in vibrio cholerae o1 el tor strains , isolated in calcutta , india , before and after the v. cholerae o139 outbreak in 1992 . class i integrons , with aada1 gene cassette , were detected primarily in the pre - o139 strains ; the sxt element was found mainly in the post - o139 strains ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: calciphylaxis has been focused on as a rare cutaneous manifestation associated with painful skin ulceration and necrosis ( 1 ) . medial calcification and intimal hyperplasia in small and medium arteries are the major pathological characteristics of this disease , however , numerous other histopathological features have also been described ( 1,2 ) . although calciphylaxis primarily occurs in patients with end - stage chronic kidney disease ( 1,3 ) , it has occasionally been reported in nonuremic patients ( 4,5 ) . in this report , we would like to show our experience in a male patient with minimal change nephrotic syndrome ( mcns ) sequentially complicated by acute kidney injury ( aki ) and painful ulcerative cutaneous lesions due to calciphylaxis . a 38 - year - old man presented to a local physician in the middle of august 2012 with complaints of abdominal distension and progressive swelling of his legs . despite having no apparent history of renal disease , he was found to have ascites with serum albumin ( salb ) and serum creatinine ( scr ) levels of 1.0 g / dl and 1.6 mg / dl , respectively . the swelling in his extremities further progressed and he gained approximately 15 kg in body weight over the next two weeks . the patient 's blood pressure was 127/78 mmhg , his pulse was 86 beats / min , his respiratory rate was 12 breaths / min and his temperature was 36.5 . no rashes or petechiae were observed . a chest x - ray showed bilateral blurred costophrenic angles , suggesting the accumulation of fluid in the thorax . renal sonography revealed that the right and left kidney measured 11360 mm and 11566 mm , respectively , with normal renal cortex echogenicity . a 24 - hour urine specimen contained 9.6 g of protein with a creatinine clearance of 28.4 ml / min . a renal biopsy consisting of four cores of renal parenchyma with twenty - nine glomeruli was performed on clinical day four . an immunohistochemical analysis failed to reveal any immune complex deposits , while electron microscopy showed a flattening of the foot processes of the glomerular visceral epithelial cells without any apparent electron dense deposits within the glomerular basement membrane or mesangial area , which was consistent with minimal change disease ( mcd ) ( fig .1 ) . intravenous prednisolone sodium succinate ( psl - ss ) ( 60 mg / day ) was initiated on the day after the renal biopsy . this was switched to oral prednisolone ( psl ) ( 50 mg / day ) about two weeks later . the intravenous administration of unfractionated heparin ( 10,000 u / day ) , which had been initiated on the day after admission in an attempt to maintain an active partial thromboplastin time of between 1.5 and 2 times the control value , was changed to warfarin ( 2.5 mg / day ) on clinical day 20 . the patient underwent a transient session of extracorporeal ultrafiltration method ( ecum ) because the control of anasarca , which had gradually developed after admission despite the administration of furosemide , was insufficient . oral mizoribine ( mzb ) ( 150 mg / day ) and a single session of low - density lipoprotein apheresis ( ldl - a ) were also added to the therapeutic regimen ; however , the patient 's decline in renal function steadily progressed , and became severe enough to commence a transient session of hemodialysis ( hd ) . in the same period , he complained of slight redness and tenderness with an increased temperature around his left thigh . these symptoms were successfully relieved by treatment with empiric antibiotics and intravenous immunoglobulin . finally , after treatment with oral cyclosporine a ( cya ) ( 150 mg / day ) for approximately two weeks and five sessions of double filtration plasmapheresis ( dfpp ) , his urine output began to increase ( fig .2 ) . the renal biopsy findings . a light micrograph of the glomerulus ( a ) shows no glomerular changes ( periodic acid - schiff stain ) , while an electron micrograph of a portion of the glomerulus ( b ) demonstrates diffuse foot process effacement ( asterisks ) and vacuolation . en : glomerular endothelial cell . serial changes in several clinical parameters and therapeutic regimens during the observation period are shown . the patient s renal function steadily worsened despite treatment with glucocorticoids , immunosuppressants , and ldl - a , and a hd was subsequently performed three times a week from clinical day 64 . about one month after the last hd session , he started to complain of several small firm and painful nodules with purple discoloration on the lower extremities ( fig .3 a ) . a skin biopsy revealed arterior calcium deposits with intimal proliferation ( fig . the lesions became much larger and ulcerative with surrounding erythema over the next two to five weeks ( fig .3 b and c ) , and a bone scan revealed an increased tracer accumulation in the soft tissue of both legs ( fig . the serum levels of intact parathyroid hormone ( ipth ) and 1,25 dihydroxy - vitamin d ( vitd ) on clinical day 152 were within the normal ranges of 24 pg / ml and 23.6 pg / ml , respectively , while an elevated urinary level of n - telopeptide cross - links of type i collagen ( ntx ) of 132.3 nmol bce / mmolcr was noted at the same time point . the patient 's medications at this point included furosemide , lansoprazole , psl , cya , narcotics for the pain from his ulcers , calcium carbonate , and warfarin . according to the diagnostic criteria of calciphylaxis ( 1 ) as well as the clinical and pathological findings , he was diagnosed to have the disease , and the last two agents , calcium carbonate and warfarin , were then discontinued and oral alendronate sodium hydrate ( 5 mg / day ) combined with beraprost sodium ( 120 g / day ) were administered . a culture obtained from the patient 's wound grew psuedomonas aeruginosa , which was treated with intravenous ceftazidime for one week , while topical wound care was applied ( silver sulfadiazine with cleansing and debridement ) . after approximately five weeks , the tenderness substantially improved and the wounds demonstrated granulation tissue growth . the pain and cutaneous manifestations continued to improve and the patient 's urinary ntx level was confirmed to have normalized to 57.1 nmol bce / mmolcr on clinical day 322 ; at that time he had been treated with a vitamin k2 analogue menatetrenone ( 45 mg / day ) for approximately three months . his scr and salb levels were around 1.4 mg / dl and 3.6 g / dl , respectively , and his 24 - hour urinary protein level was 0.6 to 0.7 g / day . an early skin lesion in the left leg showed a palpable painful petechial rash ( a ) . it developed into dusky violaceous purpuric plaque with overlying eschars ( b ) and became ulcerative with surrounding erythema ( c ) at one and two months after the onset of symptoms , respectively . the fully healed wound on same aspect was confirmed in may 2013 ( d ) . a skin biopsy specimen showed a small artery with medial calcification accompanied by edematous intimal thickening ( e , hematoxylin and eosin staining ) . a scale bar is shown . a bone scan performed in the middle of february 2013 demonstrated the superficial location of radiotracer activity in the subcutaneous region of the lower extremities although the uptakes were most prominent in the right thigh ( f ) . the concurrent use of psl and some immunosuppressive agents , including mzb and cya , has been a therapeutic option for the mcns patients in whom psl treatment is not sufficient to achieve either a complete or partial remission ( 8,9 ) . some subsets of mcns patients may require extensive volume control with ecum and / or adjunct apheresis because of the refractory nature of nephrotic syndrome ( 10,11 ) . consequently , one may argue that the therapeutic managements for mcns with aki are too common to be described ; however , the clinical significance of the current patient should be evaluated carefully due to the subsequent complication of cutaneous lesions due to calciphylaxis . currently , various metabolic disorders and therapeutics that are associated with advanced chronic kidney disease , including secondary hyperparathyroidism , hyperphosphatemia , hypercalcemia , elevated calcium - phosphorus product , vitd administration , and calcium - containing phosphate binders have come into focus as precipitating factors for calciphylaxis ( 1,2,4 ) . low salb , high serum alkaline phosphatase levels , a female sex , liver disease , and the use of systemic corticosteroids and warfarin have also been regarded as independent risk factors ( 1,12 ) . calciphylaxis may also occur in patients with serum calcium ( ca ) , serum phosphorus ( pi ) , calcium - phosphorus product , and pth levels in the reference ranges ( 2,4,12 - 14 ) . thus , the mechanism of the disease is likely to be extremely complex and it may represent common pathologic findings of tissue injury in response to a variety of heterogeneous insults ( 4 ) . we consider it to be reasonable that some medications and comorbidities might have predisposed our patient to develop calciphylaxis . one of the candidates is hypoalbuminemia , which has been focused on as an indicator of poor health , increased tissue fragility , and impaired wound healing ( 15 ) . warfarinization has been considered to induce the disease through the inhibition of the vitamin k - dependent carboxylation of the matrix - gla protein , which reduces the ability of the protein to inhibit regional vascular calcification ( 2,4,15,16 ) . the reduction of the functional protein c and / or s activities has also been implicated in some subsets of calciphylaxis patients with warfarinization ( 16 ) ; however , a quantitative analysis performed one day after the cessation of warfarin in our patient found that neither of these activities had decreased . such agents have been shown to promote vascular injuries and endothelial damage ( 17 ) ; however , their role in the pathogenic process of the disease has not been precisely clarified . in the current patient , we believe that the significant increase in the urinary level of ntx should mirror the concomitant disturbance of the bone and calcium metabolism which was induced by the systemic administration of glucocorticoid ( 19 ) . although the patient was no longer dependent on hd at the onset of calciphylaxis , the temporal decline in his renal function might also have predisposed him to the disease through the concurrent mineral disturbance characterized by hyperphosphatemia , which encouraged us to use calcium carbonate as a phosphate binder . of note , his corrected serum calcium ( cca ) levels determined by payne 's formula ( 20 ) ranged from 8.6 to 10.1 mg / dl , while the maximum cca - phosphate ( pi ) product level was 100.57 mg / dl approximately two months prior to the onset of painful nodules with petechiae . additionally , we may need to focus on the inflammatory event associated with the patient 's left thigh that developed during almost the same period of time . however , prompt relief with empiric antibiotics combined with intravenous immunoglobulin therapy encouraged us to attribute such symptoms to fasciitis and / or cellulitis due to latent bacterial infections , which might have resulted from a compromised immune status characterized by the prominent decrease in immunoglobulin levels , which could be associated with an attenuated immune status ( 21 ) . nevertheless , we feel that this might lay the groundwork for a sustained calcium accumulation , thereby predisposing our patient to calciphylaxis . this concept is purely hypothetical , although a local inflammatory milieu resulting from repetitive traumatic tissue damage , periarticular forces , and bleeding from microtrauma causing exaggerated reparative responses have been regarded as potential pathogeneses of soft tissue calcification in patients complicated by tumoral calcinosis ( 22,23 ) . finally , we speculate that the development of the disease in our patient can be ascribed to the additive or synergistic effects of multiple factors , although it is difficult to precisely determine their individual contribution . the specific impact of the concurrent ns remains unclear ; however , it is apparent that such pathology integrated the concomitant above - described factors . warfarin is highly effective in the prevention of thromboembolic disorders and it is widely used for this reason ( 24 ) , while hypercoagulability has been demonstrated among patients with nephrotic syndrome ( ns ) by their increased risk for the development of various pathologies , including venous and / or arterial thromboembolism and renal vein thrombosis ( 25 ) . however , prophylactic anticoagulation has not been accepted as the standard of care for patients with ns ( 25 ) , and a selective or individualized approach still seems justified in ordinary medical practice ( 26 ) . in our case , the prominent and protracted decreases in the salb levels of below 2.0 g / dl , which may be one of the clinical parameters predicting thromboembolic events in patients complicated by ns ( 25,26 ) , encouraged us to administer prophylactic anticoagulation . of note , warfarin has also been demonstrated to act as an inducer of skin necrosis resulting from the occlusion of dermal vessels by fibrin thrombi , with a high propensity for subcutaneous involvement in several areas , including the abdomen , thighs , and legs , thereby mimicking calciphylaxis ( 24 ) . thus , we were facing , as do most physicians at various times , therapeutic and diagnostic dilemmas . we believe that a skin biopsy should have provided a clinical benefit in the current patient since it allowed us to reach a precise diagnosis of the cutaneous manifestations ; however , the careful application of the procedure on a case - by - case basis is mandatory because a skin biopsy may result in poor wound healing with increased risks of infection and mortality ( 1,13,16,27 ) . alternatively , an imaging analysis using bone - seeking tracers may aid in the diagnosis of calciphylaxis ( 12,28 ) . considering the result obtained in the current case , however , the diagnostic impact of this modality in other patients with the disease may require a careful evaluation . indeed , it appears likely that extensive baring of the subcutaneous region rids the limbs of calcified tissue , thereby modulating the magnitude of the tracer uptake ( 27 ) . despite the accumulation of anecdotal or systemic studies disclosing the nature of calciphylaxis ( 1,2,4,13 - 17,27 ) , we feel that the ability to accurately diagnose the disease in the early stage and awareness of the disease itself remain challenges that must still be overcome by physicians . although there are several reports mentioning the potential of prostacyclin and vitamin k2 as well as bisphosphonate as therapeutic options for the disease ( 29 - 31 ) , the present case did not allow us to precisely assess the clinical benefit of individual agents . rather , the current report may emphasize the pitfalls of managing patients with ns who are subjected to warfarinization . we must be careful about skin complications , especially in nephrotic subjects who require prophylactic anticoagulation , and calciphylaxis should always be included in the list of causes of painful cutaneous ulcers , thereby leading to a higher index of suspicion and prompt recognition of the disease . we believe that the accumulation of more experience with additional cases similar to ours would aid in the establishment of an optimal management for nephrotic patients complicated by calciphylaxis .\noutput:\n" }, { "from": "agent", "value": "calciphylaxis is rare cutaneous manifestation associated with painful skin ulceration and necrosis . it primarily occurs in patients with end - stage chronic kidney disease . in this report , we would like to show our experience with a male patient presenting with minimal change nephrotic syndrome that was sequentially complicated by acute kidney injury and painful ulcerative cutaneous lesions due to calciphylaxis . there seemed to be several contributing factors , including a disturbance of the patient 's mineral metabolism and the systemic use of glucocorticoids and warfarin . various concerns regarding the diagnostic and therapeutic conundrums that were encountered in the present case are also discussed ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: recent research suggests that despite meeting the minimum physical activity recommendations , sitting for prolonged periods ( i.e. , sedentary behavior ) can compromise the health of adults . literature has established that a physically inactive lifestyle and low levels of cardiorespiratory fitness lead to an increase in the risk of developing numerous chronic diseases as well as all - cause mortality . interestingly , sedentary behavior is emerging as a potentially important independent contributor to the relationship between lifestyle and health . sedentary behavior is defined as any waking behavior characterized by an energy expenditure 1.5 mets and a sitting or reclining posture . accumulating evidence shows that , independent of physical activity levels , sedentary time is associated with an increased risk of cardiometabolic disease and all - cause mortality in children and adults . reported that all - cause death rates increased across daily sitting time categories in a dose - response manner in groups of adults under the age of 59 years and over 60 years . it has also been demonstrated that individuals greater than 60 years of age with metabolic syndrome spend a greater percentage of waking hours in sedentary time versus those with no metabolic disease . unfortunately , according to the 2007 canadian community health survey ( cchs ) , television viewing time increases steadily with age such that 36 % of those aged from 55 to 64 , 47 % of adults from 65 to 74 years and 52 % of adults 75 years and older spend 15 or more hours per week viewing television . beyond the influence on health , sedentary behavior may also influence overall successful aging ( sa ) ; a term used to represent the physical , psychological , and social success with which adults age . unfortunately , there is limited data on the relationship between sedentary behavior and sa or the components of sa . there is also a dearth of data available on sa and physical activity in middle - aged adults . this information is critical as lifestyle behaviors have been shown to persist once they are developed . for example , using a modified rowe and kahn definition of sa , sun et al . showed that participants of the nurse 's health study surviving to age 70 who had higher levels of midlife physical activity had higher odds of successful survival . similarly , in a 17 - year longitudinal study , britton et al . found early - life exercise ( mean age 44 years ) to be a predictor of sa ( free from major disease , good physical and mental function ) . no data exists on the relationship between overall sa and sedentary behavior in middle - aged adults . recent reports indicate that 69 % of waking hours of middle - aged and older adults are spent performing sedentary activities . given the strong relationship between physical activity and sa , an investigation between sedentary behavior and sa is warranted in this population . clearly , if sedentary behavior is related to sa , middle - aged and older adult populations are at high risk of poor physical , psychological , and social health . the purpose of the present study therefore was to determine whether there is an association between sedentary behavior and sa , independent of physical activity , in a canadian population of middle - aged and older adults . the healthy aging cycle of the canadian community health survey ( cchs - ha ) was used for the current analysis . the objective of the cchs - ha is to provide information on sa , examine healthy aging from a multidisciplinary approach , examine the effects of lifestyle on age , and better understand the aging process in those aged 45 years and older . all data contained in this survey were self - reported and all participants provided informed consent prior to participation . the total sample size of the cchs - ha is 30,865 . for purposes of the current analysis the samplewas restricted to those who had complete data for all variables of interest as outlined below ( n = 19,538 ) . detailed information on data collection methods and data weighting can be found in the cchs user guide . sa variables were created for all three components of sa , that is , physical , psychological , and sociological . recently outlined the required variables to assess each of the components of sa based on rowe and kahn 's model of sa . each sa component for the current analysis was based on this outline within the limitations of the database . the physical component of sa generally includes both the presence of chronic disease and functional impairments ; however , strawbridge et al. showed that sa is not dependent on the presence or absence of disease and that many older adults were being misclassified based on this variable . recent evidence using data in the cchs indicates that self - perceived health is a better indicator of physical activity levels than the presence of chronic disease . as such , the current analysis limited the definition of physical sa to those with functional impairment only . participants were classified as having no mobility problems , having a problem but not requiring any aids , requiring mechanical support , or requiring help from others or can not walk as per their responses to five separate questions in the cchs - ha . those in the first two groups were categorized as aging successfully and those in the latter two groups were categorized as aging poorly . as per youngthe psychological component should include data on cognitive function , emotional vitality , and depression . using two questions participants were classified into one of six categories for cognitive function : ( 1 ) able to remember most things , think clearly , and solve day - to - day problems , ( 2 ) able to remember most things but have a little difficulty when trying to think and solve day - to - day problems , ( 3 ) somewhat forgetful but able to think clearly and solve day - to - day problems , ( 4 ) somewhat forgetful and have a little difficulty when trying to think or solve day - to - day problems , ( 5 ) very forgetful and have great difficulty when trying to think or solve day - to - day problems , or ( 6 ) unable to remember anything at all and unable to think or solve day - to - day problems . emotional vitality was based on a single question which classified participants as either ( 1 ) happy and interested in life , ( 2 ) somewhat happy , ( 3 ) somewhat unhappy , ( 4 ) very unhappy , or ( 5 ) so unhappy that life is not worthwhile . finally , depression was assessed using a single question on the presence or absence of depression . those in the first three categories of cognitive function and the first 2 categories of emotional vitality who did not have depression were classified as aging successfully in the psychological domain ; all other were classified as aging poorly . engagement with life , social support , and spirituality are the main variables used to assess the sociological component of sa . two variables were used to classify participants as aging successfully and aging poorly , sense of belonging to the local community and the loneliness scale . sense of belonging was a single question that classified participants as very strong , somewhat strong , somewhat weak , or very weak . the loneliness scale was based on three items : lack of companionship , feeling left out , and feeling isolated . those who had a strong sense of belonging and a loneliness scale score of 6 were classified as aging successfully , all other were classified as aging poorly . those who were classified as aging successfully in the physical , psychological , and sociological domains were classified as aging successfully . the pa variable for the current analysis was therefore based on the number of hours the participant walked each week . participants who spent 1 hour or more / day walking were classified as active , those who spent 3060 minutes / day walking were classified as moderately active and those who spent 30 minutes / day walking were classified as inactive . the number of hours spent sitting per day were used to classify participants as sedentary ( 4 hours or more / day ) , moderately sedentary ( 24 hours / day ) , or least sedentary ( 2 hours / day ) . middle - aged adults were those between the ages of 45 and 64 years , and older adults were those between the ages of 65 years and more . the cchs - ha public access file does not contain age as a continuous variable for maintenance of confidentiality ; therefore these data are presented in categories . marital status was categorized as either married / common - law , widowed / separated / divorced , or single / never married . income was used as a proxy for socioeconomic status and was categorized as 20,000 , $ 2039,000 , $ 4059,000 , $ 6079,000 , or $ 80,000 . marital status was additionally included as it is related to sa in older adults . pearson chi - square analyses and standardized adjusted residuals that denote deviations from a normal distribution were calculated to determine differences in all sample characteristics with the exception of age . bivariate associations between each sa outcome and physical activity or sedentary behavior were conducted using logistic regression analysis for each sex and age group . multivariate logistic regressions controlling for age , marital status , and income were conducted for each sa outcome with both physical activity and sedentary behavior entered in the model . these models were created for each sex and age group ( middle - aged and older adults ) . all analyses were conducted using spss version 17.0 with statistical significance set at alpha 0.05 . in order to compensate for the deliberate over - sampling of particular groups , population weights supplied by statistics canada were applied to the entire dataset to ensure accurate population estimates . to estimate variance , overall there were significant differences between older and middle - aged adults for all covariates investigated . interestingly there were no differences between overall sa between age groups , nor were there for the psychological component of sa for either of both sexes combined or for females . bivariate associations ( table 2 ) indicated a consistent trend for both physical activity and sedentary behavior such that those who were active and moderately active were significantly more likely to be aging successfully compared to those who were inactive . similarly , those who were moderately sedentary and least sedentary were significantly more likely to be aging successfully compared to those who were sedentary . additionally , in most cases there was a dose - response relationship such that those who were active or least sedentary had greater odds of sa than those who were moderately active or moderately sedentary , respectively . regressions adjusted for age , income , and marital status showed similar trends as bivariate regression ( table 3 ) . compared to inactive older adults , moderately active and active older adults were 41 % ( or : 1.41 ; ci : 1.191.67 ) and 42 % ( or : 1.42 ; ci : 1.201.69 ) more likely to be aging successfully overall , respectively . moderately sedentary and least sedentary older adults were 38 % ( or : 1.38 ; ci : 1.121.69 ) and 43 % ( or : 1.43 ; ci : 1.231.67 ) more likely to be aging successfully overall , respectively . this was similar to the results seen in middle - aged adults except that moderately sedentary adults were not more likely to be aging successfully overall compared to sedentary adults ( or : 1.08 ; ci : 0.961.21 ) . using a sample of middle - aged and older adults from the cchs - ha , we analyzed the relationship of sa with physical activity and sedentary behavior . similar to previous research , we found that physical activity is strongly related to sa and each of its components . the novel findings of this study pertain to the association between sedentary behavior and sa . our primary finding is that sedentary behavior is associated with sa such that those who spend less time in sedentary activities are more likely to age successfully , regardless of their physical activity levels . our secondary finding is that the relationship between the physical component of sa with physical activity and sedentary behavior was stronger and occurred in a dose - response manner . finally , for the psychological and sociological components of sa , it seems that sedentary behavior lasting 2 hours / day is required for sa . the present study is one of the first to highlight the adverse role of sedentary behavior in sa . these findings have implications for the development of sedentary guidelines for middle - aged and older adults . our finding that there is a strong association between physical activity and sa was as expected based on research pertaining to physical activity and sa . a direct association between sa and physical activity was noted by baker et al . using data from the cchs ( cycle 2.1 , n = 12,042 ) . they reported that only 11 % of canadians were aging successfully and that older adults who were physically active were 2.26 ( estimate = 0.817 , ci : 0.7030.931 ) times more likely to age successfully compared to those who were physically inactive . in a follow - up study , meisner et al . showed that physical activity influences each component of sa , such that greater levels of physical inactivity were associated with an increased likelihood of reporting disease and disablement , low functional capacities , and being socially disengaged with life . while the results of these two studies imply that sedentary behavior would be associated with sa , no specific analyses to this effect were conducted . a study published by ko et al. showed that engaging in a greater number of activities ( physical and nonphysical in nature ) was significantly associated with several indicators of sa . therefore this study shows that those who did not engage in activities ( i.e. , sedentary individuals ) were less likely to age successfully . moreover , the master athlete has been suggested as a model of sa given that this group of middle - aged and older adults is healthier and has a better quality of life than age - matched peers . it is not surprising then that the strongest association in our study was found between sedentary behavior and the physical component of sa , that is , functional limitations . several studies have shown that functional dependence is more likely to develop in older adults who are not physically active , or who were not physically active in middle age . patel et al . found that sedentary behavior in middle age had a significant impact on functional autonomy in older age using a population - based study . similarly , huang et al . showed that middle - aged adults who were physically active and fit were less likely to have functional impairments in older age . these studies support our findings that middle - aged and older adults who were physically active and not sedentary were most likely to be aging successfully in the physical domain , that is , to maintain functional autonomy . in addition to a strong association between the physical component of sa and sedentary behavior , we also noted a dose - response relationship , that is , less time spent in sedentary activities was associated with higher odds of sa . in a recent review conducted on physical activity and functional limitations , a similar dose - response relationship was displayed such that those with higher levels of physical activity were less likely to develop functional limitations as compared to a sedentary group . spirduso and cronin conducted a review on the effect of the exercise dose response on sa using functional autonomy as a main outcome . the authors found that long - term physical activity was closely related to delaying disability and independent living in older adults . they also found that evidence for a dose response or a threshold between physical activity and physical functioning exists . it is difficult to assess a true dose response in the current analysis given the categorical nature of the variables in the data set . whether there is indeed a threshold or a dose - response relationship should be determined in the future in order to develop optimal sedentary guidelines . the possibility of a threshold for sedentary behavior was also observed for the psychological and sociological components of sa . among older adults , the psychological component was not influenced by sedentary behavior whereas the sociological component was only influenced by sedentary behavior lasting less than two hours . among the middle - aged adults , only those who were sedentary for less than two hours per day were more likely to age successfully , that is , those engaging in sedentary activities for 24 hours per day were not more likely to age successfully in these domains than those sedentary for 4 hours or more per day . in other words , less than two hours of sedentary activity per day may serve as a minimum duration ( threshold ) that must be achieved in order to age successfully in these two domains . this idea of a dose - dependent relationship or a threshold has been assessed in studies using physical inactivity and the psychological component of sa . found a dose - dependent effect of exercise on cognitive function and anxiety in an animal study using aerobic exercise in middle - aged and older rats . in the area of depression , a recent randomized control trial among adults aged 1870 with depression found that the group who was assigned a higher dose of exercise had greater benefit than a group assigned a lower dose of exercise ; however , both had clinically meaningful improvements with exercise participation . there are also cross - sectional studies on the relationship between sedentary behavior and depression or hopelessness that support our findings . . found that those who had depression and anxiety disorders were more likely to engage in sedentary activities such as television watching and computer use in a sample of adults aged 1865 . similarly , among a group of middle - aged men , a negative association between engaging in physical activity and developing hopelessness was found such that those who engaged in higher volumes of physical activity were less likely to develop feelings of hopelessness . with regards to the sociological component of sa , factors such as satisfaction with life , sense of belonging to community , and loneliness are associated with physical inactivity , but again , little data exist on sedentary behavior . future research should assess the dose - response relationship between sedentary activity and each component of sa . first , the cchs - ha uses self - reported data ; as such it is difficult to truly know how much time participants were spending in sedentary activities or being physically active . given the broad categories used in the current analysis , it is less likely that such misclassification occurred . second , the cchs is a cross - sectional data set , so reverse causality can not be ruled out . in other words , it can not be said with certainty that sedentary behavior is causing poor outcomes as it is possible that poor outcomes are leading to sedentary lifestyles . in conclusion , using a large database of middle - aged and older adults we found that similar to previous research , physical activity is strongly associated with sa . the novel finding of the current study is that sedentary behavior is significantly associated with lower odds of sa independent of physical activity levels , that is , sedentary behavior and physical activity may be independent risk factors for poor health among aging populations . we also found evidence for a dose - dependent relationship between sedentary behavior and each of the components of sa . results of the present analysis are novel and have implications for the development of sedentary guidelines for middle - aged and older adults .\noutput:\n" }, { "from": "agent", "value": "background . sedentary behavior is emerging as an important risk factor for poor health . physical activity has proven to be important in determining overall successful aging ( sa ) among older adults ; however , no data exists on the influence of sedentary behavior on sa . the purpose of this analysis was to determine whether there is an association between sedentary behavior and successful aging , independent of physical activity levels . methods . 9,478 older ( m = 4,245 ; f = 5,233 ) and 10,060 middle - aged ( m = 4.621 ; f = 5,439 ) adults from the healthy aging cycle of the canadian community health survey were analyzed . multivariate logistic regressions were conducted with sa and its three components as outcomes while physical activity and sedentary behavior were entered as main exposures . results . among older adults , compared to those who were sedentary ( 4 hours or more / day ) , those who were moderately ( 24 hours / day ) and least sedentary ( < 2 hours / day ) were 38 % ( or : 1.38 ; ci : 1.121.69 ) and 43 % ( or : 1.43 ; ci : 1.231.67 ) more likely to age successfully , respectively . among middle - aged adults , those who were least sedentary were 43 % ( or : 1.43 ; ci : 1.251.63 ) more likely to age successfully . conclusions . these novel findings suggest that sedentary activities are significantly associated with lower odds of sa among middle - aged and older adults , potentially in a dose - dependent manner ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: telemedicine is the use of information technology and telecommunications to support healthcare at a distance . in this review , the main issues of geriatrics with regard to scope , disease burdengeriatrics is a subspecialty of internal medicine and primary care that was named in 1909 by ignatz leo nascher . the specialty was recognized by a certificate of special qualifications under the internal medicine board certification by the american board of medical specialties in 1988 . that is of course a very recent date and indicates the late recognition of the care of the aging as a special matter . children 's hospitals became prominent in the 19th century , but nothing comparable happened at that time in the care of the elderly . there were hardly enough old people to attract attention ! in 1900 , most newborns could not be expected to live past 50 . now , life expectancy at birth exceeds 80 years in many countries , and this demographic trend is continuing . in 2010 , there were perhaps 524 million people over 65 years in the world , whereas in 2050 that number will be 1.5 billion . interestingly , most of that increase will be in the developing world . in about five more years , people in the world older than 65 years will exceed the number of people under age 5 . mortality in older populations has been sharply reduced with great inroads in relation to cardiovascular disease , cancer , and diabetes . however , unlike infections , these conditions are not cured ; they are curtailed . today the main threats are non - communicable diseases , including heart , stroke , cancer , diabetes , hypertension , and dementia . the previous model of healthcare throughout the world might be termed ' incident care ' . in this model , someone became aware of a health problem , sought the advice of a physician , received a diagnosis , and usually some treatment converted the condition into a short - term illness . however , among older patients , 92 % have at least one chronic disease , and 77 % suffer from at least two . in other words , there has been a huge increase in older people who are always sick rather than intermittently sick . the objective of care and management is to reduce the morbidity and slow the progression . thus , longitudinal management of progressive disease and anticipation of complications are the hallmarks of successful geriatric practice . they may have only one grandchild ; thus , the pool of family members to care for them is limited . furthermore , they tend to live so long that the intimacy of family may have passed . as an offset , men are gaining in the longevity statistics and may survive with their spouses for mutual support . preference for independent living is growing as children seem to have more career demands with both man and wife employed . for older patients , the chronic diseases they carry may progress at varying rates , and the possibility of a devastating stroke , cardiac decompensation , or diabetic complications may suddenly take away the possibility of independent living . in the united states , an older person has a fall every 15 seconds requiring a hospital visit , and every 28 minutes there is a fatal fall . then there is the terrible problem if dementia . in a study among the countries of the organization for economic cooperation and development , the disease burden of alzheimer disease / dementia was some 30 million . we just know that a typical chronically ill person has a limited network of family for care , tries to live independently , and is subject to dementia that will eventually make them incompetent for independent living . in summary , geriatrics is a medical specialty which with primary care is struggling with an ever increasing population of chronically ill patients who may live a long time with care but are subject to myriad complications . the objective of longitudinal care is to limit disease progress , diagnose problems such as cancer early , look for early signs of deterioration , and support healthy lifestyles . rather like parents in the case of children , the care of older patients often involves family members as caregivers . from the standpoint of social planning , the paramount fiscal issue is the huge increase in the cost of patients who will require frequent interventions , long - term hospital care , and institutional care . patients may perceive the desperation of the situation in that the largest incidence for suicide in the united states is among men past age 85 . the current mode of health care involving visits to clinics at rare intervals is an overwhelming challenge of expense and personnel , and there is no resource in sight for meeting the demand . the crucial expectation is for medical care to anticipate the crises , avoid them , limit office visits , limit emergency visits , anticipate mental decline , intervene only when needed , and support the social net . however , the ability of the health community to respond to this huge challenge is not apparent or sufficient . in the united states , there are 784,633 physicians in practice for a population of some 320 million . in the 1981 work force ( graduate medical education national advisory committee ) report , an excess of physicians was perceived and medical education was limited . by 2000 , it was clear that something in the calculation was wrong . with no increase in physician output in 20 years , the shortfall for older patients is said to be 70,000 . in the united states , the steady - state output of physicians was only 16,000 per year for a population that had increased to 320 million . if all medical graduates committed to geriatrics , it would take many years to train enough of them for the task . in fact , the number of trainees in geriatrics is declining , and in 2013 there were only 259 new fellows in the entire country . one possibility is that any adult primary care physician could fill the gap ; however , primary care is not doing very well in the united states either . the association of american medical colleges has recommended a 30 % increase in the number of enrollees and an additional 30 medical schools . yet despite the need for increased care of geriatric patients , the american geriatric society has only 6,000 members . thus , the number of physicians in the world is not going to remotely meet the geriatric need . however , if the shortage of physicians is deep in the developed world , the shortage of nurses for home health is hopeless . we can not send out an army of health professionals to meet with patients often enough to avert health crises . in the united states , a 17 % expenditure of the gdp on healthcaresimply is not going to expand by say 25 % to account for our current expectations for delivery of care to the elderly . our aim has been to reduce healthcare expenditures ; however , demographics are contrary to that expectation . furthermore , as patients become more and more frail , they are less able to come on their own to intermittent care visits . unfortunately , when they are in nursing facilities , access to specialist care is further confounded by transportation challenges . in conclusion , there is a growing crisis in providing proper longitudinal health care to the elderly in our current practice modes . telemedicine was given its name by kenneth bird in 1975 , and the american telemedicine association was established in 1994 . e - health , telehealth , telecare , and other terms are in reality synonyms . the use of telecommunications to support healthcare came first with videoconference access to specialty care . the notion of using telecommunications for medicine has a history as long as any form of distant communication . however , analog television communication was terribly expensive . the introduction of satellite connectivity in 1962 made the distance less prohibitive but the cost exploded . the practicality of telemedicine shares a history with the transistor , which was commercialized by bell laboratories and was the subject of the nobel prize in physics awarded to shockley , bardeen , and houses in 1956 . the vast composite of the human condition could be stored and transmitted in digital form across any telecommunication medium . the application of transistors to personal computing has a long history , but for the purpose of timelines , the introduction of the apple computer in 1976 was seminal . thereafter , management of data in small , compact , highly effective modules became an everyday practice . today , the storage of huge amounts of patient data , including images and live transmission is a simple and cheap process . the combination of telecommunications and information management constitutes a tool inviting the imagination of practitioners and attacking the very basic issues of cost and access . any practitioner can work from a desk to any point of need and can provide coherent and definitive diagnosis and management expertise . the growth of telemedicine has been greatly accelerated by wireless communication for devices , cellular telephony , fiberoptic connectivity , and digital records . the us american recovery and reinvestment act of 2009 had many components to stimulate the economy after the great recession crisis . among these were the broadband initiative , which was intended to bring great bandwidth to almost every village and school in the country . also , the act included the health information technology for economic and clinical health ( hitech ) provisions , requiring the staged expansion of electronic medical records , which were effective , and through such a system , healthcare providers could communicate with one another throughout the us in meaningful ways . in fact , the current surge of telemedicine would not have happened without the ubiquity of the internet , which came into large - scale use in 1994 . the rapid expansion of internet protocol version 6 since 2008 means that there are enough internet protocol unique addresses for every person and device on the planet with ample room for growth . thus , we have the internet of things , and this makes telemedicine so much more feasible . the drop in cost from required but fabulously expensive satellite connectivity to internet connectivity is simply astounding . these innovations and applications come at a time when the costs of medical care are soaring and the geriatric challenge is upon us . please note that the increase of healthcare costs is upward and exponential while the cost of telecommunication and electronic support is declining in the opposite direction . there is no better match in healthcare for improvement and cost saving through telemedicine than the care of the elderly . the population has a huge disease burden , which is not sustainable with the cost constraints of traditional incidental care . the provision of telemedicine services for the elderly is not particularly different from any other medical matters . there is a common belief that high - end electronics and telecommunications can not be used by the elderly because they have limited computer and technology skills . in the developed world , the current rapid growth in the aging population has occurred as a result of what has been dubbed the baby boom . the people entering the ranks of the elderly now are not the same as those very elderly who were born before the second world war . they suffered thorough the technical frustrations of floppy disks and every iteration of windows software . this group followed and cheered the magic of the space program and invented the information age . perhaps they are not actively interested in every nuance of innovation , but in general , they are technically competent and savvy about applications they perceive as having value for them . unless they have cognitive difficulties , the upcoming elderly will be the vanguard of electronic medicine in geriatrics if we invite them and listen to them without prejudice . therefore , there is a need for telemedicine in the elderly , and they are competent to participate in the abundant technology available . telemedicine has been assessed in many ways , but a brief review might be helpful . the american telemedicine association has issued 14 practice guidelines for telemedicine in a variety of applications from pathology to dermatology to diabetes . now , publications are heavily weighted to randomized controlled trials and telemedicine can be studied as a matter of meta - analysis in the cochrane database . in the early days of telemedicine , the cynical view was that a telemedicine program would close when the grant was spent . as a corollary , telemedicine would not have any inherent value until someone finally paid for it . the veterans health system has 70,000 telemedicine visits per year and they declare how much it saves money in the largest health system in the united states . more than half the states now have laws requiring private insurers to pay for telemedicine for its subscribersdemonstrations were carried out in remote parts of the world , and its relevance to highly developed communities was not clear . however , in the past 15 years , telemedicine has been used in all manner of healthcare delivery , and has been integrated into the fabric of overall healthcare . when telemedicine was a desperate measure for access , equivalence to standard office care was not an issue . currently , equivalence is of the utmost importance , and demonstration of at least non - inferiority has been crucial to acceptance by patients , physicians , regulators , and payers . videoconference encounters have been shown in every way to be comparable to face - to - face in terms of diagnostic accuracy , interrater variation , patient acceptance , and cost . the best survey in this regard is in the definitive textbook by bashshur and shannon . with regard to image transfer standards , radiology can demand the highest dicom standard from transmission technology and is not compromised . images produced by smartphone videoconferencing , microscopy , dermatology , and pathology are completely satisfactory . these facts are really technical matters and are not the subject of this clinical review . since the elderly have an excess burden of chronic disease , what is the evidence that longitudinal management by telemedicine is helpful ? an extensive review by bashshur et al . has been used by us congressional committees in policy decisions . the data clearly indicates that the use of telemedicine is superior to office visits in terms of emergency visits , hospitalizations , complications , and quality of life for diabetes , hypertension , pain , congestive heart failure , cancer care , rehabilitation after stroke , and dementia . the best place for older people to live is where they want to live , and that is almost always at home . yetwhen they are frail and forgetful , and have limited mobility , home may be a very dangerous place . extending the practice of their medical team to the home is a great strategy for retention of independence and early recognition of problems . simple monitoring devices can assess gait , pace , activity in general , and adherence to a medical regimen . monitoring of blood pressure , pulse , oxygen saturation , and weight can be done with non - invasive sensors , and the data can be transferred wirelessly to a computer for transmission to a health management office . the management site can look for alerts and trends with a response that is anywhere from a call to a summon of emergency personnel to the home , to making a small change in medication with a message back to the patient . cheap sensors , either passive or interactive , can capture the essence of a health situation at home and the managing physician can embrace that home with much of the immediate care available otherwise only in the office or hospital . instead of a visit on demand from time to time or regularly every month , surveillance can inform and empower the physician about the situation and allow timely and effective intervention . a smart home with sensors and alertscan assess the environment for such subtleties as a running tub , the temperature of the water , the age of materials in the refrigerator , the consumption of food , water , and medications as well as the urgent situations indicated by the presence of smoke , carbon monoxide , or excess heat . mobile phones can provide information support and alerts to the home bound in ways that were hard to imagine five years ago . there are thousands of medial apps for the smartphones that can be incorporated into comprehensive plans for home health by a managing physician with the fullest consent of the patient . home healthcare performed in person by skilled nursing teams is certainly well established and broadly practiced . however , that intervention can not be provided hourly or after hours . furthermore , the home health nurse alone when confronted by a worrisome change can only order transfer to definitive diagnosis and care or communicate by phone with the managing physician . instead , telemedicine as an augmentation to the physical visit , can be used by nurses to transfer images to evaluate skin lesions or gait , to discuss telemetry data , and receive new instructions which otherwise would only be possible after a visit by the patient to the physician 's office . another use of telemedicine in home healthcare is the critical support of home caregivers who are subject to exhaustion , terrible stress , and a strong urge at times to give up and send the house - bound patient to a facility . telemedicine creates a virtual team that can include the home caregiver and dispel the sense of isolation . the alternative of travel to a fixed health facility is tedious , labor intensive , perhaps painful , and expensive . smartphone programs are excellent for behavior modification in terms of weight , diet , smoking cessation , alcohol abuse , medication , and exercise . the impact , according to published reports , has largely been confined to teenagers , caregivers , and veterans suffering from post traumatic stress disorder . however , the applicability to the elderly has no apparent barrier , and there are examples of success in the elderly . increasingly , medical practices are using social media to enrich medical practice through enhanced communication and reminders to reinforce a regimen . the loss of memory and neural plasticity is perhaps the most difficult matter in the care of the elderly . considerable research is ongoing to find the basis of alzheimer disease and dementia in general . there are numerous devices and programs available on hand held devices to exercise the memory and perhaps slow the progress of dementia . the value is yet to be determined ; however , it is likely that such programs will be integral to health maintenance in the future . in a typical nursing home , the population is generally elderly , and nursing care is of paramount importance . it is carefully monitored by a physician , and outcomes are carefully analyzed by authorities . however , there is usually no physician present , and if there is any medical question , the first resort is transfer to an emergency medical facility . the regular use of telemedicine to bring the center into close contact with a medical unit can reduce visits dramatically . since the elderly have an excess burden of chronic disease , what is the evidence that longitudinal management by telemedicine is helpful ? an extensive review by bashshur et al . has been used by us congressional committees in policy decisions . the data clearly indicates that the use of telemedicine is superior to office visits in terms of emergency visits , hospitalizations , complications , and quality of life for diabetes , hypertension , pain , congestive heart failure , cancer care , rehabilitation after stroke , and dementia . the best place for older people to live is where they want to live , and that is almost always at home . yetwhen they are frail and forgetful , and have limited mobility , home may be a very dangerous place . extending the practice of their medical team to the home is a great strategy for retention of independence and early recognition of problems . simple monitoring devices can assess gait , pace , activity in general , and adherence to a medical regimen . monitoring of blood pressure , pulse , oxygen saturation , and weight can be done with non - invasive sensors , and the data can be transferred wirelessly to a computer for transmission to a health management office . the management site can look for alerts and trends with a response that is anywhere from a call to a summon of emergency personnel to the home , to making a small change in medication with a message back to the patient . cheap sensors , either passive or interactive , can capture the essence of a health situation at home and the managing physician can embrace that home with much of the immediate care available otherwise only in the office or hospital . instead of a visit on demand from time to time or regularly every month , surveillance can inform and empower the physician about the situation and allow timely and effective intervention . a smart home with sensors and alertscan assess the environment for such subtleties as a running tub , the temperature of the water , the age of materials in the refrigerator , the consumption of food , water , and medications as well as the urgent situations indicated by the presence of smoke , carbon monoxide , or excess heat . mobile phones can provide information support and alerts to the home bound in ways that were hard to imagine five years ago . there are thousands of medial apps for the smartphones that can be incorporated into comprehensive plans for home health by a managing physician with the fullest consent of the patient . home healthcare performed in person by skilled nursing teams is certainly well established and broadly practiced . furthermore , the home health nurse alone when confronted by a worrisome change can only order transfer to definitive diagnosis and care or communicate by phone with the managing physician . instead , telemedicine as an augmentation to the physical visit , can be used by nurses to transfer images to evaluate skin lesions or gait , to discuss telemetry data , and receive new instructions which otherwise would only be possible after a visit by the patient to the physician 's office . another use of telemedicine in home healthcare is the critical support of home caregivers who are subject to exhaustion , terrible stress , and a strong urge at times to give up and send the house - bound patient to a facility . telemedicine creates a virtual team that can include the home caregiver and dispel the sense of isolation . the alternative of travel to a fixed health facility is tedious , labor intensive , perhaps painful , and expensive . smartphone programs are excellent for behavior modification in terms of weight , diet , smoking cessation , alcohol abuse , medication , and exercise . the impact , according to published reports , has largely been confined to teenagers , caregivers , and veterans suffering from post traumatic stress disorder . however , the applicability to the elderly has no apparent barrier , and there are examples of success in the elderly . increasingly , medical practices are using social media to enrich medical practice through enhanced communication and reminders to reinforce a regimen . the loss of memory and neural plasticity is perhaps the most difficult matter in the care of the elderly . considerable research is ongoing to find the basis of alzheimer disease and dementia in general . there are numerous devices and programs available on hand held devices to exercise the memory and perhaps slow the progress of dementia . the value is yet to be determined ; however , it is likely that such programs will be integral to health maintenance in the future . in a typical nursing home , the population is generally elderly , and nursing care is of paramount importance . it is carefully monitored by a physician , and outcomes are carefully analyzed by authorities . however , there is usually no physician present , and if there is any medical question , the first resort is transfer to an emergency medical facility . the regular use of telemedicine to bring the center into close contact with a medical unit can reduce visits dramatically . the impact on practice has proven far more challenging than the technology or patient acceptance . why is telemedicine a threat to physicians ? in most countriesphysicians have a very high workload , and the idea of adding any more is just not possible . also in many venues , the payment for these services is not clear or not adequate . in the ideal situation , without cost or staff concerns , the impact is very positive because the patient care is so much better . in the veterans health system in the united states , doctors are all on staff , and their attraction to telemedicine is that it actually takes less time ! a well coordinated telemedicine clinic is very efficient with almost no delay between patients . furthermore , in such a system all records are immediately available by computer . for an office physician who has proper access to technology , the overhead costs of telemedicine visits are in fact negligible compared to maintaining an office , parking , many waiting rooms , staff , etc . telemedicine must be integrated into the workflow of physicians and staff in such a way as to make it an improvement and not an add - on . if telemedicine is left to the singular efforts of a physician , the task is very difficult . in the united states , there is a strong movement for telemedicine to be freestanding and not managed by the personal physician . this can certainly be seen as a threat to the sanctity of physician - patient relations . however , the attraction of this innovation to patients is undeniable , and the success is such that there are considerable efforts to accredit the freestanding activities also the best practice standards possible . the american telemedicine association is active in this area . certainly not ! the notion that some electronic beast is taking away our patients is a bleak one and contrary to the best traditions of medicine . the approach for concerned and conscientious physicians is to learn about the matter , to become leaders rather than followers , and to bring this tool into the daily practice of medicine rather than having a disruptive technology eroding our basic bond of patient care . the question regularly arises as to whether or not telemedicine is in fact a medical specialty . the challenge for biomedical engineers , software engineers , and the telecommunications community is to make the technology as transparent as possible such that the average physician and patient will not find it intimidating . the challenge to physicians is to acquire sufficient facility with the technology as to be a competent user not subject to a profound reliance on technical personnel . finally , the physician should know enough to be a prudent user of new technology . telemedicine like any other tool in medicine can be poorly used , and people can be hurt , or certainly , they can be poorly served . the good practitioner will understand the tools , their application , safeguards and nuances for best practice . there are many courses available and a little time to become comfortable is time well invested in the future of practice . this brief review has shown that our current practice of care for the elderly is simply not going to succeed as the numbers of elderly patients continues to grow . some of the evidence for the value of telemedicine as a tool for physicians and healthcare systems was presented . the use of telemedicine is a fait accompli in much of the world , and it continues to have an increasing role that is deeply imbedded in our electronic practices coupled with social media . this is a great opportunity for medical practice to evolve to new levels of engagement with our patients and new levels of attainment in terms of quality care .\noutput:\n" }, { "from": "agent", "value": "objectivesthe global population of elderly people is increasing at a remarkable rate , which may be expected to continue for some time . older patients require more care , and with the current model of care delivery , the costs may be expected to rise , although higher cost is unsustainable . for this reason , a new pattern of practice is needed . telemedicine will be presented as a highly effective and necessary tool in geriatrics.methodsthis review will present some of the background and evidence for telemedicine as a way to address the challenges of geriatrics through geriatric telemedicine . some of the evidence for the value of telemedicine as a tool for physicians and healthcare systems is presented.resultstelemedicine offers many means to address the problems of geriatric care in creative ways . the use of electronic medicine , telecommunications , and information management has now found its way into the very fabric of health care . the use of telemedicine is a fait accompli in much of the world , and it continues to have an increasing role deeply imbedded in our electronic practices coupled with social media.conclusionsthe evidence for successful incorporation of telemedicine into practice is abundant and continues to accrue . this is a great opportunity for medical practice to evolve to new levels of engagement with patients and new levels of attainment in terms of quality care ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: postgraduate ophthalmology residency curricula should include meaningful and evidence - based technological advancements to achieve necessary competencies for future clinical practice . image - guided femtosecond laser - assisted cataract surgery ( flacs ) 13 is an innovative technology that has been introduced into multiple teaching programs within the past several years , even though its routine use is not yet widespread among practicing ophthalmologists . a recent study indicated that ~ 21 % of us residency programs actively train ophthalmology residents in performing flacs , with numerous other programs planning to add flacs into teaching curricula within 15 years .4 early reported evidence has suggested good safety and outcomes when flacs is performed by residents ,5,6 but some controversy exists regarding higher costs and possible lower efficiency associated with this technology . experienced cataract surgeons have been shown to have increased overall operating room ( or ) times during the first 6 months while beginning to perform flacs ,7 but similar patterns by resident surgeons have not been reported . the purpose of this study is to characterize flacs efficiency when performed in a residency setting by senior - level trainees . using a retrospective cohort study design at a single institution , we report time comparisons for completion of total procedures and for performance of key procedure steps in cases of femtosecond laser - assisted surgery versus conventional phacoemulsification . approval of the proposed protocol by the hines / federal healthcare center institutional review board ( hines , il , usa ) was obtained prior to initiation , and a waiver of requirement of patient informed consent for medical record review was also approved . the study subsequently conformed to all applicable institutional review board ( irb ) oversight and followed the tenets of the declaration of helsinki , including protection of patient - sensitive data . surgical scheduling records were used to identify cases of cataract surgery completed by senior ( postgraduate year four [ pgy4 ] ) ophthalmology residents functioning as primary surgeons in a 9 - month period from september 01 , 2014 , to may 31 , 2015 . by protocol , all the laser and traditional phacoemulsification procedures included in this study were performed under the supervision of 1 attending faculty who was an experienced femtosecond laser user . a total of 205 cases performed by 4 senior resident surgeons were determined eligible for data analysis , including 159 cases of conventional manual phacoemulsification and 46 cases of flacs . the conventional phacoemulsification cohort had a mean age of 70.6 years ( range : 4389 years ) , with 148 men and 11 women . the mean age of the flacs group was 73.9 years ( range : 5289 years ) , with 41 men and 5 women . for each case , the patient electronic medical records and the digital operating microscope video records were analyzed for data collection . de - identified patient data were recorded and stored on a secure local network server to maintain privacy and information security . the following information was recorded from each patient chart : age , gender , preoperative nucleus grade ,8 resident surgeon , total or time interval , total operating time interval , contraindications to flacs ,9 and intraoperative complications . total or time was defined as the minutes between patient entry and departure of the or . for the purpose of this study , total operating time was defined as the start - to - finish interval for the manual procedure conducted under the operating microscope , not including the time used for laser pretreatment when performed . total room interval and total operating interval were obtained from routine nursing documentation that recorded specific room in time , procedure start time , procedure finish time , and room out time . operative complications were defined as including one or more of the following unplanned occurrences : 1 ) posterior capsular tear with vitreous prolapse , 2 ) zonular dehiscence with vitreous prolapse , and / or 3 ) posteriorly dislocated nucleus or lens fragments . in the absence of any of the abovementioned 3 occurrences , however , isolated inadvertent anterior capsule tears were recorded upon review of the detailed operative reports and are reported later . data from digital video recordings were also collected . during each case , the operating microscope video had been routinely recorded and archived using an integrative device system ( switchpoint infinity 3 ; stryker , kalamazoo , mi , usa ) . the microscope video files were analyzed using an editing software ( videopad video editor ; nch software , greenwood village , co , usa ) , and digital replay allowed for determination of recorded time intervals to a significant degree of 0.008 minutes . specific performance times were collected from the video recording in each case for the following 5 key steps of the procedure : completion of incisions , completion of anterior capsulotomy , nucleus removal , cortical removal , and intraocular lens ( iol ) implantation . corneal incision completion time was defined as the total interval starting with application of a globe fixation ring to perform a single side port paracentesis and concluding with the finished patent primary incision , with inclusion of the in - between steps of intracameral lidocaine injection and viscoelastic injection after incising a single paracentesis . in cases of flacs , completion of corneal incisions was defined as the time used to fully open 1 primary laser incision and 1 secondary laser incision using either a blunt sinsky hook or an eippert spatula and also including the time taken for lidocaine and viscoelastic injection after initially opening the side port incision . completion of capsulotomy in the flacs group was defined as the total time taken to harvest the round anterior capsule leaflet regardless of the presence or absence of capsular attachments . nucleus removal time was defined as the total duration to disassemble and remove all nucleus material , including use of the ultrasound handpiece and use of manual nucleus dividing instrumentation when applicable . cortical removal time was defined as the total interval to remove lens cortex from the capsular bag , measured by visible entry and removal of an automated irrigation / aspiration handpiece . iol insertion time was defined as the interval starting with introduction of the lens cartridge at the incision and concluding upon completion of iol positioning but prior to viscoelastic removal . protocol exclusion criteria for data analysis were as follows : 1 ) attending faculty functioning as primary surgeon , 2 ) general anesthesia , 3 ) combined operations involving non - cataract components such as conjunctiva , cornea , glaucoma , or retina procedures , and 4 ) missing data required by the protocol including incomplete or absent video recording for each specific step . eyes with contraindications9 to femtosecond laser treatment had been assigned in the course of routine patient care to undergo conventional phacoemulsification , but these cases were not excluded from the cohort study unless one of the earlier exclusion criteria was met . common examples include eyes with preexisting paracentral cornea opacities or eyes with inadequate pupil dilation at 5 mm . patients on alpha adrenergic antagonist agents such as tamsulosin were considered eligible for flacs if the dilated pupil was 5 mm . in our practice , the following less frequent conditions were also routinely deselected from laser pretreatment : pterygium , advanced glaucoma , previous filtration surgery , head tremor , or inability of patient to position flat for laser interface docking . eligible cases were selected for flacs based on multiple safety and logistics concerns including absence of contraindications , patient willingness to undergo the procedure , scheduling , and laser access . third - party reimbursement or out - of - pocket patient expenses were not factors affecting the decision for flacs in the health care setting of the study . all phacoemulsification procedures were performed with 2.0 mm temporal clear cornea incision technique under topical / intracameral anesthesia using a phacoemulsification microsurgical system ( stellaris mics ; bausch + lomb , bridgewater , nj , usa ) . iols included one of the following : monofocal lens ( akreos ao ; bausch + lomb ) , toric lens ( acrysof iq toric lens ; alcon , fort worth , tx , usa ) , or multifocal lens ( acrysof iq restor ; alcon ) . when acrysof lenses were implanted , the actual time used to enlarge the 2.0 mm incision to 2.4 mm prior to lens injection ( typically 3060 seconds ) was not included in the recorded surgical step times . femtosecond laser pretreatment was performed using a food and drug administration ( fda ) - approved cataract refractive laser system ( lensx ; alcon ) located in the same or as the remaining surgical procedure . in cases involving flacs , laser pretreatment was included in the total room times but not in the total microscope operational times . similarly , time used for performance of laser treatment was not included in any of the individual surgical step time measurements . each femtosecond laser user completed a manufacturer - required 3 - phase training program during 2013 and 2014 . prior to the study period , an introductory educational program was conducted for or nurses and technicians assigned to ophthalmology . or personnel did not undergo formal manufacturer user training , and non - physicians did not assist with the operation of the laser . analyses of results were performed using a statistical software platform ( spss statistics ; ibm , armonk , ny , usa ) . the fisher s exact test was used to perform univariate comparisons of the complication rates and gender demographics . due to variability of patient age and individual resident surgeon performance , statistical significances ( p ) for comparison of mean time intervalswere determined using a multivariable linear mixed - effects model controlling for age and allowing random intercepts for each resident . a total of 218 cases for the defined study period were initially identified and records reviewed . thirteen cases were excluded due to general anesthesia ( 3 cases ) and combined procedures ( 10 cases ) . a total of 205 cases performed by 4 senior resident surgeons under the supervision of a single attending surgeon , designated a through d , were determined eligible for data analysis , including 159 cases of conventional manual phacoemulsification and 46 cases of flacs . similarly , residents b , c , and d had , respectively , completed 48 , 29 , and 44 conventional cases before flacs . analysis of the demographic data of the conventional phacoemulsification cohort yielded a mean age of 70.6 years ( range : 4389 years ) , with 148 men and 11 women . the flacs group had a mean age of 73.9 years ( range : 5289 years ) , with 41 men and 5 women . the high proportion of men was consistent with the institutional pattern of a predominantly male population at a veterans hospital . the differences of genders between the study cohorts were not significant ( p = 0.36 , fisher s exact test ) . due to the difference of mean ages ( p = 0.01 , independent samples t - test ) , statistical significances ( p ) of mean operating time comparisons were calculated using a multivariable linear mixed - effects model controlling for age . observed preoperative nucleus grade was not statistically different between the cohorts , with a mean lens opacities classification grading system iii ( locs iii ) nuclear opalescence grade of 3.2 in the flacs group and 3.1 in the conventional group ( p = 0.32 , independent samples t - test ) . use of iris expansion devices occurred in 9 cases of the conventional cohort , all involving insertion of a ring stabilizer ( malyugin ring ; micro - surgical technology , redmond , wa , usa ) . four additional cases with documented contraindications to flacs were identified in the conventional group , including 2 patients with kyphosis , 1 patient with head tremor , and 1 case of traumatic zonular dialysis requiring capsular tension ring insertion . complications were documented in a total of 4 cases ( 2.0 % ) , including 2 ( 1.3 % ) in the conventional phacoemulsification group and 2 ( 4.3 % ) among flacs . although the flacs group had a higher percentage of complications , the difference could not be shown to be statistically significant ( p = 0.22 , fisher s exact test ) . complications for the conventional phacoemulsification group were 1 case of posterior capsular tear with vitreous prolapse and 1 case of zonular dehiscence with vitreous prolapse . isolated anterior capsule tear without other mishap occurred in 2 cases of the conventional cohort and in no cases of flacs . because sample sizes were large enough in each group , 4 cases of anterior vitrectomy were censored and significance of interval differences were determined using a multivariable linear mixed - effects model , controlling for age and allowing random intercepts for each resident . total room time , total operation time , and corneal incision completion time were all found to be significantly longer in the laser group versus the conventional phacoemulsification group ( each p 0.05 ) . the mean difference in total operating time for the flacs group was 7.37 minutes longer than the conventional group ( p = 0.001 ) . average total room time was 7.02 minutes longer in the flacs groups ( p = 0.02 ) . by contrast , the mean duration for anterior capsulotomy was significantly shorter in the femtosecond laser pretreatment group compared to conventional phacoemulsification ( p 0.001 ) . there were no statistically significant differences between groups in the individual steps of nucleus removal , cortical removal , or iol placement . femtosecond laser cataract surgery technology has been integrated into the curricula of some ophthalmology residency programs , but this innovation does not yet have universal acceptance as an essential component of cataract surgery training . as with many ophthalmic procedures , flacs is associated with a considerable learning curve as the surgeon progressively gains familiarity , but the technical difficulty encountered likely depends on the degree of background surgical expertise . despite the challenges faced by experienced ophthalmologists , their learning process with flacs is facilitated by an advanced foundation of microsurgical skills . by contrast , resident surgeons may face a particularly demanding learning curve when performing flacs alongside their ongoing fundamental training in conventional phacoemulsification . femtosecond laser learning experiences of well - established cataract surgeons have been described ,2,7,10 but this report is the first published evidence specifically examining resident performance efficiency with flacs . at this institution , laser - assisted surgery is taught in conjunction with routine phacoemulsification at both pgy3 and pgy4 levels , with greater emphasis on flacs during later stages of training . this study characterizes the comparative efficiencies of senior ophthalmology residents when performing flacs , which was generally found to be less efficient than traditional surgery in the training program setting . significantly longer times were demonstrated in association with flacs for total or time , microscope operating time , and corneal incision completion time . interestingly , the difference of mean total room time only slightly exceeded the difference of mean operative time , suggesting that laser pretreatment did not substantially increase average room time . extended time for femtosecond laser use could have been anticipated due to the 2 - step nature of the procedure , but this study indicates that extension of the manual portion of the surgical procedure was the primary factor contributing to higher room times for flacs cases . the source ( s ) of higher mean operative time in the flacs group was not identified by our analysis of individual core steps , and the cause remains unclear . there are other procedural components not studied that might have contributed to decreased efficiency such as capsular staining dye use , viscoelastic injection , laser - generated gas bubble removal , hydrodissection , or confirmation of watertight wound closure . additional non - technical factors that could potentially prolong flacs or times or procedure times include supervising attending instruction , patient restlessness , room design , operating table design , instrument access , duplication of time - out procedures , or lesser familiarity with flacs by scrub technicians . although laser photophacofragmentation has been previously documented to reduce phacoemulsification power and time ,1,5,11,12 our data did not show a benefit of reduced nucleus removal time . our findings also did not demonstrate a significant difference for average cortical removal time , notwithstanding an anecdotal association of flacs with increased technical difficulty with cortex aspiration .11,13,14 despite similar perceptions at our institution , the collective data indicated that technical hindrances encountered during cortical cleanup did not systematically yield a longer mean time to accomplish this step . completion of capsulotomy with capsular leaflet removal was found to be shorter in the femtosecond laser group , but this benefit was not associated with improved efficiencies of subsequent surgical steps by the resident flacs trainees . not surprisingly , we were unable to demonstrate shorter time for iol placement with flacspotential improvements of iol position , centration , and anterior capsule overlap were beyond the scope of this study and have been reported elsewhere .1517 the flacs group had a higher proportion of complications , but the difference of complication rate was not shown to be statistically significant with the sizes of the data sets . both groups had complications occurring near or below reported rates of contemporary studies .1822 published reports of flacs have described higher complications during early laser cases by experienced cataract surgeons ,2,23 with a reduction of complications as surgeons accumulated more experience . a similar effect might be detected within training programs if residents were to complete more cumulative procedures . higher laser case volumes would likely enable trainees to progress further along the flacs learning curve , and trends toward improved safety and efficiency might be observed in further research involving a larger database . a multi - institutional , prospective , and randomized study conducted over a longer period of timealthough analyses yielded statistically significant comparisons , this study was limited by the retrospective design and the availability of only 1 femtosecond laser device . the results of this study are specific to a single commercial laser platform , and cautious interpretation should be taken in generalization to the flacs technology as a whole . additionally , because randomization of case allocation was not possible , uncontrolled variables of the chart review had potential to affect comparisons across groups of patients and resident surgeons . the conventional cohort included patients with contraindications to femtosecond laser treatment , particularly cases with mediocre pupil dilation , cornea opacification , or difficulty with supine patient positioning . eyes with poor pupil dilation in our practice often required the additional operative steps of inserting and removing a pupil expansion device , which occurred in 9 of the conventional phacoemulsification cases and in none of the flacs cases . various other obstacles presented by some less common flacs contraindications could also result in a need for additional surgical attention . in this study , examples included 4 cases in the conventional cohort involving patient kyphosis , head tremor , or capsular tension ring insertion . the inclusion of more challenging cases in the conventional surgery group could be reasonably expected to result in longer mean surgical times and higher risk of complications , but such findings were not observed . despite laser pretreatment and deselection of complex cases , time used to complete the procedure under the operating microscope was found to be longer for the flacs cohort . this phenomenon has not been previously described and is best explained by resident learning curve to address necessary modifications of manual phacoemulsification resulting from the laser pretreatment . the role of flacs in ophthalmology resident education is evolving , as is the role of this technology in general practice . regardless of efficiency reductions during early trainee cases , inclusion of flacs in teaching curriculum provides for a more comprehensive surgical experience to prepare residents for future practice . additionally , flacs appears to improve efficiency of anterior capsulotomy , a critical portion of the procedure that is widely considered the most hazardous step for trainees . the findings of this study and previously reported data5 support the concept that automated anterior capsulotomy with flacs may eventually emerge as a better solution in cataract surgery learning for residents in the future . there is a potential for longer flacs operative times by senior residents when training programs are introducing femtosecond laser technology into residency curricula , with complications among flacs cases occurring close to expected trainee rates for conventional phacoemulsification .\noutput:\n" }, { "from": "agent", "value": "purposecomparison of resident surgeon performance efficiencies in femtosecond laser - assisted cataract surgery ( flacs ) versus conventional phacoemulsification.patients and methodsa retrospective cohort study was conducted on consecutive patients undergoing phacoemulsification cataract surgery performed by senior ophthalmology residents under the supervision of 1 attending physician during a 9 - month period in a large veterans affairs medical center . medical records were reviewed for demographic information , preoperative nucleus grade , femtosecond laser pretreatment , operative procedure times , total operating room times , and surgical complications . review of digital video records provided quantitative interval measurements of core steps of the procedures , including completion of incisions , anterior capsulotomy , nucleus removal , cortical removal , and intraocular lens implantation.resultstotal room time , operation time , and corneal incision completion time were found to be significantly longer in the femtosecond laser group versus the traditional phacoemulsification group ( each p < 0.05 ) . mean duration for manual completion of anterior capsulotomy was shorter in the laser group ( p < 0.001 ) . there were no statistically significant differences in the individual steps of nucleus removal , cortical removal , or intraocular lens placement . surgical complication rates were not significantly different between the groups.conclusionin early cases , resident completion of femtosecond cataract surgery is generally less efficient when trainees have more experience with traditional phacoemulsification . flacs was found to have a significant advantage in completion of capsulotomy , but subsequent surgical steps were not shorter or longer . resident learning curve for the flacs technology may partially explain the disparities of performance . educators should be cognizant of a potential for lower procedural efficiency when introducing flacs into resident training ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we analyzed 82 type and other culture collection strains encompassing all validly described staphylococcal species ( n = 38 ) and subspecies ( n = 21 ; according to the current list of bacterial names with standing in nomenclature , updated may 14 , 2005 ) ( 7 ) . two strains of the recently proposed candidate species s. pettenkoferi ( 8 ) were added to complete the rpob sequence reference database . using this database , we analyzed 55 clinical staphylococcal isolates collected from human ( n = 52 ) and animal ( s. intermedius , n = 2 ; s. felis , n = 1 ) specimens ; 6 of the human isolates exhibited the small - colony variant ( scv ) phenotype . this strain collection was previously analyzed by the api i d 32 staph and vitek 2 systems ( both obtained from biomrieux , marcy l'etoile , france ) , partial 16s rdna sequencing , chemotaxonomy , and riboprinting to determine species designation ( 3 ) . the thermal cycling condition to amplify the partial rpob gene ( 899 bp ) was 35 cycles of denaturation at 94c for 45 s ( 300 s for the first cycle ) , annealing ( 60 s at 52c ) , and extension ( 90 s at 72c , 600 s for the last cycle ) . the staphylococcus - specific primers used for amplification and sequencing of rpob are shown in table 1 . sequencing reactions were performed in a total volume of 10 l containing 0.5 l premix ( abi prism bigdye terminator v3 .0 ready reaction cycle sequencing kit , applied biosystems , darmstadt , germany ) , 1.8 l 400 mmol / l tris - hcl , 10 mmol / l mgcl2 , 10 pmol sequencing primer , and 2 l polymerase chain reaction product . the sequencing products were purified by using the centri - sep spin columns ( princeton separations , adelphia , nj , usa ) and analyzed with the abi prism 3100 avant genetic analyzer ( applied biosystems ) according to the manufacturer 's instructions . for further analysis , nucleotides 14441928 ( corresponding to s. aureus rpob gene positions of the genbank accession no . the sequences were analyzed by using ridom traceeditpro version 1.0 software ( ridom gmbh , wrzburg , germany ) . staphylococcal partial rpob reference sequences determined in this study were deposited in genbank under accession nos . * primers are numbered from the 3 end of the primer on the forward strand of staphylococcus aureus ( genbank accession no . all staphylococcal type strains were distinguishable by rpob ; the only exception was the s. equorum subspecies that shared the same sequence ( figure a1 ) . the mean pairwise distance of all type and other culture collection strains exhibiting a unique rpob sequence ( n = 68 ) was 13.7 % ( range 0 % 21.4 % ) and the standard deviation was 3.3 % . when assuming a normal distribution for the distances and choosing a reporting criterion 94.0 % , the similarity for a distinct species correlates with a statistical error probability of 1.0 % ( 9 ) . the definitive identification of 55 clinical isolates and the rpob gene sequence similarity search results are shown in table 2 . at the species level , the correct species designation for all 55 clinical isolates was made by rpob sequence similarity search ( sequence similarity 94.0 % ) . of 21 clinical isolates belonging to species currently divided into subspecies , 17 isolates were correctly identified to the subspecies level . subspecies identification for isolates m26 and m53 was unsuccessful by rpob or partial 16s rdna sequencing , riboprinting , and chemotaxonomy ( data not shown ) . only isolates m20 and m39 were misidentified by rpob sequencing as s. saprophyticus subsp . our previous study demonstrated the superiority of sequence - based methods over phenotypic approaches using the api i d 32 staph and vitek 2 systems ( 3 ) . the advantage of a sequence - based method became most evident when differentiating isolates with the scv phenotype , in which the api i d 32 staph and vitek 2 systems misidentified 2 and 4 isolates , respectively . when both sequence - based approaches used were compared , rpob sequencing was superior to partial 16s rdna identification . although the 16s rdna procedure differentiated 50 ( 90.9 % ) of all tested clinical isolates at species level , rpob identified 100 % . therefore , if an unknown organism needs to be identified , 16s rdna sequencing is the method of choice because of the availability of universal primers ( 10 ) . however , if the genus is already known , the rpob method should be used . compared with other published molecular probes , rpob showed the highest discriminatory power , e.g. , hsp60 and soda sequencing did not differentiate subspecies of s. carnosus , s. cohnii , s. hominis , s. schleiferi , or s. succinus ( 4,5 ) . in a previous study , rpobsequence - based identification of staphylococcus species has been reported ( 6 ) . however , a limited number of taxa were included , and the primers used were not appropriate to detect all staphylococcal subspecies . a higher discrimination with rpob sequencing compared with 16s rdna sequencing has been demonstrated for the genera corynebacterium ( 13 ) and bacillus ( 14 ) . dna sequencing is a rapid alternative to biochemical and other phenotypic procedures for the differentiation of bacterial pathogens because of its decreased costs and increased automation ( 15 ) . thus , rpob is a useful molecular target for differentiating staphylococcal isolates to the species and subspecies level .\noutput:\n" }, { "from": "agent", "value": "the emerging clinical importance of staphylococcal infections prompted us to establish a reference database for partial rna polymerase b ( rpob ; nucleotides 14441928 ) gene sequences from type strains of all staphylococcal species and subspecies . this database correctly identified 55 clinical staphylococcal isolates ; all were correctly identified at the species level . at the subspecies level , rpob misidentified only 2 isolates ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: characterized by irreversible airflow obstruction , which is usually progressive , copd worsens as a result of inhalation of smoke and noxious gases . 1 this disease , which is preventable and treatable , has various systemic manifestations , such as skeletal muscle dysfunction related to decreased exercise capacity , which , in association with dyspnea , tends to cause impairment of activities of daily living ( adls ) . 23 impairment of adls in individuals with copd can be assessed by the six - minute walk test , the six - minute walk distance being considered a good marker of functional capacity . 4 however , this test does not identify which activities are impaired , nor does it assess impairment of activities performed with the arms , which are invariably involved in adls . the available instruments have little applicability in severely impaired patients 5 or show limited sensitivity to changes following interventions , such as pulmonary rehabilitation . . 7 developed the manchester respiratory activities of daily living ( mradl ) questionnaire , which has been used as a physical disability scale in elderly patients with copd 8 and consists of four domains : mobility ( 7 items ) ; activities in the kitchen ( 4 items ) ; domestic tasks ( 6 items ) ; and leisure activities ( 4 items ) . the scoring system ranges from 0 to 21 , with the maximum score indicating no physical disability . the mradl is an adapted composite of the nottingham extended activities of daily living questionnaire and the breathing problems questionnaire .7 the mradl is valid , reliable , and reproducible , as well as being easy and rapid to complete ( 10 min ) , in addition to distinguishing between individuals with copd and healthy elderly individuals and being sensitive to pulmonary rehabilitation . 78 it has good internal consistency ( cronbach 's alpha coefficient = 0.91 ) , 7 with low final scores indicating difficulties in adls .9 however , because the mradl is an instrument originally developed in english , it should be translated into the target language and adapted to the social and cultural circumstances of the target country .1013 in this context , the objective of the present study was to translate the mradl into portuguese and to create a version of the mradl that is cross - culturally adapted for use in brazil . the study sample was intentionally comprised of 10 patients who had been diagnosed with copd and were treated at the pulmonology outpatient clinic of the federal university of santa catarina university hospital , located in the city of florianpolis , brazil . the inclusion criteria were as follows : having previously been diagnosed with copd by spirometry , in accordance with the global initiative for chronic obstructive lung disease criteria 1 ( post - bronchodilator fev1 / fvc ratio 0.70 ) ; having shown clinical stability in the signs and symptoms of copd in the last four weeks ; having been free from respiratory infection and copd exacerbation in the last three months ; and being able to understand the study procedures . patients who had a respiratory disease other than copd were excluded , as were those who had a systemic inflammatory disease and those who had a mental illness or a deficit in understanding or forming speech that would prevent them from answering the questions in the instrument . symptoms and health status were assessed by the copd assessment test ( cat ) , 14 and patients were evaluated for dyspnea on the basis of the modified medical research council ( mmrc ) scale score , 15 which was used for the classification of disease severity . the study was approved by the human research ethics committee of the federal university of santa catarina ( protocol no . the translation and cross - cultural adaptation of the mradl were performed as described by guillemin et al . 16 and wild et al .17 in brazil , felisbino et al . used this methodology to translate a chronic cough questionnaire into brazilian portuguese and adapt it for use in brazil .18 the cross - cultural adaptation process was carried out , in phases , strictly in accordance with internationally accepted guidelines 17 : acquisition of permission for cross - cultural adaptation and acquisition of the rights of use of the mradl from one of its original authors ; translation of the mradl from english into portuguese ; reconciliation ; back - translation ; review and harmonization of the back - translation ; acquisition of approval from the author of the mradl ; review of the portuguese - language version of the mradl by experts ; cognitive debriefing ; and reconciliation / preparation of the final version . first , the mradl was translated from english into portuguese by two bilingual researchers who participated in this study , and then a review committee met to produce a first portuguese - language version . subsequently , the major questions raised and difficulties encountered were discussed with the author of the questionnaire , and a second version was reached . the second portuguese - language version of the mradl was back - translated into english by a translator who was a native speaker of english and fluent in portuguese . the back - translation was then reviewed by the review committee , which produced a back - translated english version and a matching portuguese - language version . the back - translated version was sent to one of the authors of the original mradl for evaluation , and , once that had been approved , a third portuguese - language version of the mradl was produced . the third version was reviewed by an expert committee , which included a bilingual pulmonologist and two brazilian translators who were fluent in english and performed the translation independently , and , subsequently , a fourth portuguese - language version of the mradl was produced . the fourth version was used in the cognitive debriefing process , with the questionnaire being administered to the study participants . questions regarding and difficulties related to the text were addressed , and , at the end of this phase , a fifth version was produced . after reconciliation , the final portuguese - language version of the mradl was produced ( figure 1 ) . figure 1 . summary of the process of translating the manchester respiratory activities of daily living ( mradl ) questionnaire into brazilian portuguese and creating a version of the mradl that is cross - culturally adapted for use in brazil . the cognitive debriefing process consisted of a preliminary test , i.e. , a pretest to identify problems in the text of the questionnaire ( complexity of the questions , imprecise wording , unnecessary questions , embarrassment or exhaustion caused to respondents , etc . ) 19 and offer solutions to make it easier to understand . to that end , we chose 10 individuals with copd , because they belonged to the population under study , 1920 and administered the translated questionnaire to them in order to assess the clarity and precision of the terms ; the form , break - down , and order of the questions ; and the introduction to the questionnaire .19 in this phase , the following elements were also investigated : reliability ( the same results will always be obtained with the questionnaire , regardless of who administers it ) ; validity ( the data collected are necessary to the research ) ; and operability ( accessible vocabulary and clear meaning ) . 20 during the visit , the study was explained in detail , and individuals who agreed to participate gave written informed consent . individuals were informed that they should not worry about the accuracy of their responses , but rather just report what they understood , any problems related to the questions or statements on the questionnaire , and their level of acceptance of the questionnaire . during the administration of the mradl , the researcher and the patient were alone . the researcher read the questions to the participant and re - read them if necessary but did not explain them . finally , in the reconciliation phase , the review committee and the expert committee met to produce the final portuguese - language version of the mradl . to that endthe cognitive debriefing findings were discussed by the authors of this study and the author of the original questionnaire , and the relevant changes were made . therefore , the final portuguese - language version of the mradl adapted for use in brazil was produced . of the 10 patients interviewed in the cognitive debriefing phase , 7 were female , all were while , and all resided in the greater metropolitan area of florianpolis . the general , anthropometric , and clinical characteristics of the participants are listed in table 1 . characteristic result gender , m / f3 / 7smokers , yes / no4 / 6age , years62 .69.9 weight , kg69 .513.5 height , m1 .60.1 smoking history , pack - years38 .438.8 fev1 , l1 .20.8 fev1 , % of predicted36 .414.4 fvc , l2 .10.9 fvc , % of predicted49 .911.5 fev1 / fvc , % 54.411.3 cat score18 .37.9 mmrc dyspnea scale score1 .40.9 cat : copd assessment test ; and mmrc : modified medical research council . values expressed as n / n or mean sd . cat : copd assessment test ; and mmrc : modified medical research council . values expressed as n / n or mean sd . during the mradl translation phase , there were some questions raised and suggestions made for changes , with changes being made with the approval of the author of the mradl . was changed to \" do you cross the street ? \" the item \" do you wash and dry yourself ? \" was changed to \" do you carry out personal hygiene ( brush your teeth , wash your face , comb your hair ) ? \" , expanding the scope of the question to the ability of individuals to perform their personal hygiene in general . the items to which changes were made after the translation of the original questionnaire can be seen in table 2 . in addition , in this phase , the item \" do you cross roads ? \" was questioned by the experts because \" streets \" and \" roads \" are considered to be the same type of route in brazil , and the item was changed to \" do you cross the street ? \" \" do you wash and dry yourself ? \" was initially translated as \" voc se lava e se seca ? \" ; however , the translators discussed between themselves and questioned the author of the original questionnaire about the equivalence between that item and the item \" do you have a bath ? \" , both of which were aimed at determining the patients ' ability to bathe themselves . nevertheless , \" do you have a bath ? \" means bathing in a bathtub , which is not very common in brazil , where few people have a bathtub at home . therefore , the item was changed to \" do you carry out personal hygiene ( brush your teeth , wash your face , comb your hair ) ? \" , which can detect impairment of personal hygiene in general . table 2 . the manchester respiratory activities of daily living questionnaire items to which changes were made after their translation into brazilian portuguese . initial translation portuguese - language version 1 \" atravessa estradas ? \" \" atravessa a rua ? \" \" se lava e se seca ? \" \" realiza higiene pessoal ( escovar os dentes , lavar o rosto , pentear o cabelo ) ? \" in the back - translation of the mradl into english , the following items underwent changes : \" do you walk around outside ? \" was back - translated as \" do you go hiking outdoors ? \" ; however , the author of the mradl suggested that the item remain as in the original version . the item \" do you walk over uneven ground ? \" , which was back - translated as \" do you walk on irregular terrain ? \" , remained as in the original version because the author of the original questionnaire did not agree with using the word \" terrain \" , arguing that it would alter the original meaning of the question . the domestic activities domain subheading was back - translated as \" home chores \" , there being no change in its meaning in portuguese . the back - translation of the item \" do you wash small items of clothing ? \" as \" do you wash small garments ? \" was discarded by the author of the original questionnaire because the term \" garments \" was considered inappropriate . the review by the expert committee indicated some grammatical errors and offered conceptual suggestions , as well as questioning whether the item \" do you walk around outside ? \" was meant to refer to mobility ( confidence in leaving home ) or to physical activity ( walking ) . the author of the mradl explained that this item refers to both , as well as to social interaction , and therefore it was changed to \" do you walk outside the house ? \" the item \" do you do a full clothes wash ? \" was changed to \" do you have the ability to do a full clothes wash and hang them out to dry ? \" because of socioeconomic issues , because , in brazil , not everyone has a washer , and because of climatic issues , taking into account that most people hang clothes on the clothesline to dry and do not have a dryer . the items to which changes were made after the review by the expert committee are listed in table 2 . table 3 . the manchester respiratory activities of daily living questionnaire items to which changes were made after the review by the expert committee . original english - language version modified english - language version \" do you walk around outside ? \" \" do you walk outside the house ? \" \" do you do a full clothes wash ? \" \" do you have the ability to do a full clothes wash and hang them out to dry ? \" table 4 . the manchester respiratory activities of daily living questionnaire items to which changes were made after the cognitive debriefing phase . portuguese - language version 3 portuguese - language version 4 \" curva - se na posio em p ? \" \" curva - se na posio em p para pegar um objeto ? \" \" cuida do seu jardim ? \" \" cuida do seu jardim ou plantas em seu apartamento ? \" during the cognitive debriefing phase , participants raised some questions about the text . the item \" do you get in and out of the car ? \" was questioned by participants because some of them had difficulty in performing only one of these activities . however , the author of the original questionnaire suggested that the item remain in the questionnaire and that difficulty in performing only one of the activities be considered impairment . for the item \" do you bend over from standing ? \" , it was necessary to explain and even simulate the movement , and the item was changed to \" do you bend over from standing position to pick up an object ? \" for better understanding . the item \" do you do the washing up ? \" was questioned by participants because , for cultural reasons , this activity is performed mostly by women in brazil ; however , the author of the mradl suggested that the item remain in the questionnaire , because it refers to the ability of individuals to perform the activity , even if they do not do it frequently . the items \" do you wash small items of clothing ? \" and \" do you have the ability to do a full clothes wash and hang them out to dry ? \" remained in the questionnaire and should be taken into account even if patients use a washer , in which case the patients ' ability to put clothes into and take them out of the washer to hang them on the clothesline should be assessed . finally , the item \" do you manage your own garden ? \" was questioned by the individuals who lived in apartments and did not have a garden , and it was realized that some individuals in the sample would have a low total score . therefore , that item was modified to \" do you take care of your garden or plants in your apartment ? \" the items to which changes were made after the cognitive debriefing can be seen in table 4 . during the analysis of the latest provisional version of the mradl , the author of the original instrument suggested that the following changes be made to its instructions : \" this scale was elaborated \" was changed to \" this scale is designed \" and \" circle the most appropriate response that best describes you \" was changed to \" reply with one tick ( ) that best describes you \" . the final portuguese - language version of the mradl can be seen in chart 1 . chart 1.portuguese - language version of the manchester respiratory activities of daily living questionnaire adapted for use in brazil . in the present study , the mradl was translated into portuguese and a version of the mradl that is cross - culturally adapted for use in brazil was created , with some caveats and changes . there are some validated instruments to assess functional disability in patients with copd ; however , such instruments have little applicability in severely impaired patients . 21 that underscores the importance of the instrument translated in the present study , because the mradl is aimed at assessing impairment of adls in individuals with copd , as well as being able to detect overall impairment , even in severely ill individuals . the individuals included in the present study had a mean cat score and a mean mmrc dyspnea scale score of 18.37.9 and 1.40.9 , respectively , which demonstrates the severity of their disease , given that a cat score 10 and an mmrc score 2 are indicative of high impact of symptoms . 1 among the available instruments that have been validated for use in brazil , few assess impairment of adls specifically in patients with copd . 152123 one of the questionnaires developed specifically to assess impairment of adls in patients with copd - the pulmonary functional status and dyspnea questionnaire - modified version - consists of three domains ( influence of dyspnea on adls , influence of fatigue on adls , and change in adls after disease onset ) .23 however , the instrument is not appropriate for assessing individuals who are elderly or severely impaired , because it includes questions regarding tasks that are more complex . there are several predictors of prognosis for individuals with copd , including lean body mass index , frequency of hospitalizations for acute exacerbations , and classification of symptoms . 24 the six - minute walk test is also widely used .23 however , its use is limited because it does not assess functional capacity in patients who are more severely ill . the mradl has proven useful in the assessment of physical disability as a predictor of mortality in elderly individuals with copd , 24 which suggests that this instrument is more beneficial in clinical practice . of the patients interviewed in the cognitive debriefing phase , 70 % were female , and all resided in the greater metropolitan area of florianpolis . the region accounts for 18 % of the total population of the state of santa catarina , which , in recent years , has shown low fertility rates and a trend toward growth in the number of elderly individuals ; in addition , in santa catarina , the proportion of females in the elderly age group is higher than is that of males , a fact that can be explained by the greater exposure of men to a set of risk factors , such as alcohol use , smoking , and violence .25 therefore , the present study sample does not appear to be representative of the prevalence of copd , which is higher in men .26 one of the difficulties found was an inability of respondents to differentiate among the response options for each adl , because some of them reported not performing some activities because someone did that for them , and not because they were unable to perform them . difficulties in interpreting the items assessed have also been identified in other studies , and such items need to be rephrased in order to be more easily understood .2122 during the final reconciliation process carried out by the expert committee in order to prepare the final portuguese - language version of the mradl , it was suggested that a response option reading \" not applicable \" be included to minimize possible misinterpretations of responses , because , in brazil , women make up more than 90 % of all domestic workers , which shows that they predominate in this sector .27 however , this suggestion was not accepted by the author of the original instrument , because the primary objective of the mradl is to identify individuals severely affected by copd and because the change would negatively affect the scoring system , making it difficult to quantify the results . a validation study is needed in order to assess the use of the mradl , the scoring system applied , and the score by gender . perhaps a different score should be considered for males , in order to reduce limitations in the items that comprise the \" domestic activities \" domain . in a study aimed at performing a translation and cultural adaptation 21 of another measure of functional disability in patients with copd , the london chest activity of daily living scale , an alternative scoring system was designed for the item \" i do not perform this activity ( because i have never needed to or it is irrelevant ) . \" in order to disregard the questions for which the patient would score zero and prevent men completing the questionnaire from having a score that does not reflect their actual functional impairment , thereby identifying individuals who do not perform certain activities for reasons other than those related to the lung disease . the study participants , according to the criteria used in the present study , were classified as patients with severe copd ( table 1 ) . 1 this made it impossible to assess the mradl in terms of its applicability in individuals with mild disease . the objective of the present study was to translate the mradl into portuguese and to create a version of the mradl that is cross - culturally adapted for use in brazil . although the mradl is a self - report questionnaire , we chose to interview participants in order to receive their suggestions . in order to test the applicability of the mradl , as well as its reproducibility , a study is being conducted to assess its internal validity by determining interobserver and intraobserver variability . therefore , the mradl has now been translated and adapted for use in brazil . the final portuguese - language version of the mradl was found to be easy to understand and easy to administer , as well as being a useful instrument to assess the physical limitations and determine the prognosis of individuals with copd . : traduzir para a lngua portuguesa e fazer a adaptao cultural do questionrio the manchester respiratory activities of daily living ( mradl ) para uso no brasil . : a verso em lngua inglesa do mradl foi traduzida por duas pesquisadoras da rea da sade com fluncia na lngua inglesa . essa verso foi retrotraduzida para o ingls por um tradutor nascido em um pas de lngua inglesa e fluente em portugus . o processo de desdobramento cognitivo consistiu em testar a compreenso , a clareza e a aceitabilidade do questionrio traduzido na populao alvo , aplicando - o em dez indivduos com dpoc . com base nos resultados , foi realizada a formulao da verso brasileira do mradl aps sua aprovao pelo comit e um dos autores do questionrio original . : poucos itens foram questionados pelo autor da escala original , e algumas modificaes relacionadas aos domnios mobilidade e higiene pessoal foram realizadas . foram observadas diferenas culturais quanto ao domnio atividades domsticas , em especial o item \" consegue lavar a roupa e estend - la para secar ? \" devido a condies socioeconmicas e climticas . o item \" cuida do seu jardim ? \" foi questionado pelos participantes que moravam em apartamentos , sendo modificado para \" cuida do seu jardim ou plantas em seu apartamento ? \" . : a verso final do mradl , traduzido e adaptado para uso no brasil , mostrou ser de fcil compreenso e aplicao . a dpoc caracterizada pela obstruo irreversvel ao fluxo de ar nas vias areas , normalmente progressiva , e piora com a inalao de fumaa e gases nocivos .1 essa doena prevenvel e tratvel , apresentando diversas manifestaes sistmicas como a disfuno muscular esqueltica relacionada diminuio da capacidade de exerccio que , associada dispneia , tende a causar limitaes na realizao de atividades de vida diria ( avd ) . 23 as limitaes das avd nesses indivduos podem ser avaliadas pelo teste de caminhada de seis minutos , j que a distncia percorrida considerada um bom marcador da capacidade funcional . 4 no entanto , esse teste no identifica em quais atividades especficas a limitao est presente e nem avalia a limitao das atividades realizadas com os membros superiores , os quais esto invariavelmente envolvidos nas avd . poucas so as ferramentas validadas para avaliar a limitao das avd em pacientes com dpoc . os instrumentos disponveis tm pouca aplicabilidade para pacientes gravemente limitados 5 ou so pouco sensveis a mudanas aps intervenes , como a reabilitao pulmonar .7 desenvolveram o questionrio the manchester respiratory activities of daily living ( mradl ) , o qual tem sido utilizado como uma escala de incapacidade fsica em pacientes idosos com dpoc , 8 sendo composta por quatro domnios : mobilidade ( 7 itens ) , atividades na cozinha ( 4 itens ) , tarefas domsticas ( 6 itens ) e atividades de lazer ( 4 itens ) . o mradl tem a finalidade de avaliar a limitao das avd em pacientes com dpoc . sua pontuao varia entre 0 e 21 , sendo que o escore mximo significa ausncia de incapacidade fsica . foi desenvolvido a partir da combinao e adaptao do nottingham extended activities of daily living questionnaire e do breathing problems questionnaire .7 o mradl vlido , confivel , reprodutvel , de fcil e rpida aplicao ( dez minutos ) , alm de fazer a distino entre indivduos com dpoc e idosos saudveis e ser sensvel reabilitao pulmonar . 78 apresenta boa consistncia interna ( coeficiente alfa de cronbach = 0,91 ) , 7 sendo que baixos valores na pontuao final representam dificuldades nas avd . um escore 7,5 considerado como preditor de mortalidade . 9 porm , por se tratar de um instrumento desenvolvido originalmente na lngua inglesa , o questionrio mradl deve ser traduzido e adaptado s circunstncias sociais e culturais do local onde se pretende utiliz - lo . 1013 com base nesse contexto , o presente estudo teve como objetivo a traduo para a lngua portuguesa e a adaptao cultural do questionrio mradl para seu uso no brasil . a populao do estudo foi intencionalmente composta por 10 pacientes de ambos os sexos , com diagnstico de dpoc atendidos no ambulatrio de pneumologia do hospital universitrio da universidade federal de santa catarina , em florianpolis ( sc ) , brasil . os critrios de incluso foram os seguintes : ter diagnstico prvio de dpoc por meio de espirometria segundo os critrios da global initiative for chronic obstructive lung disease 1 ( relao vef1 / cvf 0,70 aps o uso de broncodilatador ) , apresentar estabilidade clnica dos sinais e sintomas da doena nas ltimas quatro semanas , estar livre de infeco respiratria ou exacerbao da doena nos ltimos trs meses eforam excludos os pacientes que apresentaram outras doenas respiratrias que no dpoc , doenas inflamatrias sistmicas , doena mental e / ou dficit de compreenso ou de linguagem que impedisse o sujeito de responder s perguntas do instrumento . os sintomas e / ou estado de sade foram avaliados por meio do copd assessment test ( cat , teste de avaliao da dpoc ) , 14 e os pacientes tambm foram avaliados quanto aos sintomas de dispneia pelo escore da escala de dispneia modified medical research council ( mmrc ) 15 para a classificao da gravidade da doena . o estudo foi aprovado pelo comit de tica em pesquisa com seres humanos da universidade federal de santa catarina ( protocolo 800.310 ) . a traduo e a adaptao cultural do mradl seguiram os pressupostos publicados por guillemin et alutilizaram essa metodologia para a traduo e adaptao cultural de um questionrio sobre tosse crnica para a lngua portuguesa falada no brasil .18 as etapas realizadas para o processo de adaptao cultural foram seguidas rigorosamente conforme sugestes internacionalmente aceitas 17 : autorizao e cesso de direitos de uso por um dos autores da escala original ; traduo da lngua inglesa para a lngua portuguesa do mradl ; reconciliao ; retrotraduo ; reviso e harmonizao da retrotraduo ; aprovao do autor do mradl ; reviso da verso em portugus do mradl por especialistas ; desdobramento cognitivo ; e reconciliao para a elaborao da verso final . primeiramente , foi realizada a traduo do mradl da lngua inglesa para o portugus por duas pesquisadoras bilngues participantes do presente estudo e , em seguida , foi realizada uma reunio do comit revisor para a confeco da primeira verso na lngua portuguesa . posteriormente , as principais dvidas e dificuldades encontradas foram discutidas com o autor da escala , chegando - se a uma segunda verso . foi realizada a retrotraduo dessa verso em portugus para o ingls por um tradutor nascido em pas de lngua inglesa e com fluncia na lngua portuguesa . em seguida , foi realizada uma nova reviso pelo comit revisor e elaborada a segunda verso do mradl para a lngua portuguesa . a verso retrotraduzida para o ingls foi enviada a um dos autores do mradl original para sua avaliao e , aps sua aprovao , foi elaborada a terceira verso na lngua portuguesa do mradl . essa verso foi revisada por um comit de especialistas , composto por uma mdica pneumologista bilngue e duas tradutoras brasileiras com fluncia na lngua inglesa , que realizaram a traduo de forma independente , sendo posteriormente elaborada a quarta verso do mradl em portugus . com essa verso foi realizado o desdobramento cognitivo , aplicando - se o questionrio aos participantes do estudo . foram investigadas possveis dvidas e dificuldades em relao ao texto e , ao final dessa etapa , foi elaborada a quinta verso . aps a reconciliao , foi elaborada a verso final do mradl na lngua portuguesa ( figura 1 ) . figura 1 . resumo do processo de traduo para a lngua portuguesa falada no brasil e da adaptao transcultural do questionrio the manchester respiratory activities of daily living ( mradl ) para uso no brasil . o desdobramento cognitivo consistiu em uma prova preliminar , ou seja , um pr - teste a fim de evidenciar possveis falhas na redao do questionrio ( complexidade das questes , impreciso na redao , desnecessidade das questes , constrangimentos ao informante , exausto , etc . ) para isso , foram escolhidos 10 indivduos com dpoc , por pertencerem populao estudada , 1920 com os quais foi realizada a aplicao do questionrio traduzido com o objetivo de se avaliar a clareza e a preciso dos termos ; a forma , o desmembramento e a ordem das questes e a introduo do questionrio .19 nessa etapa tambm foram verificados os seguintes elementos : fidedignidade ( qualquer pessoa que o aplique obter sempre os mesmos resultados ) ; validade ( os dados recolhidos so necessrios pesquisa ) ; e operacionalidade ( vocabulrio acessvel e significado claro ) .20 na visita , o estudo foi detalhadamente explicado , e os indivduos que concordaram participar do estudo assinaram o termo de consentimento livre e esclarecido . durante a visita , foram coletados dados antropomtricos , foi realizada a espirometria para o diagnstico da dpoc e foram aplicados o cat e a escala mmrc . os indivduos foram informados de que no deveriam se preocupar com a acurcia das respostas , mas apenas mostrar o que compreenderam , quais as dificuldades de cada pergunta ou afirmao do questionrio e sua aceitao ao mesmo . a avaliadora leu as questes para os participantes , limitando - se a repetir a leitura quando necessrio , mas sem explic - las . ao final , na etapa de reconciliao , o comit revisor e de especialistas reuniram - se para produzir a verso final do mradl na lngua portuguesa , sendo o instrumento revisto item por item . foram discutidos os achados do desdobramento cognitivo entre os autores do estudo e o autor do questionrio original , sendo realizadas as modificaes pertinentes para a confeco da verso final do instrumento . dessa forma , foi elaborada a verso final do instrumento adaptado para uso no brasil . dos 10 pacientes entrevistados para a etapa do desdobramento cognitivo , 7 eram do sexo feminino , todos eram da raa branca e procedentes da grande florianpolis . as caractersticas gerais , antropomtricas e clnicas dos participantes esto listadas na tabela 1 . caractersticas resultados sexo , m / f3 / 7fumantes , sim / no4 / 6idade , anos62 ,69,9 peso , kg69 ,513,5 altura , m1 ,60,1 carga tabgica , anos - mao38 ,438,8 vef1 , l1 ,20,8 vef1 , % previsto36 ,414,4 cvf , l2 ,10,9 cvf , % previsto49 ,911,5 vef1 / cvf , % 54,411,3 escore cat18 ,37,9 escore escala de dispnia mmrc1 ,40,9 cat : copd assessment test ; e mmrc : modified medical research council . durante a etapa de traduo do mradl houve algumas dvidas e sugestes para modificaes , sendo que as correes foram feitas mediante a aprovao do autor . foi modificado para \" do you cross the street ? \" . o item \" do you wash and dry yourself ? \" foi modificado para \" do you carry out personal hygiene ( brush your teeth , wash your face , comb your hair ) ? \" , ampliando o sentido da questo para a capacidade de o indivduo realizar sua higiene pessoal em geral . os itens alterados aps a traduo da escala original podem ser visualizados na tabela 2 . ainda nessa etapa , o item \" do you cross roads ? \" foi questionado pelos especialistas pelo fato de \" ruas \" e \" estradas \" serem consideradas os mesmos tipos de vias no brasil , sendo modificado para \" do you cross the street ? \" . \" do you wash and dry yourself ? \" foi primeiramente traduzido para \" voc se lava e se seca ? \" ; porm , as tradutoras discutiram e questionaram o autor da escala original devido equivalncia com o item \" do you have a bath ? \" , sendo que ambos apresentam a finalidade de identificar a capacidade do indivduo em conseguir tomar banho . no entanto , \" do you have a bath ? \" significa tomar banho na banheira , o que no muito comum no brasil pelo fato de a maioria dos indivduos no ter banheira . portanto , esse item foi modificado para \" do you carry out personal hygiene ( brush your teeth , wash your face , comb your hair ) ? \" , o que pode identificar a limitao ao realizar a higiene pessoal em geral . tabela 2 . itens alterados aps a traduo para o portugus falado no brasil do questionrio the manchester respiratory activities of daily living . traduo inicial verso 1 \" atravessa estradas ? \" \" atravessa a rua ? \" \" se lava e se seca ? \" \" realiza higiene pessoal ( escovar os dentes , lavar o rosto , pentear o cabelo ) ? \" na retrotraduo para a lngua inglesa do mradl , os seguintes itens sofreram modificaes : \" do you walk around outside ? \" foi retrotraduzido como \" do you go hiking outdoors ? \" ; porm , o autor sugeriu manter como consta na verso original . o item \" do you walk over uneven ground ? \" , retrotraduzido como \" do you walk on irregular terrain ? \" foi mantido como na verso original porque o autor no concordou com a palavra \" terrain \" , arguindo que mudaria o significado original da pergunta . o subttulo referente ao domnio sobre atividades domsticas foi retrotraduzido para \" home chores \" , no havendo mudana no seu significado na lngua portuguesa . a retrotraduo do item \" para \" do you wash small garments ? \" foi descartada pelo autor da escala original por considerar o termo \" garments \" inadequado . a reviso do comit de especialistas apontou alguns erros gramaticais e sugestes conceituais , sendo que o item \" do you walk around outside ? \" foi questionado quanto ao seu significado estar relacionado mobilidade ( confiana em sair de casa ) ou atividade fsica ( caminhada ) , sendo esclarecido pelo autor que est relacionado a ambos como tambm interao social e , portanto , foi modificado para \" do you walk outside the house ? \" . foi modificado para \" do you have the ability to do a full clothes wash and hang them out to dry ? \" devido questo socioeconmica , pois no brasil nem todas as pessoas possuem mquina de lavar roupas , e questo climtica , considerando que a maioria das pessoas penduram a roupa no varal para secar e no possuem mquina para secar roupas . os itens modificados aps a reviso do comit de especialistas esto listados na tabela 3 . tabela 3 . itens modificados do questionrio the manchester respiratory activities of daily living e aps a reviso do comit de especialistas . \" do you walk outside the house ? \" \" do you do a full clothes wash ? \" \" do you have the ability to do a full clothes wash and hang them out to dry ? \" no desdobramento cognitivo , houve algumas dvidas dos participantes com relao ao textotodavia , o autor da escala original sugeriu que esse item fosse mantido , devendo j ser considerada como dificuldade apenas a existncia de uma das atividades . no item \" do you bend over from standing ? \" , houve necessidade de explicar e at simular o movimento , o qual foi modificado para \" do you bend over from standing position to pick up an object ? \" foi questionado pelo fato de essa atividade ser realizada majoritariamente pelas mulheres no brasil por motivo cultural ; porm , o autor sugeriu manter , sendo que esse item se referecapacidade do sujeito em realizar a atividade , mesmo que no a faa frequentemente . \" e \" do you have the ability to do a full clothes wash and hang them out to dry ? \" foram mantidos e devem ser considerados mesmo que o paciente use a mquina de lavar , devendo ser avaliada a sua capacidade de colocar e retirar a roupa da mquina para pendur - la no varal . por ltimo , o item \" do you manage your own garden ? \" foi questionado pelos indivduos que moram em apartamento e no terem jardim , e percebeu - se que alguns indivduos da amostra apresentariam um baixo escore total , sendo esse item ento modificado para \" do you manage your own garden or flower pots in your apartment ? \" os itens alterados aps o desdobramento cognitivo podem ser visualizados na tabela 4 . tabela 4 . itens alterados do questionrio the manchester respiratory activities of daily living aps a etapa de desdobramento cognitivo . portugus \" curva - se na posio em p ? \" \" curva - se na posio em p para pegar um objeto ? \" \" cuida do seu jardim ? \" \" cuida do seu jardim ou plantas em seu apartamento ? \" na avaliao da ltima verso do mradl , o autor original do instrumento sugeriu as seguintes modificaes nas suas instrues : \" this scale was elaborated \" para \" this scale is designed \" e \" circle the most appropriate response that best describes you \" para \" reply with one tick ( ) that best describes you \" . a verso final traduzida para o portugus do brasil do mradl encontra - se no quadro 1 . the manchester respiratory activities of daily living questionnaire traduzido para o portugus e adaptado para uso no brasil . no presente estudo , foram realizadas a traduo para a lngua portuguesa e a adaptao cultural do questionrio mradl para uso no brasil , com algumas ressalvas e modificaes . existem alguns instrumentos validados para avaliar a incapacidade funcional de pacientes com dpoc ; porm , esses apresentam pouca aplicabilidade para pacientes gravemente limitados . 21 esse fato justifica a importncia do instrumento traduzido no presente estudo , pois o mesmo apresenta a finalidade de avaliar a limitao das avd em indivduos com dpoc , sendo capaz de identificar as limitaes gerais , inclusive de indivduos graves . os indivduos do presente estudo apresentaram uma mdia no escore do cat e da escala de dispneia mmrc de 18,37,9 pontose 1,40,9 , respectivamente , o que demonstra a sua gravidade da doena , considerando que um escore cat 10 e um escore mmrc 2 so indicativos de alto impacto dos sintomas . 1 entre os instrumentos disponveis validados para uso no brasil , poucos avaliam a limitao das avd especificamente para pacientes com dpoc . 152123 um dos questionrios desenvolvidos especificamente para avaliao das limitaes nas avd de pacientes com dpoc - pulmonary functional status and dyspnea questionnaire - modified version - composto por trs domnios ( influncia da dispneia nas avd , influncia da fadiga nas avd e mudana nas avd em comparao ao perodo anterior doena ) . 23 entretanto , esse instrumento no adequado para a avaliao de indivduos idosos e / ou gravemente limitados , pois apresenta perguntas referentes a tarefas mais complexas . h diferentes fatores que predizem o prognstico em indivduos com dpoc , tais como ndice de massa magra , frequncia de hospitalizaes por exacerbaes agudas e classificao de sintomas . 24 o teste de caminhada de seis minutos tambm bastante utilizado 23 ; porm , seu uso limitado por no avaliar a capacidade funcional de pacientes mais graves . o mradl se mostrou til na avaliao da incapacidade fsica como um fator preditor de mortalidade em indivduos idosos com dpoc , 24 o que sugere maiores benefcios desse instrumento na prtica clnica . dos pacientes entrevistados para a etapa do desdobramento cognitivo , 70 % eram do sexo feminino , e todos eram procedentes da grande florianpolis .18 % do total da populao do estado de santa catarina , que , nos ltimos anos , apresentou baixa fecundidade e tendncia ascendente do nmero de idosos ; alm disso , santa catarina possui uma maior proporo de pessoas do sexo feminino nessa faixa etria , fato que pode ser explicado devido maior exposio dos homens a um conjunto de fatores de riscos , como o uso do lcool , tabagismo e mortes violentas . 25 portanto , a amostra do presente estudo parece no ser representativa da prevalncia da dpoc , que maior em homens . 26 uma das dificuldades encontradas foi em relao diferenciao da resposta para cada avd pelos indivduos da amostra , pois alguns relataram no realizar algumas atividades porque algum as fazia por eles e no por incapacidade de execut - las . dificuldades de interpretao dos itens avaliados tambm so identificadas em outros estudos , e esses itens necessitam de adaptaes de linguagem para se tornarem mais compreensveis . 2122 na ltima reconciliao dos especialistas para a elaborao da verso final do mradl , foi sugerida a insero de uma opo de resposta \" no aplicvel \" para minimizar possveis interpretaes equivocadas das respostas , pois , no brasil , as mulheres constituem mais de 90 % de todos os trabalhadores domsticos , mostrando a sua predominncia em comparao aos homens nesse setor .27 porm , essa sugesto no foi aceita pelo autor do instrumento original devido ao fato de que o objetivo principal desse identificar os indivduos gravemente acometidos pela dpoc e que isso prejudicaria o sistema de pontuao pela dificuldade em quantificar os resultados . um estudo de validao se faz necessrio a fim de avaliar seu uso , pontuao e escores para ambos os sexos . talvez outro escore deva ser contemplado para os indivduos do sexo masculino a fim de reduzir as limitaes nos itens que compem o domnio \" atividades domsticas \" . em um estudo de traduo e adaptao transcultural 21 de outro instrumento para avaliar a incapacidade funcional de pacientes com dpoc , a escala london chest activity of daily living , foi elaborada uma pontuao alternativa para o item \" no executo essa atividade ( porque nunca precisei fazer isso ou irrelevante ) \" a fim de desconsiderar as questes nas quais o paciente pontuaria zero e evitar que os homens que respondam ao instrumento apresentemum escore que no reflita sua real limitao funcional , identificando assim os indivduos que no realizam determinadas atividades por outros motivos que no esto relacionados doena pulmonar . os participantes do estudo , segundo os critrios utilizados no presente estudo , foram classificados como pacientes com dpoc grave ( tabela 1 ) .1 isso impossibilitou a avaliao do mradl quanto a sua aplicabilidade em indivduos com doena leve . o objetivo do presente estudo foi realizar a traduo para a lngua portuguesa e a adaptao cultural do questionrio mradl para uso no brasil . apesar de ser autoaplicvel , optou - se por realizar a entrevista para receber as sugestes dos participantes . para a sua aplicabilidade , est sendo realizado um estudo da avaliao da validao interna por meio da investigao da variabilidade interobservador e intraobservador , 28 bem como a avaliao de sua reprodutibilidade . . 29 os comentrios realizados pelos entrevistados sobre o instrumento foram bastante teis . as sugestesdessa forma , o questionrio mradl encontra - se traduzido e adaptado para seu uso no brasil . a verso final adaptada para a lngua portuguesa mostrou - se simples e de fcil compreenso e aplicao , sendo esse um instrumento til para avaliar as limitaes fsicas e predizer o prognstico de indivduos com dpoc .\noutput:\n" }, { "from": "agent", "value": "objective : to translate the manchester respiratory activities of daily living ( mradl ) questionnaire into portuguese and to create a version of the mradl that is cross - culturally adapted for use in brazil . methods : the english - language version of the mradl was translated into portuguese by two health care researchers who were fluent in english . a consensus version was obtained by other two researchers and a pulmonologist . that version was back - translated into english by another translator who was a native speaker of english and fluent in portuguese . the cognitive debriefing process consisted in having 10 copd patients complete the translated questionnaire in order to test its understandability , clarity , and acceptability in the target population . on the basis of the results , the final portuguese - language version of the mradl was produced and approved by the committee and one of the authors of the original questionnaire . results : the author of the mradl questioned only a few items in the translated version , and some changes were made to the mobility and personal hygiene domains . cultural differences regarding the domestic activities domain were found , in particular regarding the item \" do you have the ability to do a full clothes wash and hang them out to dry ? \" , due to socioeconomic and climatic issues . the item \" do you take care of your garden ? \" was questioned by the participants who lived in apartments , being modified to \" do you take care of your garden or plants in your apartment ? \" conclusions : the final portuguese - language version of the mradl adapted for use in brazil was found to be easy to understand and easily applied ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the main therapeutic approach for the management of periodontal disease includes mechanical scaling and root planing , thereby removing the bacterial deposits from tooth surface . because of the complex anatomy of the roots and contours of the lesion , mechanical periodontal treatment alone may not be effective , and sufficient in the reduction of the bacterial load to make the tooth surface biologi cally acceptable . moreover , the success of mechanical periodontal treatment is closely related to the patient 's oral hygiene performance . recurrent periodontal tissue destruction is almost inevitable in patients who fail to achieve an acceptable plaque control during treatment or maintenance phase of periodontal therapy . however , the dose necessary to achieve sufficient local concentrations of antimicrobials in the periodontal environment might be associated with undesirable side effects . the local delivery device consists of a drug reservoir and a limiting element that controls the rate of the medicament release . the goal is to maintain effective concentrations of chemotherapeutic agents at the site of action for longer periods . local delivery devices can be divided into two classes according to the duration of the medicament release : sustained release devicescontrolled delivery devices sustained release devices controlled delivery devices sustained release formulations are designed to provide drug delivery for less than 24 h. on the other hand , controlled delivery systems should have duration of drug release that exceeds 1 day . its mechanism of action relates to reduction in pellicle formation , alteration of bacterial adherence to teeth and an alteration of bacterial cell wall causing lysis . chlorhexidine is effective against subgingival plaque bacteria when delivered via a sustained - release device for 9 days . the antimicrobial effects were evident up to 11 weeks after treatment , and clinical efficacy in terms of reduced probing depth , clinical attachment levels , and reduction of bleeding on probing was evident . a biodegradable chip for sustained and direct delivery of chlorhexidine to the periodontal pocket has been developed . the aim of this study is to evaluate the effectiveness of a controlled - release chlorhexidine chip ( periocol - cg ) as an adjunct to scaling and root planing when compared with scaling and root planing alone in the treatment of chronic periodontitis . each periocol - cg contains approximately 2.5 mg of chlorhexidine gluconate in a biodegradeable matrix of type 1 collagen derived from fish sources . periocol - cg releases chlorhexidine in vitro with a release profile of approximately 40 - 45 % within 24h and afterward in linear fashion for 7 - 8 days . the release profile may be explained by initial burst effect due to diffusion of the drug from the chip followed by release of the drug due to enzymatic degradation . twenty patients , aged 35 - 55 years , diagnosed with generalized chronic periodontitis , having probing pocket depth 5 mm were selected from the department of periodontology and implantology , meenakshi ammal dental college , chennai , for this study which was approved by ethical committee . group - a ( control site ) had 20 sites treated with scaling and root planing alone . group - b ( test site ) had 20 sites treated with scaling and root planing and periocol - cg . exclusion criteria included allergy to chlorhexidine , presence of overhanging restoration , smoking , pregnant women , those who have received antibiotics or any form of periodontal treatment in the previous 6 months . after selection of patients , a full mouth supragingival scaling was done with ultrasonic scalers and oral hygiene instructions were given . impressions were taken and an acrylic stent was made for standardized measurements of probing pocket depth and clinical attachment level [ figure 1a , c e ] . ( a ) armamentarium ; ( b ) periocol - cg ; ( c ) chronic periodontitis ; ( d ) assessment of bleeding on probing ; ( e ) after scaling and root planing the clinical parameters ( plaque index , bleeding on probing , probing pocket depth , clinical attachment level ) were recorded at baseline , 90 , and 180 day . baseline ( 0 day ) : after recording the clinical parameters , scaling and root planing was performed using ultrasonic scalers and gracey curettes in control sites [ figure 2 ] and test sites [ figure 3a ] . it was followed by the placement of periocol - cg at the ( test sites ) group - b [ figure 3b ] . group a - measurement of probing pocket depth and clinical attachment level using acrylic stent ( a ) group b - measurement of probing pocket depth and clinical attachment level using acrylic stent ; ( b ) placing of periocol - cg placement of periocol - cg : after scaling and root planing , the test sites were dried with cotton pellets . it was grasped at the flat end , and the curved end was first inserted into the periodontal pocket . it was gently pressed apically to the base of the pocket without any folds [ figure 3b ] . after placement into the test sites , patients were instructed not to use interdental cleansers such as dental floss or tooth pick for the next 10 days to avoid displacement , or any kind of chemotherapeutic mouth rinses or oral irrigation device . the patients were recalled on the third and seventh day to assess the position of periocol - cg . on 90 day : the clinical parameters were recorded in both groups a and b [ figures 2 and 3a ] . supragingival scaling was performed in both groups a and b. periocol - cg was again placed into group b. on 180th day : the clinical parameters were recorded in both groups a and b. the mean and standard deviation were compared by using student 's paired t - test , wilcoxon 's signed rank test , and mcnemar 's test . after selection of patients , a full mouth supragingival scaling was done with ultrasonic scalers and oral hygiene instructions were given . impressions were taken and an acrylic stent was made for standardized measurements of probing pocket depth and clinical attachment level [ figure 1a , c e ] . ( a ) armamentarium ; ( b ) periocol - cg ; ( c ) chronic periodontitis ; ( d ) assessment of bleeding on probing ; ( e ) after scaling and root planing the clinical parameters ( plaque index , bleeding on probing , probing pocket depth , clinical attachment level ) were recorded at baseline , 90 , and 180 day . baseline ( 0 day ) : after recording the clinical parameters , scaling and root planing was performed using ultrasonic scalers and gracey curettes in control sites [ figure 2 ] and test sites [ figure 3a ] . it was followed by the placement of periocol - cg at the ( test sites ) group - b [ figure 3b ] . group a - measurement of probing pocket depth and clinical attachment level using acrylic stent ( a ) group b - measurement of probing pocket depth and clinical attachment level using acrylic stent ; ( b ) placing of periocol - cg placement of periocol - cg : after scaling and root planing , the test sites were dried with cotton pellets . it was grasped at the flat end , and the curved end was first inserted into the periodontal pocket . it was gently pressed apically to the base of the pocket without any folds [ figure 3b ] . after placement into the test sites , patients were instructed not to use interdental cleansers such as dental floss or tooth pick for the next 10 days to avoid displacement , or any kind of chemotherapeutic mouth rinses or oral irrigation device . the patients were recalled on the third and seventh day to assess the position of periocol - cg . on 90 day : the clinical parameters were recorded in both groups a and b [ figures 2 and 3a ] . supragingival scaling was performed in both groups a and b. periocol - cg was again placed into group b. on 180th day : the clinical parameters were recorded in both groups a and b.the mean and standard deviation were compared by using student 's paired t - test , wilcoxon 's signed rank test , and mcnemar 's test . overall , 40 sites were treated , 20 with srp and 20 with srp plus chx chip . table 1 shows the comparison of mean , standard deviation , and test of significance for the plaque index score between groups a and b at different time points . comparison of mean , standard deviation , and test of significance for the plaque index score between groups a and b at different time points at baseline , there was no statistically significant difference in the plaque index score between the srp alone and the chx plus srp group . both groups had a significant change in the plaque index score at 90 and 180 days . at the 90 day , the plaque index score was reduced to 1.1 in the srp alone group and 0.9 in the srp plus chx chip group . further improvements occurred in the plaque index score at 180 day , 0.9 in srp alone , and 0.7 in the srp plus chx chip group , respectively . table 2 shows the percentage of gingival bleeding sites in group a and group b at different time points . percentage of gingival bleeding sites in group a and b at different time points the positivity of gingival bleeding sites was 100 % at baseline in both group a and group b. on the 90th day , there was 25 % reduction in gingival bleeding sites in group a and 45 % reduction in group b. on 180th day , there was 40 % reduction in gingival bleeding sites in group a and 85 % reduction in group b. table 3 shows the comparison of mean , standard deviation , and test of significance for probing pocket depth between group a and b at different time points . at baseline , there was no statistically significant difference in probing depth between the srp alone and chx plus srp group . at 90 day , pd was reduced to 6.2 mm in the srp alone group and 5.8 mm in the srp plus chx chip group compared to baseline . at 180 day pdwas further reduced to 4.8 mm in srp alone group and 4.2 mm in the srp plus chx chip group , respectively . comparison of mean , standard deviation , and test of significance for probing pocket depth between group a and b at different time points table 4 shows the comparison of mean change in probing pocket depth between group a and b from baseline . mean reduction in probing pocket depth between 0 and 90 day in group a was 1.40.5 mm and in group b it was found to be 1.60.5 mm . mean reduction in probing pocket depth between 180 day in group a was 2.81.0 mm and in group b it was found to be 3.20.6 mm . comparison of mean change in probing pocket depth between group a and b from baseline table 5 shows the comparison of mean change in clinical attachment level between group a and b from baseline . the mean gain in clinical attachment level from day 0 to 90 in group a was 1.30.5 mm and in group b it was 1.80.6 mm . the mean gain in clinical attachement level from day 0 to 180 in group a was 2.71.0 mm and in group b it was 3.20.9 mm . group b showed a significant gain in the clinical attachment level as compared to group a from baseline to 90 day and 180 day , respectively . in clinical trials by soskolne and jeffcoat , periochip was used as an adjunctive to scaling and root planing in the treatment of chronic periodontitis . both studies showed that the adjunctive use of periochip was effective in reducing plaque index scores , bleeding on probing , probing pocket depth , and gain in clinical attachment level when compared to scaling and root planing alone . in the present study , supragingival plaque decreased significantly from baseline in both the groups as a result of full mouth supragingival and subgingival scaling . in group a , the mean reduction in the plaque index score was in accordance to studies done by mc nabb et al . , dahlen et al . , and ximmenez - fyvie et al . who demonstrated that repeated professional supragingival plaque control reduced both supra and sub - gingival plaque . the reduction was higher in group b because of application of periocol - cg this result was similar to the study done by mizrak et al . the plaque scores were maintained at a low level throughout the study , indicating good oral hygiene performance of all the patients and successful re - motivation and instruction in supportive periodontal care . on comparing both these parameters between the groups , the reduction was more significant in group b compared to group a. the results in group a were similar with the results of mc nabb et al . , dahlen et al . , and ximmenez - fyvie et al . who demonstrated that repeated professional supragingival plaque control reduced counts of both supra - and sub - gingival plaque andapart from supragingival scaling , the adjunctive placement of periocol - cg would have released chlorhexidine with drug concentration greater than 125 g / ml into the periodontal pocket for 7 - 10 days . this concentration has been reported to be above the minimum inhibitory concentration for more than 99 % of subgingival microorganisms . this change in microflora would have further reduced the inflammatory state of periodontal tissues , thus bringing about reduction in the bleeding on probing . the results in group b were in accordance with the results of the study done by killoy et al . in the present study , the mean reduction in probing pocket depth in group a was similar to the studies done by hill , pihlstorm , and cugini . the mean reduction in probing pocket depth in group b was similar to studies done by soskolne , jeffcoat , azmak , and paolantonio . on comparison of the mean probing pocket depth between group a and b , there was no statistically significant difference observed from the baseline to 90 day and baseline to 180 day . on clinical examination , group b demonstrated a higher reduction in probing pocket depth when compared to group a. in group a , the probing pocket depth would have reduced because of the beneficial effects of scaling and root planing which occurred within the first 3 months followed by a period of stability aided by maintenance scaling . in group b , the probing pocket depths reduced because of the placement of periocol - cg . this indicates that there was an additional beneficial effect of chlorhexidine apart from scaling and root planing alone . the continuing efficacy of chlorhexidine was due to the fact that the periodontal pockets received a second application of chlorhexidine at 3 months with supragingival scaling while the control group received supragingival scaling only . the mean gain in the clinical attachment level from baseline to 90 day , and baseline to 180 day was statistically significant in group a and group b. on comparing the mean gain in clinical attachment level between group a and b , the gain was higher in group b. in group a , the improvement in clinical attachment level was due to deeper baseline probing depth in the present study . according to kaldahl , there was greater gain in clinical attachment level after scaling and root planing with ppd of 4 mm . in group b , the sites were treated by srp followed by treatment of periodontal pockets with periocol - cg . with the additional placement of chlorhexidine chip , there was sustained exposure of chlorhexidine in pocket environment for 6 - 9 days which gave long - lasting effects on microbiota . this would have brought about additional gain in the clinical attachment level in group b. these findings were similar to studies by soskolne and jeffcoat who also demonstrated gain in the clinical attachment level in test sites which received the chlorhexidine chip . studies done by mizrak and azmak demonstrated that after placement of periochip there was reduction in gcf pge2 and gcf mmp - 8 levels . in this present study , the adjunctive use of chlorhexidine along with srp resulted in a beneficial effect in both clinical and microbiological parameters which could have been due to reduction in gcf pge2 levels and reduction in gcf mmp - 8 levels . the microbiological analysis and gcf analysis after placement of the chlorhexidine chip was not performed as it was not within the scope of this study . however , long - term studies are required with larger sample size and longer time period with microbiological analysis to evaluate the effectiveness of periocol - cg . from the results observed in this study , it can be concluded that the adjunctive use of periocol - cg was safe and provided significant improvement in the plaque index and gingival bleeding index . it was more favorable than scaling and root planing alone in the reduction of probing pocket depth and gain in the clinical attachment level .\noutput:\n" }, { "from": "agent", "value": "aims and objectives : the aim of this study is to evaluate the effectiveness of a controlled - release chlorhexidine chip as an adjunctive therapy to scaling and root planing when compared with scaling and root planing alone in the treatment of chronic periodontitis.materials and methods : 20 patients with a total number of 40 posterior sites were selected . these sites were divided into two groups in a split mouth design , : group a ( control site ) had 20 sites treated with scaling and root planing alone and group b ( test site ) had 20 sites treated with scaling and root planing and periocol - cg . the clinical parameters ( plaque index , bleeding on probing , probing pocket depth , clinical attachment level ) were recorded at baseline , 90th and 180th day for both the groups.results : when both groups were compared the change in plaque index was significantly higher in group b when compared to group a on the 90th day and 180th day . however , there was no statistically significant difference in the mean percentage of gingival bleeding sites between the two groups on the 90th day , though group b showed a statistically higher reduction in the mean percentage of gingival bleeding sites at the end of 180th day . there was no statistically significant difference in probing pocket depth between the two groups on both 90th and 180th day . gain in clinical attachment level was significantly higher in group b when compared to group a on the 90th and 180th day.conclusion : from the results observed in this study , it can be concluded that the adjunctive use of periocol - cg was safe and provided significant improvement in both plaque index and gingival bleeding index . it was also more favorable than scaling and root planing alone for gain in clinical attachment level ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: previous studies of test - retest reliability of muscle strength measurement using a handheld dynamometer ( hhd ) have shown low reliability in measuring the lower limbs and high reliability in measuring the upper limbs1 , 2 . wikholm et al. 1 conducted an investigation with 3 examiners and healthy subjects and reported that , while the intraclass correlation coefficient ( icc ) values for measurements of elbow flexor and shoulder external rotator muscles , which have low muscle strength , were 0.768 and 0.932 , respectively , that of measurements of knee extensor muscles , which have high muscle strength , was 0.226 . agre et al. 2 conducted an investigation with three examiners and healthy subjects and reported that pearson s product - moment correlation values ranged from 0.19 to 0.96 for the lower extremities , but from 0.88 to 0.94 for the upper extremities . katoh et al. 3 developed a method of measurement with an hhd and a belt in order to increase the reliability of lower extremity muscle strength measurement . the icc ( 2 , 1 ) values for measurements of hip adduction , external rotation , and internal rotation , the average strength of which was less than 20 kgf , ranged from 0.70 to 0.83 without a belt and from 0.97 to 0.99 with a belt , suggesting that using a belt increases reliability even if muscle strength is lower than 30 kgf4 ( 300 n5 ) , which was believed to be the hhd measurement limit . the purpose of this study was to develop a method of measuring shoulder joint muscle strength with an hhd and a belt and to investigate its test - retest reliability . the subjects comprised 40 right - handed healthy adults ( 20 male , 20 female ) with an average , height , and weight of 20 ( range 20 to 22 ) years , 164.5 cm ( sd = 7.8 cm ) , and 60.8 kg ( sd = 13.4 kg ) , respectively , and no history of orthopedic disease or shoulder injury , from whom informed written consent was obtained . the study was conducted in accordance with the principles of the declaration of helsinki ( 1975 , revised 1983 ) . explanations of the methods and the purpose of the study were provided by the assessor to the subjects in writing , and consent to participation was obtained in the form of signed consent forms . the study was approved by the institutional review board of ryotokuji university ( approval number 2376 ) . isometric shoulder joint muscle strengths ( flexion , extension , abduction , external rotation , internal rotation , horizontal extension ) were measured twice with an hhd ( tas f - 1 , anima corp . , prior to measurement , subjects performed exercises using 50 % , 75 % , and 100 % of maximum muscle strength to both warm - up and practice . measurements were taken as subjects performed isometric exercises with 3 seconds of maximum effort , once before and once after a 30 - second break . subjects were instructed not to strongly contract muscle groups of the elbow , hand joints , or digits when performing exercises . measurement conditions are described in table 1table 1 . conditions for measuring shoulder joint muscle strength using a handheld dynanometer with a beltexertion taskposturelimb positionsdynanometer positionbelt fixationflexionsupine0 shoulder flexion , 0 abduction , elbow slightly bent , forearm in pronationhumerus lateral supracondylar ridgebed leg below armextensionseated ( a ) 0 shoulder flexion , 0 abduction , 0 elbow flexion , forearm in pronationolecranon stairs baluster parallel to armabductionseated ( a ) 90 shoulder abduction , elbow slightly bent , forearm in pronationhumerus lateral supracondylar ridgebed leg below armexternal rotationseated ( b ) 45 shoulder flexion , 135 elbow flexionstyloid process of the ulnastairs baluster parallel to forearminternal rotationseated ( b ) 45 shoulder flexion , 135 elbow flexionstyloid process of the ulnastairs baluster parallel to forearmhorizontal extensionprone90 shoulder abduction , 90 elbow flexionolecranon bed leg below arm ( a ) the examiner held the subject s shoulder on the measured side . ( b ) to prevent abduction - adduction , a 5 kg bag of sand was fixed between the elbow and the baluster . . a silicon cover was placed on the hhd sensor , and the lower edge of the hdd was fixed at the measuring position on the subject using a hook - and - loop fastener . then the limb being measured , to which the hhd had been attached , and a fixture such as bed leg or frame , selected according to the measurement being taken , were linked with a belt so that when the subject performed the exercise , force was applied to the hhd . the belt length was adjusted slightly shorter so that the joint angle defined during exercise . angle of the belt was adjusted to body part for fixing the hhd and the belt at right angles . while subjects performed the exercise , one physiotherapist ( male , height 180 cm , weight 53 kg ) with over 10 years of experience performing muscle strength measurement with an hhd and a belt held both sides of the hhd sensor so it remained relative to the direction of movement ( table 1 ) . measurements were taken while subjects lay on a training bench ( bed , l 200 cm w 60 cm h 42 cm ) with a metal frame and steel legs or sat on a 40 - cm high stool with the soles of their feet touching the floor or a platform . ( b ) to prevent abduction - adduction , a 5 kg bag of sand was fixed between the elbow and the baluster . in measuring shoulder flexion , subjects lay supine on a bed with a bed leg , which was distal to the upper arm on the measurement side , directly under them . subjects placed their bilateral upper extremities along their sides with their elbow joints in mild flexion and forearms in pronation so that their thumbs were by their sides and their palms were facing down . the hhd was fixed distal to the upper arm bone with its lower edge at the lateral supracondylar ridge , and the extremity to be measured was linked by the belt to the bed leg . in measuring shoulder joint extension , subjects sat on the stool facing some training stairs with a steel baluster in front of the upper extremity on the measurement side . subjects held their trunk vertical with the upper extremity to be measured descending with the forearm in pronation parallel to the baluster . the hhd was fixed to the posterior surface distal to the humerus with its lower edge at the olecranon fossa , and the extremity to be measured was linked by the belt to the baluster . in measuring shoulder joint abduction , subjects sat on a stool by a bed with a bed leg , which was parallel to their anteroposterior axis directly underneath distal to the upper arm when the measurement side was abducted 90 to the shoulder joint , directly underneath them . subjects held their trunk vertical with the upper extremity on the measurement side abducted 90 at the shoulder joint , elbow joints in mild flexion , and forearms in pronation . in order to prevent the trunk from tilting to compensate for the strain during measurement , the hand on the non - measurement sidewas placed on a surface with the palm facing down lateral to the limb being measured . the hhd was fixed distal to the humerus with its lower edge placed at the lateral supracondylar ridge , and then the extremity to be measured was linked by a belt to the bed leg . in measuring shoulder joint internal and external rotation , they placed their elbows on the bed in the middle position of shoulder joint abduction - adduction with the baluster of the training stairs and the forearms parallel . the extremity to be measured was placed in flexion at an angle at 45 of the shoulder joint , and the elbow was placed in flexion at 135 with the forearm perpendicular to the bed . in order to prevent shoulder joint abduction and adduction during measurement , a 5 kg sandbag was positioned between the baluster and the forearm to fix the position of the elbow . for internal rotation , the hhd was fixed to the anterior side distal to the forearm ( to the plam of the hand ) , and for external rotation , it was fixed to the posterior side distal to the forearm ( the hand dorsal side ) with is upper edge at the styloid process of the radius ; the extremity to be measured was linked by a belt to the baluster . in shoulder horizontal extension , subjects lay prone on a bed with their arms extended beyond the edge of the bed up to the distal part of humerus and their shoulder joint abducted to 90 and elbow joint flexed ( the forearm was descending ) . in this position , the elbow , bed leg , and shoulder were aligned when viewed from above . the hhd sensor was fixed to the posterior surface distal to the humerus and the extremity to be measured was linked by a belt to the bed leg . the intraclass correlation coefficient ( icc ) was used to assess relative reliability , and bland - altman analysis was used to assess absolute reliability . when a proportional bias was observed , regression analysis was used to obtain the primary regression equation . table 2table 2 . isometric shoulder muscle strength measurements of young healthy adults made by one tester using a handheld dynamometer with a beltshoulder exertion task1sttime2nd timeflexion16 .2 ( 7.9 ) 16.1 ( 7.5 ) extension14 .6 ( 5.2 ) 14.9 ( 4.7 ) abduction13 .9 ( 5.7 ) 13.3 ( 5.5 ) external rotation8 .4 ( 3.4 ) 7.9 ( 3.0 ) internal rotation15 .3 ( 5.8 ) 15.0 ( 5.6 ) horizontal extension11 .0 ( 5.1 ) 10.7 ( 4.2 ) values are shown as the mean ( sd ) . the average values for the first and second measurements of shoulder joint muscle strength were as follows : flexion , 16.2 and 16.1 kgf ; extension , 14.6 and 14.9 kgf ; abduction , 13.9 and 13.3 kgf ; external rotation , 8.4 and 7.9 kgf ; internal rotation , 15.3 and 15.0 kgf , and horizontal extension , 11.0 and 10.7 kgf . unit : kgf table 3table 3 . reliability of isometric shoulder muscle strength measurements of young healthy adults made by one tester using a handheld dynamometer with a beltshoulder exertion taskicc ( 1,1 ) bland - altman analysispoint estimation ( 95 % ci ) loasemfixed biasproportional biasrandom error95 % cibias * slope ** bias * mdcflexion0 .957 ( 0.9210.977 ) 0.60.8 n - exi0 .062 p = 0.202 n - exi4 .5 extension0 .951 ( 0.9100.974 ) 0.80.2 n - exi0 .102 p = 0.042 existabduction0 .976 ( 0.9560.987 ) 0.92.10.20.20.9 exist0 .040 p = 0.207 n - exiexternal rotation0 .902 ( 0.8230.947 ) 1.42.40.20.10.9 exist0 .111 p = 0.107 n - exiinternal rotation0 .963 ( 0.9320.981 ) 0.20.8 n - exi0 .044 p = 0.318 n - exi3 .0 horizontal extension0 .917 ( 0.8500.955 ) 0.30.9 n - exi0 .191 p = 0.002 existreliability : reliability of the 1st value and the 2nd value ; icc , intraclass correlation coefficient ; 95 % ci , 95 % coefficient interval ; loa , limit of agreement ; sem , standard error of measurements . * presence of bias : exist , present ; n - exi , not present . ** slope of regression : mdc , line minimal detectable change shows the reliability of measures of isometric shoulder joint muscle strength measurements . in terms of relative reliability , the icc ( 1 , 1 ) values ranged from 0.976 to 0.902 ( p 0.05 ) . in terms of absolute reliability , fixed biases were observed for abduction and external rotation , and proportional biases were observed for extension and horizontal extension . the limit of agreement ( loa ) for extension ranged from 16.0 % to 10.6 % . no systematic biases were observed for flexion and internal rotation , and only random errors were observed . reliability : reliability of the 1st value and the 2nd value ; icc , intraclass correlation coefficient ; 95 % ci , 95 % coefficient interval ; loa , limit of agreement ; sem , standard error of measurements . * presence of bias : exist , present ; n - exi , not present . * since the icc values for all six types of exercise were 0.9 , relative test - retest reliability was considered high . however , absolute reliability by bland - altman analysis revealed random errors at 4.5 kgf for flexion and 3.0 kgf for internal rotation . the average value of flexion and internal rotation was 15 kgf , whereas the random errors relative to the average value were 28 % in flexion and 37 % in internal rotation , which may impact patient performance . therefore , it was considered appropriate to adopt the larger of two measurements rather than assuming errors within the random error range when performing measurement once . proportional biases were observed for extension and horizontal extension . based on the loa , biases from 16.0 % to 10.6 % for extension and from 18.6 % to 20.6 % for horizontal extension were expected . since the range of bias was wide , we considered it appropriate to adopt the larger of two measurements rather than assuming biases within the loa range . since fixed biases observed in abduction and external rotation mostly showed smaller values in the second measurement for both muscle strengths , we considered it appropriate to adopt the first measurement . however , as some subjects showed larger values in the second measurement , we considered it acceptable to adopt the larger value of two measurements in line with the other exercise items . in lower extremity muscle strength measurement with an hhd with a belt in 40 young healthy subjects , katoh et al. 3 reported that measurement values when a belt was used were higher than measurement values when the hhd was held by the examiner . the present study measured the strength of shoulder joint muscles which included many items considered to be below the limit of value that can be measured to have to hand the hhd . it is necessary to compare measurements obtained with an hhd and a belt with those obtained with an hhd but without a belt , i.e. , with the hhd held by the examiner , when measuring should joint muscle strength in the future . since the present study measured young adult healthy subjects , the results may differ from those of elderly subjects and those suffering from a disease . moreover , while the present study performed two measurements taking into account the time required for measurements in the clinic , the results may be different in an investigation in which measurements are performed three times or more . the relative reliability of isometric shoulder joint muscle strength measurements with an hhd and a belt in young healthy adults was high ; however , as absolute reliability analysis revealed random errors , it was considered appropriate to perform two measurements of isometric shoulder muscle strength and to adopt the larger value of the two .\noutput:\n" }, { "from": "agent", "value": "[ purpose ] the aim of this study was to develop a method of measuring isometric shoulder joint muscle strength using a handheld dynamometer with a belt and investigate its test - retest reliability . [ subjects ] the subjects comprised 40 healthy adults . [ methods ] six types of isometric shoulder muscle strength were measured twice , and reliability was assessed . [ results ] the intraclass correlation coefficient ( 1 , 1 ) values ranged from 0.976 to 0.902 . the result of a bland - altman analysis showed differences in the types of errors between measurement items . [ conclusion ] the relative reliability of isometric shoulder muscle measurement using a handheld dynamometer with a belt was high . however , analysis of absolute reliability revealed errors that may affect interpretation of values ; therefore , it was considered that adapting the greater of two measurement values is appropriate ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a naturally - occurring 2009 pandemic h1n1 virus ( a / australia / 79/2009 ) expressing a 230 aa long ns1 protein has recently been isolated from a human patient . the 11 aa ns1 extension is the result of a change in codon 220 from tga to tgg , thus encoding the swine consensus residue w220 .\noutput:\n" }, { "from": "agent", "value": "the classical swine h1n1 influenza a virus lineage was established after the devastating 1918 human pandemic virus entered domestic pig herds . a descendent of this lineage recently re - emerged in humans as the 2009 pandemic h1n1 virus . adaptation in pigs has led to several changes in the multifunctional viral ns1 protein as compared with the parental 1918 virus , most notably a k217e substitution that abolishes binding to host crk / crkl signalling adapters , and an 11 aa c - terminal truncation . using reverse genetics , we reintroduced both these features into a prototype 2009 h1n1 strain , a / california / 04/09 . restoration of crk / crkl binding or extension of ns1 to 230 aa had no impact on virus replication in human or swine cells . in addition , minimal effects on replication , pathogenicity and transmission were observed in mouse and ferret models . our data suggest that the currently circulating 2009 h1n1 virus is optimized to replicate efficiently without requiring certain ns1 functions ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: collodion baby ( cb ) is an uncommon dermatological condition , and is a common manifestation of various hereditary disorders including harlequin ichthyosis , lamellar ichthyosis ( li ) , nonbullous congenital ichthyosiform erythroderma ( nbcie ) , and trichothiodystrophy metabolic diseases and endocrine diseases . cb is an extremely rare condition with an estimated incidence of one in 50,000 to 100,000 deliveries .1,2 we report a cb that was brought to our department and was diagnosed to have tgm1 gene c. 984 + 1 g a mutation . however , we could not confirm whether the patient had li or nbcie as both these conditions share the same mutation and the infant was later lost to follow - up . although a few cases with this mutation have been reported from around the world ,3,4 this was the first case of its type to be reported from our country . a term , male neonate was delivered by spontaneous vaginal delivery to a primigravida mother with the parents being non - consanguineous . the infant had a birth weight of 3.5 kg ( appropriate for gestational age ) , with length and head circumference being 52 and 34 cm , respectively . the apgar score was normal : 8 / 9/9 at 1 , 5 , and 10 minutes , respectively . within hours of birth , the newborn was referred to our emergency department in view of a parchment - like membrane covering the whole body . a detailed physical examination showed broad , thick scales all over the body with predominance over the chest , abdomen , and upper arms . an excess of scales around the mouth gave the typical fish - like mouth appearance . the infant also had generalized erythema and edema over the body ( figure 1 ) . dermatological opinion was sought and the infant was managed with adequate humidification in a high - humidity incubator ( relative humidity 80 % ) . oral feeds by tube were started at age of 1 day and gradually increased to full feeds by age of 2 days . nutritionist opinion was also taken for adequate calorie supplementation and fortification of the expressed breast milk was done accordingly . breast - feeding was tried on several occasions but was difficult due to the collodion membrane around the mouth . thus , spoon - feeding was continued until the age of 3 weeks , and once the membranes resolved the infant was put on breast - feeding . ophthalmological opinion was taken for eye care and artificial tears were applied to prevent drying of eyes . the infant was closely monitored for signs and symptoms of sepsis in the form of off color , shock , and delayed perfusion . the scales resolved over the next 3 weeks and the infant was discharged in well condition at the age of 4 weeks . a skin - punch biopsy was done at the age of 3 weeks from the abdominal skin . eosin stain revealed markedly thickened stratum corneum with cholesterol clefts and a normal granular layer . geneticist consultation was taken and , in view of financial constraints , gene analysis for only tgm1 gene mutation was sent , it being the commonest cause of cb . targeted gene sequencing was performed on the infant s blood and the dna isolated was used to perform exome capture using custom capture kit . the genetic analysis revealed a homozygous mutation in transglutaminase - 1 ( tgm1 gene p.val330metfsx12 [ c. 984 + 1g a ] ) located on chromosome 14q12 . genetic analysis of the parents was not performed , again due to financial constraints . however , the infant was later lost to follow - up and , thus , we were unable to do long - term follow - up and it could not be ascertained whether the infant had li or nbcie . both these conditions have the same mutation and only long - term skin manifestations can help to differentiation between the two . written informed consent was obtained from parents for the publication of images and the case report . the term collodion baby , also known sometimes as col - lodion foetus , was first used in 1884 to describe the physical appearance of a newborn with a parchment - like membrane covering the whole body .3 collodion membrane is described in literature as a congenital , transient keratinized membrane that is usually secondary to a disorder of cornification .4 it is usually parchment - or cellophane - like , shiny and taut , and wraps over whole of the neonate s body . these babies are usually born prematurely and are often diagnosed at the time of birth .5 the tight collodion membrane around the whole body causes many complications like ectropion ; 6 eclabium ; pseudo - contractures of limbs leading to restricted extension of the digits and extremities ; absence of eyebrows ; and hypoplasia of nasal and auricular cartilage with flattening of the ears and nostrils .7 this membrane also often leads to poor sucking ; restricted pulmonary function ; digital vascular constriction ; 8 distal limb ischemia ; hypohydrosis ; and edema of the extremities .9 infants usually have hypothermia or hyperthermia ; hypohydrosis ; excessive insensible water loss leading to hypernatremic dehydration ; failure to thrive secondary to poor feeding ; and infections , both cutaneous and systemic like candida and bacterial . after birth , the membrane starts drying and breaks down completely as a result of chest expansion . tests for confirmation of diagnosis can only be performed after the membrane has completely shed off .10 cb is the phenotype of many conditions and can be read from many excellent reviews .6,1113 a disease severity score has been developed for newborns with collodion membrane based on the various physical parameters to forecast the outcome and ramifications in these infants .13 there has been a case report of cb secondary to ingestion of drugs like infliximab .14 the biopsy of the skin is nonspecific and shows compact and thickened stratum corneum .15 li ( mim # 242300 ) is a member of the autosomal recessive congenital ichthyosis family that is characterized by disorders of keratinization and is distinguished as a non - syndromic form of ichthyosis . the incidence of occurrence of li has been estimated at one case per 138,000300,000 population . in the recent past , few other syndromes were also included in the autosomal recessive congenital ichthyosis family , like bathing suit ichthyosis , harlequin ichthyosis , astral self - healing , and self - healing cb .16 the bulk of li is caused by mutations in one of various genes , including tgm1 , nipal4 , alox12b , aloxe3 , abca12 , cyp4f22 , pnpla1 ( omim 615024 ) ,17 and cers3 ( omim 615023 ) . tgm1 is located on chromosome 14q11 .2 and has 15 exons ( genbank nm - 000359.2 ) .18 in li , the collodion membrane is normally replaced by thick hyperkeratotic membrane with dark , shell - like adherent scales . the histopathological examination of skin shows cholesterol clefts in the stratum corneum , and absence or thinning of cornified envelope with small keratohyalin granules and lipid droplets . at birth , electron microscopycan be used to differentiate a severe cb affected by li from a baby affected by harlequin ichthyosis by demonstrating the absence of the marginal band .15 there has been a case report of li with rickets , carcinoma of the hypopharynx , and celiac disease ,19 thus demonstrating the importance of regular follow - up .20 nbcie is an autosomal recessive disorder that usually has mild clinical features . it has recently been shown that ncie results because of mutations in alox12b and tgm1 genes resulting in production of abnormal tgm1 . the other parts involved include face , flexural sites , palms , and soles , but ectropion is usually not seen . pediatric patients with ncie disorder have erythema with finer , white scales . these patients also have cutaneous infections with bacteria , yeasts , and dermatophytes . prenatal diagnosis is possible if there is history of ncie in previous pregnancy .21 the prognosis of cb depends on the associated disorders and complications in the neonatal period and the genetic mutation responsible for cb . these patients need regular follow - up and the parents should be counseled for the expected complications .8 management of neonates with collodion usually requires a multidisciplinary approach that includes the parents , supporting staff , neonatologists , dermatologists , and , in some cases , ophthalmologist and otorhinolaryngologist . the primary aim of treatment in cb is to eliminate scaling and to reduce xerosis without causing excessive irritation . prior to deciding on treatment , various factors should be considered such as age and sex of the patient , type and severity of the disease , and the extent and site of the lesions .4 there is a high risk of dehydration and electrolyte imbalances , because of high insensible water loss from the membrane . this requires placement in a high - humidity incubator and close monitoring of body temperature as well as also good nutrition support , both in enteral and parenteral forms .22,23 moisturizers and topical keratolytic agents are usually the first - line therapeutic options in management . the various options available as moisturizers and lubricants include sodium chloride , urea , vitamin e acetate , glycerol , and petroleum jelly . in infants and children with thick scaling andmarked hyperkeratosis , one or more keratolytic agents , such as lactic acid , glycolic acid , salicylic acid , n - acetyl - cysteine , urea ( 5 % ) , or propylene glycol , can be added . surgical correction is reserved for severe cases .24 oral retinoids have keratolytic effects ; they help in elimination of scales and prevent excessive hyperkeratosis . both isotretinoin and aromatic retinoids ( acitretin and etretinate ) have been proved to be effective in treatment . cb is a newborn with a parchment - or cellophane - like membrane covering the whole body surface . the diagnosis of cb requires a detailed family history , skin biopsy , and genetic analysis for confirmation . skin biopsy forms an important tool for diagnosis of the cause of cb and specific biopsy features help in reaching the correct diagnosis . prenatal diagnosis should be offered to parents who have had previous affected children so that antenatal counseling can be done and an option for termination given . these infants need regular follow - up , as they are prone for long - term complications .\noutput:\n" }, { "from": "agent", "value": "collodion baby ( cb ) is normally diagnosed at the time of birth and refers to a newborn infant that is delivered with a lambskin - like membrane encompassing the total body surface . cb is not a specific disease entity , but is a common phenotype in conditions like harlequin ichthyosis , lamellar ichthyosis , nonbullous congenital ichthyosiform erythroderma , and trichothiodystrophy . we report a cb that was brought to our department and later diagnosed to have tgm1 gene c. 984 + 1g > a mutation . however , it could not be ascertained whether the infant had lamellar ichthyosis or congenital ichthyosiform erythroderma ( both having the same mutation ) . the infant was lost to follow - up ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: infective eggs containing larvae are discharged into the environment by nasopharyngeal secretions or coughed up , swallowed , and passed out of the host in the feces . when suitable intermediate host ( herbivorous animal ) , swallows these eggs , the larvae migrate to mesenteric lymph nodes ( mlns ) , liver , lungs , etc . males measure 1.82 cm , while females measure 813 cm in length ( soulsby 1982 ) . humans may be infected with linguatula either by ingestion of nymphs resulting in a condition called nasopharyngeal linguatulosis or halzoun syndrome or by ingestion of infective eggs which develop in internal organs resulting in visceral linguatulosis ( shekarforoush et al . halzoun syndrome may arise via consumption of raw or under - cooked liver and lymph nodes . the syndrome has been reported in many countries including africa , south - east asia and the middle east ( beaver et al . some researchers described clinical signs of the syndrome including pharyngitis , salivation , dysphagia and coughing . visceral linguatulosis generally remains asymptomatic ( khalil and schacher 1965 , yagi et al . 1996 ) . clinical signs associated with infections in intermediate hosts have not yet been described carefully ( mehlhorn 2008 ) . there are reports of linguatulosis in other organs such as eye ( lazo et al . 1999 ) . the prevalence of l. serrata have been studied in various animals in iran , including dogs ( meshgi and asgarian 2003 , oryan et al .2011 ) , goats ( razavi et al . 2004 ) , camels ( shakerian et al .2012 , bamorovat et al . 2013 ) and cattle ( hami et al . 2009 , tajik et al . 2011 ) . the indian crested porcupine ( hystrix indica ) has been distributed in iraq , iran , palestine , syria , lebanon , turkey , southern and eastern states of the former soviet union and indian subcontinent ( arsalan 2008 ) . porcupines consumed storage organs of at least twelve species of geophytes and hemicryptophytes and ate potatoes , peanuts , peppers , fallen fruit , and other agricultural crops ( alkon and saltz 1988 ) . the present study reports the occurrence of l. serrata nymph in h. indica from southwest of iran . during a six month period , september 2012 to march 2013 , the carcasses of two h. indica were transferred to department of pathobiology , school of veterinary medicine , shiraz university , shiraz , iran . one of them was died in september 2012 , when it was crossing the road in bamu national park ( 294020.52 n , 52461.21 e ) , shiraz , iran , and the other carcass was confiscated from unauthorized hunters . mesenteric and mediastinal lymph nodes and liver were collected from each animal , cut into small pieces and massaged in tepid water and left for 30 minutes to allow nymphs to come out from tissue . the livers were sliced in 45 mm thick and observed carefully to find the encapsulated or free nymphs . they were stained with carmine and then mounted in canada balsam as permanent slides measurements of morphological features were made with a light microscope using a calibrated ocular micrometer . samples ( liver , mlns , and mediastinal lymphatic nodes ) were studied separately . in the case of liver , the results were also negative for mediastinal lymphatic nodes of both animals but the mlns were infected with 12 and 8 l. serrata nymphs . based on morphologic characteristics , the parasite was identified as the nymphal stage of l. serrata ( fig . nymphs of l. serrata recovered from mesenteric lymphatic nodes of h. indica , stained with carmine ( a4 , b40 ) the parasites were tongue - shaped , segmented and covered with several spines in linear arrangement . total body length was 523 mm , the body width was 1.21 mm in anterior and 0.250.02 mm in posterior ends . canine are definitive hosts and the herbivores such as sheep , goat , cattle and camel act as intermediate host in life cycle of l. serrata . cats ( esmaeilzadeh et al . 2008 ) , fox ( gicik et al . 2009 ) , dingo , canis lupus dingo , chrysocyon brachyurus , procyon cancrivorus cancrivorus and wolf , canis lupus lupus can also be definitive hosts ( christoffersen and de assis 2013 ) , l. serrata nymphs were found in european porcupine hystrix ( hystrix ) cristata , degu , octodon degus , common hare , lepus ( eulagos ) europaeus europaeus [ as lepus europaeus ] and common rabbit , oryctolagus cuniculus cuniculus [ as lepus cuniculus ] . it has been found commonly in cottontail rabbits ( sylvilagus floridanus ) in the usa ( moore and moore 1947 ) . linguatula sp . is maintained in australia by a fox - rabbit cycle since foxes , not dogs , have been found infested ( pullar 1946 ) . our study revealed that h. indica can be regarded as another intermediate host for this parasite and a sylvatic cycle between porcupine and carnivores may exist in fars province . the prevalence rate of nymphal stages was studied by many researchers in variety of hosts . ( 2004 ) reported a prevalence of 11.5 % and 3 % in the mesenteric lymph nodes and liver of sheep , respectively and razavi et al . ( 2004 ) recorded 29 % infection in the mesenteric lymph nodes and 6 % in the livers of goats in shiraz area , fars province , southern iran . prevalence rates of nymphal linguatulosis in one - humped camels were reported 12.9 % in yazd ( oryan et al . 2011 ) , 64 % in tehran ( rajabloo et al . 2011 ) , 20.5 % in rafsanjan ( bamorovat et al . ( rezaei et al . 2012 ) , 21.0 % , 4.5 % in mlns and liver respectively , in najaf - abad ( shakerian et al . 2008 ) . it has also been reported from two - humped camel ( camelus bactrinus ) in tabriz , iran ( haddadzadeh et al . 2009 ) . the prevalence rates in sheep were 16.1 % in kerman ( razavi et al . 2004 ) and 11.5 % and 3 % in mlns and liver , respectively , in shiraz ( shekarforoush et al . 2004 ) . in goat , the prevalence rates were reported 29.9 % and 6.4 % in mlns and liver , respectively in shiraz ( razavi et al . 2004 ) and in cattle , 44 % in urmia and 0.25 % in tabriz ( hami et al . 2009 ) . halzoun syndrome was reported from shiraz ( sajjadi et al . 1998 ) , tehran ( maleki 2001 , anaraki mohammadi et al . 2008 ) and isfahan ( tabibian 2012 ) . all of these reports showed the high rate of infection in both definitive and intermediate hosts in various parts of iran and it is not unexpected to consider a canine - porcupine sylvatic cycle in this region .2011 ) , morocco ( le corroller and pierre 1959 ) and turkey ( ylmaz et al . it fed from potatoes , peanuts , peppers , fallen fruit , and other agricultural crops and classified as an herbivore rodent ( alkon and saltz 1988 , arsalan 2008 ) . infection of mlns suggests a similar migration and life cycle of the parasite in this animal . with our knowledgethere is no report about nymphal linguatulosis in indian crested porcupine species but it has been reported from lungs of european porcupine hystrix ( hystrix ) cristata ( linnaeus 1758 ) . one part of the porcupine is always a delicacy the liver , which is easily removed by making a cut just under the neck into which the hand is thrust , and the liver pulled out . it may be fried with bacon , or baked slowly and carefully in the baker - pan with slices of bacon ( kephart 2001 ) . many locals relish the porcupine 's meat ( al nees ) as a delicacy and for medicinal purposes . perhaps this is responsible for the decline of h. indica population throughout jordan ( amr et al . consumption of histrix meat and viscera has been observed among native people for medicinal purposes in south and west of iran ( personal observation ) . ( 2008 ) reported a prevalence of 76.5 % in stray dogs in shiraz , southwest of iran . the prevalence of adult stage has also been reported 27.83 % in north west ( rezaei et al .2011 ) and 62.2 % in central part of iran ( meshgi and asgarian 2003 ) . stray dogs and other wild canines can hunt porcupine and this animal can be a part of their diets . our study revealed that porcupine can act as an intermediate host for sylvatic cycle of the parasite in this area . further investigations are needed to be carried out to clarify the exact role of canine and other wild rodents in the life cycle of l. serrate . in conclusion , our results and high prevalence of linguatulosis in both definitive and intermediate host in fars province showed that sylvatic cycle should be considered as a risk factor for human beings and other hosts .\noutput:\n" }, { "from": "agent", "value": "linguatula serrata is one of the important zoonotic parasites . carnivores serve as definitive host . the larvae existed in mesenteric lymph nodes ( mlns ) , liver , lungs , etc of intermediate herbivores . the definitive host becomes infected by ingesting viscera containing the infective nymphal stage . humans may be infected with linguatula either by ingestion of nymphs resulting in a condition called nasopharyngeal linguatulosis or halzoun syndrome or by ingestion of infective eggs which develop in internal organs resulting in visceral linguatulosis . indian crested porcupine ( hystrix indica ) is a common rodent in middle east . based on some tradition , consumption of histrix meat and viscera is common in some parts of iran . the present study reports the occurrence of linguatula serrata nymph in h. indica as a new intermediate host from southwest of iran ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: coronary artery ectasia ( cae ) is a rare angiographical finding , with an estimated prevalence of 1 % 5 % of all invasive coronary angiograms .1 cae is a dilatation of coronary arteries . it is defined angiographically as having a pathological segment with a diameter of at least 1.5 times greater than that of the intact adjacent segment ; when the disease is spread so that no intact segment is present , qualitative visual estimate is used for diagnosis .1,2 according to its etiology , cae is classified as congenital or acquired , and the acquired form is subdivided into atherosclerotic or isolated ( not directly related to atherosclerosis ) forms .2 of note , cae is usually encountered as an incidental finding in the setting of coronary angiography . we report a case of a 55 - year - old male patient with no relevant medical history presenting with exertional chest pain . physical examination was unremarkable and cardiac echogram was normal , namely , there was no regional wall motion abnormalities and no left ventricular hypertrophy . surface electrocardiogram ( ekg ) showed sinus bradycardia at nearly 50 bpm with st / t changes in anterolateral leads , and a stress test yielded typical chest pain with significant st depression in lateral leads ( fig . moreover , there was a delayed and disproportional heart rate acceleration compared with the exercise load , suggesting chronotropic incompetence .2 ) showed extensive cae with delayed sluggish flow and complete filling of distal territories , stasis , poor collaterals , and without significant stenosis . no other patent cause of cardiac ischemia ( ie , myocardial bridge , abnormal coronary anatomy , etc . ) was encountered on the coronary angiogram . of note , the sinus node artery was not clearly visualized , and if present it was considered rudimentary ; also , no coronary intraluminal thrombus was visible . the patient was managed with medical therapy consisting of antiplatelets , angiotensin - converting enzyme inhibitor , and a slow dose of beta - blocker with intrinsic sympathomimetic activity ( acebutolol ) in order to avoid exacerbating the bradycardia . the exact mechanisms that cause abnormal dilatation of the coronary arteries are still poorly understood , and many factors are involved in the pathophysiology of cae , including molecular , cellular , and tissular factors . enzymatic degradation of the extracellular matrix of the media is a major pathophysiologic process that leads to cae .2,3 though various hypotheses have been put forward , the most accredited hypothesis recognizes that uncontrolled activity of metalloproteinases is a major causal factor .2 inflammation , tissue remodeling , and upregulation of matrix metalloproteinases are key factors in the pathogenesis of cae . the inflammatory component is represented by elevated levels of different inflammatory markers .2 the inflammatory process , along with the upregulation of metalloproteinases , leads to destruction of the vascular media , as smooth muscles are replaced by hyalinized collagen , with subsequent attenuation of the vascular wall and dilation .2 an increased incidence of atherosclerotic coronary artery disease in patients with cae has been reported1 ; however , many phenomena other than atherosclerotic coronary stenosis may be involved in cardiac ischemia in cae , including formation of thrombus , slow flow , poor collateral circulation , microcirculatory dysfunction , lack of adequate exertional vasodilatation , and endothelial dysfunction .2,4 in the presented case , although there was no evidence of significant atherosclerotic stenosis , the patient s stress test was positive . the involvement of each of the above - cited factors in cardiac ischemia could not be assessed in the presented patient ; however , coronary angiogram showed a poor collateral circulation . in view of this , we conclude that the above - cited processes are likely mechanistic factors in the genesis of cardiac ischemia rather than simple epiphenomena of cae . in the presented patient , the etiology of cae is not definite and we estimate that it belongs to the isolated idiopathic subtype .2 the absence of coronary artery stenosis is an argument against the atherosclerotic acquired form ; the absence of familial history of cae is an argument against the congenital form ; a normal crp is an argument against the acquired inflammatory type . however , an extensive etiological workup was not completed , as stated in the limitations section below . the presence of sinus node dysfunction , potentially consecutive to cae , was the second trouble encountered in this patient , manifested as baseline relative bradycardia and chronotropic incompetence during the stress test . the age of the patient was not in agreement with a primary sinus node disease , and he was also not an athletic nor taking any medication that blocks the sinus node . the sinus node artery arises from the proximal right coronary artery in more than 60 % of cases and from the left coronary artery in less than 40 % of cases .5 the presence of rudimentary sinus node artery in the setting of poor collaterals in cae is recognized as a potential cause of sinus node dysfunction .6 accordingly , we estimate that our patient s secondary sinus node dysfunction is a mechanistic association with cae . management of cae is mostly medical , consisting of antiplatelet therapy , beta - blockers , angiotensin - converting enzyme inhibitors , statins , and dihydropyridine calcium channel blockers .2 in severe cases and / or when complications may occur ( severe coronary aneurysm , thrombus , and coronary stenosis ) , anticoagulant therapy is needed , and percutaneous intervention ( thromboaspiration ) or even coronary artery surgery may also be required .2 cae is an incidental finding in most cases , given its asymptomatic character . in the presented case , cae is manifested as angina and fatigue , consecutive to cardiac ischemia and sinus node dysfunction , respectively . moreover , the presence of cardiac ischemia and secondary sinus node dysfunction was consecutive to cae , and therefore we estimate that the association is causal rather than epiphenomenal in this context . though the most likely etiology , according to the available data , is isolated form , an extensive etiological workup regarding the possible etiology of cae in this patient was not performed . moreover , a 24 - hour holter monitoring , along with heart rate variability measurement , would have provided more evidence in favor of sinus node dysfunction .\noutput:\n" }, { "from": "agent", "value": "coronary artery ectasia is a rare angiographical finding , and it accounts for less than 5 % of all coronary angiograms . we report a case of a 55 - year - old male patient who presented with fatigue and exertional chest pain . paraclinical tests revealed cardiac ischemia and sinus node dysfunction , as well as coronary artery ectasia without significant coronary stenosis . factors involved in cardiac ischemia in this context comprise slow flow , poor collateral circulation , microcirculatory dysfunction , lack of adequate exertional coronary vasodilatation , and endothelial dysfunction . moreover , poor collaterals with rudimentary sinus node artery may explain sinus node dysfunction . discussion is made in light of the relevant medical literature ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: kawasaki disease ( kd ) was named as acute febrile mucocutaneous lymph node syndrome or infantile polyarteritis , and first reported by dr . the disease causes severe inflammation and necrosis of all blood vessels , in particular , invading medium - sized artery with a marked tendency affecting the coronary arteries . this vasculitis results in exudative change with infiltration of lymphocytes and large mononuclear cells into the media and adventitia of the vessels with endothelial necrosis ( 2 ) . moreover , these problems of vessels manifest not only in heart but also in many other systemic organs . therefore , kd is a multi - systemic disease and unusual symptoms may be part of the systemic illness ( 3 ) . gastrointestinal involvement due to kd is not common , and its prevalence is 2.3 % ( 4 , 5 ) . the gastrointestinal symptoms have importance , because these throw into confusion to make a diagnosis of kd in case there are not enough characteristic diagnostic criteria for kd in acute febrile phase . we report a child - not diagnosed as kd on admission - who suffered from abdominal pain and showed improvement in all clinical manifestations including abdominal pain only after intravenous immunoglobulin was administered . a 5 - yr - old boy was admitted with a complaint of severe abdominal pain of three days ' duration that had spontaneously occurred without a noticeable cause . at the time of admission , he had no other symptoms than abdominal pain and vomiting . his initial body temperature was checked at 38 with a slight fever that could be noticed until admission , with a pulse rate of 124 beats per minute and respiration at the rate of 30 per minute . on physical examination , he appeared acutely ill , and skin rash , conjunctival injection and cervical lymphadenopathy were not seen . direct tenderness was so diffuse and severe , especially on the lower abdomen , that it was difficult to differentiate from the surgical abdomen . initial laboratory examinations revealed white blood cell count of 13,790 / l with predominance of neutrophil 86.5 % , red blood cell count of 4,390,000 / l , hemoglobin level of 12.4 g / dl , hematocrit of 35.6 % , and platelet count of 229,000 / l . aspartate aminotransferase ( ast ) and alanine aminotransferase ( alt ) levels , urea , creatinine level and electrolytes were all within normal limits . erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp ) were elevated at 40 mm / hr ( normal range , 0 - 10 mm / hr ) and 15.85 mg / dl ( normal range , 0 - 0.8 mg / dl ) , respectively . he presented with atypically erythematous and maculopapular skin rash of irregular shapes and sizes just after admission . he continued to complain of abdominal pain with vomiting , without any improvement over two days . it showed multiple variable lymph nodes in the right lower quadrant of the abdomen . on day 3 , he revealed erythema and swelling of the hands and feet , and strawberry tongue . secondary follow - up laboratory findings on day 4 showed slightly more elevated esr and crp , 50 mm / hr and 19.46 mg / dl , respectively . high spiking fever was prolonged remittently for five consecutive days and unresponsive to antibiotics . at this time , we came to make a presumed diagnosis of kd . subsequent abdominal computed tomographic scan showed circumferential enhanced wall thickening and edema in the distal descending and sigmoid colon and normal rectum ( fig . we noted that his lips changed red on day 6 , and that bilateral conjunctivas were injected without exudate . a right cervical lymph node was enlarged with a size of greater than 1.5 cm in diameter on day 7 . on the basis of these characteristic features that corresponded to the diagnostic clinical criteriatherefore , we perceived that gastrointestinal complications might be closely related to a vasculitis by kd . we intended to perform colonoscopy , but it could not be done because of his parents ' refusal . echocardiography performed on day 8 revealed minimal pericardial effusion and mild tricuspid regurgitation , and no dilatation of coronary arteries . abdominal pain andhe was treated with high - dose intravenous immunoglobulin , 2 g / kg in a single infusion , together with 50 mg / kg per day of oral aspirin on day 8 after admission . not only did his fever begin to subside , but abdominal pain also diminished dramatically the day after ivig administration . on the third day after the treatment , laboratory findings showed a slightly more elevated platelet count , 507,000 / l and a remarkable fall of the crp levels at 1.29 mg / dl . no infectious foci were found . a rapid resolution of all the clinical features was noted . on follow - up abdominal ultrasonogrphy performed on day 11 , we found that bowel wall thickening was almost all decreased , and the hepatobiliary system was unremarkable . on day 12 , he was discharged with reduced dosage of aspirin , 5 mg / kg per day as a single dose . about four weeks after discharge , desquamation was noticed on the fingers and the perianal area , but the patient was clinically free of abdominal symptoms . kd is a febrile systemic vasculitis of unknown cause usually affecting children younger than 5 yr of age . the etiology and pathophysiology of kd , despite numerous efforts to identify for 40 yr period , are still in a hypothetical stage . according to the consensus view , kd results from widely distributed infectious agents which evoke an abnormal immunological response in genetically susceptible individuals ( 6 , 7 ) . the results of recent immunologic , microbiologic and molecular studies show that superantigen - producing agents have been given attention with respect to the etiology of kd ( 4 ) . the diagnosis of kd can be made by fulfilling 5 characteristic diagnostic criteria ( prolonged fever for at least 5 days together with four of a collection of five clinical features , including rash , non - purulent conjunctivitis , oropharyngeal changes , lymphadenopathy and change of the extremities ) in the absence of any specific diagnostic tests . as approximately 20 - 25 % of the untreated patients in kd have cardiac involvement , the delayed diagnosis could result in life - threatening problems particularly including cardiac sequelae . it demonstrates the importance of the early diagnosis of kd . among the clinical manifestations of kd , fever and skin rash are most common , while changes of the lips and oral cavity , cervical lymphadenopathy or bilateral conjunctivitis are less than the ones . ( 8 ) studied 100 patients with kd through classification by symptoms . according to the study , in addition , there are such as joint pain and tenderness , preceding upper respiratory tract infection , pneumonia , and hydrops of the gall bladder . up to date , there have been consistently numerous reports showing that various complications arise in other organs as well . regarding complications of kd according to the system , the most common and life - threatening complication of kd , coronary artery aneurysm , occurs in about 25 % of untreated patients which may lead to death by causing coronary thrombosis or myocardial infarction . there are also non - aneurysmal cardiac complications such as dilatation of coronary artery , pericardial effusion , pericarditis , myocarditis , and mitral incompetence . we described a child who complained of severe abdominal pain on admission of which the cause was difficult to be explained until the sequential appearance of the clinical diagnostic manifestations of kd enabled us to make a definite diagnosis . based on the diagnosis of kd , we performed abdominal evaluations and could ultimately clarify that the abdominal pain was associated with gastrointestinal complication of kd . elevated liver enzyme levels and gall bladder hydrops are well - known findings , and splenic infarct , pancreatitis and ascites occur less frequently . jejunal stricture and obstruction , intussusception , intestinal pseudo - obstruction , ischemic colitis , bowel edema , hemorrhagic enteritis , and so on have presented as complications related with the intestinal tract . these complications result from vasculitis and thrombosis of the small submucosal arteries involving the intestine . submucosal hemorrhage has been also described as a causing factor of the complications through numerous cases . ( 9 ) reported that surgical abdominal complications were found in 12 patients with kd . among them , gallbladder hydrops with cholestasis has been described in three cases , small intestinal occlusion in four , functional obstruction caused by paralytic ileus in three , ischemic colitis in one , and abdominal vasculitis with massive liver necrosis in one . in most of current reports , the diagnosis of kd was usually made 4 to 6 weeks after the onset of abdominal symptoms ( 10 , 11 ) . however , in this case , we could make the diagnosis of kd 10 days after the onset of abdominal pain . compared with other previous reports , this is a case where the diagnostic signs of kd revealed a little earlier . kd complicated by colonic edema as this case has rarely been reported all over the world . kd with colonic edema is explained in the view that kd is associated with inflammatory changes and vasculitis involving bowel vessels . more severe cases might produce nodular area or cause obstruction that could not help requiring surgical treatment . descending and sigmoid colon were involved in this case , but there have been no studies or reports about the most common area where colonic wall edema occurs . with respect to the relationship between abdominal symptoms and kd , as an interesting study , a hypothesis has been reported that the gastrointestinal tract could be one of the primary sites of entry of bacterial toxins in kd patients which affect immune system acting as superantigens . therefore , we perceive the relationship between gastrointestinal symptoms and kd in that while kd give rise to complications in gastrointestinal tract , bacterial toxins affect the onset of kd by developing bacterial infection into gastrointestinal tract ( 12 ) . furthermore , as in this case , some complications precede diagnostic clinical features in the acute phase , which might lead us to have a difficulty in making an earlier diagnosis . since no diagnostic tests are available for kd , the diagnosis is absolutely based on clinical criteria . although the numerous efforts to improve the early diagnosis have been made , kd remains a disease at risk to be underrecognized or misdiagnosed with other febrile illnesses . we should recognize that the diagnosis and treatment of kd might be delayed if symptoms triggered by organic complications appear before the characteristic clinical features of kd .\noutput:\n" }, { "from": "agent", "value": "kawasaki disease ( kd ) is recognized as a systemic vasculitis affecting multi - organ with inflammatory changes . the commonest and most serious complication of kd is coronary artery aneurysm , but kd may cause other organic complications beside cardiac problems . gastrointestinal tract also present complications of kd in which , for example , hepatic dysfunction , pancreatitis , intussusception , colonic obstruction , intestinal pseudo - obstruction , and bowel edema are included . among them , colonal wall edema is left unknown in the incidence , and it has been reported even if rare . in this report , we describe a case of kd with colonal wall edema , occurred in 5 - yr - old boy who complained of severe abdominal pain and vomiting ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a previously healthy 13 - year - old boy presented to an outside institution with two months of pain that started in the posterior of his left leg and slowly progressed until the pain encompassed the entire pelvis . he had intermittent fevers with maximum temperature of 102 f. a white blood cell count at initial presentation was 12.410 / l and an mri demonstrated a partial tendon tear with strain in the left obturator adductor , minimus and magnus with no bone involvement . a diagnosis of a torn tendon was made and treatment with non - steroidal anti - inflammatory medications was initiated . c - reactive protein and erythrocyte sedimentation rate were elevated at 13.6 mg / l and 113 mm / hour one month into treatment . computerized tomography ( ct ) scan of the abdomen and pelvis with oral and intravenous contrast was negative and a tagged white blood cell scan at six weeks was also negative . two months after the initial presentation , the patient was hospitalized for continued pain and a 20 - lb weight loss . on admission , exam of the head , neck , chest and abdomen revealed no abnormalities . musculoskeletal exam showed decreased flexion at the right knee with moderately decreased internal rotation of the right hip . bone scintigraphy showed increased blood flow , blood pool and delayed radiotracer uptake primarily involving the right ischium and posterior aspect of the right inferior pubic ramus . mri demonstrated extensive signal abnormality and post - contrast enhancement of bilateral ischiopubic and adjacent soft tissue structures with a small peripherally - enhancing fluid collection medial and posterior to the right ischial tuberosity . ct - guided aspirate revealed purulent material and the biopsy was consistent with an acute osteomyelitis . culture from the aspirate grew pseudomonas aeruginosa and the patient was treated with levofloxacin and gentamicin . although the patient had improved significantly , there was continued pain at the 6 - week follow - up visit so the levofloxacin was continued to complete a 6 month course . at the 6 - monthsosteomyelitis of the pelvis is a rare entity in children with an estimated incidence of 111 % of all hematgoenous osteomyelitis . it is difficult to diagnose because of the rarity of infection and difficulty localizing the site of infection . common misdiagnoses include septic arthritis or synovitis of the hip , appendicitis , cellulitis , pelvic inflammatory disease and nephrolithiasis . there is a general delay in diagnosis with mean duration of illness prior to diagnosis of 11 days . pelvic osteomyelitis occurs more frequently in older children ( mean age 8.7 years ) , affects males slightly more and is less likely to present after antecedent trauma . it usually occurs in a single bone with the ilium being the most affected site . other symptoms include limp or inability to bear weight on affected side . in children non - specific complaints such as anorexia and weight lossthe most common clinical findings are tenderness , fever , inability to bear weight , antalgic gait and decreased hip range of motion , although this is less sever than in children with septic arthritis . common laboratory findings include an elevated esr and crp as well as an elevated white blood cell count , however , the diagnosis should not be excluded based on normal laboratory values . the most frequently recovered organisms are staphylococcus aureus with up to 50 % of cultures being negative . other organisms infrequently found were h. parainfluenzae , salmonella , group a streptococcus , e. cloacae , p. aeruginosa , and k. kingae . bone scans are frequently positive earlier in the course of pelvic osteomyelitis as compared with radiographs , however , a negative bone scan does not exclude the diagnosis . mri may be the most sensitive and specific diagnostic test with sensitivity reported between 82100 % and specificity between 7596 % . it is also useful in determining the extent of infection and distinguishing between soft tissue infection and bony involvement . ultrasound may be a non - invasive initial test that can be used to diagnose pelvic osteomyelitis as long as the clinician suspects the diagnosis . in one small study , the overall sensitivity and specificity of ultrasound was 86 % and 100 % respectively . however , ultrasound is only helpful if the study is specifically directed to look at the deep soft - tissues of the pelvis . surgical drainage and debridement may be necessary depending on extent of disease , response to antibiotic therapy and possible development of an extra - osseous abscess but due to the substantial blood flow to the pelvic bones , antibiotics are generally sufficient in treating pelvic osteomyelitis . other complications that have been reported include fusion of the sacroiliac joint and deep vein thrombosis in a protein - c - deficient patient . persistent infection due to chronic osteomyelitis or chronic recurrent multifocal osteomyelitis generally resolves with long - term antibiotics . follow up should be long enough to identify complications such as growth abnormalities and chronic recurrent infections . long - term prognosis is generally good provided prompt and adequate duration of antibiotic therapy . in conclusion , pelvic osteomyelitis is a rare condition in children . however , clinicians should suspect this diagnosis especially in a school - aged child who presents with fever , pain , limp , and / or inability to bear weight ( table 1 ) . if the diagnosis is suspected , the initial non - invasive test to consider is a bone scan . most patients with acute disease improve with no complications after 46 weeks of antibiotic therapy . adequate follow - up is needed to ensure that the patient remains free of long - term sequelae . table 1summary of published pediatric pelvic osteomyelitis cases series.review , ndemographicspresentationtreatmentpathogenoutcomeskumar , 2010 , n = 23male 65 % mean age na range 1m - 13y9mlimp 100 % fever 65 % debridement 30 % iv abx 100 % mean 18.7 d then po abx for 1 - 12 wksblood cx : negative 70 % mssa 22 % mrsa 4 % salmonella 4 % naklein , 2007 , n = 31male 61 % mean age 8y11mrange 1.5m - 17y9mpain 90 % fever 71 % limp 29 % weight loss / anorexia 3 % iv abx 97 % ( 4 - 6 wks ) po abx 3 % ( 4 wks ) blood cx : negative 59 % mssa 33 % mrsa 4 % k . aeruginosa 5 % salmonella 5 % complete resolution 97 % avascular necrosis of femoral head 3 % weber - chrysochoou , 2007 , n = 19male 72 % mean age 8.0 y range 9 m - 15y7mlimp 100 % fever84 % hx of trauma 58 % local swelling / erythema 21 % abx 100 % blood cx : s. aureus 41 % tissue cx : s. aureus 42 % s. pneumoniae 8 % complete resolution 100 % davidson , 2003 , n = 64male 63 % mean age 11 y6 m range 1y2m - 17y6mpain 95 % limp 48 % fever47 % hx of trauma 20 % iv abx 97 % ( avg 4 wks ) i / d 8 % source unspecified negative 50 % s. aureus 41 % s. pneumoniae 3 % h. parainfluenzae 2 % salmonella 2 % gas 2 % polymicrobial 2 % complete resolution 97 % persistent infection 3 % other complications 5 % zvulunov , 2003 , n = 146male 75 % mean age 8.1 y range nahx of trauma 17 % nablood cx : s. aureus 47 % s. pneumoniae 2 % hib 1 % gas 1 % tissue cx : s. aureus 47 % s. pneumoniae 2 % hib 1 % gas 1 % salmonella 6 % gram - negative bacteria 3 % m. tuberculosis 1 % micrococci 1 % recurrent osteomyelitis 2 % permanent deformity 1 % hammond , 2001 , n = 16male88 % hx of trauma 31 % iv abx 94 % ( 3 - 7 wks ) iv abx + i / d 6 % blood cx : negative 18 % s. aureus 36 % gas 27 % s. pneumoniae 9 % fusobacterium 9 % complete resolution 100 % totals , n = 299males 206 ( 69 % ) limp 112 ( 73 % ) fever 81 ( 53 % ) trauma 51 ( 21 % ) resolution 268 ( 97 % ) y , years ; m , months ; hx , history ; iv , intravenous ; abx , antibiotics ; wks , weeks ; d , days ; cx , culture ; mrsa , methicillin - resistant staph aureus ; mssa , methicillin - sensitive staph aureus ; na , not applicable ; hib , h. influenzae type b ; gas , group a streptococcus . y , years ; m , months ; hx , history ; iv , intravenous ; abx , antibiotics ; wks , weeks ; d , days ; cx , culture ; mrsa , methicillin - resistant staph aureus ; mssa , methicillin - sensitive staph aureus ; na , not applicable ; hib , h. influenzae type b ; gas , group a streptococcus .\noutput:\n" }, { "from": "agent", "value": "pediatric pelvic osteomyelitis is a rare entity . the diagnosis is frequently delayed due to difficulty in confirming the diagnosis . to our knowledge , this is the first case report of pseudomonas pelvic osteomyelitis in a previously healthy adolescent boy . the diagnosis was made radiographically and confirmed by culture . the patient was treated with levofloxacin and gentamicin resulting in a complete recovery ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: for the control of diverse signaling in response to the extracellular milieu , cells develop sophisticated tools to transmit the appropriate signals and thereby orchestrate the responses . the signaling mechanism of an agent involves effector - receptor coupling , production of second messengers , activation of protein kinases , and distribution of these transducers to specific intracellular targets . mitogen - activated protein kinases ( mapks ) are the serine / threonine kinase family of conserved enzymes that are considered to be the central building blocks in the intracellular signaling networks . there are more than a dozen of mapks known in mammals , and these enzymes exist in several isoforms ( table 1 ) . mammals express four distinctly regulated groups of mapks , that is , extracellular signal - regulated kinase 1/2 ( erk1 / 2 ) , p38 , c - jun n - terminal kinases / stress - activated protein kinases ( jnk / sapks ) , and erk5 / big mapk ( bmk1 ) . each of these four mapk cascades consist of at least three tiers of protein kinases that are consecutively activated by phosphorylation events : mapk kinase kinase ( mapkkk or map3k or mekk ) activates mapk kinase ( mapkk ( mkk or mek ) or map2k ) , which in turn activates mapk . the latter phosphorylates a large array of substrates , including mapk - activating protein kinases ( mapkapks ) . even so , the different tiers are composed of many similar isoforms that can be activated by more than one mapk , increasing the complexity and diversity of mapk signaling . substrates , regulation , and function of different mapks have been discussed in many review articles , and will not be elaborated upon in great detail here . mapks are important signal transducing enzymes that are involved in transmitting signals from a wide variety of extracellular stimuli including those of growth factors , hormones , cytokines , and neurotransmitters . in fact , mapks are major components of signaling pathways regulating a large array of intracellular events , such as proliferation , differentiation , development , acute signaling in response to hormones , stress response , programmed cell death , gene expression , and steroidogenesis . noteworthy , however , the role of the mapk signaling pathways in steroidogenesis is poorly understood as a consequence of conflicting reports demonstrating stimulation , inhibition , or no effect in different steroidogenic cells . the steroidogenic acute regulatory protein ( star ) mediates the rate - limiting and regulated step in steroid hormone biosynthesis , that is , the transfer of the substrate for all steroid hormones , cholesterol , from the outer to the inner mitochondrial membrane . as such , this protein plays a crucial role in the regulation of steroid hormones required for life itself , in the case of adrenal steroids , and for maintaining normal reproductive function , in the case of gonadal steroids . star is a rapidly synthesized , labile phosphoprotein , whose expression , activation and extinction are regulated by pka , pkc , and a host of other signaling pathways ( reviewed in ) . the star protein is localized to the mitochondria and consists of several forms of a newly synthesized 30 - kda protein , which has a 37 kda precursor form containing an n - terminal mitochondrial targeting sequence . star is primarily associated with steroid producing tissues , and studies have demonstrated a tight correlation between the synthesis of star proteins and the synthesis of steroids . the compelling evidence for the critical role star in the regulation of steroidogenesis has been illustrated by the targeted disruption of the star gene and by the study of patients suffering from lipoid congenital adrenal hyperplasia , in which both adrenal and gonadal steroid biosyntheses are severely impaired due to mutations in the star gene . in the adrenal and gonads , camp mediated mechanisms predominantly regulate expression of the star protein and steroid synthesis that involve transcriptional and translational induction . conversely , transcriptional and / or translational inhibition of star expression results in a dramatic decrease in steroid biosynthesis , with the exception of approximately 10 % 15 % of steroid production that appears to occur through star - independent events . it should be noted that phosphorylation of star is required to produce optimal cholesterol transferring ability of the star protein in steroid biosynthesis . two putative pka phosphorylation sites at serine 56/57 and serine194 / 195 have been identified , in murine and human star respectively , and mutations in these sites demonstrated the functional importance of the latter in the biological activity of star . while the camp / pka pathway is unquestionably the major signaling pathway for trophic hormone - stimulated star expression and steroid biosynthesis , it has been well established that the mapk signaling cascades play important roles in regulating these processes . the purpose of this paper is to summarize the findings of a number of laboratories , including our own , that have examined the roles of four distinct mammalian mapk cascades in regulating steroidogenesis , and where evidence exists , on star expression , in steroidogenic cells . the mapk signaling cascade involves activations of several transmembrane signaling molecules , cytoplasmic protein kinases , and a network of interacting proteins , and these , in turn , regulate almost all cellular processes , from gene expression to cell death . each of these cascades consists of several tiers of protein kinases that sequentially activate each other upon phosphorylation . activation of each of the mapk pathways is mediated by small gtp - binding proteins ( e.g. , ras , rap , or other oncoproteins ) , or by scaffold proteins or by adaptor molecules . these events allow the transmission of extracellular signals to appropriate intracellular targets either directly or through three - tiered kinase modules . mapks are activated by phosphorylation cascades that contain at least two upstream protein kinases . in all mapk cascades , the kinase immediately upstreaming of the map kinase is a member of the map / erk kinase ( mek or mkk ) family . these are dual - specificity enzymes that are capable of phosphorylating serine / threonine and tyrosine residues in their map kinase substrates in order to activate the protein 's activity . the meks are also activated by phosphorylation on serine or threonine residues in their activation loops . there are several and diverse mek kinases ( mekks ) that activate meks . in contrast , the activity of mapks is negatively regulated by mapk phosphatases , a group of dual - specificity phosphatases that remove phosphate from serine / threonine or tyrosine residues and thereby inactivate mapks for controlling signals . the mapk signaling pathway has long been implicated in the regulation of cell cycle progression , is used as a biochemical marker in evaluating the mitogenic effects of a variety of stimuli , and is a point of convergence for diverse signaling pathways . in mammals , four distinct mapk cascades ( erk1 / 2 , p38 , jnk / sapk , and erk5 / bmk1 ) are primarily activated by specific mapkks , that is , mek1 and mek2 for erk1 / 2 , mkk3 / 6 for p38 , mkk4 / 7 for jnk / sapk , and mek5 for erk5 / bmk1 . nevertheless , each mapkk can be induced by many mapkkks , and presumably each mapkkk confers responsiveness to discrete signals . the differential expression , activation , and substrate specificity of these mapks suggest their varying physiological functions in different cellular contexts . a substantial body of evidence indicates that mapk signaling cascades are activated by a large number of extracellular signals and play pivotal roles in regulating the steroidogenic response . as such , a variety of exogenous stimuli ( e.g. , hormones , growth factors , and cytokines ) that influence different mapk cascades exhibit diverse effects on star expression and steroidogenesis in different steroidogenic cell models ( figure 1 ; ) . the erk1 / 2 signaling cascade is the most widely studied member of the mapks . erk1 ( p44 mapk ) and erk2 ( p42 mapk ) are highly conserved throughout eukaryotic cells and bring together transmembrane receptors and a network of various proteins and integrating signals to control many cellular processes , including cell survival , differentiation , tumor progression , and invasion . there are also alternatively spliced forms of erks , namely , erk1b ( 46 kda ) , erk1c ( 42 kda ) , and erk2b ( 41 kda ) . both erk1 and erk2 are activated by numerous extracellular stimuli , including growth factors , cytokines , transforming agents , and ligands that act via g protein - coupled receptors ( gpcrs ) and tyrosine kinase receptors . the two phosphoacceptor sites , tyrosine and threonine , in the activation loop ( tey ) are phosphorylated in order to activate the erk1 / 2 signaling cascade , which occurs exclusively through mek1 and mek2 . erks also phosphorylate several substrates ( e.g. , ribosomal s6 kinase ( rsk ) , the mapk / sapk - activated kinase ( msk ) ) either in the cytosol ( e.g. , pla2 ) or in the nucleus ( e.g. , elk1 ) . however , this activation requires adaptor proteins that are linked to the guanine exchange factors ( gefs ) of gtp - binding proteins . following stimulation , recruitment of the adaptor protein - gef complex to the plasma membrane results in the induction of ras or related molecules , which then transmit signals to the map3k level of the cascade ( raf - 1 , b - raf , a - raf , tlp - 2 , and mekk1 ) . generally , the three - tiered system of the erk1 / 2 signaling cascade is rather complex and involves many mekks that are capable of phosphorylating a number of meks and thereby activating several map kinases and have been discussed elsewhere . this signaling pathway is involved in regulating star expression and steroid biosynthesis , but several seeming contradictions have been reported in different steroidogenic tissues . for example , it has been demonstrated that activation of erk1 / 2 by hcg increases star expression and testosterone production while inhibition of erk1 / 2 by u0126 results in decreases in these parameters in hcg - stimulated primary cultures of immature rat leydig cells . in contrast , erk1 / 2 inhibition enhances star expression as induced by lh , insulin - like growth factor - 1 ( igf - 1 ) , transforming growth factor - , and interleukin - 1 ( il - 1 ) but decreases steroid levels . it has been reported that steroid biosynthesis induced by hcg and fibroblast growth factor - 9 ( fgf - 9 ) is mediated through the involvement of ras - mapk and pka signaling in mouse leydig cells . we have demonstrated that the erk1 / 2 signaling cascade plays key roles in pka - mediated ( activated by ( bu ) 2camp and hcg ) - and pkc - mediated ( activated by pma ) regulation of steroidogenesis . all these agents activate erk1 / 2 ; however , they have diverse effects on star expression and steroid synthesis in conjunction with erk1 / 2 inhibition by either pd98059 or u0126 . in particular , whereas the inhibition of erk1 / 2 increases camp / hcg - stimulated star expression , it decreases pma - mediated star levels . was not associated with attenuation of the cytochrome p450 side chain cleavage ( p450scc ) and 3 - hydroxysteroid dehydrogenase ( 3 - hsd ) enzyme activities , as erk1 / 2 inhibition had no effect on 22r - hydroxycholesterol - mediated steroid synthesis . noteworthy , the increases in pma , ( bu ) 2camp , and hcg - induced star expression and progesterone levels were inversely correlated with the levels of a negative transcription factor , namely , dosage - sensitive sex reversal , adrenal hypoplasia congenita , critical region on the x - chromosome , gene 1 ( dax - 1 ) . while u0126 attenuates dax - 1 expression , this inhibition can be reversed by pma but not by ( bu ) 2camp / hcg . in fact , the differential effects of u0126 on pka - and pkc - mediated steroidogenesis is mediated , at least in part , by alterations in dax - 1 expression in mouse leydig cells . furthermore , studies have shown that both ( bu ) 2camp and pma can elevate the levels of scavenger receptor class b type 1 ( sr - b1 , a high - density lipoprotein ( hdl ) receptor that binds various lipoprotein particles and facilitates cellular cholesterol influx ) and that erk1 / 2 inhibition decreases sr - b1 expression . the binding of hdl to sr - b1 has been reported to stimulate the erk1 / 2 pathway following ras activation . sr - bi is involved in importing cholesterol into cells that will eventually be provided to the mitochondria for steroid biosynthesis . thus it is plausible that the decrease in steroid synthesis caused by u0126 ( during conditions of elevated star ) is due to a reduction in cholesterol availability to the mitochondria . recent studies have shown that activation of erk1 / 2 at the mitochondria plays an important role in leydig cell steroidogenesis . specifically , erk1 / 2 is capable of phosphorylating star at serine 232 in the presence of cholesterol , demonstrating that star is a substrate for erk1 / 2 and that a mitochondrial kinase complex is essential for maximum cholesterol transferring capacity of the star protein in steroid synthesis . in granulosacell - derived rlhr - 4 and rfshr - 17 cell lines , treatments with lh / hcg and fsh , respectively , increase erk1 / 2 phosphorylation , star expression , and progesterone synthesis . conversely , gonadotropin - stimulated star and steroid levels have been shown to be further augmented following inhibition of erk1 / 2 both by pd98059 and u0126 , suggesting that the induction of lh / hcg - and fsh - induced steroidogenesis involves downregulation of the steroidogenic machinery including the erk1 / 2 cascade . studies have also shown that while pd98059 and u0126 have no effects on lh / hcg , insulin , or igf -1-induced steroidogenesis , they decrease ( bu ) 2camp , cholera toxin and forskolin stimulated progesterone production . further , it has been reported that fgf - 8 mediated erk1 / 2 activity is associated with an attenuation of estradiol production in rat granulosa cells . also , erk1 / 2 activation results in differential effects on lh - induced star and cyp17 expression in bovine theca cells . activation results in an increase in star and a decrease in cyp17 that in turn results in an elevation in progesterone and a reduction in androsterone levels , processes in which dax - 1 and steroidogenic factor 1 ( sf - 1 ) play pivotal roles . likewise , administration of hcg in vivo or treatment with gonadotropins / camp in vitro is associated with down - regulation of cyp19a1 and upregulation of star and cyp11a1 mrna expression in both mural and cumulus granulosa cells of mouse preovulatory follicles . these events have been shown to be tightly regulated with steroid biosynthesis and involve erk1 / 2 - dependent signaling . recently , the activation of erk1 / 2 , as well as other mapk signaling , by leptin , has been linked to decreases in basal and camp / pka stimulated star expression and progesterone synthesis without affecting the levels of the p450scc and 3 - hsd enzymes . additionally , treatment with metformin ( a drug that is widely used for treating infertility in women with polycystic ovary syndrome ( pcos ) ) causes an activation of erk1 / 2 that results in suppression of insulin - stimulated p450 aromatase mrna expression and activity . in theca cells isolated from pcos patients , increases in cyp17 expression and androgen biosynthesisare connected to an attenuation of erk1 / 2 / mek1 / 2 activity by pd98059 , suggesting the involvement of mapk signaling in the pathogenesis of this disease . prostaglandin f2 ( pgf2 ) , an agent that influences luteal regression through the induction of the phospholipase c / diacylglycerol / pkc pathway , induces phosphorylation of erk1 / 2 , which , in contrast , decreases basal and lh / hcg - stimulated star expression and progesterone synthesis in human granulosa - luteal cells . these effects of pgf2 in the steroidogenic response can be reversed following inhibition of mek activity by pd98059 . moreover , the inhibitory effect of pgf2 on star expression and steroidogenesis , in rat luteal cells , is modulated by the negatively acting transcription factors , dax - 1 and ying yang 1 . these results demonstrate the multiple effects of the erk1 / 2 signaling cascade in star expression and steroidogenesis in gonadal cells . in mousey - 1 adrenocortical tumor cells the induction of forskolin - mediated corticosterone synthesis is dependent upon the activation of erk1 / 2 and is correlated with phosphorylation of sf - 1 and increased star gene transcription . accordingly , inhibition of erk1 / 2 , by either pd98059 or u0126 , decreases star expression and steroid production without affecting p450scc enzyme activity . increasing evidence demonstrates that acth and angiotensin ii ( ang ii ) can elevate phosphorylation of p44 / p42 mapks and result in increases in star expression and steroid synthesis that involve pkc signaling and ras / raf - 1 kinase . the induction of orexins a and b ( neuropeptide hormones ) mediated star expression and steroid synthesis is mediated by a number of mapk cascades including ekr1 / 2 activation , where the latter requires multiple g - protein signaling pathways in human h295r adrenocortical cells . it has been demonstrated that while proopiomelanocortin ( pomc ) fragments , 1 - 28 - pomc and 1 - 48 - pomc , modulate cellular proliferation , they decrease adrenal steroidogenesis by activating erk1 / 2 signaling . chronic administration of acth induces the phosphorylation of erk1 / 2 that occurs in parallel with adrenal corticosterone synthesis in adult rats . in both h295r and primary cultures of human adrenocortical cells , treatment with adipokines up - regulates the erk1 / 2 cascade and results in increases in star expression and aldosterone synthesis , processes that do not require camp / pka signaling . taken together , it seems clear that the erk1 / 2 signaling cascade plays diverse roles in regulating star expression and steroidogenesis . these roles could be a result of the existence of multiple signal transduction pathways that display differences in receptor - effector coupling between tissues and species . the p38 mapk signaling cascade is thought to participate in the response of cells to stress . four members of the p38 mapk family have been cloned and named p38 ( mapk14 ) , p38 ( p38 - 2 ) , p38 ( erk6 or sapk3 ) , and p38 ( sapk4 ) and share approximately 60 % homology in their amino acid sequences . also , several alternatively spliced isoforms of p38 mapk include mxi2 ( identical to p38 ) and exip . p38 mapks contain a thr - gly - tyr activation loop sequence ( tgy ) . they are activated by dual phosphorylations on threonine and tyrosine residues in response to numerous stimuli , including cytokines , hormones , gpcrs , heat shock , and other stresses and play important roles in controlling many cellular functions . p38 is expressed in most cells ; however , expression of other isoforms is tissue specific . cellular distribution , activation , and substrate specificity of p38 mapks result in diverse biological functions . once activated , p38 mapks either transmit the signals via a three - tier cascade or phosphorylate other regulatory molecules such as pla2 , heat shock proteins , and transcriptions factors ( c - jun , atf - 2 , creb , chop , nf - kb , and others ) . substrates of p38 mapk include mapk - activated protein kinases ( mks ) , that is , mk2 , mk3 , and mk5 ( reviewed in ) . there are also several distinct kinases at the map3k level of the p38 mapk cascade , including mlk2 , mlk3 , tpl2 , dual leucine zipper - bearing kinase , ask1 , map three kinase 1 , and tak1 . for instance , the p38 mapk pathway causes rapid inactivation of the erk1 / 2 cascade mediated by pp2a . the p38 mapk pathway is involved in tissue homeostasis and several pathologies ranging from inflammation and the immune response to cancer and neurodegenerative diseases . it has been demonstrated that il - 1 activates p38 mapk and that this event is associated with star expression and testosterone synthesis in immature rat leydig cells . the involvement of p38 mapk in steroidogenesis is further assessed by observations in which inhibition of its activity , either by sb203580 or pd169316 , results in the coordinate suppression of star and steroid levels . il - 1 is also capable of phosphorylating creb and fos / jun through the activation of a p38 substrate which is a rsk family member ( rsk - b kinase , also called msk2 ) , suggesting that this process may play a role in the differentiation of immature into adult leydig cells . in addition , it is worth noting that il - 1 also activates erk1 / 2 and inhibition of the latter by u0126 augments expression and phosphorylation of the star protein but decreases androgen synthesis by dissipating the mitochondrial electrochemical potential . these findings suggest that a number of mapk signaling events differentially influence il -1-mediated steroidogenesis in mouse leydig cells . gonadotropins have been shown to activate both p38 and erk1 / 2 mapks and result in varying effects on star expression and steroidogenesis in ovarian granulosa cells . studies have demonstrated that interference of p38 ( by sb203580 ) and erk1 / 2 ( by pd98059 and u0126 ) activity is associated with increases in lh / hcg / fsh mediated star expression and progesterone synthesis . in addition , inhibition of p38 decreases both p450arom and estradiol synthesis , and these events are tightly correlated with liver receptor homolog - 1 and dax - 1 expression , demonstrating that p38 targets these transcription factors in regulating steroidogenesis . heat shock protein hsp - 27 is identified as a downstream phosphorylation target of fsh - and forskolin - mediated p38 mapk activation . in granulosa cell - oocyte cocultures , both bone morphogenetic protein - 2 ( bmp - 2 ) and bmp - 4 exert differential effects on fsh mediated regulation of steroidogenesis through the activation of p38 mapk . indeed , both bmp - 2 and -4 increase fsh - mediated p450arom mrna expression and estradiol production but decrease star and progesterone levels . in primary cultures of rat adrenal glomerulosa cells , ang ii activates the p38 and erk1 / 2 signaling pathways and results in increases in star expression , steroidogenic enzymes , and steroid synthesis . concurrently , ang ii inhibits protein synthesis by enhancing p27 expression ( a protein known to block the cell cycle in the g1 phase ) . the effects of ang ii can be reversed through inhibition of p38 activity by sb203580 , suggesting that ang ii plays an important role in adrenal physiology . accumulating evidence indicates that activation of the p38 mapk signaling cascade is linked to the aging - induced , oxidative stress - mediated suppression of steroidogenesis in adrenal cells . alternatively , inhibitors of p38 mapks ( by either sb203580 or sb202190 ) and antioxidants ( reactive oxygen species ( ros ) scavengers mntmpyp and n - acetyl cysteine ) have been shown to restore corticosterone synthesis in cells from aged rats . these findings indicate that the stress - mediated inhibition of steroid biosynthesis involves the activation of the p38 mapk pathway in the adrenals during the course of aging . also , intense phospho - p38 mapk immunoreactivity has been detected in human brains of postmortem patients afflicted with alzheimer 's disease , indicating that p38 could be involved in the pathogenesis of this disease . jnk / sapks are also considered as stress - activated mapks ; however , they are different from p38 mapks . isolation and subsequent characterization of cdnas encoding these enzymes revealed three genes encoding proteins with 10 or more alternatively spliced forms . three main isoforms , that is , jnk1 / sapk ( 46 kda ) , jnk2 / sapk ( 54 kda ) , and jnk3 / sapk ( 52 kda ) , are approximately 85 % identical in their core catalytic domains . whereas jnk1 / 2 mapks are ubiquitously expressed , jnk3 is primarily localized to neuronal tissues , testis and cardiac myocytes . jnk / sapks are activated by cytokines , uv irradiation , growth - factor deprivation , agents that interfere with dna and protein synthesis , as well as other stressors . similar to other map kinases , the activity of jnk / sapks is dependent upon phosphorylation on tyrosine and threonine residues , which are separated by a proline to generate the tpy motif in the activation loop . the resulting signals are then transmitted to three - tier cascades either directly or through map4ks . however , two mek family members , mkk4 ( sek1 , mek4 , jnkk1 , and skk1 ) and mkk7 ( mek7 , jnkk2 , and skk4 ) , are predominantly involved in the jnk / sapk cascade for signal integration . several lines of evidence demonstrate the involvement of the jnk / sapk signaling cascade in steroidogenesis . for example , tumor necrosis factor - ( tnf ) activates jnk / sapk ; however , the latter is associated with decreases in basal and camp - induced steroidogenesis by reducing cyp17 gene expression in ma - 10 cells . tnf also decreases the phosphorylation of erk1 / 2 while simultaneously increasing the abundance of cjun as well as increasing ap - 1 binding activity , suggesting the involvement of a number of mapks in tnf signaling . therefore , the activation of jnk / sapk and erk1 / 2 mapks appears to play a mutually antagonistic role in tnf - mediated steroidogenesis . in ratr2c leydig tumor cells , bisphenol a ( bpa ) , an endocrine disruptor , is capable of activating jnk / sapk and results in an elevation in aromatase activity and an attenuation of testosterone synthesis by targeting both creb and akt . increasing evidence demonstrates that steroidogenesis decreases in aging , a time when the levels of reactive oxygen species ( ros ) increase . as a consequence , a number of ros , such as superoxide anion ( o2 ) and hydrogen peroxide ( h2o2 ) , have been involved in the repression of testicular star expression and steroid synthesis . in k28mouse leydig cells , the inhibition of ros - mediated star , p450c17 mrna , and steroid levels is mediated , at least in part , through the activation of jnk / sapk mapks and subsequent upregulation of c - jun . these events cause a repression in the trans - activation potential of nur77 on steroidogenic enzyme genes and result in decreases in star expression and steroidogenesis . in human granulosa cells , leptin activates a number of mapks including the jnk / sapk signaling pathway where it decreases camp - induced star protein expression and progesterone synthesis . likewise , bmps can induce phosphorylation of several mapk cascades , exhibit varying actions on steroidogenesis , and play important roles in ovarian follicular growth and maturation . also , an oocyte derived factor , fgf - 8 , has been shown to interact with bmps , activate the jnk / sapk and erk1 / 2 signaling cascades and subsequently regulate fsh - induced steroidogenesis in a rat granulosa cell - oocyte coculture system . altogether , the jnk / sapk signaling cascade is fundamentally connected with stress - related responses and the activation of jnk / sapk decreases the steroidogenic response in a number of steroidogenic tissues . the erk5 / bmk1 is the largest known map kinase ( ~ 110 kda ) family member . the signaling pathway leading to erk5 activation is poorly understood in comparison with other mapks as a consequence of conflicting findings in the literature . importantly , the c - terminus of erk5 contains 10 consensus map kinase phosphorylation sites which can be autophosphorylated . erk5 is ubiquitously expressed and its activity is regulated by a variety of proliferative ( growth factors , phorbol ester , serum , and lysophosphatidic acid ) and cell - stressing ( h2o2 , sorbitol , and uv irradiation ) agents . the mechanism of upstream activation of the erk5 cascade has not been fully defined . this mechanism may include the action of adaptor proteins ( e.g. , lad ) , protein tyrosine kinases , and wnk1 . these components have been shown to induce a number of kinases at the level of map3k , including mekk2 / 3 , tpl2 , and mltk . these kinases then phosphorylate mek5 ( an upstream component of erk5 ) on serine and threonine residues . mek5 then activates erk5 on threonine and tyrosine residues in the loop sequence motif ( tey ) identical to erk1 and erk2 . however , erk5 can not be phosphorylated by mek1 / 2 , and mek5 does not phosphorylate erk1 / 2 . another substrate of erk5 is the serum and glucocorticoid - inducible kinase , which may serve as a mapkapk of this cascade , allowing for the possible involvement of a five - tier cascade . erk5 can affect a number of cellular activities ( e.g. , cellular proliferation , differentiation , and motility ) by phosphorylating many transcription factors , including mads box , c - myc , c - fos , myocyte enhancer factors 2a and c , and sap1a . recently , it has been reported that orexins a and b activate erk5 and concomitantly increase expression of the star protein and steroidogenic enzyme genes in h295r cells . the effects of orexins on erk5 phosphorylation have been demonstrated to be similar to those of ang ii and are mediated by multiple g - protein signaling pathways . however , orexins simultaneously activate the erk1 / 2 and p38 mapk signaling cascades , indicating that the regulation of orexin - mediated star expression and steroidogenesis involves several mapks in adrenal cells . information that the activation of the erk5 signaling pathway in gonadal cells is linked to steroidogenesis is currently lacking . erk3 , erk4 , erk7 , nlk , mok , and others are considered as atypical mapks ( table 1 ) . regulation , structure , and substrate specificity of these mapks have been described in a recent review . the mapk signaling cascades are the major components of pathways controlling a wide variety of cellular processes , including embryogenesis , gene expression , acute responses to hormones , cell survival , and apoptosis and are of critical importance in the transduction of extracellular signals in cells . noteworthy , the mapk cascade has been implicated in the pathogenesis of a number of human disorders , including alzheimer 's disease , parkinson 's disease , and many cancers . indeed , the multiple effects of mapks could be a result of the involvement of a wide variety of substrates that include protein kinases and phosphatases , transcription factors , cytoskeletal elements , and other signal - regulated molecules . the studies summarized here have emphasized the roles of erk1 / 2 , p38 mapk , jnk / sapk , and erk5 mapks in the regulation of star expression and steroidogenesis in different steroidogenic tissues . the star protein plays an indispensable role in the production of steroid hormones required for bodily homeostasis and normal reproductive development and function . based on the results available at this time , it is obvious that the mapk signaling cascades play diverse roles in controlling star expression and steroid biosynthesis in tissue - , stimulus - , and pathway - specific manners . these processes appear to be dependent on receptor - effector coupling , signaling crosstalk , and / or other factor ( s ) involved in steroidogenesis . moreover , under specific circumstances , the regulation of mapk - dependent star expression and steroidogenesis involves more than one mapk signaling , and as a consequence different , and even opposing , effects of mapks can be seen in different steroidogenic cells . additionally , different cells express distinct sets of transcription factors , and this diversity may account for the cell - type - dependent specificity of mapk action . given the physiological and pathological roles of the mapk signaling pathways , elucidation of tissue - and disease - specific effects of each of the mapk signaling cascades together with their downstream effectorsan abundance of molecular tools including high throughput genomic and proteomic technologies will undoubtedly provide valuable insights into these regulatory mechanisms .\noutput:\n" }, { "from": "agent", "value": "mitogen - activated protein kinases ( mapks ) comprise a family of serine / threonine kinases that are activated by a large variety of extracellular stimuli and play integral roles in controlling many cellular processes , from the cell surface to the nucleus . the mapk family includes four distinct mapk cascades , that is , extracellular signal - regulated kinase 1/2 ( erk1 / 2 ) , p38 mapk , c - jun n - terminal kinase or stress - activated protein kinase , and erk5 . these mapks are essentially operated through three - tiered consecutive phosphorylation events catalyzed by a mapk kinase kinase , a mapk kinase , and a mapk . mapks lie in protein kinase cascades . the mapk signaling pathways have been demonstrated to be associated with events regulating the expression of the steroidogenic acute regulatory protein ( star ) and steroidogenesis in steroidogenic tissues . however , it has become clear that the regulation of mapk - dependent star expression and steroid synthesis is a complex process and is context dependent . this paper summarizes the current level of understanding concerning the roles of the mapk signaling cascades in the regulation of star expression and steroidogenesis in different steroidogenic cell models ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the estimated prevalence of juvenile rheumatoid arthritis ranges from 16 to 150 persons per 100,0001 . juvenile rheumatoid arthritis ( jra ) is diagnosed in children aged less than 16 years who have arthritis for at least 6 weeks . though the etiology is unknown , ravelli and martini reported that genetic and environmental factors are associated with juvenile rheumatoid arthritis2 . jra often results in significant impairments such as persistent pain , limited range of joint motion , joint stiffness , growth disturbance and poor physical fitness3 , 4 . this is of concern because physical condition through childhood and adolescence results in numerous short - and long - term health problems . in addition , the aerobic , anaerobic , and functional abilities of juvenile rheumatoid arthritis patients have been reported to be lower than those of normal children5 . functional ability is therefore a critical consideration in the treatment of juvenile rheumatoid arthritis , and its evaluation determines a patient s current state as well as the efficacy of treatment . a functional ability assessment is also a quick method of evaluating the disease stage and prognosis6 . many studies have reported that the health - related quality of life of children with juvenile rheumatoid arthritis is poor compared to that of healthy children7 . nearly 20 % of juvenile rheumatoid arthritis patients manifest behavioral problems , social isolation , depression , and anger7 . melancholia also affects the health - related quality of life of juvenile rheumatoid arthritis patients8 . many studies have found that pain is associated with health - related quality of life9 ,10,11 . disease progression was also associated with health - related quality of life12 . however , while the association between pain and health - related quality of life has been the subject of many studies , few studies have focused on the association between functional ability and quality of life in juvenile rheumatoid arthritis . the aim of this study was to assess patients health - related quality of life and compare it with a healthy age - matched population , and to examine associations between functional ability and quality of life among juvenile rheumatoid arthritis patients . we studied 51 subjects including 26 children with juvenile rheumatoid arthritis and 25 normal children visiting a hospital in gyunggido , korea . the inclusion criteria were an age of 8 to 16 years ; a diagnosis of jra ; the ability to move independently , communicate , and follow instructions in research tests ; and voluntary consent to participation in the experiment after being given an explanation of content and told about its purposes . all experimental protocols and procedures were explained to each subject , and they were approved by the institutional review board of sahmyook university , korea . the chaq assesses subjects performance across 8 activity areas : dressing , groomong , standing up , eating , walking , hygiene , reaching with the hands , and holding ability . each of the 30 chaq items is scored on a 3 _ point scale : not difficult ( 0 points ) , a little difficult ( 1 point ) , very difficult ( 2 points ) , and ca nt do ( 3 points ) . if any help or assistive devices are necessary to achieve perfect performance , at least 2 points are recorded for the corresponding area . point averages for each of the 8 functional areas range from 03 points , with 0 representing no difficulty and 3 representing serious difficulty . the participants children were instructed to read the survey explanation and questions and to handwrite answers together with their parents within approximately 10 minutes . a therapist provided additional explanations when requested by the respondents . the measurement tool s reliability has been reported to have a cronbach s alpha = 0.880.9713 . health - related quality of life was assessed using a modified korean version of the pedsql14 . the pedsql comprises 23 questions : 8 physical items , 5 mental items , 5 social items , and 5 school - life indications . items are scored as 0 points for no problem at all , 1 point for almost no problem , 2 points for problem sometimes , 3 points for problems often , and 4 points for problems almost always . each question s point value is converted to a corresponding score on a 0100 point scale , with scores of 1 , 2 , 3 , and 4 points corresponding to scores of 75 , 50 , 25 , and 0 points , respectively . the final score ranges from 0 to 2,300 , with higher scores indicating better quality of life . the participants children were instructed to read the survey explanation and questions and to handwrite answers together with their parents within approximately 5 minutes . the measurement tool s reliability has been reported to have a cronbach s alpha = 0.9315 . all of the analytical and statistical processing performed in this study was conducted using spss ver . the kolmogorov - smirnov test was used to determine the normality of the general subject characteristics and the measured variable values . the independent sample t - test was used to evaluate differences in health - related quality of life between the juvenile rheumatoid arthritis patients and normal children , and the mann - whitney u test was used to examine group differences in functional ability . one - way anova was used to compare age - specific differences in health - related quality of life and the kruskal - wallis test was performed to compare age - specific differences in functional ability . a spearman correlation analysis was conducted to identify correlations between functional abilities and health - related quality of life . the general characteristics of the subjects shown in table 1table 1 . general characteristics of the subjectsjra children ( n = 26 ) normal children ( n = 25 ) gender ( male / female ) 15 / 1115 / 10height ( cm ) 141.6617.25 * 151.6114.25 weight ( kg ) 40.0510.7340.3011.91 * p 0.05 . differences in functional ability between the children with juvenile rheumatoid arthritis and normal children are shown in table 2table 2 . comparison of functional ability scores ( chaq - di ) ( n = 51 ) jra children ( n = 26 ) normal children ( n = 25 ) gendermale0 .460.720.040.06 female0 .220.260.120.17 age810 years ( a ) 0.200.260.130.141113 years ( b ) 0.250.450.040.091416 years ( c ) 0.610.800.070.13 all0 .370.580.080.12 * p 0.05 . jra children : juvenile rheumatoid arthritis children , chaq - di : childhood health assessment questionnaire - disability index . the functional ability scores of males and females were 0.46 and 0.22 respectively in the juvenile rheumatoid arthritis group , and 0.04 and 0.12 respectively in the control group . the functional ability scores of age averaged 0.37 in the juvenile rheumatoid arthritis group and 0.08 in the control group . there were significant group differences in functional ability scores categorized by gender , overall cohort and the subgroup of participants aged 1416 years ( p 0.05 ) . jra children : juvenile rheumatoid arthritis children , chaq - di : childhood health assessment questionnaire - disability index differences in health - related quality of life between children with juvenile rheumatoid arthritis and normal children are shown in table 3table 3 . comparison of health - related quality of life ( n = 51 ) agejra children ( n = 25 ) normal children ( n = 26 ) sexmale67 .4617.94 * 85.4314.80 female69 .6716.71 * 84.7810.26 age810 years ( a ) 72.1714.76 * 89.137.101113 years ( b ) 76.8114.01 * 88.5310.431416 years ( c ) 55.0714.93 * 78.7416.82 all68 .3917.13 *** 85.1712.94 post hoc analysisa b | c ** p 0.05 , * * * p 0.001 . : jra children : juvenile rheumatoid arthritis children , chaq - di : childhood health assessment questionnaire - disability index . the health - related quality of life scores of males and females were 67.46 and 69.67 respectively in the juvenile rheumatoid arthritis group , and 85.43 and 84.78 respectively in the control group . there were significant group differences in health - related quality of life scores categorized by gender ( p 0.05 ) . average health - related quality of life scores were significantly lower in the juvenile rheumatoid arthritis group than in the control group ( 68.39 vs. 85.17 , p 0.001 ) . jra children : juvenile rheumatoid arthritis children , chaq - di : childhood health assessment questionnaire - disability index correlations between functional ability and health - related quality of life children with juvenile rheumatoid arthritis are presented in table 4table 4 . correlations among physical fitness , functional ability , and health - related quality of lifec - dipedsqlpedsqlppedsqlepedsqlspedsqlscc - di1pedsql0 .736 ** 1pedsqlp0 .709 ** 0.904 ** 1pedsqle0 .519 ** 0.770 ** 0.522 ** 1pedsqls0 .623 ** 0.838 ** 0.640 ** 0.711 ** 1pedsqlsc0 .466 * 0.748 ** 0.655 ** 0.513 ** 0.465 * 1 * p 0.05 , * * p 0.01 . c - di : childhood health assessment questionnaire - disability index , pedsql : pediatric quality of life inventory 4.0 generic core scales , pedsqlp : physical pedsql , pedsqle : emotional pedsql , pedsqls : social pedsql , pedsqlsc : school pedsql . negative correlations were found between functional ability scores and each dimension of health - related quality of life . chaq - di scores decreased as scores of the physical ( r = 0.709 , p 0.01 ) , emotional ( r = 0.519 , p 0.01 ) , social ( r = 0.623 , p 0.01 ) , and school ( r = 0.466 , p 0.05 ) subscales as well as the overall health - related quality of life score ( r = 0.736 , p 0.01 ) increased . c - di : childhood health assessment questionnaire - disability index , pedsql : pediatric quality of life inventory 4.0 generic core scales , pedsqlp : physical pedsql , pedsqle : emotional pedsql , pedsqls : social pedsql , pedsqlsc : school pedsql higher physical health - related quality of life scores were associated with higher emotional ( r = 0.522 , p 0.01 ) , social ( r = 0.640 , p 0.01 ) , and school ( r = 0.655 , p 0.01 ) subscale scores as well as with the higher overall health - related quality of life score ( r = 0.904 , p 0.01 ) . emotional health - related quality of life was higher when social ( r = 0.711 , p 0.01 ) , school ( r = 0.513 , p 0.01 ) , and overall health - related quality of life ( r = 0.770 , p 0.01 ) scores were higher . higher school ( r = 0.465 , p 0.01 ) and overall health - related quality of life ( r = 0.838 , p 0.01 ) scores were associated with better social health - related quality of life . higher overall health - related quality of life scores were associated with better school health - related quality of life ( r = 0.748 , p 0.01 ) . in the study of shaw et al . , 17 year - old juveniles with rheumatoid arthritis were found to have the poorest functional abilities on the chaq15 . in particular , at least 10 % of the adolescent respondents answered that they could not ride a bicycle or enjoy a preferred sport . this was said to be indicative of increased pain levels , reduced overall happiness , and difficulties in the adolescent period . in this study , the average chaq - di score among children with juvenile rheumatoid arthritis aged 1416 years was 0.61 , representing a slightly serious level of difficulty . therefore , we consider that the mental state of adolescents with juvenile rheumatoid arthritis affects their functional abilities . follow - up studies are expected to investigate the mental state of children aged 1416 years with poorer than normal functional abilities . children with juvenile rheumatoid arthritis have been reported to have a lower health - related quality of life than normal children16 or children with other chronic diseases17 . consistent with these reports , we found significant differences in health - related quality of life across all age groups . the health - related quality of life of juveniles with rheumatoid arthritis exhibited age - specific differences . arthritis patients in the 1416 year age group showed lower back strength , body fat percentage , and functional abilities than normal children . the study of amine et al . reported that the health - related quality of life decreased during the adolescent period and worsened with a later diagnosis . key variables indicative of a degrading health - related quality of life have been reported to be disease duration , difficulty scores , and pain10 . in the present study , subjects in the 1416 year age group who had longer disease durations and higher difficulty scores showed a lower health - related quality of life than children in other age groups . in the early stage of juvenile rheumatoid arthritis , pain leads parents , school staff , and medical experts to aggressively limit patients exercise for their protection . out of the fear of damaging weak joints , patients participation in normal childhood activities tends to be limited , and patients take greater precautions when outdoors18 . this reduction in physical activity from the ages of 8 through 16 , a key period for normal development , delays the optimization of large - scale movements that require speed , power , and coordination . aschildhood development proceeds through the interaction of physical , emotional , social , and school dimensions , limited development would ultimately have an impact on health - related quality of life15 . an initial reduction in physical activity because of pain will subsequently affect physical strength and the quality of life of children with juvenile rheumatoid arthritis , and , in turn , further diminish physical activity forming a vicious cycle . through the assessment of functional ability , children s status can be accurately identified and exercise interventions that would enable participation in daily activities should be presented in order to break the vicious cycle of decreasing activity leading decreasing functional ability in juvenile rheumatoid arthritis and improve patients quality of life .\noutput:\n" }, { "from": "agent", "value": "[ purpose ] the aim of this study was to assess patients health - related quality of life , compare it with a healthy age - matched population , and examine associations between functional ability and quality of life among juvenile rheumatoid arthritis ( jra ) patients . [ subjects and methods ] the study participants were 26 jra patients and 25 controls . the childhood health assessment questionnaire and the pediatric quality of life inventory 4.0 generic core scales were used to evaluate functional ability and health - related quality of life , respectively . [ results ] functional ability scores averaged 0.37 in the jra group and 0.08 in the control group . there were significant between - group differences in functional ability scores in the overall cohort and in the subgroup of participants aged 1416 years . health - related quality of life scores were significantly lower in the jra group than in the control group ( 68.39 vs. 85.17 ) . in the jra group , functional ability was statistically positively correlated with health - related quality of life . [ conclusion ] we conclude that the mental state of adolescents with jra affects their particular functional abilities . subjects in the 1416 age group who had a longer disease duration and higher difficulty scores showed a lower health - related quality of life than children in the other age groups ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: children or siblings of affected family members are at higher risk for testicular germ cell tumors . familial ovarian germ cell tumors are rare , may be due to the rarity of the cancer itself . trentini and palmieri first reported a family where both brother and sister developed germ cell malignancies . since then , around six families were found to be affected in a similar fashion . we present a family where the sister was diagnosed initially to have dysgerminoma and then the elder brother developed a disseminated testicular malignancy . a 16 - year - old postmenarchal girl presented to us with 3 months history of amenorrhoea . she had undergone repair of atrial septal defect of osteum secundum type when she was 3 years old . clinically , she had a large abdominopelvic mass measuring 10 cm above the symphysis pubis . computed tomogram ( ct ) of the abdomen revealed a large abdominopelvic mass probably of ovarian origin . hcg levels were mildly elevated ( 28 miu / ml ) and afp was normal ( 1 ng / ml ) . a laparotomy was performed which demonstrated large left ovarian tumor measuring 2015 cm with no peritoneal or liver deposits . left ovariectomy and pelvic nodal dissection were performed with sampling of peritoneum and para - aortic lymph nodes . other sampled sites were free of tumor . hence , she was diagnosed as dysgerminoma and has completed 5 years of follow - up and is disease free . a 24 - year - old gentleman , elder brother of case 1 , presented with abrupt onset of vomiting and loss of consciousness . ct scan of the brain showed a large infarct in the left middle cranial artery territory . histological confirmation could not be attempted . however , his general condition deteriorated and could not be revived despite all supportive treatment given . a 16 - year - old postmenarchal girl presented to us with 3 months history of amenorrhoea . she had undergone repair of atrial septal defect of osteum secundum type when she was 3 years old . clinically , she had a large abdominopelvic mass measuring 10 cm above the symphysis pubis . computed tomogram ( ct ) of the abdomen revealed a large abdominopelvic mass probably of ovarian origin . hcg levels were mildly elevated ( 28 miu / ml ) and afp was normal ( 1 ng / ml ) . a laparotomy was performed which demonstrated large left ovarian tumor measuring 2015 cm with no peritoneal or liver deposits . left ovariectomy and pelvic nodal dissection were performed with sampling of peritoneum and para - aortic lymph nodes . other sampled sites were free of tumor . hence , she was diagnosed as dysgerminoma and has completed 5 years of follow - up and is disease free . a 24 - year - old gentleman , elder brother of case 1 , presented with abrupt onset of vomiting and loss of consciousness . ct scan of the brain showed a large infarct in the left middle cranial artery territory . histological confirmation could not be attempted . however , his general condition deteriorated and could not be revived despite all supportive treatment given . a 16 - year - old postmenarchal girl presented to us with 3 months history of amenorrhoea . she had undergone repair of atrial septal defect of osteum secundum type when she was 3 years old . clinically , she had a large abdominopelvic mass measuring 10 cm above the symphysis pubis . computed tomogram ( ct ) of the abdomen revealed a large abdominopelvic mass probably of ovarian origin . hcg levels were mildly elevated ( 28 miu / ml ) and afp was normal ( 1 ng / ml ) . a laparotomy was performed which demonstrated large left ovarian tumor measuring 2015 cm with no peritoneal or liver deposits . left ovariectomy and pelvic nodal dissection were performed with sampling of peritoneum and para - aortic lymph nodes . other sampled sites were free of tumor . hence , she was diagnosed as dysgerminoma and has completed 5 years of follow - up and is disease free . a 24 - year - old gentleman , elder brother of case 1 , presented with abrupt onset of vomiting and loss of consciousness . ct scan of the brain showed a large infarct in the left middle cranial artery territory . . however , his general condition deteriorated and could not be revived despite all supportive treatment given . rapley et al . , proposed tgct1 on xq27 as the testicular susceptibility gene and suggested 810 times increased risk of testicular cancer among siblings . stettner et al . , reported seven families with more than one relative was affected with malignant ovarian germ cell tumors . trentini and palmieri first described the rare occurrence of dysgerminoma of the ovary and embryonal carcinoma of the testes in siblings of one family in 1974 . a possible genetic transmission was suggested . kingsbury et al . , elaborated on a family with 46xy gonadal dysgenesis syndrome where two phenotypically female siblings and one phenotypically male sibling developed malignant germ cell tumors . they proposed removal of dysgenetic gonads as a prophylactic measure even in phenotypical male members which may be justified . the elder sister was a survivor of dysgerminoma of the ovary when the brother was diagnosed to have mediastinal nonseminimatous germ cell tumor . hartley et al . , reported six germ cell tumors in in relatives of children with bone or soft tissue sarcomas and raised the doubt that germ cell tumors may be part of li fraumeni syndrome . galani et al . , presented a family with three affected members ; two had ovarian tumors ( teratoma and bilateral dysgerminoma ) and the male sibling had mixed germ cell tumor . bruce et al . , demonstrated brca 1 mutation in a patient with ovarian dysgerminoma . there was a strong family history of ovarian cancer and brca 1 was positive in all of them . the significance of this observation is unknown as malignant germ cell tumors are not there in the spectrum of brca - associated cancers . giambartolomei et al . , summarized the literature to date regarding familial germ cell tumors . a definite genetic abnormality has not been identified for the familial incidence of germ cell tumors . however , the increasing reports of the same give a wakeup call for further research on this subject . screening of family members may be debatable , but a discussion regarding these reports with the affected family may be worthwhile .\noutput:\n" }, { "from": "agent", "value": "familial testicular germ cell tumors are well known in literature . only few cases are reported where both brother and sister of the same family suffered from germ cell malignancies . we present a family where the proband is a survivor of ovarian dysgerminoma stage ia . her elder male sibling became acutely ill and was detected to have disseminated testicular malignancy with grossly elevated markers and vegetations in the mitral valve leaflets . despite all measures he could not be saved . presence of germ cell malignancies in the siblings of different sex in the same family points toward a genetic susceptibility . literature review revealed only six similar cases . a discussion regarding the rare occurrence of familial germ cell malignancies with the affected family members may be worthwhile ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the eye mutant resource ( emr ) and the translational vision research models ( tvrms ) programs currently housed at the jackson laboratory are tailored to provide genetically defined models of vision - associated diseases to the research community . the emr screens for spontaneous mutations in the large production and repository colonies , while the tvrm program screens for chemically induced mutations in third - generation ( g3 ) offspring of mutagenized mice . both programs are motivated by the need for well - characterized models for studying the function of particular molecules in the eye , for examining disease pathology , and for providing a resource to test therapeutic regimens . in the early phases of the emr program , the tools for examining mice for ocular abnormalities were adapted for the small size of the mouse eye . these tools included indirect ophthalmoscopy , slit lamp biomicroscopy , fundus photography , and electroretinography ( erg ) . initially , mice from various stocks and inbred strains were screened to identify spontaneous ocular mutants using the first two methodologies . currently , erg screening is done as well to identify and characterize new retinal mutants . as secondary screens , fluorescein angiography is used to detect vascular changes , and noninvasive tonometry is used to assess changes in intraocular pressure . screening has also been expanded to include genetically engineered strains from the jackson laboratory 's genetic resource sciences ( grs ) repository that are systematically examined as they are removed from the shelf or are retired from breeding . also , in addition to the initial phenotypic characterization , the emr strives to identify the mutations underlying the disorders . systematic chemical mutagenesis screens have been successfully carried out in several model organisms , including drosophila , c. elegans , and zebrafish . the zebrafish screens have provided valuable eye models , especially those pertaining to eye development . in addition to our efforts , other mutagenesis screens for eye phenotypes in mice have been reported in which a number of mutants have been described . although different methods for mutagenizing mice are available , the alkylating agent , n - ethyl - n - nitrosourea ( enu ) , is the mutagen most commonly used . enu mainly induces point mutations resulting in a range of consequences including total or partial loss - of - function , dominant - negative , or gain - of - function alleles . its effectiveness as a mutagen is dependent on dosage , frequency of administration , and mouse strain . effectiveness , in terms of identifying mutants , depends upon the type of screen ( e.g. , dominant versus recessive ) and the reproducibility of the phenotypic assay utilized . mutant recovery has ranged from a rate of 1/175 , to ~ 1/666 in specific locus tests ( slts ) , and to an average of 1/1470 based on recessive screening in a defined chromosomal region . the mutation rates for individual loci can vary by almost tenfold . the majority of large - scale mutagenesis screens have been dominant screens . this is probably due to the relative ease of creating mutagenized mice for dominant screens compared to recessive ones . screening for dominants on a genome - wide basis can be done in one generation ( g1 ) , while recessives generally require three . the neuherburg cataract mutant collection of ~ 170 dominant mutants was assembled through screening over 500,000 first - generation mice exposed to various mutagens . the gsf - munich and mrc - harwell programs were established using a phenotype - based approach to screen thousands of mice for dominant mutations affecting a variety of biological processes . a major drawback to dominant screens , however , is that not all mutations have dominant effects . estimates suggest that the frequency of diseases caused by recessive mutations is 410-fold higher than for dominant ones . in fact , of 218 eye mutants surveyed in the mouse genome informatics database , 80 % were recessive mutations and only 20 % were dominant or semidominant . therefore , the tvrm program screened a g3 population of mutagenized mice for recessive mutations . screening for spontaneous and chemically induced mutants provides an important source of models to study the effects of single - gene mutations found in human patients . additionally , new mutations within the same gene provide allelic series in which splice variants or domain - specific effects can be queried . finally , mutations in novel genes that lead to retinal disorders can be discovered using a forward genetic approach . the ages at which the visual system is affected by disease can vary considerably . for the emr program , an initial screen of jax mice & services ( jmss ) production colonies and mice removed from the grs repositoryis routinely performed at ~ 2 months of age and if necessary , additional screening is done at an older age , usually at 6 months of age . also , as with other neuronal diseases , diseases of the visual system are not reversible , so ocular diseases can be captured in retired breeders . therefore , when available , retired breeders that are older than 1 year of age are screened . c57bl / 6j ( b6 ) g3 enu mutagenized mice were screened by the tvrm program . for the chemically induced mutations , enu was administered to male b6 mice in three weekly injections of 80 mg / kg . g3 offspring were generated using a three - generation backcross mating scheme ( figure 1 ) . g3 mice were screened at 24 weeks of age in order to enhance our ability to identify late onset diseases . to determineif the disease phenotype was inheritable , mutant mice were outcrossed to wild - type ( wt ) mice to generate f1 progeny with subsequent intercrossing of the resultant f1 mice to generate f2 progeny . if f1 mice were affected , the pedigree was designated as segregating a dominant mutation . if f1 mice were not affected but ~ 25 % of f2 mice were affected , the pedigree was designated as segregating a recessive mutation . once the observed ocular phenotype was determined to be genetically heritable , mutants were bred and maintained in the research animal facility at jax . mice were provided with nih 6 % fat chow diet and acidified water , with 12:12 hour dark : light cycle in pressurized individual ventilation caging which are monitored regularly to maintain a pathogen - free environment . mice , dark adapted for a minimum of 1 hour , were treated with atropine prior to examination by indirect ophthalmoscopy with a 60 or 78 diopter aspheric lens . fundus photographs were taken with a kowa small animal fundus camera using a volk superfield lens held 2 inches from the eye as previously described . for electroretinographic evaluation of mutants , following a 2 - hour dark adaptation , mice were anesthetized with an intraperitoneal injection of xylazine ( 80 mg / kg ) and ketamine ( 16 mg / kg ) in normal saline . briefly , dark - adapted , rod - mediated ergs were recorded with the responses to short - wavelength flashes over 4.0 - log unit to the maximum intensity by the photopic stimulator . cone - mediated ergs were recorded with white flashes after 10 min of complete light adaptation . genomic dna was isolated from tail tips using a pbnd ( pcr buffer with nonionic detergents ) preparation , which was adapted from a protocol from perkin elmer cetus . samples were heated to 95c for 10 minutes , and 1 l of the dna preparation was used in a 12 l pcr reaction . amplicons were visualized with ethidium bromide after electrophoretic separation on a 4 % agarose gel . for mapping purposes , phenotypically affected mice , presumed to be homozygous for the mutations , were mated with dba / 2j mice . the resulting f1 offspring were intercrossed to generate f2 offspring if recessive and backcrossed ( bc ) to wt parental if dominant . resulting progeny were phenotyped by indirect ophthalmoscopy . dna isolated from tail tips from a minimum of 10 affected and 10 unaffected mice was pooled and subjected to a genome - wide scan using 4880 simple sequence length polymorphic markers distributed throughout the genome . total rna was isolated from whole eyes and brains of affected mutants and b6 mice using trizol reagent ( life technologies ) per manufacturer 's protocol . total rna was treated with rnase - free dnasei ( ambion ) and quantity was determined using a nanodrop spectrophotometer ( thermo scientific ) . primers to sequence the coding region of the candidate genes were designed from exon sequences obtained from the ensembl database . rt - pcr was done using eye cdna in a 24 l pcr reaction containing 1xpcr buffer ( 10 mm tris - hcl ph 8.3 , 50 mm kcl ) , 250 m of each datp , dctp , dgtp , dttp , 0.2 m of each forward and reverse primer , 1.5 mm mgcl2 , and 0.6 u taq polymerase . the following pcr program was used : 94c for 1 minute 30 sec followed by 35 cycles of 94c for 30 sec , 55c for 45 sec , and 72c for 45 sec , and a final extension of 72c for 2 minutes . pcr products were electrophoresed on a 1 % agarose gel and visualized by ethidium bromide staining . dna fragments were sequenced on an applied biosystems 3730xl ( using a 50 cm array and pop7 polymer ) . mice were asphyxiated by carbon dioxide inhalation , and enucleated eyes were fixed overnight in cold methanol / acetic acid solution ( 3 : 1 , v / v ) . the paraffin - embedded eyes were cut into 6 m sections , stained by hematoxylin and eosin ( h and e ) , and examined by light microscopy . since its inception in the 1980s , the emr program has identified and / or imported more than 100 mouse models with ocular abnormalities for research . table 1 lists some of the retinal degeneration mouse models of human disease developed and / or currently maintained in the emr that are available to the research community . the tvrm program was built upon the success of the neuromutagenesis facility ( nmf ) at the jackson laboratory , and 15 of the 60 mutant lines ( tables 2 and 3 ) in which a disease phenotype has been subsequently fixed as a coisogenic inbred strain by the tvrm program were first identified in screens conducted by the nmf . the remaining 45 tvrm lines were established by screening ~ 14,000 g3 mice for anterior and posterior segment abnormalities by indirect ophthalmoscopy and / or slit lamp biomicroscopy . six of the 60 mutations ( 10 % ) are inherited in a dominant or codominant manner , and the remaining are recessive mutations . forty six of the mutants have retinal phenotypes ranging between pan - retinal spots or patches , pigmentation defects , and / or attenuation of blood vessels with or without morphological changes that were detectable by light microscopy . six of the mutant lines have reduced or absent erg responses for either rod and / or cone cells without photoreceptor loss . forty six of the mutations ( 23 reported in table 3 ) have been localized to a chromosome , and the molecular basis has been identified for 23 of them ( table 2 ) . fourteen lines are still in the process of being mapped ( data not shown ) . nineteen of the 23 mutations in table 2 were novel alleles in genes in which mutations had previously been reported . it should be noted that the current bias for reoccurrences of mutations , herein referred to as remutations , versus identification of novel genes in table 2 is probably due to the fact that once a mutation is mapped , candidate genes previously associated with an eye disease can be quickly sequenced . regions containing no obvious candidate genes need to be narrowed further and / or all genes within the region may need to be sequenced to identify the disease - causing mutation . interestingly , new phenotypes were observed in 8 of the remutations that have been examined ( see ; , personal communication pmn ) . for example , outer segments ( oss ) were either formed abnormally or did not initiate in retinas from homozygous rpgrip1 mice . this was in contrast to the rpgrip1 targeted null mutant , hereafter , rpgrip1 in which os discs were formed and stacked vertically rather than horizontally . targeted alleles of lama1 were reported to be embryonic lethal . the enu - induced allele , lama1 , provides a viable , hypomorphic allele in which abnormalities in the adult animal could be examined . histologically , persistent hyaloid vessels and fibrous tissue were found in the vitreal space , and the inner limiting membrane was disrupted . in an allelic series of mutations within the rhodopsin gene , heterozygous rho and rho mice raised in standard vivarium lighting did not exhibit any morphological changes until exposed to bright light . previously rho alleles showed spontaneous and pan - retinal degeneration , even when mice were reared from birth in darkness . tvrm65 segregates as a recessive mutation that is characterized by a pan - retinal , grainy fundus appearance that eventually progresses with age to patches of depigmentation within the central retina ( data not shown ) . the mutation was mapped to chromosome ( chr . ) 7 between flanking markers d7mit75 and d7mit190 . a single nucleotide polymorphic ( snp ) marker ( snp i d : rs13479126 ) served to narrow the interval . crx , a reasonable biological candidate gene , contained within the minimal interval , was examined for a mutation . mice and humans share a 97 % sequence similarity . to date , two crx transcripts have been reported . the long isoform ( genbank nm_001113330 ) has 25 additional amino acids ( aa ) in its n terminus when compared to the shorter isoform ( genbank nm_007770 ) . a t a nonsense mutation identified in crx is located in the last exon and is expected to affect both isoforms . the tvrm65 mutation is predicted to cause an early termination at leu277 ( ttg ) of the 323 aa from the longer isoform or at leu253 of a 299 aa product from the shorter isoform ( figure 2 ( a ) ) . phenotypically , crx mutants resemble the null mouse model in which the single homeodomain containing region of crx was targeted . crx mutants show a rapid photoreceptor degeneration ( figure 2 ( b ) ) . at postnatal day ( p ) 14 and p21 , oss were absent and inner segments ( iss ) were rarely observed ( figure 2 ( b ) ) . by p21 , photoreceptor cell bodies were reduced to ~ 60 % of controls . the outer plexiform layer ( opl ) was also thinner , approximately 40 % of controls . by 3 months of age , the oss and iss were absent and only 2 ~ 3 layers of outer nuclear layer ( onl ) were remained . the photoreceptor degeneration observed in the crx mutants occurs more rapid than reported for the null allele . this may , in part , be due to the difference in genetic background of the two alleles as crx was generated on a b6 background , whereas the previous null allele was described on a segregating b6 and 129sb genetic background . tvrm64 segregates as a recessive mutation that is characterized by a grainy fundus appearance and attenuated retinal vessels ( data not shown ) . the mutation mapped to chr .1 between the centromere and d1mit427 , an interval in which rp1 resides . rp1 encodes a large protein of 2095 aa in mouse and 2156 aa in humans . rp1 localizes in the connecting cilia and appears to play a structural and / or functional role in molecular transport through the connecting cilia . structurally , it has two ubiquitin homolog ( ubq ) domains in its amino terminus . rp1 was tested for a mutation , as the phenotype of homozygous tvrm64 mutants was similar to that of mice carrying either of two targeted rp1 alleles , involving homologous recombination in which exons 2 and 3 were targeted ( rp1 ) or a truncation after codon 662 , rp1 , analogous to the r667ter mutation in humans . direct sequencing of homozygous rp1 retinal cdna revealed an a t transversion at nucleotide 1769 ( genbank nm_011283 ) , creating a nonsense mutation in which arg522 ( aga ) is changed to a termination codon ( tga ; figure 3 ( a ) ) . the os length of rp1 mutant retina was approximately 50 % shorter than wt controls at 1 month of age ( figure 3 ( b ) ) . the difference in is length between mutant and controls , however , was barely discernable at 1 month of age but was obviously shorter in rp1 mutants at 3 months of age . the photoreceptor degeneration was progressive with little difference in cell body number in the onl at 1 month of age but by 3 months , cell nuclei were reduced to ~ 50 % in mutants in comparison to controls . in contrast , the photoreceptor morphology of rp1 mice appeared normal by light microscopy at p30 with comparable length of os in mutant and controls . also , rp1 mice at p30 showed shorter os lengths and a 12 - layer reduction in onl . therefore , the disease progression in rp1 at similar age appears to be more severe than observed in rp1 mice but less severe than rp1 mice . this difference between the models was also discernable functionally . at 1 month of age , dark - adapted ergs of rp1 mice were comparable to wt ( figures 3 ( c ) and 3 ( d ) ) . the recessive tvrm148 mutation is characterized by late onset retinal spotting and by patches of depigmentation that is readily discernable by indirect ophthalmoscopy at 5 months of age ( data not shown ) . rpe65 was screened by direct sequencing for a mutation as it fell within the minimal interval identified , and the disease phenotype was similar to that reported for the rpe65 targeted knockout animal ( herein referred to as rpe65 ) and rpe65 alleles . a t c point mutation was found by direct sequencing of retinal cdna from rpe65 mice and is expected to generate a mutant protein with an f229s point mutation ( figure 4 ( a ) ) . f229 is evolutionarily conserved from humans to zebra fish but interestingly not in chimpanzee ( figure 4 ( a ) ) . the rpe65 mutant had a nonfunctional rod erg response due to the lack of 11 - cis - retinal production in the rpe and showed disorganized rod outer segments . another targeted allele mimicking a human r91w mutation was found in leber congenital amaurosis ( lca2 ) patients ( rpe65 ) , and a spontaneous model rpe65 showed a similar disease progression to that observed in rpe65 mutants . photoreceptors degenerated progressively in homozygous rpe65 mouse from 1 month to 1 year of age , the latest time point examined ( figure 4 ( b ) ) . at 1 month of age , os and is lengths were approximately 50 % shorter than controls with no obvious thinning of the onl . the photoreceptor nuclei were reduced in thickness by ~ 20 % at 4 months and ~ 60 % by 1 year of age . like the three previously reported mouse models , rpe65 exhibited severely impaired rod ergs and relatively spared cone ergs . cone b - wave ergs were comparable to controls at 4 weeks of age but by 17 weeks , the amplitudes were reduced compared to controls ( figures 4 ( c ) 4 ( d ) ) . these mutations offer some advantages for the study of human genetic diseases and basic gene function over mutations obtained by homologous recombination . first , these mutations are generally identified because they cause a clinically relevant phenotype . by starting with a known phenotype , information about the physiological function of the mutant gene and its biomedical relevancesecond , the forward genetic approach has the potential for discovery of new genes involved in ocular development and function that were previously unappreciated . further , spontaneous and chemically induced mutations may better model naturally occurring human genetic conditions . they produce a full and unbiased array of mutation types single base pair changes or deletions , and in the case of spontaneous mutations , retroviral insertions , repeat sequence expansions , and chromosomal rearrangements . they can abolish all protein function ( null ) , partially diminish function ( hypomorphic ) , or change function ( dominant negative or gain - of - function ) . can provide domain specific information about protein function and information on alternatively spliced variants . biomedically relevant phenotypes associated with some human genetic disorders may be revealed by the different alleles that are not replicated by knockout alleles . for example , whereas the null alleles of lama1 were embryonic lethal , the hypomorphic enu nmf223 allele allowed for the examination of ocular phenotypes in adult mice . in another example , the rd10 allele of pde6b identified by the emr program has a later onset and slower rate of degeneration than the original rd1 allele , thus allowing for the opportunity to test therapeutic strategies . finally , two phosphodiesterase 6a mutations first described by the tvrm program cause missense mutations that lead to different biochemical outcomes and rates of photoreceptor degeneration , suggesting a difference in the importance of the particular mutant residues to the function of the protein . it should also be noted that spontaneous mutations occur on a wide variety of strain backgrounds , and chemical mutagenesis can be carried out in different genetic backgrounds . the observation of altered mutant phenotypes in different genetic backgrounds can provide a means for identifying interacting genes and molecular pathways of pathophysiology . for example , nr2e3 was observable clinically only in the b6 genetic background , and a number of genetic backgrounds act to ameliorate the disease . crb1 is observable clinically in the c3h / hej background but not in the b6 background , and the null mutation is phenotypically different on a segregating 129x1 / svj and b6 background . finally , a wide variety of disease phenotypes are observed in rd3 and gnb1 in different strain backgrounds , indicating interactions with genetic background modifiers . the variation in genetic background enables discovery of modifiers and gene interactions and could be essential to the discovery of important mutant phenotypes and potential targets for therapeutic intervention . in the future , the emr will continue to screen for spontaneous mutations in the large production colonies at the jackson laboratory . the mutants identified in the tvrm programwill be incorporated into the emr distribution colonies as the molecular bases of the mutations are identified . finally , sensitized chemical mutagenesis screens are planned that will uncover pathways important in retinal development , maintenance , and function .\noutput:\n" }, { "from": "agent", "value": "the need for mouse models , with their well - developed genetics and similarity to human physiology and anatomy , is clear and their central role in furthering our understanding of human disease is readily apparent in the literature . mice carrying mutations that alter developmental pathways or cellular function provide model systems for analyzing defects in comparable human disorders and for testing therapeutic strategies . mutant mice also provide reproducible , experimental systems for elucidating pathways of normal development and function . two programs , the eye mutant resource and the translational vision research models , focused on providing such models to the vision research community are described herein . over 100 mutant lines from the eye mutant resource and 60 mutant lines from the translational vision research models have been developed . the ocular diseases of the mutant lines include a wide range of phenotypes , including cataracts , retinal dysplasia and degeneration , and abnormal blood vessel formation . the mutations in disease genes have been mapped and in some cases identified by direct sequencing . here , we report 3 novel alleles of crxtvrm65 , rp1tvrm64 , and rpe65tvrm148 as successful examples of the tvrm program , that closely resemble previously reported knockout models ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: advances in surgical intensive care have enabled patients with severe abdominal pathologies to survive . en bloctumor resections , previous surgeries , intraabdominal catastrophes , necrotizing fascial infections , or traumatic abdominal injuries cause abdominal wall defects in these kind of patients . the aims of reconstruction in such defects are full restoration of abdominal wall function , including muscular support , prevention of visceral eventration , and adequate soft tissue coverage . wide undermining of the skin and subcutaneous tissue usually permits primary wound closure . in a minority of patients , lateral migration of the rectus abdominis muscles from contraction of the flank muscles , and concomitant visceral sac protrusion , generally , two methods are used for the treatment of abdominal wall defects that are not amenable to tensionless approximation of the natural tissues . the first method is to bridge the defect with the patients ' own tissue , synthetic products , or a composite material ; and the second one is to reapproximate the natural tissue after utilizing relaxing incisions or preoperative measures like tissue expansion or progressive pneumoperitoneum . synthetic meshes , autologous tissue flaps , mostly myocutaneous flaps such as tensor fasciae latae , rectus femoris , rectus abdominis , and latissimus dorsi , with or without incorporation of synthetic meshes , pedicled omentum flaps , some biological materials like human acellular dermal matrix , were introduced in hernia repair and abdominal wall reconstruction [ 4 - 6 ] . abdominal wall reconstruction with prosthetic meshcan be safe and effective if well - vascularized soft - tissue coverage is provided . tissue expanders have been used in this clinical situation to provide soft - tissue coverage and to restore abdominal domain by increasing both the size and the vascularity of the donor tissue . our patient 's vascularized capsule , combined with the existing rectus sheath , was used to reconstruct abdominal wall defects . tissue expanders placed in the subcutaneous space , abdominal wall intramuscular spaces ( between the internal oblique and transverse abdominis muscles ) , intermuscular sites ( between the external and internal oblique muscles ) , and finally intraabdominally , have been reported as a method to increase the size of potential skin or muscle flaps before closure and also for stable coverage of prosthetic material . simplicity , safety and efficacy should be the main considerations in the management . in this reportwe describe our experience in treating a patient with large abdominal wall defect by staged abdominal wall reconstruction utilizing prosthetic mesh in conjunction with tissue expanders . exploratory laparotomy performed through a subumbilical incision showed perforated appendicitis with intraabdominal abscess of 1,500 ml . after surgery he developed intraperitoneal sepsis and in order to prevent abdominal compartment syndrome , he was reoperated and left with \" open abdomen \" . several open abdomen lavages were performed and his abdominal wall defect was allowed to granulate . two rectangular tissue expanders ( ls 822000 , laboratoires sebbin , boissy - l'aillerie , france ) of 2,000 ml volume ( 23013070 mm ) were placed in the subcutaneous pockets created just above the anterior rectus sheath and adjacent to the abdominal wound bilaterally to reconstruct the defect of 2337 cm in size . each of the tissue expanders were inflated with 200 ml of saline at the time of the initial operation . over the next several weeks , the expanders were gradually inflated to a total volume of 2,350 ml each over a period of four months ( fig .3 ) and since the fascial defect was too large to close primarily , utilizing prosthetic mesh ( expanded polytetrafluoroethylene ; gore - tex soft tissue patch ) ( fig .4 ) in conjunction with tissue expanders , the abdominal wall defect was reconstructed . expanded skin flaps were advanced toward the midline and closed in layers without tension . the postoperative period of the patient was uneventful and he was discharged on the 4th postoperative day . during follow - up for ten months , he showed no signs of mesh infection or extrusion , and did not develop recurrent hernia , ulceration or enteric fistula . treatment of large ventral hernias is difficult , partly due to a lack of available abdominal wall , and owing to the difficulty in finding sufficient space for the abdominal contents after reposition . the myofascial layer is the major supportive part of the abdominal wall , which is important for abdominal contents protection and dynamic function . there is no consensus about which technique or material is suitable for a certain kind of defect . selection should be made mainly on the basis of the size , location and depth of the defect , wound bed preparedness and the medical status of the patient . when assessing the patient initially , a complete history , physical and laboratory workup are essential with the involvement of multiple specialties , including general surgery , internal medicine , nutrition , pulmonology , and infectious disease . although multiple strategies are advocated , even for different situations , it requires careful planning to determine the optimal choice in each case . the goals of abdominal reconstruction are ; restoration of function and integrity of the musculofascial abdominal wall , prevention of visceral eventration , and provision of dynamic muscle support . type i involves only the loss of skin and can be corrected with primary suture ; type ii is a myofascial defect with intact skin coverage for reconstruction of which a myofascial substitute is needed ; and type iii is a myofascial defect without skin coverage that needs autologous tissues and synthetic or biological mesh . our patient is included in type iii and was repaired by prosthetic mesh and tissue expanders . ideally , the abdominal wall is reconstructed by mobilizing local tissue and using existing fascia . however , primary closure performed under tension results in tissue ischemia , wound dehiscence , herniation , pulmonary complications secondary to increased intraabdominal pressure . the use of prosthetic mesh in conjunction with tissue - expanded skin provides a durable abdominal closure and is technically simpler than flap closure methods . with minimal donor site morbidity relative to most musculofascial techniques , tissue expansion provides well - vascularized skin and soft tissue over the prosthetic mesh , allows excision of unsightly scars and skin grafts and obtains excellent color and texture match . subcutaneously placed tissue expanders have been successfully used in surgical situations with the primary intent of expanding skin to achieve wound closure , including adult patients who had loss of the abdominal wall from either traumatic or infectious events and in pediatric patients with abdominal wall defects . subcutaneous placement under healthy skin provides sufficient skin and subcutis to be approximated and allows uncomplicated placement of expanders and ample recruitment of soft - tissue coverage , with prosthetic mesh being used to close fascial defects . but , the relatively superficial location of the expander can cause thinning of the skin and result in extrusion that necessitates early removal and placement of a new expander at a later date . subcutaneous tissue expansion does not result in any alteration to the structure of the musculofascia labdominal wall but can serve as an adjunct to bridge these defects . subfascial placement of expanders permits expansion of muscle and fascial layers to provide full - thickness autologous abdominal wall reconstruction , but at the cost of slightly more difficult dissection and subsequent removal . placing expanders in the plane between the transverse and internal oblique muscles is risky because this area contains the nervous and arterial supplies for these two muscles and the rectus . as a prevention , the vertical incision made in the posterior layer of the internal oblique aponeurosis should be minimal in length and performed with caution . from an anatomic point of view , the plane between the external oblique and internal oblique muscles seems to be the most convenient to use , but , it is a time - consuming , expensive form of therapy , as the process of gradual expansion takes several weeks resulting in limited enlargement of the structures needed . de ugarte et al . presented a novel approach to using tissue expanders placed within the intramuscular layers of the abdominal wall of a patient with a giant omphalocele , allowing creation of an outer layer composed of skin and internal and external oblique muscles . intraabdominal placement of tissue expanders offers the advantage of creating \" tissue flaps \" that include all layers of the abdominal wall , including skin , muscle , and peritoneum . onthe other hand , expansion of the abdominal cavity can increase intraabdominal pressure , impair respiratory function , cause visceral ischemia and increase the risk of displacement of viscera . the early use of tissue expanders to increase the amount of tissue available for coverage would be limited by the presence of intestinal contamination , stomas , and drains . before starting filling of the expander , a period of wound healingtissue expanders can become infected or exposed during the course of expansion with a related complication rate of less than 15 % . the predicted surface area gain after completion of tissue expansion often falls short of the clinical requirements . due to the reversible phenomena of expanded skin to retract after removal of the expanders , overexpansion ( 10 % to 20 % over implant capacity ) is necessary . instead of resorting to serial expansions , overexpansion techniques help in reaching the desired dimensions and avoiding a shortage of donor site for expansion , and eventually reconstruction can be completed in one - stage . it appears safe without risk of implant failure at least to 5 to 10 times the vendors ' stated maximum volume . as a conclusion , the ideal reconstruction of abdominal wall should provide tension - free repair and dynamic muscle support if possible . tissue expanders can be used as an additional therapeutic modality in the treatment of complex abdominal wall defects not amenable to delayed primary closure . the location for placement of a tissue expander depends on the medical condition and specific reconstructive needs of the patient . this method has provided reliable and durable abdominal wall closure with adequate soft - tissue coverage of prosthetic mesh as well as partially restoring abdominal domain . it also minimizes the potential mesh related complications , and is aesthetically superior to that achieved with skin graft and muscle flap techniques . when the size , place , and depth of the expander is chosen carefully , and the expanding process and antibiotic prophylaxis is managed properly , this staged method of abdominal wall reconstruction is safe and simple regarding the literature and our experience . although the expansion process takes longer and , in some countries , the use of expanders has some medical and socioeconomical problems ( cost , insurance coverage problems , etc ) it allows maximization of patient healing and provides good functional and aesthetic results as in our patient .\noutput:\n" }, { "from": "agent", "value": "reconstruction of large abdominal wall defects is a challenging problem . various reconstructive techniques have been described in the surgical literature each with its advantages and disadvantages . in this report we describe our experience in treating a patient with large abdominal wall defect by staged abdominal wall reconstruction utilizing prosthetic mesh in conjunction with tissue expanders . a 41 - year - old male presented with abdominal pain . exploratory laparotomy showed perforated appendicitis with intraabdominal abscess of 1,500 ml . postoperatively , he developed intraperitoneal sepsis . to prevent abdominal compartment syndrome , he was reoperated and left with \" open abdomen \" . after several open abdomen lavages , his abdominal wall defect was allowed to granulate . after epithelization of the defect , the abdominal wall was reconstructed using prosthetic mesh and tissue expanders . the tissue expansion process was well tolerated . we suggest that the use of tissue expanders provides reliable and well - vascularized soft - tissue coverage in abdominal wall reconstruction ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: primary central nervous system lymphoma ( pcnsl ) is an aggressive form of non - hodgkin lymphoma that develops in the brain , spinal cord , eyes , or leptomeninges without evidence of systemic involvement . high - dose methotrexate ( hd - mtx ) based chemotherapy followed by whole brain radiotherapy ( wbrt ) is the most common strategy for treatment of patients with pcnsl . in comparison of historical data , the combination therapy improves survival [ 1 - 3 ] . however , the combination approach is associated with higher risk of severe neurologic toxicity ( nt ) , particularly in elderly patients [ 1,3 - 5 ] . these include deferral of wbrt until tumor progression , hyperfractionated radiation schedule as in radiation therapy oncology group ( rtog ) 02 - 27 , substitution of wbrt with high - dose chemotherapy with autologous stem cell transplantation , or avoidance of wbrt in the elderly [ 5 - 7 ] . findings of a phase 3 randomized clinical trial ( g - pcnsl - sg - 1 ) showed no significant difference in overall survival ( os ) when wbrt was skipped after first - line chemotherapy , however , a disadvantage in progression - free survival ( pfs ) was proven regardless of chemotherapy response . therefore , it was thought that the benefit of wbrt in terms of pfs outweighed the increased risk of nt . although diverse methods have been proposed , wbrt remains an essential part of treatment because no equivalent effect has been demonstrated from the other alternatives . therefore , reducing radiation dose to the whole brain and using focal boost to the tumor bed could be a valid and practical way not only to minimize nt but also to maintain high tumor control rates . in the current study , we evaluated the outcome of sequential chemoradiotherapy ( crt ) using a low - dose wbrt with tumor bed boost for pcnsl . findings of this study might provide some insights for use in clinical practice or in establishment of future clinical trials . our study analyzed immunocompetent pcnsl patients who were treated with crt at seoul national university hospital from january 2000 to december 2011 . after pathologic confirmation , all patients received hd - mtx based chemotherapy and then completed the planned dose of radiotherapy . patients with involvement of extra - central nervous system ( cns ) sites or with history of other malignancy were excluded . the 38 men and 26 women had a median age of 56 years ( range , 23 to 75 years ) . pathologic confirmation was performed in all patients by stereotactic biopsy in 54 patients ( 84.4 % ) , gross total resection in seven ( 10.9 % ) , and subtotal resection in three ( 4.7 % ) . forty - nine patients ( 76.6 % ) had multifocal lesions . in 41 patients ( 64.1 % ) , the tumor had a deep structure involving the basal ganglia , corpus callosum , brainstem , or cerebellum . twenty - five patients ( 39.1 % ) had a poor performance status ( eastern cooperative oncology group [ ecog ] scale 2 ) at the time of radiotherapy planning . seven patients ( 10.9 % ) had involvement of malignant cells in the cerebrospinal fluid ( csf ) at the time of diagnosis . upfront chemotherapy with the median of 5 cycles ( range , 2 to 6 ) of the hd - mtx based regimen was used , which was similar to that used in the prior rtog 93 - 10 study . the dose of mtx was 2.5 - 3.5 g / m every two or three weeks . methotrexate was infused over 6 hours on day 1 of each cycle with pre - and post - infusion hydration . leucovorin rescue ( 20 mg orally every 6 hours for 12 doses ) started around 24 hours after the start of mtx infusion . procarbazine 100 mg / m was administered orally for seven days during cycles 1 , 3 , and 5 . intrathecal mtx was administered to 15 patients ( 23.4 % ) with positive csf cytology or suspicious leptomeningeal involvement . after completion of radiotherapy , two cycles of consolidation chemotherapy with high - dose cytarabine were used in 12 patients ( 18.8 % ) . in addition , the combination of rituximab , mtx , procarbazine , and vincristine was used in five patients ( 7.8 % ) and concurrent crt with temozolomide was used in three patients ( 4.7 % ) . evaluation of response to upfront chemotherapy using contrast - enhanced magnetic resonance imaging ( mri ) of the brain was performed in all patients before radiotherapy planning . complete response ( cr ) was defined as complete disappearance of all enhancing or abnormal lesions on mri ( assisted with diffusion - weighted or perfusion images if available ) and clearance of csf or ocular involvement . the median dose to the whole brain and to the tumor bed was 27 gy ( range , 18 to 36 gy ) and 50.4 gy ( range , 45 to 54 gy ) , respectively . photons of 4 or 6 mv with conventional fractionation ( 1.8 gy per day , five fractions per week ) were used . patients who achieved cr after upfront chemotherapy received the median dose of 27 gy ( range , 18 to 30.6 gy ) to the whole brain and median dose of 45 gy ( range , 45 to 54 gy ) to the tumor bed , whereas patients with non - cr received the median dose of 30.6 gy ( range , 19.8 to 36 gy ) to the whole brain and median dose of 50.4 gy ( range , 45 to 54 gy ) to the tumor bed . the median follow - up duration was 27 months ( range , 5 to 151 months ) . the response evaluation was performed one month after completion of radiotherapy and was repeated every 3 - 4 months for two years , every six months for up to five years , and yearly thereafter . because prospective neurologic function assessment was not performed , we performed retrospective analysis of nt in patients who achieved cr after radiotherapy . treatment - related nt was defined as the occurrence of grade 2 or more neurologic symptoms ( such as memory impairment , cognitive disturbance , or speech impairment ) by the national cancer institute common terminology criteria for adverse events ( nci ctcae ) ver . time to nt was calculated from completion of radiotherapy and was censored at the date of the last follow - up or at the time of intra - cns failure to make certain that nt could clearly result from treatment induced toxicity . pfs was defined as the time from the date of pathologic confirmation to the date of relapse , progression , or the last date of follow - up . os and pfs were determined using the kaplan - meier method and compared using the log - rank test . pearson s chi - square test or fisher s exact test was used for comparison of the distribution of clinical parameters between two groups . our study analyzed immunocompetent pcnsl patients who were treated with crt at seoul national university hospital from january 2000 to december 2011 . after pathologic confirmation , all patients received hd - mtx based chemotherapy and then completed the planned dose of radiotherapy . patients with involvement of extra - central nervous system ( cns ) sites or with history of other malignancy were excluded . the 38 men and 26 women had a median age of 56 years ( range , 23 to 75 years ) . pathologic confirmation was performed in all patients by stereotactic biopsy in 54 patients ( 84.4 % ) , gross total resection in seven ( 10.9 % ) , and subtotal resection in three ( 4.7 % ) . forty - nine patients ( 76.6 % ) had multifocal lesions . in 41 patients ( 64.1 % ) , the tumor had a deep structure involving the basal ganglia , corpus callosum , brainstem , or cerebellum . twenty - five patients ( 39.1 % ) had a poor performance status ( eastern cooperative oncology group [ ecog ] scale 2 ) at the time of radiotherapy planning . seven patients ( 10.9 % ) had involvement of malignant cells in the cerebrospinal fluid ( csf ) at the time of diagnosis . upfront chemotherapy with the median of 5 cycles ( range , 2 to 6 ) of the hd - mtx based regimen was used , which was similar to that used in the prior rtog 93 - 10 study . the dose of mtx was 2.5 - 3.5 g / m every two or three weeks . methotrexate was infused over 6 hours on day 1 of each cycle with pre - and post - infusion hydration . leucovorin rescue ( 20 mg orally every 6 hours for 12 doses ) started around 24 hours after the start of mtx infusion . procarbazine 100 mg / m was administered orally for seven days during cycles 1 , 3 , and 5 . intrathecal mtx was administered to 15 patients ( 23.4 % ) with positive csf cytology or suspicious leptomeningeal involvement . after completion of radiotherapy , two cycles of consolidation chemotherapy with high - dose cytarabine were used in 12 patients ( 18.8 % ) . in addition , the combination of rituximab , mtx , procarbazine , and vincristine was used in five patients ( 7.8 % ) and concurrent crt with temozolomide was used in three patients ( 4.7 % ) . evaluation of response to upfront chemotherapy using contrast - enhanced magnetic resonance imaging ( mri ) of the brain was performed in all patients before radiotherapy planning . complete response ( cr ) was defined as complete disappearance of all enhancing or abnormal lesions on mri ( assisted with diffusion - weighted or perfusion images if available ) and clearance of csf or ocular involvement . the median dose to the whole brain and to the tumor bed was 27 gy ( range , 18 to 36 gy ) and 50.4 gy ( range , 45 to 54 gy ) , respectively . photons of 4 or 6 mv with conventional fractionation ( 1.8 gy per day , five fractions per week ) were used . patients who achieved cr after upfront chemotherapy received the median dose of 27 gy ( range , 18 to 30.6 gy ) to the whole brain and median dose of 45 gy ( range , 45 to 54 gy ) to the tumor bed , whereas patients with non - cr received the median dose of 30.6 gy ( range , 19.8 to 36 gy ) to the whole brain and median dose of 50.4 gy ( range , 45 to 54 gy ) to the tumor bed . the median follow - up duration was 27 months ( range , 5 to 151 months ) . the response evaluation was performed one month after completion of radiotherapy and was repeated every 3 - 4 months for two years , every six months for up to five years , and yearly thereafter . because prospective neurologic function assessment was not performed , we performed retrospective analysis of nt in patients who achieved cr after radiotherapy . treatment - related nt was defined as the occurrence of grade 2 or more neurologic symptoms ( such as memory impairment , cognitive disturbance , or speech impairment ) by the national cancer institute common terminology criteria for adverse events ( nci ctcae ) ver . time to nt was calculated from completion of radiotherapy and was censored at the date of the last follow - up or at the time of intra - cns failure to make certain that nt could clearly result from treatment induced toxicity . pfs was defined as the time from the date of pathologic confirmation to the date of relapse , progression , or the last date of follow - up . os and pfs were determined using the kaplan - meier method and compared using the log - rank test . pearson s chi - square test or fisher s exact test was used for comparison of the distribution of clinical parameters between two groups . cr was observed in 27 patients ( 42.2 % ) after upfront chemotherapy , in 43 patients ( 67.2 % ) one month after completion of radiotherapy , and in 55 patients ( 85.9 % ) during the follow - up period . five patients developed tumor progression and one had primary refractory pcnsl with progression during crt . fourteen patients relapsed in the brain alone , six patients in the brain and csf space simultaneously , one patient in the csf space alone , and two patients had isolated ocular recurrence . two patients developed an isolated extra - cns relapse ( breast and retroperitoneum ) and one patient had systemic lymph node relapse . three - and 5 - year pfs was 47.9 % and 39.3 % , respectively ( figs . 1 and 2 ) . the results of univariate and multivariate analyses of os and pfs are shown in tables 2 and 3 . in univariate analysis , four factors were associated with os : age ( p = 0.022 ) , performance status ( p = 0.012 ) , involvement of deep structure ( p = 0.018 ) , and cr to sequential crt ( p = 0.019 ) . in addition , cr to sequential crt was the only factor showing association with better pfs ( p = 0.009 ) ( table 2 ) . among 55 patients who achieved cr after crt , 16 ( 29.1 % ) patients experienced nt . memory impairment occurred in 12 patients ( 21.8 % ) , speech impairment in eight ( 14.5 % ) , and cognitive disturbance in seven ( 12.7 % ) . in univariate analysis , age 60 was the only factor associated with freedom from nt ( ffnt ) : 3 - year ffnt rates were 71.5 % in patients younger than 60 and 32 % in those 60 ( p = 0.025 ) . other factors , including wbrt dose , co - administration of chemotherapy , or intrathecal chemotherapy did not show an association with ffnt . cr was observed in 27 patients ( 42.2 % ) after upfront chemotherapy , in 43 patients ( 67.2 % ) one month after completion of radiotherapy , and in 55 patients ( 85.9 % ) during the follow - up period . five patients developed tumor progression and one had primary refractory pcnsl with progression during crt . fourteen patients relapsed in the brain alone , six patients in the brain and csf space simultaneously , one patient in the csf space alone , and two patients had isolated ocular recurrence . two patients developed an isolated extra - cns relapse ( breast and retroperitoneum ) and one patient had systemic lymph node relapse . three - and 5 - year pfs was 47.9 % and 39.3 % , respectively ( figs . 1 and 2 ) . the results of univariate and multivariate analyses of os and pfs are shown in tables 2 and 3 . in univariate analysis , four factors were associated with os : age ( p = 0.022 ) , performance status ( p = 0.012 ) , involvement of deep structure ( p = 0.018 ) , and cr to sequential crt ( p = 0.019 ) . in addition , cr to sequential crt was the only factor showing association with better pfs ( p = 0.009 ) ( table 2 ) . among 55 patients who achieved cr after crt , 16 ( 29.1 % ) patients experienced nt . memory impairment occurred in 12 patients ( 21.8 % ) , speech impairment in eight ( 14.5 % ) , and cognitive disturbance in seven ( 12.7 % ) . in univariate analysis , age 60 was the only factor associated with freedom from nt ( ffnt ) : 3 - year ffnt rates were 71.5 % in patients younger than 60 and 32 % in those 60 ( p = 0.025 ) . other factors , including wbrt dose , co - administration of chemotherapy , or intrathecal chemotherapy did not show an association with ffnt . analysis of this single - institution experience suggests that low - dose wbrt with tumor bed boost after hd - mtx based chemotherapy is an effective method for management of pcnsl . results of our study demonstrated a comparable os with respect to previously reported studies using sequential crt ( table 4 ) [ 1 - 3,12 - 15 ] . in addition , an important role of radiotherapy was verified ; a higher cr rate was observed after radiotherapy than after upfront chemotherapy , and cr to sequential crt showed an association with improved os , whereas cr to upfront chemotherapy did not . in g - pcnsl - sg - 1 , an additional benefit of pfs was obtained in patients who did not achieve cr after upfront chemotherapy compared with those who did , suggesting the importance of wbrt for disease control . similarly , in this study , the cr rate increased after wbrt and was related to better os and pfs , because cr to sequential crt was a significant prognosticator . whether or not cr is achieved following upfront chemotherapy did not show an association with os or pfs . these findings indicate that radiotherapy after upfront chemotherapy was beneficial , particularly in patients with residual disease . whole brain doses of 20 to 50 gy with or without tumor bed boost are commonly used worldwide . it is well known that volume of radiotherapy should include the whole brain due to its infiltrating nature and involved field radiotherapy alone is insufficient . in addition , based on a historical review of the literature , some authors reported a dose dependent positive survival benefit of wbrt , although it could not be completely applicable because of somewhat old - fashioned data . therefore , in general , in our institution , low - dose wbrt was used , which might reduce the risk of nt and tumor bed boost was delivered in order to compensate for low whole brain dose . the possibility of tailoring the radiation dose and field understandably remains , however , it should be prospectively explored . some authors have doubts about the necessity of wbrt in patients with cr after chemotherapy . however , the impacts on treatment outcomes and complications of consolidative wbrt have rarely been assessed in prospective pcnsl trials . with regard to omitting wbrt , many trials are still exploring and no firm conclusion regarding response - based strategies has been made . during the period in which patients in this study were treated , consolidation wbrt against microscopic residual disease was mostly preferred to salvage wbrt at the time of failure in our institution . alternatively , radiotherapy doses were slightly reduced in cr patients , although it was not much different in the clinical setting . five - year os rates varying from 22 % to 56 % were reported . when compared with historical data , our survival results are slightly better . in a study reported by deangelis et al . , which provided the basis for our treatment strategies and used a similar chemotherapy regimen , the 3 - year os was 52 % , which is comparable to the 59.8 % of our study . the authors used a whole brain dose of 45 gy or 36 gy given in 1.2 gy fractions twice daily . we achieved a more favorable outcome using a lower whole brain dose of median 27 gy and boost to the tumor bed . because we excluded patients who did not receive crt or complete radiotherapy , selection bias might have improved our survival . nevertheless , our results are impressive and demonstrate that sequential crt is quite effective even with a slightly lower dose of wbrt . in our previous report describing treatment administered from 1981 to 1997 , doses to the whole brain ranged from 36 gy to 50.4 gy with a total median dose of 54 gy to the tumor bed . median os of 63 months in the current study was more than twice as long as that previously reported of 29 months , although chemotherapy was administered to only 16 patients ( 40 % ) in the previous study . some authors also investigated radiotherapy dose reduction in patients without residual disease after primary chemotherapy , considering that nt was closely associated with this factor . shah et al . reported that 2 - year os was 89 % for patients treated with wbrt of 23.4 gy after achieving cr in response to upfront chemotherapy , which was similar to patients who received wbrt of 45 gy after obtaining non - cr in response to chemotherapy . in addition , ferreri et al . proposed that patients in cr after chemotherapy should be treated with wbrt of 30 to 36 gy because disease control using this dose did not differ from wbrt of 40 to 44 gy , whereas neurologic impairment was more common in patients treated after wbrt with more than 40 gy . the authors used tumor bed boost like ours and reported a 5 - year os of 54 % , which corresponded well with our results . in line with the preceding results , the results of the current study support the contention that wbrt dose can be reduced without compromising survival . to the contrary , bessell et al . , who conducted a nonrandomized prospective study using wbrt with dose reduction from 45 gy to 30.6 gy in patients with cr after chemotherapy , reported that reduced - dose wbrt resulted in higher relapse rate and lower os in patients younger than 60 ( 3 - year os 92 % vs. 60 % , p = 0.04 ) . however , their chod / bvam regimen could not penetrate the blood - brain barrier of the cns , except mtx , and was thought to be less effective as being evaluated in rtog 88 - 06 . in addition , the mtx dose of 1.5 g / m was lower than doses used in recent regimens . these reasons may suggest a disadvantage of low dose wbrt , although it may be not reproducible with modern chemotherapy regimens . however , potential negative effects on tumor control from a reduced - dose approach should be kept in mind . another strategy that has been investigated for replacement of wbrt is high - dose chemotherapy with autologous peripheral blood stem cell transplantation ( apbsct ) . in limited patients who are young orhave good performance status , this approach can be used to escalate chemotherapy dose as well as to eliminate the need for wbrt . preliminary studies with small numbers of patients demonstrated its feasibility , however , pfs was not satisfactory compared with that achieved with wbrt . however , encouraging results have been reported , suggesting that high - dose chemotherapy with apbsct may have a role in selected patients or in salvage settings because of lack of cross resistance with mtx . conduct of further studies will be needed in order to clarify the optimal indications and treatment regimens . the nt rate in this study was lower than those reported in many other studies , probably due to low - dose wbrt , although direct comparison could not be made because of various examining methods and grading systems . however , our result showing an association of old age with higher risk of nt coincides well with the previous report showing that risk of nt at seven years for patients aged 60 years was 58 % , compared with 27 % for those aged 60 years . despite the lack of a formal neuropsychiatric assessment , these findings supported that dose reduction of wbrt in the elderly would be helpful . further prospective , randomized studies with appropriate neurologic function tests are needed in order to draw definitive conclusions . first , this was a retrospective study , as with many other studies on pcnsl , due to its rarity . second , the small number of patients and relatively short follow - up duration restricted statistical power . false - negative results might confound evaluation of survival and prognostic factors . despite these limitations , the results can be informative because we evaluated a homogeneous population of patients treated with relatively consistent methods over the period of study . in conclusion , treatment failure and iatrogenic nt are the main obstacles in management of pcnsl patients . findings of our study suggest that low - dose wbrt with tumor bed boost after hd - mtx based chemotherapy is an effective and reasonable solution to overcoming these problems . in addition , omitting or deferring wbrt in elderly patients could be considered because considerable incidence of nt was observed . conduct of larger prospective studies is needed in order to confirm our results and to clarify treatment policy .\noutput:\n" }, { "from": "agent", "value": "purposethe purpose of this study is to evaluate the outcome of low - dose whole brain radiotherapy ( wbrt ) with tumor bed boost after methotrexate - based chemotherapy in the management of primary central nervous system lymphoma ( pcnsl ) . materials and methodswe retrospectively analyzed 64 patients with pathologically proven pcnsl between 2000 and 2011 . methotrexate - based chemotherapy with a median of five cycles was followed by radiotherapy to the whole brain and to the initial tumor bed . the median dose to the whole brain and to the tumor bed was 27 gy ( range , 18 to 36 gy ) and 50.4 gy ( range , 45 to 54 gy ) , respectively.resultswith a median follow - up period of 27 months , 55 patients ( 85.9 % ) achieved complete response ( cr ) . the 5 - year overall survival ( os ) and progression - free survival ( pfs ) rates were 52.6 % and 39.3 % , respectively . in univariate analysis , factors associated with os were age , performance status , involvement of deep structure , and cr to sequential chemoradiotherapy ( crt ) . these variables remained as significant factors for os in multivariate analysis . cr to sequential crt was the only positive factor associated with pfs ( p = 0.009 ) . neurologic toxicity was more common in elderly patients older than 60 years ( p = 0.025 ) . conclusionlow - dose wbrt with tumor bed boost after methotrexate - based chemotherapy might be an effective method for management of pcnsl ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: visualization of the spinal cord in zebrafish is inhibited by a number of factors . due to the thickness of the overlyingsomites and the internal location of the spinal cord , a considerably long working distance is required for high cellular resolution . the yolk ball ( which is still present during early stages of neurogenesis ) further increases the working distance required , and is easily damaged by pressure from a coverslip . though cross sections in the dorso - ventral ( dv ) axis are possible , they do not readily permit simultaneous visualization in the anterior - posterior ( ap ) axis . to overcome these obstacles , first , zebrafish embryos readily lie with the lateral side facing upwards , which facilitates ap axis visualization . second , removal of the yolk ball decreases the required working distance , and limits debris . fourth , mounted embryos are stable for months at 4 c , allowing prolonged specimen visualization . finally , progression of development occurs in that anterior segments are more mature than posterior segments . in order to ensure that stagedmatched spinal hemisegments are compared between embryos , overlying somite tissue is used as a guide . for example , the tenth most posterior somite overlies the tenth spinal hemisegment , which is developmentally equivalent in stage - matched embryos . we use genetics and gene knock - down technologies to study the mechanisms of axon guidance in the developing spinal cord . in particular , we have determined that robo2 , robo3 , and dcc are required for commissural primary ascending ( copa ) axon pathfinding . using the mounting procedure described here , we were able to examine ventral growth , midline crossing , commissure width , dorsal and anterior growth . this mounting procedure may also be applied to dv or ap patterning of the spinal cord . we have used this procedure to determine disparate roles of downstream wnt effectors in dv patterning of the spinal cord . using this mounting , we were able to obtain resolution of dv markers at the single cell level , and determine minute patterning shifts as a result of altered wnt signal reception . this mounting procedure also allows for mitotic index calculation through anti - phosphohistone 3 or brdu labeling ( progenitor proliferation ) differentiation . place embryos in a 35 mm petri dish filled with buffer of choice ( figure 1a ) . typically pbs - based buffers are suitable . under a dissecting microscope , and using forceps , secure the head with one pair of forceps while pulling the yolk away with the other pair ( figure 1b ) . alternatively , use an insect pin in an insect pin holder to gently pull away the yolk . using the embryo poker ( fishing line ( 0.41 mm diameter ) glued to either a capillary tube or a pasteur pipette ) move the embryos to a part of the petri dish that does not have a lot of yolk debris ( figures 1c - d ) . using a glass pasteur pipette , aspirate the embryos in as little liquid as possible , and gently pipette them onto a slide ( figure 1e ) .70 % glycerol may be used as a mounting medium . using the embryo poker , orient the embryos on their sides in rows ( figure 1f ) . add one \" dab \" of petroleum jelly or high vacuum grease to each corner of a coverslip ( figure 1 g ) . place coverslip ( petroleum jelly side down ) on top of embryos ( figure 1h ) . gently tap the coverslip on each corner until the mounting media ( 70 % glycerol or anti - fade mounting reagent ) is touching the coverslip ( figure 1h ) . if necessary , add more mounting media by pipetting right next to the coverslip , using a pipettor in the range of 20 - 200 ml . it will wick under . using a laboratory wipe , completely clean around the coverslip . be certain to not apply pressure to the coverslip , as this will damage embryos . this area must be dry and have no petroleum jelly or mounting media on it . use nail polish to seal around the edge of the coverslip ( figure 1i ) . place embryos in a 35 mm petri dish filled with buffer of choice ( figure 1a ) . typically pbs - based buffers are suitable . under a dissecting microscope , and using forceps , secure the head with one pair of forceps while pulling the yolk away with the other pair ( figure 1b ) . alternatively , use an insect pin in an insect pin holder to gently pull away the yolk . using the embryo poker ( fishing line ( 0.41 mm diameter ) glued to either a capillary tube or a pasteur pipette ) move the embryos to a part of the petri dish that does not have a lot of yolk debris ( figures 1c - d ) . using a glass pasteur pipette , aspirate the embryos in as little liquid as possible , and gently pipette them onto a slide ( figure 1e ) .70 % glycerol may be used as a mounting medium . using the embryo poker , orient the embryos on their sides in rows ( figure 1f ) . add one \" dab \" of petroleum jelly or high vacuum grease to each corner of a coverslip ( figure 1 g ) . place coverslip ( petroleum jelly side down ) on top of embryos ( figure 1h ) . gently tap the coverslip on each corner until the mounting media ( 70 % glycerol or anti - fade mounting reagent ) is touching the coverslip ( figure 1h ) . if necessary , add more mounting media by pipetting right next to the coverslip , using a pipettor in the range of 20 - 200 ml . it will wick under . using a laboratory wipe , completely clean around the coverslip . be certain to not apply pressure to the coverslip , as this will damage embryos . this area must be dry and have no petroleum jelly or mounting media on it . use nail polish to seal around the edge of the coverslip ( figure 1i ) . when elucidating the mechanisms that underlie various developmental events such as cellular patterning , differentiation , and axon guidance , it is important to be able to visualize cells within the context of their tissue . dorsoventral patterning defects typically present as a ventral or dorsal shift in the expression domain of transcription factors in the pax , nkx , or dbx families . at timeshowever , reagents with weaker signals , or cross sections that are not perpendicular to the ap axis can limit interpretation . further , cross sectional analysis does not readily take into account whether changes persist in the ap axis , and relies on the availability of a cryostat . as seen in figure 2b , nkx6 .1 mrna is distributed in roughly the ventral half of the spinal cord at 24 hr post - fertilization ( hpf ) , within the progenitor domain . progenitor cells are distinguishable from post mitotic cells due to presence of the floor plate , which is found in the medial part of the spinal cord . viewed with dic optics , individual cells are clearly distinguishable , and a defined boundary between expressing and nonexpressing cells is evident . for example , all post - mitotic neurons express huc / d which is detectable with immunocytochemistry . mrna probes for islet , gata , and vsx families label specific post - mitotic neurons of consistent position and number within each spinal cord hemisegment . in addition , axon guidance receptors such as those in the robo family are expressed in restricted populations of postmitotic neurons ( figure 2c ) . similarly , progenitors that continue to divide can be quantified with anti - phospho - histone 3 immunocytochemistry as well as brdu labeling . , axons of the following postmitotic neurons can be visualized with various methods , and are distinguishable at the single cell level : dorsal lateral ascending ( dola ) , commissural primary ascending ( copa ) , commissural secondary ascending ( cosa ) , ventral longitudinal descending ( veld ) , kolmer - agdur ( ka ) , commissural bifurcating / longitudinal ( cob / l ) , circumferential ascending ( cia ) , circumferential descending ( cid ) , and unipolar commissural descending ( ucod ) , rohon - beard ( r - b ) , motoneurons ( m ) . axons extend from these neurons in the dorsal , ventral , anterior , and posterior directions . they branch , cross the midline , and exit both the dorsal and ventral spinal cord . when coupled with confocal laser scanning microscopy , these varied cellular behaviors are evident in laterally mounted embryos , using immunocytochemistry and genetically encoded fluorescent proteins such as gfp . in figure 2d , embryos are placed in a 35 mm petri dish filled with pbt ( pbs with 0.5 % triton x-100 ) or ptw ( pbs with 0.1 % tween - 20 ) . ( b ) the yolk is removed by securing the head of the embryo followed by careful dissection . ( c ) an embryo poker ( fishing line glued to a pasteur pipette ) is used to separate embryos and yolk debris ( d ) . cleaned embryos are pipetted onto a microscope slide ( e ) and aligned ( f ) . ( g ) petroleum jelly ( h ) the coverslip is placed gently on top of the embryos in mounting medium . ( i ) nail polish is used to seal the edges of the coverslip . click here to view larger image . analysis of gene expression patterns and axon pathfinding in laterally mounted zebrafish embryos . ( a ) drawing of a zebrafish embryo at 24 hpf . in b - d , roughly four hemisegments above the yolk sac extension are visualized ( boxed area ) . ( b ) nkx6 .1 is expressed in the ventral spinal cord , including the floor plate ( fp ) . the floor plate and progenitor zone is not evident in this more lateral focal plane . in b , c , the spinal cord is bounded by a bracket on the left hand side of the image . ( d ) confocal microscopy was used to image znp - 1 immunofluorescence , which labels motor axons exiting the spinal cord ventrally . in all images ,0.8 ) lens was used ( 3.3 mm ) . click here to view larger image . lateral mounting of fixed zebrafish embryos aids visualization of spinal cord development . through removal of the yolk ball , our representative results were limited to the 24 hpf stage , however , this technique can be used as early as 18 hpf , though earlier embryos are more difficult to dissect due to the size of the embryo and the fragility of the tissue . aided by the optical clarity of the embryonic zebrafish , the ability to perform forward genetic screens , reverse genetics , and transgenic approaches , several developmental processes may be investigated . this includes mitotic indices of neuronal progenitors with markers like brdu and anti - phospho - histone 3 and patterning through expression of neuronal and glial progenitor markers in the pax , nkx , dbx , and olig families . reagents that report glial and neuronal determination ( such as glial fibrillary acid protein ( gfap ) and huc / d ) can be used . neuronal subtype differentiation can be analyzed through expression of islet , vsx , engrailed , and gata genes . and finally , analysis of axon guidance is possible through antibodies such as anti - acetylated tubulin , 3a10 , and znp - 1 . though other vertebrate model systems ( mouse and chick ) are used to study spinal cord development , only the zebrafish permits simultaneous viewing of all developmental axes in the intact embryo . the obvious limitation to this approach is that the embryos are fixed , which precludes live imaging . in fact , removal of ( or damage to ) the yolk results in rapid embryonic death , thus it is not possible to reduce the working distance in live embryos using this technique . however , high magnification spinal cord imaging in live embryos is possible . in order to preserve the yolk during live imaging , embryos can be placed in depression slides , which provide a larger space between the specimen and the coverslip . alternatively , several 22 mm x 22 mm coverslips can be glued on either slide of a 3 in x 1 in microscopic slide . if embryos are older than 18 hpf , tricaine is used to anesthetize embryos to prevent movement . while a working distance of 0.288 mm is required for deyolked embryos at 24 hpf , when working with live embryos embedded in agarose , with intact yolks , a microscopic lens with a working distance of 3.3 mm is sufficient . alternatively , explant cultures derived from deyolked embryos may be visualized using a plasma clot immobilization technique . various populations of cells can be observed through the use of genetically encoded fluorescent proteins such as gfp , mcherry , or the photoconvertible dye kaede ( to name a few ) . further , fluorescently labeled cells within chimeric embryos can also be viewed with this approach . a consistent mounting technique that is stable for monthsfurthermore , the alignment of embryos in rows readily permits identification of specific embryos for later analysis .\noutput:\n" }, { "from": "agent", "value": "the zebrafish spinal cord is an effective investigative model for nervous system research for several reasons . first , genetic , transgenic and gene knockdown approaches can be utilized to examine the molecular mechanisms underlying nervous system development . second , large clutches of developmentally synchronized embryos provide large experimental sample sizes . third , the optical clarity of the zebrafish embryo permits researchers to visualize progenitor , glial , and neuronal populations . although zebrafish embryos are transparent , specimen thickness can impede effective microscopic visualization . one reason for this is the tandem development of the spinal cord and overlying somite tissue . another reason is the large yolk ball , which is still present during periods of early neurogenesis . in this article , we demonstrate microdissection and removal of the yolk in fixed embryos , which allows microscopic visualization while preserving surrounding somite tissue . we also demonstrate semipermanent mounting of zebrafish embryos . this permits observation of neurodevelopment in the dorso - ventral and anterior - posterior axes , as it preserves the three - dimensionality of the tissue ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: prostate cancer ( cap ) has the highest incidence among cancers in the us and is the second leading cause of cancer - associated death in men . in korea , its incidence is still increasing , compared to that of other cancers and it ranked fifth in incidence in 2005 . despite recent improvements in diagnosis and therapeutic techniques , the survival rate of cap patients is poor because of the recurrence of the disease . the lack of effective therapies for advanced cap is related to a large extent to poor understanding of the molecular mechanisms underlying the progression of this disease ( invasion and metastasis ) . identification of predictive markers for cap , especially those that are indicative of the invasiveness of the disease , is important for improving clinical management , outcomes , and survival of these patients . the s100 calcium - binding proteins have recently attracted considerable interest because of their differential expression in neoplastic and normal tissues , and their involvement in metastatic processes . s100 proteins are involved in a variety of intracellular and extracellular functions including cell growth , cell - to - cell communication , energy metabolism , and intracellular signal transduction . s100a2 is tumor - suppressor gene that is typically down - regulated in cells that have acquired a tumorigenic phenotype , which suggests that s100a2 has an important role in inhibiting cancer progression . differential expression of s100a2 has been reported in breast cancer , melanoma , and other types of cancer [ 9 - 14 ] . s100a4 , another member of the s100 protein family , is associated with the invasion and metastasis of malignant tumors . s100a4 is frequently overexpressed in metastatic tumors , as well as in normal cells with uninhibited movement , such as macrophages , neutrophils , and t - lymphocytes . it is also overexpressed in various cancer types such as those of the breast , ovary , and colon . in this study , we aimed to determine the expression pattern of s100a2 and s100a4 and to assess the prognostic value of these markers in patients with prostate adenocarcinoma . immunohistochemical staining for s100a2 and s100a4 was performed on 26 tissue samples obtained during transurethral resection from patients with benign prostatic hyperplasia ( bph ) and 67 tissue samples obtained during prostate biopsy ( n = 7 ) and radical prostatectomy ( n = 60 ) from patients with prostate carcinoma . we divided the cap tissue samples ( n = 67 ) into 3 groups based on their gleason grade : gleason grade 6 or lower ( low grade ) ( n = 24 , 35.8 % ) , gleason grade 7 ( intermediate grade ) ( n = 24 , 35.8 % ) , and gleason grade 8 or higher ( high grade ) ( n = 19 , 28.4 % ) . the samples were also assigned to one of three groups based on clinical stage : localized cap ( n = 36 , 53.7 % ) , locally advanced cap ( n = 13 , 19.4 % ) , and metastatic cap ( n = 18 , 26.9 % ) . formalin - fixed , paraffin - embedded , 5 m - thick sections were dewaxed in xylene , rehydrated in graded solutions of alcohol , and placed in an endogenous peroxide - blocking solution for 15 min . sections were placed in a citrate buffer ( 10 % citrate buffer stock in distilled water , ph 6.0 ) . nonreactive staining was blocked by incubation with 1 % horse serum in tris - buffered saline ( ph 6.0 ) for 3 min . minneapolis , mn , usa ) and s100a4 ( thermo scientific , waltham , ma , usa ) were incubated with the sections overnight . antibody - binding was detected by use of a standard labeled streptavidin - biotin system ( life science division , mukilteo , usa ) . positive staining in the cytoplasm of tumor cells was defined as reddish - brown staining in at least 10 % of the tumor cells in a section . a semiquantitative scale of 0 to 3the immunoreactive score was determined by the percentage of positive cells and the staining intensity , ranging from no detectable signal ( 0 ) to a strong signal seen at lower - power magnification ( 3 ) . each image was scored as 0 ( 0 % , negative ) , 1 ( 10 - 30 % , weak ) , 2 ( 30 - 70 % , moderate ) , or 3 ( 70 - 100 % , strong ) and classified as low expression ( score 0 and 1 ) and high expression ( score 2 and 3 ) ( fig . 1 , 2 ) . we examined the difference in s100a2 and s100a4 expression between bph and cap samples among the groups , which were classified based on localization of cap . biochemical progression - free survival was determined based on levels of prostate - specific antigen ( psa ) and studied by use of the kaplan - meier product limit analysis . all analyses were performed using the statistical package for social sciences ( spss ) , version 12.0 for windows . immunohistochemical staining for s100a2 and s100a4 was performed on 26 tissue samples obtained during transurethral resection from patients with benign prostatic hyperplasia ( bph ) and 67 tissue samples obtained during prostate biopsy ( n = 7 ) and radical prostatectomy ( n = 60 ) from patients with prostate carcinoma . we divided the cap tissue samples ( n = 67 ) into 3 groups based on their gleason grade : gleason grade 6 or lower ( low grade ) ( n = 24 , 35.8 % ) , gleason grade 7 ( intermediate grade ) ( n = 24 , 35.8 % ) , and gleason grade 8 or higher ( high grade ) ( n = 19 , 28.4 % ) . the samples were also assigned to one of three groups based on clinical stage : localized cap ( n = 36 , 53.7 % ) , locally advanced cap ( n = 13 , 19.4 % ) , and metastatic cap ( n = 18 , 26.9 % ) . formalin - fixed , paraffin - embedded , 5 m - thick sections were dewaxed in xylene , rehydrated in graded solutions of alcohol , and placed in an endogenous peroxide - blocking solution for 15 min . sections were placed in a citrate buffer ( 10 % citrate buffer stock in distilled water , ph 6.0 ) . nonreactive staining was blocked by incubation with 1 % horse serum in tris - buffered saline ( ph 6.0 ) for 3 min . minneapolis , mn , usa ) and s100a4 ( thermo scientific , waltham , ma , usa ) were incubated with the sections overnight . antibody - binding was detected by use of a standard labeled streptavidin - biotin system ( life science division , mukilteo , usa ) . positive staining in the cytoplasm of tumor cells was defined as reddish - brown staining in at least 10 % of the tumor cells in a section . a semiquantitative scale of 0 to 3the immunoreactive score was determined by the percentage of positive cells and the staining intensity , ranging from no detectable signal ( 0 ) to a strong signal seen at lower - power magnification ( 3 ) . each image was scored as 0 ( 0 % , negative ) , 1 ( 10 - 30 % , weak ) , 2 ( 30 - 70 % , moderate ) , or 3 ( 70 - 100 % , strong ) and classified as low expression ( score 0 and 1 ) and high expression ( score 2 and 3 ) ( fig . 1 , 2 ) . we examined the difference in s100a2 and s100a4 expression between bph and cap samples among the groups , which were classified based on localization of cap . biochemical progression - free survival was determined based on levels of prostate - specific antigen ( psa ) and studied by use of the kaplan - meier product limit analysis . all analyses were performed using the statistical package for social sciences ( spss ) , version 12.0 for windows . the age of the patient did not differ significantly between patients with bph ( 68.288.05 years ) and cap ( 68.698.26 years ) ( p = 0.082 ) ( table 1 ) . we observed that the expression of s100a4 was significantly higher than that of s100a2 in cap tissues ( p 0.05 ) ( table 2 ) . in bph tissues , the expression of s100a2 was higher than that of s100a4 ( p 0.05 ) ( table 2 ) . the age and follow up periods of patients did not differ significantly among the groups of cap patients ( p 0.05 ) . we observed that the psa level of patients was significantly different among groups according to clinical stage ( p = 0.023 ) , but not significantly different among groups according to pathologic grade ( p = 0.264 ) ( table 1 ) . a significant progressive increase in s100a4 expression and decrease in s100a2 expressionwas observed in cancer specimens according to clinical stage and the pathologic grade ( gleason score ) ( p 0.05 ) ( table 3 , 4 , fig . 1 , 2 ) . the spearman correlation between s100a2 and s100a4 was found to be - 0.55 ( p 0.001 ) based on mean that the total of every specimen . of the 67 patients with cap , 10 ( 14.9 % ) had evidence of biochemical relapse and 4 ( 5.9 % ) died from prostate cancer . the length of biochemical relapse - free survival among the 18 patients with immunoreactive scores of 2 or 3 ( group 2 ) for s100a2 was statistically longer than among the 49 patients with immunoreactive scores of 0 or 1 ( group 1 ) ( log - rank , p = 0.035 ) ( fig . the length of biochemical relapse - free survival among the 26 patients with an immunoreactive score of 0 or 1 ( group 3 ) for s100a4 was statistically longer than among the 41 patients with an immunoreactive score of 2 or 3 ( group 4 ) for s100a4 ( log - rank , p = 0.021 ) ( fig . the age of the patient did not differ significantly between patients with bph ( 68.288.05 years ) and cap ( 68.698.26 years ) ( p = 0.082 ) ( table 1 ) . we observed that the expression of s100a4 was significantly higher than that of s100a2 in cap tissues ( p 0.05 ) ( table 2 ) . in bph tissues , the expression of s100a2 was higher than that of s100a4 ( p 0.05 ) ( table 2 ) . the age and follow up periods of patients did not differ significantly among the groups of cap patients ( p 0.05 ) . we observed that the psa level of patients was significantly different among groups according to clinical stage ( p = 0.023 ) , but not significantly different among groups according to pathologic grade ( p = 0.264 ) ( table 1 ) . a significant progressive increase in s100a4 expression and decrease in s100a2 expression was observed in cancer specimens according to clinical stage and the pathologic grade ( gleason score ) ( p 0.05 ) ( table 3 , 4 , fig . 1 , 2 ) . the spearman correlation between s100a2 and s100a4 was found to be - 0.55 ( p 0.001 ) based on mean that the total of every specimen . of the 67 patients with cap , 10 ( 14.9 % ) had evidence of biochemical relapse and 4 ( 5.9 % ) died from prostate cancer . the length of biochemical relapse - free survival among the 18 patients with immunoreactive scores of 2 or 3 ( group 2 ) for s100a2 was statistically longer than among the 49 patients with immunoreactive scores of 0 or 1 ( group 1 ) ( log - rank , p = 0.035 ) ( fig . the length of biochemical relapse - free survival among the 26 patients with an immunoreactive score of 0 or 1 ( group 3 ) for s100a4 was statistically longer than among the 41 patients with an immunoreactive score of 2 or 3 ( group 4 ) for s100a4 ( log - rank , p = 0.021 ) ( fig . the s100 proteins are small acidic proteins ( 10 - 12 kda ) that are found exclusively in vertebrates . with at least 25 members of this protein family identified to date in humans , the s100 proteins constitute the largest subfamily of ef - hand proteins . of these ,21 family members ( s100a1 - s100a18 , trichohyalin , filaggrin and repetin ) have genes clustered at chromosome locus 1q21 ; other s100 proteins are found at chromosome loci 4p16 ( s100p ) , 5q14 ( s100z ) , 21q22 ( s100b ) , and xp22 ( s100 g ) . first identified by moore in 1965 , the s100 proteins exhibit 25 - 65 % identity at the amino acid level and contain 2 ef - hand motifs flanked by conserved hydrophobic residues separated by a linker region . the sequences of the linker region and the c - terminal extension are the most variable parts of the sequence among the s100 proteins . the s100 proteins are hypothesized to participate in signal trans duction pathways that regulate cell cycle progression and differentiation ; however , the precise functions of these proteins are unknown . the gene is located on chromosome 1q21 , in a region that is frequently rearranged in a number of human cancers . expression of s100a2 is regulated during the cell cycle , with its levels increasing as cells enter the s phase , and induced by growth factors in the early g1 phase of the normal cell cycle . because s100a2 is believed to be regulated by the tumor - suppressor p53 , induction of p53 activity by cell cycle arrest caused by dna damage results in increased s100a2 transcription . the loss of s100a2 expression is associated with the development and progression of some human cancers [ 9 - 14 ] . recently , s100a2 was proposed to be a class ii tumor suppressor gene because of its loss of expression in a large number of tumors . this loss of expression is believed to influence the regulation of genes that are important for normal cell growth and differentiation . in our study , we observed decreased s100a2 expression in cap . it is important to emphasize that we observed decreased s100a2 expression only in cap and not in bph ( nonmalignant ) . another member of the s100 family of proteins is s100a4 , which influences cell cycle progression and cell motility , and modulates intracellular adhesion and invasiveness . expression of the s100a4 gene has been linked to invasion and metastasis of cancer cells and is upregulated in a number of human cancers . amplification or overexpression of s100a4 in patients with breast cancer reflects increased metastatic potential of the cancer , which is prognostically significant and closely correlated with death . s100a4 has been reported to be expressed in 44 % of foci of carcinoma within colon adenoma specimens and 94 % of those of colon carcinoma specimens . in our study , we observed high expression of s100a4 in invasive cap . we also observed that decreased expression of s100a4 gene reduces the growth and proliferative potential of cap . these results indicate that the s100a4 protein may be associated with proliferation , invasion , and metastasis during the progression of cap . during about 5 years of follow - up , 10 of 67 ( 14.9 % ) patients had a biochemical relapse based on psa levels . we found that the length of biochemical relapse - free survival was longer in those patients with higher expression of s100a2 and shorter for those with higher expression of s100a4 . our study was limited by its retrospective design , the relatively small number of patients , and the short length of follow - up . this makes it difficult to draw definitive conclusions . because a single pathologist assessed the immunohistochemical staining of samples in a blinded fashion , interobserver variance was not tested in this study . we found an inverse relationship between expression of s100a2 and s100a4 protein in cap and bph . reduced expression of s100a2 and increased expression of s100a4 in cap was associated with clinical advancement and biologic aggressiveness of tumors . hence , the simultaneous analysis of s100a2 and s100a4 expression in prostate tissues may be a useful prognostic marker for cap .\noutput:\n" }, { "from": "agent", "value": "purposethe aim of this study was to investigate the expression pattern of calcium - binding proteins s100a2 and s100a4 . we also sought to determine the prognostic value of these markers for patients with prostate adenocarcinoma.materials and methodsimmunohistochemical staining was performed to detect s100a2 and s100a4 expression in 26 tissue samples obtained during transurethral resection from patients with benign prostatic hyperplasia ( bph ) and in 67 tissue samples obtained during prostate biopsy and radical prostatectomy from patients with prostate carcinoma . the immunoreactivity of these proteins was stratified on a scale of 0 to 3 and was correlated with the pathologic features of prostate adenocarcinoma.resultshigh expression of s100a2 was observed in the tissue of patients with bph , whereas low or no expression was observed in prostate cancer ( cap ) cells . the protein level of s100a4 was significantly higher in cap than in bph cells . the higher level of s100a4 observed in cap tissue correlated with increasing tumor grade.conclusionsdecreased expression of s100a2 and increased expression of s100a4 may be important in the progression of cap . this finding could aid in identifying aggressive cap . the simultaneous analysis of s100a2 and s100a4 expression in prostate tissues may be a useful prognostic marker for cap ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the prevalence of obesity has been increasing , both in developed and developing countries . in taiwan , according to the department of health , executive yuan , r.o.c . ( nutrition and health survey , 2005 - 2008 ) , 51 % of the adult male population and 36 % of the adult female population are overweight or obese . the impact of obesity on society is huge because of its associated morbidity and mortality . the absence of effective conservative treatment , combined with the development of laparoscopic surgery , has led to a significant increase in the amount of bariatric surgery . the common laparoscopic techniques are gastric bending , sleeve gastrectomy , gastric bypass , and biliopancreatic surgery . however , the surgical procedures may have some complications occasionally . neurological complications , including peripheral neuropathy , myotonic syndrome , myelopathy , burning feet syndrome , meralgia paresthetica , lumbosacral plexopathy , and wernicke - korsakoff encephalopathy , are increasingly recognized . peripheral neuropathies are the most frequent neurological complications , and can affect up to 16 % of operated patients . the objective of this report is to highlight the symptoms of this type of complication , and to emphasize that prognosis depends on the time between the beginning of the symptoms and institution of treatment . a 24 - year - old woman underwent a successful laparoscopic gastric bypass on june 2008 for super morbid obesity ( body weight 166 kg , body mass index 61.7 ) . the differential diagnoses of symptoms include nutritional deficit and internal hernia . in the following 4 months , she lost 32 kg , her weight falling from 166 to 134 kg . approximately 5 months after the surgery , she noticed muscle weakness in her lower limbs and experienced difficulty in walking and standing . the symptoms worsened progressively and she developed generalized weakness and ultimately became bed - ridden . she could not move her ankles and feet , and the strength of her hips was only grade 2 according to the five - point scale of medical research council of the great britain . the strength of the upper limbs was grade 3 in proximal arms and grade 1 in distal hands . foot drop and wrist drop developed and there was marked distal limb muscle atrophy [ figures 1 and 2 ] . the laboratory findings were within normal ranges , including complete blood cell counts , creatinine kinase , liver function , renal function , vitamin b12 , thyroid stimulating hormone ( tsh ) , and serum electrolyte levels . magnetic resonance imaging ( mri ) of the cervical spine without contrast enhancement was normal [ figure 3 ] . electromyography was done to confirm the clinical suspicion of neuropathy ; it showed the presence of sensorimotor axonal polyneuropathy . according to the clinical presentation , two months after she had become bed - ridden , intravenous replacement therapy with vitamin b complex was started : 1 ml of b - complex was given once daily ( containing 100 mg of thiamine , 5 mg of riboflavin , 5 mg of pyridoxine , 50 mg of nicotinamide , and 5 mg of sodium pantothenate ) . the inability to extend the wrist and finger upwards when the hand is palm down , in the patient with peripheral neuropathy after bariatric surgery for morbid obesity bilaterally foot drop and marked distal limb muscle atrophy were found in the patient with peripheral neuropathy after bariatric surgery for morbid obesity . this patient could not sit up , someone behind push her forward sagittal t2 - weighted mr images of cervical spine showed no compression on the spinal cordthe amount of bariatric surgery ( bs ) is rapidly growing as the prevalence of obesity increasing . well - reported neurologic complications of bariatric surgery include peripheral neuropathy ( pn ) , burning feet syndrome , meralgia paresthetica , myotonic syndrome , myelopathy , wernicke korsakoff encephalopathy , and lumbosacral plexopathy . thaisetthawatkul et al described three distinct clinical patterns of pn after bs : sensory predominant polyneuropathy , mononeuropathy , and radiculoplexus neuropathy . sensory - predominant polyneuropathies present with symmetric sensory symptoms and signs , and some have distal motor weakness involving the hands and feet ; the manifestation of drop foot is relatively common . the mononeuropathy group has asymmetric involvement at the common sites of entrapment such as median neuropathy at the wrists in most of the patients . it is believed that nutritional deficiencies may play the most important role in the pathogenesis . deficiency of thiamine , in particular , has been deemed to cause polyneuropathy after bariatric surgery . chang et al demonstrated the presence of vitamin deficiency in 40 out of 99 patients who developed peripheral neuropathy after bariatric surgery ; 17 patients had vitamin b12 deficiency , 29 had thiamine deficiency , and 6 had both deficiencies . however , it has not been established whether the development of pn after bs for morbid obesity may be attributed to a specific vitamin deficiency . a controlled study of peripheral neuropathy after bariatric surgery identified risk factors for development of pn . risk factors included rate and absolute amount of weight loss , prolonged gastrointestinal symptoms , not attending a nutritional clinic after bs , reduced serum albumin and transferrin after bs , postoperative surgical complications requiring hospitalization , and having a jejunoileal bypass . in our patient , the rapid weight loss in addition to the fact that the patient did not take vitamin supplements probably contributed to the development of pn . alves et al described two cases of beriberi after bariatric surgery that were adequately treated with vitamin b1 supplements . one of the patients had complete resolution of the neurologic symptoms , but the other patient ( with a longer time between the development of symptoms and beginning of treatment ) had persistent motor deficit . the probability of irreversible damage increases with increased time between development of symptoms and initiation of vitamin treatment . in our patient , the patient in this report had sensorimotor axonal polyneuropathy as a complication of bariatric surgery . this uncommon neurological complication might have been due to rapid weight loss and vitamin deficiency . morbid obesity management is multidisciplinary teams management and the patients should be educated for the importance of multivitamins especially iron , calcium , vitamin d , vitamin b mainly b12 and the thiamin , to be taken life long mainly in any bariatric surgery include malabsorption effect as gastric bypass or biliopancreatic division .\noutput:\n" }, { "from": "agent", "value": "a patient with peripheral polyneuropathy after bariatric surgery for morbid obesity is reported . she suffered from frequent episodes of vomiting and abdominal pain after surgery . muscle weakness in her lower limbs developed 5 months later and she experienced difficulty in walking and standing . wrist drop , foot drop , and marked distal limb muscle atrophy were found bilaterally . electromyography showed the presence of sensorimotor axonal polyneuropathy . nutritional deficiencies may play an important role in pathogenesis . this uncommon neurological complication might be due to rapid weight loss and vitamin deficiency . physicians who take care for patients after bariatric surgery should have a high index of awareness for the neurologic complications , and routine vitamin supplementation might be useful for these patients ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: acute kidney injury ( aki ) is characterized by rapid ( over hours to days ) decline in glomerular filtration rate , retention of nitrogenous waste products and perturbation of the extracellular fluid volume , electrolytes and acid - base homeostasis . aki constitutes approximately 5 % of hospital admissions and up to 30 % of admissions to intensive care units . although reliable statistics on the prevalence of aki are not available , statistics on referrals to dialysis units suggest that the condition is more common in india as compared to the west . aki can result from decreased renal perfusion without cellular injury , an ischemic , toxic or obstructive insult to the renal tubule , a tubulointerstitial process with inflammation and edema or primary reduction in the filtering capacity of the glomerulus . the mortality rate among patients with aki approaches 50 % and has changed little over the past 15 years . this study was conducted in a tertiary care hospital providing nephrology services in himachal pradesh , india , located in western himalayas to assess clinico - etiological aspects , risk factors , clinical course and outcome of aki . this was a prospective study , done over a period of 1 year in a tertiary care hospital . all one hundred and two patients with clinical ( uremic symptoms or oliguria or anuria of recent onset ) and laboratory evidence of azotemia ( urea and creatinine above 40 mg / dl and 1.5 mg / dl , respectively ) were eligible . adult patients who developed kidney injury after at least 24 hours of admission were referred as hospital - acquired aki . patients with chronic renal failure , acute on chronic renal failure and those not willing to participate were excluded from this study . the patients included in the study were explained in detail about the purpose of the study and an informed consent was taken . each patient was looked for the complications of aki - like fluid overload , hypertension , electrolyte abnormalities , metabolic acidosis , uremic complications , bleeding , neurological abnormalities and infections . kidney injury was listed as a cause of death if patient exhibited evidence of severe uremia , hyperkalemia or volume overload secondary to oliguria . patients were classified as oliguric ( urine output 500 ml / day ) and non oliguric ( urine output 500 ml / day ) during the azotemic phase.the study has been approved by institutional ethics committee . a total of 19,248 admissions were recorded in the hospital during the year of study . community - acquired aki was observed in 86 patients ( 84.3 % ) and hospital - acquired kidney injury in 16 ( 15.7 % ) patients . the mean age of these patients was 48.9618.3 ( range 18 to 85 ) years . the mean duration of hospital stay was 9.417.3 days with a range from 1 to 34 days . out of the 102 patients , 87 were admitted with medical causes ( 85.3 % ) , 10 with surgical causes ( 9.8 % ) and 5 with obstetrical causes ( 4.9 % ) . the coexisting conditions observed in aki were observed in 87 ( 85.3 % ) patients and is shown in table 2 . multiorgan failure was present in 61 ( 59.8 % ) patients and single organ failure in 41 ( 40.2 % ) patients . active urinary sediment was noted in 54 patients and mortality rate in them was 56 % . kidney biopsy was done in nine patients which revealed acute tubular necrosis ( atn ) in 4 : snake bite 2 , wasp bite 1 , drugs 1 ( nsaids + aminoglycoside 1 ) ; allergic interstitial nephritis ( ain ) in 1 ( cephalosporins ) ; atn + ain in 1 ( wasp bite ) ; diffuse proliferative glomerulonephritis ( dpgn ) in 2 and crescentic glomerulonephritis in 1 . in the remaining majority of patients either the consent for kidney biopsy was not available or the patients had improved . the rate of infection was 62 % in those who survived and 78 % in those who died ( p 0.05 ) . the mortality rate with positive blood culture was 48 % as compared to that of 39 % where blood culture was negative ( p 0.05 ) . in the study ,64 patients required vasopressor support and 26 ( 40.6 % ) died whereas 2 ( 5.3 % ) out of 38 patients died who did not receive vasopressor support ( p 0.05 ) . fifty - four patients ( 53 % ) received dialysis , were treated with peritoneal dialysis ( pd ) and 50 with hemodialysis ( hd ) . on an average each patient treated with hd received 2.51.5 ( range 1 - 7 ) sessions of hd .25 ( 46.3 % ) of the patients who received dialysis died . in this study , 16 patients had nonoliguric aki and mortality in nonoliguric aki was 11 % as compared to 46 % in the oliguric patients ( p 0.05 ) . pre - renal aki was present in 21.6 ( 20.6 % ) , intrinsic renal in 71 ( 69.6 % ) and post - renal in 10 ( 9.8 % ) . out of 102 patients 28 died ( 29.2 % ) and 68 patients recovered renal function ( 70.8 % ) . in 6 patients ( 5.9 % ) outcome could not be ascertained as they were either discharged on request or left against medical advice before recovery . the mortality was 6.7 % in hospital acquired aki and 22.5 % in community acquired aki ( p 0.05 ) . the present study was conducted in a tertiary care hospital a hilly state in western himalayas . out of a total 102 patients with aki , it is due to endemic malnutrition , poor socioeconomic conditions , hot climate ( resulting in peripheral vasodilatation ) , which in conjunction with excessive sweating predisposes to hypovolumic insults . the study revealed that our patients are more than a decade younger than in the west but comparable with most of indian studies . medical causes contributed to aki in 85.3 % , surgical causes in 9.8 % and obstetric causes in 4.9 % of patients . a study from south india showed 87.6 % aki in medical patients , 8.9 % and 3.4 % aki in surgical and obstetrical patients respectively and similar observations have been made previously . the pattern is however changing , surgical causes are increasing due to more trauma and major surgeries and obstetrical causes are decreasing because of better care in obstetrics . the low percentage of aki in surgical patients in our study could be attributed to non performance of open heart and pancreatic surgery in our institution during the study period . among the causes leading to aki , intrinsic renal causes were seen in 69.6 % , pre - renal in 20.6 % and postrenal causes were present in 9.8 % patients . septicemia was observed in 33.3 % , acute gastroenteritis ( leading to volume depletion ) in 20.6 % , toxic causes ( nephrotoxic drugs + biological toxins ) in 25.5 % , obstructive uropathy in 9.8 % , toxemia of pregnancy in 3.9 % , cardiogenic shock in 5.9 % , cerebral malaria and visceral leishmaniasis in one patient each . eleven out of 34 patients who died were aged 60 years and above accounting for 32.4 % . the literature regarding the development of aki in elderly with septicemia is variable . in the present study drugs were responsible for the development of aki in 16 patients ( 15.7 % ) . drug - related causation was implicated in 18.3 % of aki cases reported in a one year survey . in indiaa study reported a 20 % incidence of drug induced aki with a larger proportion ( 40 % ) being secondary to aminoglycoside usage . nsaid 's , acei 's , radiocontrast media and aminoglycosides are labeled as internists nephrotoxic quartet as these are common nephrotoxic drugs . the kidney is an organ characterized by a large blood supply which ensures a high level of toxicant delivery over a period of time . the extensive resorptive capacity of the tubule with specialized transporters promotes cellular uptake of the toxicant . concentrating capability of the tubule produces the high concentrations in the medullary lumen and interstitium . in the present study ,9.8 % patients had obstructive uropathy . whereas trauma , drugs and cardiovascular surgery are the leading causes of surgical aki in the developed countries , obstructive uropathy constitutes a major cause of surgical aki in certain tropical areas . the obstetrical causes of aki were 5.2 % in this study which were comparable with the figure of 6 % by an indian study . improvements in obstetrical care have led to a decline in the incidence of obstetric aki from 22 % of all aki in 1960s to 8 % in 1990s . community acquired aki was associated with increased mortality as compared to hospital - acquired aki ( 22.5 % vs 6.7 % ) . mortality was high in patients having aki due to medical causes as compared to patients with aki resulting from surgical and obstetrical causes . possible explanation for the lower mortality in surgical and obstetrical patients is that they did not have multiorganfailure which was common among patients with medical aki . presence of cardiovascular diseases , neurological diseases at the time of presentation to the hospital were associated with higher mortality . mortality was high in patients who required vasopressor support and amongst those who required dialysis therapy . vasopressor support as well as dialysis support are considered a prognostic factor for outcome in aki patients . urine output is an established prognosticator in aki . occurrences of infections after the development of aki were associated with a poor outcome . in conclusion , aki is still common in the community and is associated with high mortality . septicemia , volume depletion and nephrotoxins were the leading cause of aki in our study . presence of hypotension , multiorgan failure , oliguria and active urine sediment and complications in the form of severe metabolic acidosis and hyperkalemia and patients with renal category of aki were associated with increased mortality .\noutput:\n" }, { "from": "agent", "value": "acute kidney injury ( aki ) is common in hospitalized patients and is an important cause of mortality . this is a descriptive study of aki in patients from himachal pradesh , india , located in western himalayan region . over a period of 1 year , 102 patients with clinical and laboratory evidence of azotemia were included . out of 102 patients , 84.3 % had community acquired aki and 15.7 % had hospital acquired aki . medical causes were leading contributors ( 85.3 % ) , with septicemia being the main factor ( 33.3 % ) . multiorgan failure was present in 59.8 % patients . the overall mortality was 29.2 % , and community acquired aki was associated with higher mortality as compared to hospital - acquired aki ( 22.5 % vs 6.7 % ) . aki is still common in community and associated with high mortality . septicemia , volume depletion and nephrotoxins were the leading cause of aki in our study . our study highlights the presence of hypotension , multiorgan failure and oliguria with mortality . community - acquired aki had higher mortality than hospital - acquired aki ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the aim of endodontic retreatment is the complete removal of the solid obturating core material and its associated sealer , in order to regain access and patency to the apical foramen for an effective cleaning and shaping of the root canal system . gutta - percha ( gp ) core material in combination with sealers is the most commonly used root canal filling material . endodontic sealers can be categorized based on their composition or chemical structure on many different groups such as zinc oxide - eugenol , calcium hydroxide , glass ionomer , resin , or silicon . more recently , manufacturers have developed innovative contemporary endodontic sealers with calcium silicate - based technology such as mineral trioxide aggregate ( mta ) - based sealers and bioceramic - based sealers . according to the current literature , these materials are biocompatible , induce biomineralization , offer antimicrobial activity , achieve better bond strength to dentin than conventional sealers , and exhibit sealing ability on equal terms with epoxy resin - based sealers . mta fillapex ( mta - f ) ( angelus solues odontolgicas , londrina , pr , brazil ) is one of the several - based sealers that has been recently introduced to the endodontic community . according to the manufacturer reports , the sealer is a 2 - paste system that contains 40 % mta , salicylate resin , natural resin , bismuth , and silica . endosequence bc sealer ( bcs ) ( brasseler , savannah , ga , usa ) , also known as totalfill bcs in europe ( fkg dentaire sa , la chaux - de - fonds , switzerland ) , is the major representative of bioceramic - based sealers . its inorganic components include zirconium oxide , calcium silicates , calcium phosphate monobasic , calcium hydroxide , filler , and water - free thickening agents . bcs is a premixed ready - to - use , injectable , radiopaque , hydrophilic paste and uses the presence of moisture in dentinal tubules to initiate and complete its setting reaction , which range from 4 h to more than 10 h in very dry environment . although several studies have addressed the removal of gp along with zinc oxide - eugenol and resin sealers , little is known regarding the removal of calcium silicate - based sealers from root canals . this is important taking into consideration the fact that these materials are known to be hard upon setting . the aim of this study was to evaluate the retreatability and reestablishment of apical patency of two calcium silicate - based sealers , mta f and bcs when used for filling with gp , as compared with ah plus ( dentsply detrey , konstanz , germany ) . human single - rooted anterior teeth ( n = 54 ) , extracted for periodontal reasons , were collected , cleaned using ultrasonics and stored in 0.5 % naocl . the roots were decoronated at the cementoenamel junction using a diamond disk and water cooling . the patency was confirmed by extending a size 10 k - file ( fkg dentaire sa , la chaux - de - fonds , switzerland ) 1 mm past the anatomical apex and in the same manner the working length ( wl ) was established using the same 10 k - file to the anatomical apex and subtracting 0.5 mm from this measurement . the root canal instrumentation was performed using waveone primary ( 25/0 .08 ) ( dentsply maillefer , ballaigues , switzerland ) nickel - titanium reciprocating instrument in an x - smart plus micromotor ( dentsply maillefer , ballaigues , switzerland ) . irrigation was performed using 5 ml of 5.25 % naocl with a 5 ml disposable plastic syringe ( ultradent products inc . , souththe removal of smear layer was performed by irrigating with 5 ml 17 % ethylenediaminetetraacetic acid followed by 2 ml 5.25 % naocl . all the irrigants were agitated with passive ultrasonic irrigation for 20 s using irrisafe ultrasonic tip ( satelec acteon , mrignac , france ) . all the specimens were rinsed with 5 ml distilled water and dried with waveone primary paper points ( dentsply maillefer , ballaigues , switzerland ) . the roots were randomly divided into three groups ( n = 18 ) to be filled with gp / ah plus ( group a ) , gp / mta f ( group b ) or gp / bcs ( group c ) . these groups were further subdivided into two groups of nine specimens each , where in the first subgroup the master cone was placed to wl ( groups al , bl , and cl ) and in the second subgroup the master cone was trimmed to fit 2 mm short of the wl ( groups as , bs , and cs ) to simulate a short filling . waveone primary ( dentsply maillefer , ballaigues , switzerland ) gp cones were used in all groups . the sealers were introduced into the root canal using a # 20 k - file ( flexofile , dentsply maillefer , ballaigues , switzerland ) in order to coat the canal walls . the master gp cones were then coated with sealer and slowly inserted to the appropriate length . the continuous wave condensation was performed with the superendo alpha ii and 55/0 .08 heat plugger ( b and l biotech usa inc . , philadelphia , usa ) while the down - packing stopped 5 mm from the wl . all the orifices were sealed with a glass ionomer restorative material ( fuji ix gp fast , gc europe n.v , leuven , belgium ) . subsequently , the quality of the filled roots was assessed with digital radiographs at different angulations . for the retreatment , a piezoelectric ultrasonic device ( p5 newtron ; satelec acteon , mrignac , france ) with an ultrasonic tip ( bl1 , b & l biotech usa inc . , philadelphia , usa ) was initially used in order to remove a superficial layer of gp and to create a small reservoir for the solvent . in this case , 23 drops of chloroform were introduced . waveone large ( 40/0 .08 ) ( dentsply maillefer , ballaigues , switzerland ) and race 0.06 tapered niti rotary instruments were then inserted into the canal system at 600 rpm according to the following technique : race rotary instruments size 20 and 25 with 0.06 taper were used with pecking motions in a crown - down fashion and were advanced 23 mm into the canal system followed by flute clearing with alcohol gauze . this procedure was repeated until the wl was reached , or resistance was met . in cases , the wl was reached , patency was checked with 10 k - file and root canal instrumentation was continued using the race rotary instruments with crown - down technique at 550 rpm to the wl until size 30/0 .06 was reached . waveone large ( 40/08 ) in reciprocating motion was finally used to wl as a finishing file . if the wl was not reached , small hand files ( c + files sizes 6 , 8 , 10 and 15 , dentsply maillefer ) were used in order to penetrate and regain patency . when the wl was reached , the root canal instrumentation was continued as described above . in casethe wl was not reached after all the attempts , the instrumentation was completed to the maximum lengththe retreatment procedure was deemed complete when the aforementioned instrumentation procedure was completed to the full wl or to the maximum length reached . the ability to establish patency and reach wl was determined for each specimen . specimens were observed under a dental , optical microscope ( dom ) ( carl zeiss opmi pro ergo , germany ) . the apical area and foramen were examined at 10 magnification and representative photos were taken . chi - square and mann whitney u - test were applied to investigate potential differences within and between obturation material groups , as far aspatency establishment and time required variables were concerned . however , for wl regained and patency establishmentparameters no tests were computed , because all the recorded data for all the materials were identical . the analyzes of the data were carried out using ibm spss statistics software version 21.0 ( spss , inc . human single - rooted anterior teeth ( n = 54 ) , extracted for periodontal reasons , were collected , cleaned using ultrasonics and stored in 0.5 % naocl . the roots were decoronated at the cementoenamel junction using a diamond disk and water cooling . the patency was confirmed by extending a size 10 k - file ( fkg dentaire sa , la chaux - de - fonds , switzerland ) 1 mm past the anatomical apex and in the same manner the working length ( wl ) was established using the same 10 k - file to the anatomical apex and subtracting 0.5 mm from this measurement . the root canal instrumentation was performed using waveone primary ( 25/0 .08 ) ( dentsply maillefer , ballaigues , switzerland ) nickel - titanium reciprocating instrument in an x - smart plus micromotor ( dentsply maillefer , ballaigues , switzerland ) . irrigation was performed using 5 ml of 5.25 % naocl with a 5 ml disposable plastic syringe ( ultradent products inc . , souththe removal of smear layer was performed by irrigating with 5 ml 17 % ethylenediaminetetraacetic acid followed by 2 ml 5.25 % naocl . all the irrigants were agitated with passive ultrasonic irrigation for 20 s using irrisafe ultrasonic tip ( satelec acteon , mrignac , france ) . all the specimens were rinsed with 5 ml distilled water and dried with waveone primary paper points ( dentsply maillefer , ballaigues , switzerland ) . the roots were randomly divided into three groups ( n = 18 ) to be filled with gp / ah plus ( group a ) , gp / mta f ( group b ) or gp / bcs ( group c ) . these groups were further subdivided into two groups of nine specimens each , where in the first subgroup the master cone was placed to wl ( groups al , bl , and cl ) and in the second subgroup the master cone was trimmed to fit 2 mm short of the wl ( groups as , bs , and cs ) to simulate a short filling . waveone primary ( dentsply maillefer , ballaigues , switzerland ) gp cones were used in all groups . the sealers were introduced into the root canal using a # 20 k - file ( flexofile , dentsply maillefer , ballaigues , switzerland ) in order to coat the canal walls . the master gp cones were then coated with sealer and slowly inserted to the appropriate length . the continuous wave condensation was performed with the superendo alpha ii and 55/0 .08 heat plugger ( b and l biotech usa inc . , philadelphia , usa ) while the down - packing stopped 5 mm from the wl . all the orifices were sealed with a glass ionomer restorative material ( fuji ix gp fast , gc europe n.v , leuven , belgium ) . subsequently , the quality of the filled roots was assessed with digital radiographs at different angulations . for the retreatment , a piezoelectric ultrasonic device ( p5 newtron ; satelec acteon , mrignac , france ) with an ultrasonic tip ( bl1 , b & l biotech usa inc . , philadelphia , usa ) was initially used in order to remove a superficial layer of gp and to create a small reservoir for the solvent . in this case , 23 drops of chloroform were introduced . waveone large ( 40/0 .08 ) ( dentsply maillefer , ballaigues , switzerland ) and race 0.06 tapered niti rotary instruments were then inserted into the canal system at 600 rpm according to the following technique : race rotary instruments size 20 and 25 with 0.06 taper were used with pecking motions in a crown - down fashion and were advanced 23 mm into the canal system followed by flute clearing with alcohol gauze . this procedure was repeated until the wl was reached , or resistance was met . in cases , the wl was reached , patency was checked with 10 k - file and root canal instrumentation was continued using the race rotary instruments with crown - down technique at 550 rpm to the wl until size 30/0 .06 was reached . waveone large ( 40/08 ) in reciprocating motion was finally used to wl as a finishing file . if the wl was not reached , small hand files ( c + files sizes 6 , 8 , 10 and 15 , dentsply maillefer ) were used in order to penetrate and regain patency . when the wl was reached , the root canal instrumentation was continued as described above . in casethe wl was not reached after all the attempts , the instrumentation was completed to the maximum length . the retreatment procedure was deemed complete when the aforementioned instrumentation procedure was completed to the full wl or to the maximum length reached . the ability to establish patency and reach wl was determined for each specimen . specimens were observed under a dental , optical microscope ( dom ) ( carl zeiss opmi pro ergo , germany ) . the apical area and foramen were examined at 10 magnification and representative photos were taken . chi - square and mann whitney u - test were applied to investigate potential differences within and between obturation material groups , as far as wl regained , patency establishment and time required variables were concerned . however , for wl regained and patency establishmentparameters no tests were computed , because all the recorded data for all the materials were identical . the analyzes of the data were carried out using ibm spss statistics software version 21.0 ( spss , inc . , chicago , il , usa ) , with a 0.05 level of significance . the wl was regained in 100 % of specimens in all groups [ table 1 ] . the mean time ( standard deviation ) required to reach the wl in each group is summarized in table 1 . group cs took the longest time to retreat followed by the groups cl , bs , bl , as , and al . according to the statistical analysis , there were significant differences both between and within groups ( p 0.05 ) . whitney u - test indicated significant differences between the following groups : al versus bl ( p = 0.001 ) , as versus bs ( p 0.004 ) , al versus cl ( p = 0.001 ) , as versus cs ( p = 0.001 ) , and bs versus cs ( p = 0.001 ) [ table 1 ] . as far as it concerns within filling material groups , there was a significant difference between al versus as ( p = 0.001 ) and cl versus cs ( p = 0.001 ) . the ability to regain the wl , patency , and time taken to reach wl ( meansd in minutes ) for each group ( n = 9 ) dom images of samples revealed filling material remaining in all groups . the most amount of remaining material can be observed in the groups of ah plus [ figure 1a ] while the least amount in the groups of mta f [ figure 1b ] . the purpose of this study was to evaluate the retreatability of two novel calcium silicate - based sealers namely mta f and totalfill bcs considering an epoxy resin sealer ( ah plus ) as the standard for comparison . based on the results of our study , obturation with the new sealers could not completely block the apical zone and patency was re - established in all samples . regarding the groups where the gp was seated at the wl , the ability to re - establish the wl and patency can be attributed to the fully seated master cone . although calcium silicate - based sealers become quite hard upon setting , the core material still remains gp . many different solvents can be used for softening gp cones and other root canal filling materials . chloroform is one of the most common solvents because it acts very rapidly , but it was also proposed to be a potential carcinogen . however , the current study was in vitro and hence , the chloroform was used . when the gp master cone is softened effectively , this may provide a pathway for the rotary and hand instruments to approach the apical foramen through the sealers . in order to minimize the effect of gp on the ability to retreat the new sealers , the master cones were intentionally seated 2 mm short of the wl in three groups . even though there was no possible pathway to the apical foramen through the softened gp , wl , and patency were reconfirmed in 100 % of samples . the retreatability of 100 % of the samples in our study may be attributed to the differences in the root canal anatomy . while our samples were anterior teeth , hess et al . anterior teeth have usually wide and straight canals while mesiobuccal roots of the mandibular molars exhibit a more complex anatomy . regarding mta f , the results of the present study are in agreement with carpenter et al . , implying that the chloroform may soften effectively the resin matrix of this sealer . further studies are required for the effect of different solvents and retreatment techniques on bcs and mta f. furthermore , the average time required for removing calcium silicate - based sealers was longer than the time for ah plus . according to the results , there were significant differences regarding retreatment time between al versus bl , as versus bs , al versus cl , as versus cs , and bs versus cs groups . these results indicate clearly that calcium silicate - based sealers are more hard and resilient to common retreatment techniques but not impenetrable . even if the theory of the possible pathway through the gp cone is true , the fact is that calcium silicate - based sealers increase retreatment time approximately twice in the case of bcs [ table 1 ] . successful negotiation requires patience , more time and additional efforts in comparison with conventional filling materials . the time commitment for the retreatment required sometimes may compromise proper cleaning and shaping of the root canal system and affect the success of nonsurgical endodontic therapyfinally , quite interesting observations regarding the residual filling material could be made based on the pictures of the apical area under the dom . the most amount of remaining root filling material after the retreatment was observed with ah plus [ figure 1a ] followed by bcs [ figure 1b ] and mta f [ figure 1c ] . these findings regarding mta f are in agreement with the study of neelakantan et al . , who reported the low bond strength of mta f to root dentin . a possible explanation for these findings may be the low adhesion capacity of mta f reported in recent studies . further investigations are required regarding the adhering properties of these new calcium silicate - based sealers and the ability to be retreated under different situations . the present in vitro study suggests that the new calcium silicate - based sealers are negotiable , when the root canal anatomy is simple . however , these procedures may be time demanding . under different root canal anatomies with much more complexity\noutput:\n" }, { "from": "agent", "value": "objective : aim of the present study was to evaluate the retreatability and reestablishment of apical patency of two calcium silicate - based sealers , totalfill bc sealer ( bcs ) and mineral trioxide aggregate fillapex ( mta f ) , versus ah plus , when used in combination with gutta - percha ( gp ) . materials and methods : the canals of 54 single - rooted anterior teeth were instrumented and filled with gp / ah plus ( group a ) , gp / mta f ( group b ) , or gp / bcs ( group c ) using continuous wave obturation technique . the groups were subdivided into subgroups with the master - gp cone placed to the working length ( wl ) or intentionally 2 mm short . the retreatment procedures were performed using ultrasonics , chloroform , rotary , and hand files . the ability to establish the patency and reach wl was determined as well as the time taken to reach wl was calculated in minutes . furthermore , the samples were observed under a dental , optical microscope , after vertically splitting them.results : the wl and patency were reestablished in 100 % of specimens in all groups . the mann whitney u - test indicated that there was a significant difference in the amount of time required to reach wl between the groups ( p < 0.05 ) with group gp / bcs short of the wl showing the most amount of time to be retreated.conclusion : the novel calcium silicate - based sealers are negotiable under simple root canal anatomy . however , the conventional retreatment techniques are not able to fully remove them ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: free - living amoebae ( fla ) include potentially pathogenic protozoan parasites such as acanthamoeba , balamuthia and naegleria ( 1 , 2 ) . these amoebae could lead to severe diseases such as painful keratitis , fatal encephalitis and cutaneous ulcers ( 3 ) . recently there are several reports regarding other free - living amoebae as potentially pathogenic parasites including paravahlkampfia francinae and vahlkampfia spp . these mentioned amoebae could be the cause of primary amoebic meningoencephalitis ( pam ) mimicking naegleria fowleri - related infection and keratitis , respectively ( 5 ) . it is worthy to mention that there are also report regarding mixed infection of acanthamoeba and bacteria in keratitis patients ( 6 ) . these protozoan parasites are distributed in different niches such as lakes , soil , wastewater and clay ( 1 , 2 ) . it should be mention that beside the direct pathogenic effect of free - living amoebae , they could be a carrier of pathogenic microorganisms such as bacteria and viruses . there are also various opportunistic pathogens such as non - tuberculous mycobacteria ( ntm ) , pseudomonas and legionella that could exist in the same ecological niches as acanthamoeba ( 79 ) . indeed , a wide range of bacteria could resist the intracellular killing of amoebae and they could survive and even exploit acanthamoeba for their multification such as pseudomonas putida , pasteurella pneumotropica , aeromonas salmonicida , legionella pneumophila serogroup 1 , l. pneumophila serogroup 3 , l. pneumophila serogroup 6 ( 7 , 10 ) . bacteria could remain in amoebae cyst form , this could be a problematic health aspect , since acanthamoeba cysts are very resistance to harsh environment and could tolerate many adverse conditions such as high osmolarity , various ranges of temperature and ph ( 7 , 11 ) . interestingly , pathogenic bacteria are shown to have the ability to survive in acanthamoeba cytoplasm despite non - pathogenic bacteria , which they were used only as food sources . it is interesting to note that some endosymbiont environmental chlamydiae alter the growth speed and / or motility of acanthamoeba , this could be due to mutual relationship between amoebae and environmental chlamydiae ( 12 , 13 ) . previous studies in iran were mainly focused on isolation of acanthamoeba spp . from water sources , however there were no previous researches regarding survey of acanthamoeba in chlorinated water an also amoebae - endosymbionts in this region and thus the main aim of the present research was to address the occurrence of bacterial endosymbionts of acanthamoeba isolated from man - made recreational water sources using staining and molecular based methods . a total of 75 samples of recreational water sources including 40 samples of ponds and 35 samples from indoor swimming pools were collected from tehran , iran . parasitology and mycology , school of medicine , shahid beheshti university of medical sciences within few days . all plates were then sealed and incubated at room temperature for up to 1 month . positive plated were then submitted to cloning according to our previous study ( 14 ) . briefly , a single cyst was transferred to a fresh medium and adopted to axenic situation within weeks . cleaned plates were then examined for intracellular bacteria using inverted microscopy and gram staining as following . cloned plates washed with sterile normal saline and slides were then prepared from acanthamoeba - positive plates . dna extraction was performed using modified phenol - chloroform method according to our previous study ( 14 ) . pcr analysis was done using genus - specific primer pairs called jdp1 - 2 primers . the pcr reaction was prepared in 30 l ampliqone ( taq dna polymerase master mix red , denmark ) . briefly , 25 l of master mix with 10 ng dna templates and 20 pmol primers were mixed to achieve a volume of 30 l . these primes could amplify a fragment of 16s rrna gene of various bacteria including pseudomonas , agrobacterioum and several other genera . the nucleotide sequences of the primers were as following : forward : 5 - tcg aca aca gag ttt gat cct ggc tca g -3 and reverse : 5 - atc caa gct taa gga ggt gat cca gcc - 3 . these primers correspond to 1100 bp dna sequence of 16s rrna gene of several bacteria ( 17 ) . thermal profile involved 40 s at 94c , 90 s at 59.6 c and 120 s at 72c for 35 cycles . sequences derived from the amoebae and their endosymbionts were tested against all available nucleotide sequences in the genbank database . the dna sequences have been deposited in the genetic sequence database at the national center for biotechnical information ( ncbi ) using the sequin program ( version 10.3 ) . ( genbank i d for acanthamoeba : kj504214 - kj504227 and genbank i d for bactertia : kj563278 - kj563281 ) . a total of 75 samples of recreational water sources including 40 samples of ponds and 35 samples from indoor swimming pools were collected from tehran , iran . parasitology and mycology , school of medicine , shahid beheshti university of medical sciences within few days . all plates were then sealed and incubated at room temperature for up to 1 month . positive plated were then submitted to cloning according to our previous study ( 14 ) . briefly , a single cyst was transferred to a fresh medium and adopted to axenic situation within weeks . cleaned plates were then examined for intracellular bacteria using inverted microscopy and gram staining as following . cloned plates washed with sterile normal saline and slides were then prepared from acanthamoeba - positive plates . dna extraction was performed using modified phenol - chloroform method according to our previous study ( 14 ) . for genotyping of acanthamoeba spp . pcr analysis was done using genus - specific primer pairs called jdp1 - 2 primers . the pcr reaction was prepared in 30 l ampliqone ( taq dna polymerase master mix red , denmark ) . briefly , 25 l of master mix with 10 ng dna templates and 20 pmol primers were mixed to achieve a volume of 30 l . these primes could amplify a fragment of 16s rrna gene of various bacteria including pseudomonas , agrobacterioum and several other genera . the nucleotide sequences of the primers were as following : forward : 5 - tcg aca aca gag ttt gat cct ggc tca g -3 and reverse : 5 - atc caa gct taa gga ggt gat cca gcc - 3 . these primers correspond to 1100 bp dna sequence of 16s rrna gene of several bacteria ( 17 ) . thermal profile involved 40 s at 94c , 90 s at 59.6 c and 120 s at 72c for 35 cycles . sequences derived from the amoebae and their endosymbionts were tested against all available nucleotide sequences in the genbank database . the dna sequences have been deposited in the genetic sequence database at the national center for biotechnical information ( ncbi ) using the sequin program ( version 10.3 ) . ( genbank i d for acanthamoeba : kj504214 - kj504227 and genbank i d for bactertia : kj563278 - kj563281 ) . out of 75 samples , 16 ( 21.3 % ) plates were positive for acanthamoeba according to the morphological criteria . acanthamoeba trophozoites were flat in shape and cysts were double walled with star shape endocysts . ten samples ( 25 % ) of pond and 4 samples ( 11.4 % ) of swimming pool waters were found to be positive for acanthamoeba genus in non - nutrient agar medium . of 16 acanthamoeba isolate , five isolates ( 35.7 % ) of acanthamoeba were positive for bacterial endosymbionts in their cytoplasm using microscopic observation and gram staining method . gram staining revealed the presence of bacteria readily in the host amoebae cytoplasm ( fig . it should be mention that 4 isolated bacteria showed an approximately 1100 bp band ( fig . sequencing of pcr products verified the presence of three pseudomonas aeruginosa and one agrobacterium tumefasiens in acanthamoeba t4 genotypes ( table 1 ) .500 bp pcr product electrophoresis of positive acanthamoeba ( marker : 100 bp , nc : negative control , pc : positive control , sp : swimming pool , plp : pond water ) cloned acanthamoeba spp . cysts and trophozoites containing rod shaped - bacteria ( magnification x400 ) 1100 bp pcr product electrophoresis of positive endosymbionts ( four isolates ) ( marker : 1 kb ) multialign of isolated acanthamoeba belonginig to t4 and t5 genotypes ( multalign software , france ) acanthamoeba genotypes isolated from recreational waters and their related endosymbiontsthe present study revealed that acanthamoeba could harbor potentially pathogenic bacteria in recreational water sources such as pond and chlorinated water including swimming pools . this is the first study regarding detection of acanthamoeba in swimming pools in iran and the result showed that contamination of pools are less than ponds . additionally , out 24 % of environmental acanthamoeba and 26 % of clinical acanthamoeba contain intracellular bacteria ( 19 ) . in accordance , several bacteria have been reported that could live in the free - living amoebae as endosymbionts including acanthamoeba and naegleria ( 2022 ) , however this is the first report of agrobacterium tumefasience in acanthamoeba spp . worldwide . agrobacterium is a potentially pathogenic gram - negative bacterium responsible for systematic human infection especially in imunocompromised individuals ( 23 , 24 ) . are ubiquitous in natural and man - made water sources and basically they are harmful for plants ( 24 ) . this is important since both of organisms are corneal pathogen and they may increase the chance of ak in appropriate situation ( 25 ) . to this endthere are several reports regarding severe keratitis due to mixed acanthamoeba and pseudomonas infection in cosmetic contact lens wearers with poor prognosis ( 26 , 27 ) . complicated cases of ak also may be due to coexistence of corneal bacterial pathogens such as pseudomonas with acanthamoeba and lack of response to proper treatment may reflect the presence of amoebae - endosymbionts . in addition , according to previous studies this interaction may lead to increased virulence of bacteria and also may affect the pathogenicity of amoebae ( 25 , 26 , 28 ) . , the focus of recent researches has shifted from direct pathogenic effects of acanthamoeba toward their role as carriers of pathogenic bacteria . overall , amoebae could be an ideal replicative niche for bacterial communications and could act as reservoir . the long interaction between amoebae and bacteria could lead to adaptation behavior towards an intracellular lifestyle ( 29 ) . a previous research also revealed that although addition of disinfectants may influence amoebal density , but it seems that fla can re - colonize in treated waters within a short period of time ( 30 ) . the present study reports for the first time the occurrence of novel endosymbiotic bacteria ( such as a. tumefasciences ) in environmental acanthamoeba strains . further researches regarding the relationship between bacteria and their host amoeba and their effect on pathogenicity of either amoebae or bacteria is of utmost importance .\noutput:\n" }, { "from": "agent", "value": "background : acanthamoeba - bacteria interactions enable pathogenic bacteria to tolerate harsh conditions and lead to transmission to the susceptible host . the present study was aimed to address the presence of bacterial endosymbionts of acanthamoeba isolated from recreational water sources of tehran , iran . to the best of our knowledge this is the first study regarding occurrence of bacteria in environmental acanthamoeba spp . in iran.methods : a total of 75 samples of recreational water sources were collected . samples were cultured on non - nutrient agar 1.5 % plates . positive acanthamoeba spp . were axenically grown . dna extraction and pcr reaction was performed using jdp1 - 2 primers . all positive samples of acanthamoeba were examined for the presence of endosymbionts using staining and molecular methods . the pcr products were then sequenced in order to determine the genotypes of acanthamoeba and bacteria genera.results : out of 75 samples , 16 ( 21.3 % ) plates were positive for acanthamoeba according to the morphological criteria . molecular analysis revealed that acanthamoeba belonged to t4 and t5 genotypes . five isolates ( 35.7 % ) were positive for bacterial endosymbionts using staining method and pcr test . sequencing of pcr products confirmed the presence of pseudomonas aeruginosa and agrobacterium tumefasiens.conclusion : the presence of acanthamoeba bearing pathogenic endosymbionts in water sources leads us to public health issues including improved sanitation and decontamination measures in recreational water sources in order to prevent amoebae - related infection . to the best of our knowledge this is the first report regarding the isolation of a. tumefasiens from acanthamoeba in iran and worldwide ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: nonalcoholic steatohepatitis ( nash ) , the progressive form of nonalcoholic fatty liver disease ( nafld ) , is characterized by the presence of 5 % macrovesicular steatosis , inflammation , and liver cell ballooning . its prevalence is increasing concomitantly with prevalence of obesity and diabetes , thus representing a serious public health issue . about 30 to 40 % of nash progresses to fibrosis or to cirrhosis , resulting in a high risk for cardiovascular and liver - related morbidity and mortality . however , treatment is presently limited to lifestyle intervention , as approved treatment options are lacking and represent a significant unmet need . sirt1 enzyme and ampk are important regulators of energy metabolism and modulate hepatic glucose and lipid metabolism . thus they play an important role in the pathophysiology of nafld and nash . liver - specific deletion of sirt1 results in hepatic steatosis and inflammation in mice , while treatment with sirt1 activators or sirt1 overexpression ameliorates fatty liver and reduces lipogenic gene expression . we have previously demonstrated that leucine acts as a direct sirt1 activator by lowering the activation energy for nad and enables coactivation with other ampk / sirt1 activators thereby reducing the necessary concentration for each individual compound . synergy with leucine was also demonstrated with metformin ( met ) , the first - line treatment drug for diabetes , at which effects are also mediated by merging on the ampk / sirt1 pathway . accordingly , treatment with a met - leu combination resulted in reduction of lipid accumulation in vitro and reversal of hepatic steatosis in vivo in a hfd - induced nafld mouse model . the endothelial nitric oxide synthase , nitric oxide and cyclic guanosine monophosphate ( enos - no - cgmp ) signaling pathway has also been shown to affect the progression of nafld to nash . high - fat diet feeding reduced enos - no signaling in the liver of nafld models of mice and rats . this was precedent to the onset of hepatic inflammation and insulin resistance and was prevented by daily administration of sildenafil . the primary action of sildenafil is the inhibition of phosphodiesterase 5 ( pde5 ) which hydrolyses cgmp and thus terminates cgmp signaling . in addition , sildenafil activates enos resulting in increased no / cgmp signaling with consecutive activation of the cgmp - dependent protein kinases ( pkgs ) to induce vasodilatory , anti - inflammatory , and antiproliferative effects . this pathway also interacts with the sirtuin pathway , as it stimulates sirt1 , while sirt1 appears to deacetylate and activate enos and thereby elevate no levels ; thus sildenafil 's effects may be partly mediated by sirt1 activation . moreover , leucine synergizes with pde5 inhibitors to exert amplifying downstream effects of ampk and sirt1 activation on glucose and fat metabolism as well as reversal of hepatic steatosis and inflammation in vitro and in vivo . accordingly , the aim of this study was to evaluate the effects of a three - way interaction between leucine , metformin , and sildenafil on ampk / sirt1 / enos pathway and the protective effects on hepatocyte metabolism in a nash mouse model . human hepatoma hepg2 cells ( atcc , manassas , va , usa ) were grown in dulbecco 's modified eagle 's medium ( dmem , 5.5 mm glucose ) containing 10 % fetal bovine serum ( fbs ) and antibiotics ( 1 % penicillin - streptomycin ) at 37c in 5 % co2 in air . mouse aml - 12 liver cells ( atcc , manassas , va , usa ) were grown and maintained in 1 : 1 mixture of dmem and ham 's f12 medium with 0.005 mg / ml insulin , 0.005 mg / ml transferrin , 5 ng / ml selenium , 40 ngml dexamethasone , 10 % fbs , and antibiotics ( 1 % penicillin - streptomycin ) at 37c in 5 % co2 in air . mouse raw 264.7 macrophages ( atcc , manassas , va , usa ) were grown and maintained in dmem containing 10 % fetal bovine serum ( fbs ) and antibiotics ( 1 % penicillin - streptomycin ) at 37c in 5 % co2 in air . cells were split at a 1 : 4 ratio at 70 to 80 % confluence . lipid accumulation in hepg2 cells was induced by incubation in 25 mm glucose dmem media for 48 hours . lipid accumulation and inflammatory response in aml - 12 cells and raw 264.7 macrophages were induced by stimulation with 500 m free fatty acids ( ffa , palmitic - oleic acid mixture 1 : 2 ) and lipopolysaccharide ( lps , 1 ng / ml ) for 24 hours . treatment ( metformin 0.1 mm , leucine 0.5 mm , and sildenafil 1 nm ) was added for further 24 to 48 hours . mouse aml - 12 liver cells and raw 264.7 macrophages were seeded together in a ratio 4 : 1 . next day lipid accumulation and inflammatory response were induced by stimulation with 500 m free fatty acids ( palmitic - oleic acid mixture 1 : 2 ) and lps ( 1 ng / ml ) for 24 hours . the cells were then treated as indicated for 24 hours . aml - 12 and / or raw 264.7 macrophages were seeded and treated as described above . at the end of the treatment , monocyte chemotactic protein - ( mcp - ) 1 and tumor necrosis factor - ( tnf - ) secretion was measured with the mcp1 mouse elisa kit and tnf - alpha mouse elisa kit ( abcam , cambridge , ma , usa ) , respectively , according to manufacturer 's instructions . the sirt1 , phospho - ampk ( thr172 ) , ampk , fas , scd1 , ppar - , and ppar , srebp1 , and tnf - antibodies were obtained from cell signaling ( danvers , ma ) . protein levels of cell extracts were measured by bicinchoninic acid assay ( bca ) kit ( thermo fisher scientific inc .1050 g protein was resolved on 415 % gradient polyacrylamide gels ( criterion precast gel , bio - rad laboratories , hercules , ca ) , transferred to pvdf or nitrocellulose membranes , incubated in blocking buffer ( 5 % nonfat dry milk in tbs ) , and then incubated with primary antibody ( 1 : 1000 dilution ) , washed , and incubated with horseradish peroxidase - or fluorescence - conjugated secondary antibody ( 1 : 10000 dilution ) . visualization was conducted using li - cor odyssey fc imaging system ( li - cor biosciences , lincoln , nb ) and band intensity was assessed using quantity one ( bio - rad laboratories , hercules , ca ) , with correction for background and loading controls . cellular oxygen consumption was measured using a seahorse bioscience xf24 analyzer ( seahorse bioscience , billerica , ma ) in 24 - well plates at 37c . cells were treated for 24 hours with the indicated treatments , washed twice with nonbuffered carbonate - free ph 7.4 low glucose ( 2.5 mm ) dmem containing carnitine ( 0.5 mm ) , equilibrated with 550 l of the same media in a non - co2 incubator for 30 minutes , and then inserted into the instrument for 15 minutes of further equilibration . o2 consumption was measured in three successive baseline measurements at eight - minute intervals prior to injection of palmitate ( 200 m final concentration ) . post - palmitate - injection measurements were taken over a 3 - hour period with cycles consisting of 10 min break and three successive measurements of o2 consumption . six - to eight - week - old male c57bl / 6j mice were purchased from jackson laboratories . first nash was induced in all animals ( except low - fat diet control animals ( lf ) ) via feeding of a high - fat atherogenic diet ( hc : 60 % of calories from fat , 1.25 % cholesterol , and 0.5 % cholate ) for 6 weeks . after this induction period , the hc animals were randomized into one of the following groups with 10 animals / group and kept on their experimental diet for additional 6 weeks ( 12 weeks total ) : high - fat atherogenic diet ( hc ) ; hc + sildenafil ( 25 mg / kg diet , calculated as human equivalent dose of 1 mg / day ) ( hc + sil ) ; hc + leucine ( 24 g / kg diet ) + sildenafil ( hc + leu + sil ) ; hc + leucine + metformin ( 0.25 g / kg diet , calculated as a human equivalent dose of 250 mg / day ( hc + leu + met ) ) ; hc + metformin + sildenafil ( hc + met + sil ) ; hc + leucine + metformin + sildenafil ( hc + leu + met + sil ) . animals were housed in polypropylene cages at a room temperature of 22c and a 12 h light / dark cycle . body weight was measured every week . at the end of the treatment period ( 6 weeks ) blood was collected via trunk bleed and tissues were collected for further experiments as described below . this study and all animal procedures were performed under the auspices of institutional animal care and use committee - approved protocol of the georgia state university and in accordance with phs policy and recommendations of the guide . liver tissues were fixed in 10 % neutral formalin , embedded in paraffin , and cut into 5 m sections . sections were processed for hematoxylin and eosin ( h & e ) staining and histological images were recorded using nikon eclipse e800 microscopy with zeiss axiocam camera . briefly , ~ 100 mg of liver was thawed , minced , and weighted in glass tube . the lipid portion was then dried down under n2 and redissolved in a measured volume of 2 : 1 chcl3 / methanol . diluted h2so4 was added to the sample , which was then vortexed and centrifuged to split the phases . the aqueous upper phase was aspirated and discarded , and an aliquot of the bottom phase was dried down and dissolved in 2 % triton x-100 . the triglyceride content was then measured using tg kit / l - type tg m ( wako chemicals , usa ) and normalized to liver weight . serum alt levels were measured in fed mice after 4 weeks of diet treatment using a mouse alt elisa kit from biovision . liver tissues were fixed in 10 % neutral formalin , embedded in paraffin , and cut into 5 m sections . for inflammation immunostaining , slides were immunoblotted with cd68 ( bio - rad mca 1957 ) as primary antibody and biotin - sp - affinipure mouse anti - rat igg as secondary antibody . areas of staining were quantified with imagej and expressed as percentages of the field area . for fibrosis picrosirius red staining , liver slides were dewaxed and hydrated , weigert 's hematoxylin stained for 8 minutes , and picro - sirius red ( picro sirius red stain kit , abcam , cat # ab150681 ) stained for one hour . slides were dehydrated in three changes of 100 % ethanol and cleared in xylene and mounted in a resinous medium . all of the histological images were recorded using nikon eclipse e800 microscopy with zeiss axiocam camera . areas of staining were quantified with imagej and expressed as percentages of the field area . cell lysis , reverse transcription , and rt - pcr were performed using the taqman gene expression cells - to ct kit ( life technologies , cat # 4399002 ) according to manufacturer 's instructions . gene expression was assessed by rt - pcr using steponeplus pcr system ( thermo fisher scientific ) and taqman gene expression assays for ampk ( life technologies , cat # mm01264789 ) and sirt1 ( life technologies , cat # mm01168521 ) . total rna from liver was extracted using the tri - reagent kit ( molecular research center , cincinnati , oh ) and gene expression was assessed by quantitative reverse transcription - ( rt - ) pcr ( abi universal pcr master mix , applied biosystems , foster city , ca ) using a stratagene mx3000p thermocycler ( stratagene , la jolla , ca ) . the primer and probe sets used in the assays were purchased from applied biosystems / life technologies ( grand island , ny ) . data were analyzed by one - way anova , and significantly different group means ( p 0.05 ) were separated by the least significant difference test using graphpad prism version 6 ( graphpad software , la jolla , california , usa , www.graphpad.com ) . based on our previous results in vitro and in vivo showing interacting effects of leucine with either low dose metformin or with pde5 inhibitors ( icariin , sildenafil ) on hepatic lipid metabolism , we tested in this study the three - way interaction of leucine , metformin , and sildenafil . as expected , incubation of hepg2 cells with high glucose ( 25 mm ) medium for 48 hours caused significant downregulation of the ampk / sirt signaling . this was completely reversed by the three - way combination sild - met - leu while the two - way combinations met - leu and sild - leu exerted a significant smaller effect ( figures 1 ( a ) and 1 ( b ) ) . accordingly , the palmitate - induced oxygen consumption rate in hepg2 cells , measured as a downstream effect of sirt1 / ampk activation , was significantly increased by the three - way combination . this effect was greater than that exerted by the two - way combinations or by the individual compounds , which had no effect ( figure 1 ( c ) ) . in addition , gene and protein expressions of lipogenic enzymes ( fas , scd1 and acc alpha ) , which were 2 - to 3-fold upregulated after incubation with high glucose medium , were significantly suppressed by sild - met - leu ( figure 2 ) . in addition , the high glucose induced increase of srebp1 , a key transcription factor for lipid synthesis , was reversed by sild - met - leu ( figure 3 ( c ) ) . in contrast , ppar alpha and delta , transcription factors regulating fatty acid oxidation , were augmented by sild - met - leu ( figures 3 ( a ) and 3 ( b ) ) . moreover , sild - met - leu treatment reduced significantly the ratio of phospho - nf - b to nf - b , indicating a reduced inflammatory response ( figure 3 ( d ) ) . next we tested whether these effects could be repeated using a different induction scheme and a different hepatocyte cell line . induction of lipid accumulation with ffa and lps had similar effects on sirt1 and ampk signaling in hepg2 cells as treatment with high glucose ( data not shown ) . also , treatment with sild - met - leu increased sirt1 protein expression in mouse aml - 12 hepatocytes and reduced lipogenic protein expression of srebp1 , scd1 , and fas similar to our observations in hepg2 cells ( data not shown ) . these treatment effects were not caused by significant changes in cell viability ( data not shown ) . since the activation of macrophages plays an important role in the pathogenesis of nash , we used mouse hepatocytes ( aml 12 cells ) and mouse macrophages ( raw 264.7 cells ) as an in vitro model of nash . to induce lipid accumulation and an inflammatory response , cells were grown individually or in coculture and stimulated with free fatty acids ( oleic / palmitic acid mixture ) and / or lps . stimulation with lps and ffa reduced both ppar alpha and delta in coculture ( figures 4 ( a ) and 4 ( b ) ) and treatment with sild - met - leu reversed this effect . sild - met - leu also increased ppar alpha and delta in macrophages ( figures 4 ( c ) and 4 ( d ) ) , while there was only a trend ( 27 % increase ) for ppar delta and no effect on ppar alpha ( figures 4 ( e ) and 4 ( f ) ) in aml 12 cells . secretion of the inflammatory mediator mcp - 1 was increased after stimulation of cells with ffa only , lps only , or the combination ffa and lps . sild - met - leu completely reversed this effect in aml 12 cells and aml / raw coculture ( figures 5 ( a ) and 5 ( b ) ) . sild - met - leu also reduced the ratio of phospho - nf - b / total nf - b in aml 12 cells to normal control levels . however , the ratio was not changed in raw macrophages , since sild - met - leu reduced both , total and phospho - nf - b ( figures 5 ( c ) and 5 ( d ) ) . in addition , ffa and lps induced tnf secretion and protein expression was significantly decreased by sild - met - leu in raw macrophages ( figures 5 ( e ) and 5 ( f ) ) . based on the in vitro data , we assessed the in vivo effects of sild - met - leu in comparison with met - leu , met - sild and sild - leu in a nash mouse model . feeding of a high - fat atherogenic diet ( hc ) increased liver weight , liver triglycerides , and alt levels ( sixfold ) , indicating significant hepatocellular injury , while treatment with the sild - met - leu combination significantly blunted these effects . although the two - way combinations and sildenafil by itself had some effect on alt levels , the three - way combination exerted a significantly greater effect in comparison with all other groups ( figure 6 ) . histology staining confirmed a pronounced increase in lipid droplets and ballooned hepatocytes induced by hc diet compared with low - fat diet control . while the two - way combinations attenuated these effects , the triple combination sild - met - leu substantially reversed the steatohepatitis ( figure 7 ( a ) ) . moreover , both met - leu and sild - met - leu increased ppar alpha expression in the liver twofold ( figure 7 ( b ) ) , consistent with activation of hepatic fatty acid oxidation . to assess the level of inflammation in the liver , sections of liver were stained with cd68the hc diet caused a sixfold increase of cd68 staining in the liver sections , representing a substantial increase in kupffer cell activation ( figure 8 ) . all two - way combinations significantly attenuated this effect , while only the three - way combination fully reversed it to levels not significantly different from low - fat fed animals ( figure 8 ) . consistent with this , inflammatory markers such as il1 beta , tnf - alpha , mcp - 1 , and pai - 1 were reduced to normal levels by sild - met - leu , but not by the two - way combinations ( figure 9 ) . the increase in fibrotic changes induced by the hc diet was substantially reversed by sild - met - leu and to a lesser degree by the two - way combinations ( figure 10 ) . in accordance with this , gene expressions of the fibrotic markers col1a1 , col1a2 , col4a1 , and tgf - beta were decreased to normal levels by sild - met - leu but only partly reduced by met - leu and sild - met ( figure 11 ) . our data indicate that the triple combination of leucine , metformin , and sildenafil substantially regresses hepatic steatosis , inflammation , and fibrosis and exerts greater effects than the two - way combination , suggesting that this combination may provide a new therapeutic approach to treat nash . multihit process , where multiple environmental , dietary , and genetic factors interact with others . the accumulation of excess lipids in the liver is considered the first step and the prerequisite for subsequent events , which causes progression from simple steatosis to the severe form of nash in about 30 % of patients with nafld . among the other factors contributing to the progression of nashchronic injury to hepatocytes or hepatocyte death due to excess free fatty acid influx leads to activation of resident macrophages ( kupffer cells ) as well as other infiltrating monocytes and macrophages to release proinflammatory cytokines , including tnf - , il - 1 beta , and il - 6 , and profibrogenic factors such as tgf - which in turn results in activation of hepatic stellate cells and fibrosis progression . the three - way combination leu - met - sild targets the ampk - sirt1 - enos network , as depicted in figure 12 . ampk , sirt1 , and enos are key regulators of hepatic energy and lipid metabolism , as well as inflammation , oxidative stress , and cell proliferation , the key factors for progression of simple nafld to nash and liver fibrosis . downregulation of sirt , ampk , or enos promotes the progression of nash , while activation of this network has been shown to improve hepatic steatosis and inflammation . for example , enos - knockout mice fed a high - fat diet showed more extensive hepatic lipid accumulation and inflammation than wild - type mice and resveratrol treatment , a known sirt1 and ampk activator , prevented and reversed lipid accumulation , oxidative stress , and inflammation in vitro and in vivo . we found the triple combination sild - met - leu to upregulate ampk and sirt1 and to increase palmitate - stimulated oxygen consumption and decrease the expression of lipogenic genes such as fas , acc , and scd1 in hepg2 cells . moreover , treatment with sild - met - leu lowered liver triglycerides and reversed the hfd - induced steatosis in mice , the prerequisite condition for developing nash . in addition , we show a reduction of inflammatory markers in vitro and in vivo as well as a normalization of the cd68 staining in liver samples , a marker expressed by monocytes and macrophages . this was also repeated for f4 / 80 marker in a follow - up mouse study ( data not shown ) , in which f4 / 80 was reduced by 40 % by sild - met - leu feeding to levels not statistically different from the control low - fat fed animals . therefore , the triple combination also significantly improves inflammation , one of the key factors for driving progression of the disease . in support of this , the hc - induced fibrosis was totally reversed by supplementation with sild - met - leu , indicated by the percentage of sirius red positive area in liver . however , there is an increasing body of evidence for a role of enos and no / cgmp signaling in the development of hepatic steatosis , inflammation , and progression to fibrosis . the liver is a highly vascularized tissue and enos - derived no from sinusoidal endothelial cells ( sec ) regulate vascular resistance , proliferation , and migration , as well as exerting paracrine effects on adjacent stellate cells . as the first cells exposed to portal vein components and bacterially derived lipopolysaccharides ( lps ) from the gut , secs can undergo dramatic phenotype changes and can induce inflammation and stellate cell activation . enos is constitutively expressed in sec and no plays a crucial role in maintaining physiological phenotypes of secs and stellate cells . moreover , endothelial dysfunction and reduced no production have been found to precede inflammation and fibrosis in a nafld rat model . in contrast , activation of enos as well as increased no production ameliorates the progression of nash - related hepatic fibrosis . we previously demonstrated the amplifying effects of the met - leu combination on ampk signaling and reduction of hepatic steatosis in dio - mice . similarly , leucine with pde5 inhibitors ( sildenafil , icariin ) increased fat metabolism and reduced hepatic lipid accumulation in dio - mice which was associated with increased no production in addition to ampk / sirt1 activation , indicating that the actions of the pde5 inhibitors converge on this pathway . in this study , we demonstrate that the sild - met - leu combination exerts greater effects on inflammatory and fibrogenic parameters than the met - leu or the sild - leu combination , suggesting that the stimulation of enos / no / cgmp pathway may contribute to additional effects on the ampk / sirt1 signaling . the peroxisome proliferator - activated receptors - ( ppar - ) alpha and delta are transcription factors finely regulating energetic fluxes and metabolic pathways . ppar - is highly expressed in liver and regulates the rates of fatty acid catabolism and lipogenesis in response to nutritional demands . ppar - deficient mice develop more severe hepatic steatosis , inflammation , and nash when fed a hfd compared to wild - type mice , while administration of the ppar - agonists reverses hepatic steatosis and fibrosis . , it controls hepatic glucose and lipoprotein metabolism and exerts anti - inflammatory effects . beneficial effects of ppar - agonists on improvement of hepatic steatosis and inflammation have been reported in mouse models of nash . the three - way combination in this study showed significant upregulation of ppar - and - in vitro and of ppar - in the mouse liver . this may be an indirect treatment effect secondary to ampk / sirt1 stimulation , since ampk and sirt1 interact with ppar - and - . we recently demonstrated the efficacy of the met - leu combination and a combination of leucine with the pde5 inhibitor icariin in reducing hepatic lipid accumulation and inflammation in a hfd - induced nafld mouse model . in this study , we used a high - fat atherogenic diet ( 60 % fat , 1.25 % cholesterol , and 0.5 % cholate ) to induce a more severe form of nash , as this diet induces hepatic insulin resistance , progressive steatosis , inflammation , and fibrosis over 6 to 24 weeks , mimicking the human disease pathology . the animals used in this study developed a significant steatosis with ~ 7-fold increase in liver triglycerides , hepatic inflammation , and fibrosis within the 12 weeks of study , which is comparable to other studies using this form of diet to induce nash . we used different forms of induction for the lipid accumulation in hepg2 ( high glucose ) and aml cells ( high concentration of ffa ) , which limits the ability to compare results between these cell lines . moreover , aml and raw cells were stimulated with ffa , lps , or a combination of both in different experiments , although we show in figure 3 ( a ) that there was a comparable effect . finally , not all in vitro parameters were measured in vivo due to limited tissue availability and since we had demonstrated ampk / sirt1 activation already previously for the two - way combinations in mice studies . in summary , we demonstrate the beneficial effects of the three - way combination sild - met - leu on the reversal of hepatic steatosis , inflammation , and fibrosis in a nash mouse model and that all the three components are necessary for maximal effect . these effects are mediated by targeting the ampk / sirt1 / enos network from multiple sites , each contributing a modest effect to the overall outcome , as summarized in figure 12 . this approach allows a substantial dose reduction of each individual compound to a concentration , which has little or no independent effect on the measured outcomes . therefore , the risk of associated adverse effects of the individual compounds will be diminished . based on the pivotal role of the ampk / sirt1 / enos network in hepatic metabolism and the promising results of this animal study , the sild - met - leu combination provides a new therapeutic approach to treat nafld and nash .\noutput:\n" }, { "from": "agent", "value": "sirt1 , ampk , and enos modulate hepatic energy metabolism and inflammation and are key players in the development of nash . l - leucine , an allosteric sirt1 activator , synergizes with low doses of metformin or sildenafil on the ampk - enos - sirt1 pathway to reverse mild nafld in preclinical mouse models . here we tested a possible multicomponent synergy to yield greater therapeutic efficacy in nafld / nash . liver cells and macrophages or an atherogenic diet induced nash mouse model was treated with two - way and three - way combinations . the three - way combination sild - met - leu increased hepatic fatty acid oxidation and reduced lipogenic gene expression and inflammatory marker in vitro . in mice , sild - met - leu reduced the diet induced increases of alt , tgf , pai - 1 , il1 , and tnf , hepatic collagen expression , and nearly completely reversed hepatocyte ballooning and triglyceride accumulation , while all two - way combinations had only modest effects . therefore , these data provide preclinical evidence for therapeutic efficacy of sild - met - leu in the treatment of nafld and nash ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: hypocalcemia may be associated with a spectrum of clinical manifestations ranging from tingling to life - threatening seizures , refractory heart failure , or laryngospasm . besides severity , the rate of development of hypocalcemia and chronicity determine the clinical manifestations . among the symptoms of hypocalcemia , tetany , papilledema , and seizures may occur in patients who develop hypocalcemia acutely . by comparison , ectodermal and dental changes , a 30 - year - old female presented with symptoms of fearfulness , self - talking , asociality , anhedonia , avolition , apathy , suicidal ideations , decreased sleep , aggressive behavior for the past 2 months , and , in addition , delusion of persecution and auditory and visual hallucinations on mental status examination ( mse ) . there was no history of fever , headache , vomiting , or weakness of any side . she also complained of intermittent paresthesias in her hands and feet but denied any muscle weakness or cramps . she was oriented to time , place , and person with no focal neurological deficit . there were no cerebellar signs and no evidence of extrapyramidal disorder in the form of tremor , rigidity , or bradykinesia . image showing positive trousseau 's sign laboratory studies revealed serum calcium of 5.6 mg / dl ( normal range : 8.4 - 10.5 mg / dl ) , phosphate 4.7 mg / dl ( normal range : 2.7 - 4.5 mg / dl ) , and 3.4 g / dl of albumin ( normal range : 3.5 - 5.3 g / dl ) . in view of hypocalcemia , her parathormone levels were sent , which came out to be normal 30 pg / ml parathyroid hormone ( pth ) ( normal range : 10 - 65 pg / ml ) . renal functions tests , liver function tests , thyroid function tests , and viral markers did not reveal any abnormality . computed tomography head showed diffuse , symmetric parenchymal calcifications involving the globus pallidus [ figure 2 ] . computed tomography of head showing calcification of b / l globus pallidi in view of normal pth levels with basal ganglia calcification , a diagnosis of fahr 's syndrome was made . the patient was started on 0.5 g calcitriol and 1000 mg calcium carbonate ( oral , daily ) . after 1 week , her chronic paresthesias resolved and serum calcium rose to 9.2 mg / dl . she was also started on 100 mg / day of quetiapine , increased to 600 mg / day in divided doses , and subsequently reduced to 50 mg / day within 1 year . the patient was lost to follow - up and subsequently presented after about 14 months with the same psychopathology of paranoid behavior , asociality , anhedonia , and auditory and visual hallucinations , and again was found to have serum calcium levels of 6 mg / dl ( rest all investigations within normal range ) . the patient was started on quetiapine gradually increased to 600 mg / day along with serum calcium correction , and the patient maintained well - till a period of 1 year ( till the time patient was followed up ) . fahr disease , first described in 1930 , is an autosomal dominant disorder characterized by symmetric calcifications in basal ganglia , dentate nucleus , and cerebral white matter . various clinical manifestations include cognitive impairment , extrapyramidal features , cerebellar dysfunctions , and seizures . psychotic symptoms include auditory and visual hallucinations , paranoid delusions , ideas of reference , ideas of influence , catatonia , and atypical features such as complex perceptual disturbances . the common signs and symptoms of patients presenting with hypocalcemia are seizures ( all types ) , dementia ( in adults ) , mental retardation ( in children ) , emotional problems ( anxiety , depression ) , extrapyramidal symptoms ( parkinsonism is most common ) , calcifications of basal ganglia ( in longstanding disease ) , papilledema , increased neuromuscular irritability , chvostek 's sign , trousseau 's sign , paresthesias in circumoral and acral areas ( fingers , toes ) , muscle stiffness , myalgias , and spasms ; cardiovascular symptoms include prolongation of qt interval , congestive heart failure , hypotension , autonomic symptoms , biliary colic , bronchospasm , diaphoresis , and other symptoms such as cataract , dry coarse skin , dermatitis , hyperpigmentation , and eczema . in mild hypocalcemia , patients have anxiety , paresthesias , irritability , and emotional lability . a case of psychosis due to idiopathic hypoparathyroidism ( ihp ) has been followed for over 9 years . the optimal treatment for ihp psychosis was found to be a combination of ergocalciferol and fairly large doses of antipsychotic medication . in general , it is suggested that psychiatric disturbances in ihp and treatment resistance to antipsychotic medication in other psychoses may also be related to hypomagnesemia . although virchow and bamberger independently described the histology of bilateral basal ganglia calcifications in 1855 , it was not until 1939 that their association with chronic hypocalcemia was recognized by eaton et al . microscopic colloid deposition around cerebral blood vessels is followed by calcification most commonly in the basal ganglia , but also in the thalami , dentate nuclei , cerebral cortex , centrum semiovale , and mesencephalic gray matter . it is an interesting case worth reporting because this patient of hypocalcemia with schizophreniform disorder was found to have two such episodes of schizophreniform disorder over a period of about 3 years and is currently under remission with treatment with no cognitive decline .\noutput:\n" }, { "from": "agent", "value": "among the symptoms of hypocalcemia , tetany , papilledema , and seizures may occur in patients who develop hypocalcemia acutely . we describe a rare case of hypocalcemia presenting as schizophreniform disorder . among other presentations of hypocalcemia , one should also look for the relation between psychotic symptoms and calcium levels in a patient presenting with psychotic symptoms ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: many investigations are being conducted to understand biological aspects of normal physiology of female reproductive tract , female reproductive diseases and infertility with female factor , in particular at the molecular and protein levels , although much still remains to be known . to find out biological complexities of female reproduction , each protein at the tissue level requires to be addressed . significant advances in molecular biology research particularly in high - throughput proteomics technologies have provided unbelievable opportunities to investigate global and targeted protein expression and modification in different biological systems . to date , many data in molecular biological research have been withdrawn from genomic analysis ; however , genomic data alone presents nothing about protein expression , functions and isoforms . then , integration of genomic data with results from the analysis of protein expression and function would be more valuable if we want to know that how cells or tissues act at the molecular level in physiological and pathological conditions . therefore , today , many efforts turn to the investigation of proteins expressed by the genome of a tissue or an organism so - calledthe use of proteomics technologies enables us to study the expression of several hundreds or thousands of proteins in order to reveal physiological state of a tissue or an organ at the molecular level and to identify disease - specific biomarkers . in the field of reproductive biology , proteomics toolshave been exploited to address many molecular biological questions related to various reproductive tissues ( including ovary , gametes , testis , endometrium , and placenta ) and to know molecular interactions which occur during gametogenesis , fertilization , endometrial receptivity , and embryo implantation . both gel - based proteomics including two - dimensional gel electrophoresis ( 2de ) gel and 2de - fluorescence difference gel electrophoresis ( dige ) and gel - free proteomics such as liquid chromatography ( lc ) and capillary electrophoresis are useful methods to identify proteins playing role in reproductive system . currently , proteomics has been dominated by 2de gel coupled by mass spectrometry ( ms ) as it is still most reproducible and effective technology to separate overall proteins of the microorganisms , cells , and heterogeneous tissues . however ,2 de gel is not still widely employed by reproductive biologists to address questions attributed to proteins , proteins functions , and interactions involved in the reproductive system . therefore , this current review will provide an overview in application of 2de gel coupled by ms about female reproductive system in both human and animal species to introduce proteomic technique as a useful method to investigate proteins and molecules involved in the biology of female reproductive system . gel - based proteomics is the most popular and a well - established technique for global protein separation and quantification . through this technique , overall protein expression of tissuescould be analyzed at the large scale , and it is a cheaper approach in comparison with gel - free proteomics .2 de gel , ms and bioinformatics tools are the key components of the gel - based proteomics . polyacrylamide gel - based proteomics consists of 2de gel and 2de - dige , a 2de variant . in 2de , the complex protein samples are separated in two dimensions according to their net charge at different ph ( isoelectric focusing ) and their molecular weights sodium dodecyl sulfate - polyacrylamide gel electrophoresis ( sds - page electrophoresis ) . protein migration in a perpendicular direction provides a spot map of the proteins distributed in 2de gel . the technique has a great resolving power to make it possible to visualize 10,000 spots corresponding to 1000 proteins . the next typical steps of 2de gel technique are spot visualization , spot evaluation and expression analysis . application of 2de - dige can reduce the protein ratio errors because of low gel - to - gel variations which could frequently occur in 2de gel technique .2 de - dige includes tagging three protein extracts with different fluorescent cydyes ( cy2 , cy3 , and cy5 ) that are subsequently mixed and separated on a single gel . schematic representation of various steps involved in two - dimensional gel electrophoresis coupled by mass spectrometry to identify proteins in various cells , tissues and organs . wb = western blot ; elisa = enzyme - linked immunosorbent assay ; ihc = immunohistochemistrythe endometrium is hormonally regulated organ that is receptive to blastocyst implantation only for a limited time ( 45 days of each menstrual cycle ) called the implantation window . therefore , characterizing implantation molecular events is crucial as failure of implantation is a main reason for loss of a normal pregnancy . moreover , the high incidence of in vitro fertilization ( ivf ) failure is mainly due to disruption of implantation after embryo transfer in ivf cycles . however , as a huge number of proteins and mediators are involved in the process of embryo implantation , and also many of these factors have multiple functions and high rates of redundancy , a single biomarker for embryo implantation has not yet been discovered . to date , the results of 2de gel application on the endometrial tissue and secretions have shown different patterns of endometrial protein expression during various time points of the menstrual cycle . in most studies , endometrial proteome in the secretory phase has been compared with endometrial proteome in the proliferative phase within a normal menstrual cycle . study of cycling human endometrium by 2de - dige identified 76 proteins , production of 41 different genes , differentially regulated between mid - proliferative ( days 810 , nonreceptive ) and mid - secretary ( days 1923 , receptive ) phases of the menstrual cycle . the proteome changes were confirmed by immunohistochemistry on 3 representative proteins including rho gdp - dissociation inhibitor 1 - , chloride intracellular channel and membrane - associated progesterone receptor membrane component 1 ( pgrmc1 ) . to find crucial interactive networks in the cycling of human endometriumthey reported that the jnk and epidermal growth factor signaling pathways play regulatory roles in protein expression during the mid - secretory phase . employed 2de gel to study endometrial proteome at the late proliferative phase in comparison with mid - secretory phase of the menstrual cycle of fertile women .57 spots were up - regulated in the proliferative phase compared to 104 spots which were down - regulated in the mid - secretory phase . of identified proteins , the level of calreticulin ( calr ) , fibrinogen , adenylate kinase isoenzyme 5 and transferrin was up - regulated in proliferative phase while annexin v , peroxiredoxin 6 , 1 - antitrypsin ( aat ) , and creatine kinase were down - regulated in mid - secretory phase . in this study also , heat - shock protein 27 ( hsp 27 ) , transferrin , and aat precursor were detected in both proteome of endometrial and uterine fluid samples at mid - secretory phase of menstrual cycle , implying that endometrium is one of the sources of protein secretion in uterine fluid . in similar study , 57 out of 215 spots were differentially altered at the proliferative phase compared to the secretory phase of the menstrual cycle . identification of proteins in the 49 differentially altered spots revealed that proteins involved in cell proliferation and cytoskeleton were up - regulated in the proliferative phase compared to the secretory phase . further , the level of hsps including 96 kda glucose - regulated protein ( grp96 ) , grp78 , hsp 70 isoforms increased during the proliferative phase . it may be concluded that since the proliferation needs higher protein synthesis , chaperones such hsps which are involved in correct folding of synthesized proteins are produced more during the proliferative phase . two - dimensional gel electrophoresis - fluorescence difference gel electrophoresis study on endometrial samples of fertile women at the prereceptive phase ( 2 days after luteinizing hormone [ lh ] surge , lh + 2 ) and at the receptive phase ( 7 days after lh surge , lh + 7 ) within a normal menstrual cycle revealed only two consistently regulated proteins in both groups . annexin a2 was up - regulated in the receptive endometrium , probably due to facilitating adhesion of the embryo to the apical surface of the endometrial epithelium . uterine secretome contains nutrients , cytokines , enzymes , transport proteins , antiproteases , plasma - derived proteins and other biologically active factors . molecular alterations in the glandular and surface epithelium could result in changes of protein contents in uterine fluid during different phases of the menstrual cycle , embryo implantation , and various stages of pregnancy . thus , using lavage of the uterine cavity ( uterine fluid ) could be useful to investigate endometrial proteome particularly secretory proteins . using lavage samples in studiescould be helpful as collection of endometrial lavage is less invasive than sample biopsy so it could be more acceptable and less annoying for patients or women participating in studies . further , sample of uterine secretome has less complexity than the tissue , as it contains no abundant structural and housekeeping proteins such as actin and vimentin which are present in endometrium , also abundant plasma proteins like albumin can be easily removed from uterine fluid by provided various immunodepletion kits . finally endometrial biopsy for implantation study could impact on the process of embryo implantation while using uterine fluid for endometrial study not only it does not affect the process of implantation also it could be helpful method to predict implantation outcome in women are under treatment of ivf . a research on endometrial lavage at prereceptive ( lh + 4 ) and receptive phases ( lh + 9 ) of the menstrual cycle was performed by scotchie et al . surprisingly , some proteins which are crucial for implantation including glycodelin , leukemia inhibitory factor , and osteopontin , were not identified in uterine secretion . it may be because these proteins are low abundance and highly glycosylated and phosphorylated in lavage samples which could impact ability of identification of these proteins in analyses . casado - vela et al . identified 803 various proteins in endometrial secretion at mid - secretory phase using a combination of techniques including high - performance liquid chromatography ( hplc ) tandem ms , sds - page followed by hplc / ms / ms and 2de gel followed by matrix - assisted laser desorption ionization time - of - flight ms . although this study could provide a list of proteins present in the uterine secretion in secretory phase , the level of identified proteins were not compared to different phase of the menstrual cycle or with the same phase of menstrual cycle in endometrium of infertile women . in an extensive study using 2de - dige , the protein content of uterine lavage at receptive and nonreceptive phases of the menstrual cyclethe expression level of three isoforms of 2 - macroglobulin , aat , and activin receptor type - 2b increased at mid - secretory phase ( receptive ) when compared to mid - proliferative phase ( nonreceptive ) across menstrual cycle of fertile women , suggesting they may have roles in embryo implantation . comparison of mid - secretory phase between fertile and infertile women showed a reduction of 6 proteins and elevation of 12 proteins in uterine lavage of infertile women . this different pattern in proteins expressions in the uterine lavage of fertile and infertile women may impact on fertility of women . as reviewed earlier , most endometrial proteome studies have been conducted on the endometrial or uterine fluid samples at mid - proliferative and mid - secretory phases across the menstrual cycle in fertile or infertile women however , proteome analysis of human endometrium during various stages of pregnancy has not been achieved due to increasing risk of miscarriage and ethical considerations . a few animal studies have been carried out to identify differentially expressed proteins in pregnant endometrium compared to nonpregnant endometrium using 2de gel . we compared ovine endometrial ( caruncular and intercaruncular ) proteome of pregnancy on days 12 ( conceptus preattachment ) , 16 ( embryo implantation ) , and 20 ( postimplantation ) of pregnancy with ovine endometrial ( caruncular and intercaruncular ) proteome of oestrous cycle on days 12 and 16 using 2de gel - based proteomics . in the caruncular endometrium ,58 % ( 500 out of 867 ) and in the intercaruncular endometrium , 75 % ( 998 out of 1324 ) of detected protein spots demonstrated some changes in expression during embryo implantation and early pregnancy . in caruncular endometrium , 45 protein spots ( 5 % of total spots ) changed between days 12 and 16 of pregnancy whereas 85 protein spots ( 10 % of total spots ) were differentially expressed between days 16 of pregnancy and oestrous cycle . in intercaruncular endometrium , 31 protein spots ( 2 % of total spots ) altered between days 12 and 16 of pregnancy while 44 protein spots ( 4 % of total spots ) were different between days 12 and 16 of oestrous cycle . among the identified proteins , 11 proteins in the caruncular endometrium and 6 proteins in the intercaruncular endometrium were identified . the identified proteins play a role in proteins synthesis , protein degradation , antioxidant defense , cell structural integrity , cell adhesion , and signal transduction which may be important for embryo implantation and establishment of the pregnancy . studied proteome of pig endometrium on 7 days after menstruation ( nonpregnant ) and 40 , 70 , and 93 days of pregnancy . they reported 63 up - or down - regulated proteins between nonpregnant and pregnant endometrium . several proteins involved in the development , cell differentiation , cell proliferation and cell death including transferrin , protein dj - 1 , transgelin , and galectin 1 changed significantly in pregnant pig endometrium , indicating their importance in the maintenance of pregnancy . findings of this study suggest that differentially expressed proteins in endometrium may regulate uterine development for the maintenance of pregnancy . in similar study , endometrial proteome of nonpregnant and pregnant pig ( day 14 ) was compared together using 2de - dige followed by lc - ms / ms along with itraq labeling and nano - lc - ms / ms . data of both proteomics techniques revealed 14 significantly changed proteins among endometrial proteome of pregnant and nonpregnant pigs . expression of several proteins including signal transducer and activator of transcription 1 , interferon and aldose reductase 1 ( akr1b1 ) altered between pregnant and nonpregnant endometrium . proteome studies relevant to endometrial tissue and secretions at the time of embryo implantation and during different phases of endometrial cycle have been resulted in identifying many proteins essential for embryo - maternal dialog , demonstrating that 2de gel coupled by ms can apply to identify proteins playing crucial roles in endometrial function and development . further , these findings reveal the complexity of the endometrial tissue in nature , in particular during receptivity , pregnancy , and infertility . with improvement of proteomic technology and better designing of in vivo and in vitro biological studies , it will likely provide better opportunity to identify novel biomarkers for embryo implantation , maintenance of pregnancy , and infertility in the near future . the human corpus luteum ( cl ) is a principal source of steroid hormones particularly progesterone ( p4 ) during the luteal phase that is important to the maintenance of early pregnancy . application of gonadotropins for ovarian stimulation in ivf cycles results in changing endocrine environment and cl dysfunction . thus , research on proteome of cl would be helpful to reveal proteins and molecules involved in rescuing of the cl and maintenance of p4 production during early pregnancy . further , it is valuable to know more about proteins which are involved in regression of the cl at the end of luteal phase within the normal menstrual cycle and also about molecular and proteome basis of the cl when there is a need to apply exogenous p4 or human chorionic gonadotrophin or estradiol to support luteal phase in patients undergoing ivf cycles . to date , however , a few proteomics studies have been carried out to investigate cl proteome . we studied proteome of ovine cl on days 12 , 16 , and 20 of pregnancy compared with proteome of ovine cl on days 12 and 16 of the oestrous cycle using 2de gel - based proteomics . at the time of embryo implantation on day 16 , 77 protein spots were up - regulated , and 101 protein spots were down - regulated in cl of pregnancy compared to regressed cl . to identify proteins , we found several proteins , playing crucial roles in key biological pathways including oxidative stress , steroidogenesis , signal transduction , and apoptosis which have not previously been reported in association with alterations occurring in the cl during peri - implantation periods . the identified proteins are probably involved in rescuing the cl from regressing and allowing the cl to produce p4 during early pregnancy . a study on mouse cl proteome was carried out when the cl is functional during pregnancy ( pregnancy cl ) , when the pregnancy cl is regressing after parturition ( regressing cl ) and finally the cl during lactation ( lactation cl ) . the results demonstrated 24 proteins with a few differences between pregnancy cl and lactation cl probably because both pregnancy and lactation cls are functional , secreting steroid hormones .10 out of 24 identified proteins were enzymes defining a ketogenic metabolic landscape which can reveal the prevalence of de novo cholesterol synthesis in steroidogenic cells particularly in lactation cl . in addition , protein of 20 alpha - hydroxysteroid dehydrogenase , a well - known marker of cl regression , and 3 proteins of ferritin , cathepsin d , and gamma actin which are involved during cl regression were found higher in regressing cl when compared with functional cls ( pregnancy and lactation cls ) . gametes are good candidates to be subjected to proteomics technologies as their proteins create oocyte or sperm , having great importance in fertilization and pregnancy outcomes and it can enhance our knowledge about their biology to generate a healthier offspring in reproductive medicine . further , the mature oocyte contains maternal proteins required for fertilization , oocyte - to - embryo transition and the early embryo development . for proteome analysis of gametes , as accessibility of human oocytes is difficult , and it is sometimes annoying for women , proteomics study on human oocytes has not been performed to date , however , due to easily accessibility of sperms , many proteomics studies have been carried out on human sperms . thus , the proteomics studies of oocyte have been carried out only in animals , particularly in mice . ma et al . applied 2de gel to analyze proteome and phosphoproteome of mouse oocyte at metaphase - ii ( mii ) stage while the zona pellucida of oocytes had been removed . , 90 protein spots representing 53 unique proteins have been subjected to phosphopotein staining using pro - q diamond dye , demonstrating they are present in the mii oocytes in phosphorylated forms . a comparative proteomics study on mouse oocyte at the germinal vesicle ( gv ) and mii stages ( zona pellucida had been removed ) the results revealed 56 up - regulated protein spots and 39 down - regulated ones at the mii oocytes compared with gv oocytes . of 95 differentially expressed proteins spots between gv and mii oocytes , 63 proteins were identified . however , in the similar study , only 12 differential proteins were identified using 2de gel . the reason may be because zona pellucida , which contains similar proteins , had not been removed from mii and gv oocytes and thus it might impact sensitivity of detection . many of 63 identified proteins are known to be involved in oocyte meiosis and early embryonic development including adenylosuccinate synthetase , nucleoplasmin - 2 and protein arginine deiminase type 6 . they also identified for the 1 time , a highly expressed novel protein , e330034g19rik , which might be an oocyte - specific protein . jiang et al . investigated proteins associated to oocyte aging and the effects of caffeine on oocyte aging in porcine using 2de - dige . they reported 23 highly expressed proteins including citrate synthase , aldose reductase , and 3 lowly expressed proteins such as beta - actin and peptidyl arginine deiminase like protein during the oocyte aging process . in caffeine - treated oocytes , expression of 6 identified proteins such as heat shock 70 kda protein 1b ( hspa1b ) and protein glial fibrillary acidic increased while expression of 12 proteins such as 90 - kda heat shock protein ( hs90a ) and calr decreased compared to oocytes in mii stage . they concluded that caffeine treatment could change expression levels of gamete proteins in favor of prolonging physiological aging . in conclusion , proteomic studies of oocyte may enhance our knowledge in connection with molecular and protein relationship underlying physiology , quality , and aging of oocyte . as reviewed , gel - based proteomics coupled with ms is a useful technique to investigate protein identification and protein expression alterations in female reproductive tissues . nevertheless , obtained data from gel - based proteomics techniques should be cautiously interpreted particularly when the interested tissues are heterogeneous in nature . heterogeneous tissues such as ovary , cl and endometrium contain various types of cells including epithelial cells , fibroblast cells , immune cells , blood cells , and endothelial cells . further , these tissues undergo remodeling during the oestrous cycle , embryo implantation , and early pregnancy . in general , the issues that should be considered in analyzing and interpreting the data acquired from the heterogeneous tissues are : ( 1 ) the cell types which express the identified protein , ( 2 ) the amount of protein expressed in the different cell types , ( 3 ) changes in the ratios of different cell types in the tissues . these issues can be addressed by performing immunolocalization ( immunohistochemistry [ ihc ] ) and histomorphological analysis . in addition , no single approach can fully unravel the relationship between the amount of protein expressed ( obtained data from gel - based proteomics ) and gene expression or tissue remodeling . ihc , quantitative reverse transcription - polymerase chain reaction and cell culture followed by western blot ( wb ) may be carried out to understand this relationship . for instance , in cell culture studies of endometrium , epithelial and stromal cells could be separately cultured and then protein levels , quantified by wb , could be correlated with the number of cells by counting cells recognized by the relevant antibodies . data obtained from gel - based proteomics are required to be strongly validated to overcome technical errors performed during sample analysis or to reduce false positive or false negative results arising from individual biological variation . to validate the 2de gel findings , 1de / 2de wb and enzyme - linked immunosorbent assay ( elisa ) were frequently utilized , however , in some cases , wb or elisa findings did not show strong agreement with 2de gel findings . therefore , where the 2de gels yielded specific isoform separately , the wb reflected total immunoreactive quantities of the protein , and this may cause a dismaching between the 2de gel and wb quantitations of proteins . detection of low - abundance proteins in reproductive biological samples is one of the main limitations of current gel - based proteomics since large quantities of abundant soluble proteins obscure their detection . the most low - abundance proteins including regulatory proteins , signal transduction proteins , and receptors are known to be important in cell function . to obviate this , cellular proteomics approach is increasingly used . moreover , to detect the low - abundance proteins , the abundant proteins could be removed from the reproductive samples by various methods such as affinity columns and sample sub - fractionation . thus , robust sample preparation techniques remain one of the most important steps in gel - based proteomics . applying narrow range immobilized phgradient / ipg ( 23 ph units and 1 ph unit ) enables the most proteins to be resolved . as a consequence , more low - abundance proteins can be detected , and it also has markedly improved the reproducibility of 2de gels . most significant challenges in gel - based proteomics arise from working with samples of biological fluids including plasma , urine , secretome , and peritoneal fluid . the collection of these samples is easier and noninvasive when they are compared to tissue samples , however , there are some drawbacks to use samples of biological fluids in proteomics studies . for instance , the wide dynamic range of protein concentrations and presence of high - abundance proteins in plasma such as albumin and igg makes difficult identification of low - abundance proteins in plasma and also other biological fluids . to overcome this problem , high - abundance proteins can be removed by immunodepletion , affinity depletion , chromatography , and subfractionation of biological fluid samples . collectively , careful sample selection ( tissue or biological fluid ) , high - throughput sample preparation , removal of abundance proteins , and sample fractionation strategies could significantly improve the data drawn from gel - based proteomics when a hypothesis is defined in female reproductive research . this review provides an opportunity to deeper understanding of proteomics application , in particular , gel - based proteomics technology as a powerful technique to unravel molecular complexity underlying female reproductive biology and infertility . despite good progress in sds - page electrophoresis , bioinformatics , and protein detection , there is still a long way to achieve highly standardized gel - based technique . indeed , there are a few limitations to exploit the gel - based proteomics to investigate proteome profile of female reproductive tract . to challenge this , it is crucially required to robust sample preparation and to enhance the sensitivity of the technique . if the limitations of the gel - based proteomics are obviated , it will expectedly open new doors to research on the biology , physiology , and pathology of female reproductive tract including cl , oocyte , and endometrium .\noutput:\n" }, { "from": "agent", "value": "recently , gel - based proteomics has been increasingly applied to investigate proteins involved in female reproductive tract in healthy and disease states . gel - based proteomics coupled by mass spectrometry ( ms ) facilitate the identification of new proteins playing roles in cellular and molecular interactions underlying female reproductive biology and it is a useful method to identify novel biomarkers of diseases by studying thousands of proteins simultaneously involved in female reproductive tract in healthy state compared to disease state . this review will discuss the best studies areas contributed to female reproductive biology in which gel - based proteomics coupled by ms has been applied to generate proteome of female reproductive tract in a healthy state ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it is widely recognized that gps ' views are important in the evaluation of mental health care services .1 together with frequently conducted patient experiences or user satisfaction studies ,2,3 such evaluations give insight into how the health care system functions fromthe perspectives of important target stakeholders . however , the validity of patient satisfaction or experiences studies is debated ,2,4,5 and evidence for an association with other widely used measures of institutional performance would strengthen the validity of such studies .6 since health professionals normally are better qualified to evaluate the technical or professional aspects of health care than patients , one fruitful approach may be to compare patient evaluations and gp or other referrer evaluations of mental health care institutions . systematic searches of the literature revealed few studies on the association between ratings based on user evaluation and referral evaluation , and the studies found had varying quality .5,711 in a study that compared patient satisfaction and other quality indicators ,5 it was found that patient satisfaction was more closely associated with the results of an independent review than other quality indicators including referral satisfaction . however , the sample was small for each of the five service units , and no statistical tests were conducted to assess the associations at the individual or service level . in another study of consumer satisfaction at an inpatient childpsychiatric unit ,7 a low - to - moderate correlation was found between parent satisfaction and referral satisfaction . however , different data collection methods for parent satisfaction and referral satisfaction make it hard to interpret results . other referrer and user evaluation studies have also been restricted to one unit and have not included an assessment of the strength of associations between the groups evaluation of the unit .811 in our study , we examine the association between gps and patients assessment of community mental health outpatient clinics in norway . gps act as spokesmen for patients in addition to being users of mental health services by referring patients and receiving supervision , and the need for better communication between psychiatric services and gps has been stressed by others .12 due to lack of knowledge about the association between patient experiences and gp experiences , the study was exploratory without formal hypothesis about the strength of association . our first research question is concerned with whether clinics with positive patient assessments also have positive gp assessments . general satisfaction and waiting time for patients are measured in the same manner in the two national surveys and can be expected to be correlated because of similar content . second , we assess the association between clinic scores for gp and patient evaluation across a range of variables . the focus in this part of the analysis is not each separate association but rather to assess if there is a systematic pattern of positive and significant associations between clinic scores for patient and gp evaluations across a range of aspects of health care . our second research question concerns health care predictors of general satisfaction for both gps and patients . the objective of this aspect of the analysis is to provide relevant information for quality improvement work aimed at increasing patient satisfaction and / or gp satisfaction . all community mental health centres in norway were included in both national surveys ( n = 77 ) . in the gp study , six centres reported in the gp study were merged to three institutions to give concurrence between the institutional lists in the two surveys . the gp sample was all gps registered in norway who filled in a questionnaire for evaluation of the community mental health centre in their area in a postal survey in january 2006 . , 106 gps were excluded because a filter question showed that they did not evaluate the outpatient clinic at the community mental health centre . the national sample has been shown to be representative .13 there were small differences between respondents and non - respondents in relation to demographic and practice variables , and the background variables that were significantly different were not at all or were only weakly related to the main outcome variables . the procedure regarding informed consent , study design and data collection was approved by the norwegian social science data services . the postal patient survey included adults with one or more registered contacts with a mental health outpatient clinic in norway between august 20 and november 11 , 2007 . we drew a probability sample of 400 patients for each institution or included all eligible patients in the period if the number of patients were 400 . clinics for elderly or substance abuse clinics were excluded . in our study , patients attending the outpatient clinics at the community mental health centres from the gp survey were included ( n = 69 centres ) . the questionnaire was answered by 9001 ( 40 % ) patients . the respondents differed from non - respondents in relation to age , gender , diagnosis and the number of consultations in the inclusion period . to assess non - response bias , we randomly selected 293 postal non - respondents from 10 randomly selected clinics to be included in a telephone follow - up . a total of 110 patients answered a shorter version of the postal questionnaire , including the 11 core items of the psychiatric out - patient experiences questionnaire .14 the difference between telephone respondents and postal respondents on the psychiatric out - patient experiences questionnaire ( popeq ) - 11 scale was small and insignificant ( 2 on a scale from 0 to 100 ) , indicating little non - response bias . the norwegian regional committee for medical research ethics , the data inspectorate and the norwegian directorate of health and social affairs approved the survey . the general practitioner experiences questionnaire is described in detail elsewhere1 and comprises the following scales with good evidence for data quality , reliability and validity : workforce situation ( four items ) , discharge letter ( three items ) , competence ( four items ) , guidance ( three items ) and emergency situations ( two items ) . guidance includes items relating to cooperation meetings , organized training and receiving necessary professional support . emergency situations includes items relating to contact with and help from the centre in emergency situations . all scales met the criterion of 0.7 for cronbach 's alpha and test retest correlations were 0.720.87 . the results of construct validity testing were as hypothesized . to secure the comparability between gps and patients , we included items with similar content from the two questionnaires . for gps single items related to general satisfaction , perceived waiting time for the patients , and contact with the centre in situations where the gp need advice . the reliability of the five scales is unaffected by the inclusion of the single items . the reliability of single items is poorer than for scales , but following the objective of this study comparability was prioritized . the popeq is described in detail elsewhere14 and comprises one unidimensional scale with the three following subscales : clinician interaction ( 6 items ) , information ( 2 items ) and outcome ( 3 items ) . all scales met the criterion of 0.7 for cronbach 's alpha and test retest correlations were 0.750.90 . as a result of better face validity and psychometric results in 2007 , two of three items within the outcome scale were replaced with two new items . the revised subscale includes three questions about outcome related to improvement in health problem , functioning in the family and functioning outside the family , all compared to pretreatment at the clinic . we also included items of similar content as in the gp questionnaire : general satisfaction , assessment of waiting time and ease of getting in touch with the clinic by telephone . all items have a five - point response scale , except waiting time , which has a four - point response scale . all scales and items were transformed to scores ranging from 0 to 100 where 100 is the best possible rating . for computation of scale scorewe summed these values for individual questions within a scale and transformed them into percentage scores . patients with missing values on more than half of the items in a scale were excluded . the single items were directly transformed from a five - point scale to a 0100 scale ; 1 = 0 , 2 = 25 , 3 = 50 , 4 = 75 and 5 = 100 . the size of the catchment area and the number of consultations in 2005 for each centre were extracted from the samdata reports with the 2005 national statistics for the mental health services .15 the norwegian patient register provided data about waiting time . we present descriptive statistics for the outpatient clinics ; mean , sd and range for clinic size , number of inhabitants in the catchment area , size of gp and patient sample and for the scales and items from the evaluations by gps and patients . correlations between gp variables and patient variables at the clinic level were assessed by pearson 's r. pearson 's r can be viewed as an indicator that describes a linear interdependence between two variables , ranging from 1 to 1 . it has been argued that pearson 's r is robust also at the ordinal level , at least when there are more than two response alternatives .16 moreover , several of the variables comprise summated rating scales based on more than one item . all correlation estimates were tested for statistical significance ( two tailed ) . because of the exploratory nature of our study , we chose not to adjust for multiple testing .17 all analyses were conducted within spss15 .0 . an earlier multilevel study has shown that there is significant variation at the centre level for all scales measuring gp experiences with the centres .18 multilevel analysis of the patient experiences data shows less variation between clinics , but most variables in this study also have a significant intraclass correlation coefficient at the clinic level . we performed two multiple regression analyses to identify health care predictors of gp and patient satisfaction with the clinics . we included 14 health care factors in the analysis of patient satisfaction with the clinics and 12 health care factors in the analysis of gp satisfaction . all community mental health centres in norway were included in both national surveys ( n = 77 ) . in the gp study , six centres reported in the gp study were merged to three institutions to give concurrence between the institutional lists in the two surveys . the gp sample was all gps registered in norway who filled in a questionnaire for evaluation of the community mental health centre in their area in a postal survey in january 2006 . , 106 gps were excluded because a filter question showed that they did not evaluate the outpatient clinic at the community mental health centre . the national sample has been shown to be representative .13 there were small differences between respondents and non - respondents in relation to demographic and practice variables , and the background variables that were significantly different were not at all or were only weakly related to the main outcome variables . the procedure regarding informed consent , study design and data collection was approved by the norwegian social science data services . the postal patient survey included adults with one or more registered contacts with a mental health outpatient clinic in norway between august 20 and november 11 , 2007 . we drew a probability sample of 400 patients for each institution or included all eligible patients in the period if the number of patients were 400 . clinics for elderly or substance abuse clinics were excluded . in our study , patients attending the outpatient clinics at the community mental health centres from the gp survey were included ( n = 69 centres ) . the questionnaire was answered by 9001 ( 40 % ) patients . the respondents differed from non - respondents in relation to age , gender , diagnosis and the number of consultations in the inclusion period . to assess non - response bias , we randomly selected 293 postal non - respondents from 10 randomly selected clinics to be included in a telephone follow - up . a total of 110 patients answered a shorter version of the postal questionnaire , including the 11 core items of the psychiatric out - patient experiences questionnaire .14 the difference between telephone respondents and postal respondents on the psychiatric out - patient experiences questionnaire ( popeq ) - 11 scale was small and insignificant ( 2 on a scale from 0 to 100 ) , indicating little non - response bias . the norwegian regional committee for medical research ethics , the data inspectorate and the norwegian directorate of health and social affairs approved the survey . the general practitioner experiences questionnaire is described in detail elsewhere1 and comprises the following scales with good evidence for data quality , reliability and validity : workforce situation ( four items ) , discharge letter ( three items ) , competence ( four items ) , guidance ( three items ) and emergency situations ( two items ) . guidance includes items relating to cooperation meetings , organized training and receiving necessary professional support . emergency situations includes items relating to contact with and help from the centre in emergency situations . all scales met the criterion of 0.7 for cronbach 's alpha and test retest correlations were 0.720.87 . the results of construct validity testing were as hypothesized . to secure the comparability between gps and patients , we included items with similar content from the two questionnaires . for gps single items related to general satisfaction , perceived waiting time for the patients , and contact with the centre in situations where the gp need advice . the reliability of the five scales is unaffected by the inclusion of the single items . the reliability of single items is poorer than for scales , but following the objective of this study comparability was prioritized . the popeq is described in detail elsewhere14 and comprises one unidimensional scale with the three following subscales : clinician interaction ( 6 items ) , information ( 2 items ) and outcome ( 3 items ) . all scales met the criterion of 0.7 for cronbach 's alpha and test retest correlations were 0.750.90 . as a result of better face validity and psychometric results in 2007 , two of three items within the outcome scale were replaced with two new items . the revised subscale includes three questions about outcome related to improvement in health problem , functioning in the family and functioning outside the family , all compared to pretreatment at the clinic . we also included items of similar content as in the gp questionnaire : general satisfaction , assessment of waiting time and ease of getting in touch with the clinic by telephone . all items have a five - point response scale , except waiting time , which has a four - point response scale . all scales and items were transformed to scores ranging from 0 to 100 where 100 is the best possible rating . for computation of scale score , we set the lowest item response to 0 , the highest to 4 . we summed these values for individual questions within a scale and transformed them into percentage scores . patients with missing values on more than half of the items in a scale were excluded . the single items were directly transformed from a five - point scale to a 0100 scale ; 1 = 0 , 2 = 25 , 3 = 50 , 4 = 75 and 5 = 100 . the size of the catchment area and the number of consultations in 2005 for each centre were extracted from the samdata reports with the 2005 national statistics for the mental health services .15 the norwegian patient register provided data about waiting time . we present descriptive statistics for the outpatient clinics ; mean , sd and range for clinic size , number of inhabitants in the catchment area , size of gp and patient sample and for the scales and items from the evaluations by gps and patients . correlations between gp variables and patient variables at the clinic level were assessed by pearson 's r. pearson 's r can be viewed as an indicator that describes a linear interdependence between two variables , ranging from 1 to 1 . it has been argued that pearson 's r is robust also at the ordinal level , at least when there are more than two response alternatives .16 moreover , several of the variables comprise summated rating scales based on more than one item . all correlation estimates were tested for statistical significance ( two tailed ) . because of the exploratory nature of our study , we chose not to adjust for multiple testing .17 all analyses were conducted within spss15 .0 . an earlier multilevel study has shown that there is significant variation at the centre level for all scales measuring gp experiences with the centres .18 multilevel analysis of the patient experiences data shows less variation between clinics , but most variables in this study also have a significant intraclass correlation coefficient at the clinic level . we performed two multiple regression analyses to identify health care predictors of gp and patient satisfaction with the clinics . we included 14 health care factors in the analysis of patient satisfaction with the clinics and 12 health care factors in the analysis of gp satisfaction . the highest score for gp assessment of the clinics was on the competence scale with 54.9 on a scale from 0 to 100 where 100 represents the best experience ( table 1 ) . the lowest score for gp assessment of the clinics was the guidance scale , with a mean score of 32.0 , followed by perceived waiting time for patients with 34.2 . the largest variation in mean clinic scores was found for perceived waiting time for patients ; the best clinic score was 58.3 compared to 6.1 for the clinic with the lowest score . all correlations between gp variables at the clinic level were significant and of a moderate - to - high level ( table 2 ) . descriptive statistics for the 69 community mental health centres scores 0100 where 100 represent best possible experiences . clinic level correlation of gp and patient evaluations ( n = 69 clinics ) * p 0.05 ( two tailed ) , * * p 0.01 ( two tailed ) . the highest score for patient assessment of the clinics was for the item related to telephone contact ( 72.1 ) . the lowest score for patient assessment of the clinics was the information scale , with a mean score of 60.2 , followed by assessment of waiting time with 63.7 . the largest variation in mean clinic scores was found for the item related to waiting time ; the best clinic score was 77.5 compared to 36.2 for the clinic with the lowest score . the least variation in clinic scores was found for patients assessment of outcome , followed by clinician interaction . except for assessment of waiting time , all correlations between patient variables at the clinic level were significant and of a moderate - to - high level ( table 2 ) . the content of two of the items in the gp and patient questionnaire were identical : waiting time and general satisfaction . the strongest correlation between clinic scores for gp and patient evaluation in our study was found for perceived waiting time ( table 2 ) , r : 0.65 . the patient scores are consistently higher than the gp scores , but the two lines show the good agreement between the two ratings at clinic level . the two clinics with the lowest patient score for waiting time were also the clinics with poorest gp assessment of waiting time . the two poorest rated clinics had the longest mean waiting time in the period may to august 2007 , 197 and 110 days , respectively , compared to a national average of 56 days . correlations between the two other related items in the questionnaires were lower than between clinic score for gp and patient evaluation of perceived waiting time ( table 2 ) . clinic scores for general patient satisfaction and general gp satisfaction were significantly but only moderately correlated ( 0.37 ) . gp and patient evaluation of waiting time at the 69 centres ( pearson 's r : 0.65 ) . centres sorted ascending by gp scores ( blue markers ) significant correlations between clinic scores for gp and patient assessments were found for 38 of the 48 associations tested ( table 2 ) . multiple regression analysis identified nine significant health care predictors for gp satisfaction with the clinics ( table 3 ) . the most important predictors were perceived competence at the clinic ( beta : 0.25 ) , rejection of referrals ( beta : 0.17 ) and waiting time for patients ( beta : 0.16 ) . multiple regression analysis identified 11 significant health care predictors for patient satisfaction with the clinics ( table 3 ) . the most important health care predictors for patient satisfaction with the clinics were interaction with the clinician ( beta : 0.23 ) and being met with politeness and respect at the clinic ( beta : 0.19 ) . regression analysis of gp and patient satisfaction on aspects of health care variables adjusted r2 = 59 % . excluded variables : contact when needing advice , feedback from centre during treatment of patients and received information about services at the centre . excluded variables : telephone availability to the clinic , improvement potential regarding influence on medication issues and improvement potential regarding information about medication side effects . the study found that clinic scores for gp and patient assessment of waiting time for patients had a positive high - level association . clinic scores for gp and patient satisfaction had a lower but significant positive association , while correlations including several aspects of health care identified a consistent positive association between gp and patient clinic scores . the study also found that the most important predictors of patient satisfaction with the clinics were interaction with the clinician and being met with politeness and respect at the clinic , while the most important predictors for gp satisfaction with the clinics were perceived competence , rejection of referrals and waiting time for patients . the literature on patient and referral satisfaction is large ,112,14 but studies about the association between patient and referral evaluation are few and inconclusive .5,711 our study is to our knowledge the only study based on two national surveys examining the association between patient and gp assessment scores at the unit level . it supports the view that a clinics performance in the eyes of gps is related to a clinics performance in the eyes of patients . this strengthens the validity of using each perspective as an indicator of quality at the clinic level and might be especially useful in cultures where patient views are less highly regarded or are a new source of evaluation and quality indicator information . several barriers have been identified that limit the active use of results from patient surveys in quality improvement processes including clinical skepticism .19 this evidence for an association between clinician and patient ratings of quality might increase the clinical credibility of results and hence may contribute to the use of results in quality improvement processes within units . a high correlation between patient and gp evaluationmight have justified a less resource intensive data collection , in the sense that assessment from one group could be used as a proxy for the other . this could be especially relevant for patient groups that are hard to reach in surveys20 and might be most relevant in large and resource intensive national indicator systems as in norway . however , the results of our study do not justify using assessments from one group as a proxy for the other . in spite of a low response rate in the patient sample and the costs of conducting the patient survey , the proxy approach replacing patient satisfaction with gp evaluation would conceal the fact that patients are generally more satisfied with the outpatient clinics than gps . there are several possible explanations for the difference in satisfaction level , and all have relevance in this context : patients and gps have different standards and ways of viewing the services ; 20 patients answers are influenced by a social desirability bias2 and more than gps as a result of the personal relationship between patients and clinicians and gps evaluation is more critical because they experience the service provided to many patients , increasing the probability of experiencing errors and negative episodes . therefore , a balanced evaluation and indicator system should incorporate both patient and gp evaluation , in addition to other validated quality indicators . this would also secure a broader evaluation in a thematic sense since the validated instruments for measuring patient experiences and gp experiences include several supplementary scales for the measurement of clinic quality . first , we are unable to validate the present findings against clinical quality measures . strictly speaking , we can only conclude that clinic scores for gp and patient evaluation are related , but whether these scores are associated with clinical quality measures is unknown . jaipaul and rosenthal6 reported that hospitals with higher patient satisfaction also tended to have lower mortality . shipley et al. 5 found that patient satisfaction was a more accurate quality indicator than standard indicators , validated against an independent review of quality at five mental health units . a problem with the study , however , was that the number of respondents in each group was small , resulting in a questionable generalizability . therefore , further research relating to the association between patient / referral satisfaction at the clinic level and clinical quality measures is needed . second , the causes of the association between patient and gp evaluation at the clinic level are unknown . we have identified a consistent association but lack variables about possible explanations for the association including for example organizational processes such as leadership , collaboration and communication .21 these organizational aspects should be explored in future studies . third , our study was exploratory without any formal hypothesis derived from theory and earlier research . therefore , the results can only be interpreted as preliminary information that future confirmatory studies could be based on . first , gps evaluated the centres the spring of 2006 while patients evaluated the clinics in the autumn 2007 . this would be a methodological problem if many units had substantially improved or worsen their quality in the period . however , national results from 2004 and 2007 indicate small changes in patient evaluations in the period , implying that this is not an important limitation . second , gps were instructed to evaluate all services at the community mental health centres , while patients only assessed the outpatient clinic at the centre . however , the outpatient clinics were evaluated by almost all gps ( 94 % ) , and the rest of the gps were excluded in this study . therefore , gps mainly evaluated the outpatient clinics , and we believe that this limitation also has small consequences for our study . in summary , our study found a consistent positive association between gp and patient ratings at the clinic level . to further test our major findings and gain a better understanding of the factors connecting patient and gp evaluations , future research should be conducted at the individual level with patients nested within gps . mental health services aiming at improving gp and patient satisfaction should be aware of the importance gps put on competence , rejection of referrals and waiting time for patients and the importance patients put on interaction with the clinician and being met with politeness and respect at the clinic . the open access publication charges for this article was provided by norwegian knowledge centre for the health services . ethical approval : the norwegian regional committee for medical research ethics , the data inspectorate and the norwegian directorate of health and social affairs approved the patient experiences survey . the procedure regarding informed consent , study design and data collection in the gp survey was approved by the norwegian social science data services .\noutput:\n" }, { "from": "agent", "value": "background . gps and patients are frequently asked to evaluate mental health care , but studies including evaluations from both groups are rare.objective . to assess the association between gps ' and patients ' assessment of mental health outpatient clinic in norway and identify important health care predictors for patient and gp satisfaction with the clinics.methods . two cross - sectional national surveys were carried out : survey of gps in 2006 and patients in 2007 evaluating outpatient clinics at 69 community mental health centres in norway . a total of 2009 gps and 9001 outpatients assessed the clinics by means of a postal questionnaire . main outcome measures were correlations between gp and patient ratings of the outpatient clinics at the clinic level and health care predictors for patient satisfaction and gp satisfaction with the clinics.results . clinic scores for gps ' and patients ' assessment of waiting time were moderate to highly correlated ( 0.65 ) , while clinic scores for gp and patient satisfaction had a lower but significant positive association ( 0.37 ) . significant positive correlations between clinic scores for gp and patients ratings were found for 38 of the 48 associations tested . the most important predictors for patient satisfaction with the clinics were interaction with the clinician ( beta : 0.23 ) and being met with politeness and respect at the clinic ( beta : 0.19 ) , while the most important predictors for gp satisfaction with the clinics were perceived competence ( beta : 0.25 ) , rejection of referrals ( beta : 0.17 ) and waiting time for patients ( beta : 0.16 ) . conclusions . a consistent positive association between gp and patient ratings at the clinic level was identified . mental health services aiming at improving gp and patient satisfaction should be sensitive to the fact that the two groups prioritize different health care factors ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: spinocerebellar degeneration or olivopontocerebellar degeneration denotes a group of disorders of varied etiologies manifesting as degenerative changes of various part of the central nervous system . the cerebellum , cerebral cortex , inferior olives , basal ganglia , substantia nigra and the spinal cord are involved . the predominant areas to be affected are the cerebellum and its afferent and efferent pathways including spinocerebellar pathways and fronto - ponto - cerebellar pathways . in severe cases , the degeneration is also seen in the cerebral cortex , basal ganglia and substantia nigra . we describe the anesthetic management of a patient with severe olivopontocerebellar degeneration posted for vaginal hysterectomy . a 45 - year - old woman with history of progressive ataxia , dysarthria and intentional tremors presented with complete uterine prolapse . she had difficulty getting up from squatting position , difficulty in swallowing and had episodes of coughing on rapid oral fluid intake . she complained of progressive increase in difficulty in walking and speaking in the last three years . she exhibited signs of recent memory loss but her long - term memory was intact . other signs of autonomic imbalance like postural hypotension , absence of heart rate variability were absent . magnetic resonance imaging ( mri ) of the brain showed atrophy of cerebellar hemispheres , vermis , pons and cerebellar peduncles . prominence and widening of sulci and basilar cisterns were noted with partial atrophy of the frontal , temporal and cerebral lobes . prominence of transverse and sylvian fissures was also noted . no focal mass lesion or hyperintensitythe patient was not on any medications , and the treating physician opined that her clinical condition was stable and did not require any intervention till the surgery . electrocardiogram ( ecg ) and routine blood investigations were normal . considering the possibility of erratic response to neuromuscular blockade and risk of aspiration and delayed recovery of airway reflexes , a combined epidural - spinal technique was planned . routine monitoring with 5 - lead ecg , nibp and pulse oximetry was started and patient preloaded with 500 ml of lactated ringer 's solution . combined spinal - epidural anesthesia was administered via l2 - l3 interspace , 2.5 ml of 0.5 % bupivacaine heavy was administered intrathecally and 18 g epidural catheter was passed and fixed at 9 cm ( space located at 5 cm ) . her blood pressure fell to 90/60 mmhg from 130/80 mmhg after 15 min of the procedure . she responded to 6 mg of intravenous ephedrine , and did not require any other vasopressors . epidural top - up of 5 ml of 0.5 % bupivacaine was given after two - segment regression after a negative test dose . the surgical procedure lasted for 3 h and was uneventful . at the end of the procedure , her motor recovery was complete within approximately one hour of the surgery with return of her original spasticity and power . there was no progression of her neurological symptoms in one month of follow - up . spinocerebellar atrophy or olivopontocerebellar degeneration belongs to a group of ataxic disorders characterized by diverse neurological symptoms depending on the anatomical site of lesions . the common signs include ataxia , progressing to static and kinetic motion disorders and dysarthria gradually rendering the speech unintelligible . later in the course of the disease the patient can develop other motion abnormalities , signs of parkinsonism , ocular disturbances , autonomic neuropathy and mental deterioration . the etiology of the ataxic disorders can be classified according to the onset and progress of the disease . symmetric ataxias can be classified as acute ( hours or days ) , subacute ( weeks or months ) or chronic ( months to years ) [ table 1 ] . classification of ataxic disorders more than 30 types of ataxias are identified with various mutations . the predominant being spinocerebellar ataxias type 1 through type 22 , friedreich 's ataxia , kearns - sayre syndrome , melas ( mitochondrial encephalopathy , lactic acidosis and stroke syndrome ) , leigh 's disease and ataxia telangiectasia . the clinical features of most of the ataxias overlap , and genotypic evaluation is the basis of classification and predicting the course of the disease . it is important to note that certain ataxias are associated with other disorders relevant to the anesthesiologist like seizures , cardiomyopathy , various heart blocks , diabetes mellitus , scoliosis , and immune disorders like iga and igg deficiency . although difficult to perform , central neuraxial blockade helps in proper positioning of patients with spasticity . the patient had intentional tremors but was comfortable at rest and able to lie down in supine position without discomfort . a comparison of regional and general anesthesia for spinocerebellar disorders autonomic neuropathy and involvement of spinocerebellar tracts pose a threat of unpredictable responses to central neuraxial blockade . autonomic neuropathy has been shown to cause hypotension during positive pressure ventilation . our patient had history of difficulty in deglutition , choking and regurgitation on fluid intake which indicated bulbar muscle dysfunction . scoliosis and muscular dystrophies , though not present in this case , should be ruled out . exaggerated response to barbiturates , and both depolarizing and nondepolarizing muscle relaxants may exist in patients with spinocerebellar atrophy , increasing the potential for prolonged neuromuscular paralysis and mechanical ventilation . circulatory collapse after administering succinylcholine in a patient with diffuse motor neuron disorder has been reported . conversely , resistance to atracurium and increased number of acetylcholine receptors has been demonstrated in patients with multiple sclerosis , who also have spastic paraparesis . peripheral nerves may also be involved in the form of axonopathy , neuronopathy , reduction of number of neurons in anterior horns and dorsal root ganglions . this might cause postoperative neuropathies which may be attributed to the regional technique . unlike diseases like multiple sclerosis which exhibit a relapse pattern , spinocerebellar degenerationthere is no evidence of exacerbation of the pathological process in spinocerebellar degeneration after neuraxial anesthesia as judged from the recent case reports . case reports of successful anesthetic management of patients with olivopontocerebellar degeneration in both general and regional anesthesia exists . schmitt et al . , reported use of rocuronium in two children with friedreich 's ataxia posted for scoliosis correction with no appreciable increase in onset and recovery timings . various atrioventricular blocks , attributed to myocardial degeneration and hypertonicity of the vagus nerve , have been reported after general anesthesia . kazunori and zuigan reported two cases of spinocerebellar degeneration managed under regional anesthesia and propofol infusion uneventfully . epidural anaethesia combined with general anesthesia has been administered for abdominal aortic aneurysm repair in a patient with spinocerebellar degeneration . inspite of the concerns for aspiration , laryngeal mask airway has been used uneventfully with propofol and nitrous oxide combination . if intravascular volume is maintained exaggerated hypotension after spinal or epidural - induced further autonomic blockade is unlikely in patients with preexisting autonomic neuropathy . our patient did not exhibit refractory hypotension after regional blockade ( sensory level t8 ) as she did not exhibit other signs of autonomic instability . a combined spinal - epidural technique was preferred to provide adequate muscle relaxation and effective postoperative analgesia .\noutput:\n" }, { "from": "agent", "value": "spinocerebellar degeneration or olivopontocerebellar degeneration denotes a group of disorders of various etiologies manifesting as degenerative changes of various part of the central nervous system . we describe the anesthetic management of a patient with severe olivopontocerebellar degeneration posted for vaginal hysterectomy . a combined spinal epidural technique was performed at the level of l2 - l3 . the anesthetic implications of the various aspects of spinocerebellar degeneration are discussed ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: pleural tuberculosis ( tb ) is one of the most important and common causes of pleural effusion , especially in the regions with high prevalence . nevertheless , the establishment of tuberculous pleural effusion ( tpe ) diagnosis is difficult and challenging . traditionally , it is based on the isolation of mycobacterium tuberculosis from the pleural fluid or pleural biopsy specimens or the demonstration of caseating granulomas on histological examination by obtaining biopsy . only 10 % to 35 % of cultures and 20 % to 81 % of molecular tests reveal mycobacteria in pleural fluid . pleural biopsy and culture of biopsy material provide a relative high sensitivity , but these procedures are invasive and may not be well accepted by all the patients . therefore , some new effective and efficient methods should be identified to aid the diagnosis of tuberculous pleurisy . tnf - is an important pro - inflammatory cytokine which is synthesized by lymphocytes and macrophages . kleine et al evaluated the diagnostic value of tnf - assay in cerebrospinal fluid for bacterial meningitis , which reached a sensitivity of 85 % and a specificity of 91.3 % . surbatovic and padkovic study showed the correlation between tnf - and severe acute pancreatitis ( sap ) . in patients with sap , the lower level of tnf - indicated higher probability to develop multiple organ dysfunction syndrome ( mods ) , with a sensitivity and specificity of 83 % and 77.4 % respectively . tebruegge et al investigated the diagnostic value of peripheral blood tnf - assay to differentiate between tb - uninfected and tb - infected children ( up to 18 year ) , the results showed that the assay achieved an excellent diagnostic value , with a sensitivity of 95.5 % and a specificity of 88.0 % . related studies proved that mycobacterial proteins can cause the secretion of tnf - and it can reach high localized concentrations in pleural effusion to eliminate the bacilli and granuloma formation . therefore , various studies focused on whether tnf - can be used as a diagnostic tool for tuberculous pleurisy . some studies detected a high level of tnf - in the tuberculous pleural effusion and many of them consider tnf - assay can be used for the differential diagnosis of tuberculous pleural effusion . several other studies , however , showed that there is no difference of tnf - level between tb pleural effusion and non - tb pleural effusion . due to the controversial results of the previous studies , this meta - analysis established the overall accuracy of pleural tnf - test in the diagnosis of tuberculous pleurisy . multiple data base including medline ( using pubmed as the search engine ) , embase , web of science , cnki , wangfang and weipu ( up to december 30 , 2015 ) were searched using the following search strings : tumor necrosis factor , tuberculosis , pleurisy / pleuritis , pleural effusion / pleural fluid , tuberculosis , sensitivity and specificity , and accuracy to identify relevant literatures . references listed in the selected articles were also examined . conference abstracts and letters to the journal editors were excluded because of limited information and data . a study providing both sensitivity and specificity of tnf - was incorporated into the meta - analysis . ethical approval is not required because meta - analysis is based on the published articles . the reviewers were blinded to publication to retrieve the data , including : the author , publication year , the country , patient number , test method , cut - off value , sensitivity , specificity , and methodological quality . to assess the trial methodology , we used the quadas - 2 ( quality assessment for studies of diagnostic accuracy ) tool to evaluate the quality of diagnostic accuracy of the primary studies we used . we used standard methods recommended for the diagnostic accuracy of meta - analyses and followed the preferred reporting items for systemic reviews and meta - analysis ( prisma ) criteria . we computed the following indices of test accuracy : sensitivity , specificity , positive likelihood ratio ( plr ) , negative likelihood ratio ( nlr ) , and diagnostic odds ratio ( dor ) . the sensitivity and specificity of each single test were used to plot a summary roc ( sroc ) . heterogeneity among the primary studies was detected with chi - squared and fisher 's exact tests . the average sensitivity , specificity , and other related measurements of the studies were calculated by random - effects model or fixed - effects model . if there were enough studies , subgroup analyses were performed to explore potential between - study heterogeneity . the analysis was performed by 2 kinds of statistical software : stata , version 11 ( stata corporation ; college station , tx ) and meta - disc for windows ( xi cochrane colloquium ; barcelona , spain ) . multiple data base including medline ( using pubmed as the search engine ) , embase , web of science , cnki , wangfang and weipu ( up to december 30 , 2015 ) were searched using the following search strings : tumor necrosis factor , tuberculosis , pleurisy / pleuritis , pleural effusion / pleural fluid , tuberculosis , sensitivity and specificity , and accuracy to identify relevant literatures . references listed in the selected articles were also examined . conference abstracts and letters to the journal editors were excluded because of limited information and data . a study providing both sensitivity and specificity of tnf - was incorporated into the meta - analysis . ethical approval is not required because meta - analysis is based on the published articles . the reviewers were blinded to publication to retrieve the data , including : the author , publication year , the country , patient number , test method , cut - off value , sensitivity , specificity , and methodological quality . to assess the trial methodology , we used the quadas - 2 ( quality assessment for studies of diagnostic accuracy ) tool to evaluate the quality of diagnostic accuracy of the primary studies we used . we used standard methods recommended for the diagnostic accuracy of meta - analyses and followed the preferred reporting items for systemic reviews and meta - analysis ( prisma ) criteria . we computed the following indices of test accuracy : sensitivity , specificity , positive likelihood ratio ( plr ) , negative likelihood ratio ( nlr ) , and diagnostic odds ratio ( dor ) . the sensitivity and specificity of each single test were used to plot a summary roc ( sroc ) . heterogeneity among the primary studies was detected with chi - squared and fisher 's exact tests . the average sensitivity , specificity , and other related measurements of the studies were calculated by random - effects model or fixed - effects model . if there were enough studies , subgroup analyses were performed to explore potential between - study heterogeneity . the analysis was performed by 2 kinds of statistical software : stata , version 11 ( stata corporation ; college station , tx ) and meta - disc for windows ( xi cochrane colloquium ; barcelona , spain ) . after literature review , 20 studies were selected . among them , 7 were excluded because sensitivity and specificity of tnf - test could not be estimated with the data provided by the articles . one study was excluded because the same authors published the research on the same patient ; thus , only the best quality study was chosen . consequently , the remaining 12 studies were eligible for the meta - analysis , with a total number of 1022 patients . diagnosis of tpe in 7 studies was made based upon histological or bacteriological confirmation , which are consideredwhereas in the other remaining 5 studies , tpe patients were diagnosed based upon gold standard or on their clinical course which included clinical presentation , pleural fluid analysis , radiology , and the responsiveness to anti - tuberculous therapy . one study used the ria assay as the test method , whereas the remaining 11 studies used elisa assay . among the 12 included studies , 2 studies reported blinded interpretation of tnf - assay independent of the reference standard . the clinical characteristics and other information are outlined in table 1 . by the quadas - 2 tool , it was found that the quality of studies for our research was generally good .2 a and b. summary of included studies . methodological quality assessment of studies of the tnf - assay . the forest plots of sensitivity and specificity of tnf - test for the diagnosis of tp are shown in fig .3 . the sensitivity varied between 0.71 and 0.96 ( pooled 0.85 , 95 % ci , 0.810.89 ) , whereas specificity ranged from 0.63 to 0.93 ( pooled 0.80 , 95 % ci , 0.770.83 ) . the plr was 4.12 ( 95 % ci , 3.075.53 ) , the nlr was 0.20 ( 95 % ci , 0.150.27 ) , and the dor was 21.93 ( 95 % ci , 12.8537.43 ) . the i values of sensitivity , specificity , plr , nlr , and dor were 13.4 % , 66.5 % , 67.1 % , 33.4 % , and 52.7 % respectively . so the overall sensitivity and nlr were pooled by the mixed - effects model ( i 50 % ) , and the others were pooled by the random - effects model to perform the analysis because the heterogeneity across studies showed significant difference ( p the point estimates of sensitivity and specificity from each study are shown as solid circles . ci = confidence interval , tnf - = tumor necrosis factor - alpha , tpe = tuberculous pleural effusion . we also performed subgroup analysis . in the 5 studies performed in area with high tb incidence , the pooled sensitivity was 0.86 ( 95 % 0.800.90 ) and specificity was 0.78 ( 95 % 0.720.84 ) . the remaining 7 studies conducted in area with low tb incidence , the pooled sensitivity and specificity was 0.84 ( 95 % 0.780.89 ) and 0.81 ( 95 % 0.770.85 ) respectively . subgroup analysis difference was not statistically significant compared with pooled results from all included studies ( p = 0.978 ) . to summarize the global diagnostic performance of the test , the summary receiver operating characteristic ( sroc ) curve was generated and the q - value , the point represents the maximum polymerization spot of sensitivity and specificity in the sroc curve , was also calculated . as is shown in fig .4 , in our study , the area under the curve ( auc ) was 0.89 and the q - value was 0.82 , suggesting a relatively high diagnostic accuracy . summary receiver operating characteristic curve ( sroc ) of tnf - assay for the diagnosis of tpe . the size of each solid circle represents the sample size of each study . the regression sroc curve indicates the overall diagnostic accuracy . sroc = summary receiver operating characteristic curve , tpe = tuberculous pleural effusion . to explore the possible reasons for the heterogeneity , a meta - regression analysis based on sample size ( 100 or 100 ) , setting ( area with high tb incidence or area with low tb incidence ) and diagnosis standard ( by gold standard or clinical course ) was performed . in our study , none of the above covariates included in the meta - regression was found to be the significant source of heterogeneity ( p 0.05 ) ( table 2 ) . the deeks test was performed to test the publication bias and it was insignificant ( p = 0.71 ) . the funnel plot for publication bias ( fig . the statistically insignificant value ( p = 0.70 ) for the slope coefficient suggested symmetry in the data and a low likelihood of publication bias . after literature review , 20 studies were selected . among them , 7 were excluded because sensitivity and specificity of tnf - test could not be estimated with the data provided by the articles . one study was excluded because the same authors published the research on the same patient ; thus , only the best quality study was chosen . consequently , the remaining 12 studies were eligible for the meta - analysis , with a total number of 1022 patients . in our meta - analysis , the average sample size of the included studies was 85 ( range 50127 ) . diagnosis of tpe in 7 studies was made based upon histological or bacteriological confirmation , which are consideredwhereas in the other remaining 5 studies , tpe patients were diagnosed based upon gold standard or on their clinical course which included clinical presentation , pleural fluid analysis , radiology , and the responsiveness to anti - tuberculous therapy . one study used the ria assay as the test method , whereas the remaining 11 studies used elisa assay . among the 12 included studies , 2 studies reported blinded interpretation of tnf - assay independent of the reference standard . the clinical characteristics and other information are outlined in table 1 . by the quadas - 2 tool , it was found that the quality of studies for our research was generally good . the forest plots of sensitivity and specificity of tnf - test for the diagnosis of tp are shown in fig .3 . the sensitivity varied between 0.71 and 0.96 ( pooled 0.85 , 95 % ci , 0.810.89 ) , whereas specificity ranged from 0.63 to 0.93 ( pooled 0.80 , 95 % ci , 0.770.83 ) . the plr was 4.12 ( 95 % ci , 3.075.53 ) , the nlr was 0.20 ( 95 % ci , 0.150.27 ) , and the dor was 21.93 ( 95 % ci , 12.8537.43 ) . the i values of sensitivity , specificity , plr , nlr , and dor were 13.4 % , 66.5 % , 67.1 % , 33.4 % , and 52.7 % respectively . so the overall sensitivity and nlr were pooled by the mixed - effects model ( i 50 % ) , and the others were pooled by the random - effects model to perform the analysis because the heterogeneity across studies showed significant difference ( p 0.05 , i 50 % ) . the point estimates of sensitivity and specificity from each study are shown as solid circles . ci = confidence interval , tnf - = tumor necrosis factor - alpha , tpe = tuberculous pleural effusion . we also performed subgroup analysis . in the 5 studies performed in area with high tb incidence , the pooled sensitivity was 0.86 ( 95 % 0.800.90 ) and specificity was 0.78 ( 95 % 0.720.84 ) . the remaining 7 studies conducted in area with low tb incidence , the pooled sensitivity and specificity was 0.84 ( 95 % 0.780.89 ) and 0.81 ( 95 % 0.770.85 ) respectively . subgroup analysis difference was not statistically significant compared with pooled results from all included studies ( p = 0.978 ) . to summarize the global diagnostic performance of the test , the summary receiver operating characteristic ( sroc ) curve was generated and the q - value , the point represents the maximum polymerization spot of sensitivity and specificity in the sroc curve , was also calculated . as is shown in fig .4 , in our study , the area under the curve ( auc ) was 0.89 and the q - value was 0.82 , suggesting a relatively high diagnostic accuracy . summary receiver operating characteristic curve ( sroc ) of tnf - assay for the diagnosis of tpe . to explore the possible reasons for the heterogeneity , a meta - regression analysis based on sample size ( 100 or 100 ) , setting ( area with high tb incidence or area with low tb incidence ) and diagnosis standard ( by gold standard or clinical course ) was performed . in our study , none of the above covariates included in the meta - regression was found to be the significant source of heterogeneity ( p 0.05 ) ( table 2 ) . the deeks test was performed to test the publication bias and it was insignificant ( p = 0.71 ) . the funnel plot for publication bias ( fig . the statistically insignificant value ( p = 0.70 ) for the slope coefficient suggested symmetry in the data and a low likelihood of publication bias . with the high prevalence of tuberculosis and the complexities in diagnosing pleural tuberculosis , it is crucial to develop new methods that are rapid , efficient , and noninvasive . some researchers proposed that the tnf - assay was a useful noninvasive tool to aid the diagnosis of pleural tuberculosis , whereas others hold the opposite opinion . the present meta - analysis investigated the overall accuracy of pleural tnf - test in the tpe with a sensitivity of 0.85 ( 95 % ci , 0.810.89 ) and a specificity of 0.80 ( 95 % ci , 0.770.83 ) and , which means nearly 15 % of non - tpe patients would be missed and almost 20 % of patients without tuberculosis would be inaccurately treated . so the positive results may not confirm tpe entirely and negative tests do not indicate the absence of tpe . to present a global summary of the test performance , the sroc curve was applied . the present meta - analysis based on the sroc curvehas shown the maximum joint sensitivity and specificity ( q value ) was 0.82 , and the auc was 0.89 , indicating that the level of the overall accuracy was relatively high . dor , the ratio of the odds of positive test results in the diseased relative to the odds of positive test results in the nondiseased , is another indicator of test accuracy . dor combines the data from sensitivity and specificity into a single number , reflecting the correlation between the diagnostic method results and the likelihood of the disease . the mean dor value was 21.93 ( 95 % ci , 12.9337.43 ) in the present study , indicating that the tnf - test plays a role for the diagnosis of tpe . meanwhile , both plr and nlr are also presented as measures of diagnostic accuracy in our study because likelihood ratios are considered to be more clinically expressive . a greater plr or a lower nlr means a better diagnostic value of the diagnostic test . the pooled plr was 4.12 and nlr was 0.20 in our study , indicating that compared to patients without tpe , tpe patients have an 4-fold higher chance of being tnf - assay positive . however , a patient could have a 20 % chance of having tpe if he gets a negative tnf - assay result . exploration of heterogeneity is an important part of the meta - analysis . in our study , the i test for the pooled specificity , plr , and dor suggested that the heterogeneity among the studies was significant . because of the different cut - offs between the included studies , the threshold effect is one of the most important causes of heterogeneity ; therefore , we used the spearman correlation coefficient to analyze the threshold effect . the results found that there is no correlation between the sensitivity and specificity ( p 0.05 ) , suggesting that the threshold effect is not the source of heterogeneity . variables like sample size ( 100 or 100 ) , setting ( area with high tb incidence or area with low tb incidence ) , and diagnosis standard ( by gold standard or clinical course ) were included in the meta - regression analysis but none of them were observed to substantially affect the diagnostic accuracy of tnf - for tpe . the present meta - analysis suggests that the tnf - assay play a vital role for tpe but it is far from perfection . combination with other markers may be a reliable way to improve the diagnostic accuracy . momi et al found that combined sensitivity and specificity of tnf - plus vegf is better than testing tnf - alone , with a higher sensitivity of 88.9 % . wong et al reported that the combination of tnf - with ifn - gained a high - diagnostic performance . the combination of tnf - and ada has been found to improve the diagnostic value of tpe with a high specificity of 96.3 % . our results suggest that the accuracy of tnf - test was relatively high , which was in accordance with numerous previous studies . however , it is in disagreement with those of soderblom et al and chomej et al who found that tnf - is not a good marker to separate tuberculous from malignant or parapneumonic pleural fluid . this discrepancy may be due to the inhomogeneity of the patients included in their nontuberculous group . it should be emphasized that this meta - analysis still has some limitations although comprehensive search strategy and data extraction were carried out . first , studies published in languages other than english or chinese were excluded , and unpublished studies or abstracts from conferences were also filtered due to insufficient data , which may lead to publication bias , although the present meta - analysis shows no publication bias . second , only 12 studies with 1022 cases were included . the pooled results generated from the limited samples may limit the interpretation of the meta - analysis . third , the misclassification bias may occur since not all the tuberculous pleurisy patients in the studies were diagnosed by bacteriological or histological assessments or on the gold standard combination of both . in fact , 5 studies included in the meta - analysis used a mixture of bacteriological , histological , or clinical assessments . the issue regarding accuracy of diagnosis can cause nonrandom misclassification , contributing to biased results . in conclusion , our study demonstrated that the tnf - assay play a vital role in the diagnosis of tpe , whereas other test results or clinical findings should be interpreted together with the test to improve the diagnostic accuracy .\noutput:\n" }, { "from": "agent", "value": "abstractbackground : the diagnosis of tuberculous pleurisy is difficult and traditional methods are not always helpful . many studies have focused on the tumor necrosis factor - alpha ( tnf - ) assay in pleural effusion for the diagnosis of tuberculous pleurisy , but the results remain controversial . this meta - analysis was conducted to determine the overall diagnostic accuracy of tnf - . methods : relevant studies were searched from pubmed , embase , web of science , chinese national knowledge infrastructure ( cnki ) , wangfang , and weipu . we pooled the published results and computed the accuracy measures , including sensitivity , specificity , positive likelihood ratio ( plr ) , negative likelihood ratio ( nlr ) , and diagnostic odds ratio ( dor ) . receiver operating characteristic curves ( sroc ) and the area under the curve ( auc ) were used to summarize the overall test performance.results : twelve studies with 1022 patients met the inclusion criteria . the pooled sensitivity and specificity were 0.85 ( 95 % ci , 0.810.89 ) and 0.80 ( 95 % ci , 0.770.83 ) respectively . the area under the sroc curve was 0.89 . conclusions : the results of meta - analysis suggested that the tnf - assay plays a vital role in the diagnosis of tuberculous pleurisy , whereas other test results or clinical findings should be interpreted together with the tnf - assay to improve the overall diagnostic accuracy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: more than 20 years ago , the first graphical web browser netscape navigator was released , and the world changed forever ( mosaic communications press release , 1994 ) . widespread access to the repository of information stored on computers across the globe has changed the way we teach , learn , and communicate . the internet opened the door to global educational tools , from wikipedia to massively open online courses ( aka moocs ) , and changed the way that students access and engage with information . we describe an innovative , ongoing project to create and disseminate university - level educational materials in plant science by way of their publication in a scholarly journal , we report the new ways these resources are being used across the globe , and we propose new opportunities for enhanced engagement . we face many challenges in the 21 century as a consequence of rising population , rising affluence , and energy requirements and global climate changes . it is widely acknowledged that food production must increase by 50 % or more by 2050 ( ray et al . , 2013 ) , andat the same time it is vital to preserve natural ecosystems and employ more sustainable food production methods . food production is a global problem that must be addressed locally , and plant scientists , horticulturalists , and agronomists with local knowledge will be at the forefront of these efforts . as a first step to addressing the need for increased recruitment and training of plant scientists , the premier plant science journal , the plant cell ( published by the american society of plant biologists ) in 2009 began publishing online educational tools for use in higher education . we have published 30 teaching tools ; each includes a set of image - rich powerpoint slides from which educators can select parts or complete teaching materials , a review - style article written for advanced undergraduates , recommended reading lists that span recent research and review articles as well as historical reports , and teaching guides with questions for discussion and assessment . each teaching tool is peer - reviewed and regularly updated with content and references , features that were impossible before online publishing . the overarching goal of this project is to support plant scientists in their teaching and learning . the targeted users of these resources are the readers of the plant cell ( access to the articles requires a personal or institutional subscription to the journal ) and their students in upper - level undergraduate or graduate courses . besides summarizing current plant science , specific objectives are to support a variety of teaching and learning styles , to highlight the relevance of plant research to global issues , and to help bridge the gap between textbook - based learning and learning from the primary literature that occurs as students transition from undergraduate to graduate education . as online resources , these are used widely across the globe and have been regularly accessed from more than 100 countries . in 2014 , the countries with the greatest number of pageviews were the united states , china , india , germany , japan , s. korea , the united kingdom , spain , canada , and france ( figure 1 ) ; each of these countries falls within the top 20 countries in terms of number of internet users ( internet world stats , 2014 ) . although we can track download numbers and sources , we lacked data about who is reading these articles and how they are being used . therefore , four years into the project , we conducted a survey to learn more about how these resources are used in different countries by instructors , students , and independent learners . a link to the survey was embedded on the download page for the teaching tools resources . to encourage survey completion , the remainder were students in a formal course or independent learners not enrolled in a formal course . more than 100 countries are represented in the more than 250,000 pageviews accrued during 2014 . since 2011 , the us , china and india have been the countries with the largest number of pageviews . when we initiated this series , we envisioned the articles being used as a supplement to a textbook , and intentionally did not tie them to the content of any of the several textbooks used to teach advanced plant biology or plant physiology . through our survey , we learned that in some cases both instructors and students have poor access to textbooks ( due to financial or language issues ) and many are using the materials from the plant cell as a substitute for a textbook ( figure 2 ) . a particularly high proportion of survey respondents from least - developed countries who access the materials through research4life / agora identify as having poor access to textbooks . now that we recognize that these articles are in some cases being used in lieu of a textbook , we are including more basic as well as advanced coverage of each topic . this was particularly a concern for respondents from least - developed countries ( shown in purple ) from which access teaching tools in plant biology is available through agora ( access to global online research in agriculture ) . although in the us there is wide support from learned societies , funding agencies , and many instructors for an emphasis on student - centered , project - based learning , this approach is not universally embraced , particularly outside the us ( aaas , 2011 ; freeman et al . , 2014 ; tanner , 2009 ) . for example , in china higher education styles tend to be more traditional for a variety of social , cultural , and political reasons ( lee , 2004 ; thompson & ku , 2005 ; zhang , 2007 ; zhang , 2010 ) . in line with this ,80 % of the survey respondents in china reported that the materials are used in courses that are primarily lecture based , whereas in asia ( without china ) and latin america , the largest category of course types was described asrespondents from the us or canada mainly identified their courses equal parts lecture and non - lecture . this question was only asked to instructors , who selected one category out of the four options indicated . our survey responses also indicated that the teaching tools are being used differently by students , independent learners , and instructors ( figure 4 ) . course instructors most highly valued the powerpoint files as sources of images for preparing lectures , students found the lecture notes important , and independent learners rated the references as the most important component ( independent learner respondents included undergraduates , graduate students , postdocs , lab heads , staff scientists , teaching staff , and other , a category that included librarian , communicator , and entrepreneur ) . instructors particularly value the powerpoint files as sources of images for teaching , the students rank the lecture notes as most important , and the independent learners rank the references as most important . although english is the lingua franca of science , about half of the people we surveyed teach or learn in a different language , raising the question of whether we should present these materials in multiple languages . as a first step , we have coordinated the production of translations of one of these lessons , called why study plants ? into 14 languages ( http://www.plantcell.org/site/teachingtools/ttpb1.xhtml ) , and we are exploring the possibility of translating additional lessons in collaboration with the global plant council . we have been exploring the use of social media as a way to connect the geographically widespread users of teaching tools in plant biology . scientists are generally considered slow adopters of social media , but there is growing awareness that these tools can be used in a professional context and support professional development ( bik & goldstein , 2013 ; osterrieder , 2013 ) . since the earliest days of online education , educators have stressed the importance of building community and trust ( brown , 2001 ; rovai , 2002 ) ; trust is based on positive interactions , whether online or in person . social media provide the opportunities for community building that were lacking in the earliest iterations of distance learning and have proven to be an effective medium to support interactions among globally distributed professional communities ( claussen et al . , 2013 ; davies & glasser , 2014 ; evans , 2014 ; kietzmann et al . , 2011 ) . our efforts so far have focused on three platforms : twitter , facebook , and scoopit . as described by van noorden ( 2014 ) , twitter and facebook are perceived very differently , with far more of the scientists they surveyed indicating that professionally they prefer twitter to facebook . our data indicate that the geographic distribution of people following or likingthe teaching tools in plant biology feed differs between the two platforms ( figure 5 ) . notably , more than two thirds of twitter followers are from the uk , the us , canada , and australia , a fact that emphasizes the importance of language for this type of interaction . by contrast , seven out of eight of the largest groups of followers of the facebook feed are from countries whose primary languages are not english . the geographically broad distribution of followers of both the teaching tools articles and the social media feeds provides an interesting challenge for the content curators and creators , which is to be vigilant about the tone and implications of the materials shared . many companies and organizations have developed social media guidelines for their staff to follow ( http://socialmediagovernance.com/policies/ ) , and these are particularly relevant when considering diverse audiences . it is possible for a tweet that is meant to be ironic or humorous to be wildly misinterpreted , and there are plenty of well - publicized social media mistakes to serve as reminders of the importance of the ruletrust is one of the most important factors for the success of online learning , so providing a positive online presence has been one of our goals ( wang , 2014 ) . a successful online resource has to reflect the values and concerns of a broadly multicultural community ( liu et al . , 2010 ) . to further support the global community of plant scientists , we endeavour to use examples and case studies highlighting agricultural challenges from geographically diverse regions . recent teaching tools describe the challenges of seawater incursion in bangladesh , groundwater limitations in northern china , and phosphate - deprived soils of chile and south western australia . contributors to our social media communities are excellent sources of information about regional concerns and perspectives . finally , it is clear that our social media platforms are helping to connect the core materials to our audience . as an example , on december 30 , 2014 , we posted a new teaching tool . forty - eight hours after posting a notice of this new tool on facebook , the notice had been seen by 3300 people , shared 30 times , and been liked 56 times , with more than 500 pageviews of the new article . through social media , we are creating an environment in which professors , postdocs , and students can share and discuss ideas about current research in plant biology . the platforms we are using now arrange the information chronologically , but later this year we are launching a custom - built platform that will allow the discussions to be archived by theme and topic as well . we are designing the new platform to encourage direct peer - to - peer sharing of teaching tips and strategies . for example , many users of teaching tools ask us to suggest videos or animations to accompany the topics , and we will include a simple user interface to support uploading links to such materials . we envision that when an instructor or student is ready to learn what s new in photosynthesis , he or she can find not only the relevant teaching tool , but also links to more recent articles , animations , lesson plans , and teaching ideas contributed from the community . a similar model for introductory biology topics was recently unveiled ( coursesource.org ) . our own experiences and several other studies suggest that there are many different ways that teachers and learners can use online educational materials , both in and out of the formal classroom environment . social and cultural issues , centralized control of curriculum and exams , access to textbooks , and fluency in english all affect the learning experience . support has been strong for the approach we have taken , which is to make available a diversity of materials suitable for teachers and learners to use as they will . our strategy has been to create and curate high - quality , authoritative content that highlights and interprets the cutting - edge of plant science , and we are increasingly providing an opportunity for educators and learners to share in the development of these resources . we are confident that through teaching tools in plant biology we are making a significant contribution to developing the next generation of educational tools with global outreach .\noutput:\n" }, { "from": "agent", "value": "in 2009 , we started a project to support the teaching and learning of university - level plant sciences , called teaching tools in plant biology . articles in this series are published by the plant science journal , the plant cell ( published by the american society of plant biologists ) . five years on , we investigated how the published materials are being used through an analysis of the google analytics pageviews distribution and through a user survey . our results suggest that this project has had a broad , global impact in supporting higher education , and also that the materials are used differently by individuals in terms of their role ( instructor , independent learner , student ) and geographical location . we also report on our ongoing efforts to develop a global learning community that encourages discussion and resource sharing ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: medical science universities intend to graduate students who help maintain and improve the social health as a health team . they will produce knowledge ( basic and clinical science ) , apply it ( clinical decision making ) and manage health and society to keep up and improve people s health ( health system management ) ( 1 ) . medical science universities have few programs to improve problem - solving skill in the health system and focus on individual memories , though the first goal of any educational system is to transfer learners from mere memorizing level to reasoning and problem - solving level ( 1 ) . common educational methods provide individual with plenty of theoretical information who may sometimes be unable to solve small problems . in fact , traditional educational method provides students with a combination of information and concepts but leaves them alone in prioritization and organization of new knowledge analysis which is necessary to critical thinking and results in effective learning ( 2 ) . clinical reasoning is the key skill in practice and worthiness of clinical reasoning skill should be considered as one of the most important skills that a physician needs ( 1 ) . the reasoning is a mental procedure in which primary terms are transformed into secondary or desirable terms . the reasoning is a transmission from what we see and a try to give them meaning and concept ( 3 ) . in medicine , reasoning is getting patient s medical history , finding out signs and symptoms and by passing through them by conclusion you get to a clinical diagnosis . so , clinical reasoning is a mental procedure which helps physicians to cross from signs and symptoms to clinical reasoning and treatment ( 2 ) . the first principle of clinical reasoning is gathering valid , accurate and reliable information from the patient . the patient is an information source from which physician tries to obtain useful and relevant information and form a diagnostic hypothesis based on self - knowledge . then , the physician evaluates hypothesis and for this new information from the patient is required . if physician happened to understand patient s problem , they could enter clinical counsel which requires further information gathering for hypothesis design and evaluation . studies have shown that most physicians , even when the diagnosis is clear , use multi - level clinical reasoning and their general clinical reasoning does not vary based on different patient problems or different medical specialties ( 3,4 ) . since the most important step of clinical reasoning is data gathering , the physician should be able to obtain a medical history from the patient or any other source through a purposeful medical interview using communication skillsphysicians face some patient complaints in the work life which show that their experience and skills do not seem satisfactory . thus , the ability to deal with such situations with appropriate medical reasoning approaches should be developed in physicians ( 5 ) . getting medical history and communication and effective interpersonal skills are some basic clinical capabilities which medical students and residents should learn . proper communication requires practicing and special attention . often success in managing a disease is dependent on getting history , proper and rapid communication with patient and gathering data from different sources ( 6 ) . the base of health surveillance is the communication between physician and patient . an appropriate communication leads to greater success in achieving a correct diagnosis and performing suitable medical services . to use communication skills in the workplace , a physician should first understand their concept then practiced them enough . in many curriculumsnot adequate attention has been devoted to communication skills and faculty members use quantitative methods and strategies for teaching and evaluation of this skill ( 7 ) . on the other hand , in pediatric medicine communication , getting a medical history and data gatheringstudents of medicine should get familiar with special points in pediatric medicine communication skills other than general communication skills to succeed in information gathering which is the most important step of medical reasoning . many signs in pediatric medicine are different from adult medicine , and their interpretation requires special precision . the physician should be able to interpret signs which are stated by parents . this research is intended to teach medical reasoning to students with a special attention to pediatrics medicine and measure its effect on their problem solving s ability . in the educational phase , data gathering is based on special communication skills in pediatrics medicine and all signs and symptoms of pediatric diseases . in the evaluation phase , students medical reasoning is measured according to available tests and widespread pediatric diseases . the applicable result of this research would be the design of a new educational course in the pediatric department for medical students . additionally , since an area of national medical students scientific olympiad which has been held annually in medical science universities since 2010 , is evaluation of medical students reasoning skill , performing this project is helpful for preparation and practice of students of arak medical university to achieve great results for the university . sampling volume was calculated with the formula below , and students were put into case and control group . n = ( z1 / 2 + z1 ) * ( 12 +22 ) ( 12 ) 2 where equals 0.5 , equals 0.9 and equals 3 ( range divided by 6 ) . the minimum significant difference between case and control group is 3 points ( of 20 points ) and the minimum sample is 20 for each group . according to university s educational schedule , they were divided into different sections , getting medical history from inpatients and outpatients and getting familiar with diseases and diagnosis and therapeutic methods . theory classes were held every day and main pediatric diseases were described to stagers ( undergraduate medical students ) . at the end of the course a multiple - choice written test and an oral examstagers of one period were put into the case group and stagers of the two other periods were put into the the control group . the control group consisted of stagers who passed their pediatric course with the traditional method including no clinical reasoning instruction as indicated above . at the end of the course , instead of an oral exam , these stagers take clinical reasoning tests : diagnostic thinking inventory ( dti ) , key features ( kf ) and clinical reasoning problem ( crp ) . since the numbers of students in each period of this course were below 20 , two periods of this course were used as control group . case group passed a 2 - day workshop on clinical reasoning 15 days left to the end of course and taken clinical reasoning tests . arrangement for the two days of the workshop was done with the help of the pediatrics group of the medical school . main topics of the workshop were : instruction of communication skills in pediatric medicine instruction of data gathering instruction of hypothesizing instruction of analytical reasoning approach instruction of nonanalytic reasoning approach instruction of changing clinical reasoning approach in problem - solving it was a student - based workshop and practice on common pediatric diseases in small groups . all contexts were presented by the power - point software ( appendixes 2 to 6 ) . five cases of pediatric diseases in addition to other pamphlets were provided and copied . the duration of the workshop was 12 hours in 2 days , and 19 medical stagers ( case group ) took part in the workshop . before getting to the topics of the workshopthis questionnaire consisted of 41 questions with six answers which was designed for evaluation of the quality of medical reasoning . in the first day of the workshop , generalities of clinical reasoning in medicine were discussed and participants got familiar with its primary concepts . data gathering was introduced as first and most important step of clinical reasoning . in the open discussion , participants get to ways to accredit information and pediatric medicine properties . due to importance of communication with patients , calgary - cambridge interview guidance was practiced . two patient illness scripts was given to the participants for workshop practice and home use . in the second day , after reviewing previous day s topics and presentation of home problems , bugs were fixed . afterward , two new illness scripts besides previous illness scripts were discussed . finally , after summarizing the topics presented at the workshop , satisfaction questionnaires were completed by participants .15 days after the workshop , dti ( diagnostic thinking inventory ) , kf ( key features ) , and crp ( clinical reasoning problem ) clinical reasoning tests were taken from the case group . ten questions of common pediatric issues were designed for both kf and crp tests ( see them in the appendix ) . to design the answer - key of the tests , five residents of pediatrics was asked to answer the questions . for any question of the kf test7 .5 points was considered which made 75 points in total . for each question of crpconsequently , kf and crp tests reached 200 points together . since any question had six choices and the number of dti questionnaire s questions , minimum and maximum scores were 41 and 246 , respectively . dti , kf and crp tests were taken from both case and control groups and were scored . this research has been approved by ethics committee of research in the arak medical faculty under number 90 - 115 - 1 .19 were in the case group ( 36.8 % male and 63.2 % female ) , and 23 were in the control group ( 43.5 % male and 56.5 % female ) . about 85 % ( n = 36 ) of them stated that the workshop could make the concept clinical reasoningclear to them and 72.7 % ( n = 30 ) told they were satisfied with time and place of the workshop ( table 1 ) . mean of grade point average for the case and control groups were 15.42.4 and 15.02.6 respectively which is not significantly different ( p 0.05 ) . statistical analysis of diagnostic thinking inventory ( dti ) ( total points = 246 ) : in the control group , mean dti score of 162.04 and 170.2 with standard deviations of 18.3 and 19.5 was calculated before and after workshop respectively ( pretest and posttest ) . in the case group , meandti scores of 153.26 and 181.68 with standard deviations of 13.6 and 21.9 was calculated before and after workshop respectively ( pretest and posttest ) . comparing mean pretest dti score of the control group with case group did not show a significant difference ( p 0.05 ) . comparing mean dti score of the control group with case group ( posttest dti ) showed a significant difference ( p 0.05 ) . comparing mean dti score of pretest and posttest in the case group showed a significant difference ( p 0.001 ) . comparing mean dti score of pretest and posttest in the control group did not show a significant difference ( p 0.05 ) . statistical analysis of kf ( key features ) and crp ( clinical reasoning problem ) tests showed in table 2 . comparing mean kf scores in the case and control groups did not show a significant difference ( p 0.05 ) . comparing mean crp scores in the case and control groups showed a significant difference ( p 0.05 ) . comparing meanthus , enough attention must be paid to problem - oriented and student - oriented teaching as two principles . to have a closer contact with real clinical environment , a best educational method is case - based learning ( 8 ) . using patient s medical history as a scenario is the cornerstone of learning and evaluation of clinical reasoning . desig of these medical scenarios proper to the scientific level of participants was time - consuming and sensitive . ten different histories were used for kf test , crp test , and workshop s practices . the best learning environment for clinical reasoning is small groups which are based on problem solving . so the followings were prepared for this research : illness scripts of common pediatrics diseases to be used in workshops and tests test questions and the keys designing an educational course based on workshop s plan preparing booklets and pamphlets to be used in workshop preparing power point presentation for workshop s lectures in this research , the workshop was held in 2 days including 12 hours of clinical reasoning course which is a proper time compared with similar studies . in a study at hong kong university in 2007 , a workshop was held for the case group only 3 hours long using illness scripts ( 11 ) . when informational , judgmental and reasoning errors of individuals are detected and discussed , its effect on clinical medicine memory and clinical reasoning strategy is reinforced ( 9 ) . because of this , the workshop was planned to be based on practicing illness scenarios of real patients with emphasis on pediatric medicine . in most studies , using illness scripts which are patient s real medical history have been recommended ( 1,10 ) . evolution of clinical reasoning is somehow evaluation of medical skills and as a result has special tests . clinical reasoning tests are designed to investigate its different principles . for evaluation of clinical reasoning , three skills should be investigated , account to give a complete picture : data gathering , hypothesizing and hypothesis evaluation . tests which can be used for this purpose include ( 8 ) : information gathering test hypothesis formation test clinical reasoning problem integrated puzzles diagnostic thinking inventoryafter consultation with expert faculty , key feature , clinical reasoning problem and diagnostic thinking inventory , which provide a great variation compared with other tests , were selected to be used in this research ( 9,10 ) . to check the case and control groups likeness , mean grade point of stagers was used which showed no significant difference . also , when dti questionnaire score of the control group and the case group before workshop was compared there were no significant difference . the workshop was held 15 days before the end of the pediatric course to be far away from the exam time . this means that the workshop was successful in teaching primary concepts of clinical reasoning to the participants . although mean kf score of the case group was higher than the control group , it did not show any significant difference . it can demonstrate the nil impact of this intervention ( workshop ) in improving kf score and this workshop is too short to influence the kf score , but mean crp and the total score showed a significant difference which means that clinical reasoning has a long - term effect on the problem - solving ability of stagers . since no significant difference has been observed in one of the tests and some dti questionnaire questions , it can be inferred that the in some aspects of clinical reasoning , the workshop has been more effective . students who are familiar with the clinical reasoning skills as well as the theatrical knowledge , will be more successful in analyzing , prioritizing , and knowledge organizing to solve health problems . since medicine learning issues are paid attention in the whole world , we ought to teach and use new techniques to have something to say with these rapid advances in medicine and medical education . suggested the impact of both the developmental effect and the curriculum effect on the development of diagnostic reasoning skills ( 11 ) . common errors in clinical reasoning muse be recognized and teachers provide guidance on the cognitive processes involved in making diagnostic decisions ( 12 ) . study of bian wu et al . showed that the learning of clinical reasoning in both problem solving and knowledge construction would be developed using computer - based cognitive representation approach ( 13 ) . martine chamberland et al . concluded that self - explanation seems to be an effective technique to help medical students learn clinical reasoning . its impact is increased significantly by combining it with examples of residents ses and prompts ( 14 ) . study and also round ap . showed that clinical reasoning strategies can result in improved diagnostic thinking inventory ( 15,16 ) . however , rajabi et al . found no significant difference between the scores of crp before and after the intervention ( 17 ) . anna lee et al . showed that there is no difference between post - intervention scores of the two groups although the total score was higher in the intervention group compared to the control group ( 18 ) . this research showed that stagers problem - solving skill can be improved by teaching clinical reasoning ; and widespread theoretical issues can be provided as illness scripts to improve clinical reasoning skill of stagers . this workshop can be performed in all department of arak medical faculty and other medical sciences university of the country . thanks to the deputy of arak university of medical sciences and research students who participated in this study .\noutput:\n" }, { "from": "agent", "value": "background : clinical reasoning process leads clinician to get purposeful steps from signs and symptoms toward diagnosis and treatment . this research intends to investigate the effect of teaching clinical reasoning on problem - solving skills of medical students . methods : this research is a semi - experimental study . nineteen medical student of the pediatric ward as case group participated in a two - day workshop for training clinical reasoning . before the workshop , they filled out diagnostic thinking inventory ( dti ) questionnaires . fifteen days after the workshop the dti questionnaire completed and \" key feature \" ( kf ) test and \" clinical reasoning problem \" ( crp ) test was held . 23 medical student as the control group , without passing the clinical reasoning workshop dti questionnaire completed , and kf test and crp test was held . results : the average score of the dti questionnaire in the control group was 162.04 and in the case group before the workshop was 153.26 and after the workshop was 181.68 . compare the average score of the dti questionnaire before and after the workshop there is a significant difference . the difference between average kf test scores in the control and the case group was not significant but between average crp test scores was significant . conclusion : clinical reasoning workshop is effectiveness in promoting problem - solving skills of students ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in 1901 , a german surgeon , kelling , reported his views of the abdominal viscera after filling a dog 's abdomen with air and inserting a cystoscope . since then , several innovative advancements have been made in the field of laparoscopic surgery . it has also accelerated the introduction of endoscopic and laparoscopic procedures in the field of urology , general surgery , and gynecology . the advantages of laparoscopic donor nephrectomy have been well documented and include less patient discomfort , shortened hospital stay , quicker recovery and return to usual activities , and more pleasing cosmetic results . increasing experience with the technique has prompted its use for more complicated procedures , such as bilateral laparoscopic nephrectomy in adult patients with polycystic kidney disease ( adpkd ) before transplantation . we present our experience with the use of the laparoscopic technique for bilateral nephrectomy before transplantation in adpkd patients . we retrospectively reviewed the charts of all the patients who underwent pretransplant bilateral hand - assisted laparoscopic nephrectomy for adpkd between february 2000 to april 2002 . we recorded patient demographics , such as age , race , sex , renal size , indication for bilateral laparoscopic nephrectomy , and perioperative complications ( table 2 ) . all patients had end - stage renal disease ( esrd ) and were on maintenance hemodialysis . the indications for the nephrectomy were massive kidney size , uncontrolled hypertension , recurrent cyst hemorrhages with macroscopic hematuria , and frequent urinary tract infections . all procedures were performed by a single surgeon at our institution along with surgical residents assisting under direct supervision . laboratory workup included a complete blood count ( cbc ) , basal metabolic panel ( bmp ) , prothrombin ( pt ) , and partial thromboplastin time ( ptt ) . oral intake was stopped 12 hours before the procedure . a bowel preparation consisting of a gallon of polyetheleneglycol ( golytely ) hemodynamics is monitored with a central venous catheter , swan - ganz catheter , and arterial - line as needed . a pneumoperitoneum is created with the patient in the supine position . due to the lateral tilting of the operating table , repositioning of the patientthe handport incision was central at the level of the umbilicus , and then this was connected to the co2 insufflactor . three to 5 trocars are placed after transillumination of the inside abdominal wall ( figure 2 ) . gerota 's fascia is then incised to visualize the kidneys . in situ aspiration of the anterior nonhilar cystsis done to reduce the size of the kidney and thereby facilitate further mobilization of the kidney to access the renal vessels . dissection is continued along the lower and upper pole of the kidney , additionally draining large cysts , until complete mobilization of the kidneys . hand - assisted laparoscopy ( hal ) as used in these cases provides the surgeon with tactile sensation and spatial orientation not available with standard laparoscopy . the kidney is manipulated into the device and morcellated with either mechanical forceps or an electrical tissue morcellator ( cook urological inc , spencer , in ) . reduction of renal size through aspiration of cyst fluid in situ precludes the need to make a sizable incision . the fascia is closed with absorbable sutures , and the skin is closed with nonabsorbable ones . port placement for left nephrectomy : 1 is the hand port . 2 and 4 are 10 - mm ports . port - site needle closure system is used for closure ( a ) operative setup during laparoscopic nephrectomy . laboratory workup included a complete blood count ( cbc ) , basal metabolic panel ( bmp ) , prothrombin ( pt ) , and partial thromboplastin time ( ptt ) . oral intake was stopped 12 hours before the procedure . a bowel preparation consisting of a gallon of polyetheleneglycol ( golytely ) hemodynamics is monitored with a central venous catheter , swan - ganz catheter , and arterial - line as needed . due to the lateral tilting of the operating table , repositioning of the patient is not required ( figure 1 ) . the handport incision was central at the level of the umbilicus , and then this was connected to the co2 insufflactor . three to 5 trocars are placed after transillumination of the inside abdominal wall ( figure 2 ) . gerota 's fascia is then incised to visualize the kidneys . in situ aspiration of the anterior nonhilar cystsis done to reduce the size of the kidney and thereby facilitate further mobilization of the kidney to access the renal vessels . dissection is continued along the lower and upper pole of the kidney , additionally draining large cysts , until complete mobilization of the kidneys . hand - assisted laparoscopy ( hal ) as used in these cases provides the surgeon with tactile sensation and spatial orientation not available with standard laparoscopy . the kidney is manipulated into the device and morcellated with either mechanical forceps or an electrical tissue morcellator ( cook urological inc , spencer , in ) . reduction of renal size through aspiration of cyst fluid in situ precludes the need to make a sizable incision . the fascia is closed with absorbable sutures , and the skin is closed with nonabsorbable ones . port placement for left nephrectomy : 1 is the hand port . 2 and 4 are 10 - mm ports . port - site needle closure system is used for closure ( a ) operative setup during laparoscopic nephrectomy . laparoscopic nephrectomy in patients with adpkd was first reported in 1993 with intact removal of a 2200 - g specimen from a 15 - cm incision . laparoscopic procedures may require more operative time to complete in patients with adpkd because of the massive renal size , surrounding fibrosis , and proximity to several vital structures . with the advent of hand - assisted techniques , hand - assisted laparoscopic surgery is associated with rapid dissection and a significantly shorter learning curve when compared with that of traditional laparoscopy . also , hal shortens the laparoscopic learning curve of the technique . longer operative times have been reported for standard laparoscopy and hal in the literature as compared with operative times with the open procedures . it is an additional option in more complex cases , allowing the surgeon to convert to hand assistance . because laparoscopic surgery is minimally invasive , it confers upon the patient superior cosmetic results , shorter hospitalization , lower morbidity , and shorter convalescence . in addition , a decrease in analgesic use , hospital stay , and convalescence will make this technique more accepted and practiced . recent literature has documented the problems experienced by adpkd patients after transplantation ( pain , recurrent infection , hemorrhage ) . nephrectomy before transplantation improved the 5 - year graft survival and patient survival by 19 % and 18 % , respectively , among those adpkd patients undergoing pretransplantation nephrectomy . bilateral laparoscopic nephrectomy may be undertaken before transplantation in those patients with cyst - related signs and symptoms . we feel that in - situ cyst drainage , entrapment , and morcellation eliminate the need for a large incision and wound hernia formation . this also reduces blood loss , operative time , and postoperative use of parenteral analgesics . given the effectiveness and excellent convalescence associated with the laparoscopic approach , we believe more patients with adpkd may become candidates for pretransplantation bilateral laparoscopic nephrectomy . the ages ranged from 39 years to 65 years with a mean of 49.44.7 years . the mean bmi ( body mass index ) was 27.61.78 ( range , 23 to 33 ) . the average estimated blood loss was 345 ml ( range , 100 ml to 600 ml ) per case . the operative time ranged from 150 minutes to 210 minutes , with an average of 185 minutes per case . the use of laparoscopy in general and transplantation surgical procedures has increased in recent years as more studies show the safety and efficacy of this approach . bilateral laparoscopic nephrectomy in adpkd patients appears to be safe in experienced hands . in this article , we have illustrated the use of the laparoscopic technique for bilateral nephrectomy in adpkd patients with good results . we feel that these data support the efforts to incorporate laparoscopic procedures as an alternative to open nephrectomy in pretransplant adpkd patients for bilateral laparoscopic nephrectomy\noutput:\n" }, { "from": "agent", "value": "laparoscopic procedures continue to gain popularity over traditional open procedures for a number of abdominal and pelvic surgeries . with increasing experience , the application of this technique is rising because it provides an alternative , less invasive , approach to various surgical procedures . herein , we report our experience with adult patients with polycystic kidney disease , requiring bilateral laparoscopic nephrectomy before renal transplantation ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: glaucoma is a multifactorial chronic progressive disease , characterized by the loss of ganglion cells which leads to typical damage of the optic nerve and to visual field loss . the pathogenic concepts of glaucoma may be divided into a mechanical , pressure - related , and a vascular approach . it is well established that the main risk factor for glaucoma is individually elevated intraocular pressure . in addition , systemic vascular factors like arterial hypertension and hypotension , cardiovascular diseases , vasospasms , and others have been identified to play a significant role in the disease as well as impaired ocular blood flow . in this context , disturbed vascular regulation may increase the susceptibility of the optic nerve and the ganglion cells to fluctuations in ocular perfusion pressure . systemic blood pressure regulation and local mechanisms ( autoregulation ) need to maintain ocular blood flow at a constant level despite changes in perfusion pressure . it has been shown that low ocular perfusion pressure is a risk factor for the prevalence of glaucoma . abnormal perfusion and the following ischemia of the optic nerve are supposed to lead to glaucomatous damage . disturbed autoregulation was observed in several studies in glaucoma . the mechanisms may be related to primary vascular dysregulation , endothelial dysfunction , astrocyte activation , or increased intraocular pressure . in a previous study on 24 h blood pressure monitoring in glaucoma , an increased night - time blood pressure variability was found suggesting disturbed systemic blood pressure regulation . the present prospective pilot study investigates the autonomic blood pressure regulation in patients with primary open - angle glaucoma ( poag ) and controls . systolic and diastolic blood pressure and heart rate variability was noninvasively and continuously assessed to characterize systemic vascular dysregulations using linear and nonlinear methods . the hypothesis is that poag patients exhibit a different pattern of blood pressure and heart rate variability compared to controls as defined by using nonlinear analyzing methods . thirty - one patients with poag and 48 age - matched controls were included in a prospective pilot study . all patients with poag had a detailed ophthalmological examination ; intraocular pressure was measured using goldmann applanation tonometry . patient 's history was explored with special interest on cardiovascular risk factors ( diagnosis of treated hypertension , arterial hypotension , history of cardiovascular events , nicotine abuse , and obesity ) . the systemic medications were recorded , but only the status of treated arterial hypertension was included in the analysis . ethics approval was granted by the committee of ethics at the university of aachen . to measure cardiovascular biosignals , blood pressure , and electrocardiogram , the diagnostic system glaucoscreen ( aviant gmbh , jena , germany ) synchronous ecg and blood pressure time series were continuously recorded over a period of 30 minutes in a lying position at rest using glaucoscreen ( aviant gmbh , jena , germany ) ; see figures 1 and 2 . the method focusses on the detection of abnormal fluctuations of the cardiovascular system and the mechanisms of systemic autonomic regulation in patients without any physical activity . this system allows simultaneous and continuous multichannel registration of diastolic and systolic blood pressure and heart rate . participants avoided activities that could alter the blood pressure or heart rate 30 min before examination . nicotine or caffeine intake was not allowed on the day of the examination . for preparing the recording , at first electrodeswere fixed on subject 's body to record the electrocardiogram . for calibration , blood pressurewas measured once before starting the recording using the upper arm . during the period of 30 minutes , blood pressure was measured continuously at two fingers , applying the noninvasive cnap oem module ( cnsystems medizintechnik ag , austria ) . all recordings were performed under resting conditions ( supine position , quiet environment , and the same location ) and patients were instructed to lie calmly and to avoid speaking . systemic blood pressure variability ( bpv ) and heart rate variability ( hrv ) were analyzed offline ( ernst - abbe - hochschule jena , department of medical engineering and biotechnology , jena , germany ) . for data preprocessing , the time series of successive beat - to - beat intervals ( bbis ) and of systolic as well as diastolic pressure values were extracted . hrv is the bbi length variability also called rr variability ( where r represents the peak of the qrs complex of the ecg complex and rr is a time interval between two successive r peaks ) whereas bpv represents the variability of successive systolic or diastolic blood pressure values corresponding to the related heart beats . in a further step , artefacts and / or ectopic beats and other disturbances ( either r peaks recognized incorrectly or r peaks generated not in sinus rhythm ) were detected within the rr time series and replaced ( applying an adaptive filter ) by interpolatednormal beats to generate normal - to - normal ( nn ) beat time series representing normal sinus rhythm of the heart . hrv and systolic and diastolic bpv standard parameters were calculated from time ( table 1 ) and frequency domain ( table 2 ) according to the task force of the european society of cardiology and the north american society of pacing and voss et al . in addition to these linear analysis methods , symbolic dynamics ( syd ) and joint symbolic dynamics ( jsd ) , two nonlinear methods were applied in this study . results of syd analysis have been shown to be sufficient for the investigation of complex systems and describe dynamic aspects within time series . syd is a nonlinear method which describes the global short - and long - term dynamics of beat - to - beat variability on the basis of symbolization and was introduced by kurths and voss et al . the syd method converts the nn interval time series into an alphabet of four predefined symbols ( 0 , 1 , 2 , and 3 ) according to the transformation rules based on consecutive comparison of successive nn intervals . the symbols 0 and 2 reflect slight deviations ( 10 % increase , resp . , 10 % decrease ) from the mean nn interval , and the symbols 1 and 3 reflect stronger deviations ( 10 % increase , resp . then , the symbol strings are transformed into word series where each word consists of three successive symbols . this leads to a range of 64 different word types ( xxx = 000 , 001 , , 333 ) . then , estimates from the word distribution using the probability of occurrence ( pwxxx ) of each word type within nn interval time series are calculated ( the summarized probability of all word types is normalized to 1 ) . on the basis of these word types , the number of all word types with a probability of occurrence of more than yyy percent ( pthyyy for hrv and _ pthyyy _ sys / dia for bpv ) was separately counted ( e.g. , pth13_sys means the number of word types with a probability of occurrence greater than 13 % in systolic blood pressure time series ) . the syd indices were all calculated for the heart rate and systolic and diastolic blood pressure time series . the jsd ( figure 3 ) is a bivariate method investigating interactions between bbi time series and systolic or diastolic time series . jsd was applied to quantify the short - term bivariate nonlinear behavior of the cardiovascular system . similar to the syd , jsd transforms bbis , diastolic , and systolic blood pressure time series into symbol sequences of different words w according to the transformation rules using an alphabet a = { 0,1 } . thereby , symbol 1represents increasing values ( the actual value is greater than the previous one ) and symbol 0 decreasing and unchanged values ( the actual value is less than or equal to the previous one ) applying a threshold level equal to zero . afterwards , short patterns ( words of length consisting of 3 symbols ) were formed ( k = 64 ) in detail ; see figure 3 . the analysis method of jsd included the evaluation of 64 parameters for characterization of systolic blood pressure interaction with heart rate and 64 parameters for the interaction of diastolic blood pressure and heart rate . the analysis was performed on the basis of the hrv / bpv indices ( time and frequency domain , methods from nonlinear dynamics ) . the nonparametric mann - whitney u test ( spss 21 ) was applied for statistical analysis to figure out significant ( p 0.05 ) and highly significant ( p 0.001 ) parameters differentiating between patients with glaucoma and controls . for highly significant parameters , the multivariate stepwise discriminant function analysis was performed to calculate the specific sensitivity and specificity and the area under the receiver operating characteristics ( roc ) curve ( auc ) applying the best set of six parameters . thirty - one patients with poag and 48 age - matched volunteers were included in this prospective pilot study . patients with poag had a glaucomatous excavation of the optic disc and glaucomatous visual field defects as defined by the european glaucoma society . field loss was considered significant when ( a ) glaucoma hemifield test was abnormal , ( b ) 3 points were confirmed with p 0.05 probability of being normal ( one of which should have p 0.01 ) , not contiguous with the blind spot , or ( c ) corrected pattern standard deviation ( cpsd ) was abnormal with p 0.05 . all patients with poag had iop values above 21 mmhg without treatment in their medical history . visual field examinations were performed with the humphrey field analyzer ( model 750 , humphrey - zeiss , san leandro , california , sita program 24 - 2 ) . the control subjects did not have any ophthalmologic disease , showed iop values below 22 mmhg , and did not receive any topical treatment . visual field parameters ( mean deviation ( md ) and pattern sd ( psd ) , humphrey visual field analyzer ) were within normal range and the glaucoma hemifield test was within normal limits . healthy controls presented in funduscopy a normal optic nerve head appearance ( no thinning or notching of neuroretinal rim , no bared circumlinear vessels , and no disc hemorrhages ) . volunteers and patients with poag with an acute cardiovascular or cerebrovascular event within the last 6 months or with known heart rhythm disorders were excluded from this study . patients with glaucoma and controls were matched for age , sex , and treated arterial hypertension . all patients with glaucoma were on topical iop lowering therapy that might influence the results . thirty - one patients with poag ( mean age 6610 years ; 17 men , 14 women ) and 48 control subjects ( mean age 6810 years ; 24 men , 24 women ) were included in this study . patients with poag had on the right eye a mean iod of 153 mmhg ( minimum 8 mmhg , maximum 36 mmhg ) and on the left eye a mean iod of 175 mmhg ( minimum 10 mmhg , maximum 33 mmhg ) . iod of the healthy controls was never above 21 mmhg ; mean iod for the right eye was 153 mmhg and for the left eye 143 mmhg . seventeen patients used carbonic anhydrase inhibitors , 24 patients - blockers , 6 patients brimonidine , and 19 patients prostaglandins . twenty - nine patients with poag and 23 controls confirmed in their medical history treated arterial hypertension . the clinical data ( systemic vascular risk factors by medical history ) of both groups are shown in table 3 . in the group of poag , patients had a mean diastolic blood pressure of 899 mmhg and a mean systolic blood pressure of 14517 mmhg . the controls showed a mean diastolic blood pressure of 8612 mmhg and a mean systolic blood pressure of 14717 mmhg . mean heart rate in the group of poag was 6810 / min ; healthy controls showed a mean heart rate of 6710 / min . the mean as well as standard deviation of the heart rate and diastolic and systolic blood pressure did not significantly differ between the two investigated groups . looking at the time series of heart rate and systolic blood pressure , more parameters belonging to the nonlinear analysis methods ( syd ) were able to significantly separate control subjects and patients with poag compared to the time series of diastolic blood pressure , where only one syd parameter could separate the two groups significantly ( table 4 ) . applying the method of jsd , more significant parameters were detected when analyzing the interaction of the time series diastolic blood pressure and heart rate compared to the interaction of time series systolic blood pressure and heart rate . the univariate indices pw113 and pw120_sys ( probability of occurrence of the specific word types : 113 for beat - to - beat intervals and 120 for systolic blood pressure ) were increased in poag . that means an increase of patterns with a valley - like behavior of heart rate patterns and an increase of systolic bpv patterns with a start of a plateau phase . the univariate indices pth10_sys and pth11_sys ( number of systolic bpv word types with a probability of occurrence higher than 10 , resp . , 11 percent ) reflect a reduction of dominant patterns at the expense of an increased probability of occurrence of other word types ( an increase of pth3 ) . that means that poag exhibit a higher systolic bpv than controls . finally , the indices jsddia29 , jsddia50 , and jsddia52 were increased in poag . interestingly all these indices may be found directly or in neighborhood to the word types representing diametric behavior ( e.g. , 011,100 or 110,001 ) . these word types demonstrate a behavior oppositional to the typical baroreflex response ( e.g. , 001,001 or 110,110 ) . overall , only single linear indices from time and frequency domain analysis showed significant differences between groups . the optimum set consisting of six parameters ( jsddia29 , jsddia58 , pth9_sys , pw231 , pw110_sys , and pw120_sys ) revealed a sensitivity of 83.3 % , a specificity of 80.6 % , and an auc of 82.3 % . ocular blood flow is an important factor in glaucomatous optic neuropathy and , together with ocular perfusion pressure , is directly affected by systemic blood pressure . the influence of systemic blood pressure on glaucomatous optic neuropathy has been investigated in several studies before . systemic blood pressure has different fluctuation rhythms under physiological conditions , that is , seasonal variability with lower blood pressure values in winter times , short - time fluctuation patterns during day and night and the physiological night - time blood pressure depression . there is evidence that excessive dipping could be associated with development or progression of glaucoma . examined the relationship between 24 h mean ocular perfusion pressure and visual field progression in patients with normal tension glaucoma . in that retrospective study , 101 patients had at least a 4 - year follow - up , and blood pressure and iop were evaluated over 24 hours in each patient . showed that elevated 24 h mean arterial pressure and increased 24 h mean ocular perfusion pressure fluctuations were a significant risk factor for glaucoma progression . autoregulation is the physiological phenomenon in which the resistance changes dynamically to keep blood flow at a constant level which is required by the local and metabolic activity despite changes in perfusion pressure . in healthy subjects , retinal blood flow is autoregulated to provide a constant blood flow regardless of changes in ocular perfusion pressure . earlier studies have suggested that glaucoma patients show abnormal autoregulation especially in response to acute changes in ocular perfusion pressure . in glaucoma , autoregulatory dysfunctionmay be related to fluctuations in ocular perfusion pressure , via changes in either systemic blood pressure or intraocular pressure , leading to changes in retinal and optic nerve head perfusion . the concept of altered ocular blood flow has been postulated to be a major component of glaucoma pathogenesis in normal tension glaucoma . however , disturbed blood flow has been found to be relevant in primary open - angle glaucoma also . in addition to the concept of autoregulation , systemic blood pressure and heart rate are influenced by systemic mechanisms of regulation . the concept of systemic vascular dysregulation in glaucoma affecting recurrent ischemic episodes of the optic nerve caused by an impaired capacity to compensate low perfusion pressures has been described before . the concept of disturbed blood flow regulation in glaucoma has been investigated in various studies using different approaches provoking the capability of systemic and local mechanisms of blood flow regulation . stimuli such as carbon dioxide , oxygen , cold stress , isometric exercise , brachial arterial occlusion , or light flicker were used to examine blood flow regulation in patients with normal tension and primary open - angle glaucoma . however , until today , no standard method to measure vascular dysregulation has been established . in contrast to provocation methods that focus on autoregulation of ocular blood flow , the concept of the present study is to quantify the extent of defective or abnormal systemic vascular regulation of blood pressure and heart rate without any stimulus given . using this approach , the autonomic system may be characterized without any influence ab externo . in our study , blood pressure and heart rate variability was noninvasively assessed to characterize systemic vascular dysregulation in glaucoma patients and controls . the nonlinear model was designed to account for complex interactions of the continuously gained values characterizing systemic blood pressure and heart rate variability and dysregulation . in contrast , only singular linear indices from time and frequency domain showed significances . however , these indices could not contribute to the discrimination between glaucoma and controls in the same level as the nonlinear methods syd and jsd . the optimum set consisting of 6 indices revealed a sensitivity of 83.3 % and a specificity of 80.6 % . interestingly , in this set only , indices from nonlinear dynamics ( symbolic dynamics ) were included . in this context , we should emphasize that we do not believe that the identification of abnormal blood pressure or heart rate patterns would probably be a tool to identify glaucoma patients . but the measurement of systemic autonomic dysregulation might be an important method to identify patients with an increased risk for progression due to an impaired capacity of optic nerve head perfusion . methods of heart rate variability ( hrv ) and bpv based on nonlinear system theory and beat - to - beat dynamics have gained recent interest as they may reveal dedicated changes of autonomic regulations . these methods have been already used in other studies , investigating risk estimation for sudden cardiac death in patients with cardiomyopathy or examining heart rate variability in normal pregnancy . there are various types of different fractal scaling measures , complexity measures , power law analysis , measures of symbolic dynamics , turbulence , and acceleration / deceleration of heart rate and blood pressure and they have been studied in various patient populations . in this study , especially indices from syd ( univariate ) and jsd ( bivariate , coupling ) exhibit significant impairments in the cardiovascular regulation in glaucoma patients . these results support the idea that glaucoma is not just a process involving the eye but may be a manifestation of a more generalized autonomic dysfunction that is in agreement with the findings of brown et al . and others . andrikopoulos et al . summarized that pex syndrome may be linked to impaired heart and blood vessels function , systemic and ocular blood flow changes , altered parasympathetic vascular control and baroreflex sensitivity , increased vascular resistance and decreased blood flow velocity , arterial endothelial dysfunction , high levels of plasma homocysteine , and arterial hypertension . these partly complex linked impairments might be a reason for the found coupling impairments in poag in this study . an increased variability of systolic blood pressure represents also a strong predictor of early carotid atherosclerosis progression in general population . in a 3 - year follow - up study , progression of intima - media wall thickness was significantly greater in the patients with increased systolic bpv even after adjustment for other risk factors . moreover , especially an increased daytime systemic bpv was associated with a greater risk of cardiovascular events . the reduced values of pth10 and pth11 ( a lower number of dominating word types leading to a more broadly distributed variability ) and the increased values of pwsys120 ( representing an increased number of alternating patterns of the systolic blood pressure ) are typical signs of an increased bpv . these patterns are related to an increased number of downregulations of the heart rate and to more temporal limitations of blood pressure increases . both together might reflect an increased number of baroreflex activities to short - term down - regulated systolic blood pressure . even the sensitivity of baroreflex control of heart rate is depressed in glaucoma patients ; the number of tachycardic baroreflexes seems to be increased . higher values of jsddia29 , jsddia50 , and jsddia58 indicate enhanced occurrences of baroreflex regulations ( couplings between diastolic blood pressure and heart rate ) and , therefore , impaired short - term blood pressure regulation in glaucoma patients . diastolic blood pressure variability and baroreflex characterize the short - term behavior of the cardiovascular system and are mainly determined by respiratory influences on the blood pressure and heart rate . however , it might be too early for this method for a more specific interpretation of the data . further studies have to show if our pilot results can be reproduced in a larger scaled investigation . a major limiting factor of this prospective study is the possible influence of other systemic vascular diseases and topical and systemic medications possibly affecting ocular blood flow . a large controlled prospective study would be appropriate to investigate such confounding factors and to validate the results of this study . secondly , this approach has to be investigated in patients with normal tension glaucoma as well , to learn if the same or other parameters will be found to be altered in these patients . in conclusion , these alterations in blood pressure variability and coupling with heart rate suggest modified autonomic regulation due to a vascular dysfunction in patients suffering from glaucoma . the importance of the vascular influence for the pathogenesis of glaucoma is again emphasized by this study . further studies need to show if the method is valuable to identify systemic autonomic dysfunction in glaucoma . patients with systemic autonomic dysfunction might be at higher risk for progression of the disease due to a higher susceptibility of the optic nerve to fluctuations in intraocular pressure or ocular perfusion pressure .\noutput:\n" }, { "from": "agent", "value": "purpose . to investigate blood pressure and heart rate variability in patients with primary open - angle glaucoma ( poag ) to detect disturbed blood pressure regulation . methods . thirty - one patients with poag ( mean age 68 10 years ) and 48 control subjects ( mean age 66 10 years ) were included in a prospective study . continuous blood pressure and heart rate were simultaneously and noninvasively recorded over 30 min ( glaucoscreen , aviant gmbh , jena , germany ) . data were analyzed calculating univariate linear ( time domain and frequency domain ) , nonlinear ( symbolic dynamics , sd ) and bivariate ( joint symbolic dynamics , jsd ) indices . results . using nonlinear methods , glaucoma patients were separated with more parameters compared to linear methods . in poag , nonlinear univariate indices ( pw113 and pw120_sys ) were increased while the indices pth10_sys and pth11_sys reflect a reduction of dominant patterns . bivariate indices ( jsddia29 , jsddia50 , and jsddia52 ; coupling between heart rate and diastolic blood pressure ) were increased in poag . the optimum set consisting of six parameters ( jsddia29 , jsddia58 , pth9_sys , pw231 , pw110_sys and pw120_sys ) revealed a sensitivity of 83.3 % and specificity of 80.6 % . conclusions . nonlinear uni - and bivariate indices of continuous recordings of blood pressure and heart rate are altered in glaucoma . abnormal blood pressure variability suggests disturbed autonomic regulation in patients with glaucoma ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the yeast gene order browser ( ygob ) has been developed to take advantage of the potential the hemiascomycete yeasts offer for studying many aspects of genome evolution , including in particular the whole - genome duplication ( wgd ) event we proposed in 1997 ( 1 ) as having occurred in an ancestor of saccharomyces cerevisiae , and which was conclusively confirmed in 2004 ( 24 ) . ygob version 1.0 features seven genomes : three from lineages that separated after the wgd [ post - wgd species : s.cerevisiae ( 5 ) , saccharomyces castellii ( 6 ) and candida glabrata ( 4 ) ] , and four from outgroups [ pre - wgd species : ashbya gossypii ( 3 ) , kluyveromyces lactis ( 4 ) , kluyveromyces waltii ( 2 ) and saccharomyces kluyveri ( 6 ) ] . the phylogenetic relationship among these species and the position of the wgd eventygob consists of a curated database of homology assignments across these genomes , an intuitive and interactive online interface and software that accurately assesses and displays gene order ( synteny ) . ygob is publicly available online ( ) and is being used by our laboratory for a number of research projects . we believe it will be of similar utility to yeast researchers in general , and of interest to evolutionary biologists as a pioneering comparative genomics tool . the algorithms involved in accurately assigning synteny and aligning chromosomal fragments , information on the curation of the genomic data and research carried out using ygob are presented in detail elsewhere ( 7 ) . the tracks are labeled at right and show from top to bottom : the a tracks of the three post - wgd species , the four single - track pre - wgd species and the b tracks of the post - wgd species . genes are represented by boxes stating the gene name , chromosome or scaffold name , and species name ( except for s.cerevisiae , where systematic and genetic names are both shown instead ) . each genome has a color palette that is used to distinguish genes from different chromosomes or contigs ; for example , the three differently colored s.kluyveri contigs in figure 1b . genes without synteny are colored gray , for example the s.kluyveri gene 950.1 in the column markedthe in - focus gene , which was used to compose the entire display , is highlighted by an orange border . connectors join nearby genes : solid connectors join adjacent genes , two small bars connect genes 5 genes apart , and one small bar connects genes 20 genes apart . these connectors are usually colored black , but are highlighted in orange if they denote an inversion . when there is an intervening space between genes , for example in the post - wgd tracks in figure 1b , then the connectors are extended in gray over that space . the end of a chromosome or contig is denoted by a brace ( e.g. s.kluyveri contigs in figure 1b ) . the arrows under a gene box denote its relative transcriptional orientation . whether a rightwards arrow corresponds to a watson orfor this reason , no orientation arrow is shown below genes without synteny ( i.e. those colored gray ) . the online interface is a perl ( ) application with the visual output created using the gd package ( ) . some advanced aspects of the control console ( discussed below ) , but none of the features in the main visual interface , require users to have javascript enabled in their web browser . the user can click on any other gene in the display ( figure 1b ) to refocus the browser on it . this allows users to walk along chromosomes by repeatedly refocusing on genes at the edge of the display ; these effectively serve asbrowsing a genomic region when focused on a pre - wgd genome often gives the best view of genes ' syntenic context . ygob 's display of homology information in the syntenic context of many genomes makes features such as annotation problems , fast evolving loci , species - specific genes , gene clusters , chromosomal rearrangements , ohnologs ( paralogs arising from a wgd , e.g. column a in figure 1b ) , or cases of differential gene loss ( e.g. column c in figure 1b ) immediately apparent . a number of these features , in particular the patterns of gene loss , have been examined by us elsewhere ( 7 ) . the control console , which is at the bottom of ygob 's web interface ( figure 1b ) , allows a user to select several parameters : which genomes to display ; the window size ( between 4 and 50 columns can be shown on each side of the in - focus gene 's column ) ; and which gene to focus the display on . a new in - focusgene can be chosen by typing its name into the text box , as an alternative to clicking on one of the genes currently on screen . the control console includes buttons that allow a user to invert the whole display output ( twist ) or to swap the a and b tracks for the post - wgd species ( flip ) . every homology pillar and gene box in the ygob visual interface ( figure 1b ) features buttons offering ready access to standard bioinformatics tools ( figure 2 ) . the s ( sequence ) button below a column clicks through to its protein sequences ( figure 2a ) . s.cerevisiae gene boxes have an i ( information ) button that clicks through to the saccharomyces genome database ( sgd ) description ( 8 ) of the protein and its gene ontology terms ( figure 2b ) . b ( blast ) button , which opens a window with blastp results for that gene 's protein against all the proteins in ygob 's database . in the pop - up window of blastp results ( figure 2c ) , gene names are highlighted in red ( seen as dark gray highlighting in figure 2c ) if they are in the same column as the query gene ; blue if they appear on screen but not in its column , and orange if they are a tandem copy of the query gene . b button is orange when the gene has a tandem repeat on screen nearby . finally , where there are 3 genes in a column , the t ( tree ) button draws an approximate phylogenetic tree ( figure 2d ) , generated on the fly using a t - coffee alignment ( 9 ) and phylip 's neighbor - joining program , rooted with pre - wgd species if possible . rolling the computer mouse over a gene 's box will also display brief information for that gene , for example from sgd title lines in the case of s.cerevisiae , and genbank annotation tags for other genomes . clicking the button displays the same ygob data in a tabulated text format , showing each track as a column and each pillar as a row . this allows a user to easily retrieve the raw syntenic context information around a gene or region of interest . the ygob website also hosts interactive lists of loci classed by syntenic locus type , allowing researchers to quickly acquire lists of genes / loci from particular classes or alternatively to browse through these lists online ( e.g. a list of all loci that are single copy in s.cerevisiae but retained in duplicate in c.glabrata and s.castellii can be retrieved ) . in addition to this the website features lists of genes from locus classes further subdivided by gene ontology ( ) terms whereas interactive diagrams show the physical distribution of all locus classes over the three pre - wgd species . the ygob database consists of a set of extensively curated homology assignments across the seven yeast genomes currently included . the use of syntenic information in assigning homology means these pillars are virtually free from the demonstrated limitations of blast . the ygob online interface ( ) provides browsing access to this database via an interface that is intuitive to use , with ready access to various bioinformatics utilities . ygob has been primarily designed to facilitate the use of gene order in the study of polyploid genomes and post - polyploid evolution , but by showing genes and homology in an accurate syntenic context , ygob makes the characteristics of genomic regions or loci of interest immediately apparent . the success of this contextual syntenic approach in polyploid yeasts encourages us to extend it to other groups of species for which there is sufficient genomic data . ( a ) approximate phylogenetic relationship of the yeasts included in ygob , with the wgd event marked as a closed circle . ( b ) ygob screenshot focused on the a.gossypii gene agl112c with a window size of 6 . is the control console , which allows users to select the window size and the gene to focus on . each box in the display represents a gene , and each color , a chromosome . the b buttons open a window with blastp results against ygob 's database , t buttons draw approximate phylogenetic trees and + buttons output ygob data in a tabulated text format . ygob bioinformatics utilities screenshots for the homology pillar containing the s.cerevisiae gene ref2 , and labeled c in figure 1b . clockwise from top left : ( a ) protein sequences for the pillar ; ( b ) sgd and gene ontology information for ref2 ; ( c ) blastp results for ref2 against the ygob database ; and ( d ) approximate phylogenetic tree for genes in the pillar .\noutput:\n" }, { "from": "agent", "value": "the yeast gene order browser ( ygob ) is an online tool designed to facilitate the comparative genomic visualization and appraisal of synteny within and between the genomes of seven hemiascomycete yeast species . three of these genomes are polyploid , and hence contain intra - genomic syntenic regions , the correct assembly of which is a particular success of ygob . designed to accurately assemble , display and score gene order relationships , ygob is both an interactive tool for browsing genomic data , and a software engine now being used for evolutionary analyses on a whole - genome scale . underlying the online interface is the ygob database , which consists of homology assignments across the species , extensively curated based on sequence similarity and novelly , an appraisal of genomic context ( synteny ) in multiple genomes . currently the ygob database incorporates genome data from saccharomyces cerevisiae , candida glabrata , saccharomyces castellii , ashbya gossypii , kluyveromyces lactis , kluyveromyces waltii and saccharomyces kluyveri , but the system is scaleable to accommodate additional genomes . this paper discusses the usage and utility of version 1.0 of ygob , which is publicly available at ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: honey is one of the oldest known medicines and its use has been rediscovered in later times by the medical profession , especially for dressing wounds . it has been reported from various clinical studies on the usages of honey as a dressing for infected wounds that the wound become sterile in 3 - 6 days , others have also reported that the honey is effective in cleaning up infected wound . , - honey is considered to positively affect all three primitive imbalance of the body . charak and sushruta applied honey dressing for sores . in the third century , greek philosopher celsus used mixes honey and bran to treat burn . dry socket or alveolar osteitis is one of the most common post - operative complications following the extraction of permanent teeth . it is a condition in which there is a loss of clot from the socket clinically post - operative discomfort can range from simple local inflammation to classic alveolar osteitis including halitosis regional trismus dull thrombing pain irradiating from empty socket , normally to ipsilateral ear , temporal region or eye . it is believed to be multi factorial in origin and these are some commonly etiological aggravating and precipitating factors . oral microorganism , trauma during surgery , roots and bone fragments remaining in the cavity , excessive curettage and irrigation , dislodgement of blood clot , oral contraceptives and smoking are the some of the important factors . there are various treatment modalities used for management of dry socket like bland obtundant dressing , pain reducing dressing such as zinc oxide euginol dressing , anti - infective agents , systemic or local , antifibrinolytic agent , surgical intervention to remove necrotic clot and encourage the formation of blood clot . a total of 54 patients of dry socket were selected from the out - patient department of oral and maxillofacial surgery . patients with systemic illness like diabetes , pregnant and lactating female were not included in the study . this study was under taken to evaluate the effect of honey dressing in management of dry socket [ tables 16 ] . associated clinical symptoms days of onset of symptoms resolution of symptoms all the 54 patients had pain and necrotic slough and 18 patients had halitosis . in 41 patients symptoms developed at 3symptoms - resolutions of symptoms in 30 patients all the symptoms subsided at 5 day in other 16 , patient on 6 day and in 3 patients on 8 day after extraction [ figures 13 ] . clinical image of dry socket after 1 dressing clinical imageafter 2 dressing c - reactive protein ( crp ) reduced significantly at post - operative . the crp levels are often elevated in patients with odontogenic infection and post - operative complications . it is a cytokine induced acute phase protein that increases in concentration as a result of inflammation . in our study , crp reduced significantly at post - operative . no adverse effect have been reported in the present study , honey has been used topically on wound over thousands of years without any adverse effect . allergy to honey is rare but there could be an allergic reaction to either the pollen or the bee protein in the honey . honey gives a fast rate of tissue regeneration and suppression of inflammation , edema exudation and malodor in the wounds . honey can be expected to have a direct nutrient effect on regenerating tissues because it contains a wide range of amino acids , vitamins and trace elements in addition to large quantities of readily assimilable sugars . honey has an effective antibacterial potential to combat oral pathogens and hold promises for the treatment of periodontal diseases and mouth ulcers . honey was used to treat infected wounds as long ago as 2000 years before bacteria was discovered to be cause of infection . honey has been reported to have an inhibitory effect to around 60 species of bacteria including aerobes and anaerobes . gram - positive and gram negative microorganisms . the antibacterial property of honey was first recognized in 1892 by van ketel .8 % ( v / v ) indicating that the honey has sufficient antibacterial potency to stop bacterial growth if diluted at least 9 times due to its hygroscopic properties , its acidic ph and hydrogen peroxide . the major antibacterial activity in honey has been found to be due to hydrogen peroxide produced enzymatically in the honey . phytochemical factors it has enzyme and tissue nutrition material and vitamins that help repair tissue directly . the proliferation of peripheral blood b lymphocytes and t lymphocytes in cell culture is stimulated by honey at concentration as low as 0.1 % . it all so stimulates monocytes in cell culture to release cytokines tumor necrosis factors - , interleukin - 1 ( il - 1 ) and il - 6 which activate the immune response to infection . the honey is saturated or supersaturated solution of the sugar 84 % being the mixture of fructose or sucrose the water content is usually 15 - 21 % by weight . the strong interaction of these molecules with water molecules leaves very few of the water molecules available for microorganisms . this free water is what is measured as water activity ( aw ) : m0 ean value for the honey have been reported from 0.562 to 0.62 . many species of bacteria have their growth completely inhibited if ( aw ) is in the range of 094 - 0.99 . acidity - it is quite acidic its ph is from 3.2 to 4.5 , low enough to be inhibitory for many pathogens . the major antibacterial activity in honey has been found to be due to hydrogen peroxide enzymatically in the honey . the glucose oxide enzyme is secreted from the hypo pharyngeal gland of the bee in to the nectar to assist in the formation of honey from the nectar . the hydrogen peroxide produced would be the effect as a sterilizing agent only during ripening of the honey . full strength honey has a negligible level of hydrogen peroxide because this substance is short lived in the presence of transition metal ions and ascorbic acid in the honey which catalyzes its decomposition to water and oxygen . on dilution of honeythe activity increases by a factor of 2500 - 50,000 thus giving a slow release antiseptic at a level which is antibacterial but not tissue damaging . all the antibacterial activity does not account for peroxide generating system it shows that there must be an additional antibacterial factor involved . several chemicals with antibacterial activity has been identified in the honey by various researches , pinocembrin , terpenes , benzyol alcohol , 3,5 - dimethoxy -4-hrdroxy benzoic acid , methyl 3,5 - dimothoxy 4 - hydroxy benzoiate , 3,45 trimethoxy benzoic acid , 2 hydroxy , 3 phenyl propoinic acid , 2 hydrobenzioc acid and 1,4 dihrdroxy benzene . it appears that the honey from certain plants has better antibacterial properties than from others but there are no sufficient evidence . it has been reported from various clinical studies on the uses of honey as dressing for the infected wounds that the wounds become sterile in 3 - 6 days and other reported that honey is effective in cleaning up infective wounds . it has also been found to act as a barrier preventing wounds from becoming infected , preventing cross infection and allowing burn wound to heal rapidly . it all so reduces inflammation , reduced hyperemia , edema , exudation and soothing effect when applied to wounds . hence its physical properties provide a protective barrier , by osmosis , create moist healing environment , in the form of the solution , not to stick underlying tissue . the antibacterial properties of honey prevents bacterial colonization , of the moist environment and no impairment of the healing process through adverse effect on wound tissue to the contrary it appears to have a stimulatory effect on tissue regeneration . there are clean indication of anti - inflammatory action , so this can be used as a therapeutic agent for the dry socket . the honey is saturated or supersaturated solution of the sugar 84 % being the mixture of fructose or sucrose the water content is usually 15 - 21 % by weight . the strong interaction of these molecules with water molecules leaves very few of the water molecules available for microorganisms . this free water is what is measured as water activity ( aw ) : m0 ean value for the honey have been reported from 0.562 to 0.62 . many species of bacteria have their growth completely inhibited if ( aw ) is in the range of 094 - 0.99 . acidity - it is quite acidic its ph is from 3.2 to 4.5 , low enough to be inhibitory for many pathogens . the major antibacterial activity in honey has been found to be due to hydrogen peroxide enzymatically in the honey . the glucose oxide enzyme is secreted from the hypo pharyngeal gland of the bee in to the nectar to assist in the formation of honey from the nectar . the hydrogen peroxide produced would be the effect as a sterilizing agent only during ripening of the honey . full strength honey has a negligible level of hydrogen peroxide because this substance is short lived in the presence of transition metal ions and ascorbic acid in the honey which catalyzes its decomposition to water and oxygen . on dilution of honeythe activity increases by a factor of 2500 - 50,000 thus giving a slow release antiseptic at a level which is antibacterial but not tissue damaging . all the antibacterial activity does not account for peroxide generating system it shows that there must be an additional antibacterial factor involved . several chemicals with antibacterial activity has been identified in the honey by various researches , pinocembrin , terpenes , benzyol alcohol , 3,5 - dimethoxy -4-hrdroxy benzoic acid , methyl 3,5 - dimothoxy 4 - hydroxy benzoiate , 3,45 trimethoxy benzoic acid , 2 hydroxy , 3 phenyl propoinic acid , 2 hydrobenzioc acid and 1,4 dihrdroxy benzene . it appears that the honey from certain plants has better antibacterial properties than from others but there are no sufficient evidence . it has been reported from various clinical studies on the uses of honey as dressing for the infected wounds that the wounds become sterile in 3 - 6 days and other reported that honey is effective in cleaning up infective wounds . it has also been found to act as a barrier preventing wounds from becoming infected , preventing cross infection and allowing burn wound to heal rapidly . it all so reduces inflammation , reduced hyperemia , edema , exudation and soothing effect when applied to wounds . hence its physical properties provide a protective barrier , by osmosis , create moist healing environment , in the form of the solution , not to stick underlying tissue . the antibacterial properties of honey prevents bacterial colonization , of the moist environment and no impairment of the healing process through adverse effect on wound tissue to the contrary it appears to have a stimulatory effect on tissue regeneration . there are clean indication of anti - inflammatory action , so this can be used as a therapeutic agent for the dry socket .\noutput:\n" }, { "from": "agent", "value": "background : honey is one of the oldest known medicines . its use has been rediscovered in later times by the medical profession , especially for dressing wounds . it has been reported from various clinical studies on the usages of honey as a dressing for infected wounds that the wound become sterile in 3 - 6 days , others have al so reported that the honey is effective in cleaning up infected wound.materials and methods : the 54 patients of dry socket were selected from the from the outpatient department of oral and maxillofacial surgery . a diagnosis of dry socket was made clinically . this study was under taken to evaluate the effect of honey dressing in management of dry socket.results : in this study there was significant reduction if inflammation , hyperemia , edema and exudation after honey dressing that results in soothing effect and reduction in pain and discomfort . there was al so significant reduction in crp level post operative days . there was side effect of honey was observed in our study , so it can be used as alternative for the management of dry socket.discussion : it has al so been reported that the honey dressing halt advancing necrosis . it has al so been found to act as barrier preventing wounds from becoming infected , preventing cross infection , and allowing burn wound to heal rapidly.conclusions : there are no side effects of honey . excess use of euginol , can lead to necrosis of bone . the honey can be used as medicament for the management of dry socket ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: schwannoma are tumors arising from the embryonic neural crest cells of the nerve sheaths of peripheral and cranial nerves . about 25 % of the schwannoma occur in the head and neck region involving cranial nerves and sympathetic chain ; however , brachial plexus schwannoma are uncommon . degenerative changes such as hemorrhage , calcification , and fibrosis are commonly seen in the schwannoma , but cystic changes are rare . to the best of our knowledge , we report here , the first case of it diagnosed by the histopathological examination and confirmed with immunohistochemistry ( ihc ) . a 40 - year - old female presented to orthopedics - out - patient department with complaints of shoulder pain for 6 months and treated for cervical spondylitis , shoulder arthritis and given short wave diathermy and physiotherapy . in due course of treatment , she noticed an axillary mass , which increased gradually and further referred to surgery out - patient department for further management . local examination revealed a 64 cm oval tender , firm , mobile mass in the left axilla deeper to pectoralis major muscle . a provisional diagnosis of peripheral nerve sheath tumor was made and the case was subjected for fine needle aspiration cytology ( fnac ) . the size of the swelling markedly reduced after aspiration and no residual lump was palpated . the cytological diagnosis of benign cystic lesion possibly lymphatic cyst was made and the case was asked for biopsy . a well - defined , oval shaped , hyperintense cystic lesion , of 6.64.8 cm in anterolateral compartment of arm was noted [ figure 1 ] . the lesion was parallel to long axis of neurovascular bundle predominantly in subcutaneous plane with an extension into the inter - muscular plane . the case underwent surgery and the excised mass was sent for the histopathological examination . magnetic resonance imaging scan showing hyperintense cystic lesion gross examination revealed a cystic mass measuring 6.54.52 cm . cut section revealed uniloculated cyst filled with gelatinous material and the inner lining of the wall was smooth [ figure 2 ] . hypercellular areas show spindle shaped cells having wavy nuclei arranged in fascicles with focal palisading of nuclei [ figure 3 ] . hypocellular areas showed large number of foamy macrophages and loose myxoid stroma [ figure 4 ] . there was mild nuclear pleomorphism , but no mitotic activity was noted . on ihc tumor cells showed diffuse cytoplasmic positivity for s - 100 protein [ figure 5 ] andwas negative for ki67 [ figure 6 ] ; confirming the diagnosis of schwannoma . cut surface of the tumor showing cystic degeneration section showing hypocellular and hypercellular area ( h and e , 400 ) histological findings showing sheets of foamy macrophages ( h and e , 400 ) immunohistochemistry pictures showing cytoplasmic s - 100 positivity ( ihc , s - 100 , 100 ) immunohistochemistry ( ihc ) showing ki67 negativity ( ihc , ki67 , 100 ) schwannoma is a slow growing , solitary , firm , well - circumscribed and encapsulated round or ovoid tumors . the common sites include the head and neck , the flexor surfaces of the upper and lower extremities , the posterior mediastinum in the thorax and on the trunk . any part of the body can be affected mainly head and neck region , but localization in the axilla is very unusual . ancient schwannoma was initially mentioned by ackerman and taylor as a degenerative change occurring in a long standing schwannoma , was characterized by nuclear hyperchromasia , mild nuclear pleomorphism , stromal edema , fibrosis , and xanthomatous changes leading to a misdiagnosis of malignancy in the aspirates . grossly , schwannoma are usually solitary , well - circumscribed , firm , smooth surfaced tumors . as extracranial schwannoma are usually large , these tumors manifest with secondary degenerative changes due to the long duration resulting in waxing and waning of the tumor size . ( antoni type a ) and loose , hypocellular myxoid areas with microcystic spaces ( antoni type b ) . degenerative changes such as hemorrhage , calcification , and fibrosis are commonly seen in schwannoma , but cystic changes are rare . degeneration is due to central tumor necrosis as the schwannoma grows to a size beyond the capacity of its blood supply . such tumors have been reported in the orbital region , tentorial hiatus , posterior cavernous sinus , and retroperitonium . schwannoma with the cystic degeneration arising from the brachial plexus has been reported by chen et al . , but they found the focal solid area and the present case showed purely cystic tumor and did not reveal any solid area . the differential diagnosis of such a large cyst in the axilla includes cystic schwannoma , ganglioma , and lymphangioma . the tumor cells show cytoplasmic positivity for s - 100 protein . the diagnosis of the present case of schwannoma was established and possibility of ganglioma and lymphangioma was ruled out by the histopathological examination and ihc . to conclude , schwannoma with extensive cystic degeneration should be considered as rare differential diagnosis of cystic lesion of the axilla . the histopathological examination remains the mainstay of differentiation as radio - imaging and fnac features can be indistinguishable .\noutput:\n" }, { "from": "agent", "value": "schwannoma affect mainly head , neck , and flexor aspect of the limbs . neurogenic tumors arising from the brachial plexus are rare and axillary schwannoma is extremely uncommon . cystic degeneration is common in longstanding cases and which when aspirated may yield only macrophages or lymphocytes leading to false diagnosis of the case in spite of strong clinical suspicion . we report one such rare case of a solitary axillary schwannoma with extensive cystic degeneration , which was misdiagnosed on fine needle aspiration cytology and subsequently confirmed by the histopathological examination and immunohistochemistry ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the earliest investigations into conformity were carried out by social psychologists during the twentieth century and were focused very much on its causation ; that is , on the social contexts that elicited it ( jenness , 1932 ; sherif , 1935 ; asch , 1955 ) . in an extremely influential paper , solomon asch ( asch , 1955 ) described the observation that adults would willingly abandon their own perceptual judgment in a very simple visual task when faced with a group of confederates who disagreed with them . asch termed this behavior conformity , supposing the deference to the group norm to be driven by a desire to receive social approval . such a finding has been replicated a huge number of times across age groups and cultures and a large number of factors that influence whether or not individuals conform have been identified including group size ( asch , 1955 ; bond , 2005 ) , task difficulty and importance ( baron et al . , 1996 ) , culture ( bond and smith , 1996 ) motivation ( griskevicius et al . , 2006 ) , and mood ( tong et al . , 2008 ) . whilst social psychology , replete with empirical data , has successfully identified many factors influencing when individuals adopt the decisions of others , it has struggled to unify such findings into a single theoretical framework . perhaps the most successful attempt is social impact theory ( latane , 1981 ; latane and wolf , 1981 ; nowak et al . , 1990 ) , which characterizes social influence as a force , analogous to a physical force such as electro - magnetism , that acts on an individual . factors proposed to influence the magnitude of this force are its strength ( determined by factors such as the age and status of the source ) , immediacy , ( proximity in space - time to the observer ) , and the number of people in the group to which the observer is exposed . social impact theory can effectively explain the diminishing effect of increasing the number of confederates in the asch experiments ( latane , 1981 ) , and was also extended to cases where a majority conflicted with a minority ( latane and wolf , 1981 ) . however , its variables of strength and immediacy precisely that which distinguished it from other models ( e.g. , tanford and penrod , 1984 ) came up against conflicting empirical findings and where effects were found they were typically of a very low magnitude ( mullen , 1985 , 1986 ; jackson , 1986 ) . furthermore , these theories were largely based on studies involving the adoption of arbitrary or bizarre group decisions and so their ability to understand social influence more generally , particularly in the context of evolution , is limited . accordingly , the ambitions of theories of social influence from social psychology , although valuable contributions to the study of social learning , were never fully realized . nonetheless , social influence theories were very successful in accounting for group size effects . moreover , social psychology is also the source of a valuable distinction between informational and normative motivations for conforming to a group norm ( deutsch and gerard , 1955 ) . this distinction came about as researchers attempted to understand why their subjects were conforming to clearly incorrect decisions . they argued for two goals on the part of the subject , one to be correct , but a second to earn positive appraisal from others through agreement . the former is an informational goal , the latter a normative goal . as the simplicity of the task in the asch experiments seems to preclude an informational goal , it has been argued that the subjects were conforming in order to achieve a normative reward , received by being in agreement with your group mates . surprisingly given this , deutsch and gerard ( 1955 ) found that some subjects would still choose the clearly incorrect answer even when they made their decision in the absence of confederates . they took this to mean that the confederates were also exerting some informational influence and that the subjects may really have believed the group decisions . an alternative explanation is that , even when apparently isolated , individuals may find normative tendencies hard to resist . starting in the 1970s , a group of theoretical evolutionary biologists began to investigate culture and the social transmission of information using mathematical evolutionary models ( cavalli - sforza and feldman , 1981 ; lumsden and wilson , 1981 ; boyd and richerson , 1985 ) . central to this approach was setting the use of social information in an evolutionary context ( that is , considering its function and evolutionary history , in terms of tinbergen s questions ) and attempting to understand when and how individuals should come to rely on social transmission to maximize their fitness . individuals were predicted to be equipped with a wide range of cultural transmission biases that dictate when they copy others and who they copy ( boyd and richerson , 1985 ; feldman et al . , 1996 ; henrich and boyd , 1998 ; schlag , 1998 , 1999 ; henrich and gil - white , 2001 ; henrich and mcelreath , 2003 ; laland , 2004 ; enquist et al . , 2007 ; wakano and aoki , 2007 ; kendal et al . , 2009 ) . cultural evolutionists used the term conformity to describe a particular learning rule by which an individual was disproportionately likely to adopt the majority decision ( see boyd and richerson , 1985 , p. 206 , see figure 1 ) . mathematical models established that conforming is an effective strategy in a spatially variable environment with migration between subpopulations , because it helps individuals to home in on the locally adaptive behavior ( boyd and richerson , 1985 ; henrich and boyd , 1998 ; nakahashi et al . , forthcoming ) . in this respect , the cultural evolutionist notion of conformity fits well with an informational notion of conformity people are expected to conform because it leads them to acquire valuable fitness - enhancing information . nonetheless , the evolution of this tendency to conform could also plausibly explain the existence of normative conformity ( boyd and richerson , 1985 ; richerson and boyd , 2005 ) . moreover , different groups can conform to different variants under the action of a conformist bias , with the potential to explain the combination of stable intergroup heterogeneity and intragroup homogeneity seen in human populations , and potentially promote cultural group selection ( boyd and richerson , 1985 ; richerson and boyd , 2005 ; kendal et al . , 2009 ) . conformity ( the dashed line ) is just one of several learning rules that result in increasingly likely adoption of a trait as it increases in frequency , however , it is unique as the tendency toward the most popular trait is disproportionate given its frequency . a proportionate tendency , equivalent to random copying ( solid line ) , results in a probability of adoption equal to trait frequency , whereas anti - conformity ( dotted line ) resists the most popular choice and has the opposite population consequences to conformity . . however , theoretical analyses have found conflicting results when investigating the adaptive value of a conformist response to social information . for example , some models have found that conformity evolves alongside less discriminate social learning and fares well even in the face of a spatially and temporally variable environment ( boyd and richerson , 1985 ; henrich and boyd , 1998 ) . however , these models have been criticized as they assume that individuals have access to all behavioral variants at all times and merely have to choose the correct option . the critics claim that when this assumption is relaxed conformity suffers ( eriksson et al . , 2007 ) . however , eriksson et al. s models could be argued to be no more realistic than boyd , richerson , henrich et al. s , as here each incidence of environmental change means an entirely new behavior must be developed from scratch . equally important is the extent of spatial and temporal variation , since the former promotes reliance on conformity while the latter selects against it ( hoppitt et al . , 2010thus the extent to which conformity is expected to be adaptive is contested , but the evidence from theoretical models on balance leads us to expect a broad range of conditions under which it will be utilized . the huge amount of empirical data from social psychology might be thought to clarify this issue , as researchers could empirically determine whether , and under what circumstances , human subjects displayed a conformist tendency . firstly , although a conformist would be expected to behave like subjects in the asch experimental paradigm , such experiments are unable to distinguish between multiple possible learning rules that posit a positive relationship between trait popularity and probability of trait adoption . for example , as depicted in figure 1 , conformity , anti - conformity , and random copying all result in more popular traits being more likely to be adopted than less popular traits ( boyd and richerson , 1985 ) , yet amongst these only conformity would lead to the homogenization of group behavior ; anti - conformity erodes any group preferences whilst random copying does not act to change trait frequencies . secondly , a disproportionate tendency to adopt the majority behavior is only expected in cases where the observing individual is naive ( boyd and richerson , 1985 ) . this means that the asch paradigm is unsuitable to investigate conformity in the context of cultural evolution as the simplicity of the tasks used meant that the subjects were far from naive when listening to the decisions of the confederates . instead , asocial information must be controlled for , either experimentally , by using a design such that subjects genuinely are in a state of naivety , or statistically , such that a measure of asocial information is taken and can be used in analyses to separate the effects of asocial and social information . given this , empirically minded cultural evolutionists have carried out further studies to investigate the nature of the response to variant frequency . before considering experiments with human subjects it is well worth noting that social learning researchers have carried out a great deal of work with other animals looking for conformist learning . this provides further insights into the third of tinbergen s questions , evolutionary history , as through a consideration of the current taxonomic distribution of conformity researchers are potentially able to infer the most likely evolutionary history of the trait . in fact , evidence in line with conformity exists in a wide range of taxa including fish ( day , 2001 ; pike and laland , 2010 ) , rats ( konopasky and telegdy , 1977 ; galef and whiskin , 2008 ) , monkeys ( dindo et al . , 2009 ) , and great apes ( whiten et al . , 2005 ) , although in the latter case the claim for conformity rests on a more normative notion . it should be noted , however , that the methods employed in these studies , as in the asch experiment , are typically not sufficient to rule out other forms of social learning that involve a positive relationship between trait popularity and the likelihood of its adoption . the only study of which we are aware that provides clear evidence of non - human animals exhibiting a disproportionate tendency to adopt the majority behavior is pike and laland s ( 2010 ) investigation of public information use in sticklebacks . given the taxonomic distance between fish and humans , this finding is most likely to reflect convergent selection for conformity rather than a homologous capability ( laland et al . , ( 2011b ) . thus , although intriguing , more detailed experimental work is required to understand both the evolutionary history of the human capability for conformity , and its phylogenetic distribution . concerning humans , however , there have been several experiments with the required precision to distinguish a disproportionate tendency to adopt the majority decision from other rules that lack the same population level consequences . ( 2008 ) carried out an experiment in which subjects chose between two technologies . the subjects knew the alternative technologies had different expected payoffs , but did not know which was the better technology . half the subjects were asocial learners and were given feedback concerning the payoffs of their decisions , the other subjects were social learners and were only given information on the decisions of the asocial learners . although conformity was found to be an effective strategy for the social learners , efferson et al . found that only the behavior of some subjects in the social learning condition , those that self - defined as conformist , could be well explained with a conformist model , whilst the behavior of the other subjects , who did not describe their behavior as conformist , could not . characterize this difference in terms of a mixed population of conformists and mavericks , the latter representing individuals typically reliant on asocial information . there was considerable individual - level variation within the conformist and maverick groups , suggesting that a dichotomy of types would not be an appropriate interpretation rather , individuals vary in the extent to which they utilize social information and / or tend to conform . a further experiment ( mcelreath et al . , 2005 ) also used a design where subjects were required to choose between two technologies , and once again subject differences were found in the use of social information . furthermore , although subjects did sometimes show a conformist response , they did not do so when the environment was stable , a result at odds with theory that suggests environmental stability is the ideal scenario for conformity to do well ( henrich and boyd , 1998 ) . ( 2010 ) found that subjects track variant popularity over time and in effect anticipate a future majority choice by favoring variants that show increasing popularity . this makes sense in the context of possible environmental change and such behavior may allow individuals rapidly to take advantage of emerging technologies and overcome the cultural inertia that conformity imposes . following these conflicting findings , studies are now turning to the idea of flexible conformity and attempting to identify factors that influence whether or not , and under what circumstances , subject behavior is conformist . to this endwe carried out a study ( morgan et al . , 2011 ) in which subjects were required to decide whether a pair of 3d shapes were the same shape seen from different angles or different shapes entirely ( cf . over multiple trials , subjects were initially allowed to attempt the task themselves and were asked to make a decision and rate their confidence in their decision . they were then shown the decisions of a group of previous subjects who had been faced with the same shape pair ( the number of demonstrators was either 4 , 8 , or 12 , one trial per subject involved no social information ) and were again asked to make a decision and rate their confidence in it . crucially , this design recorded subjects decisions and confidence both before and after receiving social information , allowing us to separate the social and asocial information in the subjects decision making . we found that subjects were disproportionately likely to adopt the social majority decision only when the number of demonstrators was high and subjects were uncertain in their own abilities ( see figure 2 ) . further analyses examined the effect of social information in isolation and identified a general conformist response underlying subject decision making ( see figure 2 ) . the effect of the popularity of the modal choice interacted with the size of the group of demonstrators , however , with increasing group size corresponding to an increasingly disproportionate response to popularity . this is in concordance with theory that shows that the information provided by a majority of a given size hinges on the size of the overall population ( see esm , morgan et al . , 2011 ) . accordingly , we provide evidence that there is a conformist bias underlying human decision making and that in at least some circumstances human behavior will match conformist predictions . finally , we were able to show that subjects use of social information in the experiments was adaptive in the sense that it increased their performance across the experiment , in line with the adaptive predictions of evolutionary models . ( 2011 ) found that adult human subjects were disproportionately likely to switch their decision to that favored by the majority only when they were presented with a large group of demonstrators , they were uncertain in their own abilities to solve the tasks and the majority was very large . ( b ) however , controlling for prior asocial information showed that the response of subjects to the social information in isolation was more generally conformist , as illustrated by the s - shaped curve . in this case the y - axis reflects the change to a linear predictor prior to transformation into a probability and the shape of the curve was not constrained in any way . whilst the aforementioned studies by social psychologists have made ground in isolating the social contexts that elicit conformity , this is just one aspect of the immediate causes of this behavior . a complete understanding requires some knowledge of what goes on in the brains of conforming individuals . nonetheless , recent studies investigating the neurobiology of social learning more generally have come up with several relevant findings . firstly , studies using both mental rotation tasks ( berns et al . , 2005 ) and auditory tasks ( berns et al . , 2010 ) have found that social information affected neural activity in the relatively low level processing areas associated with each task , in addition to areas distinct from these perceptual decision making circuits , suggesting that the social information was affecting the perception of the subjects as well as their decision making , a possibility raised by asch in the interpretation of his findings ( asch , 1955 ) . in addition to this , ventral striatum activity in a music choice task ( campbell - meiklejohn et al . , 2010 ) suggests that the social information was directly affecting the perceived value of different songs . these findings are consistent with the idea that social and asocial sources of information are integrated starting at early stages of processing , however , the low temporal resolution of fmri limits the strength of such a conclusion . finally , mason et al . ( 2009 ) exposed subjects to symbols that received positive , negative , or no social labeling . exposure to a socially marked symbol resulted in activity in the medial prefrontal cortex , irrespective of whether it was positively or negatively marked , whilst activity in the caudate coded the valence of the social marking . these findings suggest that it is through the integration of activity in these two areas that individuals distinguish between positively and negatively socially marked stimuli . for subjects to be employing a conformist learning bias we would predict there to be parts of the brain that evaluate levels of consensus amongst demonstrators . whilst no data exists for studies using sufficiently large groups of demonstrators with varying levels of consensus , the music choice experiment ( campbell - meiklejohn et al . , 2010 ) found that along with activity in the insula cortex and right tempoparietal junction , areas associated with monitoring the decisions of others , anterior insula activity increased when the two expert reviewers were in agreement . although this is suggestive of a consensus evaluating mechanism it should be noted that with a group of only two demonstrators the social information was either in unanimity or in total disagreement , thus the anterior insula may have been responding to social information with an overall message and not the specific level of consensus itself . what is more clear , however , are changes in brain activity caused by disagreement between the subject and the demonstrators . ( 2009 ) found that disagreement between the subject and the demonstrators caused activity in several areas known to be involved with more general error and conflict processing such as the rostral cingulate zone ( botvinick et al . , 2004 ) andthus , brain areas that evaluate object value , such as the ventral striatum in the music choice task ( campbell - meiklejohn et al . , 2010 ) , also seem to play a role in rewarding the subject for being in agreement with others . furthermore the magnitude of the change in activation of these areas predicted changes in subsequent subject behavior ( klucharev et al . , 2009 ; campbell - meiklejohn et al . , 2010 ) . neurobiological experiments are doing more than explaining phenomena from other fields , however , they are also highlighting how those fields need to broaden their perspectives . for example , cultural evolution and social psychology are yet to integrate the study of normative and informational influences into a single framework ( deutsch and gerard , 1955 ) . experiments typically attempt to explain subject behavior in terms of one or the other source of influence ( e.g. , informational ; morgan et al . , 2011 ) and even posit different behavioral responses when subjects are influenced by one or the other ( campbell and fairey , 1989 ) . however , evidence from neurological studies provide evidence that the two processes may be unavoidably intertwined .2005 ) found increased activity when subjects disagreed with human participants as opposed to computers , despite the fact that the task was not obviously normative in nature , although this could be a result of subjects placing more weight on human responses that those of computers . however , other studies have found activity in areas strongly suggestive of a normative response , including the amygdala , an area associated with emotional load , suggesting that subjects found their being in disagreement with others stressful ( klucharev et al . , 2009 ) . potentially suggesting otherwise , a study into the social modification of memory ( edelson et al . , 2011 ) in which subjects were asked questions about a video they had watched several weeks earlier , both before and after being given false information , found that the amygdala showed increased activity only when the information purportedly came from other individuals ( as opposed to computers ) and when the subject subsequently altered their long - term responses accordingly . that no such activity was seen when behavioral adjustments were temporary suggests the activity was related to memory modification and so an emotional load may not have been involved , however , the activity was only seen when the information came from humans indicative of a normative aspect . a further study ( berns et al . ,2010 ) found similar activity in the insula , an area associated with anxiety and ostracism , whilst another ( campbell - meiklejohn et al . , 2010 ) found activity in the lateral prefrontal cortex , an area linked with reputation management , this activity also predicted subsequent behavioral adjustments to the group norm . the similarities between the response to human and computer decisions could be interpreted as subjects anthropomorphizing the computers , or alternatively treating human demonstrators as machines . such findings imply that if researchers are to understand social information use , including conformity , at the behavioral level it may be insufficient to consider it in light of either informational or normative influence in isolation as they may not be distinct processes at the neural level . a more complete theory of social decision making may need to include both , with variable payoffs associated with getting the correct answer and fitting in with group mates . experiments where both are included and their relative strengths manipulated could help our understanding of how the two interact . from this perspective , social decision making involves a maximization of reward taking into account the information provided by others on the group norm and the level consensus behind it , the expected cost of deviating from such a consensus , the individual s own information concerning the task , the information provided by others concerning the task , and the expected cost of making an incorrect decision . to proceed with our understanding of social decision makingit may be necessary to combine the above elements into a single theoretical framework and to stop thinking of behavior in terms of either normative and social influences . the fourth of tinbergen s questions , ontogeny , is one area that the study of conformity has left relatively untouched . researchers have tended to assume that any conformist bias is an evolved predisposition , and have not generally sought to investigate how its expression changes during the lifetime of an individual . the study of trust in developmental psychology ( harris , 2007 ; harris and corriveau , 2011 ) however , is of clear relevance to this topic . young children have been shown to be remarkably sensitive to a range of factors when deciding how to use social information and although work has generally focused on reliability ( koenig and harris , 2005 , 2007 ; fusaro and harris , 2008 ; corriveau and harris , 2009 ) , studies have replicated the asch experiment with young children ( corriveau and harris , 2010 ) and have found a persistent bias for relying on individuals who fit in well with the child s cultural group ( corriveau et al . , 2009 ) . were such studies extended to examine the impact of different levels of consensus it would be highly illustrative with regards to the ontogeny of conformity . indeed , there is already evidence that learning rules vary over time . for example , children of different ages show a shift in sensitivity to reliability assessment that may be experientially triggered ( clement et al . , 2004 ) . there is also support for this from neurobiological experiments , for example , the dorsomedial prefrontal cortex , right middle temporal gyrus , and the right superior temporal sulcus at the temporal junction have been found to monitor the reliability of informants in a manner similar to dopaminergic activity in reward learning ( behrens et al . , 2008 ) . this implies that expected values are estimated for different sources as the subject gains feedback from their decisions . these areas are also involved in motive attribution in social tasks , suggesting that social reliability takes a multitude of distinctly social factors , such as deceit , into account ( behrens et al . , similarly , whilst activity in the anterior cingulate sulcus monitors volatility in the expected reward value of non - social decisions , the anterior cingulate gyrus monitors volatility in the expected reward value of following the advice of others ( behrens et al . , 2008 ) . these two sources were then combined in the ventromedial prefrontal cortex with the relative activity of the two streams predicting which stream best corresponds with behavior ( behrens et al . , 2008 ) . this continuous assessment of the value of social information and demonstrators implies that the ontogeny of social learning biases may be more complicated that many experimentalists have typically assumed . from the above we can see that tinbergen s four questions of history , ontogeny , function , and causation are highly instructive in identifying areas in which our understanding of conformity and social learning rules more generally needs to be developed . with large amounts of theoretical and empirical data on the topic , researchers are beginning to identify when individuals will conform , and with further careful non - human experimental work they will soon be able to understand the current taxonomic distribution of such a bias . however , recent neurobiological experiments show that a complete understanding of conformity likely requires integration across these categories . it may no longer be fruitful to view conformity in a solely normative or informational world , as the human ( and likely non - human ) brain seemingly does not separate the two . further work is required to explore how experience can affect the development of conformist learning , with clear implications for both individual differences , and the use of social information in general . whilst multiple approaches have found a range of exciting results , researchers are now at the point at which integration is required for the biological understanding of conformity . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .\noutput:\n" }, { "from": "agent", "value": "humans are characterized by an extreme dependence on culturally transmitted information and recent formal theory predicts that natural selection should favor adaptive learning strategies that facilitate effective copying and decision making . one strategy that has attracted particular attention is conformist transmission , defined as the disproportionately likely adoption of the most common variant . conformity has historically been emphasized as significant in the social psychology literature , and recently there have also been reports of conformist behavior in non - human animals . however , mathematical analyses differ in how important and widespread they expect conformity to be , and relevant experimental work is scarce , and generates findings that are both mutually contradictory and inconsistent with the predictions of the models . we review the relevant literature considering the causation , function , history , and ontogeny of conformity , and describe a computer - based experiment on human subjects that we carried out in order to resolve ambiguities . we found that only when many demonstrators were available and subjects were uncertain was subject behavior conformist . a further analysis found that the underlying response to social information alone was generally conformist . thus , our data are consistent with a conformist use of social information , but as subjects behavior is the result of both social and asocial influences , the resultant behavior may not be conformist . we end by relating these findings to an embryonic cognitive neuroscience literature that has recently begun to explore the neural bases of social learning . here conformist transmission may be a particularly useful case study , not only because there are well - defined and tractable opportunities to characterize the biological underpinnings of this form of social learning , but also because early findings imply that humans may possess specific cognitive adaptations for effective social learning ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it is also associated with lower morbidity and faster recovery . however , placement of nephrostomy tube results in distressing peritubal pain requiring administration of analgesia . inadequate analgesia can result in delayed mobilization , impaired ventilation , and prolonged hospitalization , which increases cost . tubeless pcnl can avert this problem but can be performed only in the selected patients . analgesics such as non - steroidal anti - inflammatory drugs and opioids have side effects and limiting their use in patients with potential renal problems . skin infiltration with local anesthetic has not proven very effective after pcnl ; however , infiltration of renal capsule has shown to facilitate painless insertion of nephrostomy tube . we hypothesized that peritubal infiltration from renal capsule to skin would alleviate postoperative pain after pcnl . we investigated the analgesic efficacy of peritubal infiltration of 0.25 % bupivacaine , under fluoroscopic guidance , after pcnl . a prospective randomized double blind study was conducted in 60 american society of anaesthesiology grade i - ii patients posted for pcnl surgery after informed consent and ethical committee 's approval . they were randomly divided in two equal groups , group s or study group ( 0.25 % bupivacaine infiltration ) and group c or control group ( normal saline infiltration ) , of 30 patients . all the patients were aged between 18 and 60 years with body mass index bmi less than 35 . exclusion criteria included patients requiring supracostal puncture or more than one puncture or patients having excessive intraoperative bleeding , stone size 2.5 cm , and duration of surgery 3 hours . on the day of surgery , all patients were premedicated with intravenous glycopyrolate 0.004 mg / kg and fentanyl 2.0 g / kg . analgesia in the form of opioids or nsaids was avoided during the entire procedure . at the end of the procedure but prior to extubation , a 23 - gauge spinal needle was passed along the nephrostomy tube ( 22 - 24 fr ) under fluroscopic guidance ( to confirm the direction of the needle along the nephrostomy tube ) so as to puncture the renal capsule at 6 oclock position and 12 oclock position . at each site , 10 ml of 0.25 % bupivacaine in group s and 10 ml of normal saline in group c was infiltrated along renal capsule , muscle , subcutaneous tissue , and skin . trachea was extubated with the patients in supine position and patients were transferred to postanesthesia care unit ( pacu ) . postoperative pain was assessed by visual analogue scale ( vas ) ( score between 0 and 10 ) at rest and during deep breathing and coughing ( dvas - dynamic visual analogue scale score between 0 and 10 ) by an independent observer blinded to infiltration , at 0 hours , every half hour for 2 hours , every 2 hour for 6 hours , and every 4 hour till 24 hours . in visual analogue scale , 0 means no pain and 10 means maximum untolerable pain . when the score was 4 , intravenous tramadol was given in dose of 1 mg / kg as a rescue analgesic up to 24 hours . the duration of peritubal block was taken as the time from infiltration to first demand for rescue analgesic . the total requirement of tramadol within 24 hours and any side effects such as nausea , vomiting , and sedation were observed . data are expressed as mean with 95 % confidence intervals ( cis ) for continuous variable . comparisons of continuous variables were compared using independent t - test with two tail significance . figure 1 shows the vas at rest , while figure 2 shows dvas during coughing and deep breathing . both were significantly low , i.e. , 4 in the immediate postoperative period and remained low for a prolonged period , i.e. , around 9 hours in the study group than that of the control group . the first demand of analgesia in study group was at 9.08 hours , while it was 2.66 hours in control group ( p 0.05 ) [ table 2 ] . total consumption of tramadol in study group was 119.3 mg , which was significantly lesser than in that of the control group ( 276.8 mg ) ( p 0.05 ) . the side effects such as nausea and vomiting were also less in study group than in the control group , but the difference was nonsignificant ( p 0.05 ) [ table 2 ] . mean vas pain scores at rest mean dynamic vas pain score comparison of analgesic efficacy and side - effects between two groupspain is an unpleasant sensory and emotional experience associated with the actual or potential tissue damage which can result in an increase in the sympathetic response of the body with subsequent rise in heart rate , cardiac work , oxygen consumption , and respiratory complications . it has been hypothesized that the pain after pcnl surgery , which requires insertion of nephrostomy tube , could be due to structures beyond the skin puncture site like renal capsule . placement of the nephrostomy tube is the last surgical step in pcnl and it provides hemostasis along the tract , avoids urinary extravasation , and maintain adequate drainage of the kidney . the nephrostomy tube produces local inflammatory reaction which causes the post operative pain and discomfort in pcnl . dalela et al . performed pcnl under renal capsular block by infiltrating renal capsule with 2 % lignocaine . they emphasized that most of the pain during pcnl is felt at the time of dilatation of renal capsule and parenchyma as it is richly innervated by pain conducting neurons . they placed a 16 fr nephrostomy tube under local anesthesia and kept it for 1 week . after infiltration of the tract and renal parenchyma with lignocaine , pcnl was performed later . various studies have been done to reduce the pain by reducing the size of the nephrostomy tube or performing tubeless pcnl . the tubeless approach is safe in selected patients with uncomplicated percutaneous procedure and has a low calculus burden . performed tubeless pcnl in 50 , 60 , and 37 selected patients , respectively , and concluded that tubeless pcnl reduces postoperative patient discomfort , analgesic requirement , hospital stay , and cost to the patient . a small bore ( 8 - 12 fr ) nephrostomy tube is preferred in patients in whom the incidence of stent dysuria is likely or who may require percutaneous access for subsequent calculus manipulation , while conventional large bore nephrostomy tube drainage may be reserved for procedures with a large complex calculus , significant bleeding , prolonged procedure , infected calculi , or major perforations . in our institute , it is routine pass a nephrostomy tube of 22 - 24 fr in size in all pcnl patients . desai et al . did comparative study of type of nephrostomy drainage following pcnl , i.e. , large bore ( 20 fr ) versus small bore ( 9 fr ) versus tubeless pcnl . large bore nephrostomy tube patients had significantly higher analgesic requirement ( 218 mg of diclofenac sodium ) than small bore and tubeless patients ( 140 and 88 mg of diclofenac sodium , respectively ) . pietrow et al used 10 fr and 22 fr catheter for drainage after pcnl in 30 patients . they found lower pain score in immediate postoperative period with less narcotic requirement in small drainage catheter after pcnl . the other modalities of pain relief after pcnl are subcutaneous infiltration , tract infiltration , systemic analgesics , etc . halebian et al . studied subcutaneous infiltration of 1.5 mg / kg , of 0.25 % bupivacaine in 25 patients . their results showed reduced rescue analgesia requirement but no significant difference in vas score and pain relief around nephrostomy site area after pcnl . ugras et al . assessed the effect of local anesthetic infiltration on postoperative pain status and pulmonary functions using either 0.2 % ropivacaine or saline into renal puncture site , nephrostomy tract , and skin . their results showed that the combination of ropivacaine instillation with metamizol decreased pain and analgesic use and improved peak expiratory flow more than the use of metamizol alone . studied the efficacy of the levobupivacaine infiltration to nephrostomy tract in combination with intravenous paracetamol on postoperative analgesia in patients of pcnl and concluded that levobupivacaine infiltration through the nephrostomy tract in combination with intravenous paracetamol infusion was safe and effective as an analgesia method after pcnl . we observed that infiltration of 0.25 % bupivacaine in skin , subcutaneous tissue , nephrostomy tract , and renal capsule significantly reduced vas and dvas , prolonged the time to demand analgesia , and reduced consumption of rescue analgesic for first 24 hours . our results are in accordance with the study by jonnavithula et al . except that in their study duration of block was prolonged in both control as well as study group and the total consumption of tramadol in 24 hours was also less as compared to our study . this difference was probably related to small nephrostomy tube size ( 14 - 16 fr ) used by them compared to large nephrostomy tube ( 22 - 24 fr ) used in our study . peritubal local anesthetic infiltration with bupivacaine is efficacious in providing postoperative analgesia after pcnl as judged by significant reduction in pain score at rest and on movement , prolongation of time to first demand analgesic and reduction in total analgesic requirement during first 24 hours .\noutput:\n" }, { "from": "agent", "value": "background : percutaneous nephrolithotomy is a routine endourologic procedure in patients with renal stones . although it is less painful than open surgery , good postoperative analgesia is required to alleviate pain around nephrostomy tube.materials and methods : sixty asa grade i patients , 18 to 60 years of age , of either sex were randomized to receive 20 ml of 0.25 % bupivacaine ( group s ) or 20 ml of normal saline ( group c ) through 23 - gauge spinal needle along the nephrostomy tube under fluroscopic guidance at the end of the surgery . postoperative pain score was assessed by visual and dynamic visual analog scores . when the scores were 4 , rescue analgesia was given in the form of tramadol 1 mg / kg i.v . upto maximum 400 mg in 24 hours . time to first demand analgesia and total dose of tramadol in first 24 hours was noted.results : pain scores at rest and during coughing as well as rescue analgesic requirements for first 24 hours were significantly less in the bupivacaine group than those of the control group ( p < 0.05 ) . the first request for demand analgesia was around 9 hours in group s , while in group c it was around 2.6 hours ( p < 0.05 ) . total requirement of tramadol in group s was 119.3 mg and in c group it was 276.8 mg ( p < 0.05 ) . conclusion : peritubal infiltration of 0.25 % bupivacaine is efficient in alleviating postoperative pain after pcnl ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: malnutrition is common in dialysis patients . it predicts morbidity and mortality in hemodialysis as well as peritoneal dialysis . hence , nutritional supplements are routinely suggested in such patients to keep their nutritional status appropriate . however , non - compliance is reported to be common , and long - term studies with oral protein supplements are not available . different protein formulae with different protein concentrations are available in the market . the two common ingredients to supplement protein in such patients are whey protein and egg albumin . a comparative study was carried out to look for the effect of the two oral formulae supplements on nutritional parameters in dialysis population . the total number of patients to be studied was 50 , randomly divided into 25 patients to get whey protein and 25 to get egg albumin supplement . both these proteins were commercially available with 100 gm of whey powder containing 46 g protein and 230 kcal energy , and egg albumin powder containing 70 g protein and 316 kcal energy per 100 gram . patients , who were on thrice a week hemodialysis or more than 3 exchanges per day of peritoneal dialysis were included . adequacy of hemodialysis was observed by urea reduction ratio ( urr ) every month , and for peritoneal dialysis by kt / v urea every 6 months . patients with active infection in last four weeks , hepatitis b , hepatitis c , or hiv infection were also excluded . patient enrolment was done on first come first basis after fulfilling the inclusion and exclusion criteria . after consent , at the enrolment , daily dietary intake of calories and proteins was calculated from 3 - day dietary diary . deficiency of calorie and protein intake was calculated from standard requirement and actual intake was calculated from the dietary diary . standard requirement was fixed at 35 kcal / kg of calories and 1.2 g / kg of protein in hemodialysis patients and 1.3 g / kg of protein in peritoneal dialysis patients . group a was given whey protein supplement and group b was given egg protein powder as supplement . according to randomization and protein deficit , each patient was given the protein supplement to match the requirement and counseled to improve their calorie intake . weekly feedback was taken in dialysis unit ( hemodialysis patients ) or on telephone ( peritoneal dialysis patients ) and compliance emphasized . monthly supply of the protein supplements were given on as required or on monthly visit to the clinic . the amount of supplement consumed was calculated from the refills taken , divided by number of days . bioelectrical impedance analysis ( bia ) was carried out for body fat mass ( bfm ) and fat - free mass ( ffm ) . bia was carried out by direct segmental multi - frequency method using in - body - 230 body composition analyzer ( biospace 1996 - 2009 , biospace co. ltd ) . baseline laboratory investigations were also carried out . at the end of 6 months , bia and investigations were repeated . their actual calorie and protein intake at 6 months was also calculated from three - day dietary diary . continuous variables were recorded as mean and standard deviation and compared between the two groups using independent sample t - test . comparison of variables between baseline and at 6 months was carried out by paired t - test . out of 50 patients randomized , 14 ( 28 % ) patients were excluded because of side effects leading to discontinuation of the supplements within the first month . two patients died within 2 months of enrolment and were also excluded , cause of death being sudden cardiac death and myocardial infarction respectively . table 1 shows the demographic profile and initial dietary intake between the two groups , which was similar . the mean initial daily protein intake was 0.740.3 vs. 0.690.2 g / kg , p = 0.5 ( 4514.4 vs. 41.410.5 , p = 0.4 ) and calorie intake was 205.6 vs. 20.55.1 kcal / kg , p = 0.8 ( 1217.5356.4 vs. 1226.5297.7 kcal / d , p = 0.9 ) in whey and egg albumin group respectively . the deficit calculated was almost half the required intake ( protein deficit 45 % in whey and 49 % in egg albumin ; calories deficit 56 % in both the groups ) . the deficit was intended to be supplemented by respective protein formulae divided in two to three servings . flow of patients into the study demographic profile of patients included in the study many patients became irregular in theirsignificant number withdrew complaining of intolerance ( as mentioned above and excluded from the study ) . remaining patients wanted to continue with the supplements , but at decreased quantity , as higher quantity was intolerant . comparison of dietary intake of proteins and calories , serum albumin , body fat mass and fat free mass at baseline and at 6 months are shown in table 2 . the actual total intake of proteins and calories remained the same despite suggested protein formulae supplementation . the body fat mass and fat - free mass were also same for pre - and post - intervention . other biochemical laboratory tests were also comparable between the groups ( data not shown ) . dietary intake , serum albumin , and bioelectric impedance analysis comparison between the two groups pre - and post - intervention during the follow - up , despite regular counseling and emphasizing the need for protein supplementation , only 20 % ( 7/34 ) patients were estimated to consume 50 % of suggested protein formula . rest 80 % patients were infrequent and taking 50 % of the suggested quantity because of intolerance and side effects . side effects noted in patients in both the groups leading to drop out as well as in patients completing the studymalnutrition is a strong adverse predictive marker in outcome of dialysis patients . our study showed significant reduction in protein and calorie intake in our dialysis patients . on an average they took 50 % of the recommended calories and proteins per day . low intake was also shown in the hemo study cohort , where 76 % patients had calorie intake of 28 kcal / kg / day and 61 % patients had protein intake of 1 gm / kg / day . studied the effects of medical nutritional products in hemodialysis patients and found good tolerability but in short - term study of 10 days . we tried a larger , long - term study on the effects of protein supplement in dialysis patients . in our study , when supplemented with protein formulae , 28 % patients discontinued the supplements because of poor tolerance and severe side effects . the predominant side effect was gastrointestinal with bloating and vomiting being most frequent . even in those who continued , the intake was below 50 % of the suggested quantity , again because of side effects . patients limited their intake of supplements to avoid side effects and complained fear of increasing the quantity recommended . hence , at the end of the study , no increase in total protein or calories intake was recorded in either group . it was not surprising that no difference was observed in any of the nutritional parameters like serum albumin or fat - free mass ( bia ) . protein assimilation ( digestion and absorption ) is impaired in small intestine in chronic kidney disease as well as end - stage renal disease patients on dialysis ( both hemodialysis and peritoneal dialysis ) , as shown by bammens et al . undigested protein passes into the colon and is then fermented by the microbial flora of the colon forming metabolites like thiols , phenols , ammonia , indoles , and amines , which are potentially toxic . gastric acid suppression by drugs , which many of these patients are on , also leads to decreased protein assimilation and increased fermentation in the colon . supplementary load of dietary protein can further enhance fermentation process many of these fermented metabolites have been shown to be associated with gastro - intestinal diseases and malabsorption . so , it is likely that poor protein assimilation , compounded by gastric acid suppressive drugs and excess protein load leads to increased fermentation of undigested proteins resulting in toxic metabolites , which may be the actual pathogenesis of adverse effects seen in these patients . despite several limitations , this study gives an important insight in the management of malnutrition in dialysis patients . this study shows that oral protein supplements in high dose and for longer period of time are not well tolerated in dialysis patients . however , similar studies have been carried out earlier to compare the effect of protein supplements in physiologically similar set of patients . it can be concluded from our study that both protein and calorie intakes are poor in our dialysis patients and oral supplements are poorly tolerated amounting to significant non - compliance . it is possible that instead of oral protein supplements , parenteral protein supplements may be a better alternative in managing malnutrition in dialysis patients .\noutput:\n" }, { "from": "agent", "value": "a randomized study was planned to compare the effects of whey and egg albumin protein supplements in dialysis patients . fifty adult patients were randomized to receive either whey protein or egg albumin as per their deficit calculated from k / doqi recommendations . actual intake was calculated from three - day dietary diary . assessment of nutritional status was done by serum albumin and bioelectric impedance analysis ( bia ) . repeat evaluation was done after 6 months . the mean initial intake of protein in whey and egg albumin group was 0.74 0.3 vs. 0.69 0.2 g / kg / day , ( p = 0.5 ) and calorie intake was 20 5.6 vs. 20.5 5.1 kcal / kg / day , ( p = 0.8 ) , respectively . out of 50 patients , two died within 2 months and were excluded from the study and 14 ( 28 % ) dropped out within one month because of side effects . the most common side effect in drop - outs was nausea and vomiting ( 43 % ) . out of remaining 34 patients who completed the study , 80 % could not consume > 50 % of the recommended supplement because of side effects . the protein and calorie intake remained similar at baseline and 6 months in both the groups . the main side effects in whey group were bloating and nausea with vomiting , and in egg protein group were nausea with vomiting , bloating and anorexia . oral protein supplements were not tolerated in dialysis patients and side effects resulted in high degree of non - compliance ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we acknowledge financial support from the dutch cancer society ( nki 20022634 ) and the federation of european biochemical societies ( jbh ) . the authors declare no financial interest .\noutput:\n" }, { "from": "agent", "value": "tumor suppressor activity of the retinoblastoma protein prb is preserved despite loss of interaction with e2f transcription factors ( e2f ) or proteins harboring a leucine - x - cysteine - x - glutamic acid motif ( lxcxe , where x is any amino acid ) . this indicates that prb uses several parallel pathways to suppress tumorigenesis , which may also include e2f - and lxcxe - independent interactions ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: type one ( t1 ) copper proteins are a highly studied group of metal - containing et active sitesone reason being their adaptability , which allows them to carry out et in a broad range of biological functions and environments . t1 active sites are built from a conserved equatorial trigonal ligand field , which is constituted by a very short cuthe axial ligand has been the subject of much research effort and can be a s ( met ) residue ( e.g. , plastocyanin ( pc ) and azurin ( az ) ) , o ( gln ) ( e.g. , stellacyanin ( st ) ) , or non - coordinating , hydrophobic residues ( ile / phe ) ( e.g. , fungal laccases ) . the trans - axial position can be occupied by a carbonyl group provided by the protein backbone ( e.g. , az ) ; however , due to the long ocu distance of 3 , it does not interact covalently with the cu but contributes electrostatically . alternatively , this position can be shielded by bulky , hydrophobic residues , which have a tendency to rotate the carbonyl ligand away from the cu ( e.g. , fungal laccases ) . the geometric structure of the t1 site , as outlined above , exerts a strong influence on its electronic structure . two major classes of t1 sites have been identified on the basis of their spectral features : blue ( bc ) and green copper ( gc ) sites . the classic bc proteins , pc and az , exhibit an intense s ( cys ) ( 3p ) cu ligand - to - metal charge - transfer ( lmct ) transition at 600 nm ( 5000 m cm ) , which imparts the characteristic blue color to the protein and a small parallel cu hyperfine coupling ( a | | ) in electron paramagnetic resonance ( epr ) spectroscopy . this transformation has been termed the coupled distortion coordinate and includes ( 1 ) a decrease in the axial cu ( ii ) s ( met ) distance , ( 2 ) an increase in the cu ( ii ) s ( cys ) distance , and ( 3 ) a rotation of the s ( met ) cun ( his ) plane , which is a tetragonal jahn teller ( eu ) rotation from tetrahedral ( blue ) to tetragonal ( green ) . this protein induced change in geometry results in a rotation of the ground state wave function from - to - bonding between the cu and the s ( cys ) ( figure 1 ) . the two wave functions give rise to significantly different intensity distributions between the s ( cys ) ( 3p ) and s ( cys ) ( 3p ) cu lmct transitions in absorption ( abs ) ( figure 1 ) . thus , the electronic structure and spectral features , which are dominated by the cus ( cys ) bonding interaction , are highly anisotropic in nature , switching from - to - types through the interaction of the t1 cu site with the protein environment . orbital interactions for a blue ( a ) and a green ( b ) t1 cu site in nirs and mcos . strong overlap between the cu ( 3dx y ) and scys ( 3p ) orbitals ( a ) results in strong and weak charge - transfer intensity in absorption . good overlap ( b ) reverses the intensity distribution between and ct . these unique spectral features reflect the high degree of covalency of the cu ( ii ) s ( cys ) bond of the t1 site . the degree of electron delocalization over the cu ( ii ) s ( cys ) bond of t1 sites has been directly measured using a combination of cu l - edge and s k - edge x - ray absorption spectroscopy , which are direct probes of the - lowest unoccupied molecular orbital ( - lumo ) . this is the mo responsible for et and is therefore referred to as the redox - active molecular orbital ( ramo ) . at least for pc , previous studies have hypothesized that the high - type covalency of the t1 cu bond activates the site for long - range et . two enzyme classes contain t1 sites , the nitrite reductases ( nirs ) and multi - copper oxidases ( mcos ) . nir enzymes are involved in bacterial denitrification and carry out the one - electron reduction of no2 to no and h2o . the mcos couple the oxidation of a wide variety of substrates to the reduction of o2 to h2o . much of the recent work on mcos has been directed toward using enzymes with high t1 cu reduction potentials ( e s ) as cathodes in biofuel cells . both nirs and mcos have t1 cu sites that are connected via a protein - derived cys - his bridge to a catalytic metal active site : a mononuclear cu ( type two ( t2 ) ) site in the nirs and a trinuclear copper cluster in the mcos . the cu - to - cu et pathway construct in nir is given in figure 2 . structure of the cys - his pathway connecting type one ( t1 ) and type two ( t2 ) cu sites in nir . the protein backbone is shown as spheres , and residue r groups are given as lines ( pdb i d : 1nia ) . there are a number of important issues to consider in terms of the structure of the cys - his pathway and the t1 sites in nirs and mcos . first , the cys - his pathway is considered to contribute two individual pathways : through the s ( cys ) r group , into the protein backbone , and out the t2 cu bonded his residue ( pathway 1 ( p1 ) ) , and through the s ( cys ) r group , through the s ( cys ) amide functionality to an h - bond jump ( dotted line in figure 2 ) , and out the t2 cu bonded his residue ( pathway 2 ( p2 ) ) . in principle , both of these pathways can contribute to et . it is of further interest to consider that nirs have both blue and green t1 cu sites while the mcos only have blue t1 cu sites . the difference between blue and green sites , as mentioned above , involves a very different interaction between the cu ( 3dx y ) orbital and the and orbitals of the s ( cys ) ligand of the molecular bridge . therefore , the electronic structure of the t1 site could also influence et to the catalytic site . three parameters within the framework of marcus theory govern the rates of intramolecular et between the t1 and t2 cu sites : g , the driving force ; , the reorganization energy , which can be divided into contributions from the t1 and t2 cu ( t = t1 / 2 + t2 / 2 ) ; and hda , the electronic coupling matrix element . during catalysis carried out by nir and mco enzymes , while past research has largely focused on g and the associated potentials of the cu sites as well as reorganization energies , the focus of this study is on hda . here , density functional theory ( dft ) calculations are coupled to a range of perturbations within structural models of nir to investigate the contributions to hda from the cys - his pathway . these contributions include ( 1 ) the cys - his protein fold connecting the t1 and t2 cu sites ; ( 2 ) the nature of the high degree of covalency of the cu ( ii ) s ( cys ) bond and its contribution to activating electron or hole superexchange pathways ; ( 3 ) the anisotropy of the t1 cu ( ii ) s ( cys ) bond and its effect on coupling into superexchange pathways ; and ( 4 ) the relative efficiencies of p1 and p2 . some existing experimental data on intramolecular et in nirs are put into context of these results . while multiple et pathways to multiple cu sites are present in the mcos and only one cys - his pathway is present in the nirs , a comparison between the analogous cys - his bridge of the mcos and nirs indicates that a specific second - sphere interaction is capable of tuning hda differently for blue vs green t1 cu sites . finally , the calculated hda is related to the heisenbergdirac van vleck exchange coupling , j , of the two cu ( ii ) centers connected via the cys - his bridge . knowledge of j allows for an experimental estimate of hda as both relate to the same superexchange pathway . molecular orbital compositions and fragment analyses were determined using the qmforge program ( c and mulliken population analyses ( cspa and mpa , respectively ) ) , orbital overlaps were calculated using the aomix program , and all orbital surfaces were generated using the - lumo program . for all results and analysis sections , dft calculations were carried out using the b ( 38hf ) p86 functional ( spin unrestricted ) , in combination with a triple - tzvp basis set on all atoms . this amount of hf mixing was chosen because , in the absence of the protein environment , it gives the correct active - site covalency ( e.g. , 42 % s ( ) in the pp1p2b model in section 3.1.3 ) , which will be seen to be important in this study . since point charges are used as described below , this precludes employing the polarized continuum model in calculating hda . the geometries for the calculations were derived from an x - ray crystal structure of nir ( pdb i d : 1nia , achromobacter cycloclastes ( a.c . ) ) . because several different models are compared in sections 3.1 and 3.2 , we have mostly employed idealizedoxidized t1 ( blue and green ) and t2 geometries at reasonable cu ( ii ) bond distances . the important structural parameters are in supporting information table s1 and are described in more detail in the text . further , in section 3.1.2 , the geometries of the t1 site were partially optimized to properly estimate the effect of second - sphere perturbations on the t1 active site and thus covalency on hda , and in section 3.2.1 the t2 cu site was varied to reflect the geometry in the crystal structure . to calculate hdathis involves using either a 2cu ( ii ) ( triplet ) or 2cu ( i ) electronic structure . either the - lumos ( 2cu ( ii ) case ) or the - homos ( 2cu ( i ) case ) are brought into and out of resonance using point charges of equal magnitude and opposite sign . n1 ( his ) bond ( for the t2 cu ) and at a distance of 8.0 from the cu ion . variation in the value of the charge resulted in the energetic stabilization or destabilization of the molecular orbitals of the t1 and t2 cu sites . near the resonance point , where the energies of the two molecular orbitals become similar , they mix due to configuration interaction ( ci ) , and the closest energy splitting ( i.e. , at resonance ) is taken to be 2hda . in the discussion , j is calculated as the energy splitting between the 2cu ( ii ) triplet and broken - symmetry singlet states ( spin - corrected ) : 1 hda was obtained from j as described in ref ( 53 ) and ( 54 ) . specific factors contributing to electronic coupling between t1 and t2 sites through the cys - his p1 are considered here ( in1a numbering , figure 2 ) . it is found below that hda through p1 is strongly dependent on bridge conformation . for blue ( - type ) sites , the protein fold of p1 activates a superexchange pathway capable of coupling blue t1 cu ( ) and t2 cu ( ) sites . the opposite is observed for a superexchange pathway coupling green t1 cu ( ) and t2 cu ( ) , where p1 is deactivated by the local protein conformation . two conformations of p1 were evaluated : ( 1 ) a linearized model , in which p1 has been extended into an idealized all - trans geometry ( figure 3 , left ) ; and ( 2 ) p1 in the local protein fold , as found in the x - ray crystal structure of nir ( figure 3 , middle ) . in addition , for each conformation of p1 , the t1 cu site is varied between a blue ( - type ) and a green ( - type ) site ( figure 1 ) . the individual models are referred to as follows : ( 1 ) l p1b ( i.e. , linear bridge , p1 only , blue t1 cu site ) ; ( 2 ) p p1b ( i.e. , protein bridge , p1 only , blue t1 cu site ) ; ( 3 ) l p1g ; and ( 4 ) pp1g , where ( 3 ) and ( 4 ) are the same as ( 1 ) and ( 2 ) except with a green ( ) t1 cu site . geometric parameters of the four models are given in the supporting information , table s1 . for the blue site , two n ( his ) ligands are bonded to the cu in a trigonal fashion giving a - type ground state wave function . thus , these models represent the limits of the coupled distortion coordinate . on the acceptor side of the cys - his pathwaythe t2 site is constructed as having a distorted square planar geometry , which results in four bonds to the t2 cu ( t2 ( ) ) . representative - lumos for the t2 cu ( ii ) and the blue and green t1 cu ( ii ) are given in figure 4a c . structures and labeling for the idealized linear and protein bridge models . the h - bond in pathway 2superexchange pathways for electronic coupling between the t1 and t2 cu active sites in linear and protein models : ( a c ) linear p1 t2 , t1 blue , and t1 green , respectively ; ( d , e ) protein fold blue and green , respectively . p1b and l p1g models , respectively , and can be related to the orbital symmetries of the t1 and t2 - lumos ( figure 4a ) . note that the t2 - lumo is of the - type , while the blue and green t1 - lumos are of the - and - type , respectively ( figure 4b and 4c ) . therefore , in the limit that the linear models are cs , the - lumos of the t1 and t2 sites in the l p1b model are orthogonal and hda = 0.00 cm ( defined here as - / - type t1 / t2 coupling ) . p1g model is maximized due to the nature of both the t1 and t2 sites , respectively ( defined here as - / - type t1 / t2 coupling ) , and results in a large hda ( 22.7 cm ) . p1b is not 0.00 cm ( 0.7 cm ) due to the placement of the n ( his ) ligands on the t1 cu site as they are found in the protein structures , which results in some character in this blue model . modification of the t1 and t2 ligands to ammines ( nh3 ) and maintaining cs symmetry abolishes the s ( p ) character in the linear blue model and hda = 0.00 cm ( supporting information , table s2 , top ; see also supporting information , figure s1 , for structures ) . the above results indicate that the intrinsic electronic coupling between a blue t1 cu ( ii ) and a t2 cu ( ii ) ( - / - type ) is zero in the absence of additional perturbations , even with a highly covalent cu ( ii ) s ( cys ) bond ( i.e. , 45 % s ( p ) character in the - lumo ) . conversely , the intrinsic electronic coupling between a green t1 cu ( ii ) and a t2 cu ( ii ) ( - / - type ) is high in the all - trans configuration of the cys - his pathway despite the lower total s ( p ) character ( 18 % in the - lumo ) relative to the blue site . therefore , not only is it necessary to have a covalent cu ( ii ) s ( cys ) bond , but the covalency should be of the correct symmetry to couple to specific fragment orbitals of the bridge . this is related to the nature of the superexchange pathway and is analyzed below . the linear bridge considered above was refolded into the local protein fold in nir ( figure 3 , left to middle , corresponding to p p1b and pno changes are made to the t1 and t2 cu ( ii ) sites . transforming the bridge in pp1b increases hda to 8.7 cm ( relative to 0.7 cm ) and decreases it to 1.2 cm for p p1g ( relative to 22.7 cm ) . the changes in hda upon going to the protein p1 are not related to changes in t1 or t2 active - site electronic structure , but relate to the nature of the t1 / t2 interaction ( coupling ) through the bridge ( i.e. , no change in t1 / t2 electronic structure ) . despite maintaining the local - / - type ( p p1b ) and - / - type ( p p1g ) t1 / t2 coupling , the - / - coupling is now more favorable than the - / - type and has a larger hda ( 8.7 vs 1.2 cm , respectively ) , which is opposite the trend in the linear models . thus , for the blue site , the cys - his bridge in the protein results in a - to - crossover . the activation of hda for the blue site and deactivation for the green site can be understood by expanding the contours of the blue and green t1 - lumos . the t1 wave function extends through the s ( cys ) amide functionality formed between cys136 and his135 . for the blue site , the amide orbital is out - of - plane ( ) ; for the green site it is in - plane ( ) ( zoom - ins indicated by dotted lines in figure 4b , c ) . expansion of the t2 - lumo ( dotted lines in figure 4a ) indicates that the t2 cu wave function extends into the orbital of the n ( his ) ligand . comparison of figure 4a , c shows the formation of a good superexchange pathway between the green t1 cu and t2 cu sites through the all - trans conformation of the linearized p1 . upon folding , a right angle is created in the cys136 and his135 connection ( figure 4d , e , arrows ) . this fold in the pathway greatly decreases the superexchange pathway between the green t1 cu and t2 cu sites and activates the superexchange pathway in the blue t1 model . the 135 n ( his ) orbital is rotated to stack alongside the amide functionality of cys - his pathway ( shown as dotted lines in figure 4d ) . this creates orbital overlap between the n ( his ) orbital and the s ( cys ) amide out - of - plane orbital , which forms the - to - crossover in p1 for the blue site in the nir protein cys - his fold and defines the superexchange pathway for the phere , we evaluate this idea using p p1b by tuning the covalency of the t1 cu ( ii ) s ( cys ) bond . s ( cys ) covalency , which indicates its important role in activating specific superexchange pathways for long - range et . additionally , fragment analyses define the orbital superexhange pathway for blue t1 cu sites and demonstrate that a hole - transfer mechanism ( as opposed to electron - transfer ) is dominant . we have previously shown that active h - bonds ( i.e. , those that interact with and are in the plane of the lobes of the 3p ( ) cys orbital ) tune down the covalency of the t1 cus ( cys ) bond . here , two partial point charges ( varied from 0.00 to 0.75 in increments of 0.25 ; the t1 site is partially optimized at each point ) have been placed in the plane of the cuincreasing the charge from 0.00 to 0.75 decreases the covalency of the t1 cu ( ii ) s ( cys ) bond by 17 % s ( p ) ( mpa ) ( 10 % s ( p ) cspa ) ( table 1 ) and decreases hda by 3.0 cm ( from 8.3 to 5.3 cm ) . plots of hda versus s ( p ) character for both mpa - and cspa - derived contributions yield linear relationships with high values of r ( 0.939 and 0.999 , respectively , table 1 ) . the y - intercepts were set to zero in the fits and yield slopes of 0.22 ( mulliken ) or 0.28 ( cspa ) cm / % s ( p ) . the correlation between hda and s ( p ) character is plotted , normalized to zero charge , in figure 5 and indicates that hda and covalency vary in a linear fashion . in context of marcus theory , covalency will have a large impact on ket as it varies as hda and consequently follows the square of the s contribution ( or an orbital coefficient to the power of 4 ) of the t1 cu ( ii ) s ( cys ) bond , which can be obtained experimentally using s k - edge xas . this is covalency activated superexchange and enables the t1 cu site to carry out long - range et . covalency - activated hda : linear correlation of hda with covalency ( % s ( p ) ) . values are normalized to no charge ( red squares , mpa - derived contributions ; black circles , cspa - derived contributions ) . linear fit performed with y - intercept set to zero for t1 s ( p ) vs hda . average of mpa - and cspa - derived contributions . the mechanism of superexchange ( i.e. , electron vs hole transfer ) for et between t1 and t2 cu sites has also been evaluated . the literature has approached the problem of electron and hole transfer by using either the doubly oxidized or doubly reduced forms of the donor and acceptor . in the former case , the e ( lumo / lumo +1 ) is calculated , while in the latter , the e ( homo / homo1 ) is calculated upon bringing the corresponding orbitals into and out of resonance . a schematic for electron vs hole transfer between a reduced t1 and oxidized t2 site is given in figure 6 . a hole can be transferred from the t2 to the t1 via occupied valence bridge states ( figure 6 , bottom ) and can be initiated via an lmct ( labeled in figure 6 ) . electron transfer , conversely , is mediated via virtual bridge conduction states ( figure 6 , top ) and can be initiated via a metal - to - ligand ct ( mlct , labeled in figure 6 ) . these mechanisms can be differentiated by the nature of the bridge states involved in superexchange . this has been evaluated through fragment orbital analyses on the 2cu ( ii ) ( 2cu ( i ) ) model , which projects the bridge orbitals onto the lumo and lumo +1 ( homo1 and homo ) . this was done when the ramos were out of and in resonance . at resonance , the occupied bridge orbitals of the t1 frag1_53 and t2 frag1_47 cu are mixed in equal proportions , and the superexchange pathway of the bridge is formed from the mixing between these bridge orbitals ( figure 7 and supporting information , table s4 ) . analogous results were obtained for the 2cu ( i ) model and no evidence for additional mixing of virtual bridge orbital character was observed ( supporting information , tables s4 and s5 and text ) . occupied valence fragment molecular orbitals of ( a ) t1 cu s ( cys ) ( frag1_53 ) and ( b ) t2 cu n ( his ) ( frag1_47 ) out of resonance and ( c ) in resonance . isovalues : ( a ) 0.050 , ( b ) 0.050 , and ( c ) 0.015 . in the above , p1 has been considered ; however , the cys - his pathway also contains p2 , which can potentially contribute to et . p2 is composed of an h - bond between the carbonyl of cys136 and the n h unit of the t2 cu his135 ( figure 2 , a.c . models include p2 as well as p1 in the native protein cys - his orientation and are referred to as pp1p2g for blue and green t1 cu sites , respectively ( figure 3 , middle to right ) . no other perturbations have been added , and the t1 and t2 cu sites are structurally identical to those used above . the differences between blue ( ) and green ( ) t1 cu site superexchange pathways and their relative efficiencies , are elucidated below . these differences are further shown to derive from the anisotropic nature of the cu ( ii ) s ( cys ) ( vs ) bond , which results in different hda values . p1p2g are calculated to be 6.9 and 16.4 cm , respectively ( n o h - bond distance 2.8 ) . p1 ( 8.7 cm ) and a large increase for the green site relative to p p1 ( 1.1 cm ) . to quantitate the effect of p2 on hda , the h - bond distance involving p2 was varied by rotation about the cc bond of the his residue ( see supporting information , figure s2 ) . to account for potential changes in p1 superexchange due to this structural perturbation , p1p2b is shown as black circles in figure 8a ( listed in table 2 ) . however , a plot of hda for the p p1b model as a function of the same perturbation results in the same distance dependence , even in the absence of p2 ( red circles , figure 8a ) . the small decrease in hda observed between the pp1p2b models can be accounted for by a small decrease in the covalency of the cu ( ii ) s ( cys ) bond ( decreases by 6 % s ( p ) ( average between mpa - and cspa - derived orbital contributions ; see supporting information , table s3 ) ) upon addition of p2 . using the value of 0.25 cm / % s ( p ) gives an hda = 8.3 cm for the paccounting for this covalency difference , there is a good correspondence to the pp1p2b model does not change upon addition of p2 and is still dominantly through p1 . t2 ( nir ) , p2 rotates to 75 . the h - bond dependence for the pp1p2g model shows a strong h - bond distance dependence ( black circles ) , while the distance dependence for pp1p2g models are essentially the same , and thus no covalency correction is necessary . p1g ( no h - bond ) models are 16.4 and 1.1 cm , respectively , and indicates that p2 contributes significantly to hda for the green t1 site . this trend in h - bond distance dependence and hda is opposite to those observed in figure 8a for the analogous models with a blue t1 cu site . thus , the blue and green sites utilize different superexchange pathways of the same molecular bridge , which results in significant differences in hda . because of the location of the p2 amide relative to the t1 cu ( ii ) s ( cys ) bond , vs t1 cu bonding results in different coupling to the p2 amide . this is observed through successive expansions of the blue and green - lumos ( figure 9 ; zoom - in on p2 indicated by dotted lines ) . the green - lumo shows orbital character on the oxygen atom involved in the p2 h - bond ( figure 9 , right , bottom arrow ) ; however , the - lumo of the blue site at the same isosurface value ( 0.005 ) has no o character ( figure 9 , left , bottom arrow ) . this difference in o - character is supported by population analyses ( supporting information , table s6 ; note the larger coefficients for the o ( p ) - character in green ( 0.04 vs blue 0.01 , bolded ) ) . the o ( p ) orbital contribution in the - lumo activates p2 for the green site , and , conversely , the lack of o ( p ) character precludes the blue site from utilizing the p2 h - bond for superexchange . this pathway selectivity is related to hda and is analyzed below . further analysis related to the molecular orbital basis for this differenceis given in the supporting information , figures s4 and s5 and supporting text . p2 o ( p ) - character activation : ( left ) blue site and ( right ) green site . considering a range of his rotation and h - bond distance variation for p1 and p2 within available thermal energy at room temperature , hda can vary by 17 % and 9 % for the p p1p2b and pit is interesting to note that the hda value for the green site is higher than that for the blue site ( 16.4 cm green vs 6.9 cm blue ) in nir despite the lower covalency of the cu ( ii ) s ( cys ) bond ( 17.3 % s ( p ) green vs 42.3 % s ( p ) blue ) . in order to understand this difference , the relative efficiencies of p1 ( blue ) vs p2 ( green ) were evaluated . the atoms involved in p1 and p2 pathways are indicated in figure 10 with blue and green numbers , respectively . starting from the common s ( cys ) atom and proceeding to the common n atom of the n ( his ) residue ( figure 10 ) , p1 ( blue ) consists of four covalent bonds and several through - space or weak h - bonding interactions ( dotted lines between cp1 , n p1 and c - his , n - his , and h - his in figure 10 , where black labels through space and red , h - bonding ) . p2 ( green ) consists of two covalent bonds and two h - bonds ( s ( cys ) , h = 3.06 ; and n his , o p2 = 2.80 ) . note that two possible pathways exist for the green t1 site to exit the s ( cys ) ( a and b in figure 10 ) ; we focus on ( a ) due to the fact that the interaction between the p2 nh and s ( dotted line in figure 10 , 3.06 ) was shown above to activate o ( p ) - character in p2 ; however , both routes yield similar results . in order to compare the relative efficiencies , two factors are considered first : ( 1 ) the covalency of the cu ( ii ) s ( cys ) bond , which activates the superexchange pathway , and ( 2 ) the specific molecular orbital components of the pathway ( i.e. , number of chemical bonds , h - bonds , and through - space interactions ) . these two contributions for p1 and p2 can both be taken into account by noting the calculated total p - characters on the n p1 and cp1 and n p1 atoms are 0.05 % and 0.08 % , respectively , while the total p - character on the o p2 atom is 0.04 % ( supporting information , table s6 , averages between mulliken and cspa ) . interestingly , the higher contribution for p1 ( 0.13 % ) vs the contribution for p2 ( 0.04 % ) indicates that , only considering the two pathways up to these atoms , p1 would be the more efficient pathway . note that the orbital coefficients of the acceptor t2 n ( his ) are the same for p1 and p2 , and thus are not a factor . therefore , the higher hda for green relative to blue must be related to the relative orientations of the pathway components , which will govern the magnitude of the orbital interactions and overlaps . importantly , the t2 n ( his ) orbital is directed along the n h bond of the his ligand ( figure 10b ) , which is an optimal alignment for orbital overlap with the o ( p ) orbital of p2 and is at a short distance ( 2.8 heavy atom / heavy atom and 1.8 h o ) . alternatively , the through space interactions / weak h - bond of the n h of the n ( his ) orbital with the out - of - plane amide of p1 results in only moderate orbital overlap ( figure 10b ) and long distances ( 3.03.1 ) . these differences in orbital orientations and distances favor the p2 ( green ) superexchange pathway . indeed , the calculated absolute change in the overall orbital overlaps between the lumo and lumo +1 for p2 ( including op2 , n - his , and h - his ) and p1 ( including cp1 , c - his , n - his , and h - his ) in going from out of resonance to in resonance is 3 times larger for p2 than p1 ( 0.009 vs 0.003 , respectively ) . thus , the key differences between p2 and p1 superexchange efficiency are ( 1 ) the better orbital alignments and overlaps for p2 relative to p1 and ( 2 ) the shorter p2 h - bond vs longer p1 through - space / h - bond interactions ( figure 10b ) . in nir , these factors contribute to a higher value of hda for the green site ( 16.4 cm ) relative to the blue site ( 6.9 cm ) , despite the lower covalency of the cu ( ii ) s ( cys ) bond in the former . p1 and p2 superexchange pathways : ( a ) the atoms involved in p1 and p2 ( black dotted lines indicate through - space interactions and red dotted lines indicate h - bonding ) and ( b ) relative orbital overlaps for the molecular orbitals in p1 and p2 ( blue and green dotted lines indicate interactions for the blue and green t1 sites , respectively ) . thus , anisotropy of the t1 cu ( ii ) s ( cys ) bond ( vs ) allows for the coupling of the t1 site into different superexchange pathways of the cys - his bridge , and , due to the relative orientations of the pathway components and orbitals , these pathways will have different efficiencies . hda through the cys - his pathway can therefore be varied by changing the geometric structure of the metal site . for the calculations presented in section 3.1 , the t2 site was modeled as approximately square planar . this geometric structure has four bonds between the t2 cu ( 3dx y ) and the 3n ( his ) and h2o ligands ( figure 11 , top ( t2 ( ) ) . the t2 site was not allowed to vary . in this sectionp1p2g models to the actual structure of the t2 cu site in nir ( t2 ( nir ) ) and the effect on hda . it is shown below that the covalencies of both the donor and acceptor cu sites play important roles in intramolecular et . variation between the t2 ( ) ( top ) and t2 ( nir ) ( bottom ) models . note that in t2 ( nir ) the h2o is below the plane and covered by the orbital isosurface . perturbing the idealized t2 ( ) site to the actual structure in nir ( t2 ( nir ) ) decreases the calculated hda for both the blue and green t1 sites . specifically , the blue site hda decreases from 6.9 to 2.2 cm , while hda for the green site decreases from 16.4 to 5.8 cm ( table 2 ) . this is an equivalent decrease in hda by a factor of 3 for both blue and green sites . the structural change involved in transforming the t2 ( ) to t2 ( nir ) involves an d2d distortion of the ligands toward tetrahedral , with rotation of the ligands around the t2 cuthis structural change rotates the t2 cu ( 3dx y ) orbital , which , in t2 ( nir ) , results in the misalignment of the lobe of the cu ( 3dx y ) orbital and the lobe of the n1 ( his ) ligand ( figure 11 , top to bottom ) . n1 ( his ) bond from 7.2 to 1.9 % n ( ) ( mpa ) or from 9.5 to 1.8 % n ( ) ( cspa ) ( supporting information , table s3 ) . note that the coefficients on the relevant p1 and p2 atoms do not change ( supporting information , table s7 ) . given the findings of the above sections , this decrease in covalency of the t2 cu ( ii ) n ( his ) bond also decreases hda . given that the t2 ( nir ) site is common to both blue and green models , the decrease in hda is similar and 3 in both . the mcos also use a cys - his pathway for intramolecular et , which connects the t1 cu site to the t3b cu of a catalytic trinuclear cu cluster , where o2 is reduced to h2o . we note that there are also two other potential et pathways to the t3a and t2 site of the trinuclear cu cluster in the mcos . the presence of multiple pathways to multiple cu sites in the mcos can result in constructive or destructive interference . these additional pathways are not included here , but will be the subject of a future study . this section is therefore limited to a comparison between p1 and p2 of the cys - his bridge in nirs and mcos . through this comparisonwe find a conserved variation in the cys - his pathway structure due to different second - sphere interactions in these two classes of enzymes . it is shown below that , in going from the nirs to mcos , this difference activates hda for blue sites and deactivates green t1 sites . comparing x - ray crystal structures of nirs and mcos shows a conserved difference between the protein residues in the vicinity of the cys - his pathway . an overlay of nir and mco structures is given in figure 12 ( nirs , green , and mcos , teal ) . in the above sections , for nir , both p1 and p2 of the cys - his pathway were considered , where p2 is composed of an h - bond between the cys carbonyl oxygen and his135 ( labeled p2 h - bond ( a ) in figure 12 , inset , green dotted line ) . there is an additional second - sphere h - bond to the cys - his pathway . for the nirs , this h - bond ( b ) is formed by the c = o group of an amide from an asn r group ( red asn and red dotted lines in figure 12 ) . asn is a conserved residue across most nirs . in the mcos , however , this h - bond ( b ) is formed by the carbonyl oxygen of the protein backbone of a pro residue , which is conserved across the majority of mcos ( black pro and black dotted lines in figure 12 ) . the difference between the asn and pro h - bond ( b ) orientations results in a rotation of the s ( cys ) ccc o dihedral angle ( starred atoms in figure 12 inset ) from 87 for a.c . nir ( pdb i d : 1nia ) to 75 for the mco trametes versicolor ( t.v . ) laccase ( pdb i d : 1gyc ( 58 ) ) , a difference of 12 . this trend holds over many proteins in each class ( supporting information figure s6 , tabulated in supporting information table s8 ) , with the average value of the dihedral angles being 77 for the mcos and 88 for the nirs . inset : h - bonds to the cys - his pathway ( green , nir , pdb i d : 1nia ; and teal , mco , pdbthe s ( met ) ligand has been removed from the nir structure for clarity . to make a direct comparison to the calculations in section 3.2.1 , the dihedral angle in both the p p1p2b and pp1p2g t2 ( nir ) models was rotated from 87 to 75 . this increases hda for the blue site from 2.2 to 5.5 cm and decreases hda for the green site from 5.8 to 0.4 cm ( table 2 ) ( see supporting information , figure s7 , for structures ) , thus favoring a higher hda for the blue t1 site over the green t1 site . since the mcos contain strictly blue sites and the nirs operate with both green and blue sites , determining the molecular orbital origin of this variation in hda for blue vs green sites is of interest . comparing the - lumos indicates that the rotation of the p2 dihedral has little to no influence on the t1 or t2 cu ( ii ) - ligand bonds ( compare columns two and three to four and five in supporting information table s9 ) . however , upon rotation of the p2 dihedral , the o ( p ) - character decreases for the green site ( figure 13a , arrows ) , while the o ( p ) - character increases for the blue site ( figure 13b , arrows ; supporting information table s10 , bolded ; compare to bolded in supporting information table s7 : blue site , 0.000.03 % ; green site , 0.040.01 % ) ) . thus , rotation of the p2 s ( cys ) ccc o dihedral angle from 87 to 75 , a structural perturbation in going from nirs to mcos , varies the o ( p ) - centered character of the p2 amide differently for blue and green sites , which activates p2 superexchange for blue t1 sites and deactivates it for green t1 sites while leaving p1 unperturbed . effect of p2 rotation for the nir - to - mco transition in figure 12 on the t1 green ( a ) and blue ( b ) - lumos . both the nirs and mcos use a similar structural motif in order to carry out catalysis : a t1 cu et active site is covalently linked to a remote , catalytic active site containing an additional one or three cu ions , respectively . this cys - his pathway provides two potential superexchange pathways ( p1 and p2 , figure 2 ) . this study has focused on the elucidation of structural and electronic factors that allow for this cys - his pathway to operate efficiently for different t1 cu active sites , with focus on the t1 to t2 pathway in nirs and the analogous t1 and t3b pathways in mcos . s ( cys ) bond activates a hole - superexchange pathway via occupied valence orbitals of the cys - his pathway through lmct to the cu ( ii ) center . models containing only p1 showed that the local protein fold , which governs the structure of the cys - his pathway , effectively activates or deactivates specific superexchange pathways for t1 cu sites that have different electronic structures ( i.e. , blue vs green ) . the idealized linear cys - his pathway is strongly activated for a green site ( l p1g , 22.7 cm ) and deactivated for a blue site ( l p1b , 00.7 cm ) . this preference for green over blue was due to the / and / nature of the t1 cu / t2 cu coupling , respectively . the linear , all - trans conformation of the bridge facilitates / coupling due to the high degree of mixing between the - bridge molecular orbitals involved in bonding at the t1 and t2 cu sites . in the / case of the blue site , however , orthogonality of the - lumos precludes electronic coupling . importantly , for the cys - his pathway in the natural protein configuration of the nirs , the fold overcomes the orthogonality problem by having the his r group imidazole exit at an 90 angle to the backbone ( figure 4d ) . this orientation results in a - to - crossover in the overlap and allows the blue site to couple to the t2 cu site . in parallel , the 90 orientation of the im - group deactivates what was an efficient superexchange pathway for the green site in the linear , all - trans configuration ( figure 4e ; hdapaddition of the h - bond pathway p2 to the nir model indicated that the blue site and green site utilize different superexchange pathways of the cys - his bridge . specifically , the blue site only uses p1 superexchange in nir , while the green site utilizes p2 superexchange . thus , the anisotropic covalency of the t1 cu ( ii ) bond activates specific superexchange pathways of the same molecular bridge , and these pathways ( i.e. , p1 and p2 ) can have different efficiencies due to the differences in the covalency , number of atoms and h - bonds , and orbital overlap interactions with the acceptor ( figure 11 ) . because of the higher overall efficiency of p2 , the green site has a higher hda ( p p1p2g , 16.4 cm ) than the blue site ( p p1p2b , 6.9 cm ) in nir , despite the lower covalency of the cu ( ii ) s ( cys ) bond for the green t1 center . further , it was found that hda is also affected by the distortion of the acceptor t2 cu site from t2 ( ) to t2 ( nir ) ( figure 11 ) , which decreased the t2 ligand covalency and hda for both blue and green t1 cu sites . thus , the ligand environment around both the donor and acceptor metal sites controls the superexchange pathway both in selectivity and efficiency through anisotropic covalency activated superexchange ; these are tuned by the protein environment . the second coordination sphere also plays a role in tuning the geometric structure and efficiencies of the et pathways in the cys - his bridge . extension of the nir model to the mcos indicated that structural perturbations can lead to significantly different coupling , and thus hda , for blue and green sites . by changing the h - bonding pattern to p2 in going from nirs to mcos ( p2 h - bond ( b ) in figure 12 ) , the s ( cys ) ccc o dihedral angle ( starred atoms in figure 12 inset ) rotates from 87 to 75 . this structural change activates the p2 superexchange for the blue site , while deactivating it for the green site . thus , the second - sphere environment tunes hda to selectively favor a t1 cu green site in the nirs and a t1 cu blue site in the mcos . kinetics data have been obtained for intramolecular et via the cys - his pathway in the nirs . rates and driving forces have been measured for different blue and green t1 - containing enzymes as well as axial ligand variants within the same green nir , thus enabling the calculations above to be compared to experiment . note that because of the additional et pathways and cu acceptors in the mcos , the scope of this section is limited to the nirs . for blue nir sites , the forward rates ( kf ) are 280 s and g is small ( table 3 ) . in one case , the blue cu nir et rate and driving force , in combination with an estimate of hda ( determined for a ru - modified high - potential ironsulfur protein ( hipip ) containing a cys - his pathway ) were used to obtain a t of 1.20.1 ev for intramolecular et between blue t1 and t2 cu . however , from the results presented above , hda for the cys - his pathway is strongly dependent on the bridge conformation and the nature of the redox active orbitals of the donor and acceptor metal sites . alternatively , hda can be estimated given kf , g , and a reasonable value of t . t for blue copper sites have be determined experimentally to be 0.77 ev ( i.e. , pc , 0.72 ev , and az , 0.82 ev ) . from computational studies on reduced and oxidized structures , the inner - sphere reorganization energy for a blue cu t1 site ( with or without a weak axial met ligand ) is 0.40 ev , giving an outer - sphere contribution of 0.40 ev . i of the t2 cu site is estimated here to be 1.50 ev . using o0 .40 ev for the t2 site , the t for blue t1 to t2 intramolecular et is estimated to be 1.34 ev . using this value of t for blue nirs , we estimate hda 1.00.2 cm ( table 3 ) . the dft calculated value of 2.2 cm therefore overestimates hda by a factor of 2 . values calculated in this work using the marcus expression and the values of kf , g , and t given in the table . in going from blue to green nirs , the kfs increase across different species , while g is somewhat variable , but low ( table 3 ) . the increased rates for green enzymes have previously been ascribed to lower reorganization energies for the green t1 cu site relative to a blue site , as it was assumed hda would be the same for the cys - his pathway in both classes of nirs . however , literature consensus is that the t1 cu inner - sphere reorganization energies for green sites are higher than blue sites by at least 70 mv . t for the intramolecular et of green nirs can therefore be estimated as 1.38 ev . using this t results in hda values for green sites that are higher than those for blue sites by a factor of 1.6 ( table 3 , 1.60.3 cm ) . this ratio of the hda for green relative to blue nirs ( 1.6 ) is in reasonable agreement with the ratio from the calculations presented above ( 2.5 ) . it is noted that values for hda have been calculated with 38 % hf mixing to agree with the experimental value for the covalency of a blue cu site . as confirmed in this study , hda is dependent on this covalency , and varying the amount of hf exchange changes the covalency of the cus ( cys ) bond , which indeed is found to increase the calculated hda ( see supporting information , figure s8 and supporting text ) . rates and driving forces have also been measured for axial ligand variants within the same green t1 nir . these allow for an estimate of the dependence of hda with variation of the t1 cu geometric and electronic structure within the same enzyme . from the absorption data , eliminating the strong cus ( met ) axial interaction from the green t1 site results in conversion to a blue site ( e.g. , for m150 g and m150 t ) . corrected for driving force , the significant decreases in the rates observed for the variant blue nirs have also been interpreted as resulting from increases in inner - sphere reorganization energy of the t1 sites . however , from the considerations above , t for the blue relative to the green site should decrease . taking this into account , the decreased rates for the blue axial variants are consistent withdecreased hda values by a factor of 3 relative to the wt green nir ( table 3 ) . lastly , exchanging the s ( met ) axial ligand with n ( his ) results in increased sp ( ) character of the t1 site as observed in absorption and an increased rate of intramolecular et ( table 3 ) . the rate increase is partially due to the increased driving force ; however , hda for this variant can be estimated using a reasonable value of i ( calculated to be 0.48 ev higher than for a green t1 site with a s ( met ) ligand ) . t and hda can be estimated to be 1.58 ev and 2.3 cm , respectively , for the m150h green variant . in nirs , the experimental et rate correlations between blue and green enzymes and variants are consistent with the above computational results , which indicate that hda through the same cys - his pathway can be varied through the anisotropic covalency of the donor ( and acceptor ) metal site . previously , a valence bond configuration interaction ( vbci ) model was used to relate the ground - state exchange coupling constant , j , for a homovalent dimer ( i.e. , cu ( ii ) cu ( ii ) ) to the hda for cu ( i ) cu ( ii ) et . the idea here is that these involve the same superexchange pathways and should correlate . hubbard parameter for the repulsion of two electrons in the same d orbital . this has been estimated to be 6.5 ev for cu ( ii ) compounds using variable energy photoelectron spectroscopy.hda in eq 2 is for a homovalent dimer , and for biological et , hda for the mixed - valent dimer ( hda ( mv ) ) is given by3where the factor of 1/2 derives from the loss of two - fold symmetry of the dimer due to the additional electron . in this computational studycomputationally , we can calculate j for the same system from the triplet and the ms = 0 spin - polarized singlet states using the broken - symmetry formalism ( methodology section ) . using eqs 2 and 3 , an hda can be estimated from this j and compared to the value for hda calculated above . p1g model from section 3.1.1 as it simply reflects a single / superexchange pathway .2 j is calculated to be 0.066 cm , which gives ( eqs 2 and 3 ) an hda ( mv ) = 29.5 cm . this compares well to the 22.7 cm value of hda calculated in section 3.1.1 by bringing the - lumos of the 2cu ( ii ) dimer into and out of resonance . while these values are larger than the experimental estimate of 1.6 cm for hda in nir , as they reflect an idealized linear cys - his structure , the internal consistency is satisfying and supports the idea of experimentally estimating hda for et from 2j . the latter can be obtained by experimental methods using the isotropic component of the spinspin coupling . note that these values of hda and j are obtained with 38 % hf mixing , and the amount of hf mixing can affect both the covalent contribution to hda and the electron repulsion expressed in u. the dependence of hda and j on hf is given in the supporting information , table s11 . therefore , given a ket and the relative redox potentials of the two cu centers ( g ) involved in intramolecular et , hda can be evaluated experimentally through j , which further allows for a reasonable estimate of t . t1 cu centers are connected via a cys - his pathway to catalytic cu - containing active sites : a mononuclear cu t2 cu site in the nirs and a trinuclear cu cluster in the mcos . electronic coupling ( hda ) through this bridge was shown to vary linearly with the covalency of the t1 cu ( ii ) s ( cys ) bond , and thus hda between the t1 cu and t2 cu sites is activated via ligand metal covalency . in addition , the covalency of the acceptor t2 cu site can modulate hda . the conformation of the cys - his bridge is governed by the local protein fold that is formed by these two residues and is composed of two et pathways , p1 and p2 ( figure 2 ) . while the s ( cys ) of the cys - his bridge couples the t1 cu site into the protein backbone , the imidazole r group of the his residue exits at a right angle with respect to the backbone . this structural feature activates a superexchange pathway for the blue ( ) site through a - to - crossover within the et pathway and deactivates superexchange for a green ( ) site . addition of the h - bond et pathway via p2 to the nir model greatly increased hda for the green but not for the blue t1 cu center . the selectivity of different pathways ( p1 for blue and p2 green ) within the same molecular bridge was shown to result from the anisotropic covalency of the t1 cu ( ii ) s ( cys ) bond ( i.e. , vs ) . the selectivity in et can therefore be controlled via the active - site ligand geometry . these pathways ( i.e. , p1 and p2 ) have different efficiencies due to the number of atoms , h - bonds , distances , and orbital overlaps . p2 is the more efficient pathway and results in the green site having a higher hda than blue sites in the nirs . the second coordination sphere tunes the geometric structure of the cys - his pathway , which allows for the selective activation of hda for blue sites and disfavors green sites by activating and deactivating the p2 superexchange component , respectively . hda can therefore be varied between a t1 cu site and a remote catalytic cu active site through perturbations to the donor and acceptor electronic structures through their geometric structures as well as the geometric structure of the intervening intramolecular cys - his et bridge .\noutput:\n" }, { "from": "agent", "value": "type one ( t1 ) cu sites deliver electrons to catalytic cu active sites : the mononuclear type two ( t2 ) cu site in nitrite reductases ( nirs ) and the trinuclear cu cluster in the multicopper oxidases ( mcos ) . the t1 cu and the remote catalytic sites are connected via a cys - his intramolecular electron - transfer ( et ) bridge , which contains two potential et pathways : p1 through the protein backbone and p2 through the h - bond between the cys and the his . the high covalency of the t1 cu s ( cys ) bond is shown here to activate the t1 cu site for hole superexchange via occupied valence orbitals of the bridge . this covalency - activated electronic coupling ( hda ) facilitates long - range et through both pathways . these pathways can be selectively activated depending on the geometric and electronic structure of the t1 cu site and thus the anisotropic covalency of the t1 cu s ( cys ) bond . in nirs , blue ( - type ) t1 sites utilize p1 and green ( - type ) t1 sites utilize p2 , with p2 being more efficient . comparing the mcos to nirs , the second - sphere environment changes the conformation of the cys - his pathway , which selectively activates hda for superexchange by blue sites for efficient turnover in catalysis . these studies show that a given protein bridge , here cys - his , provides different superexchange pathways and electronic couplings depending on the anisotropic covalencies of the donor and acceptor metal sites ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: nhanes is conducted by the national center for health statistics of the centers for disease control and prevention . each 2 - year survey includes a sample of the noninstitutionalized u.s . civilian population identified through a stratified multistage probability sampling design . detailed methods of the design and conduct of nhanes are available online ( 7 ) . the protocol for each nhanes was approved by the national center for health statistics of the centers for disease control and prevention institutional review board . informed consent was obtained from each participant . to provide stable estimates , we pooled data from the nhanes 20052006 , 20072008 , and 20092010 . we included adults 20 years of age or older who attended a morning study visit . because we were interested in identifying individuals whose only indication , per atp iii , for an ldl - c goal 100 mg / dl was the presence of diabetes , we excluded individuals with a 10 - year framingham chd risk score 20 % and those with a self - reported history of chd or stroke . data for other chd risk equivalents such as peripheral arterial disease and aortic aneurysm are not available in nhanes 20052010 and therefore are not included in this analysis . individuals who had not fasted for 9 h were missing lipid or glucose values , had triglycerides 400 mg / dl , or who did not answer questions regarding the awareness and treatment of high cholesterol or the awareness of diabetes also were excluded .1 ) . nhanes collects data through standardized procedures that include questionnaires , a medical examination , and phlebotomy . questionnaires are used to assess age , race / ethnicity , sex , education , annual household income , health insurance status , smoking status , family history of chd , personal history of chd or stroke , and a previous diagnosis of , and treatment for , high blood cholesterol and diabetes . additionally , participants were asked if their cholesterol had ever been checked , where and how recently they have obtained health care , and whether they had been tested for diabetes in the past 3 years . blood pressure was measured three times and height and weight were measured and used to calculate bmi . blood collection and processingplasma glucose , hemoglobin a1c , total cholesterol , hdl cholesterol ( hdl - c ) , and triglycerides were directly measured . participants were categorized based on diabetes status into one of four mutually exclusive categories as follows : 1 ) normal fasting glucose ; 2 ) impaired fasting glucose ; 3 ) undiagnosed diabetes ; and 4 ) diagnosed diabetes . based on guidelines from the american diabetes association ( 10 ) , diabetes was defined as a hemoglobin a1c 6.5 % , fasting plasma glucose 126 mg / dl , or the use of antidiabetes medications in those who reported a history of diabetes . in individuals who reported a history of diabetes , the use of antidiabetes medications was determined by an affirmative response to at least one of the following questions : are you now taking diabetic pills to lower your blood sugar ( these are sometimes called oral agents or oral hypoglycemic agents ) ? or are you now taking insulin ? individuals who met the criteria for diabetes but answered no to the question other than during pregnancy , have you ever been told by a doctor or health professional that you have diabetes or sugar diabetes ? impaired fasting glucose was defined as a hemoglobin a1c of 5.76.4 % or fasting plasma glucose of 100125 mg / dl ( 10 ) . normal fasting glucose was defined as a hemoglobin a1c 5.7 % and a fasting plasma glucose 100 mg / dl . all individuals who reported using cholesterol - lowering medications were considered to have high ldl - c . also , high ldl - c was defined based on the individual s global chd risk based on the 2004 update of the atp iii guidelines ( 11 ) and their ldl - c level as detailed in supplementary table 1 . we used a goal ldl - c of 100 mg / dl for those with undiagnosed and diagnosed diabetes . those without diabetes who had two or more other chd risk factors and a framingham chd risk score of 1020 % had an ldl - c goal of 100 mg / dl . individuals without diabetes who had two or more chd risk factors and a framingham chd risk score of 10 % had an ldl - c goal of 130 mg / dl . those with less than two chd risk factors had an ldl - c goal of 160 mg / dl . chd risk factors used to determine global risk included older age ( 55 years or older for women and 45 years or older for men ) , current cigarette smoking , hypertension , family history of chd ( history of myocardial infarction or angina before age 50 years among first - degree relatives ) , low hdl - c ( 40 mg / dl ) , or diabetes status . hdl - c 60 mg / dl is considered protective and offsets the presence of one these risk factors . awareness of high ldl - c was defined by an affirmative response to the question have you ever been told by a doctor or other health professional that your blood cholesterol level was high ? use of lipid - lowering treatment was defined by affirmative responses to the following two questions : to lower your cholesterol , have you ever been told by a doctor or other health professional to take prescribed medicine ? andldl - c control was defined based on the individual participant s global cardiovascular risk based on the 2004 update of the atp iii guidelines , as summarized in supplementary table 1 ( 11 ) . government insurance included medicare , medi - gap , medicaid , state children 's health insurance program , military health insurance , indian health service , or a state - sponsored health plan . hypertension was defined as mean systolic blood pressure 140 mmhg , mean diastolic blood pressure 90 mmhg , or a self - reported history of high blood pressure in an individual using medications for high blood pressure . estimated glomerular filtration rate was calculated using the chronic kidney disease epidemiology collaboration equation ( 12 ) . reduced estimated glomerular filtration rate was defined as levels 60 ml / min / 1.73 m. albuminuria was based on the random spot urine sample and was defined as levels 30 mg / g . we calculated descriptive statistics including mean ldl - c levels , the prevalence of high ldl - c , and awareness of high ldl - c by diabetes categories ( normal fasting glucose , impaired fasting glucose , undiagnosed diabetes , and diagnosed diabetes ) . next , we calculated the percent of each diabetes category who were treated among those with high ldl - c as well as among those aware of their high ldl - c . we then calculated the percent of each diabetes category in which ldl - c was controlled among those with high ldl - c as well as among those who were treated for high ldl - c . adults in 20052010 with high ldl - c , as well as the number who were aware of their high cholesterol , treated for high cholesterol , and had their ldl - c controlled . also , we calculated the number of u.s . adults with high ldl - c who were not aware of their diagnosis of high cholesterol , were aware but not treated , were treated but ldl - c was not controlled , and had controlled ldl - c . next , we used poisson regression models to calculate the prevalence ratios for having high ldl - c and awareness , treatment , and control of high ldl - c associated with undiagnosed versus diagnosed diabetes . initial models were unadjusted and age , sex , and race / ethnicity were adjusted . final regression models included adjustment for age , sex , race / ethnicity , income , education , insurance status , smoking status , bmi , hypertension , reduced estimated glomerular filtration rate , and albuminuria . data management was conducted using sas 9.2 ( sas institute , cary , nc ) and all analyses were performed using sudaan 10.1 ( research triangle institute , research triangle park , nc ) , accounting for the complex sampling design of nhanes . these weights adjust for the unequal probabilities of selection of participants , oversampling of certain populations , and participant nonresponse . nhanes sampling weights were recalibrated based on the proportion of participants missing data by 10 - year age group , sex , and race / ethnicity . recalibration of the sampling weights corrects for differences in missing data across age , sex , and race / ethnicity strata , and assumes that data within strata are missing at random . nhanes is conducted by the national center for health statistics of the centers for disease control and prevention . each 2 - year survey includes a sample of the noninstitutionalized u.s . civilian population identified through a stratified multistage probability sampling design . detailed methods of the design and conduct of nhanes are available online ( 7 ) . the protocol for each nhanes was approved by the national center for health statistics of the centers for disease control and prevention institutional review board . informed consent was obtained from each participant . to provide stable estimates , we pooled data from the nhanes 20052006 , 20072008 , and 20092010 . we included adults 20 years of age or older who attended a morning study visit . because we were interested in identifying individuals whose only indication , per atp iii , for an ldl - c goal 100 mg / dl was the presence of diabetes , we excluded individuals with a 10 - year framingham chd risk score 20 % and those with a self - reported history of chd or stroke . data for other chd risk equivalents such as peripheral arterial disease and aortic aneurysm are not available in nhanes 20052010 and therefore are not included in this analysis . individuals who had not fasted for 9 h were missing lipid or glucose values , had triglycerides 400 mg / dl , or who did not answer questions regarding the awareness and treatment of high cholesterol or the awareness of diabetes also were excluded . nhanes collects data through standardized procedures that include questionnaires , a medical examination , and phlebotomy . questionnaires are used to assess age , race / ethnicity , sex , education , annual household income , health insurance status , smoking status , family history of chd , personal history of chd or stroke , and a previous diagnosis of , and treatment for , high blood cholesterol and diabetes . additionally , participants were asked if their cholesterol had ever been checked , where and how recently they have obtained health care , and whether they had been tested for diabetes in the past 3 years . blood pressure was measured three times and height and weight were measured and used to calculate bmi . blood collection and processingare detailed in the nhanes laboratory / medical technicians procedures manual ( 8 ) . plasma glucose , hemoglobin a1c , total cholesterol , hdl cholesterol ( hdl - c ) , and triglycerides were directly measured . participants were categorized based on diabetes status into one of four mutually exclusive categories as follows : 1 ) normal fasting glucose ; 2 ) impaired fasting glucose ; 3 ) undiagnosed diabetes ; and 4 ) diagnosed diabetes . based on guidelines from the american diabetes association ( 10 ) , diabetes was defined as a hemoglobin a1c 6.5 % , fasting plasma glucose 126 mg / dl , or the use of antidiabetes medications in those who reported a history of diabetes . in individuals who reported a history of diabetes , the use of antidiabetes medications was determined by an affirmative response to at least one of the following questions : are you now taking diabetic pills to lower your blood sugar ( these are sometimes called oral agents or oral hypoglycemic agents ) ? or are you now taking insulin ? individuals who met the criteria for diabetes but answered no to the question other than during pregnancy , have you ever been told by a doctor or health professional that you have diabetes or sugar diabetes ? were considered to have undiagnosed diabetes . among individuals without diabetes , impaired fasting glucose was defined as a hemoglobin a1c of 5.76.4 % or fasting plasma glucose of 100125 mg / dl ( 10 ) . normal fasting glucose was defined as a hemoglobin a1c 5.7 % and a fasting plasma glucose 100 mg / dl . all individuals who reported using cholesterol - lowering medications were considered to have high ldl - c . also , high ldl - c was defined based on the individual s global chd risk based on the 2004 update of the atp iii guidelines ( 11 ) and their ldl - c level as detailed in supplementary table 1 . we used a goal ldl - c of 100 mg / dl for those with undiagnosed and diagnosed diabetes . those without diabetes who had two or more other chd risk factors and a framingham chd risk score of 1020 % had an ldl - c goal of 100 mg / dl . individuals without diabetes who had two or more chd risk factors and a framingham chd risk score of 10 % had an ldl - c goal of 130 mg / dl . those with less than two chd risk factors had an ldl - c goal of 160 mg / dl . chd risk factors used to determine global risk included older age ( 55 years or older for women and 45 years or older for men ) , current cigarette smoking , hypertension , family history of chd ( history of myocardial infarction or angina before age 50 years among first - degree relatives ) , low hdl - c ( 40 mg / dl ) , or diabetes status . hdl - c 60 mg / dl is considered protective and offsets the presence of one these risk factors . awareness of high ldl - c was defined by an affirmative response to the question have you ever been told by a doctor or other health professional that your blood cholesterol level was high ? use of lipid - lowering treatment was defined by affirmative responses to the following two questions : to lower your cholesterol , have you ever been told by a doctor or other health professional to take prescribed medicine ? andldl - c control was defined based on the individual participant s global cardiovascular risk based on the 2004 update of the atp iii guidelines , as summarized in supplementary table 1 ( 11 ) . government insurance included medicare , medi - gap , medicaid , state children 's health insurance program , military health insurance , indian health service , or a state - sponsored health plan . hypertension was defined as mean systolic blood pressure 140 mmhg , mean diastolic blood pressure 90 mmhg , or a self - reported history of high blood pressure in an individual using medications for high blood pressure . estimated glomerular filtration rate was calculated using the chronic kidney disease epidemiology collaboration equation ( 12 ) . reduced estimated glomerular filtration rate was defined as levels 60 ml / min / 1.73 m. albuminuria was based on the random spot urine sample and was defined as levels 30 mg / g . we calculated descriptive statistics including mean ldl - c levels , the prevalence of high ldl - c , and awareness of high ldl - c by diabetes categories ( normal fasting glucose , impaired fasting glucose , undiagnosed diabetes , and diagnosed diabetes ) . next , we calculated the percent of each diabetes category who were treated among those with high ldl - c as well as among those aware of their high ldl - c . we then calculated the percent of each diabetes category in which ldl - c was controlled among those with high ldl - c as well as among those who were treated for high ldl - c . adults in 20052010 with high ldl - c , as well as the number who were aware of their high cholesterol , treated for high cholesterol , and had their ldl - c controlled . also , we calculated the number of u.s . adults with high ldl - c who were not aware of their diagnosis of high cholesterol , were aware but not treated , were treated but ldl - c was not controlled , and had controlled ldl - c . next , we used poisson regression models to calculate the prevalence ratios for having high ldl - c and awareness , treatment , and control of high ldl - c associated with undiagnosed versus diagnosed diabetes . initial models were unadjusted and age , sex , and race / ethnicity were adjusted . final regression models included adjustment for age , sex , race / ethnicity , income , education , insurance status , smoking status , bmi , hypertension , reduced estimated glomerular filtration rate , and albuminuria . data management was conducted using sas 9.2 ( sas institute , cary , nc ) and all analyses were performed using sudaan 10.1 ( research triangle institute , research triangle park , nc ) , accounting for the complex sampling design of nhanes . these weights adjust for the unequal probabilities of selection of participants , oversampling of certain populations , and participant nonresponse . nhanes sampling weights were recalibrated based on the proportion of participants missing data by 10 - year age group , sex , and race / ethnicity . recalibration of the sampling weights corrects for differences in missing data across age , sex , and race / ethnicity strata , and assumes that data within strata are missing at random . risk equivalents , 8 % met criteria for diagnosed diabetes and 4 % met criteria for undiagnosed diabetes . in general , those with undiagnosed diabetes were more similar to those with diagnosed diabetes than those with normal or impaired fasting glucose . although 89 % of those with undiagnosed diabetes reported having a regular place for health care and 85 % reported having received health care in the past year , only 67 % reported being tested for diabetes in the past 3 years . those with undiagnosed diabetes had higher mean ldl - c than those with diagnosed diabetes overall and among those who were not being treated for high cholesterol ( table 1 ) . among those treated for high cholesterol , ldl - c levels were similar in subjects with undiagnosed and diagnosed diabetes . characteristics of nhanes participants without chd or chd risk equivalents other than diabetes by diabetes category , 20052010 the awareness , treatment , and control of high ldl - c are depicted in fig . individuals with undiagnosed diabetes had a similar prevalence of high ldl - c as those with diagnosed diabetes . however , those with undiagnosed diabetes were less likely to be aware of their high cholesterol compared with those with normal and impaired fasting glucose and diagnosed diabetes . they also were less likely to be treated for high cholesterol than those with diagnosed diabetes . among those with high ldl - c , ldl - c control was worse for those with undiagnosed diabetes than for those with either impaired fasting glucose or diagnosed diabetes . among those treated for high cholesterol , individuals with undiagnosed diabetes were equally as likely to have their ldl - c controlled as those with diagnosed diabetes but less likely to be at goal when compared with those with normal glucose or impaired fasting glucose . after multivariable adjustment , individuals with undiagnosed diabetes were less likely to be aware of their high ldl - c , be treated for high cholesterol , and among those with high ldl - c , were less likely to be controlled , relative to those with diagnosed diabetes ( table 2 ) . prevalence of high ldl - c and the awareness , treatment , and control of high ldl - c among u.s . adults without chd or chd risk equivalents other than diabetes by diabetes status , nhanes 20052010 . * p 0.05 , with undiagnosed diabetes as referent . among all individuals with high ldl - c . among individuals aware of their diagnoses of high ldl - c . adults with undiagnosed diabetes compared to those with diagnosed diabetes in nhanes participants without chd or chd risk equivalents other than diabetes , 20052010 the number of u.s . adults with high ldl - c and the percent aware of , treated for , and with controlled ldl - c by diabetes status are depicted in fig . adults with undiagnosed diabetes and no history of chd or other chd risk equivalents . of these individuals ,59 % were unaware of their high ldl - c , 13 % were aware but not treated for high cholesterol , 12 % were aware and treated but not at atp iii goals for high ldl - c , and 16 % were aware of , treated for , and achieved ldl - c levels . in contrast , among those with diagnosed diabetes and no history of chd or other chd risk equivalents , only 28 % were unaware of their high ldl - c , 10 % were aware and not treated , 22 % were aware and treated but it was not controlled , and 40 % were aware , treated , and achieved goal ldl - c ( fig . adults with high ldl - c and the number who were aware of , treated for , and whose ldl - c was controlled among u.s . adults without chd or chd risk equivalents other than diabetes by diabetes status , nhanes 20052010 . in this analysis , we demonstrate that more than half of individuals with undiagnosed diabetes who do not have a history of chd or chd risk equivalents have high ldl - c . in addition , these data indicate that undiagnosed diabetes is associated with a lack of awareness of high cholesterol and lower likelihood of treatment and control compared with subjects with diagnosed diabetes . even after multivariable adjustment , those with undiagnosed diabetes were 36 % less likely to be aware of having high ldl - c , 52 % less likely to be treated for it , and 58 % less likely to have their high ldl - c controlled to guideline - recommended levels when compared with those with diagnosed diabetes . adults with undiagnosed diabetes who did not have chd or other chd risk equivalents , only 16 % had their ldl - c treated to atp iii goal . our findings are supported by at least one previous study that has documented individuals with undiagnosed diabetes and a high prevalence of uncontrolled cardiovascular risk factors . ( 13 ) studied the risk factor profiles of individuals with undiagnosed diabetes in nhanes from 1999 to 2008 . in their analyses , individuals with undiagnosed diabetes had a high prevalence of smoking , hypertension , and dyslipidemia . these analyses focused on variations by ethnicity but did not compare those with undiagnosed diabetes to those with diagnosed diabetes . furthermore , awareness , treatment , and control of ldl - c were not examined . our data extend these previous findings by demonstrating that individuals with undiagnosed diabetes are less aware of their high cholesterol and therefore are less likely to be treated for high cholesterol and , as a result , less likely to have their ldl - c controlled than those with diagnosed diabetes , despite similar risk factor profiles . the finding that individuals with undiagnosed diabetes have adverse risk factor profiles is clinically relevant because undiagnosed diabetes is common among individuals presenting with cardiovascular disease . in the atherosclerosis risk in communitiesstudy , in those with undiagnosed diabetes , higher hemoglobin a1c levels were associated with higher degrees of carotid intima - media thickness ( 14 ) . in addition , in a study from germany , 47 % of individuals with diabetes presenting for elective coronary angiography were unaware of their diabetes diagnosis ( 15 ) . in a u.s . study , a total of 28 % of individuals admitted to the hospital for acute coronary syndromes had undiagnosed diabetes ( 16 ) . unfortunately , despite being admitted to the hospital , 65 % of these individuals were not recognized as having diabetes and were not treated as such ( 16 ) . undiagnosed diabetes also has been associated with increased mortality after cardiac surgery ( 17 ) .5 % had undiagnosed diabetes . compared with those with diagnosed diabetes or without diabetes , those with undiagnosed diabetes required more resuscitation , had higher rates of reintubation , had more ventilator days , and had higher perioperative mortality ( 17 ) . ( 17 ) , it would not be surprising if aggressive risk factor modification would reduce cardiovascular events in individuals with undiagnosed diabetes , assuming their diabetes was recognized and appropriate risk factor modification was initiated . one of the clearest implications for making a diagnosis of diabetes is that it would , per the atp iii guidelines , establish the presence of a chd risk equivalent ; in the absence of overt chd or the presence of other chd risk equivalents , this would lower the ldl - c treatment goal to 100 mg / dl ( 3 ) . adults would have their ldl - c goal changed if their diabetes diagnoses were recognized . recent meta - analyses by chen et al . ( 18 ) and costa et al . ( 19 ) have demonstrated that statins significantly reduce cardiovascular events in individuals with diabetes . ( 20 ) and the cholesterol treatment trialists collaborators ( 21 ) strongly support aggressive lowering of ldl - c in individuals with diabetes . a previous study has suggested that identifying individuals with undiagnosed diabetes and instituting appropriate risk factor modification , including treatment of high ldl - c , would result in 510 % absolute risk reduction in chd events over the course of 10 years ( 22 ) . given the millions of u.s . adults with undiagnosed diabetes , this absolute risk reduction means that hundreds of thousands of events could be averted . a disturbing observation in these data are that although 89 % of those with undiagnosed diabetes report having a regular place for health care and 85 % report having received health care in the past year , only 67 % report being tested for diabetes in the past 3 years . this underscores the need to more aggressively identify individuals who are at risk for having diabetes and to appropriately screen these individuals . the failure to identify the diagnosis of diabetes , especially in this sample of u.s . adults with no history of chd and no other chd risk equivalents , represents an important missed opportunity to appropriately risk - stratify these individuals and aggressively lower their ldl - c to guideline - recommended levels . however , among those treated for high cholesterol , individuals with undiagnosed diabetes were as likely as those with diagnosed diabetes to have their ldl - c controlled , suggesting that , if identified , undiagnosed diabetes can be effectively treated . we relied on self - report to define chd , which may have resulted in the inclusion of some individuals with chd in our analysis . in addition , laboratory values for glucose and cholesterol were available from only a single point in time , potentially resulting in some misclassification of participants . we chose to exclude individuals with a self - reported history of chd or other chd risk equivalents , which limits generalizability of our findings to these populations . adults are not adequately classified according to atp iii recommendations solely on the basis of their undiagnosed diabetes . despite these limitations , these include its large population - based sample , the complex survey design that permitted the generation of nationally representative estimates , and the availability of fasting glucose and ldl - c measurements . in summary , undiagnosed diabetes is associated with lack of awareness , treatment , and control of high ldl - c . approximately 5 million u.s . these individuals may not be treated to achieve atp iii defined ldl - c goals in large part as a result of the failure to make the diagnosis of diabetes . strategies to identify individuals at risk for having undiagnosed diabetes and screening these individuals are necessary to appropriately define and achieve atp iii ldl - c treatment targets in these individuals .\noutput:\n" }, { "from": "agent", "value": "objectivediabetes is often undiagnosed , resulting in incorrect risk stratification for lipid - lowering therapy . we conducted a cross - sectional analysis of the national health and nutrition examination survey ( nhanes ) 20052010 to determine the prevalence , awareness , treatment , and control of elevated ldl cholesterol ( ldl - c ) among u.s . adults with undiagnosed diabetes.research design and methodsfasting nhanes participants 20 years of age or older who had 10 - year framingham coronary heart disease ( chd ) risk scores < 20 % and were free of chd or other chd risk equivalents ( n = 5,528 ) were categorized as having normal glucose , impaired fasting glucose , undiagnosed diabetes , or diagnosed diabetes . high ldl - c was defined by the 2004 adult treatment panel ( atp ) iii guidelines.resultsthe prevalence of diagnosed and of undiagnosed diabetes was 8 and 4 % , respectively . mean ldl - c was 102 2 mg / dl among those with diagnosed diabetes and 117 3 mg / dl for those with undiagnosed diabetes ( p < 0.001 ) . the prevalence of high ldl - c was similar among individuals with undiagnosed ( 81 % ) and diagnosed ( 77 % ) diabetes . among individuals with undiagnosed diabetes and high ldl - c , 38 % were aware , 27 % were treated , and 16 % met the atp iii ldl - c goal for diabetes . in contrast , among individuals with diagnosed diabetes and high ldl - c , 70 % were aware , 61 % were treated , and 36 % met the atp iii goal . subjects with undiagnosed diabetes remained less likely to have controlled ldl - c after multivariable adjustment ( prevalence ratio , 0.42 ; 95 % ci , 0.230.80 ) . conclusionsimproved screening for diabetes and reducing the prevalence of undiagnosed diabetes may identify individuals requiring more intensive ldl - c reduction ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: transient focal cerebral ischemia is the most common type of stroke caused by occlusion of a cerebral artery . it causes both acute and chronic dysfunctions in the central nervous system ( cns ) and lowers the quality of life in patients for a long period of lifetime . the middle cerebral artery ( mca ) is most frequently infarcted in the cerebral ischemia , and various animal models have been developed including nonhuman primates and rodents . in the models of transient focal cerebral ischemia , neurons in the ischemic core including cerebral cortex and some parts of the striatum were immediately damaged after the ischemia - reperfusion manipulation , sometimes followed by the delayed neuronal death in the areas apart from the ischemic core , including a part of thalamus , substantia nigra , and hippocampus . they cause various dysfunctions such as cognitive , mood / emotional , and motor impairments in the chronic stage after stroke . among the cns dysfunctions in the chronic stage of cerebral ischemia , depression is one of the major mood / emotional impairments known as poststroke depression ( psd ) . it has been generally recognized that psd occurred in around 40 % of the stroke patients , although it varies depending on the studies from around 20 % to 72 % . because the physical disabilities lowering the activities of daily living are the stressor on the stroke patients , psd has been believed to occur as the result of psychogenic and systemic responses to the stressed conditions with complicated mechanisms of pathogenesis . robinson and price reported their follow - up study of 103 stroke patients with evaluating psd , confirming that the lesion location ( frontal area in the left hemisphere and posterior area in the right hemisphere ) determined frequency and severity of depression . it was the first study suggesting the psd pathogenesis as a neurodegenerative lesion in a particular brain area . now , psd pathogenesis is considered to be multifactorial with neurodegenerative , psychogenic , and genetic mechanisms . animal models of psd have been reported especially using rodents , mostly combining a surgical operation ( mca occlusion ) with application of extra stressors such as unpredicted chronic mild stress ( ucms ) , ovariectomy , and spatial restraint stress . among various symptoms seen in psd , anhedonia is one of the typical ones : loss of interest or pleasure in almost all the activities and things that one previously liked . pathogenesis of anhedonia includes brain areas such as orbitofrontal cortex , nuclear accumbens , and ventral pallidum . a recent study reported a positive correlation between the postischemic anhedonia with salivary cortisol levels and reduction of volume by lesion in parahippocampal / hippocampal area . hippocampus is one of the vulnerable areas to the ischemic stress , showing delayed neuronal death in ca1 region within a few days to a week after mca occlusion ( mcao ) . because hippocampus is deeply related to higher brain functions such as cognition , learning , and memory , ca1 degeneration causes functional impairments of them after stroke . different from ca1 , other regions such as ca3 and dentate gyrus ( dg ) in the hippocampus are considered to be resistant to the ischemic stress . the neurogenesis in subgranular zone ( sgz ) of dg as well as cortical subventricular zone ( svz ) produces newly generated neurons even in adulthood and is known to increase neural stem cells ( nscs ) proliferation and differentiation into neurons after the transient brain ischemia . because the rats that received ucms after mcao treatment had reduced neurogenesis in dg , it was considered as an adaptive or a compensatory process against the poststroke stressors . proliferation and differentiation of nscs in sgz are controlled by various factors such as stress , mood / emotion , environment , corticosteroids , and antidepressants . based on these backgrounds , we initially examined whether anhedonia could be spontaneously induced after mcao in rats while observing them for up to 30 weeks together with the effects of antidepressant imipramine ( imp ) or fluvoxamine ( flv ) in this study . the reason why we chose anhedonia rather than other depression - related behaviors such as the forced swimming or tail suspension was to minimize the negative effects of the motor impairments directly influenced by mcao . we also evaluated the long - term neurodegenerative changes of the hippocampal dg , including apoptosis of the granular cells ( gc ) and the neurogenesis in sgz , with the effects of imp . young male sd rats weighing 200250 g at 6 weeks of age were purchased from nihon slc , co. , shizuoka , japan . they were housed in a controlled environment ( 231c , 505 % humidity ) and were allowed food and tap water ad libitum and habituated for 2 weeks before the surgical operation . the room lights were on between 8:00 and 20:00 ( illuminated with 950 lux ) . the procedure of the surgical operations for transient mcao was described in our previous publications . in brief , the right middle cerebral artery of the rat was occluded for 90 min by inserting a silicone - coated 4 - 0 monofilament after the right carotid artery was exposed and separated into the internal and the external ones with careful conservation of the vagus nerve under anesthetization with 2 % halothane in a mixture of 30 % oxygen and 70 % nitrous oxide . one day after the reperfusion of blood flow by withdrawing the filament , animals that showed grade 3 or over of hunter 's neurological score were used for further experiments . to examine the behavioral changes after the surgical operation for 30 weeks , 40 rats were divided into 4 groups : sham , sham + antidepressants , mcao , and mcao + antidepressants ( n = 10 / group , total , another 80 rats were divided equally into two groups of sham and mcao , and 5 rats / group were sacrificed at 1 day ( 1 d ) , 3 days ( 3 d ) , 1 week ( 1 w ) , 2 weeks ( 2 w ) , 6 weeks ( 6 w ) , 20 weeks ( 20 w ) , and 30 weeks ( 30 w ) after the surgical operation . nave animal ( n = 5 ) means the rats fixed without any surgical operation at 8 weeks of age . all handling and procedures of animal experiments were performed in accordance with the national institutes of health guide for the care and use of laboratory animals ( nih publications number 8023 , revised 1978 ) and approved by the committee for animal experiments of tokushima university . from 1 week after mcao , the antidepressant imipramine hydrochloride or a selective serotonin reuptake inhibitor ( ssri ) fluvoxamine maleate ( sigma , st . louis , mo , usa ) was dissolved directly in tap water based on the daily amount of water consumption so that the rats could absorb the drugs with 20 mg / kg / day . the doses were determined based on the previous reports . for drug administration , we avoided a direct handling procedure such as intraperitoneal injection to minimize any noxious stressor on rats after mcao . for habituation during one week before mcao , animals were exposed to water containing 1 % sucrose twice for 2 successive days separated by a 2 - day interval substituted by normal tap water . the tests were performed at 1 w , 2 w , 6 w , 20 w , and 30 w after mcao during the dark period ( 20:008:00 ) with presenting two bottles of water simultaneously ( one was normal while the other one contained 1 % sucrose ) , and the percentage of sucrose preference was calculated as ( sucrose water intake ) / ( total water intake ) . this test was performed to evaluate the spontaneous activity of the rats at 1 w , 2 w , 6 w , 20 w , and 30 w after mcao . the rats were put in an open field ( 50 cm 50 cm , divided into 25 squares of 10 cm 10 cm by line grids ) under the 950 - lux illumination for 10 min and were recorded by a video camera set at 60 cm high above the field . the number of stepping instances over the grids was counted as the horizontal activity , and the number of rearing instances was counted as the vertical activity , by an examiner unaware of the grouping details . the procedure of the immunohistochemical examinations was followed essentially by the previous studies in our laboratory . rats were anesthetized with intraperitoneal injection of 50 mg / kg of sodium pentobarbital solution at 1 d , 3 d , 1 w , 2 w , 6 w , 20 w , and 30 w after mcao , flashed with 1 % heparin - containing saline , and fixed with perfusion of 4 % paraformaldehyde ( wako , osaka , japan ) in phosphate buffered saline ( pbs , ph 7.4 , 137 mm nacl , 2.7 mm kcl , 10 mm na2hpo4 , and 10 mm kh2po4 ) . one day after the fixation , brains were excised out and kept in the same fixative solution for one night . the fixed brains were washed with pbs for 1 hr 3 times and dehydrated in ethanol ( 70 , 80 , 95 , and 100 % ) and then embedded in paraffin . the coronal sections of the dorsal hippocampus ( between bregmata 2.5 mm and 4.5 mm ) with 5 m thickness were sliced out by a sliding microtome ( tu - 213 , yamato , saitama , japan ) , and 4 slices / animal ( for one primary antibody ) were taken out from each of the 0.5 mm ranges and mounted on the slide glasses . for deparaffinization , the slices were heated at 59c for 1 hr , treated with xylene , ethanol , and dh2o , and then served for the immunohistochemical examinations . they were washed with pbs for 3 min 3 times and incubated with the blocking solution containing 10 % normal horse serum ( vector labs , ca , usa ) and 0.3 % triton x-100 in pbs for 60 min at room temperature . for the primary antibodies of immunostaining , anti - neuronal nuclei ( neun , monoclonal , chemicon - millipore , ca , usa , 1 : 200 ) , anti-iii - tubulin ( monoclonal , abcam , ma , usa , 1 : 400 ) , anti - map2 ( monoclonal , abcam , ma , usa , 1 : 1500 ) , anti - bax ( polyclonal , santa cruz , ca , usa , 1 : 100 ) , anti - bcl - 2 ( monoclonal , lab vision , nd , usa , 1 : 50 ) , anti - nestin ( monoclonal , chemicon , ca , usa , 1 : 500 ) , anti - ki67 ( polyclonal , abcam , ma , usa , 1 : 400 ) , and anti - doublecortin ( dcx , polyclonal , abcam , ma , usa , 1 : 1000 ) were used . they were diluted in the blocking solution and incubated with the slices for one night at 4c . the slices were washed with pbs for 3 min 3 times before incubating with the secondary antibody . to visualize the bound primary antibodies , a vectastain elite abc kit and 3,3 - diaminobenzidine ( dab ) substrate kit ( vector labs , ca , usa ) were used according to the manufacturer 's protocol . as negative control sections , each primary antibody or the secondary antibody was omitted . all the slices on the slide glasses were covered by cover glasses with vectashield mounting medium ( vector labs , ca , usa ) . they were observed and recorded with a digital camera - equipped bx51 light microscope ( olympus , tokyo , japan ) at a magnitude of 12.5 x ( cresyl violet ) or 200x ( neun , bax , bcl - 2 , and dcx ) or 400x ( iii - tubulin , map2 , nestin , and ki67 ) . to detect anti - cleaved caspase - 3 antibody ( polyclonal , bio vision , ca , usa , 1 : 100 ) , tsa system with fitc kit ( ge health science , ma , usa ) combined with hchst 33258 ( invitrogen , or , usa ) nuclear stainingthe images were observed and captured with lsm510 confocal laser scanning microscope system ( carl zeiss , heidelberg , germany ) at a magnitude of 200x using zen 2009 interface with line mode , 3 m thickness of pinhole setting , and 4 averaging with scan speed 4 ( 2 min , 5 sec ) . the images of dg from 4 slices / animal were captured and analyzed using a computer - associated image analyzer ( winroof version 5 ; mitani corporation , fukui , japan ) by an examiner who was not aware of the grouping details . images from one slice were collected from both ipsi - and contralateral dg so that 70 % or more of the area of gcl could be examined . we defined the granular cell layer ( gcl ) in each image with 100 m width and sgz at the inner edge of gcl with 20 m width and measured the defined area as mm automatically with the analyzer . the number of cresyl violet - stained or immunopositive cells ( neun , cleaved caspase - 3 , bax , bcl - 2 , nestin , ki67 , and dcx ) or % immunopositive density ( iii - tubulin and map2 ) in each image was measured , summed up for 4 slices / animal , and was calculated as per mm of the measured area in each animal . all the data are given as means standard error of mean ( sem ) . the following analysis was used : behavioral examinations , two - way ( time , group ) analysis of variance ( anova ) followed by scheffe post hoc test at each time point ; immunohistochemical examinations of the time course analysis , two - way ( time , group ) anova followed by tukey - kramer post hoc test ( nissl , neun , iii - tubulin , map2 , nestin , ki67 , and dcx ) or unpaired t - test ( cleaved caspase - 3 , bax , and bcl - 2 ) at each time point ; immunohistochemical examinations with imp at 30 weeks after the surgical operation , one - way ( group ) anova followed by tukey - kramer post hoc test ; comparisons of two independent groups , unpaired t - test . all of the analysis was done using statview ver . 5.0 ( sas institute , usa ) . we first examined whether depression - related behavior anhedonia would be spontaneously expressed after mcao in rats . normal rats usually show 8090 % of sucrose preference ( 87.92.8 % at 30 weeks in sham ) , as shown in figures 1 ( a ) and 1 ( b ) ( open symbols ) . mcao - operated rats ( closed symbols ) tended to less prefer sucrose containing water compared to sham groups ( open symbols ) throughout the time course after mcao . interestingly , sucrose preference was further decreased significantly at 20 and 30 weeks after mcao to around 5060 % ( 56.84.5 % at 30 weeks in mcao , p 0.01 versus sham ) , and it was prevented by chronic administration of imp ( figure 1 ( a ) , 78.93.8 % at 30 weeks in mcao + imp , p 0.05 versus mcao ) or flv ( figure 1 ( b ) , 76.72.2 % in mcao + flv at 30 weeks , p 0.05 versus mcao ) significantly . daily amount of water consumption was decreased significantly to around 60 % in mcao - operated rats ( 59.23.3 ml in sham versus 33.71.8 ml in mcao at 30 weeks , p 0.01 ) and was not prevented by chronic imp treatment ( figure 1 ( c ) , 34.43.1 ml in mcao + imp at 30 weeks , p 0.05 versus mcao ) . the body weight of the mcao - operated rats initially decreased significantly ( 230.13.7 g in sham versus 170.45.3 g in mcao at 3 days , p 0.01 ) and stayed lower than sham groups until around 6 weeks after mcao and then gradually recovered and was almost the same as sham group at 30 weeks ( figure 1 ( d ) : 487.46.2 g in sham versus 485.27.1 g in mcao at 30 weeks , p 0.05 ) . chronic imp treatment did not affect them after mcao ( 465.97.3 g in mcao + imp at 30 weeks , p 0.05 versus mcao ) . the rats given flv also showed similar results to figures 1 ( c ) and 1 ( d ) ( data not shown ) . we next examined the spontaneous activity of rats with open field test ( figures 1 ( e ) and 1 ( f ) ) . it revealed that both horizontal and vertical activities of mcao - operated rats ( closed symbols ) were decreased significantly compared to sham groups ( open symbols ) . however , they gradually recovered and reached a similar level to that of sham group at 30 weeks after mcao ( figures 1 ( e ) and 1 ( f ) : horizontal activity , 103.44.3 in sham versus 77.65.8 in mcao , p 0.05 ; vertical activity , 30.11.2 in sham versus 23.52.2 in mcao , p 0.05 ) . chronic imp treatment did not affect them ( figures 1 ( e ) and 1 ( f ) : horizontal activity , 83.24.9 in mcao + imp , p 0.05 versus mcao ; vertical activity , 24.21.8 in mcao + imp , p 0.05 versus mcao ) . similar results with flv - treated rats were observed ( data not shown ) . in the paraffin sections prepared from the brains at 30 weeks after mcao , dg of the dorsal hippocampus was observed with cresyl violet staining ( figure 2 ) . we noticed that the shape of gcl was shrunk specifically in the slices prepared from mcao - operated ipsilateral hippocampus ( figure 2 ( b ) ) . time course analysis of the cresyl violet - stained cells revealed the significant loss of the cells in gcl observed at 20 and 30 weeks after mcao ( figure 3 ( b ) : 4699.6119.2 cells / mm in sham versus 3561.8177.3 cells / mm in ipsilateral mcao at 30 weeks , p 0.01 ) , and it was prevented by chronic administration of imp from 1 week to 30 weeks after mcao ( figure 3 ( c ) : 4531.0262.5 cells / mm in ipsilateral mcao + imp , p 0.05 versus ipsilateral mcao ) . we also quantified the number of the cells in which the condensed cytosol was observed with cresyl violet staining at 30 weeks after mcao ( f5 ,24 = 1.67 , one - way anova followed by tukey - kramer post hoc test ) . compared with sham ( 102.714.7 cells / mm ) , mcao tended to increase the condensed cells in both ipsi - and contralateral gcl without statistical significance ( 147.59.6 cells / mm in ipsilateral mcao and 129.216.7 cells / mm in contralateral mcao , p 0.05 versus sham ) , and imp did not reverse them ( 137.414.8 cells / mm in ipsilateral mcao + imp and 133.221.4 cells / mm in contralateral mcao + imp , p 0.05 versus sham ) . because loss of gc in dg after ischemia had never been reported yet , we examined neun immunoreactivity as a marker of the matured neurons in gcl ( figure 4 ) . similar to the result of cresyl violet staining in figure 3 , time course analysis revealed that the number of neun immunopositive cells in gcl was decreased at 20 and 30 weeks after mcao significantly ( figure 4 ( b ) : 4401.0110.4 cells / mm in sham versus 3230.9235.8 cells / mm in ipsilateral mcao at 30 weeks , p 0.01 ) and the decrease was prevented by chronic imp treatment for 29 weeks after mcao ( figure 4 ( c ) : 4169.8287.5 cells / mm in ipsilateral mcao + imp , p 0.05 versus ipsilateral mcao ) . we further examined other antibodies for the neuronal markers iii - tubulin and map2 ( figures 5 and 6 ) in gcl with measuring % density of the immunoreactive area . immunoreactivity of iii - tubulin in ipsilateral gcl started to decrease at 6 weeks after mcao ( figure 5 ( b ) : 18.80.90 % in sham versus 14.60.61 % in ipsilateral mcao , p 0.05 ) and further decreased at 20 and 30 weeks ( 12.40.48 % , p 0.01 versus sham ) , and it was reversed by chronic imp treatment ( 15.70.72 % , p 0.01 ) . similar results were obtained from the examination of map2 immunoreactivity ( figure 6 ) . at30 weeks after the surgical operation , 19.60.50 % in sham was decreased to 14.20.51 % in ipsilateral mcao ( p 0.01 ) , and chronic imp treatment prevented it ( 17.01.20 % , p 0.05 versus sham ) . all of these data indicated the degenerative loss of gc in the ipsilateral dg at chronic stages after mcao . in section 3.3 , we showed that delayed neuronal loss occurred in the ipsilateral gcl of the hippocampal dg at chronic stages after mcao . to examine whether the degenerative loss of gc involved neuronal apoptosis , we next performed immunostaining of cleaved caspase - 3 , which executes apoptosis . we analyzed the ipsilateral gcl and sgz separately to distinguish the matured neurons and the other cells including nscs in dg . in gcl , the number of cleaved caspase - 3 immunopositive cells was significantly increased at 2 through 30 weeks of mcao ( figure 7 ( b ) : 17.71.44 cells / mm in sham versus 55.14.76 cells / mm in mcao at 30 weeks , p 0.01 ) and the decrease was mostly prevented by chronic imp treatment at 30 weeks after mcao ( figures 7 ( a ) and 7 ( d ) : 19.81.01 cells / mm in mcao + imp at 30 weeks , p 0.01 versus mcao ) . in contrast , the number of cleaved caspase - 3 immunopositive cells in sgz was initially increased at 3 days ( 49.33.03 cells / mm in sham versus 65.13.71 cells / mm in mcao , p 0.05 ) and then decreased at 6 through 30 weeks of mcao ( figure 7 ( c ) : 52.33.73 cells / mm in sham versus 32.23.48 cells / mm in mcao at 30 weeks , p 0.01 ) , and chronic imp treatment tended to prevent it ( figure 7 ( e ) : 40.61.79 cells / mm , p 0.05 versus sham ) . it is notable that the number of cleaved caspase - 3 immunopositive cells in sgz was much higher than that of gcl in sham groups , whereas it was reversed after 20 and 30 weeks of mcao , suggesting the increased apoptosis of the matured gc and decreased apoptosis of nscs in dg after mcao . related to the increased apoptosis in the ipsilateral gcl , we characterized the immunoreactivities of bax as a marker of death signaling and bcl - 2 as a marker of survival signaling in dg using specific antibodies for them ( figures 8 and 9 , supplementary figures 1 and 2 in supplementary material available online at http://dx.doi.org/10.1155/2016/5054275 ) . in the ipsilateral gcl , bax immunoreactivity increased transiently at 1 day after mcao ( figure 8 ( b ) : 11.92.23 cells / mm in sham versus 53.72.38 cells / mm in mcao , p 0.01 ) , returned to the sham level in 3 days , and then increased again and stayed higher than the sham group significantly at 1 through 30 weeks of mcao ( figure 8 ( b ) : 14.72.47 cells / mm in sham versus 57.44.78 cells / mm in mcao at 30 weeks , p 0.01 ) . the increased bax was not prevented by chronic imp treatment at 30 weeks after mcao ( figure 8 ( d ) : 47.85.29 cells / mm in mcao + imp , p 0.01 versus sham ) . in the ipsilateral sgz , bax immunoreactivity showed a biphasic increase with its initial peak at 13 days ( figure 8 ( c ) : 77.73.52 cells / mm at 1 day , p 0.01 ) and the second peak at 2 weeks ( 49.45.70 cells / mm , p 0.05 ) and then returned to the sham level and was lower than sham at 30 weeks after mcao ( 24.52.97 cells / mm , p 0.05 ) . chronic imp treatment tended to prevent this decrease at 30 weeks ( figure 8 ( e ) : 34.84.66 cells / mm , p 0.05 versus sham ) . the same analysis was performed in the contralateral dg ( supplementary figure 1 ) . different from the ipsilateral gcl , bax immunoreactivity in the contralateral gcl only showed the initial increase at 1 day ( supplementary figure 1b : 16.72.98 cells / mm in sham versus 61.95.38 cells / mm in mcao , p 0.01 ) and returned to the basal level at 3 days through 30 weeks after mcao , and chronic imp treatment had no effect on it ( supplementary figure 1d ) . the contralateral sgz showed a similar time course change to the ipsilateral sgz , although it only had a significant increase at 1 and 3 days after mcao ( supplementary figure 1c : 28.54.31 cells / mm in sham versus 73.313.80 cells / mm in mcao at 1 day , p 0.01 ) and returned to the sham level at 1 week through 30 weeks after mcao . immunoreactivity of bcl - 2 in the ipsilateral gcl ( figure 9 ( b ) : 47.01.50 cells / mm in sham throughout the time course ) showed a biphasic increase with two peaks at 1 day ( 182.410.7 cells / mm , p 0.01 ) and 2 weeks ( 79.48.99 cells / mm , p 0.05 ) after mcao . however , it was significantly lower than sham at 1 , 6 , 20 , and 30 weeks ( 22.82.04 cells / mm at 30 weeks , p 0.01 ) , and chronic imp treatment normalized it at 30 weeks ( figure 9 ( d ) : 52.22.15 cells / mm , p 0.05 versus mcao ) . similar time course change of bcl - 2 to gcl was observed in the ipsilateral sgz with two peaks at 1 day ( 121.67.11 cells / mm , p 0.01 ) and 2 weeks ( 85.26.38 cells / mm , p 0.05 ) after mcao ( figure 9 ( c ) ) . as was in gcl , it was significantly lower than sham at 1 and 6 weeks , although it returned to the sham level at 20 and 30 weeks after mcao , and there was no difference between sham and mcao groups with or without imp ( figure 9 ( e ) ) . in the contralateral gcl ( supplementary figure 2b : 45.91.68 cells / mm throughout the time course in sham ) , it also showed a biphasic increase with two peaks at 1 day ( 268.16.60 cells / mm , p 0.01 ) and 2 weeks ( 139.325.2 cells / mm , p 0.01 ) . different from the ipsilateral gcl , it never dropped below the sham level throughout the time course . at 30 weeks after mcao , there was no significant difference between sham and mcao with or without chronic imp treatment ( supplementary figure 2d ) . similar result was obtained from the contralateral sgz ( supplementary figures 2c and 2e ) . from these results of bax and bcl - 2 , we calculated bax / bcl - 2 ratio to see how the death and the survival signaling were changed after mcao in gcl and in sgz ( figure 10 ) . in the ipsilateral gcl ( figure 10 ( a ) , closed triangle ) , it exceeded 1.0 at 6 through 30 weeks after mcao , suggesting that the death signaling was dominant in chronic stages . in contrast , the index in sgz ( figure 10 ( b ) ) increased at early stages after mcao , exceeded 1.0 at 3 days and 1 week , and returned to the normal level at 2 through 30 weeks after mcao . in the contralateral gcl and sgz ( open triangle ) , it kept below 1.0 as was in sham ( open square ) throughout the time course for 30 weeks after mcao . we further analyzed the proliferation and development of nscs in sgz because they are well related to mood , depressiveness , and effects of antidepressants . in mcao rats , immunoreactivity of nscs marker nestin increased transiently at 3 days and 1 week after mcao in both the ipsilateral and contralateral sgz of dg ( figure 11 ( b ) at 3 days : 58.44.13 cells / mm in sham ; 101.47.55 cells / mm in ipsilateral sgz , p 0.01 versus sham ; 88.47.18 cells / mm in contralateral sgz , p 0.05 versus sham ) and then decreased and reached almost 50 % of sham group ( at 30 weeks : 29.92.12 cells / mm in ipsilateral mcao , p 0.01 versus sham ; 36.13.5 cells / mm in contralateral mcao , p 0.01 versus sham ) . chronic imp treatment for 29 weeks significantly prevented the decrease of nestin - positive cells observed in ipsilateral mcao group at 30 weeks ( 39.91.47 cells / mm , p 0.05 versus mcao ) , although they were still lower than those of sham group significantly ( figure 11 ( c ) ) . ki67 immunoreactivity increased transiently with its peak at 3 days after mcao ( figure 12 ( b ) at 3 days : 50.46.29 cells / mm in sham ; 175.912.8 cells / mm in ipsilateral sgz , p 0.01 versus sham ; 90.15.12 cells / mm in contralateral sgz , p 0.05 versus sham ) and then decreased and stayed with a few cells per mm at 6 through 30 weeks ( figure 12 ( b ) at 30 weeks : 6.400.79 cells / mm in ipsilateral mcao , p 0.01 versus sham ; 8.512.55 cells / mm in contralateral mcao , p 0.01 versus sham ) . chronic imp treatment significantly prevented the decreased ki67 immunoreactivity at 30 weeks after mcao in all groups , although they were still around 50 % of sham group ( figure 12 ( c ) : 16.51.98 cells / mm in ipsilateral mcao + imp ; 24.16.05 cells / mm in contralateral mcao + imp ; p 0.05 versus its corresponding mcao ) . although we analyzed entire gcl , most of the immunopositive cells are found around sgz . as was observed in nestin and ki67 , it also increased in early stages with its peak at 1 week ( figure 13 ( b ) at 1 week : 58.23.39 cells / mm in sham ; 124.95.54 cells / mm in ipsilateral sgz ; 97.55.36 cells / mm in contralateral sgz , p 0.01 versus sham ) and then decreased and stayed lower than sham significantly at 6 through 30 weeks after mcao ( figure 13 ( b ) at 30 weeks : 14.42.21 cells / mm in ipsilateral mcao ; 14.81.30 cells / mm in contralateral mcao , p 0.01 versus sham ) . chronic imp treatment significantly prevented the decreased dcx immunoreactivity at 30 weeks in mcao groups , although they were not normalized as sham group ( figure 13 ( c ) : 26.21.83 cells / mm in ipsilateral mcao + imp ; 29.13.84 cells / mm in contralateral mcao + imp ; p 0.05 versus its corresponding mcao ) . here we characterized a possible animal model of the postischemic depression after the transient mcao in rats with a behavioral and an immunohistochemical analysis . our findings in this study are as follows : ( i ) we observed spontaneous aggravation of anhedonia in mcao - operated rats at chronic stages ( 20 and 30 weeks ) after mcao , which was prevented by chronic imp or flv treatment ; ( ii ) this aggravation of anhedonia associated with delayed neuronal death of the granular neurons specifically in the ipsilateral dg , suggesting it would be a part of cellular and molecular pathophysiological mechanisms ; ( iii ) the increased proliferation of nscs and the following neural development in sgz at early stages after mcao were decreased significantly at chronic stages with almost ceased nscs proliferation ; ( iv ) the neurodegenerative changes in dg were prevented by chronic imp treatment . in the following , we discuss these subjects in further detail . from many previous studies combining mcao and additional stressor in rodents , it is strongly suggested that the stress vulnerability after stroke is increased significantly . without adding any contemplated stress , boyko et al . reported % sucrose preference in permanent mcao rats ( operated on at 20 weeks of age and examined at 3 weeks after mcao ) decreased to around 60 % , together with the increased immobility in fst and decreased responses in the shuttle avoidance task . craft and devries reported that the transient ischemia model of mice showed anhedonia with around 50 % sucrose preference at 7 days after the surgical operation and was rescued by administration of an antagonist of interleukin - 1 ( il - 1 ) receptor . although both of them did not examine the time course change of anhedonia nor effect of antidepressants on it , these reports with our results in figures 1 ( a ) and 1 ( b ) showed that psd in rodents could be induced after mcao without combining extra stressor stimuli . sensitivity of the experimental anhedonia to antidepressants should carefully be examined because as shown in figures 1 ( a ) and 1 ( b ) , lessor sucrose preference in mcao rats was observed throughout the time course from 1 day to 6 weeks after mcao , and it was insensitive to imp or flv . it should also be noted that the decreased amount of daily water consumption in mcao rats was not rescued by imp nor by flv , suggesting that some hypothalamic functions controlling water intake may be affected after mcao . because of this reason , we had to increase the concentration of antidepressants in the drinking water of mcao rats so that they take the same amount of antidepressants as sham rats . to avoid this issue , use of an osmotic minipump , for example , would be examined in further studies . as mentioned in the introduction , delayed neuronal death of the hippocampal ca1 pyramidal neurons after ischemia has been well characterized , and other regions such as ca3 and dg were thought to be resistant to ischemic stress . in this study , however , we demonstrated delayed neuronal death of the granular neurons in dg at chronic stages after mcao for the first time , which was consistent with the time course of the aggravation of anhedonia ( figures 1 ( a ) , 26 ) . considering the increased immunoreactivities of cleaved caspase - 3 and bax together with decreased bcl - 2 at chronic stages in the ipsilateral gcl ( figures 79 ) , it seems that the death signal exceeded the survival signal in gcl after 1 week of mcao ( figure 10 ) , resulting in the increased apoptotic neuronal death of the matured gc . the increased bax after 1 week stayed higher than that of sham , whereas bcl - 2 significantly decreased compared to sham in those periods , suggesting that the death signal exceeded the survival signal . further studies are required to identify what kind of molecular factor triggers this neurodegenerative condition . one possible mechanism is the increase of the inflammatory factors such as tumor - necrosis factor ( tnf ) , il - 1 , il - 6 , and inos from glial cells . in fact , trimethyltin was reported to induce selective loss of granular neurons in dg with activating tnf - mediated apoptotic signaling . other possible molecular candidates are the decreased trophic factors such as brain - derived neurotrophic factor ( bdnf ) , nerve growth factor ( ngf ) , and vascular endothelial growth factor ( vegf ) . bdnf expression in psd animals has been examined by researchers . considering the neuronal activity - dependent production of neurotrophic factors , it is also possible that the brain areas innervating dg such as the entorhinal cortex might be damaged after mcao with decreasing the neuronal input to dg ; thus it reduced the neuronal activities of dg , resulting in the loss of neurotrophic conditions . further electrophysiological , neurochemical , and immunohistochemical examinations will explore the detailed pathological mechanisms of the neurodegeneration in the ipsilateral dg after mcao . increased proliferation of nscs after ischemic event in sgz was reported previously . it was also indicated that the proliferated nscs differentiated into mature neurons and integrated in gcl . in fact , our results of nestin , ki67 , and dcx immunostaining at early stages after mcao ( figures 1113 ) were consistent with these reports . although this initial increase is thought to be important to keep the number of mature gc after mcao for at least 20 weeks , it did not last for 2 weeks and dropped under the sham levels after 6 weeks of mcao in our observations ( figures 1113 ) . it seemed that nscs in sgz after 6 weeks of mcao escaped from cell cycle and stayed quiescent . the decreased apoptosis in sgz after 20 weeks of mcao also supports this idea ( figures 7 and 8 ) . different from the loss of gc specifically observed in the ipsilateral gcl , time course changes of nscs were observed in both ipsi - and contralateral sides of sgz , suggesting that they were controlled by systemic regulatory mechanisms such as glucocorticoids released according to the activation of hypothalamic - pituitary - adrenal ( hpa ) axis . gc with condensed cytosol stained by cresyl violet also tended to increase in both ipsi - and contralateral dg ( see section 3.3 , 2nd paragraph ) . together with the apoptotic loss of the ipsilateral gc , the suppressed neurogenesis of the bilateral sgz would also contribute to the aggravation of anhedonia as a result of response to the psychogenic stressor triggered by such motor impairments . because both imp and flv prevented aggravation of anhedonia after 20 weeks of mcao ( figure 1 ) , flv is a ssri , which primarily increases serotonin and dopamine together with stimulating sigma - 1 receptor . . showed decreased sucrose preference , increased immobility in forced swim and tail suspension tests , and exacerbated neurological functions with reduced body weight by combining mcao and spatial restraint stress in mice . they also showed the decreased serotonin and dopamine levels in hypothalamus , hippocampus , and cortex in their psd mice , which were reversed by chronic imp treatment . thus , psd is thought to imply decreased serotonin and dopamine levels in brain with increased cortisol level in serum . based on the results of bax and bcl - 2 analysis shown in figures 8 and 9 , chronic imp treatment seemed to stimulate the survival signal rather than suppressing the death signal in gcl . neuroprotective effect of antidepressants was suggested to mediate bdnf - cyclic amp responsive element - binding ( creb ) protein pathway in a previous report , and this could be one possible molecular mechanism to keep gc alive by antidepressants after mcao . antidepressants including imp and flv are also known to stimulate proliferation of nscs in sgz , thus promoting the increase of adult neurogenesis . it is understood to be one of the essential mechanisms for the effects of antidepressants . in fact , our results in figures 1113 showed that imp tended to stimulate the proliferation of nscs , although it did not normalize to the sham level in mcao groups in our experimental condition . considering our time course data of both apoptosis and neurogenesis with the effect of antidepressants , favorable timing for the onset of antidepressant treatment on psd seems to be within 2 weeks after mcao , although it should be carefully examined with considering the species difference between rodents and humans . moreover , effects of antidepressants after establishing anhedonia should be examined in our future study , because it will clarify whether antidepressants have therapeutic potency in addition to neuroprotective effects in our psd model . spontaneous aggravation of anhedonia was observed at the chronic stage in a rat model of transient cerebral focal ischemia . it associated with the neurodegenerative changes in the hippocampal dentate gyrus : apoptotic neuronal loss of the granular cells and decreased proliferation of the neural stem cells . our study provides new insights into the pathophysiological mechanisms of poststroke depression and effective use of antidepressants on it .\noutput:\n" }, { "from": "agent", "value": "poststroke depression is one of the major symptoms observed in the chronic stage of brain stroke such as cerebral ischemia . its pathophysiological mechanisms , however , are not well understood . using the transient right middle cerebral artery occlusion - ( mcao - , 90 min ) operated rats as an ischemia model in this study , we first observed that aggravation of anhedonia spontaneously occurred especially after 20 weeks of mcao , and it was prevented by chronic antidepressants treatment ( imipramine or fluvoxamine ) . the anhedonia specifically associated with loss of the granular neurons in the ipsilateral side of hippocampal dentate gyrus and was also prevented by an antidepressant imipramine . immunohistochemical analysis showed increased apoptosis inside the granular cell layer prior to and associated with the neuronal loss , and imipramine seemed to recover the survival signal rather than suppressing the death signal to prevent neurons from apoptosis . proliferation and development of the neural stem cells were increased transiently in the subgranular zone of both ipsi - and contralateral hippocampus within one week after mcao and then decreased and almost ceased after 6 weeks of mcao , while chronic imipramine treatment prevented them partially . overall , our study suggests new insights for the mechanistic correlation between poststroke depression and the delayed neurodegenerative changes in the hippocampal dentate gyrus with effective use of antidepressants on them ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it has been well - documented that increased infiltration of immune cells into tumor masses can result in physical destruction of the targeted tumor cells , with a concomitant reduction in tumor burden and improvement in patient prognosis 1 - 4 . paradoxically , it is equally well - documented that pre - invasive epithelial tumors with increased immune cell infiltration have a significantly higher frequency of progression to invasive lesions than their stage - and histopathologically - matched counterparts lacking distinct immune cell infiltrates 5 - 7 . in addition , a number of in vitro studies have suggested that tumor infiltrating immune cells can promote tumor invasion and metastasis through a number of mechanisms 8 - 12 . unfortunately , the direct impact of tumor - infiltrating immune cells and the factors that regulate their ability to either inhibit or promote neoplastic progression remain elusive , making it difficult to judge the clinical significance of tumor - infiltrating immune cells . as all normal epithelial tissues and in - situ tumors are physically surrounded by a dense continuous capsule that must be breached before physical contact between tumor and immune cells can occur , or before tumor invasion and metastasis can proceed 13 - 15 , we have speculated that the apparent contradiction in the direct impact of tumor infiltrating immune cells may result primarily from the differences in tumor stages and physical locations of infiltrating immune cells . it has been well documented that all the primary infiltrating immune cells , including cytotoxic t - lymphocytes ( ctl ) , natural killer ( nk ) cells , leukocytes , macrophages , and mast cells , have to physically contact their targets in order to exert their cytotoxic functions 16 - 21 . thus , it is likely that infiltrating immune cells are initially recruited to the tumor site by focal tumor capsule degeneration - and disruption - related alterations , to remove damaged structures . consistent with our speculation , we found a significant predilection of infiltrating immune cells in tumor nests with focal capsule disruption in breast ( 97 % vs. 22 % ) and prostate ( 91 % vs. 33 % ) than morphologically similar counterparts without disrupted tumor capsules 22 - 24 . our subsequent studies revealed that residual breast myoepithelial and prostate basal cells within focally disrupted capsules express a significantly lower level of tumor suppressors and cell proliferation - related proteins , whereas demonstrate a significantly higher rate of degeneration - related changes than their morphologically similar , non - disrupted counterparts 25 - 32 . our studies also revealed that the predominant immune cell type associated with epithelial capsules was ctl , which displayed significant cytotoxic impact on degenerative myoepithelial or basal cells , but not on associated luminal cells 25 - 32 . in contrast , luminal cells overlying focally disrupted capsules have a significantly higher level of proliferation and expression of tumor stem cell - and growth factor - related genes than their adjacent counterparts distant from the disruptions 25 - 32 . our more recent study has further shown that denatured collagen i , a main element of tumor capsules , can function as a strong chemoattractant for macrophage recruitment 33 . together , these findings have led us to propose that aberrant immune cell infiltration at the pre - invasive stage may represent a trigger factor for tumor invasion and metastasis 25 - 29 . according to our hypothesis , focal degeneration of the epithelial capsule due to age or disease attracts immune cell infiltration , which further degrades the focally degenerating area resulting in a focal disruption within the capsule . if the focal disruption occurs in a region underlying undifferentiated progenitor or tumor stem cells , the changing microenvironment may selectively favor their proliferation , leading to cell budding from the disruption and subsequent growth into the stroma or dissemination to vascular structures 25 - 32 . our hypothesis has been recognized by a number of internationally recognized experts in the field 34 - 36 as more compatible with existing experimental evidence than the traditionalthe hypothesis tested was that as colorectal tissues share very similar structural barriers , the basement membrane ( bm ) and the muscularis mucosa ( mm ) , and the same hypothesized sequence of tumor progression 38 - 41 , aberrant immune cell infiltration may have the same destructive impact on epithelial capsules and the same promoting impact on tumor progression as those seen in breast and prostate tumors 23 - 27 . in addition , our study intended to identify direct morphological and immunohistochemical signs suggestive of the potential sub - cellular mechanism ( s ) of tumor infiltrating immune cells on tumor progression . de - identified and unstained slides of formalin - fixed , paraffin - embedded ( ffpe ) consecutive tissue sections were obtained from 100 age - and type - matched crc patients with and without positive lymph nodes plus five normal controls . all tumor cases were confirmed to be adenocarcinoma and the five controls were confirmed to be free of morphological and immunohistochemical sings of colorectal disease . these slides were retrieved under an institutional review board ( irb ) - approved protocol ( # 2008001 ) from the nanjing municipal hospital of nanjing university of traditional chinese medicine ( tcm ) , china . the first and last slides from each tissue block from each case were stained with hematoxylin and eosin ( h & e ) for morphological classification using established criteria . after preliminary examination , 8 - cases are excluded due to the lack of sufficient tissue for analysis or tissue detachment from the slides . double immunohistochemistry was utilized to examine the distribution and interactions among tumor - infiltrating immune cells , tumor capsules , and budding tumor cells . the following antibodies were used in this study : ( a ) leukocyte common antigen ( lca , clone : 2b11 + pd7 / 26 . dako , carpinteria , ca ) , which is expressed by all normal hematopoietic cells and their neoplastic transformations ; ( b ) cytokeratin ( ck ) ae1 / ae3 ( clone : ae1 / ae3 , dako , carpinteria , ca ) , which detects high - and low - molecular weight keratins expressed by all epithelium - derived cells ; ( c ) collagen iv ( clone : civ22 , dako , carpinteria , ca ) , which is the main building block of the tumor capsule , ( d ) d2 - 40 ( clone : d2 - 40 , signet , dedham , ma ) , which is a phenotypic marker for lymphatic endothelium , and ( e ) cd34 ( clone : clone : qbend 10 ; dako , carpinteria , ca , usa ) , which is a phenotypic marker for blood vessel endothelial cells . double immunohistochemistry was carried out using our previously published methods ( 42 ) . to assess the specificity of the immunostaining , various negative controls were used , including : ( 1 ) substitution of the primary antibody with the same isotype or pre - immune serum of the antibody , and ( 2 ) omission of the secondary antibody . lymphoid follicles , lymphocyte aggregates , and tumor - infiltrating lymphocytes were defined according to commonly accepted criteria 38 . a focal disruption in the bm or a fragmentation in the mm was defined as a physical gap in these structures , larger than the combined diameter of at least three epithelial cells in at least three consecutive tissue sections . dissociated tumor cells were defined as isolated individual cells , or small clusters of cells ( few than15 cells / cluster ) observed to be physically separated from the tumor core in at least three consecutive tissue sections . to compare the frequencies of focal bm disruptions , mm fragmentations , and dissociated tumor cells in structures adjacent to and distant from , infiltrating lymphoid follicles and large immune cell aggregates , the entire epithelium , lamina propria ( lp ) , and mm of the pre - invasive tissue component was digitally photographed . the digital images were enlarged to 400x and reviewed under the screen of a standard computer . the mean frequencies of focal bm disruptions , mm fragmentations , and dissociated tumor cells between these tissue sites were statistically compared with the pearson 's chi - square test . statistical significance was defined as p 0.05 . to assess the correlation of immune cell infiltration with tumor invasion , all junctions of pre - invasive and invasive lesions were identified and examined to determine whether these junctions are exclusively or preferentially associated with infiltrating immune cell aggregates . to identify the direct morphological and immunohistochemical signs suggestive of the potential sub - cellular mechanism ( s ) of infiltrating immune cells on tumor progression , tissue sections from 10 selected cases were assessed with three panels of bio - markers . first , they were subjected to triple immunohistochemistry with vascular structure - related markers , including d2 - 40 , cd34 , and cd31 ( clone : jc70a ) . immunostained sections were examined to determine whether increased immune cell infiltration is associated with an increased vascular density , which has been suggested to promote tumor invasion and metastasis . second , they were subjected to triple immunohistochemistry with an epithelial capsule marker , collagen iv and markers to immune cells ( cd8 , clone : c8 / 144b ; cd16 , clone : dj130c ; mast cell tryptase , clone : aa1 . immunostained sections were examined to determine whether these immune cells are physically associated with the epithelial capsules and whether associated capsules show degenerative alterations . third , they were subjected to triple immunohistochemistry with phenotypic markers to immune cells , stem cell ( cd133 , clone : ac133 , miltenyi biotec , auburn , ca , usa ; ck - 19 , clone : rck108 , dako , carpinteria , ca , usa ) , and proliferation marker ki - 67 ( clone : mib1 ) ( dako , carpinteria , ca , usa ) . immunostained sections were examined to determine whether increased immune cell infiltration is associated with increased epithelial cell proliferation , budding , and dissemination . in sections immunostained for collagen iv , the bm and mm in a vast majority of the normal and pre - invasive epithelial structures distant from lymphoid follicles or infiltrating immune cell aggregates were presented as a dense and continuous band , which completely encircles the colonic crypts and segregates the mucosae from the submucosae ( figure 1a - b ) . in sectionsdouble immunostained for infiltrating immune cells and epithelial capsules , immune cell infiltration and focal disruptions of the bm were readily appreciable in some normal colonic epithelial structures . however , most infiltrates distant from the tumor tissue were located at the middle or upper portion of the mucosae , and the bm in epithelial structures near the mm was generally intact ( figure 1c - d ) . in addition , focal bm disruptions distant from the tumor tissue were facing the luminal direction , and the mms were largely intact with no distinct immune cell infiltration ( figure 1e - f ) . in contrast , focal bm disruptions adjacent to the tumor tissue were generally facing the basolateral direction , and the mms were often focally fragmented or separately with extensive immune cell infiltration within the mms ( figure 1g - h ) . the frequency and extent of focal bm and mm attenuation or disruptions appeared to increase with increasing extent of immune cell infiltration and increasing degree of malignancy . as shown in figure 2 , both the bm and mm in normal appearing epithelial structures distant from the invasive crc are largely intact with fewer infiltrating immune cells . in contrast , both the bm and mm in normal appearing epithelial structures immediately adjacent to the invasive crc are focally attenuated or disrupted with extensive immune cell infiltration . these infiltrating immune cell aggregates harbor several epithelial cell clusters with no distinct surrounding bm ( figure 2b ) . a vast majority of the mm distant from lymphoid follicles was well defined and continuous . in sharp contrast , nearly all mms immediately adjacent to lymphoid follicles exhibited aberrant alterations . as shown in figure 3 , all the mms immediately adjacent to 7 - lymphoid follicles in two casesare either totally absent or focally disrupted and variable numbers of dissociated individual epithelial cells or cell clusters are seen within or immediately adjacent to these lymphoid follicles . nearly all epithelial structures distant from focally disrupted mms were uniform in size with a distinct lumen , and were surrounded by a continuous bm . in sharp contrast , variable numbers of solid epithelial cell clusters or dissociated individual cells lacking bm were seen overlying focally disrupted mms , and some of these cells or cell clusters appeared to have migrated into the center of the lymphoid follicles through the focal mm disruption ( figure 4 ) . within or immediately adjacent to lymphoid follicles , the vascular density was significantly increased , compared to that seen in tissues distant from these follicles . as shown in figure 5 , these lymphoid follicles not only harbor a variable number of dissociated epithelial cells , but also harbor large open lumen vascular structures with disseminated cells . over 75 % of dissociated epithelial cells were either immediately adjacent to or physically associated with infiltrating immune cells . those dissociated epithelial cell clusters within the lymphocyte follicles or aggregates overlying focally disrupted mm ( as shown in figures 3 - 5 ) appeared to be at increased risk to progress to invasive crc . as shown in figure 6 , invasive crc is exclusively seen near the normal appearing epithelial structures physically associated with infiltrating immune cell aggregates . the infiltrating immune cell aggregate in each of two cases harbor multiple epithelial cell clusters that have no distinct surrounding bm , and they also share similar morphological features with the adjacent invasive crc . the risk of progression to invasive crc for those dissociated epithelial cells or cell clusters was further suggested by the fact that all 35 morphologically distinct pre - invasive and invasive junctions detected in 24 cases were located within or immediately adjacent to lymphoid follicles or infiltrating immune cell aggregates . as shown in figures 7 - 9 , most of these dissociated cells or invasive cancer cells are either immediately adjacent to or physically associated with infiltrating immune cells , and dissociated epithelial cells in the mucosa migrate into the submucosa through focally disrupted mms . no similar dissociated epithelial cells or pre - invasive and invasive junctions were seen in tissues that completely lacked lymphoid follicles or large infiltrating immune cell aggregates . increased immune cell infiltration appeared to stimulate lymphangiogenesis and angiogenesis , which facilitate intravasation of dissociated epithelial cells . as shown in figure 10 , in morphologically comparable tissues , both the density and luminal size of lymphatic ducts are substantially higher and larger in tissues adjacent to than those distant from infiltrating immune cell aggregates . similar findings were obtained with phenotypic markers cd31 and cd34 for blood vessel endothelium ( data not shown ) . infiltrating ctl , nk , and mast cells were preferentially seen within the normal appearing or pre - invasive tissue component and a majority of infiltrating immune cellsas shown in figure 11 , most infiltrating nk and mast cells are located at or near the site of focally disrupted epithelial capsules , which harbor several dissociated epithelial cell clusters that lack distinct surrounding bm . in contrast , the bm distant from infiltrating nk and mast cells is morphologically distinct and continuous . as shown in figure 12 , a majority of proliferating cells in normal appearing tissues are either physically associated with or immediately adjacent to infiltrating immune cells . in addition , these tissues harbor large open lumen lymphatic ducts with proliferating disseminated cells ( figure 12 a - b ) . increased immune cell infiltration appeared to facilitate tumor stem cell budding and dissemination . in sectionsdouble immunostained with markers of stem cells , blood vessel endothelial cells , or infiltrating immune cells , some isolated ck -19-positive cell clusters were seen within an overall ck -19-negative background . these ck -19-positive cell clusters within normal appearing epithelial structures are morphologically and immunohistochemically similar to adjacent invasive cancer cells and also to disseminated cells within the vascular structure ( figure 13 ) . nearly all these dissociated ck -19-positive cell clusters were either surrounded by or were physically associated with infiltrating immune cells and were also in direct physical continuity with invasive cancers within the submucosa ( figure 14 ) . a total of 91 lymphoid follicles and large lymphocyte aggregates were seen in 33 of 92 cases . all laminar propria ( lp ) immediately adjacent to these lymphoid follicles and lymphocyte aggregates harbored normal epithelial structures with focally attenuated or disrupted bm , or dissociated cells or cell clusters . in contrast , only 9 ( 10 % ) lps distant from these follicles and aggregates harbored similar structures ( table 2 ; p 0.001 ) . similarly , all mm immediately adjacent to these follicles and aggregates were focally attenuated or fragmented , while only 9 ( 10 % ) mm distant from these lymphoid follicles showed similar alterations ( table 3 , p 0.001 ) . the morphology and distribution of infiltrating lymphocytes on the bm and mm of both node positive and negative cases appeared to be similar , except that lymphatic ducts with disseminated cells were exclusively seen in the lamina propria of node positive cases and a single ' node negative ' case with confirmed crc metastasis . consistent with our hypothesis , our current study has detected almost identical frequency and pattern of immune cell infiltration and associated epithelial capsule disruptions as those seen in our previous studies of human breast and prostate tumors 23 - 32 . in addition , our current study has yielded the following unique findings : ( 1 ) normal appearing epithelial structures immediately adjacent to lymphoid follicles and infiltrating immune cell aggregates have a significantly higher frequency of focally attenuated or disrupted bm , dissociated cells within lymphatic ducts or blood vessels , and focally fragmented mm than their distant counterparts , ( 2 ) a vast majority of dissociated epithelial cells within the stroma or vascular structures are either immediately adjacent to or physically associated with infiltrating immune cells , ( 3 ) the physical conjunctions of pre - invasive and invasive lesions are exclusively seen at the sites of lymphoid follicles and infiltrating immune cell aggregates , ( 4 ) aberrant immune cell infiltration is predominantly seen in normal appearing epithelial structures with focally disrupted bm and mm , ( 5 ) infiltrating ctl , nk , and mast cells are preferentially associated with the epithelial capsules , which is often associated with distinct degenerative alterations , ( 6 ) infiltrating immune cells appear to substantially stimulate lymphangiogenesis and angiogenesis , and ( 7 ) increased immune cell infiltration is associated with elevated stem cell proliferation , budding , and dissemination . together , these findings suggest that tumor infiltrating immune cells may have promoting impact on tumor invasion and metastais . the promoting impact of tumor infiltrating immune cells on tumor progression seen in our current study is in agreement with previous clinical observations that pre - invasive epithelial tumors with increased immune cell infiltration have a significantly higher frequency of subsequent invasive lesions than their stage - and histopathologically - matched counterparts without distinct immune cell infiltration 5 - 7 . the findings of the mechanistic assays in our current study are also consistent with those of others , which have shown that aberrant immune cell infiltration could promote tumor invasion and metastasis through a number of mechanisms : ( a ) macrophage - enhanced cancer cell migration through secretion of chemotactic and chemokinetic factors known to promote angiogenesis and fibrillogenesis , allowing tumor cells to track along collagen fibers to blood vessels 8 , 9 , ( b ) macrophage digestion of tumor cells , resulting in the mixture of genetic material that creates a hybrid phenotype , which can metastasize to remote sites 10 , and ( c ) infiltrating immune cell release of growth factors and other proliferation - related molecules to associated tumor cells through direct physical contact 11 , 12 . to the best of our knowledge , however , our study is the first one to suggest that the primary impact of tumor - infiltrating immune cells may be associated with the physical destruction of the tumor capsule . as the disruption of the tumor capsule is an absolute pre - requisite for invasion or metastasis of all epithelium - derived tumors , our findings appear to have unique scientific and clinical implications , compared to previously published findings and theories regarding the impact of tumor - infiltrating immune cells . the bm is composed of type iv collagen , laminins , and other molecules that form a continuous fibrous capsule , which attaches to the normal epithelial cells and their derived pre - invasive tumor cells , physically segregating these cells from the surrounding stroma 13 - 17 . as the epithelial component is normally devoid of blood vessels and lymphatic ducts , the disruption of the bm is a pre - requisite for tumor invasion or metastasis 13 - 17 . the colorectal mm consists of two morphologically distinct smooth muscle layers that form a dense band - like structure , which physically separates the mucosa from the submucosa 38 , 43 - 46 . although its structural features have been well described , the physiological functions of the mm remain elusive 38 , 43 , 44 . however , it has been suggested that the mm might have an important inhibitory role on tumor progression 43 - 46 . in human crc , a focal disruption or absence of the mmis a pre - requisite for migration of invasion - initiating cells from the mucosa into the submucosa 38 , 43 - 46 . because of these structural features , a focal disruption in the bm and mm could potentially have several consequences : ( a ) altered permeability for oxygen and nutrients 47 , ( b ) direct epithelial - stromal cell contact 48 , ( c ) direct exposure of epithelial cells to different growth factors 49 , and ( d ) an open path allowing the migration of epithelial cells from the mucosa into the submucosa . as the adult gut stem cell population is basally located near the mm 50 - 55 , these alterations may individually or collectively elicit the exit of stem cells from quiescence leading to increased proliferation , which could have two fundamentally different consequences . on one hand , it may represent the normal colonic replenishment process , as the bm towards the luminal direction has to be degraded or disrupted in order to allow the cells at the base of the crypt growing upwards to replace aged or damaged apical luminal cells . on the other hand , it may selectively favor invasion and dissemination of the overlying tumor stem cells or a biologically more aggressive cell clone . the fate of the consequences of a given bm disruption is likely to be determined not only by the genetic profile of the overlying epithelial cells , but also by the physical location of the epithelial structure . the epithelial structures shown in figure 1e - f are likely to represent a normal replenishment process as the focal bm disruptions are facing the luminal direction and the mm is densely packed and continuous . in contrast , the structures shown in figures 1g - h , 2b , 6 - 8 , 11 , and 12 are likely to be at increased risk for invasion as ( 1 ) the focal bm disruptions are facing the basolateral direction , ( 2 ) they harbor budding or dissociated cells , and ( 3 ) the mm is loosely packed withalthough these alterations are only microscopic , they may signify aberrant expression of the building - blocks of the bm and mm . it has been well documented that the expression levels of both mrnas and proteins of the bm subunits changes substantially during colorectal carcinogenesis and are significantly down - regulated during crc invasion 56 - 58 . it has also been reported that the expression of the collagen iv or collagen i mrnas or proteins can directly and significantly impact the lineage differentiation of both adult and embryonic stem cells 59 - 62 . a previous study assessed the physical integrity of the bm with immunohistochemistry for collagen iv and laminin ( two primary components of the bm ) and attempted to correlate bm disruptions with the survival of patients with different stage crc 63 . the study revealed that a total loss or considerable discontinuity of the bm was adversely correlated with survival , whereas no corresponding association of outcome with the stage of disease was evident 63 . the mechanism ( s ) and specific molecule ( s ) for the recruitment of tumor - infiltrating immune cells to the site of epithelial structures with focally degenerated bm and mm can not be determined by our current study , while it is most likely that immune cell infiltration is triggered by the convergence of tissue injury , innate immune response to that injury , and the presence of tumor stem cells at the site of the injury . our previous studies have shown that a denatured component of the bm , collagen i , could act as a strong chemoattractant for the recruitment of macrophages , suggesting that degenerated tumor capsule elements may function as chemo - attractants for tumor - infiltrating immune cells 33 . after focal disruption of the tumor capsule by infiltrating immune cells and the exposure of the overlying epithelial cells to the adjacent stroma , additional immune cells may be recruited to the site resulting from the accumulation of microvesicles on the surface of the tumor cell plasma membrane 64 . microvesicles released from tumor cell membranes may contain proteins that function as self - epitopes activating a subset of immune cells . prior to their release , these microvesicles are embedded within the tumor cell membrane , and could potentially function as receptors to attract immune cell infiltration . it was interesting to note that although distinct signs of degeneration were seen in epithelial capsules physically associated with infiltrating immune cells , whereas no distinct degenerative alterations were observed in epithelial cells physically associated with or surrounded by infiltrating immune cells . the underlying mechanism ( s ) for the differential impact of immune cells on epithelial capsules and epithelial cells is unknown , while it could potentially result from two main factors : ( a ) the lack of tumor antigenic proteins on the surface of the associated epithelial cells . as those cells are located exclusively at or near focally disrupted epithelial capsules , they may represent a population of tumor progenitors or stem cells that are not mature enough to express a measurable amount of surface proteins on their plasma member 25,26 . consistent with our speculation is the fact that our previous gene expression profiling with freshly frozen prostate and breast tissues have shown that tumor cells overlying focally disrupted capsules have a 5.03 - and 5.45-fold increase in the expression level of two stem cell lineage markers , kit and ncor2 , respectively 25 , 26 , and ( b ) the presence of a subtype ( s ) of immune cells that lack cytotoxic functions . immune cells physically associated with epithelial cells are likely to represent a population of cd4 ( + ) / cd25 ( + ) / foxp3 ( + ) regulatory t cells or cd8 ( + ) / cd28 ( - ) cells . recent studies have shown that the number of these infiltrating immune cells increases with tumor progression , and that these cells can induce tolerance to tumor cells through cell - to - cell interactions or by secreting different cytokines , which suppress the cytotoxic functions of the immune cells 65 . focal bm disruptions and mm fragmentations seen in our current study in normal appearing colorectal tissues are consistent with those of our previous studies , which have shown that 15 - 30 % of patients with or without malignant prostate or breast lesions harbor morphologically normal epithelial structures that show extensive focal capsule disruptions and budding cells 22 - 25 . the intrinsic entity of these structures is unknown , but they are most likely to represent the previously undefined malignant phenotype , or pending malignant lesions with pre - disposition of genetic abnormalities . our previous study revealed that breast clinging ductal carcinoma in situ ( dcis ) share a similar molecular and clinical profile with other types of dcis , while it is often morphologically indistinguishable from normal breast epithelial structures 66 . previous studies from others have also shown that : ( 1 ) the prostate tissues in a subset of aged men or normal - appearing prostate tissues adjacent to prostate cancer harbor a dna phenotype that is identical to invasive and metastatic prostate cancer 67 , and ( 2 ) cancer of unknown primary site ( cup ) is one of the 10 most frequent cancers and is ranked as the 4 commonest cause of cancer deaths , but its primary tumor site remains elusive 68 . it is interesting to note that the dominant histological type of both cup and crc are adenocarcinoma 69 , 70 , raising a possibility that some of cup may originate from crc . in summary , our current study suggest that at the early stage of colorectal carcinogenesis , tumor infiltrating immune cells may be recruited to the tumor site by the degenerated products of the tumor capsule due to age or disease . infiltrating immune cellsdegrades the degenerating capsule resulting in the formation of a focal disruption in the capsule , which selectively favors proliferation , budding , and dissemination of the underlying stem cells . consequently , aberrant immune cell infiltration into the pre - invasive tumors is likely to directly and significantly promote tumor invasion into the stroma . our findings could reasonable explain the contradictory reports and statements regarding the impact and clinical significance of immune cell infiltration into tumor tissues . more importantly , as the disruption of the tumor capsule is an absolute prerequisite for tumor invasion and metastasis , local or systematic administration of anti - inflammatory agents to prevent immune cell infiltration - induced capsule destruction may be beneficial in preventing tumor progression . a recent report published in lancet oncology has revealed that regular use of aspirin , a non - steroidal anti - inflammatory drug , reduces the long - term risk of crc and other cancer and the risk of distant metastasis 71 .\noutput:\n" }, { "from": "agent", "value": "background : our previous studies of human breast and prostate cancer have shown that aberrant immune cell infiltration is associated with focal tumor capsule disruption and tumor cell budding that facilitate invasion and metastasis . our current study attempted to determine whether aberrant immune cell infiltration would have similar impact on colorectal cancer ( crc ) . materials and methods : tissue sections from 100 patients with primary crc were assessed for the frequencies of focal basement membrane ( bm ) disruption , muscularis mucosa ( mm ) fragmentation , and tumor cell dissemination in epithelial structures adjacent and distal to infiltrating lymphoid aggregates using a panel of biomarkers and quantitative digital imaging.results : our study revealed : ( 1 ) epithelial structures adjacent to lymphoid follicles or aggregates had a significantly higher ( p < 0.001 ) frequency of focally disrupted bm , dissociated epithelial cells in the stroma , disseminated epithelial cells within lymphatic ducts or blood vessels , and fragmented mm than their distal counterparts , ( 2 ) a majority of dissociated epithelial cells within the stroma or vascular structures were immediately subjacent to or physically associated with infiltrating immune cells , ( 3 ) the junctions of pre - invasive and invasive lesions were almost exclusively located at sites adjacent to lymphoid follicles or aggregates , ( 4 ) infiltrating immune cells were preferentially associated with epithelial capsules that show distinct degenerative alterations , and ( 5 ) infiltrating immune cells appeared to facilitate tumor stem cell proliferation , budding , and dissemination.conclusions : aberrant immune cell infiltration may have the same destructive impact on the capsule of all epithelium - derived tumors . this , in turn , may selectively favor the proliferation of tumor stem or progenitor cells overlying these focal disruptions . these proliferating epithelial tumor cells subsequently disseminate from the focal disruption leading to tumor invasion and metastasis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: physical forces act on us every day when we push open a door or accelerate while riding in a car . these experiences provide us with an intuitive understanding of force at the scale of our bodies . similarly , cells interact with their local environment by sensing and generating forces , but the magnitudes of these forces and the mechanisms by which cells and proteins respond to force are not as intuitive . this perspective aims to provide an intuition for the magnitudes of forces involved in cellular processes and a framework for thinking about how molecules transmit , route , and sense mechanical signals . b cells selectively develop high - affinity antibodies by mechanically testing the strength of antigens on the surface of antigen - presenting cells ( natkanski et al . , 2013 ) ; dividing cells rely on mechanical cues to control progression through several phases of mitosis ( rajagopalan et al . , 2004 ; pinsky and biggins , 2005 ; lafaurie - janvore et al . , 2013 ; hotz and barral , 2014 ) ; and cells sense mechanical properties of their surroundings to direct cell differentiation , wound healing , and tumor progression ( moore et al . , 2010 ) . our senses of touch and hearing are also examples of cellular force transduction involving mechanosensitive ion channels that convert mechanical signals into electrical ( ionic ) currents . we will not focus on this class of mechanosensitive proteins , which are the subject of several reviews ( sackin , 1995 ; hamill and martinac , 2001 ; kung , 2005 ) . instead , we focus on proteins that route forces through the cytoskeleton and on proteins that transduce these mechanical signals into biochemical signals . by definition , a signal can be transmitted , routed , and transduced , and each of these steps can be a point for regulation . the study of cellular signaling has traditionally rested on biochemical concepts , in which chemical signals are transmitted via diffusion , routed by specific binding interactions , and transduced via activation of key effectors ( e.g. , ion channels , enzymes , or transcription machinery ) . propagation of biochemical signals often occurs through allosteric changes in a protein 's conformation or through phosphoregulation . changes in phosphorylation state can directly control the activity of a binding site or active site of an enzyme , and they can induce conformational changes similar to allosteric mechanisms . because mechanical loads on a protein can also change the conformation of a protein , it should be no surprise that evolution has produced molecules that use force - dependent conformational changes to route and transduce mechanical signals ( ingber , 1997 ) . in cells , mechanical signals are transmitted by cytoskeletal filaments such as actin and microtubules , routed by rearrangements of the cytoskeletal network , and transduced into biochemical signals by force - sensitive proteins . how cytoskeletal filaments transmit mechanical signalsis straightforward ; however , what molecular features allow certain proteins to modulate when and where mechanical signals are routed or transduced is an active area of research . ( 1988 ) provided an early hypothesis about how proteins might exhibit sensitivity to forces when they introduced the concept of binding interactions , called catch bonds , that become stronger under a tensile force ( evans and leung , 1984 ) . ( 2003 ) confirmed the existence of catch bonds by applying precise mechanical loads to individual l - selectin and p - selectin glycloprotein ligand - 1 ( pslg - 1 ) interactions and observing longer lifetimes under a range of tensile loads compared with interactions that were not under tension . because catch bonds are preferentially stable once engaged , they can be likened to switches or routers of mechanical signals : when a catch bond is engaged , force is preferentially propagated through the adjoining proteins and cytoskeletal filaments . other mechanosensitive proteins exhibit tension - dependent modulation of enzyme activity , tension - dependent accessibility of substrate sites , and tension - dependent availability of cryptic binding sites . these types of force - sensitive proteins can be likened to transducers that convert mechanical signals into biochemical signals . to estimate the forces that individual proteins sustain , consider that molecular interactions , such as enzyme - catalyzed reactions , require fluctuations in thermal energy to overcome transition states . thus the energies involved must be similar in magnitude to thermal energy , which is given by boltzmann 's constant , kb , multiplied by temperature , t. at room temperature , kbt = 4.1 pn nm ( 4.110 j ) , and since proteins are nanometer sized , forces acting on individual proteins must be in the piconewton range . one piconewton is 10 n , about the weight of one red blood cell , approximately the force exerted by a standard laser pointer on a screen , and about the drag force on a 30 - nm vesicle moving at 500 nm / s through cytosol ( courty et al . , 2006 ; howard , 2001 ) . electrostatic interactions between the charged surfaces of two proteins generate forces on the order of 1100 pn that decay with d , where d represents the distance between the charges . for instance , according to coulomb 's law , two point charges separated by 0.5 nm in water exert a force on one another of 10 pn . van der waals forces and hydrogen bonds , which are due to permanent or transient dipole moments in polar molecules , are on the order of 10 pn and decay with d ( howard , 2001 ) . finally , hydrophobic interfaces associate with strengths similar to those of hydrogen bonds ( chandler , 2005 ) due to the hydrophobic effect , which is an entropy - driven process that reduces the amount of ordered water around nonpolar molecules . hence essentially all types of forces relevant to biological proteinprotein interactions and biological enzyme catalysis are on the piconewton scale ( see table 1 for examples ) . common cellular events in which forces are critical to biochemical function . table 1 shows that tools for direct observation of individual protein interactions must operate with nanometer precision and on the piconewton force scale . biophysical tools capable of this precision can be grouped into two categories : those that actively control position and therefore apply force ( figure 1 , a c ) and those that passively measure force ( similar to a strain gauge ; figure 1 , df ) . to apply force actively to a protein interaction of interest , the interaction is typically recapitulated in vitro with one protein tethered to a glass coverslip and its binding partner tethered to a polystyrene bead for laser trapping ( ashkin and dziedzic , 1987 ; neuman and block , 2004 ; matthews , 2009 ) , to a magnetic bead for magnetic tweezers ( smith et al . , 1992 ; strick et al . , 1996 ; 2000 ) , or to the tip of a submicrometer cantilever for atomic force microscopy ( afm ; binnig et al . , another method , not illustrated in figure 1 , called the biomembrane force probe , can also be used to apply forces to proteinprotein interactions ; however , most investigators have moved toward the laser trapping , afm , or magnetic beads platforms ( evans et al , 1995 ; gourier et al . , 2008 ; proteins are typically tethered using well - established conjugation chemistries ( hermanson , 2013 ; kim and herr , 2013 ) , and in general tethering is not a major limitation . the physical principles underlying these instruments are outside the scope of this perspective ( see review by neuman and nagy , 2008 ) . however , all of them share the ability to manipulate the position of a tethered protein or complex with nanometer precision while observing the deflection of a sensor element ( i.e. , bead or afm tip ) from its resting position . ( a c ) instruments often used to apply precise forces to individual macromolecules or complexes . ( a ) in laser trapping , a focused laser beam behaves roughly like a hookean spring , pulling a submicrometer bead toward its center with a force proportional to the stiffness of the laser trap , k , multiplied with the displacement of the bead from the trap center , x ; beads are often decorated with a protein or receptor of interest and can be controlled by manipulating the position of the laser beam relative to the microscope slide . ( b ) atomic force microscopes employ a micrometer - width cantilever , at the tip of which is a nanometer - sized pointer that can be decorated with proteins or receptors ; once these proteins bind their receptors on the surface of a glass slide , the cantilever is retracted causing it to deflect . ( c ) magnetic tweezers employ magnetic beads with a magnetic moment , ; when subjected to a magnetic field , the force on the beads is proportional to the magnetic field strength multiplied by . up to several hundred magnetic beads can be pulled at the same time . ( d ) pillars with diameters and lengths on the nanometer to submicrometer scale can be formed from elastic polymers and decorated with extracellular matrix proteins , such that cultured cells adhere and form focal adhesions ; the deflection of each nanopillar from its resting position reveals the contractile forces exerted at the corresponding focal adhesion . ( e ) hybridized dsdna molecules for which one strand is tethered to a surface and the complementary strand is tethered to a protein or receptor can act as a tension - gauge - tether by which the number of base pairs within the dsdna that support the load dictates a well - defined force at which the dsdna will unzip or melt ; unzipping of the dsdna can be observed using fluorescent tags on the dna molecules or by cell phenotypes , allowing estimation of the range of forces to which a proteinligand interaction might be subjected during a cellular event such as early stages of cell adhesion . ( f ) an intramolecular strain sensor based on fret can be used to determine the forces exerted through a protein by engineering the probe into the protein structure and monitoring the level of fret . experiments using these instruments can be performed in several ways . to quantify the strength of a binding interaction , the force on an interactionmay be steadily increased ( ramped ) until the interaction dissociates ( i.e. , until it mechanically fails ) . the force at which failure occurs is called the rupture force , and it is a function of the intrinsic binding strength , as well as of the rate at which the force was increased ( evans , 2001 ) . to test for force - dependent stabilization of an interaction , as occurs in catch bonds , the average lifetime of an interaction can be measured as a function of a constant applied force ( i.e. , with a force clamp ) ; any increase in the lifetime with increasing force indicates catch - bond behavior ( dembo et al . , 1988 ) . more complex force profiles , such as sinusoids or rapid changes in force , can also be applied and may reveal time dependence that would otherwise be difficult or impossible to observe . techniques for passively measuring piconewton - scale forces use cleverly engineered molecules or nanoscale materials . for instance , arrays of pillars formed in elastic substrates can be decorated with adhesion molecules , and when cells adhere , their contractile forces are applied to the pillars via focal adhesion complexes . subsequent bending of the pillars indicates the forces at individual focal adhesions ( figure 1d ; tan et al . , 2003 ) . the unzipping behavior of individual double - stranded dna ( dsdna ) molecules can be used as a molecular force gauge , since dsdna unzips at well - defined and tunable levels of force , depending on how many base pairs support the load ( figure 1e ) . another type of molecular force gauge relies on insertion of a stress sensor into a structural protein host ( figure 1f ) . the stress sensor consists of elastic - helical peptides ( meng et al . , 2008 ) or elastic derivatives of the spider silk flagelliform protein ( grashoff et al . , 2010 ) , which connect a pair of fluorophores or fluorescent proteins capable of frster resonance energy transfer ( fret ) . when this sensor is inserted into the flexible region of a protein believed to transmit force , the magnitude of the fret signal indicates the amount of stretching in the sensor and , when calibrated , the force being transmitted through the protein in vivo ( grashoff et al . , 2010 ) . the foregoing single - molecule approaches , in combination with atomic structures and mutational analyses , are beginning to reveal how cells route and transduce mechanical signals ( thomas , 2009 ; forties and wang , 2014 ) . in many cases , mechanosensitivity derives from tension - dependent allosteric regulation or local unfolding of a protein . in this sectiontogether these two proteins play a crucial role after injuries as pselectin , which is exposed on the surface of epithelial cells after exposure to inflammatory cytokines , captures psgl - 1presenting platelet cells to hold them at the location of injury . psgl - 1 interactions ( marshall et al . , 2003 ; sarangapani et al . , 2004 ) . this stabilization stems from the allosteric regulation between selectin 's two domains , which are connected through a hinge region that can adopt one of two conformations . tension across selectin straightens the hinge region , concomitantly positioning residues in the binding pocket to make high - quality molecular interactions with psgl - 1 and improving the strength of the interaction ( lou et al . , 2006 ; phan et al . , 2006 ; klopocki et al . , 2008 ; waldron and springer , 2009 ) . for an illustrated examplea similar mechanism appears in intracellular adhesion molecule - 1 ( icam - 1 ) , which exhibits catch - bond behavior when binding to lymphocyte function - associated antigen - 1 ( lfa - 1 ; chen et al . , 2010 ) . the bacterial adhesive protein fimh also has two domains and exhibits catch - bond behavior through a slightly different mechanism . its lectin domain , which binds mannosylated proteins , connects through a flexible peptide to its pilin domain , which anchors the protein to fimbriae . binding of the pilin to the lectin domain reduces lectin 's affinity for mannose ( aprikian et al . , 2007 ; afm experiments revealed that individual lectin mannose interactions in vitro typically fall into a low - or a high - strength population ( yakovenko et al . , 2008 ) , but applying an intermediate tension before increasing the force shifts most interactions into the high - strength population ( yakovenko et al . , 2008 ) . a crystal structure revealed that when the pilin and lectin domains are associated , a - sheet sandwich in lectin is twisted such that the mannose binding pocket is in a low - affinity state ( le trong et al . , 2010 ) . in contrast , tension - dependent dissociation of the pilin from the lectin domain allows the - sheet sandwich to untwist and tighten the ligand pocket . similar sandwich domains are found in many adhesive , matrix , and extracellular proteins believed to be under tensile loads ( le trong et al . , 2010 ; puchner and gaub , 2012 ) and thus are likely well suited to propagate mechanical signals . in general , the common mechanism underlying these adhesion proteins is the tension - dependent removal of an autoinihibitory domain , which concomitantly induces a conformational change in the binding pocket of protein protein interactions that are under tension . because these types of force - stabilized bonds influence where and when forces are transmitted through the cytoskeleton , it is not surprising that catch - bond behavior is commonly observed in cell - adhesion proteins . clusters of cell - adhesion proteins occur at focal adhesions and contain multiple mechanosensitive proteins involved in coupling transmembrane / - integrins to the actin network . the extracellular portion of / - integrins connects to fibronectin in the extracellular matrix ( ecm ) and exhibits classic catch - bond behavior , likely through an allosteric pathway ( kong et al . , 2009 ) . contractile forces generated in the actomyosin network are transmitted through talin to the integrins and the ecm . talin contains a c - terminal rod - like structure consisting of 13 - helical bundles . under 5 pn of tension , several - helical bundles unfold , revealing binding sites for vinculin ( figure 2 ; del rio et al . , 2009 ; vinculin binds to these cryptic sites with high affinity ( nanomolar range ) , preventing the - helical bundles from refolding and recruiting additional actin filaments ( ciobanasu et al . , 2014 ; the onset of vinculin binding to talin correlates with an increase in the strength of the focal adhesion ( ciobanasu et al . , 2014 ) . an intracellular fret sensor ( figure 1d ) inserted into vinculin indicated that each vinculin in a stable focal adhesion supports an average of 2.5 pn , that recruitment of vinculin and force transmission are independently controlled processes , and that the ability of vinculin to transmit force determines whether a focal adhesion will assemble or disassemble under tension ( grashoff et al . , 2010 ) . forces in cells are routed , transmitted , and transduced by mechanically sensitive proteins and have cell - wide implications , influencing biochemical signaling in the cytoplasm and gene expression in the nucleus . forces generated in the actin cytoskeleton by myosin ii cross - bridges are transmitted several micrometers between adhesion proteins in cell membrane and linc complexes in the nuclear cortex . tension - dependent unfolding of talin ( step 1 ) reveals substrates for vinculin binding ( step 2 ) , which in turn recruits additional actin filaments ( steps 3 and 4 ) as part of focal adhesion development ( del rio et al . , 2009 ; ciobanasu et al . , 2014 ; yao et al . , tension - dependent unfolding of p130cas reveals phosphorylation sites for src kinase as part of integrin signaling and ultimately generates the active form of a diffusible gtpase rap1 ( steps 5 and 6 ; sawada et al . , 2006 ) . concomitantly , tension in the actin cytoskeleton is transmitted through linc complexes to the nuclear cortex . lamin a , an intermediate filament of the nuclear cortex , mechanically couples the nuclear cortex to linc complexes and therefore the cytoplasmic cytoskeleton ; it affects dna transcription of the gene for lamin a and the transcription of stress fiber genes ( swift et al . ,2013 ) . increased cytoskeletal tension on linc complexes correlates with decreasing phosphorylation of lamin a , decreasing turnover of lamin a in the nuclear cortex , increasing stiffness of the nuclear cortex , and ultimately , through the retnonic acid pathway , increasinglevels of lamin a. note that many intermediate proteins are not shown , for simplicity . whereas catch bonds influence when and where forces are transmitted , other mechanosensitive proteins transduce forces into biochemical signals with downstream effectors . for instance , local unfolding of a protein under tension can reveal substrates for enzymatic modification ( e.g. , protease cleavage sites , phosphorylation sites , or glutathionylation sites ) . for example , the blood protein von willebrand factor ( vwf ) is partially unfolded by forces on the order of 1020 pn , the same range of forces it is expected to experience in blood vessels due to shear flow , revealing an otherwise hidden protease site ( interlandi and thomas , 2010 ) . cleavage at this site reduces the size of vwf aggregates and inhibits blood coagulation . vwf also exhibits catch - bond - like behavior in which force increases its interaction with platelet receptor protein i / . the p130cas protein , which associates with integrins as part of integrin signaling , also unfolds under tension to reveal phosphorylation sites for the src family of kinases ( sawada et al . , 2006 ) . phosphorylation of these sites leads to the activation of a diffusible secondary messenger called rap1 , which is a gtpase involved in integrin signaling ( hattori and minato , 2003 ; tamada et al . , 2004 ) . local unfolding can also reveal the active site of a kinase and is the mechanism underlying the tension - dependent activity of the muscle protein titin ( puchner et al . , 2008 ) . titin connects myosin bundles in the a band to the z - disk in sarcomeres , where it is optimally positioned to sense muscle tension and thereby control the size of sarcomere units ( agarkova et al . the kinase domain of titin is closely related to the myosin light - chain kinase ( mlck ) class of enzymes , which are activated by repositioning of an autoinhibitory tail upon ca binding . unlike mlcks , the active site of titin is revealed only upon forceful repositioning of the autoinhibitory tail under tension ( puchner et al . , 2008 ; gautel , 2011 ) . once the active site is revealed , titin phosphorylates downstream signaling proteins that affect the expression of muscle genes and the turnover of proteins ( lange et al . , 2005 ) . another domain of titin , the immunoglobulin g ( igg ) domain , unfolds under 100 pn of force in vitro , revealing cysteines for s - glutathionylation . glutathionylation of these cysteines prevents the igg domain from completely refolding , thereby affecting the intrinsic length of titin and the elasticity of cardiomyocytes ( alegre - cebollada et al . , thus titin exhibits features of tension - dependent kinase activity and tension - dependent unveiling of cryptic substrates , which ultimately enable titin to participate in regulating muscle elasticity . the foregoing examples illustrate that local unfolding is a shared molecular mechanism in many mechanosensitive proteins . mechanical forces are transmitted at the speed of sound , orders of magnitude faster than diffusion for any distances greater than tens of nanometers , arriving in microseconds , compared with seconds or minutes for diffusion . there is precedence in biology for rapid transmission of signals across cells : in muscle cells , electrical signals , which also travel much faster than diffusive signals , penetrate deep into the cell along t - tubules , where they arrive very close to sarcomeres ; at this point , the electrical signal is transduced into a biochemical signal : release of calcium from the sarcoplasmic reticulum . a recent report suggests that mechanoregulation occurring at integrins in the cell membrane may route forces through the cytoplasmic cytoskeleton directly to the nuclear cortex and ultimately to transcription factors in the nucleus ( figure 2 ; swift et al . , 2013 ) . they span the nuclear envelope , with their cytosolic side binding actin and their nuclear side binding the intermediate filaments , lamin a and lamin c , an ideal arrangement for transmitting forces within cytosolic actin into the intranuclear cortex . like integrins , linc complexes may form catch bonds or exhibit mechanical - to - biochemical transducing behavior . consistent with this expectation , high cytoskeletal tension correlates with low turnover and dephosphorylation of lamin a , perhaps because phosphorylation sites on lamin a are sequestered by tension in a mechanism similar to the tension - dependent sequestration of protease sites in collagen ( camp et al . , 2011 ; swift et al . , 2013 ) . moreover , actin filaments emanating from a subset of focal adhesions appear to connect directly to linc complexes in the nuclear membrane , and these actin - cap - associated focal adhesions respond more readily to changes in the stiffness of the extracellular matrix than non actin - cap - associated focal adhesions ( kim et al . , 2012 ) . thus it certainly seems plausible that mechanical signals can be routed through catch - bond behavior at the cell membrane , transmitted long distances through cytoskeletal elements , and transduced into a biochemical signals that affect gene expression directly in the nucleus . the key steps of cell division are regulated by checkpoints such as the spindle assembly checkpoint , which delays anaphase until all chromosomes are properly attached to microtubules emanating from each spindle pole . whether force - sensing proteins participate in mitotic checkpoints is an active area of research and is likely understudied due to the difficulties of measuring precise forces in vivo and reconstituting these complex systems in vitro . given the presence of force - sensitive proteins in many aspects of cell behavior , however , it seems likely that they participate in routing mechanical signals through spindle microtubules and transducing mechanical signals into biochemical signals by which the ends of microtubules are anchored to their substrates . on chromosomes , the multiprotein structure that binds the plus ends of spindle microtubules is the kinetochore . even before kinetochores and the roles of microtubuleswere understood , tension - dependent processes were implicated in orienting chromosomes for proper segregation when dietz in the 1950s noticed that bioriented chromosomes remained stably in that configuration , whereas maloriented chromosomes were unstable and constantly reorienting . dietz proposed that the defining feature of properly oriented chromosomes was tension , and that all chromosomes are biased toward the bioriented state through tension - dependent stabilization of their attachments to the spindle ( dietz , 1958 ) . in support of this hypothesis , nicklas later showed that maloriented chromosomes could remain stable for hours if tension was artificially applied using a microneedle , whereas relaxed , maloriented bivalents reoriented within minutes ( nicklas and koch , 1969 ) . we now know that kinetochores contain at least 80 different proteins in various copy numbers ( cheeseman and desai , 2008 ; biggins , 2013 ) , but determining the strength of kinetochore coupling to microtubules in vivo has remained difficult , in part due the unknown and size - dependent viscosity of the nucleoplasm , the complex architecture of the spindle , and likely differences in the kinetochore microtubule coupling strength in different organisms . despite these challenges , theoretical and experimental efforts to determine the strength of kinetochore attachments to microtubules in vivo indicate that kinetochores couple to individual microtubules during metaphase with strengths on the order of 1100 pn ( nicklas , 1988 ; marshall et al . the number of microtubules attached to kinetochores varies among organisms , ranging from one microtubule / kinetochore in yeast to 1520 microtubules / kinetochore in humans ( cheeseman and desai , 2008 ) , and thus the net strength of kinetochore attachments to the spindle could approach nanonewton forces in some organisms . chromosomes in grasshopper spermatocytes , which have 15 microtubules / kinetochore , resisted opposing forces up to 700 pn ( nicklas , 1988 ) . it remains an open question as to why chromosomes can couple to the spindle with such high and widely varying strengths , since the forces to segregate chromosomes in vivo during anaphase are estimated to be between 0.1 and 10 pn ( marshall et al . , 2001 ; fisher et al . , 2009 ; ferraro - gideon et al . , 2013 ) . in vitro tests using the laser trapping method ( figure 1 ) revealed that isolated kinetochore complexes can bind dynamically to microtubules and harness the energy of disassembling microtubule tips to move loads with forces up to an average of 9 pn ( table 1 ) . moreover , these kinetochore particles exhibited catch - bond - like behavior , in which the lifetime of kinetochore microtubule interactions increased with tension over the range of 15 pn ( akiyoshi et al . , 2010 ) . the physiologically relevant consequence of this catch - bond behavior is that kinetochores on bioriented sister chromatids , which are under tension , form more stable attachments to microtubules than those attachments to kinetochores on chromatids that are not bioriented and therefore not under tension , in agreement with the hypothesis of dietz . adding to the complexity , these laser trapping experiments also revealed that tension applied across the kinetochore - microtubule interface affected microtubule dynamics . ongoing efforts to reconstitute the load - bearing components of the kinetochore piece by piece may reveal the force - sensitive elements and the effects of microtubule dynamics ( asbury et al . , 2006 ; franck et al . , 2007 , 2010 ; gestaut et al . , 2008 , 2010 ; there is strong evidence that the activity of several enzymes also facilitates biorientation of sister chromatids . for example , aurora b kinase is known to phosphorylate various kinetochore proteins and thereby weaken kinetochore microtubule attachments . aurora b activity declines with the onset of tension across the microtubule kinetochore interface ( tanaka et al . , 2002 ; dewar et al . , 2004 ; welburn et al . , 2010 ; deluca et al . ,2011 ) , but how the activity of aurora b responds to tension is unclear . several components of the kinetochore have been proposed as tension sensors that could affect the activity of aurora b ( biggins , 2013 ) . one candidate is the sli15 - bir1 protein complex , which localizes to kinetochores and contains an aurora b activating domain . tension across sli15 - bir1 might reveal a binding site to sequester the aurora b activating domain , thus preventing aurora b mediated phosphorylation of kinetochore proteins when chromosomes are properly bioriented ( sandall et al . , 2006 ) . alternatively , tension within kinetochore proteins might induce a conformational change that 1 ) sequesters aurora b substrates , 2 ) physically separates aurora b from its substrates , or 3 ) induces a conformational change in the catalytic site of kinetochore - associated aurora b , thereby inhibiting its activity ( lampson and cheeseman , 2011 ; biggins , 2013 ; sarangapani and asbury , 2014 ) . centrosomes , called spindle pole bodies in yeast , are mechanical hubs balancing forces from astral , kinetochore , and interpolar microtubules . in yeast , they serve as signaling platforms for the mitotic exit network , sporulation , and possibly the spindle position checkpoint ( jaspersen and winey , 2004 ) ; therefore mechanosensitive proteins may reside at centrosomes to transduce mechanical signals into biochemical signals during regulation of these processes . one study implicates kendrin proteins , called pcp1 in fission yeast and spc110 in budding yeast , as possible tension sensors ( rajagopalan et al . , 2004 ) to control progress through the spindle position checkpoint . so far , however , the lack of suitable techniques for mechanically probing protein interactions with centrosomes has precluded a clear understanding of the extent to which centrosomes participate in mechanical signaling pathways . mechanical signaling in other aspects of cell division are also being actively investigated . for instance , the final step of cell division is abscission of the intercellular bridge , which takes anywhere from 1 to 3 h , even in the same cell lines ( steigemann et al . , 2009 ) . despite this large time window , abscission occurs promptly if tension in the intercellular bridge is suddenly removed by cutting the bridge with a laser ( lafaurie - janvore et al . ,2013 ) , suggesting that elements of the abscission machinery may be inhibited by tension . other indications for mechanical signaling in mitotic processes stem from observations that confined cells undergoing mitosis that are prohibited from rounding up appear to have difficulty capturing chromosomes , maintaining defined spindle poles , and stably positioning their spindles ( fink et al . , 2011 ; these defects could stem from disruptions in the normal routing of mechanical signals important for functionality of the checkpoints that govern kinetochorethe precise role of mechanical signaling in all aspects of cell division warrants thorough investigation and will likely benefit from molecular force probes that can be integrated into in vivo structures . this review has highlighted some well - understood mechanisms for transmitting , routing , and sensing mechanical signals , and it has discussed emerging areas of mechanobiology in which mechanical signaling is likely to be important . in many instances , combinations of protein structures , molecular dynamic simulations , and single - molecule force spectroscopy were required to uncover the molecular basis for mechanosensation . single - molecule techniques have been particularly powerful since they allow careful control of the force , force history , and loading rates on individual molecules . these tools have enabled researchers to uncover how numerous mechanically active protein systems work , including how myosin , kinesin , and dynein convert chemical energy into work and how simple catch - bond systems become stronger under load ( fimh , selectins ) . various examples of mechanically regulated enzymes have also been demonstrated directly ( src kinase , titin kinase , collagenases ) . thus it seems certain that these tools will be crucial for understanding at the molecular level all forms of mechanoregulation . a major challenge will be applying these tools to even more complex systems , such as the eukaryotic replisome , the ribosome , the spliceosome , the kinetochore , and centrosomes . in these systems , force may affect multiple proteins simultaneously , or the complex as a whole , in ways that will be difficult to discern without studying the whole macromolecular complex for emergent behaviors and without understanding the entire structure . first , advances in traditional biochemical techniques are making it possible to isolate larger protein assemblies in vitro . second , next - generation single - molecule tools are more capable , multimodal ( e.g. , combined laser trap and total internal reflection fluorescence microscopes ) , reliable , and accessible than ever . there is a synergy between these two advances because the single - molecule techniques allow one to work with much smaller amounts of material than bulk techniques and thus make it possible for useful information to be gained even for large assemblies for which large amounts of concentrated material can be difficult or impossible to obtain . as the molecular components sensitive to force become better characterized , it may become possible to complete the picture of mechanoregulatory cascades that involve transmitting , routing , and transducing mechanical signals .\noutput:\n" }, { "from": "agent", "value": "cells sense biochemical , electrical , and mechanical cues in their environment that affect their differentiation and behavior . unlike biochemical and electrical signals , mechanical signals can propagate without the diffusion of proteins or ions ; instead , forces are transmitted through mechanically stiff structures , flowing , for example , through cytoskeletal elements such as microtubules or filamentous actin . the molecular details underlying how cells respond to force are only beginning to be understood . here we review tools for probing force - sensitive proteins and highlight several examples in which forces are transmitted , routed , and sensed by proteins in cells . we suggest that local unfolding and tension - dependent removal of autoinhibitory domains are common features in force - sensitive proteins and that force - sensitive proteins may be commonplace wherever forces are transmitted between and within cells . because mechanical forces are inherent in the cellular environment , force is a signal that cells must take advantage of to maintain homeostasis and carry out their functions ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a novel class a serine carbapenemase detected in north carolina in 1996 was given the designation kpc - 1 because it was first identified in klebsiella pneumoniae . since then , a number of variants of this enzyme ( currently up to kpc - 8 ) have been identified and have spread globally . the mobile nature of the genetic element encoding kpc , tn4401 , which is carried on a plasmid , has contributed to the spread of this enzyme , which has now been identified in many of the enterobacteriaceae as well as in pseudomonas and salmonella . strain dissemination , however , appears to be of greater importance than plasmid dissemination as evidenced by the fact that almost 70 % of strains in a us centers for disease control and prevention collection are of a single lineage , sequence type ( st ) 258 . kpcs hydrolyze all - lactam antibiotics and are not significantly inhibited by clavulanic acid , sulbactam , or tazobactam . detection of kpcs in the clinical laboratory may be difficult and many bacteria producing this enzyme appear to be susceptible to anti - pseudomonal carbapenems by routine testing . resistance to ertapenemmay be a more sensitive ( albeit less specific ) indicator of the possible presence of kpc than resistance to other carbapenems . because of the insensitivity of current breakpoints in detecting the presence of kpc , it is suggested that isolates of k. pneumoniae with a minimal inhibitory concentration ( mic ) of at least 1 g / ml to imipenem , meropenem , or doripenem undergo further testing designed to detect the presence of carbapenemases , including kpc [ 4 - 6 ] . the importance of detection resistance in these organisms is evidenced by the fact that the use of imipenem or meropenem in patients with infections due to kpc - producing k. pneumoniae that appear to be susceptible to these carbapenems is associated with frequent therapeutic failure . a survey of 42 kpc - producing k. pneumoniae isolates in the eastern us found that each isolate carried a mean of 3.5 - lactamases ; one kpc - producing k. pneumoniae isolate has been reported to contain seven extended spectrum - lactamases . k. pneumoniae isolates producing both kpc - 2 and vim - 1 enzymes ( the latter of which are class b metallo - carbapenemases ) have been detected in greece . kpc - producing bacteria are often resistant to a broad range of antibiotics beyond the - lactams . in fact , the plasmids that carry the kpc gene may also contain genes encoding aminoglycoside - modifying enzymes and some have also been reported to encode qnra and qnrb , resulting in reduced susceptibility to fluoroquinolones . an evaluation of 104 carbapenemase - producing enterobacteriaceae , 70 % of which produced kpc - 2 or kpc - 3 , found that the most active agent tested was tigecycline , to which all isolates were susceptible . among antibiotics other than - lactams that were tested , tigecycline was followed ( in decreasing order of susceptibility ) by polymyxin b ( 88 % susceptible ) , amikacin ( 73.0 % ) , gentamicin ( 50.0 % ) , tetracycline ( 35.6 % ) , and ciprofloxacin ( 32.1 % ) . a similar evaluation of 96 carbapenemase - resistant k. pneumoniae from 10 brooklyn hospitals ( 82 % of a single ribotype ) also found that all were susceptible to tigecycline . ninety - one percent were considered susceptible to polymyxin b , 66 % to doxycycline , 61 % to gentamicin , 45 % to amikacin , and 2 - 7 % to chloramphenicol , rifampin , tobramycin , and ciprofloxacin . time - kill studies found that tigecycline was bacteriostatic whereas gentamicin and polymyxin b were bactericidal . most published experience of treatment of infection due to kpc - producing organisms is with tigecycline , a polymyxin ( polymyxin b or colistin ) , or their combination , with variable reported outcomes . monotherapy , however , may be associated with persistent infection and the emergence of antibiotic resistance . recurrence of an empyema due to a kpc - producing k. pneumoniae during treatment with tigecycline was associated with an increase in mic from 0.75 to 2.0 g / ml . elemam and colleagues recently reported two patients with infections due to k. pneumoniae isolates resistant to all antibiotics tested , including tigecycline and polymyxin b , with both isolates having developed progressive increases in the mic to polymyxin b during treatment with this antibiotic . similarly , of 16 patients with infection due to carbapenemase - resistant k. pneumoniae carrying a kpc gene who had persistently positive cultures , 12 were treated with polymyxin b alone whereas 4 received this polypeptide antibiotic in combination with tigecycline for at least a portion of their therapy . blood cultures , though initially positive in only 12 , subsequently yielded the organism in all 16 . marked increases in the polymyxin b mic were observed in 3 of the 12 given that antibiotic alone and in 0 of 4 who also received tigecycline . the development of resistance during therapy may be due to the presence of heteroresistant subpopulations , a phenomenon observed with colistin ( polymyxin e ) in 15 of 16 multidrug - resistant k. pneumoniae isolates considered susceptible to colistin by mic testing , a result consistent with the very high mutant prevention concentration / mic ratios observed . although polymyxin b causes concentration - dependent killing , this is accompanied by rapid regrowth of resistant subpopulations with little or no postantibiotic effect , consistent with the clinical observation of treatment - emergent resistance . it should be noted that resistance has also been reported to emerge in acinetobacter during treatment with tigecycline . this problem may require optimization of dosage regimens to overcome some of these characteristics of polymyxins , combination therapy , or both . very limited published clinical experience suggests that combination therapy may prove to be more successful than polymyxin monotherapy . neither antagonism nor synergy was detected with the combination of tigecycline and polymyxin b tested against three isolates of k. pneumoniae in vitro . in one series , only 1 of 3 patients with bacteremia due to a kpc -2-producing k. pneumoniae had a favorable outcome after treatment with polymyxin b , whereas another patient , treated with a combination of tetracycline and an aminoglycoside , survived . as indicated above , resistance to polymyxin b occurred in 0 of 4 patients given this antibiotic in combination with tigecycline , whereas resistance occurred in 3 of 12 given polymyxin b monotherapy . other combinations , such as those including an active aminoglycoside , may also have promise : a patient with endocarditis due to kpc -3-producing k. pneumoniae was successfully treated with a combination of colistin and gentamicin . another agent for consideration in combination therapy is rifampin ; polymyxin b and rifampin were synergistic in vitro against 15 of 16 isolates of carbapenemase - resistant k. pneumoniae . the optimal therapy for infections due to these multidrug - resistant pathogens is not well defined and depends upon the susceptibilities of individual isolates , and the choices are often severely limited . the most frequently active antibiotics in vitro are tigecycline and colistin ( or polymyxin b ) and these may often be the only choices based on susceptibility test results . the pharmacodynamics of the polymyxins remain poorly defined , and optimal dosing regimens have not yet been determined . it is possible that doses higher than those currently approved by the us food and drug administration may provide improved therapeutic results . concerns about toxicity of the polymyxins ( which may have previously been overestimated ) have limited the attempts at significantly increasing the dose of these agents . in cases of ventilator - associated pneumonia , consideration could be given to adjunctive administration of colistin by aerosolization . the currently approved dose of tigecycline results in low serum and urine concentrations , raising concern about the efficacy of this agent in the treatment of bacteremia and urinary tract infections as well as about the emergence of resistance . inadequate tissue concentrations may have accounted for the failure of tigecycline relative to comparator therapy in the treatment of patients with ventilator - associated pneumonia due to a variety of organisms . cunha has reported administering tigecycline in a 400 mg loading dose followed by 200 mg every 24 hours - a dose four times higher than currently approved - without eliciting nausea or vomiting , frequent adverse reactions seen with standard dosing regimens . however , he provides little specific information in regard to the use of these doses . although higher doses of tigecycline or a polymyxin may be beneficial , lack of knowledge in regard to tolerability and safety may limit their current acceptance by clinicians . combination therapy of serious infections due to kpc - producing organisms would , however , appear to be warranted . the combination to be used depends on the antibiotic susceptibilities of the isolated pathogen but most often would be tigecycline with a polymyxin , perhaps at escalated dosages . limited in vitro data suggest that co - administration of rifampin may have a role in such cases . the future of therapy for infections caused by multidrug - resistant aerobic gram - negative bacilli appears bleak as a result of the paucity of development of new drugs targeting these organisms . one potential exception is the development of - lactamase inhibitors active against carbapenemases , such as nxl104 , a potent inhibitor of kpc - 2 . it can be hoped that the attitude of the pharmaceutical industry toward antibiotic development will soon change and that additional candidates will be developed . scd has served on the advisory panel and / or speaker s bureau of pfizer incorporated ( new york , ny , usa ) , johnson & johnson ( new brunswick , nj , usa ) , merck & co , incorporated ( whitehouse station , nj , usa ) , and wyeth ( madison , nj , usa ) .\noutput:\n" }, { "from": "agent", "value": "the emergence of the klebsiella pneumoniae carbapenemases in k. pneumoniae and other gram - negative bacteria , usually on a background of multidrug resistance , has led to difficult therapeutic choices . among available antibiotics , tigecycline and the polymyxins are the most frequently active against these organisms in vitro . optimal therapy of infections due to these bacteria may involve maximization of antibiotic dose as well as their use in combination ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in the field of analytical chemistry , sample pretreatment is often needed in order to enable the selective and sensitive analysis of compounds in complex samples . commonly applied sample pretreatment techniques are solidphase extraction ( spe ) , liquid liquid extraction ( lle ) , and protein precipitation 1 . recently , various miniaturized electromigrationbased extraction techniques have been introduced that offer low solvent consumption , simple extraction procedures , and the ability to deal with small sample volumes 2 . analyte extraction is not based on passive diffusion , as in conventional extraction techniques , but on active electric fieldenhanced transport . this increases the extraction speed and allows exhaustive extraction to take place , thereby making electric fieldassisted extraction techniques promising for highthroughput analysis and for the analysis of lowabundant analytes . electromembrane extraction ( eme ) and electroextraction ( ee ) are based on immiscible liquidanalytes are electroextracted and concentrated from a donor phase , often via a filter phase , into an acceptor phase . due to the fact that the electrophoretic velocity of the ions is proportional to the electric field , extraction speed is enhanced in the organic ( filter or donor ) phase a high electric field strength is present there . high analyte concentration factors can be achieved , because of the fact that the acceptor phase is small in volume when compared to the donor phase . in eme , the liquidliquid system typically comprises donor and acceptor phases that are both aqueous and are separated by a membrane of which the pores contain an organic filter phase , i.e. a supported liquid membrane ( slm ) .3 and has so far primarily been used for drug analysis studies 4 , 5 . in ee , no membranes are used and the donor phase is typically comprised of an organic solvent and the acceptor phase is comprised of an aqueous solution . it was applied for analytical purposes in 1994 by van der vlis et al . 7 and for bioanalysis by lindenburg et al . in 2010 , ee has been mainly applied to analysis of peptides and metabolites . in 2013 ,10 , 11 reported on a system comprised of three liquid phases , i.e. aqueous donor and acceptor phase separated by a layer of organic solvent acting as a filter . eme across free liquid membranes , but in essence both systems utilize the same extraction principle . a pubmed ncbi query to with either electromembrane extraction orelectroextraction in the title that appeared between april 2012 and november 2015 resulted in 95 papers , underlining that research in this area is quite active . a variety of instrumental setups for electrophoretic sample pretreatment have been developed , which were reviewed by lindenburg et al . however , the authors noted that commercial electrophoretic sample pretreatment setups were required in order for electrophoretic sample pretreatment to become routinely used . explored the optimal experimental eme conditions for various bioanalytical applications and discussed recent advances in the use of eme for bioanalysis . the review also discussed challenges with eme , such as matrix interference during eme , difficulties with the extraction of acidic and polar compounds and the lack of commercial setups 4 . mathematically described mass transport in eme by creating a theoretical model of the process 12 . huang et al . summarized the recent efforts that were made to gain understanding of mass transport taking place during eme 13 . until now , aspects such as ( online ) hyphenation of ee and eme to analytical separation and / or detection techniques have not been considered in detail . therefore , in this review , the hyphenation of ee and eme to three major separation techniques is discussed , i.e. lc , gc , and ce , as well as the hyphenation to direct detection . special emphasis is placed on online hyphenation of ee and eme to the aforementioned separation and detection techniques . in this review , an overview is presented of the ee and eme systems that permit concentration of analytes , which can only be achieved when the acceptor phase volume is smaller than the donor phase volume . in order to provide the reader with a proper comparison , only studies that report lod valuesare included . in this context , the presence of information on parameters , such as extraction recovery and enrichment factor , was also used as inclusion criteria . in section 2 , theoretical aspects , more details are provided concerning the relevant analytical parameters , i.e. extraction recovery and enrichment factor . these parameters are not always combined , but can provide useful insights in the process efficiency of ee and eme , as is discussed in the section 3 regarding hyphenation . the review is concluded with a critical discussion on the challenges and requirements of online hyphenation of eme and ee to analytical separation and detection techniques . we have included these aspects in order to provide a framework for the next sections . the obtained enrichment factor ( ef ) of analyte i ( efi ) is based on the ratio of the analyte concentrations in the acceptor and donor phase , i.e. ( 1 ) efi = cacceptoricdonoriwhen the measured concentration is within the linear response of the detector , the detector signal can be used to calculate efi . the maximum attainable ef ( efmax ) , i.e. when all analyte molecules are extracted from the donor into the acceptor phase , is based on the volume ratio of the donor and acceptor phase : ( 2 ) efmax = vdonorvacceptor from this equation , it can be derived that in order to be able to concentrate analytes , an eme or ee system should encompass a larger donor phase volume than acceptor phase volume . for example , eme across free liquid membrane as reported by kub & bocek 10 , 11 , 14 utilizes equal volumes of donor and acceptor phase and thus has no concentrating power . a similar technique , threephase ee , utilizes a much smaller acceptor phase volume in comparison to the donor phase and thus was able to concentrate analytes 9 . the extraction recovery ( er ) of analyte i ( eri ) is based on the ratio between efi and the maximum attainable ef ( efmax ) , expressed as a percentage : ( 3 ) eri = efiefmax100 % when equation 13 are combined , the extraction recovery of analyte i can be written as : ( 4 ) eri = cacceptorivacceptorcdonorivdonor100 % and thus , combining equation 1 and 4 ( 5 ) eri = efivacceptorvdonor100 % it is important to have information about both eri and efi . when a very large donor volume is used , a large efi can be achieved even though eri is low . thus , in order to be able to assess the extraction performance correctly , either eri or efi in combination with vdonor and vacceptor should be reported in the paper . in the case that eri or efi is missingno acceptor phase volume could be reported because the acceptor phase was solid 15 , 16 . in a few other examples , however , the technologies reported here were clearly concentrating analytes and were considered as relevant for this review due to their innovative character . thus far , the majority of the reported eme and ee work was coupled offline to separation and / or detection techniques . in these cases , the extracts are collected after the experiment , transferred to a sample vial and introduced into an analytical system . however , there are several examples where eme and ee are fully integrated into the analytical system and sample extraction takes place in conjunction with consecutive analysis . in the next sections , we discuss progress of online hyphenation and steps taken towards online hyphenation using lc , gc , ce , and direct detection , respectively . table 1 provides a detailed overview of the work in which eme and ee have been combined with lc . a total of 29 studies have been included of which two were coupled online to lc , which are highlighted in this section . in the majority of the eelc and emelc work optical detection techniques were used , such as uv ( 17 ) or fluorescence ( 2 ) detection . furthermore , several instances of ms detection ( 12 ) were reported . certain applications reported combinations and have not been assigned separately . in order to make a comparison between the different techniques , the reported detection limits were converted to nm , which was also done for the articles discussed in the remainder of the review . analyses performed with lcms and both lcuv both typically yielded subnm to 10 nm detection limits , which is surprising , as ms is generally considered more sensitive than uv detection . the majority of the eme and ee work was applied to drug compounds or relatively hydrophobic compounds , such as aromatic amino acids , azo red dyes , herbicides , and volatile organic compound metabolites . notable exceptions are the eme of inorganic anions , pulsed mode eme of histidine , phenylalanine , tryptophan , and asparagine and glutamine . the highest efs were achieved using ee , which was applied to extract peptides from plasma and ee , which was applied to extract acylcarnitines from urine . these high efs were achieved by having nearly exhaustive extraction for selected target compounds combined with the fact that the donor volume was 1000 times larger than the acceptor volume . the ee flow cell developed by schoonen et al. 30 showed demonstrated near exhaustive extraction for target analytes except for lauroylcarnitine , the largest achievable ef in the cited works was in studies that made use of a 24 ml donor phase in combination with acceptor phases of 1025 l . according to eq .2 , very high efs of up to 2400 can theoretically be achieved with this system . however , since the extractions were not exhaustive , with ers typically below 15 % , moderate efs were obtained as follows from eq . recently , it was demonstrated that ph changes due to electrolysis affecting the acceptor phase during eme play an important role in the ability of an extraction to be exhaustive . furthermore , by choosing an acceptor phase with a stronger buffering capacity , the ers that can be achieved are strongly enhanced . this can be explained by the fact that the analytes maintain their charge in the acceptor phase for a longer duration due to reduced effects of electrolysis of the acceptor phase . a potential downside of this approach is that the sample might not be suitable for injection into an analytical system due to the high / low ph value or the salt content becomes too high when the sample is neutralized prior to injection . the extraction times for all techniques were in the range of 5 min to 20 min , with exception of the chipbased eme setups , where the optimized extraction times were 33 min and 25 min 23 . it is important to note that the flow rate and the donor volume play a critical role in the extraction times of chipbased setups . a chipbased setup for the eme of chlorinated phenoxyacetic acids was faster , despite having a donor volume that was five times higher than the eme chip for basic drugs . the parallel eme setup had the highest throughput , despite taking 8 min for the eme procedure . the system with the fastest total analysis time reported the extraction of drugs from whole blood , taking 5 min for eme and 5.5 min for separation . the range of voltages applied span several orders of magnitude , from 1.5 v to 300 v for eme and 300 v to 15 kv for ee . the 1.5 v for eme was chosen due to the fact that the extraction took place over an ionic liquidbased membrane , which typically has a lower resistance than commonly used slm solvents . this results in higher currents and necessitates the use of a low extraction voltage in order to avoid effects of electrolysis and joule heating . ee usually takes place from a thick organic phase , often ethyl acetate , into an aqueous phase . because of this , higher voltages can be applied during ee than in eme , where the organic phase , which is located inside the slms , is typically thin . when hyphenating ee and eme to lc , care should be taken that the acceptor phase is suited for injection onto the lc column . in all the lcrelated work that is within the scope of this review , the acceptor phase is of aqueous nature , which explains the fact that reversed phase lc is almost exclusively used in combination with ee and eme , one exception being ion chromatography for the analysis of inorganic anions . furthermore , this might also explain the fact that the application area of emelc currently mainly covers mediumapolar to apolar compounds , such as peptides and drugs . overview of ee and eme hyphenated to lc . ef and er values indicated in italics are calculated based on data provided in the paper matrix is only mentioned when extraction performance is tested therein . * in order of increasing lod . ** danofloxacin , enrofloxacin , marbofloxacin , ciprofloxacin , grepafloxacin , gatifloxacin . * * * danofloxacin , enrofloxacin , grepafloxacin , ciprofloxacin , norfloxacin , gatifloxacin , marbofloxacin . ** * * nacetyls ( phenyl ) lcysteine , nacetylsbenzyllcysteine , nacetyls ( 2,2 dichlorovinyl ) lcysteine , nacetyls ( 2,2 dichlorovinyl ) lcysteine , nacetyls ( 1,2 dichlorovinyl ) lcysteine , 3methylhippuric acid , 4methylhippuric acid , 2methylhippuric acid , phenylglyoxylic acid , hippuric acid , mandelic acid . naproxen , ketoprofen , ketorolac , salicylic acid , diclofenac , ibuprofen . nacetyls ( phenyl ) lcysteine , 2methylhippuric acid , 3methylhippuric acid , 4methylhippuric acid , hippuric acid , phenylglyxolic acid . n.r . ef , enrichment factor ; er , extraction recovery ; et , extraction time ; st , separation time ; ev , extraction voltage . an important aspect that should be taken into account when ee and eme are hyphenated online to lc is that the setup should either be resistant to high pressure or decoupled from this pressure . moreover , current leakage from the ee or eme system to the lc system should be prevented in order to avoid possibly damaging the equipment and to prevent endangering the operator . see & hauser reported on an automated system for eme coupled online with lcms . in this work a previously developed polymer inclusion membrane ( pim ) this pim consisted of cellulose triacetate as base polymer , tris ( 2ethylhexyl ) phosphate as plasticizer and varying amounts of aliquat 336 as cationic carrier . the eme system ( fig .1 a ) was composed of a twoway syringe pump , a nineport channel selection valve and a miniaturized flowthrough extraction cell . the acceptor side of the chamber was filled with acceptor solution and remained stagnant during extraction , while the donor solution was flowing . the operation of the entire system was performed using an opensource electronics prototyping platform . in one experimentthe donor volume and analyte concentration were varied while the total amount of chlorinated phenoxyacetic acid herbicides ( cpas ) that were led through the extraction cell were kept constant . the lods that were obtained ( using 5 ml donor phase ) with this system for cpas were 0.120.43 nm and efs of 201235 were reported . furthermore , the repeatability was good ; when the cpas were spiked to river water samples the relative standard deviations were in the range of 4.85.5 % . the ( nearly ) exhaustive extraction of samples as large as 25 ml was successfully demonstrated , suggesting that very high efs and thus very low lods can be achieved . ( a ) experimental setup of the developed emelcms system ( b ) emelcms results of cpas spiked to river water ( extraction voltage 200 v , donor phase flow rate 0.2 ml / min ) . ( a ) 5 ml of 0.5 ng / ml cpas ( b ) 10 ml of 0.25 ng / ml cpas and ( c ) 25 ml of 0.1 ng / ml cpas .4 cpa = chlorophenoxyacetic acid ; 3,4 d = 3,4 dichlorophenoxyacetic acid ; 2,4 d = 2,4 dichlorophenoxyacetic acid ; 2,4,5 t = trichlorophenoxyacetic acid . lindenburg et al . coupled ee online to reversedphase lcms via a 2way 10port switching valve for the determination of peptides spiked to plasma . ee took place in a large bore ( 1 mm inner diameter ) peek capillary . a schematic diagram of this setup is shown in fig . first , the injection of the donor and acceptor phases , application of the electric field and transfer to the sample loop of the switching valve , were performed using a ce apparatus . next , the loop was switched and the extracted analytes were injected onto the separation column using an lcms system . the entire system , i.e. ce instrument , switching valve and lcms equipment , was automated and could extract and analyze a series of samples without human interference . the organic donor phase volume was 100 l of ethyl acetate containing the sample ions and 1.8 % ( v / v ) trifluoroacetic acid , the extraction voltage was 15 kv and the extraction time 6 min . lods of 1050 nm were obtained , and efs of 570990 , corresponding to ers of 5799 % . ( a ) valve setup for interfacing large volume cee with lc . ( a ) inlet capillary , ( b ) ee capillary , ( c ) sample loop , ( d ) outlet capillary , ( e ) lc waste , ( f ) lc pump tubing , ( g ) tubing to earth , ( h ) tubing to lcms . step 1 : situation after all phases have been loaded . the grey zone in the eecapillary depicts the organic phase with analytes . step 2 : situation after ee is finished ; the small black zone depicts the concentrated analytes . step 3 : situation after the sample has been transferred into the sample loop by applying pressure . step 4 : situation where the sample zone is being injected into the lcms system . ( b ) comparison of chromatograms obtained from lc ( 0.1 l injection ) and large volume ceelcms ( 100 l extraction volume ) . the aforementioned method was successfully applied to the analysis of acylcarnitines in urine , resulting in estimated lods of 1.4390 nm and efs of 175970 , corresponding to ers of 17.597 % . the polarity of the acylcarnitines , which is mainly a result of the acyl chain , was observed to be of major influence on extraction performance ( with a bias to the more apolar acylcarnitines in the test mixture ) . generally emegc was applied to tricyclic antidepressants , once to opioids and once to pyridine derivates . the extraction times ranged between 14 and 20 min , with voltages ranging from 50 to 240 v and separation times between 5 and 25 min . ef and er values indicated in italic are calculated based on data provided in the paper matrix is only mentioned when extraction performance is tested therein . * in order of increasing lod the number of reported emegc applications is lower than the combination of eme and lc . this is due to the fact that eme typically takes place from an aqueous donor into an aqueous acceptor . however , when combined with gc only one eme work made use of an aqueous acceptor phase , which was subsequently directly injected into the gc system . several precautions were taken in order to make this possible , such as keeping the injection volume low , preventing the water from condensing on the column and selecting appropriate column . however , despite these complications , this system had the fastest total analysis time . the other works made use of organic injection solvents by applying eme directly into a solid support , i.e. solidphase microextraction ( spme ) , into an organic phase or by applying dispersive liquidliquid microextraction ( dllme ) after the eme procedure . in general , polar groups need to be derivatized prior to gc analysis in order to increase the vapor pressure of the analytes . only one technique included derivatization , which was performed after eme into a solid pencil support . the largest efs were achieved with emedllme of drugs from urine followed by gcms analysis . as already mentioned in the lc section , the highest efs can be obtained where the difference between donor and acceptor volume is the largest . however , the ef can not be deduced from emespme , as the analytes adsorb to a solid sorbent . this is due to the fact that the reported recoveries are not the recoveries of eme alone , but recoveries from the combination of eme and spme or dllme . it is important to note that in order to properly assess the total analysis time when combining eme with gc that the duration of the spme , dllme and derivatization procedures need to be taken into account . these analysis times were 10 min for the emedllme of pyridine derivates , 3 min for the emedllme of tricyclic antidepressants and 2 min for the thermal desorption and derivatization during emespme . until now , eme has not been coupled online to gc , but important steps have been taken towards achieving online hyphenation . for example , an eme system called electromembrane surrounded solid phase microextraction bridges the gap between eme and gc considerably . here , the analytes were extracted from an aqueous donor phase , via an organic supported liquid membrane , into an aqueous acceptor phase in which the analytes were adsorbed to a solid sorbent , i.e. a pencil lead , that acted as the cathode . after eme , the pencil lead was inserted into a gc injector for thermal desorption of the analytes and consecutive analysis . the method was applied to analysis of doxepin and amitriptyline in urine ( lod 3.6 nm for both ) and plasma ( lod 18 and 9 nm , respectively ) ; reported ers ( covering both eme and spme ) were in the range 310 % . in the work performed by razazadeh et al. 15 , emespme was applied to the analysis of acidic herbicides in plant material , with lods of 2.225 nm and ers ( including spme ) of 0.64.8 % . two reports of an eme setup where the acceptor phase and slm phase were comprised of the same organic solvent were made , i.e. twophase eme . this allowed for direct injection of the extracted analytes into a gc system . in both cases the eme setup consisted of a sample vial containing the donor phase in which one electrode is immersed and a hollow slm fiber containing the acceptor phase in which the other electrode is immersed . using a magnetic stirrer , the donor solvent was agitated during eme to enhance extraction . after extraction , the acceptor solution was collected and injected directly into a gc system . fid was used in case of optimization experiments and ms in case of analytical characterization . the authors tested several organic solvents as acceptor solvent and found that 1heptanol yielded the highest ers for tricyclic antidepressants . a requisite of the solvent is that it has some electric conductance , which draws parallels to ee . the ph of the donor solution , extraction voltage , stirring speed and extraction time were optimized and a comparison with conventional ( threephase ) eme was made . twophase eme was shown to have an interday repeatability in the range of 6.210.8 % while intraday repeatability was in the range of 6.011.8 % , indicating robust analytical performance . twophase eme was found to be faster than threephase eme ( 15 versus 20 min extraction time ) , while the ef and lod were somewhat lower , i.e. 145 versus 280 and 0.1 ng / ml versus 0.8 ng / ml respectively . however , this comparison does not take into account differences in volume ratios of donor and acceptor phase that affect both ef and er ( eq .5 ) . there is an important difference in the electric field distribution in conventional ( threephase ) eme and twophase eme , which could account for the shorter extraction time in twophase eme . in the twophase eme setup , the majority of the electric field is applied over the acceptor phase , which has the highest resistance , which could indicate slow extraction and low recovery . however , the er of some selected test compounds ( imipramine , desipramine , sertraline and citalopram ) after 15 min of eme with 1heptanol as organic phase was surprisingly high : 7087 % . interesting to note is that further improvements have been made by performing twophase eme in pulsed mode and in combination with a surfactant to enhance mass transport across the slm . herethe acceptor phase consisted of 1octanol instead of 1heptanol and the donor phase contained 0.02 % ( w / v ) sodium dodecyl sulfate . by performing the eme in pulsed mode with the aforementioned surfactant , the recoveries increased compared to conventional twophase eme from 48.368.5 % to 70.595.2 % . in our opinion , the fact that analytes were successfully extracted from an aqueous donor phase into an organic donor phase , which is opposite to all other ee and eme work , is important . this is because it not only opens up possibilities for online hyphenation of eme to gc , but also to normal phase lc and hilic . as the donor and acceptor solvent are immiscible and present in sufficient volumes , the membranece , ee , and eme are all based on electromigration , combinations of ce with one of the two is a logical and attractive option . however , no reports of ee coupled with ce have been reported within the timeframe of this review . table 3 shows that the combination of eme with ce has been reported in the literature various times . in all cases , a combination of eme and capillary zone electrophoresis was reported . however , in the aforementioned ee of acylcarnitines in urine , the primary employed separation technique was lc , but the offline combination with ce was briefly explored and found to be promising : extracts from urine obtained by ee were analyzed with a cems system and it was shown that metabolites from various important classes , such as amino acids and acylcarnitines could be measured in these extracts . ef and er values indicated in italic are calculated based on data provided in the paper matrix is only mentioned when extraction performance is tested therein . * in order of increasing lod . * * loperamide , haloperidol , nortriptyline , tryptophan , phenylalanine , creatinine , tyrosine , histidine , arginine . * * * pentachlorophenol , 2,4,6 trichlorophenol , 2,3 dichlorophenol , 2,3 dichlorophenol , 2chlorophenol , 3chlorophenol , 4chlorophenol . * * * * 3,4 methylenedioxymethamphetamine , amphetamine , methamphetamine . # loperamide , methadone , nortriptyline , pethidine , haloperidol . as can be observed in table 3 , ms detection in combination with emece has not been reported , despite the sensitivity and selectivity it offers . cd has two advantages for usage in combination with eme , ( i ) integration into a ce system is relatively simple and ( ii ) detection of all charged species is possible , including those that can not be detected with optical detection methods . as ce is more suited than reversed phase lc for separation of hydrophilic and charged analytes , some eme applications to amino acids , polyamines and polar herbicides were combined with ce . the reported lods were generally in the low nm range , regardless of the use of cd or uv as detection method . it is interesting to note that some applications had low ers , but still had favorable , low nm to m lods , such as eme performed at constant current and nanoeme . the low lods with nanoeme that were obtained , despite the ers 1 % , were achieved due to the fact that the potential ef would be 25000 times on the basis of exhaustive extraction . nearly exhaustive extractions were obtained when using carbon nanotubes in slms , with ers of 90 % and efs of 180 . extraction times ranged from 2 to 32 min and separation times between 4 and 25 min . voltages ranged between 4 and 1500 v. in case of the 1500 v potential , as was applied in a polymer inclusion membrane ( pim ) eme flow cell , electrolysis issues were resolved by placing the electrode in the donor channel at the outlet , which caused bubbles to be flushed away and prevented them from intervening with the extraction process . when hyphenating eme online with ce , care must be taken that the acceptor phase is suited for ce analysis . thus , the acceptor phase solvent should not disturb ce separation and , especially in the case of online coupling , the acceptor phase volume should match the ce injection volume . a typical hydrodynamic injection into a ce capillary should be preferably below 2 % of the capillary volume , often corresponding to volumes of up to 20 to 30 nl , unless stacking procedures are used . the low loadability of ce can be considered a limiting factor in achieving low lods ; this is where online coupling of ee and eme to ce can be highly advantageous . this integration resulted in an emece capillary that could be used as many as 200 times , before it needed to be replaced . these 200 runs took place in a period of two months in which water samples and urine samples were analyzed . nanoeme , as the acceptor volume consisted of a minute amount of 8 nl phosphate buffer . the nanoeme setup was realized with a cracked fused silica capillary , which was surrounded by an slm ( fig .3 a ) . with this setup , pethidine , nortriptyline , methadone , haloperidol , and loperamide were extracted from urine , separated by ce and detected with uv . the sample volume was 200 l , the membrane solvent was nitrophenyl octyl ether , the extraction time 120 s and the extraction voltage 200 v. efs were 25196 , but the ers were low ( 1 % ) . this could be a benefit when the setup is applied to study reaction kinetics , as oversampling would disturb the kinetics . importantly , the authors developed a electromigrationbased slm cleaning procedure by submerging the slm for 2 min in 10 mm hcl while applying 200 v and simultaneously flushing the capillary with separation buffer . furthermore , the relative standard deviations were less than 15 % when this cleansing extraction procedure was applied and it ensured that one emece capillary could be used 200 times . the authors also show highly promising urine analysis results in which several spiked drugs were significantly enhanced by rapid 15 s extractions ( fig . no betweencapillary repeatability was reported . however , the authors indicated that a more robust nanoeme design should be created . ( a ) instrumentation used for nanoeme ( b ) urine analysis by ceuv , comparing ( a ) blank urine without nanoeme , ( b ) spiked urine without nanoeme and ( c ) spiked urine with nanoeme , applying 200 v for only 15 s. peak assignment : 1 pethidine , 2 nortriptyline , 3 methadone , 4 haloperidol , 5 loperamide . adapted from 50 . forthe analysis of lowabundant analytes in biological samples the low recovery does not pose a limitation ( the obtained lods were 0.4160 nm ) . nonetheless , online coupling of emece to a more sensitive detector , such as lif or ms seems attractive for the analysis of lowabundant compounds . table 4 shows an overview of the efforts that have been undertaken to combine ee and eme directly with detection techniques that require no separation of analytes . most of these efforts are highly targeted approaches , due to the fact that without prior separation interfering components might affect efforts to quantify the analytes . several efforts were aimed at the online monitoring of drug metabolism by rat liver microsomes using direct infusion ms . these platforms investigate kinetics involved on a continuous timescale as opposed to the discrete concentrationtime profiles that are obtained via lcms . another msbased online approach that was reported is threephase ee . aside from drug compounds and metabolites , two eme applications focused on the detection of nuclear fuel in aqueous environmental samples using fluorescence and uv detection . the lods for the various direct detection techniques ranged from subnm to high nm concentrations . the ers and efs were varying to a great degree , but the highest efs were achieved by eme of morphine from urine , showing a 152fold enrichment along with a satisfactory er of 76 % . extraction times for the monitoring of drug metabolism kinetics depend on the time the reaction is monitored as well as the volume of the phases . for example , the eme probe could theoretically be used for 333 min at an acceptor flow rate of 3 l / min and an acceptor volume of 1 ml . aside from the monitoring applications , the extraction times were in the range of 9 and 30 min . for the online applications this time was very close to the total analysis time . overview of eme hyphenated to direct detection matrix is only mentioned when extraction performance is tested therein . * in order of increasing lod . ** propionyl , octanoyl , butyryl , decanoyl and hexanoylcarnitine . * * * and their metabolites . a major complication in ms is ion suppression of analytes by cooccurring sample components , such as salts , buffer molecules and proteins . ee and eme enable selective extraction of analyte molecules while leaving salts , buffer components and proteins behind , this in turn enables direct targeted ms analysis . as mentioned , in the past few years , several eme devices have been developed that allow for direct monitoring of drug metabolism . in these studies , the main objective was not to achieve the highest ers and lowest lods , but to couple eme online to ms and to apply it to study drug metabolism in real time . one such application is a microfluidic eme chip that can be coupled online to ms and allows for monitoring of metabolism of amitriptyline by rat liver microsomes in an easily accessible open reservoir . the chip consisted of two polymethyl methacrylate ( pmma ) plates with channels on each plate . a polypropylene slm consisting of porous polypropylene with nitrophenyl octyl ether immobilized in its pores was located between the two plates , which separated the donor and acceptor channels . a platinum wire electrode was inserted in the sample channel , in order to close the electric circuit . furthermore , this electrode prevented the slm from blocking the channel upon application of negative pressure at the outlet . the eme chip was connected to a temperaturecontrolled reaction chamber , in which amitriptyline was metabolized by rat liver microsomes . with a syringe pump , the reaction mixture was transferred to the sample channel , where amitriptyline and its metabolites were extracted by eme . another syringe pump transferred the acceptor solvent containing the extracted analytes towards an ion trap ms . the response time of the system , i.e. the time until the detector responded to a change in the sample , was rapid at 9 s. the eme recovery of amitriptyline from a standard solution was 83 % at 5 l / min sample flow , which was determined using a sample loop . the authors thoroughly investigated ion suppression and showed that salts , proteins and buffer components were not extracted . this new design was implemented in order to simplify construction and to make access to the slm easier . the eme probe was tested on rat liver microsome mediated metabolism of amitriptyline , promethazine and imipramine . finally , fuchs et al. 19 further improved the probe to prevent sample depletion . instead of extracting from a stagnant donor phase , as in previous online drug kinetics monitoring this is of importance , because depletion of the sample influences the kinetics of the reaction under study . figure 4a shows the probe , which is located inside a tube through which the donor solution is pumped . first , the dipin flowflow eme probe was dipped in a temperaturecontrolled chamber containing the reaction mixture , then the sample was slowly ( 10 l / min ) flushed through the chamber while eme took place ( extraction voltage 200 v ) . finally , the acceptor phase of eme , which was flowing as well during the extraction ( 10 l / min ) , was flushed to a triple quadrupole ms to detect the analytes in selected ion monitoring mode . figure 4b shows extracted ion chromatograms of the products of promethazine metabolism by rat liver microsomes into its two major metabolites soxide promethazine and soxide ohpromethazine . it would be interesting to know the associated lods of this innovative approach , but these are not reported . thus eme could provide a valuable alternative to lc , offering analysis speed and efficient removal of ion suppressing compounds , especially when the analysis of a limited number of analytes is to be measured . a ) overlay of extracted ion chromatograms of promethazine ( b ) and its two main metabolites , soxide promethazine ( c ) and soxide ohpromethazine ( d ) . ee took place from a 50 l donor solution on the bottom of a vial , via an immiscible layer of organic solvent , which acted as a filter , into a 2 l acceptor solvent droplet , which was hanging from a conductive pipette tip ( fig . a set of acylcarnitines was used to demonstrate this approach . the optimal extraction time and voltagethe influence of the polarity of the organic filter phase on the enrichment of analytes was studied ( fig .5 b ) and it was shown that the system became more favorable for the extraction of more hydrophilic acylcarnitines when the polarity of the organic filter phase decreased . these results indicate that extraction selectivity can be tuned by altering the organic filter phase composition . furthermore , the authors demonstrated analysis of acylcarnitines spiked to protein rich samples and plasma with relative standard deviations below 15 % . in plasma , endogenous acylcarnitines were detected and lods were 90330 nm . clean mass spectra were obtained , implying effective protein removal and a multitude of endogenous metabolites were detected in plasma . lastly , the ability of automating the approach using an automated nanoesi robot and a modified 96wells plate was explored . as being capable of automatically performing ee and nanoesi would make the approach highly suitable for highthroughput metabolomics studies . ( a ) setup of threephase ee ( left ) and its coupling to nanoesidims ( right ) . etoac = ethyl acetate , metoac = methyl acetate , dehp = bis ( 2ethylhexyl ) phosphate . adapted from 9 . table 1 provides a detailed overview of the work in which eme and ee have been combined with lc . a total of 29 studies have been included of which two were coupled online to lc , which are highlighted in this section . in the majority of the eelc and emelc work optical detection techniqueswere used , such as uv ( 17 ) or fluorescence ( 2 ) detection . furthermore , several instances of ms detection ( 12 ) were reported . certain applications reported combinations and have not been assigned separately . in order to make a comparison between the different techniques , the reported detection limits were converted to nm , which was also done for the articles discussed in the remainder of the review . analyses performed with lcms and both lcuv both typically yielded subnm to 10 nm detection limits , which is surprising , as ms is generally considered more sensitive than uv detection . the majority of the eme and ee work was applied to drug compounds or relatively hydrophobic compounds , such as aromatic amino acids , azo red dyes , herbicides , and volatile organic compound metabolites . notable exceptions are the eme of inorganic anions , pulsed mode eme of histidine , phenylalanine , tryptophan , and asparagine and glutamine . the highest efs were achieved using ee , which was applied to extract peptides from plasma and ee , which was applied to extract acylcarnitines from urine . these high efs were achieved by having nearly exhaustive extraction for selected target compounds combined with the fact that the donor volume was 1000 times larger than the acceptor volume . the ee flow cell developed by schoonen et al. 30 showed demonstrated near exhaustive extraction for target analytes except for lauroylcarnitine , which is likely caused by solubility issues . the largest achievable ef in the cited works was in studies that made use of a 24 ml donor phase in combination with acceptor phases of 1025 l . according to eq .2 , very high efs of up to 2400 can theoretically be achieved with this system . however , since the extractions were not exhaustive , with ers typically below 15 % , moderate efs were obtained as follows from eq . recently , it was demonstrated that ph changes due to electrolysis affecting the acceptor phase during eme play an important role in the ability of an extraction to be exhaustive . furthermore , by choosing an acceptor phase with a stronger buffering capacity , the ers that can be achieved are strongly enhanced . this can be explained by the fact that the analytes maintain their charge in the acceptor phase for a longer duration due to reduced effects of electrolysis of the acceptor phase . a potential downside of this approach is that the sample might not be suitable for injection into an analytical system due to the high / low ph value or the salt content becomes too high when the sample is neutralized prior to injection . the extraction times for all techniques were in the range of 5 min to 20 min , with exception of the chipbased eme setups , where the optimized extraction times were 33 min and 25 min 23 . it is important to note that the flow rate and the donor volume play a critical role in the extraction times of chipbased setups . a chipbased setup for the eme of chlorinated phenoxyacetic acids was faster , despite having a donor volume that was five times higher than the eme chip for basic drugs . the parallel eme setup had the highest throughput , despite taking 8 min for the eme procedure . the system with the fastest total analysis time reported the extraction of drugs from whole blood , taking 5 min for eme and 5.5 min for separation . the range of voltages applied span several orders of magnitude , from 1.5 v to 300 v for eme and 300 v to 15 kv for ee . the 1.5 v for eme was chosen due to the fact that the extraction took place over an ionic liquidbased membrane , which typically has a lower resistance than commonly used slm solvents . this results in higher currents and necessitates the use of a low extraction voltage in order to avoid effects of electrolysis and joule heating . ee usually takes place from a thick organic phase , often ethyl acetate , into an aqueous phase . because of this , higher voltages can be applied during ee than in eme , where the organic phase , which is located inside the slms , is typically thin . when hyphenating ee and eme to lc , care should be taken that the acceptor phase is suited for injection onto the lc column . in all the lcrelated work that is within the scope of this review , the acceptor phase is of aqueous nature , which explains the fact that reversed phase lc is almost exclusively used in combination with ee and eme , one exception being ion chromatography for the analysis of inorganic anions . furthermore , this might also explain the fact that the application area of emelc currently mainly covers mediumapolar to apolar compounds , such as peptides and drugs . ef and er values indicated in italics are calculated based on data provided in the paper matrix is only mentioned when extraction performance is tested therein . * in order of increasing lod . * * danofloxacin , enrofloxacin , marbofloxacin , ciprofloxacin , grepafloxacin , gatifloxacin . * * * danofloxacin , enrofloxacin , grepafloxacin , ciprofloxacin , norfloxacin , gatifloxacin , marbofloxacin . * * * * nacetyls ( phenyl ) lcysteine , nacetylsbenzyllcysteine , nacetyls ( 2,2 dichlorovinyl ) lcysteine , nacetyls ( 2,2 dichlorovinyl ) lcysteine , nacetyls ( 1,2 dichlorovinyl ) lcysteine , 3methylhippuric acid , 4methylhippuric acid , 2methylhippuric acid , phenylglyoxylic acid , hippuric acid , mandelic acid . naproxen , ketoprofen , ketorolac , salicylic acid , diclofenac , ibuprofen . nacetyls ( phenyl ) lcysteine , 2methylhippuric acid , 3methylhippuric acid , 4methylhippuric acid , hippuric acid , phenylglyxolic acid . n.r . detection , ef , enrichment factor ; er , extraction recovery ; et , extraction time ; st , separation time ; ev , extraction voltage . an important aspect that should be taken into account when ee and eme are hyphenated online to lc is that the setup should either be resistant to high pressure or decoupled from this pressure . moreover , current leakage from the ee or eme system to the lc system should be prevented in order to avoid possibly damaging the equipment and to prevent endangering the operator . see & hauser reported on an automated system for eme coupled online with lcms . in this work a previously developed polymer inclusion membrane ( pim ) this pim consisted of cellulose triacetate as base polymer , tris ( 2ethylhexyl ) phosphate as plasticizer and varying amounts of aliquat 336 as cationic carrier . the eme system ( fig .1 a ) was composed of a twoway syringe pump , a nineport channel selection valve and a miniaturized flowthrough extraction cell . the acceptor side of the chamber was filled with acceptor solution and remained stagnant during extraction , while the donor solution was flowing . the operation of the entire system was performed using an opensource electronics prototyping platform . in one experimentthe donor volume and analyte concentration were varied while the total amount of chlorinated phenoxyacetic acid herbicides ( cpas ) that were led through the extraction cell were kept constant . the lods that were obtained ( using 5 ml donor phase ) with this system for cpas were 0.120.43 nm and efs of 201235 were reported . furthermore , the repeatability was good ; when the cpas were spiked to river water samples the relative standard deviations were in the range of 4.85.5 % . the ( nearly ) exhaustive extraction of samples as large as 25 ml was successfully demonstrated , suggesting that very high efs and thus very low lods can be achieved . ( a ) experimental setup of the developed emelcms system ( b ) emelcms results of cpas spiked to river water ( extraction voltage 200 v , donor phase flow rate 0.2 ml / min ) . ( a ) 5 ml of 0.5 ng / ml cpas ( b ) 10 ml of 0.25 ng / ml cpas and ( c ) 25 ml of 0.1 ng / ml cpas .4 cpa = chlorophenoxyacetic acid ; 3,4 d = 3,4 dichlorophenoxyacetic acid ; 2,4 d = 2,4 dichlorophenoxyacetic acid ; 2,4,5 t = trichlorophenoxyacetic acid . adapted from 23coupled ee online to reversedphase lcms via a 2way 10port switching valve for the determination of peptides spiked to plasma . ee took place in a large bore ( 1 mm inner diameter ) peek capillary . a schematic diagram of this setup is shown in fig . first , the injection of the donor and acceptor phases , application of the electric field and transfer to the sample loop of the switching valve , were performed using a ce apparatus . next , the loop was switched and the extracted analytes were injected onto the separation column using an lcms system . the entire system , i.e. ce instrument , switching valve and lcms equipment , was automated and could extract and analyze a series of samples without human interference . the organic donor phase volume was 100 l of ethyl acetate containing the sample ions and 1.8 % ( v / v ) trifluoroacetic acid , the extraction voltage was 15 kv and the extraction time 6 min . lods of 1050 nm were obtained , and efs of 570990 , corresponding to ers of 5799 % . ( a ) valve setup for interfacing large volume cee with lc . ( a ) inlet capillary , ( b ) ee capillary , ( c ) sample loop , ( d ) outlet capillary , ( e ) lc waste , ( f ) lc pump tubing , ( g ) tubing to earth , ( h ) tubing to lcms . step 2 : situation after ee is finished ; the small black zone depicts the concentrated analytes . step 3 : situation after the sample has been transferred into the sample loop by applying pressure . step 4 : situation where the sample zone is being injected into the lcms system . ( b ) comparison of chromatograms obtained from lc ( 0.1 l injection ) and large volume ceelcms ( 100 l extraction volume ) . the aforementioned method was successfully applied to the analysis of acylcarnitines in urine , resulting in estimated lods of 1.4390 nm and efs of 175970 , corresponding to ers of 17.597 % . the polarity of the acylcarnitines , which is mainly a result of the acyl chain , was observed to be of major influence on extraction performance ( with a bias to the more apolar acylcarnitines in the test mixture ) . generally emegc was applied to tricyclic antidepressants , once to opioids and once to pyridine derivates . the extraction times ranged between 14 and 20 min , with voltages ranging from 50 to 240 v and separation times between 5 and 25 min . ef and er values indicated in italic are calculated based on data provided in the paper matrix is only mentioned when extraction performance is tested therein . * in order of increasing lod the number of reported emegc applications is lower than the combination of eme and lc . this is due to the fact that eme typically takes place from an aqueous donor into an aqueous acceptor . however , when combined with gc only one eme work made use of an aqueous acceptor phase , which was subsequently directly injected into the gc system . several precautions were taken in order to make this possible , such as keeping the injection volume low , preventing the water from condensing on the column and selecting appropriate column . however , despite these complications , this system had the fastest total analysis time . the other works made use of organic injection solvents by applying eme directly into a solid support , i.e. solidphase microextraction ( spme ) , into an organic phase or by applying dispersive liquidliquid microextraction ( dllme ) after the eme procedure . in general , polar groups need to be derivatized prior to gc analysis in order to increase the vapor pressure of the analytes . only one technique included derivatization , which was performed after eme into a solid pencil support . the largest efs were achieved with emedllme of drugs from urine followed by gcms analysis . as already mentioned in the lc section , the highest efs can be obtained where the difference between donor and acceptor volume is the largest . however , the ef can not be deduced from emespme , as the analytes adsorb to a solid sorbent . this is due to the fact that the reported recoveries are not the recoveries of eme alone , but recoveries from the combination of eme and spme or dllme . it is important to note that in order to properly assess the total analysis time when combining eme with gc that the duration of the spme , dllme and derivatization procedures need to be taken into account . these analysis times were 10 min for the emedllme of pyridine derivates , 3 min for the emedllme of tricyclic antidepressants and 2 min for the thermal desorption and derivatization during emespme . until now , eme has not been coupled online to gc , but important steps have been taken towards achieving online hyphenation . for example , an eme system called electromembrane surrounded solid phase microextraction bridges the gap between eme and gc considerably . here , the analytes were extracted from an aqueous donor phase , via an organic supported liquid membrane , into an aqueous acceptor phase in which the analytes were adsorbed to a solid sorbent , i.e. a pencil lead , that acted as the cathode . after eme , the pencil lead was inserted into a gc injector for thermal desorption of the analytes and consecutive analysis . the method was applied to analysis of doxepin and amitriptyline in urine ( lod 3.6 nm for both ) and plasma ( lod 18 and 9 nm , respectively ) ; reported ers ( covering both eme and spme ) were in the range 310 % . in the work performed by razazadehet al. 15 , emespme was applied to the analysis of acidic herbicides in plant material , with lods of 2.225 nm and ers ( including spme ) of 0.64.8 % . two reports of an eme setup where the acceptor phase and slm phase were comprised of the same organic solvent were made , i.e. twophase eme . this allowed for direct injection of the extracted analytes into a gc system . in both cases the eme setup consisted of a sample vial containing the donor phase in which one electrode is immersed and a hollow slm fiber containing the acceptor phase in which the other electrode is immersed . using a magnetic stirrer , the donor solvent was agitated during eme to enhance extraction . after extraction , the acceptor solution was collected and injected directly into a gc system . fid was used in case of optimization experiments and ms in case of analytical characterization . the authors tested several organic solvents as acceptor solvent and found that 1heptanol yielded the highest ers for tricyclic antidepressants . a requisite of the solvent is that it has some electric conductance , which draws parallels to ee . the ph of the donor solution , extraction voltage , stirring speed and extraction time were optimized and a comparison with conventional ( threephase ) eme was made . twophase eme was shown to have an interday repeatability in the range of 6.210.8 % while intraday repeatability was in the range of 6.011.8 % , indicating robust analytical performance . twophase eme was found to be faster than threephase eme ( 15 versus 20 min extraction time ) , while the ef and lod were somewhat lower , i.e. 145 versus 280 and 0.1 ng / ml versus 0.8 ng / ml respectively . however , this comparison does not take into account differences in volume ratios of donor and acceptor phase that affect both ef and er ( eq .5 ) . there is an important difference in the electric field distribution in conventional ( threephase ) eme and twophase eme , which could account for the shorter extraction time in twophase eme . in the twophase eme setup , the majority of the electric field is applied over the acceptor phase , which has the highest resistance , which could indicate slow extraction and low recovery . however , the er of some selected test compounds ( imipramine , desipramine , sertraline and citalopram ) after 15 min of eme with 1heptanol as organic phase was surprisingly high : 7087 % . interesting to note is that further improvements have been made by performing twophase eme in pulsed mode and in combination with a surfactant to enhance mass transport across the slm . herethe acceptor phase consisted of 1octanol instead of 1heptanol and the donor phase contained 0.02 % ( w / v ) sodium dodecyl sulfate . by performing the eme in pulsed mode with the aforementioned surfactant , the recoveries increased compared to conventional twophase eme from 48.368.5 % to 70.595.2 % . in our opinion , the fact that analytes were successfully extracted from an aqueous donor phase into an organic donor phase , which is opposite to all other ee and eme work , is important . this is because it not only opens up possibilities for online hyphenation of eme to gc , but also to normal phase lc and hilic . as the donor and acceptor solvent are immiscible and present in sufficient volumes , the membrane could perhaps be abandoned , which might result in a simpler ee system . since ce , ee , and eme are all based on electromigration , combinations of ce with one of the two is a logical and attractive option . however , no reports of ee coupled with ce have been reported within the timeframe of this review . table 3 shows that the combination of eme with ce has been reported in the literature various times . in all cases , a combination of eme and capillary zone electrophoresis was reported . however , in the aforementioned ee of acylcarnitines in urine , the primary employed separation technique was lc , but the offline combination with ce was briefly explored and found to be promising : extracts from urine obtained by ee were analyzed with a cems system and it was shown that metabolites from various important classes , such as amino acids and acylcarnitines could be measured in these extracts . ef and er values indicated in italic are calculated based on data provided in the paper matrix is only mentioned when extraction performance is tested therein . * in order of increasing lod . ** loperamide , haloperidol , nortriptyline , tryptophan , phenylalanine , creatinine , tyrosine , histidine , arginine . * * * pentachlorophenol , 2,4,6 trichlorophenol , 2,3 dichlorophenol , 2,3 dichlorophenol , 2chlorophenol , 3chlorophenol , 4chlorophenol . * * * * 3,4 methylenedioxymethamphetamine , amphetamine , methamphetamine . #loperamide , methadone , nortriptyline , pethidine , haloperidol . as can be observed in table 3 , ms detection in combination with emece has not been reported , despite the sensitivity and selectivity it offers . cd has two advantages for usage in combination with eme , ( i ) integration into a ce system is relatively simple and ( ii ) detection of all charged species is possible , including those that can not be detected with optical detection methods . as ce is more suited than reversed phase lc for separation of hydrophilic and charged analytes , some eme applications to amino acids , polyamines and polar herbicides were combined with ce . the reported lods were generally in the low nm range , regardless of the use of cd or uv as detection method . it is interesting to note that some applications had low ers , but still had favorable , low nm to m lods , such as eme performed at constant current and nanoeme . the low lods with nanoeme that were obtained , despite the ers 1 % , were achieved due to the fact that the potential ef would be 25000 times on the basis of exhaustive extraction . nearly exhaustive extractions were obtained when using carbon nanotubes in slms , with ers of 90 % and efs of 180 . extraction times ranged from 2 to 32 min and separation times between 4 and 25 min . voltages ranged between 4 and 1500 v. in case of the 1500 v potential , as was applied in a polymer inclusion membrane ( pim ) eme flow cell , electrolysis issues were resolved by placing the electrode in the donor channel at the outlet , which caused bubbles to be flushed away and prevented them from intervening with the extraction process . when hyphenating eme online with ce , care must be taken that the acceptor phase is suited for ce analysis . thus , the acceptor phase solvent should not disturb ce separation and , especially in the case of online coupling , the acceptor phase volume should match the ce injection volume . a typical hydrodynamic injection into a ce capillary should be preferably below 2 % of the capillary volume , often corresponding to volumes of up to 20 to 30 nl , unless stacking procedures are used . the low loadability of ce can be considered a limiting factor in achieving low lods ; this is where online coupling of ee and eme to ce can be highly advantageous . this integration resulted in an emece capillary that could be used as many as 200 times , before it needed to be replaced . these 200 runs took place in a period of two months in which water samples and urine samples were analyzed . nanoeme , as the acceptor volume consisted of a minute amount of 8 nl phosphate buffer . the nanoeme setup was realized with a cracked fused silica capillary , which was surrounded by an slm ( fig .3 a ) . with this setup , pethidine , nortriptyline , methadone , haloperidol , and loperamide were extracted from urine , separated by ce and detected with uv . the sample volume was 200 l , the membrane solvent was nitrophenyl octyl ether , the extraction time 120 s and the extraction voltage 200 v. efs were 25196 , but the ers were low ( 1 % ) . this could be a benefit when the setup is applied to study reaction kinetics , as oversampling would disturb the kinetics . importantly , the authors developed a electromigrationbased slm cleaning procedure by submerging the slm for 2 min in 10 mm hcl while applying 200 v and simultaneously flushing the capillary with separation buffer . furthermore , the relative standard deviations were less than 15 % when this cleansing extraction procedure was applied and it ensured that one emece capillary could be used 200 times . the authors also show highly promising urine analysis results in which several spiked drugs were significantly enhanced by rapid 15 s extractions ( fig . no betweencapillary repeatability was reported . however , the authors indicated that a more robust nanoeme design should be created . ( a ) instrumentation used for nanoeme ( b ) urine analysis by ceuv , comparing ( a ) blank urine without nanoeme , ( b ) spiked urine without nanoeme and ( c ) spiked urine with nanoeme , applying 200 v for only 15 s. peak assignment : 1 pethidine , 2 nortriptyline , 3 methadone , 4 haloperidol , 5 loperamide . adapted from 50 . for the analysis of lowabundant analytes in biological samples the low recovery does not pose a limitation ( the obtained lods were 0.4160 nm ) . nonetheless , online coupling of emece to a more sensitive detector , such as lif or ms seems attractive for the analysis of lowabundant compounds . table 4 shows an overview of the efforts that have been undertaken to combine ee and eme directly with detection techniques that require no separation of analytes . most of these efforts are highly targeted approaches , due to the fact that without prior separation interfering components might affect efforts to quantify the analytes . several efforts were aimed at the online monitoring of drug metabolism by rat liver microsomes using direct infusion ms . these platforms investigate kinetics involved on a continuous timescale as opposed to the discrete concentrationtime profiles that are obtained via lcms . another msbased online approach that was reported is threephase ee . aside from drug compounds and metabolites , two eme applications focused on the detection of nuclear fuel in aqueous environmental samples using fluorescence and uv detection . the lods for the various direct detection techniques ranged from subnm to high nm concentrations . the ers and efs were varying to a great degree , but the highest efs were achieved by eme of morphine from urine , showing a 152fold enrichment along with a satisfactory er of 76 % . extraction times for the monitoring of drug metabolism kinetics depend on the time the reaction is monitored as well as the volume of the phases . for example , the eme probe could theoretically be used for 333 min at an acceptor flow rate of 3 l / min and an acceptor volume of 1 ml . aside from the monitoring applications , the extraction times were in the range of 9 and 30 min . for the online applications this time was very close to the total analysis time . overview of eme hyphenated to direct detection matrix is only mentioned when extraction performance is tested therein . * in order of increasing lod . * * propionyl , octanoyl , butyryl , decanoyl and hexanoylcarnitine . * * * and their metabolites . a major complication in ms is ion suppression of analytes by cooccurring sample components , such as salts , buffer molecules and proteins . ee and eme enable selective extraction of analyte molecules while leaving salts , buffer components and proteins behind , this in turn enables direct targeted ms analysis . as mentioned , in the past few years , several eme devices have been developed that allow for direct monitoring of drug metabolism . in these studies , the main objective was not to achieve the highest ers and lowest lods , but to couple eme online to ms and to apply it to study drug metabolism in real time . one such application is a microfluidic eme chip that can be coupled online to ms and allows for monitoring of metabolism of amitriptyline by rat liver microsomes in an easily accessible open reservoir . the chip consisted of two polymethyl methacrylate ( pmma ) plates with channels on each plate . a polypropylene slm consisting of porous polypropylene with nitrophenyl octyl ether immobilized in its pores was located between the two plates , which separated the donor and acceptor channels . a platinum wire electrode was inserted in the sample channel , in order to close the electric circuit . furthermore , this electrode prevented the slm from blocking the channel upon application of negative pressure at the outlet . the eme chip was connected to a temperaturecontrolled reaction chamber , in which amitriptyline was metabolized by rat liver microsomes . with a syringe pump , the reaction mixture was transferred to the sample channel , where amitriptyline and its metabolites were extracted by eme . another syringe pump transferred the acceptor solvent containing the extracted analytes towards an ion trap ms . the response time of the system , i.e. the time until the detector responded to a change in the sample , was rapid at 9 s. the eme recovery of amitriptyline from a standard solution was 83 % at 5 l / min sample flow , which was determined using a sample loop . the authors thoroughly investigated ion suppression and showed that salts , proteins and buffer components were not extracted . this new design was implemented in order to simplify construction and to make access to the slm easier . the eme probe was tested on rat liver microsome mediated metabolism of amitriptyline , promethazine and imipramine . finally , fuchs et al. 19 further improved the probe to prevent sample depletion . instead of extracting from a stagnant donor phase , as in previous online drug kinetics monitoring this is of importance , because depletion of the sample influences the kinetics of the reaction under study . figure 4a shows the probe , which is located inside a tube through which the donor solution is pumped . first , the dipin flowflow eme probe was dipped in a temperaturecontrolled chamber containing the reaction mixture , then the sample was slowly ( 10 l / min ) flushed through the chamber while eme took place ( extraction voltage 200 v ) . finally , the acceptor phase of eme , which was flowing as well during the extraction ( 10 l / min ) , was flushed to a triple quadrupole ms to detect the analytes in selected ion monitoring mode . figure 4b shows extracted ion chromatograms of the products of promethazine metabolism by rat liver microsomes into its two major metabolites soxide promethazine and soxide ohpromethazine . it would be interesting to know the associated lods of this innovative approach , but these are not reported . thus eme could provide a valuable alternative to lc , offering analysis speed and efficient removal of ion suppressing compounds , especially when the analysis of a limited number of analytes is to be measured . a ) overlay of extracted ion chromatograms of promethazine ( b ) and its two main metabolites , soxide promethazine ( c ) and soxide ohpromethazine ( d ) . ee took place from a 50 l donor solution on the bottom of a vial , via an immiscible layer of organic solvent , which acted as a filter , into a 2 l acceptor solvent droplet , which was hanging from a conductive pipette tip ( fig . a set of acylcarnitines was used to demonstrate this approach . the optimal extraction time and voltagethe influence of the polarity of the organic filter phase on the enrichment of analytes was studied ( fig .5 b ) and it was shown that the system became more favorable for the extraction of more hydrophilic acylcarnitines when the polarity of the organic filter phase decreased . these results indicate that extraction selectivity can be tuned by altering the organic filter phase composition . furthermore , the authors demonstrated analysis of acylcarnitines spiked to protein rich samples and plasma with relative standard deviations below 15 % . in plasma , endogenous acylcarnitines were detected and lods were 90330 nm . clean mass spectra were obtained , implying effective protein removal and a multitude of endogenous metabolites were detected in plasma . lastly , the ability of automating the approach using an automated nanoesi robot and a modified 96wells plate was explored . as being capable of automatically performing ee and nanoesi would make the approach highly suitable for highthroughput metabolomics studies . ( a ) setup of threephase ee ( left ) and its coupling to nanoesidims ( right ) . etoac = ethyl acetate , metoac = methyl acetate , dehp = bis ( 2ethylhexyl ) phosphate . adapted from 9 . in this review , we presented a detailed overview of concentration enrichment studies performed by ee and eme in the period between april 2012 and november 2015 . specifically , we made a comparison between various approaches and the combination with separation techniques and direct detection . in this comparison , the importance of looking at the combination of ef and er was emphasized , as ef alone does not yield sufficient information on the extraction efficiency . not all papers reported on all crucial parameters , i.e. er , ef , acceptor and / or donor phase volume and lod , which made it difficult to put the techniques into perspective and to compare the various approaches . therefore , we propose that at minimum the aforementioned crucial parameters are reported in ee and eme research , in order to provide results that can be compared to other methodologies . several papers were highlighted that demonstrated the online hyphenation of ee and eme to analytical separation and / or detection techniques or in which important steps were taken towards achieving online hyphenation . ms is often the detection method of choice , as it offers unmatched selectivity and high sensitivity . however , due to the concentration power of eme subnm lods could also be obtained with uv detection . online hyphenation of eme with lc was achieved by coupling an eme flow cell to a channel selection valve . the advantage of this flow cell based setup is its ability to extract large donor phase volumes without compromising the high er . the other ee and eme flow cell designs covered in this review also have a similarly high potential for online hyphenation to lc . the nanoeme technique was also coupled online to ce and has an advantage over conventional hydrodynamic injection , as the analytes are concentrated directly within the minute volume of the separation capillary and thereby the loadability of ce is enhanced . though far from exhaustive , this type of extraction can still be of added value for monitoring reaction kinetics . most online monitoring of reaction kinetics using eme took place via direct detection , often ms was the detector of choice . whether via flow cell designs or probes , eme was able to extract drug metabolites generated by rat liver microsomes . the focus here was not so much on the concentration enrichment , but on the removal of components that could result in ion suppression . the eme probe setup was modified to make use of both flowing donor and acceptor phases , which prevented perturbations in the reaction kinetics . another technique , threephase ee , was briefly evaluated for online hyphenation to ms analysis and showed promising results for high throughput metabolomics . last , the twophase eme method shows a high potential for automated online coupling to gc , as the acceptor solvents are suited for direct injection into a gc column and the manual removal of the acceptor phase by the injection syringe could be automated . the twophase extraction without the use of an slm , as it is identical to the acceptor phase solvent , might warrant investigation . the twophase eme technique could also be used in conjunction with normal phase lc and hilic due to the nature of its ( organic ) acceptor phase solvents . eme will continue to move from academic research towards reallife applications , as demonstrated in forensics and clinical applications ( e.g. driedbloodspot analysis ) . in the near future we foresee that ee and eme can become important in labonachip ( loc ) systems . the high efs that ee and eme offer can provide loc systems with much demanded sensitivity , as is already shown in the works involving the metabolism of drugs via rat liver microsomes . furthermore , as highlighted in this review , several groups successfully developed chipbased ee and eme approaches which show excellent potential for incorporation into loc systems , such as the ee and eme flow cells . these setups make use of low voltages and low flows , which matches the scales that are used on loc systems . another eme system that demonstrates scalability with loc systemsfurthermore , using nanoeme very short extraction times can be sufficient to concentrate analytes , which implies that it is promising for highthroughput screening of drug compounds on in vitro cell cultures in microfluidic loc systems . there are promising examples of ee and eme of hydrophilic compounds , but their number is limited . improved knowledge of eme processes have enhanced the extraction process of these hydrophilic compounds as described recently , but the extractions are often not exhaustive . further research into expanding the target range of ee and eme analysis to more hydrophilic compounds makes the extraction of many endogenous compounds , such as metabolites , feasible . overall , we conclude that eme and ee are highly promising electromigrationbased sample pretreatment techniques with excellent prospects for online hyphenation to analytical separation and detection techniques . in the resulting systems efficient sample cleanup and analyte enrichmentthis review was made possible by the european union campac project , seventh framework programme ( fp7 / 20072013 ) under grant agreement 602783 .\noutput:\n" }, { "from": "agent", "value": "electroextraction ( ee ) and electromembrane extraction ( eme ) are sample preparation techniques that both require an electric field that is applied over a liquidliquid system , which enables the migration of charged analytes . furthermore , both techniques are often used to preconcentrate analytes prior to analysis . in this review an overview is provided of the body of literature spanning april 2012november 2015 concerning ee and eme , focused on hyphenation to analytical techniques . first , the theoretical aspects of concentration enhancement in ee and eme are discussed to explain extraction recovery and enrichment factor . next , overviews are provided of the techniques based on their hyphenation to lc , gc , ce , and direct detection . these overviews cover the compounds and matrices , experimental aspects ( i.e. donor volume , acceptor volume , extraction time , extraction voltage , and separation time ) and the analytical aspects ( i.e. limit of detection , enrichment factor , and extraction recovery ) . techniques that were either hyphenated online to analytical techniques or show high potential with respect to online hyphenation are highlighted . finally , the potential future directions of ee and eme are discussed ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: . early markers of the syndrome are often present before persistent blood pressure elevation . progression is strongly associated with functional and structural abnormalities that damage the heart , kidneys , brain , and vasculature . based on population - based survey conducted in 1979 arterial hypertension comprises 12 % of the iraqi population . after that , there is only small report from selected primary health care centers in nasiriya city south of iraq , reported 46.1 % of study population were hypertensive . hospitals morbidity data provided by iraqi ministry of health in 2004 demonstrates a 65 % increase of the hospital admission due to coronary heart disease ( chd ) and stroke and more than a fivefold increase in outpatient visits with the same diagnosis between 1989 and 1999 . the major antihypertensive drugs are provided to the patients in iraq by special cards freely in the primary health centers , yet this supply frequently was insufficient and interrupted . in developed countriesarterial hypertension is the most prevalent cardiovascular disorder modifiable risk factor ; it affects about 20 % to 50 % of the adult population in these countries . hypertension increases the risk of stroke by sevenfold more than general population , and strict blood pressure control can decrease the risk of recurrent stroke by one third . for every 20 - mm hg systolic or 10 - mm hg diastolic increase in bp , there is a doubling of mortality from both coronary heart disease and stroke . despite advances in the understanding of the hypertension pathophysiology and the availability of effective treatment strategies , the rate of blood pressure control is still very low and the reasons for that include poor health awareness , poor dietary system , and noncompliance on the drug therapy . the aim of the study is to evaluate hypertension duration , type of antihypertensive drug , antihypertensive treatment compliance , and salt - free diet compliance , as well as the age at onset of hypertension in group of patients with acute myocardial infarction and group of patients with acute ischemic stroke , and to assess the differences in those parameters between both groups . the study is cross - sectional comparative study involving one - hundred and ninety - one hypertensive patients ; the patients were from 2 groups , the first group was the acute ischemic stroke patients with hypertension which includes 81 consecutive patients ( 36 females and 45 males ) , and their ages were between 3382 years . the second group was the acute myocardial infarction patients with hypertension which includes 110 consecutive patients ( 46 females and 64 males ) , and their ages ranges from 2376 years . the study was conducted in neurosciences hospital , al - kindy teaching hospital and ibn albitar cardiac center in baghdad between june 2010 and june 2011 . the selection of patients does not differ in these diseases between general and specialized centers as the stroke and coronary heart disease patients were admitted into each hospital as an emergency cases . each patient with those diseases was asked about his chronic disease treatment cards which are provided for patients with chronic diseases in the primary health centers and was asked and assessed clinically for hypertension . the criteria for inclusion of the first group were all patients admitted with acute ischemic stroke with history of hypertension or patients with no history of hypertension but having retinal stigmata of hypertension or ecg changes suggestive of hypertension . the criteria for inclusion of the second group were all patients admitted with acute myocardial infarction proved by ecg and cardiac enzymes ; all types of myocardial infarction were included ; there should be history of hypertension or retinal stigmata of hypertension or ecg changes suggestive of hypertension in those who deny history of hypertension . all patients were asked about age of hypertension onset , hypertension duration , type of antihypertensive drug treatment , antihypertensive treatment compliance , and salt - free diet compliance . these data were also documented by reviewing the patient primary health care chronic disease card . all patients had ecg testings during their admissions ; brain ct scanning was done for all stroke patients . the data about drug and diet was taken from the patients and their relatives , and the patients were considered noncompliant on drug when there are frequent interruptions in their dug intake , all patients had been advised for salt - free diet , and patient considered noncompliant when the patient eat normal salt diet . the patient was considered as silent hypertensive when there is no past history of hypertension , but the patient has retinal stigmata of hypertension or ecg changes suggestive of hypertension . the data was tabulated using microsoft excel 2007 , and statistical differences were assessed using graph pad software ( quick calc site for scientist ) . fisher 's test was used to assess the statistical differences for categorical data , and mcnemar 's test was used to compare proportions differences . the male involvement from both groups ' total patients was 57 % ; male forms 58 % and 55.5 % of myocardial infarction and ischemic stroke groups respectively ( table 1 ) . the female ratio were 42 % and 44.5 % of myocardial infarction and ischemic stroke groups , respectively ( table 1 ) . salt - free diet noncompliance was seen in 69 % and 62 % of myocardial infarction and ischemic stroke groups , respectively ( table 1 ) . ages below 40 years were seen in 22 % and 7 % of myocardial infarction and ischemic stroke groups , respectively ( table 1 ) . duration of hypertension between 6 to 10 years was seen in 57 out of 110 and 41 out of 81 of myocardial infarction and ischemic stroke groups , respectively , other durations were seen in table 2 . patients not known as hypertensive previously and discovered only by retinal stigmata and ecg changes of old hypertension form 23 out of the total 191 of both groups ( 12 % ) ; 7 out of 110 ( 6.3 % ) and 16 out of 81 ( 19.7 % ) of myocardial infarction and ischemic stroke groups , respectively , were not known as hypertensive previously ( table 3 ) . noncompliance on antihypertensive therapy was seen in 61 % out of the total 191 of both groups ; 71 % and 48 % myocardial infarction and ischemic stroke groups , respectively , were not compliant on antihypertensive therapy ( table 3 ) . the total drug treatment types were 24 % angiotensin converting inhibitor , 18.8 % combined drugs , 16.2 % beta blocker , 11 % angiotensin receptor blocker , 10.4 % ca channel blocker and 7.3 % diuretic ( table 4 ) . the drug treatment type in myocardial infarction with hypertension cases were 25 % angiotensin converting inhibitor , 19 % combined drugs , 17 % beta blocker , 15 % angiotensin receptor blocker , 10 % ca channel blocker and 8 % diuretic ( table 4 ) . the drug treatment type in ischemic stroke with hypertension cases was 23 % angiotensin converting inhibitor , 21 % combined drugs , 15 % beta blocker , 10 % ca channel blocker , 6 % diuretic and 5 % angiotensin receptor blocker ( table 4 ) . the prevalence of hypertension was widely variable in different societies ; it was ranged from 3 % to 73 % . hypertension forms a very big medical problem in iraq , the present study showed male involvements were higher than females in both ischemic stroke and myocardial infraction groups ; this is related to higher male prevalence in both of these diseases and not reflecting higher hypertension prevalence in male gender ; this is in agreement with higher male gender reported by zdrojewski et al . in natpol iii study . many reports from different countries reported higher female prevalence rate of hypertension . the salt - free diet noncompliance rate was seen in 69 % and 62 % of the myocardial infarction and ischemic stroke groups , respectively ; there is no statistical difference of both rates in both groups ; those rates represent a major reason for difficult to control treatment of the high blood pressure and later complications like stroke and ischemic heart disease . this high rate was in agreement with studies done in usa , which suggest strategies to reduce sodium intake on a population level to reduce stroke and mi incidence . many clinicians emphasize that not the level of salt intake but salt sensitivity of blood pressure which predicts the effect of salt restriction in the individual treatment of essential hypertension . silent hypertension is the asymptomatic cases that carry only stigmata of hypertension on ecg and retinal examination , it was reported in 12 % of the sample in the present study , and it forms 6 % and 19.7 % of the myocardial infarction and ischemic stroke groups , respectively . the silent hypertension was significantly associated with ischemic stroke rather than ischemic heart disease . we did not find an explanation for this higher risk of stroke in silent hypertension . the silent hypertension in the present study was less than the 20 % that was reported in the survey of hypertension in iraq in 1979 . awareness of hypertension was reported in 46 % of one meta - analysis and varied from 25.2 % in korea to 75 % in barbados ; . also in usa , more than 25 % of adults were unaware of their diagnosis . all the above results of unawareness of hypertension were higher than the present study results ; this is related to many factors including easy access and availability of blood pressure measurement in private and governmental clinics and too many nursing small booths available everywhere in iraq . this was related to serious increased prevalence of hypertension and other risk factors such as lack of smoking preventions laws as well as more stressful life events and insecure life style in iraq . the rate of the noncompliance was seen in 61 % , 71 % and 48 % of the total sample , the myocardial infarction , and ischemic stroke groups , respectively . those rates were higher than al - lami result and al - dabbagh results . our higher results is correlated to sampling error as our sample represents a complicated hypertension disease with stroke and myocardial infraction , whereas other samples represent hypertension without ischemic stroke or myocardial infraction . noncompliance was significantly higher in patients with myocardial infarction ( p = less than 0.0001 ) more than ischemic stroke . the present study showed the rate of antihypertensive drug prescription was angiotensin converting inhibitor 24 % , combined 18.8 % , beta blocker 16.2 % , angiotensin receptor blocker 11 % , ca channel blocker 10.4 % , and diuretics 7.3 % . these rates of treatment strategy were different from bajraktari et al . who found the angiotensin - converting enzyme inhibitors ( aceis ) and / or angiotensin ii receptor blockers were the drugs most commonly prescribed in his study group ( 83 % ) . - blockers ( bb ) were the second group of the drugs that were prescribed ( 71 % ) , followed by diuretics ( 60 % ) , and calcium channel blockers ( 26 % ) . the differences in treatment modalities between the 2 studies are related to socioeconomic differences between the two societies . the present study showed myocardial infarction was significantly associated with high rate of angiotensin receptor blocker use in comparison to stroke group ( p = 0.022 ) . the difficulties facing the progress of the present study were unavailability of recent iraqi other studies in this field because of the continuous war events in iraq since 1982 , the smallness of the sample size was because we did not include patients not having hypertension , those with coexisting stroke , and coronary heart disease , and many patients with severe stroke and coronary heart disease were unable , and refuse to participate in the study . the sample small size imposed us to use proportions and to use mcnemar 's test to compare differences between proportions . there was high rate of salt - free noncompliance in both myocardial infarction and ischemic stroke groups . silent hypertension forms 6 % and 19.7 % of the myocardial infarction and ischemic stroke groups , respectively . there is high rate of young below 40 age of myocardial infarction with hypertension patients more than the stroke patients . the noncompliance was seen in very high percentage of both groups , and noncompliance was significantly higher in patients with myocardial infarction . drugs most commonly used were angiotensin converting inhibitor in 24 % , combined in 18.8 % , beta blocker in 16.2 % , angiotensin receptor blocker in 11 % , ca channel blocker in 10.4 % , and diuretics in 7.3 % .\noutput:\n" }, { "from": "agent", "value": "objective . to assess differences in age of onset , hypertension duration , type of drug , treatment compliance , and salt - free diet compliance between patients with stroke and myocardial infarction . patients and methods . the study was conducted in 3 hospitals in baghdad between june 2010 and june 2011 . first group includes 81 stroke patients ( 36 females and 45 males ) , age ranges between ( 3382 years ) . second group includes 110 myocardial infarction patients ( 46 females and 64 males ) , ages ranges from ( 2376 years ) . results . salt - free diet noncompliance was seen in 69 % and 62 % of myocardial infarction and stroke groups , respectively . silent hypertension was seen in 6.3 % and 19.7 % of myocardial infarction and stroke groups , respectively . noncompliant on antihypertensive therapy was seen in 61 % , 71 % , and 48 % of the total , myocardial infarction , and stroke groups , respectively . the drug type was 24 % angiotensin converting enzyme inhibitor , 18.8 % combined drugs , 16.2 % beta blocker , 11 % angiotensin 11 receptor blocker , 10.4 % calcium channel blocker and 7.3 % diuretic . in stroke group , the commonest drug was 23 % angiotensin converting inhibitor and the least ( 5 % ) was angiotensin receptor blocker . in myocardial infarction group , the commonest drug was 25 % angiotensin converting inhibitor and the least ( 8 % ) was diuretic . discussion and conclusion . silent hypertension was high in iraq . salt - free diet noncompliance was high in both groups ; drug noncompliance was significantly higher in patients with myocardial infarction . angiotensin 11 receptor blocker use was associated significantly with myocardial infarction more than in stroke ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: sayur asin , spontaneously fermented mustard ( brassica juncea ( l. ) czem ) , is commonly consumed in many areas in indonesia in particular in east java province ( 1 ) . fermentation of sayur asin is performed over 37 days at ambient temperature ( 2830 c ) in the presence of brine and coconut water and an anaerobic treatment of the mustard ( 2 ) . salt addition to the mustard results to the growth of epiphytic lactic acid bacteria ( lab ) and fermentation until developing acidic and unique charateristics within the mustard ( 3 ) . the quality and food safety is related to the development of microbes during fermentation procedure . puspito and graham reported slight variations in manufacturing of mustard fermentation in some regions in indonesia ( 1 ) . it was probably due to the diverse topographies , tropical climate and other physical condition of indonesia . therefore , local fermented mustard from different regions in indonesia become an interesting source for exploration of indigenous lab diversity . in other regions , many new species have been reported from fermented foods including fermented mustard . for example , four new species of lab were reported in taiwan from fermented mustard ( 4 ) and different new species of lactobacillus from kimchi was also found in korea ( 5 ) and tiongkok ( 6 ) . the genetic variability and high diversity of lab from fermented foods were possibly caused by divergence in manufacturing processes , varying conditions of concentration of salts , anaerobiosis , moisture levels and temperature . these factors can determine and select the composition and community structure of lab in the fermentation final product . information regarding microbiology and diversity of lab species in fermented mustard from different regions in indonesia is still limited and is mainly obtained from a study applied conventional methods in identification of lab ( 1 ) . current lab taxonomy and identification studies involve combination of phenotypic ( physiological and biochemical ) and genotypic ( dna sequence ) analyses . molecular identification method is more accurate , sensitive , rapid , reproducible , and reliable which is not influenced by environmental factors ( 7 ) . this method supports the phenotypic methods suffer from lack of reproducility due to its specific conditions such as its association to the culture and the diversity of strains ( 8 ) . in bacteria , nucleotide sequences related to the 16s rdna have been useful and informative to provide information about the genus and species . the lenght of this region is relatively large enough ( approximately 1540 bp ) for genetic based identification and characterization purposes ( 9 , 10 ) . the aim of this study was to describe the diversity and distribution of culturable lactic acid bacteria in sayur asin of indonesia . four samples ( contain fermenting liquor and fermented mustard ) were collected from traditional manufactures located at tulung agung ( ta ) and kediri ( kdr ) in east java province , indonesia ( table 1 ) . sayur asin from two manufactures was prepared by spontaneous fermentation of brassica juncea ( l. ) czern at room temperature ( 2830 c ) for 37 days . samples were collected twice at different periods of the harvesting time . for the analyses of sayur asin , samples were taken aseptically and packaged into a plastic bag and stored at 4 c in ice boxes . profile of sayur asin collected from tulung agung and kediri ( east java ) in this study salinity of fermenting liquor was determined as described previously ( 11 ) . one gram fermented crushed mustard or 1 ml fermenting liquor was mixed with 9 ml 0.85 % ( w / v ) nacl solution . the serial dilutions were spread directly on the surface of mrs agar plates supplemented with 1 % caco3 , 1 % nacl and 6 % nacl ( for halophilic lactic acid bacteria ) . samples were incubated under anaerobic conditions in anaerobic jar at 28 c for 4 days ( 2 , 12 ) . colonies of acid - producing bacteria with distinct morphologies in terms of color , shape and size were further purified by streaking at least twice on mrs agar plates containing 1 % nacl ( 4 ) . only gram - positive , catalase - negative strains were selected ( 13 ) . the selected strains were stored at 80c in mrs broth containing 10 % glycerol ( 145 ) . genomic dna from each lab strain was isolated according to the method described before ( 15 ) . amplification of 16s rdna was carried out using primer pair of 27f ( 5 - agagtttgatcctggctcag - 3 ) and 1492r ( 5 - ggttaccttgttacgactt - 3 ) ( 16 ) . each reaction mixture contained 25 l go taq green master mix ( 2x ) ( promega ) , 4 l each primer ( 10 m ) and 1 l dna template ( 10100 ng ) . the amplification program was set as follows : 94 c ( 90 sec ) , 30 cycles of 95 c ( 30 sec ) , 50 c ( 30 sec ) , 72 c for ( 90 sec ) and a final extension at 72c for 5 min . pcr products were electrophorized on 1 % aga - rose gels at 100 v for 20 min and stained by ethidium bromide and visualized using uv transilluminator . full - length sequencing of 16s rdna was performed with the following universal primers : 27f , 518f , 800r , and 1492r . homology of the sequences was examined by comparing the obtained 16s rdna sequences with those available in the nucleotide databases of the genbank ( http://www.ncbi.nlm.nih.gov/blast ) using the basic local alignment search tool ( blast ) program . sequence from type material was selected in the blast option to find the homolog sequences only from the type strains materials . about new sequences of lab strains from sayur asin were aligned with eight sequences of the lab seqeunces from type strains using multiple sequence comparison by log - expectation ( muscle ) implemented in mega ( molecular evolutionary genetics analysis ) version 5.2 ( 17 ) . phylogenetic analysis was performed using the neighbor - joining method ( 18 ) in mega . the stability of the tree was assessed by bootstrap method ( 20 ) using 100 replications . phylogenetic tree generated from nj analysis of 16s rdna sequences from representative lab isolates from sayur asin collected in tulung agung and kediri ( east java ) . bootstrap values 50 % have been shown below the branch length and the scale bar represents 0.05 sequence divergence . four samples ( contain fermenting liquor and fermented mustard ) were collected from traditional manufactures located at tulung agung ( ta ) and kediri ( kdr ) in east java province , indonesia ( table 1 ) . sayur asin from two manufactures was prepared by spontaneous fermentation of brassica juncea ( l. ) czern at room temperature ( 2830 c ) for 37 days . samples were collected twice at different periods of the harvesting time . for the analyses of sayur asin , samples were taken aseptically and packaged into a plastic bag and stored at 4 c in ice boxes . profile of sayur asin collected from tulung agung and kediri ( east java ) in this studyone gram fermented crushed mustard or 1 ml fermenting liquor was mixed with 9 ml 0.85 % ( w / v ) nacl solution . each sample was serially diluted ( 10 to 10 ) . the serial dilutions were spread directly on the surface of mrs agar plates supplemented with 1 % caco3 , 1 % nacl and 6 % nacl ( for halophilic lactic acid bacteria ) . samples were incubated under anaerobic conditions in anaerobic jar at 28 c for 4 days ( 2 , 12 ) . colonies of acid - producing bacteria with distinct morphologies in terms of color , shape and size were further purified by streaking at least twice on mrs agar plates containing 1 % nacl ( 4 ) . only gram - positive , catalase - negative strains were selected ( 13 ) . the selected strains were stored at 80c in mrs broth containing 10 % glycerol ( 145 ) . genomic dna from each lab strain was isolated according to the method described before ( 15 ) . amplification of 16s rdna was carried out using primer pair of 27f ( 5 - agagtttgatcctggctcag - 3 ) and 1492r ( 5 - ggttaccttgttacgactt - 3 ) ( 16 ) . each reaction mixture contained 25 l go taq green master mix ( 2x ) ( promega ) , 4 l each primer ( 10 m ) and 1 l dna template ( 10100 ng ) . the amplification program was set as follows : 94 c ( 90 sec ) , 30 cycles of 95 c ( 30 sec ) , 50 c ( 30 sec ) , 72 c for ( 90 sec ) and a final extension at 72c for 5 min . pcr products were electrophorized on 1 % aga - rose gels at 100 v for 20 min and stained by ethidium bromide and visualized using uv transilluminator . full - length sequencing of 16s rdna was performed with the following universal primers : 27f , 518f , 800r , and 1492r . homology of the sequences was examined by comparing the obtained 16s rdna sequences with those available in the nucleotide databases of the genbank ( http://www.ncbi.nlm.nih.gov/blast ) using the basic local alignment search tool ( blast ) program . sequence from type material was selected in the blast option to find the homolog sequences only from the type strains materials . about new sequences of lab strains from sayur asin were aligned with eight sequences of the lab seqeunces from type strains using multiple sequence comparison by log - expectation ( muscle ) implemented in mega ( molecular evolutionary genetics analysis ) version 5.2 ( 17 ) . phylogenetic analysis was performed using the neighbor - joining method ( 18 ) in mega . the stability of the tree was assessed by bootstrap method ( 20 ) using 100 replications . phylogenetic tree generated from nj analysis of 16s rdna sequences from representative lab isolates from sayur asin collected in tulung agung and kediri ( east java ) . bootstrap values 50 % have been shown below the branch length and the scale bar represents 0.05 sequence divergence . our study demonstrated different profiles of sayur asin produced by two traditional manufacturers , tulung agung and kediri . salinity of fermenting liquor from four samples ranged from 3.60 to 5.67 % ( w / v ) . lab colony counts based on the total plate count ( tpc ) method in four samples of sayur asin was also variable from 2010 to 2610 cfu / ml . the highest lab population was found on the sayur sain sample from tulung agung ( ta2 ) ( 2610 cfu / ml ) while the lowest colony count was found in the sayur asin from kediri ( kdr1 ) . all sayur asin samples from tulung agung ( ta1 and ta2 ) had lower salinity and higher ph than those from kediri ( kdr1 and kdr2 ) . a total of 172 lab strains were succesfully isolated from sayur asin origin east java . based on the 99 % cut off homology similarity , 32 isolates were determined as l. farciminis , four isolates as l. fermentum 15 isolates as l. namurensis , 118 isolates as l. plantarum and a single isolate as l. parafarraginis . strain d5 - s - 2013 showed 98 % similarity to l. paralimentarius while lactobacillus sp . strain b4 - s - 2013 showed 97 % dna sequence similarity to l.composti . according to the results of a published study ( 20 ) , if the rate of similarity between 16s rdna sequences of two organisms is lower than 98.799.0 % they will belong to separate species . due to the observed similarity rates lower than 99 % , the isolates in the present study could be classified into novel species . lactic acid bacteria ( lab ) composition and assemblage in four samples of sayur asin have been presented in tabel 2 . lactobacillus plantarum and l. farciminis were found as common lab used in sayur asin origin from east java . strain d5 - s - 2013 and b4 - s - 21 ) were found in sayur asin from tulung agung and kediri , respectively . culturable l. plantarum was found to predominate sayur asin ta ( 82.292.3 % ) , whereas spread evenly lab species was recognized in sayur asin kdr . l. namurensis were found in both samples ta and kdr but not always appeared at the time of harvesting time of sayur asin . distribution of lab assemblage in four samples of sayur asin from a total 172 isolated lab strains from sayur asin , 27 representative 16s rdna sequences were selected for phylogentic studies . the remaining 145 lab sequences were excluded from the analyses due to their high similarity with 27 representative lab sequences ( data not shown ) . full - length 16s rdna sequence analysis was performed for lactobacillus sp . strains b4 - s - 2013 and d5 - s - 2013 . the generated phylogenetic tree showed that isolated lab strains could be divided into 7 independent clades , viz , l. plantarum ( orla - jensen ) bergeys et al . ( 99 % bs ) , l. parafarraginis endo and okada ( 100 % bs ) , l. namurensis scheirlinck et al . ( 100 % bs ) , l. fermentum beijerinck ( 99 % bs ) , l. farciminis reuter ( 95 % bs ) , l. composti ( 100 % bs ) , and l. paralimentarius ( 90 % bs ) . sequences categorized within l. plantarum , l. parafarraginis , l. namurensis , l. fermentum and l. farciminis clades showed almost identical sequences in each clade which is represented by the length of each branch ( no difference was observed in the branch length within these clades ) . however in the l. composti and l. paralimentariusour study demonstrated different profiles of sayur asin produced by two traditional manufacturers , tulung agung and kediri . salinity of fermenting liquor from four samples ranged from 3.60 to 5.67 % ( w / v ) . lab colony counts based on the total plate count ( tpc ) method in four samples of sayur asin was also variable from 2010 to 2610 cfu / ml . the highest lab population was found on the sayur sain sample from tulung agung ( ta2 ) ( 2610 cfu / ml ) while the lowest colony count was found in the sayur asin from kediri ( kdr1 ) . all sayur asin samples from tulung agung ( ta1 and ta2 ) had lower salinity and higher ph than those from kediri ( kdr1 and kdr2 ) . a total of 172 lab strains were succesfully isolated from sayur asin origin east java . based on the 99 % cut off homology similarity , 32 isolates were determined as l. farciminis , four isolates as l. fermentum 15 isolates as l. namurensis , 118 isolates as l. plantarum and a single isolate as l. parafarraginis . strain d5 - s - 2013 showed 98 % similarity to l. paralimentarius while lactobacillus sp . strain b4 - s - 2013 showed 97 % dna sequence similarity to l.composti . according to the results of a published study ( 20 ) , if the rate of similarity between 16s rdna sequences of two organisms is lower than 98.799.0 % they will belong to separate species . due to the observed similarity rates lower than 99 % , lactic acid bacteria ( lab ) composition and assemblage in four samples of sayur asin have been presented in tabel 2 . lactobacillus plantarum and l. farciminis were found as common lab used in sayur asin origin from east java . strain d5 - s - 2013 and b4 - s - 21 ) were found in sayur asin from tulung agung and kediri , respectively . culturable l. plantarum was found to predominate sayur asin ta ( 82.292.3 % ) , whereas spread evenly lab species was recognized in sayur asin kdr . l. namurensis were found in both samples ta and kdr but not always appeared at the time of harvesting time of sayur asin . from a total 172 isolated lab strains from sayur asin , 27 representative 16s rdna sequences were selected for phylogentic studies . the remaining 145 lab sequences were excluded from the analyses due to their high similarity with 27 representative lab sequences ( data not shown ) . full - length 16s rdna sequence analysis was performed for lactobacillus sp . strains b4 - s - 2013 and d5 - s - 2013 . the generated phylogenetic tree showed that isolated lab strains could be divided into 7 independent clades , viz , l. plantarum ( orla - jensen ) bergeys et al . ( 99 % bs ) , l. parafarraginis endo and okada ( 100 % bs ) , l. namurensis scheirlinck et al . ( 100 % bs ) , l. fermentum beijerinck ( 99 % bs ) , l. farciminis reuter ( 95 % bs ) , l. composti ( 100 % bs ) , and l. paralimentarius ( 90 % bs ) . sequences categorized within l. plantarum , l. parafarraginis , l. namurensis , l. fermentum and l. farciminis clades showed almost identical sequences in each clade which is represented by the length of each branch ( no difference was observed in the branch length within these clades ) . however in the l. composti and l. paralimentarius clades a significant branch length was observed between lactobacillus sp . the microbiology of mustard fermentation is similar to the other fermented vegetables because the microorganisms responsible for this fermentation process are mainly belonging to lab ( 1 , 21 ) . activity of lab during fermentation can cause a decrease in ph value of the fermented vegetables . the final ph resulted from the fermentation process is possibly related to the incubation time . our data showed that average ph of sayur asin from tulung agung and kediri were different . sayur asin samples from kediri possessed in more acidic conditions than those from tulung agung ( table 1 ) . although the incubation time of sayur asin fermentation process in tulung agung and kediri was 3 days but sayur asin in kediri was maintained by backslopping and the acidic conditions from the previous batch probably will affect the ph . any changes in ph of sayur asin by the labs can also be considered as one of the main indicators for a good fermentation . a previous study has reported that the variety of lab population in the fermented mustard was influenced by different fermentation processes and treatments especially the salt concentration ( 4 ) . in this studyit seems that low salt concentration can be supportive for the growth of lab strains in sayur asin than higher salt concentration . during the fermentation process , lab are initially present in low numbers , however , they immediately proliferate because the growth of other microorganisms are inhibited by the initial addition of salt . rapid growth of lab strains decreases the ph of the medium which result to the slow growth of other microorganisms ( 21 ) . the growth of lactic acid bacteria is also influenced by the nutrient movement from plant material into the surrounding liquid ( 3 ) . among lab species found in this study , l. plantarum was found predominant which is probably due to its acid tolerance and in particular because of its ability in transportation and metabolism of different carbohydrates ( 22 ) . phylogenetic analyses of a total 17216s rdna sequences showed that these lab strains belong to a single genus , lactobacillus , and five species ( l. farciminis , l. fermentum , l. namurensis , l. plantarum and l. parafarraginis ) . these five species have been found in different fermented foods ( 23 ) , reported as non pathogenic bacteria for humans or animals ( 24 ) . identification of five lactobacillus species from sayur asin is not unpredictable since members of lactobacillus have commonly been found and used in various fermentation processes in developing various foods and drinks . genus lactobacillus has been known as the largest group of lactic acid bacteria with over than 145 recognized species ( 25 ) . members of this genus are also very heterogenous , encompasing species with a large variety of phenotypic , biochemical and physiological properties . many species have been found in many spontaneous lactic fermentation procedures such as vegetable and silage fermentations ( 26 ) . the phylogenetic affinity of lab from sayur asin showed a close relationship among particular lab species ( fig . this clade formed a monophyletic clade with l. plantarum and l. composti clades ( 74 % bs ) . this data indicates that l. parafarraginis , l. namurensis , l. plantarum and l. composti were originated from recent common ancestor species . lactobacillus parafarraginis and l. composti were firstly described from compost of sochu ( 27 , 28 ) while l. namurensis from sourdoug ( 29 ) and l. plantarum from fermented vegetables ( 30 ) . in addition members of l. farciminis formed a sister clade to l. paralimentarius with 75 % bs while l. fermentum formed independent clade closed to the large clade containing l. parafarraginis , l. namurensis , l. plantarum and l. composti clades . lactobacillus farciminis was originated from sausage while l. paralimentarius was isolated from sourdough ( 31 ) . the phylogenetic analysis of lactobacillus 16s rdna sequences showed that there is no relationship between these species based on the source of isolation . species from the same source such as l. parafarraginis and l. composti from sochu compost and l. namurensis and l. paralimentarius from sourdough nested in distantly related clades ( fig . has revised the previous report ( 1 ) in which l. confusus sharpe et al . , l. curvatus abo - elnaga and kandler , and l. plantarum as members of lab from sayur asin in indonesia . ( 1 ) , have been determined in the current study which included l. farciminis , l. fermentum , l. namurensis and l. parafarraginis . it showed that sayur asin is potential resource for the exploration of unique and distinct species of lab in indonesia . diversity of labs from central java reported by others ( 2 ) is higher than those from east java , eleven species of lab viz , l. farciminis , l. fermentum , l. namurensis , l. plantarum , l. helveticus , l. brevis , l. versmoldensis , l. casei , l. rhamnosus , l. fabifermentans and l. satsumensis . five distinct species of lactobacillus were determined from sayur asin collected from tulung agung and kediri ( east java provinces , indonesia ) based on phylogenetic analysis of 16s rdna sequences . these species include l. farciminis , l. fermentum , l. namurensis , l. plantarum and l. parafarraginis . two lactobacillus isolates ( strains d5 - s - 2013 and b4 - s - 2013 ) showed slightly lower similarity rates of lower than 99 % and had clade with significant branch length in phylogenetic tree which was observed with their closely related species , viz , l. paralimentarius and l. composti , respectively suggesting that they may be classified into novel species .\noutput:\n" }, { "from": "agent", "value": "background and objectives : lactic acid bacteria ( lab ) play important roles in processing of sayur asin ( spontaneously fermented mustard ) . unfortunately , information about lab in indonesian sayur asin , prepared by traditional manufactures which is important as baseline data for maintenance of food quality and safety , is unclear . the aim of this study was to describe the diversity and distribution of culturable lactic acid bacteria in sayur asin of indonesia.materials and methods : four sayur asin samples ( fermentation liquor and fermented mustard ) were collected at harvesting times ( 37 days after fermentation ) from two traditional manufactures in tulung agung ( ta ) and kediri ( kdr ) , east java provinces , indonesia . lab strains were isolated by using mrs agar method supplemented with 1 % caco 3 and characterized morphologically . identification of the strains was performed basedon 16s rdna analysis and the phylogenetic tree was drawn to understand the phylogenetic relationship of the collected strains.results : different profiles were detected in total count of the plates , salinity and ph of fermenting liquor of sayur asin in ta and kdr provinces . a total of 172 lab isolates were successfully isolated and identified based on their 16s rdna sequences . phylogenetic analysis of 27 representative lab strains from sayur asin showed that these strains belonged to 5 distinct species namely lactobacilus farciminis ( n = 32 ) , l. fermentum ( n = 4 ) , l. namurensis ( n = 15 ) , l. plantarum ( n = 118 ) and l. parafarraginis ( n = 1 ) . strains d5 - s - 2013 and b4 - s - 2013 showed a close phylogenetic relationship with l. composti and l. paralimentarius , respectively where as the sequence had slightly lower similarity of lower than 99 % , suggesting that they may be classified into novel species and need further investigation due to exhibition of significant differences in their nucleotide sequences . lactobacillus plantarum was found being dominant in all sayur asin samples.conclusion : lactobacilli were recognized as the major group of lactic acid bacteria in sayur asin including 5 known and 2 novel candidate species . the distribution of lab species was associated with the manufactures where sayur asin is produced ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the age of the subjects was 29.84.0 years ( range 1944 ) and the bmi was 23.00.9 kg / m ( 20.726.0 ) . written informed consent was obtained after the purpose , nature , and potential risks of the study were explained to the subjects . the study was approved by the ethics committee of the medical university of graz . in the morning after an overnight fast , study subjects were admitted to the clinical research center . at 7:30 a.m. , an intravenous catheter was placed into an arm vein for glucose infusion . the forearm with the sampling catheter was then placed in a thermoregulated box ( 55c ) to ensure arterialization of the venous samples . subsequently , a 24 - gauge microperfusion ( mp ) catheter ( 7,8 ) and a microdialysis ( md ) catheter ( cma60 , modified as described below ; cma / microdialysis , solna , sweden ) were inserted into the periumbilical subcutaneous adipose tissue , and peristaltic pumps ( minipuls 3 ; gilson , villiers - le - bel , france ) were attached to the inflow and outflow tubing of each catheter ( fig . both catheters were then sequentially perfused with an insulin - free solution ( 5 % mannitol ; fresenius kabi , graz , austria ) for 2 h , a standard human insulin preparation ( 100 units / ml actrapid ; novo nordisk , bagsvaerd , denmark ) for 6 h , and , again , an insulin - free solution ( 5 % mannitol ) for 2 h. during the 6 - h insulin perfusion period , the insulin delivered to the tissue by the mp catheter was at a rate of 0.33 units / h over the first 2 h , 0.66 units / h over the subsequent 2 h , and 1.00 units / h over the final 2 h. similar insulin delivery rates , but in reverse chronological order , were administered via the md catheters . as the outflow rates of the two catheters were maintained at a constant value ( 0.45 l / min ) throughout the experiment , the insulin delivery rate of each catheter was adjusted by simply adjusting the inflow rate of the catheter ( dual - pump operation mode ) ( 9 ) ( fig . catheter effluents were continuously collected in 30 - min fractions in vials ( microvial ; cma / microdialysis ) kept on ice and covered to avoid fluid evaporation . in parallel , glucose concentrations in blood plasma were measured frequently ( i.e. , every 530 min ) , and , to prevent a fall in the blood glucose concentration during and after the subcutaneous insulin delivery period , glucose ( 0.1 g / ml ; fresenius kabi ) was intravenously infused at a variable rate . schematic of the experimental set - up for the assessment of insulin 's effect on the glucose concentration at the tissue site of insulin delivery . a : a microperfusion ( mp ) and a microdialysis ( md ) catheter were inserted into subcutaneous adipose tissue of healthy subjects ( n = 5 ) . both catheters were perfused sequentially with an insulin - free solution ( mannitol ) for 2 h , a standard human insulin preparation ( 100 units / ml , actrapid ) for 6 h , and , again , an insulin - free solution ( mannitol ) for 2 h. perfusion of each catheter was accomplished by applying two peristaltic pumps , with one pump ( 1 , 1 ) attached to the inflow tubing and another ( 2 , 2 ) to the outflow tubing ( dual - pump operation mode ) . b and c : the perfusate streamed through the inflow tubing and the inner cannula to the tip of the catheter and then entered the space between inner and outer cannula of the catheter ( bold arrows ) . by operating the inflow pump at a higher speed than the outflow pump , a fraction of the perfusate entering the space between inner and outer cannula was forced to flow through the perforations and membrane pores of the mp and md catheter , respectively , to the surrounding tissue ( tissue - directed flows indicated by thin straight arrows ) . the magnitude of this flow fraction and , thus , the amount of perfusate solutes ( e.g. , insulin ) convectively transported to the tissue was controlled by controlling the difference between the inflow and outflow rates of the catheter . in parallel to this convective tissue - directed solute transport , diffusive bidirectional solute transport took place across the perforations and membrane pores of the mp and md catheter , respectively ( wavy arrows ) , thereby causing isf solutes ( e.g. , glucose ) to enter the fluid fraction that flowed in the space between inner and outer cannula of the catheter ( bold striped arrows ) . along with the permeated isf solutes , this fluid fraction was pumped continuously through catheter outlet and outflow tubing to the collecting vial . the efficiency by which glucose was transported via diffusion from the isf of the tissue into the catheter ( glucose recovery ) was measured by applying the ionic reference technique ( 7,8 ) . mp and md catheters applied were of concentric design with a cylindrical inner and outer tube ( fig . the outer tube of the mp catheter ( 7,8 ) consisted of a conventional , intravenous 24 - g cannula ( shaft length : 19 mm , neoflon ; becton dickinson , helsingborg , sweden ) in which 27 perforations ( each 0.3 mm in diameter ) were formed in the cannula wall using an excimer laser ( lzh , hannover , germany ) . two 750 - mm lengths of tygon tubing ( outer diameter : 2.0 mm , inner diameter : 0.19 mm ; cole - parmer , vernon hills , il ) were used to connect catheter inlet and outlet with perfusate reservoir and sampling vial , respectively . in the case of the md catheter ( cma60 ) , part of the outer tube was made from a polyamide membrane with a molecular weight cutoff of 20 kda ( membrane length : 30 mm , pore sizes : 1 m ) . to operate md catheters in the dual pump mode ( fig .1 ) , the original inflow and outflow tubing of the catheters were replaced by two 750 - mm lengths of tygon tubing . in addition , to increase the insulin delivery efficiency of md catheters , a fluid communication between the distal inner tube end and the outer surface of the catheter tip was established by forming a perforation into the catheter tip using a 30 - g syringe needle ( point length : 1.2 mm ; microlance , becton dickinson , drogheda , ireland ) . to monitor the outflow rate of the mp and md catheters and to determine the exact sampled effluent volume , the sample vials were weighed before and after sample collection . the effluent sampling delay time introduced by the dead space volume of the catheter outflow tubingplasma glucose concentrations were measured at the bedside using a beckman glucose analyzer ii ( beckman instruments , fullerton , ca ) with a coefficient of variation ( cv ) of 2 % . the glucose concentrations in catheter effluents were determined using an automated cma600 analyzer ( cma / microdialysis ) with a within - run cv of 2 % . separate in vitro experiments have shown that preservatives contained in the regular human insulin solution used to perfuse the catheters ( actrapid ) do not compromise the accuracy of the cma600 glucose analyzer . the conductivities in the plasma , perfusate , and catheter effluent samples were measured using a contactless conductivity detector ( tracedec ; i.s.t . , the isf glucose concentration was calculated ( 7,8 ) as the glucose concentration in the catheter effluent sample divided by the glucose recovery of the catheter ( r ) . the recovery was determined for each sampling period as r = ( cout cin ) / ( cpl cin ) , where cin , cout , and cpl are the measured electrical conductivity in the perfusate , the effluent sample , and the corresponding plasma sample , respectively . application of this technique ( ionic reference technique ) ( 7,8 ) was possible because the electrical conductivity in the used catheter perfusates was either negligible ( mannitol ) or low compared with that in blood plasma ( actrapid : 1.7 % of average cpl ) . to facilitate comparison of glucose time courses observed in the tissue isf with those determined in the blood plasma , we calibrated the mp - derived and md - derived isf glucose values against the mean plasma glucose concentration observed during the 2 - h baseline period ( basal calibration ) . these glucose values ( termed tissue glucose concentrations ) and the corresponding plasma glucose levels were then used to calculate the time courses of the tissue - to - plasma glucose ratio ( tpr ) . the differences of mean glucose and tpr results were examined by one - factor repeated - measures anova . if significance was achieved , post hoc comparison of means with dunnett 's test was performed . a p value 0.05 was considered to indicate statistical significance . data analysis was performed using matlab ( mathworks , natick , ma ) and spss ( spss , chicago , il ) software packages . mp and md catheters applied were of concentric design with a cylindrical inner and outer tube ( fig . the outer tube of the mp catheter ( 7,8 ) consisted of a conventional , intravenous 24 - g cannula ( shaft length : 19 mm , neoflon ; becton dickinson , helsingborg , sweden ) in which 27 perforations ( each 0.3 mm in diameter ) were formed in the cannula wall using an excimer laser ( lzh , hannover , germany ) . two 750 - mm lengths of tygon tubing ( outer diameter : 2.0 mm , inner diameter : 0.19 mm ; cole - parmer , vernon hills , il ) were used to connect catheter inlet and outlet with perfusate reservoir and sampling vial , respectively . in the case of the md catheter ( cma60 ) , part of the outer tube was made from a polyamide membrane with a molecular weight cutoff of 20 kda ( membrane length : 30 mm , pore sizes : 1 m ) . to operate md catheters in the dual pump mode ( fig .1 ) , the original inflow and outflow tubing of the catheters were replaced by two 750 - mm lengths of tygon tubing . in addition , to increase the insulin delivery efficiency of md catheters , a fluid communication between the distal inner tube end and the outer surface of the catheter tip was established by forming a perforation into the catheter tip using a 30 - g syringe needle ( point length : 1.2 mm ; microlance , becton dickinson , drogheda , ireland ) . to monitor the outflow rate of the mp and md catheters and to determine the exact sampled effluent volume , the sample vials were weighed before and after sample collection . the effluent sampling delay time introduced by the dead space volume of the catheter outflow tubingplasma glucose concentrations were measured at the bedside using a beckman glucose analyzer ii ( beckman instruments , fullerton , ca ) with a coefficient of variation ( cv ) of 2 % . the glucose concentrations in catheter effluents were determined using an automated cma600 analyzer ( cma / microdialysis ) with a within - run cv of 2 % . separate in vitro experiments have shown that preservatives contained in the regular human insulin solution used to perfuse the catheters ( actrapid ) do not compromise the accuracy of the cma600 glucose analyzer . the conductivities in the plasma , perfusate , and catheter effluent samples were measured using a contactless conductivity detector ( tracedec ; i.s.t . , the isf glucose concentration was calculated ( 7,8 ) as the glucose concentration in the catheter effluent sample divided by the glucose recovery of the catheter ( r ) . the recovery was determined for each sampling period as r = ( cout cin ) / ( cpl cin ) , where cin , cout , and cpl are the measured electrical conductivity in the perfusate , the effluent sample , and the corresponding plasma sample , respectively . application of this technique ( ionic reference technique ) ( 7,8 ) was possible because the electrical conductivity in the used catheter perfusates was either negligible ( mannitol ) or low compared with that in blood plasma ( actrapid : 1.7 % of average cpl ) . to facilitate comparison of glucose time courses observed in the tissue isf with those determined in the blood plasma , we calibrated the mp - derived and md - derived isf glucose values against the mean plasma glucose concentration observed during the 2 - h baseline period ( basal calibration ) . these glucose values ( termed tissue glucose concentrations ) and the corresponding plasma glucose levels were then used to calculate the time courses of the tissue - to - plasma glucose ratio ( tpr ) . the differences of mean glucose and tpr results were examined by one - factor repeated - measures anova . if significance was achieved , post hoc comparison of means with dunnett 's test was performed . a p value 0.05 was considered to indicate statistical significance . data analysis was performed using matlab ( mathworks , natick , ma ) and spss ( spss , chicago , il ) software packages . figure 2a shows the time courses of the glucose concentration in arterialized blood plasma and in the tissue surrounding the mp and md catheters . commencement of insulin delivery with the md and mp catheters induced a fall in the tissue glucose concentration for 60 min ( p 0.05 ) . however , during the rest of the 6 - h period of variable insulin delivery , the tissue glucose concentration paralleled the glucose concentration observed in plasma , thereby indicating that insulin 's effect on the tissue glucose concentration saturated within 60 min after the start of insulin administration . after switching back from insulin to mannitol perfusates , tissue glucose concentration increased slowly and reattained plasma glucose levels at the end of the experiments ( fig . glucose dynamics at the subcutaneous tissue site of insulin delivery . a : average time course ( n = 5 , means se ) of plasma glucose concentration ( ) as well as tissue glucose concentration determined with md ( ) and mp ( ) catheters . * p 0.05 tissue glucose vs. corresponding plasma glucose values , one - factor repeated - measures anova , and dunnett 's post hoc test . b and c : average time course ( n = 5 , means se ) of the tpr obtained with md ( ) and mp ( ) catheters . * p 0.05 ; * * p 0.01 vs. the first basal tpr value , one - factor repeated - measures anova ( huynh - feldt corrected ) , and dunnett 's post hoc test . panels also show the average time course ( n = 5 , means se ) of the insulin delivery rates ( bars ) of the md ( b ) and mp ( c ) catheters . figures 2b and c depict the tpr for the md and mp catheters as a function of time . as can be seen , during the first 60 min of insulin delivery , the tpr declined to a level of 83.83.6 and 78.55.0 % for md and mp catheters , respectively , and then remained at these levels until the end of the 6 - h period of variable insulin delivery . during the final 5 h of the insulin delivery period , the tpr levels for md and mp catheters averaged 83.2 taken together , the temporal pattern of change in tissue and plasma glucose and tpr values suggests that within 60 min after exposing adipose tissue to a standard 100 units / ml insulin preparation , insulin 's effect on the tissue glucose concentration saturates and a stable ratio between the tissue and plasma glucose concentration is attained . at the used outflow rate of 0.47 l / min , the transport efficiency ( recovery ) of glucose for the mp catheter was found to be 25.15.4 % during the first 2 h of insulin delivery and remained unchanged during the subsequent 2 h and final 2 h of insulin delivery ( 24.64.4 and 24.84.9 % , respectively ; p = 0.93 , one - factor repeated - measures anova ) . similarly , recovery for the md catheter was 96.81.2 % during the first 2 h of insulin delivery and remained at this level during the subsequent 2 h ( 98.01.3 % ) and final 2 h ( 98.11.3 % ) of insulin delivery ( p = 0.20 , one - factor repeated - measures anova ) . the lower glucose recovery for mp catheters compared with md catheters may be mainly attributable to the different size of the exchange area of the applied catheters ( mp perforations distributed over an 11 - mm shaft length versus md membrane length of 30 mm ) . figure 2b and c show the average time course of the total insulin delivery rate ( i.e. , the sum of the convective and diffusive portions of the insulin delivery rates ) for the md and mp catheters ( see also online appendix supplementary methods ) . the time course of the intravenous glucose infusion rate is shown in online appendix fig .2 . as can be seen , the glucose infusion rate needed to maintain euglycemia gradually increased during the second half of the 6 - h insulin delivery period and reached a peak value of 1.750.31 mg kg min 1 h after termination of insulin delivery . figure 2a shows the time courses of the glucose concentration in arterialized blood plasma and in the tissue surrounding the mp and md catheters . commencement of insulin delivery with the md and mp catheters induced a fall in the tissue glucose concentration for 60 min ( p 0.05 ) . however , during the rest of the 6 - h period of variable insulin delivery , the tissue glucose concentration paralleled the glucose concentration observed in plasma , thereby indicating that insulin 's effect on the tissue glucose concentration saturated within 60 min after the start of insulin administration . after switching back from insulin to mannitol perfusates , tissue glucose concentration increased slowly and reattained plasma glucose levels at the end of the experiments ( fig . glucose dynamics at the subcutaneous tissue site of insulin delivery . a : average time course ( n = 5 , means se ) of plasma glucose concentration ( ) as well as tissue glucose concentration determined with md ( ) and mp ( ) catheters . * p 0.05 tissue glucose vs. corresponding plasma glucose values , one - factor repeated - measures anova , and dunnett 's post hoc test . b and c : average time course ( n = 5 , means se ) of the tpr obtained with md ( ) and mp ( ) catheters . * p 0.05 ; * * p 0.01 vs. the first basal tpr value , one - factor repeated - measures anova ( huynh - feldt corrected ) , and dunnett 's post hoc test . panels also show the average time course ( n = 5 , means se ) of the insulin delivery rates ( bars ) of the md ( b ) and mp ( c ) catheters . figures 2b and c depict the tpr for the md and mp catheters as a function of time . as can be seen , during the first 60 min of insulin delivery , the tpr declined to a level of 83.83.6 and 78.55.0 % for md and mp catheters , respectively , and then remained at these levels until the end of the 6 - h period of variable insulin delivery . during the final 5 h of the insulin delivery period , the tpr levels for md and mp catheters averaged 83.2 taken together , the temporal pattern of change in tissue and plasma glucose and tpr values suggests that within 60 min after exposing adipose tissue to a standard 100 units / ml insulin preparation , insulin 's effect on the tissue glucose concentration saturates and a stable ratio between the tissue and plasma glucose concentration is attained . at the used outflow rate of 0.47 l / min , the transport efficiency ( recovery ) of glucose for the mp catheter was found to be 25.15.4 % during the first 2 h of insulin delivery and remained unchanged during the subsequent 2 h and final 2 h of insulin delivery ( 24.64.4 and 24.84.9 % , respectively ; p = 0.93 , one - factor repeated - measures anova ) . similarly , recovery for the md catheter was 96.81.2 % during the first 2 h of insulin delivery and remained at this level during the subsequent 2 h ( 98.01.3 % ) and final 2 h ( 98.11.3 % ) of insulin delivery ( p = 0.20 , one - factor repeated - measures anova ) . the lower glucose recovery for mp catheters compared with md catheters may be mainly attributable to the different size of the exchange area of the applied catheters ( mp perforations distributed over an 11 - mm shaft length versus md membrane length of 30 mm ) . figure 2b and c show the average time course of the total insulin delivery rate ( i.e. , the sum of the convective and diffusive portions of the insulin delivery rates ) for the md and mp catheters ( see also online appendix supplementary methods ) . the time course of the intravenous glucose infusion rate is shown in online appendix fig .2 . as can be seen , the glucose infusion rate needed to maintain euglycemia gradually increased during the second half of the 6 - h insulin delivery period and reached a peak value of 1.750.31 mg kg min 1 h after termination of insulin delivery . the present investigation was undertaken to assess insulin 's effect on the tissue glucose concentration at the site of subcutaneous insulin administration . for this reason , we subcutaneously administered insulin at variable rates and simultaneously sampled isf glucose directly from the administration site . to carry out isf glucose sampling and simultaneous insulin administration at the same adipose tissue site , we utilized mp and md catheters together with standard insulin preparations as catheter perfusates and used two peristaltic pumps to operate each catheter ( fig . this technique of catheter operation allowed the withdrawal of isf at a constant rate as well as the simultaneous adjustment of the insulin delivery rate during the experiments . when insulin delivery to the adipose tissue of the healthy humans was started at basal rates similar to those used in the replacement therapy of diabetic patients , there was an initial delay of 60 min before the effect of insulin on the tissue - to - blood glucose concentration gradient at this delivery site reached its maximum ( fig .2 ) . this observed delay in insulin action ( activation time ) may be a reflection of the time required for the convectional and diffusional transport of insulin from the catheter to the surface of the insulin - sensitive fat cells surrounding the catheter as well as for the subsequent recruitment and activation of glucose transport proteins stimulating cell glucose uptake ( 10 ) . after this activation time , despite changes in the insulin delivery rates , the tissue to blood glucose concentration gradient remained stable , thereby supporting our hypothesis that insulin 's effect on the tissue glucose concentration at the insulin delivery site is saturated and attains steady - state values . this steady - state condition in insulin action at the insulin delivery site in turn allowed us to reliably estimate blood glucose concentrations from glucose concentrations measured in the isf of this tissue site ( 11 ) . after switching back from insulin to mannitol perfusates , the tissue glucose concentration and the tissue to blood glucose concentration gradient increased slowly and reattained preinsulin delivery levels by the end of the 2 - h mannitol perfusion period ( fig .2 ) , thereby indicating that insulin 's effect on the tissue glucose concentration vanished within 2 h after termination of the insulin delivery . overall , the observed activation and deactivation kinetics of insulin action on the tissue to blood glucose concentration gradient in adipose tissue are compatible with previous findings in humans showing similar activation and deactivation kinetics of insulin 's action on the forearm ( 12 ) , leg ( 4 ) , and peripheral ( 13 ) glucose uptake . ( 14 ) , who reported no influence of insulin on the glucose concentration in the adipose tissue located near the insulin infusion site . the disparity between our results and those of hermanides et al . may be attributable to the different experimental procedure used to assess the effect of insulin on the tissue glucose at the insulin administration site . whereas the mp and md catheters used in the present study functioned simultaneously as insulin delivery and isf sampling instruments ( single - port approaches ) , ( 14 ) used a dual - port approach consisting of a subcutaneously inserted insulin infusion catheter and an md catheter , which had a membrane length of 25 mm ( 14,15 ) and which was inserted in subcutaneous tissue at a closest mean distance of 92 mm from the infusion catheter . thus , in contrast to our study in which isf glucose was withdrawn from the insulin - exposed tissue layer surrounding the md and mp catheter , hermanides et al . ( 14 ) performed isf glucose sampling from tissue regions that were at considerable distances from the insulin administration site . a previous study by linde and philip ( 16 ) , using radiography of the radioactivity distribution of subcutaneously injected i - insulin , indicated that when a bolus amount of 0.25 ml of a 40 unit / ml insulin solution ( 10 units ) is administered subcutaneously , the maximal volume of distribution of the administered insulin may have an average cross - sectional area of 170 mm or an average radius of 7 mm ( when a near - spherical shape is assumed ) ( 17 ) . furthermore , our recent study in diabetic subjects ( 11 ) , using mp catheters for insulin delivery and simultaneous glucose sampling , showed that a subcutaneous administration of a bolus amount of 0.08 ml of a 100 unit / ml insulin solution ( 8 units ) is causing a dilution of the isf at the insulin delivery site , thereby decreasing the glucose concentration around the insulin delivery catheter during and shortly after the bolus delivery period . in comparison , in the study of hermanides et al . ( 14 ) , a bolus amount of 0.11 ml of a 100 unit / ml insulin solution ( 11 units ) was administered . apparently , no decrease in the effluent glucose during the bolus administrations and , thus , no dilution effect of the insulin solvent were observed . therefore , a possible reason for not observing a significant effect of insulin and / or insulin solvent on the local tissue glucose concentration in their study may be that , due to the considerable length of the microdialysis membrane used ( 25 mm ) , the whole or most parts of the glucose - exchanging membrane , especially the membrane part near the catheter outlet , may not have been positioned in the insulin - exposed tissue layer surrounding the insulin infusion catheter . there have been other studies evaluating the effect of insulin on the glucose concentration in human adipose tissue by using either continuous glucose sensors ( 18,19 ) or microdialysis - based glucose sensing ( 1921 ) . ( 14 ) assessed the effect of supraphysiological insulin levels ( i.e. , 100 units / ml ) on the adipose tissue glucose concentration , these studies evaluated the effect of physiological insulin levels ( 150 u / ml ) on this glucose concentration . ( 14 ) and our study , where insulin was locally introduced into the isf of subcutaneous adipose tissue , these studies invariably increased the insulin levels in the central circulation by intravenous insulin infusions ( 1821 ) and / or by enhancing endogenous insulin secretion using intravenous glucose infusions ( 18,19 ) . the results of these studies indicated that physiological changes in the insulin levels affect ( 19,21 ) or do not affect ( 18,20 ) the isf - to - plasma gradient in human adipose tissue . the divergent findings may be partially attributable to technical and procedural differences in the performance of the studies ( 18 ) . besides the effect of insulin on the fat cell glucose uptake , an additional mechanism potentially influencing the glucose concentration at the site of insulin delivery may be the local dilution of the isf by the insulin solvent . we reasoned that if an increase in the perfusate flow fraction directed to the tissue ( fig .1 , thin straight arrows ) is causing a dilution of the isf surrounding the catheter , then there will be a decrease in the efficiency of exchange of solutes between the isf and the perfusates of the two catheters . we found that changes in the tissue - directed flow rates did not cause changes in the exchange efficiency ( recovery ) of the two catheters , thereby suggesting that insulin solvent delivery at basal rates is not diluting the isf in the tissue surrounding the catheters . this observation is in agreement with the results of our recent study in diabetic subjects ( 11 ) , in which after changes in the basal delivery rates , no changes in the catheter recovery were observed . the relatively high blood flow per unit adipose tissue weight ( 2030 l min g ) ( 22 ) compared with the amount of insulin solution infused during basal delivery ( 0.10.2 l / min ) may be the likely reason for not observing a local dilution of the isf when basal insulin is delivered . our present and recent study ( 11 ) may also provide the basis for the pursuit of a principal concept to the design of a single - port treatment system . this concept involves the integration of a continuous glucose sensor directly onto the shaft wall of an insulin infusion catheter . when connected to an insulin pump , the system may then permit simultaneous insulin infusion and glucose sensing . available information on solute transport in isf surrounding infusion catheters ( which is governed by a combination of convection , diffusion , and tissue clearance ) ( 17,23,24 ) may be used to guide the exact placement of the glucose sensor onto the shaft of an insulin infusion catheter . for example , when a typical bolus amount of 0.10.2 ml ( 1020 units ) of a standard insulin solution is administered through a conventional infusion catheter ( diameter : 0.5 mm ; shaft length : 10 mm ) , there may be a significant backflow of infusate from the catheter tip along the catheter shaft ( 24 ) toward the skin , so that the initial area of distribution of infused insulin ( initial depot volume ) ( 17,23 ) may correspond to a cylindrical tissue layer surrounding the catheter shaft ( 24 ) and having a width of a few millimeters ( 17 ) . shortly after bolus administration , the relative rates of diffusion and clearance may then produce first an expansion of the insulin - exposed tissue layer about the catheter shaft to a width of several millimeters ( e.g. , 7 mm ) ( 16 ) and , as soon as clearance prevails , a decrease of the size of this layer , so that 610 h after bolus administration , all the insulin is cleared from the tissue site of insulin administration ( 17,21 ) . furthermore , in the case of insulin delivery at basal rates ( 0.01 ml / h = 1 unit / h , usually administered as microboluses with 0.0250.1 units per pump stroke ) ( 25 ) , backflow distances may be shorter and hence the volume of insulin - exposed tissue about the catheter shaft may be smaller than after bolus administrations ( 24 ) . therefore , when a basal - bolus insulin regimen is applied , the best placement location of a continuous glucose sensor on the catheter shaft may be close to the catheter tip because at this site the tissue surrounding the sensor may be permanently exposed to insulin . in the case of suspension of the insulin pump treatment , a recalibration of the glucose sensor may be required when the length of pump suspension exceeds the deactivation time of insulin action . the deactivation time , however , may largely depend on the actual insulin depot size at the delivery site , which can be very high after bolus administrations or lower after prolonged basal insulin delivery ( two to five times the hourly infusion rates ) ( 25 ) . in summary , our results show that within 60 min after exposing adipose tissue to a standard 100 units / ml insulin preparation , insulin 's effect on the tissue glucose concentration saturates and a stable ratio between the tissue and plasma glucose concentration is attained , thus indicating that insulin delivery and glucose sensing may be performed simultaneously at the same adipose tissue site via a single tissue catheter . this single - port treatment approach may hold great promise to simplify and improve glucose management in diabetes .\noutput:\n" }, { "from": "agent", "value": "objectiveto examine insulin 's effect on the tissue glucose concentration at the site of subcutaneous insulin administration.research design and methodsa cma - 60 microdialysis ( md ) catheter and a 24 - gauge microperfusion ( mp ) catheter were inserted into the subcutaneous adipose tissue of fasting , healthy subjects ( n = 5 ) . both catheters were perfused with regular human insulin ( 100 units / ml ) over a 6 - h period and used for glucose sampling and simultaneous administration of insulin at sequential rates of 0.33 , 0.66 , and 1.00 units / h ( each rate was used for 2 h ) . before and after the insulin delivery period , both catheters were perfused with an insulin - free solution ( 5 % mannitol ) for 2 h and used for glucose sampling only . blood plasma glucose was clamped at euglycemic levels during insulin delivery.resultsstart of insulin delivery with md and mp catheters resulted in a decline of the tissue glucose concentration and the tissue - to - plasma glucose ratio ( tpr ) for 60 min ( p < 0.05 ) . however , during the rest of the 6 - h period of variable insulin delivery , tissue glucose concentration paralleled the plasma glucose concentration , and the tpr for md and mp catheters remained unchanged at 83.2 3.1 and 77.1 4.8 % , respectively . after subsequent switch to insulin - free perfusate , tissue glucose concentration and tpr increased slowly and reattained preinsulin delivery levels by the end of the experiments.conclusionsthe results show the attainment of a stable tpr value at the site of insulin administration , thus indicating that insulin delivery and glucose sensing may be performed simultaneously at the same adipose tissue site ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: there are classic symptoms such as shortness of breath , coughing , and wheezing23 , and daily the use of medication should be recommended for all children with moderate to severe asthma , according to guidelines4 . in general , the medical treatment is administrations of corticosteroids , which may incur the risk of developing steroid - induced myopathy when used for long periods and in high quantities . this myopathy occurs in the peripheral muscles , but its impact on respiratory muscle it is not clear yet567 . there are also changes in the respiratory system of asthmatics due to the mechanical disadvantage caused by increased airway resistance8 . one of them is the hyperinflation , which flattens the diaphragm , thereby shortening the inspiratory muscle8 .9 . several studies suggest that hyperinflation negatively affects the efficiency of respiratory muscles in asthmatic adults8910 . this study is important because its objective is to evaluate the respiratory muscle strength in asthmatic children , whereas most studies on pathophysiology and treatment of the disease evolution have until now been performed only in adults11 . this is a descriptive cross - sectional and individualized study that was developed in the pediatric allergology ambulatory and / or general pediatric clinic of the hospital das clnicas , linked to the universidade federal of pernambuco ( ufpe ) , between august 2008 and july 2009 . the study population included 2 groups : a group of asthmatic children , including 25 children with diagnosis of asthma per the handbook of pediatric ambulatory allergology , who had asthma as the main complaint , and the other group of 25 non - asthmatic children . this age group was selected because this is considered a transition period in the development of the respiratory system and marks the end of pubertal growth and structural changes in the peripheral lung12 . children who had neurological neurologic impairment , crisis of asthma at the time of evaluation , serious cardiopathies , orthodontic devices , craniofacial abnormalities , and hypertrophy of tonsil and / or adenoids and those whose guardians did not consent were excluded from this study . in both groups , respiratory muscle strength was evaluated by measuring the maximal inspiratory pressure ( mip ) and maximal expiratory pressure ( mep ) produced in the mouth during the maximum effort against occluded airway during inspiration and exhalation , respectively , using a portable manuvacuometer ( medical commercial , brazil ) . the children were asked to make a maximal inspiration from the residual volume for the measurement of mip with the occluded valve . to determine mep , a maximal exhalation from total lung capacity was performedto register the peak pressure against the valve13 . each child performed the procedure , at the most , 5 times , resulting in at least 3 acceptable maneuvers ( with no leaks during at least 2 seconds of each maneuver ) . then , the highest pressure values in cmh2o were compared between the groups . to assess this measure , the children were seated with their nose occluded with a nose clip for inspiration , and exhalation was performed only at the mouth , with the mouthpiece connected to the manuvacuometer . to evaluate the nutritional status of children in this sample , the distribution of percentiles of body mass index ( bmi ) was analyzed according to age and sex , obtained using the equation bmi = weight ( kg ) / height ( m ) . weight was recorded using a properly calibrated balance filizzola with sensitivity of 1 kg with each child wearing as little clothing as possible , requiring the registration of the weight in kilograms and grams . height was measured with the child in a standing position , barefoot , with feet parallel and together ; a tape - measure and a square , which was firmly supported on the head were used for measuring the height . the measured variables are presented in tables and include descriptive measures such as minimum , maximum , average , and standard deviation . smirnov test was applied test the assumption of normality of the variables involved in the study . for the analysis of quantitative variables between asthmatic and non - asthmatic groups , the student 's t test was used , and to analyze the qualitative variables , a chi - square test was used . the children 's ' guardians received clarification about the objectives of this research and were informed that this study was approved by the research ethics committee of the universidade federal de pernambuco ; they were requested to sign an assent free and clarified term allowing the child 's participation in the study . this work was approved by the ethics committee in research of universidade federal de pernambuco ( 224/2006 ) . the sample in this study consisted of 50 children distributed into 2 groups , the asthmatic and non - asthmatic groups . table 1 shows the distribution of children evaluated by gender in the asthmatic and non - asthmatic groups . in the asthmatic group ,52 % children were male and 48 % were female , and in the non - asthmatic group , 32 % were male and 68 % were female . although there were more male children in the asthmatic group , this difference was not significant , so the groups were distributed evenly by gender . n - number of children in the group % - percentage corresponding to the number of children in the group statistical test , chi - square table 2 shows the distribution of the data for age , weight , height , and bmi in the asthmatic and non - asthmatic groups . the average of age of children in the asthmatic group was 8.521.49 years and in the non - asthmatic group it was 9.79 years 1.51 years ( p = 0.004 ) . the asthmatic group had a mean weight of 30.627.66 kg and the non - asthmatic group had mean weight of 39.9216.57 kg ( p = 0.016 ) . average height was 129.8510.24 cm in the asthmatic children and 139.0411.62 cm in the non - asthmatic children ( p = 0.005 ) . the average bmi was 17.942.94 kg / m in the asthmatic group and 20.086.26 kg / m in the non - asthmatic group ( p = 0.133 ) . thus , the non - asthmatic children had greater age , weight , and height , but no significant differences were found in bmi . n , number of children in the group statistical test , student 's t table 3 shows the distribution of children evaluated for mean inspiratory and peak expiratory pressures in the asthmatic and non - asthmatic groups . the average mip in the asthmatic group was 84.9627.57 cmh2o and in the non - asthmatic group was 88.5626.50 cmh2o ( p = 0.640 ) . the average mep was 64.4819.23 cmh2o in the asthmatic group and 66.7216.56 cmh2o in the non - asthmatic group ( p = 0.661 ) . it was observed that although the non - asthmatic group showed greater maximal inspiratory and expiratory pressures , there was no statistically significant difference between the groups for mip and mep . mip , maximum inspiratory pressure mep , maximum expiratory pressure statistical test , student 's tcohen et al. 14 in 1940 , observed that the association between asthma and growth inhibition manifested initially as weight loss and if the symptoms persisted , as compromised height and bone maturity . this growth retardation may be associated with early onset asthma , time and severity of the disease , thoracic deformities , hypoxemia , chronic anorexia , corticosteroid use , and socioeconomic status . however , more recent studies concerned with the increase in obesity in the general population have established a relation with asthma ; thus , obesity also increases the probability of developing asthma . in this study , statistically significant values for lower height and weightwerefoundin the asthmatic group compared to the non - asthmatic group , corroborating the work of cohen et al . all children in the asthmatic group had been taking corticosteroids for a long period of time , but the treatment of asthma as well as the socioeconomic level was low in both groups , which could be correlated with the region where the study was conducted . thus , the prolonged use of steroids or low socioeconomic status may have led to growth retardation , without association with obesity . we also observed a slight decrease in respiratory muscle strength in asthmatic children compared to non - asthmatic children , but this difference was not statistically significant . it has been proposed by several authors that asthma leads to decreased overall muscle strength especially of the respiratory muscles6 because of hyperinflation by air trapping that occurs as a consequence to bronchoconstriction151617 and continuous use and high doses of corticosteroids567 for the treatment and control of asthma . according to weiner et al . , hyperinflation leads to respiratory muscle weakness because it interferes at the insertion of the muscles responsible for the biomechanics of breathing , leading to flattening of the diaphragm and mechanical disadvantage . corticosteroids in high doses lead to steroid - induced myopathy5 . however , some studies have been establish a relation between long - term corticosteroid treatment even at low doses and decreased muscle strength6711 . in this study , we could not determine the degree of hyperinflation because the children in prepubertal age are still developing their respiratory framework . they do not show structural changes expected with permanent changes imposed by time , such as imprisonment entrapment of air and increased airway resistance . all had used corticosteroids for long time . in a literature research for related articles , we found no studies evaluating the impact of asthma and the biomechanical changes in children leading to a decrease in respiratory muscle strength . only 2articles that evaluate muscle strength in asthmatic children were found . nickerson et al . evaluated the effects of inspiratory muscle training in asthmatic children and compared the mip values with the values predicted , concluding that children with asthma had reduced respiratory muscle strength and with training , these values were increased . lands l et al . examined the mip and nutritional status in children with asthma , cystic fibrosis , and changes in nutritional status andconcluded that only the group with cystic fibrosis had decreased mip , and that this reduction was related to hyperinflation . it is possible that changes in respiratory function , such as hyperinflation will progress more quickly in this group of patients . furthermore , since this research sample also dealt with children , who , as noted , are still in the process of developing their respiratory framework , not verifying a mechanical disadvantage that would lead to decreased muscle strength . in contrast , studies in adults have shown that the changes in the biomechanics of the thorax are permanent , and the time of exposure to the effects of prolonged use of corticosteroids is higher . thus , the respiratory muscle weakness becomes more evident56151617 . dividing the asthmatic group according to asthma severity would relate the decrease in respiratory muscle strength with asthma in patients with severe asthma . in moderate asthma , where the disease could lead to faster development of mechanical disadvantage , lower mip and mepwere observed compared to the non - asthmatic group and a sub - group with mild asthmawould be expected . overall , there is a scarcity of articles in the literature relating to respiratory muscle strength in asthmatic children . many studies were performed on adults but there are few studies describing and standardizing respiratory muscle strength in children . this research proposes further studies monitoring the dosage and duration of corticosteroid use for comparing asthmatic children who are non - users or short - term users of corticosteroids with long - term users . according to the severity of asthma , it is important to have studies relating corticosteroid use with respiratory muscle strength . studies concerning nutritional status may be more reliable with skinfold measurements , z - score , and questionnaires about the child 's feeding and may help determine the associations between respiratory muscle strength , nutritional status , and use of corticosteroids . we suggest that similar samples be allocated in others institutions , making this a multicenter study with no influence of the socioeconomic realities of a particular region , thereby providing a greater chance of increasing the validity of the sample . moreover , the children in the non - asthmatic groups could be found in schools , daycare centers and other local area without links with hospitals and , thus , unrelated to disease .\noutput:\n" }, { "from": "agent", "value": "summary introduction : changes in the respiratory system of asthmatics are also due to the mechanical disadvantage caused by the increased airway resistance . objective : the study aims to evaluate the respiratory muscle strength and nutritional status of asthmatic children . method : this is a prospective descriptive and transversal study with 50 children aged 7 to 12 years , who were placed into 2 groups , asthmatic and non - asthmatic . respiratory muscle strength was evaluated on the basis of maximal inspiratory pressure ( mip ) and maximal expiratory pressure ( mep ) . the nutritional status was evaluated by measuring the anthropometric data , including height , weight , and body mass index ( bmi ) . the findings were subjected to analysis of variance , chi - square , and student 's t test , and p - values < 0.05 was considered statistically significant . results : in our comparisons , we observed statistically significantly lower values for age , weight , and height in asthmatic patients : 8.52 1.49 years , 30.62 7.66 kg , and 129.85 10.24 cm , respectively , vs. non - asthmatic children ( 9.79 1.51 years , 39.92 16.57 kg , and 139.04 11.62 cm , respectively ) . there was no significant increase in mip and mep between the groups : mip was -84.96 27.52 cmh2o for the asthmatic group and -88.56 26.50 cmh2o for the non - asthmatic group , and mep was 64.48 19.23 cmh2o for asthmatic children and + 66.72 16.56 cmh2o for non - asthmatics . conclusion : there was no statistically significant difference between groups , but we observed that mip and mep were slightly higher in the non - asthmatic group than in the asthmatic group ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: medical - grade skin adhesives , eyeglasses , and tissue undercuts have been traditionally used in the rehabilitation of patients with extra - oral defects . however , with the development and advancement of craniofacial implants and greater predictable aesthetics , improved prosthesis retention and stability is now a reality .1,2 a retentive matrix to hold clips and magnets is mandatory when using implant retained extra - oral prosthesis . this retentive matrix is made using acrylic resin to which the elastomer of extra - oral prosthesis is processed . this demands acrylic resin matrix to be securely bonded to flexible soft material of prosthesis . that means that denture resins may be used as a rigid base into which retention components are embedded , while the facial surface supports the silicone component of facial prosthesis . the rigid base or framework is usually fabricated with auto - polymerizing , heat - polymerizing , or visible light - curing denture resin . so it is apparent that for a serviceable and functional prosthesis , adequate bond strength is vital .1,3 the bond of silicone elastomer to the acrylic resin component must be sufficiently tenacious to withstand the substantial forces acting upon the bond interface , not only during placement and removal of the prosthesis , but also during mould opening and deflasking procedures as this is the weakest link in the restoration .2 maxillofacial silicone elastomers are dimethyl siloxane polymers and have different chemical structure from that of pmma denture base resin . it is likely that adhesive primers have an organic solvent and an adhesive agent that reacts with both silicone and resin materials .4 they activate the surfaces via etching or promoting hydrogen bonding and covalent coupling , increasing the wettability of the substrate and by impregnating the surface layer with the polymeric ingredients .5 singer et al. 6 found that bond strength was enhanced using a combination of mdx 4 - 4210 silicone and either s - 2260 or a-4040 primers . primer 1205 showed better bond strength than 1205 irrespective of the polymerization method or primer reaction time .7 polyzois8 reported that the curing method ( microwave irradiation and dry heat ) did not significantly affect the bond strength of silicone elastomers to acrylic denture resin unlike , the type of silicone elastomers . frangou et al. 9 stated that the compatibility and affinity of primer composition with the selected silicone elastomer is important for efficient bonding . polyzois and frangou2 found that higher bond strength was achieved when the resin base was finished with 80 - grit sic paper than when it was finished with 240 , 260 , 600 or 1000 - grit sic paper . in another study , frangou et al. 9 also claimed that when the bonding surface of the resin specimens were finished with a polishing machine using 80 - grit sic paper under a constant flow of water , the bond strength increased . on the contrary , amin et al. 10 reported that sandblasting the acrylic resin base weakened the bond between the resin and the silicone . similar results were reported by miami et al. 4 who proved that roughening of the denture surface with air - particle abrasion was not effective for enhancing failure load and maintaining longevity of the silicone and acrylic resin . further studies should be carried out to find the proper preparation of resin surfaces to increase the bond strength between silicone elastomer and resin bases . there is a lack of evidence that compares the effect of primers on silicone - acrylic bond strength using various surface characteristics . the aim of this study was to evaluate the effect of 3 different commercially available bonding agents and surface alterations on the bond strength of silicone to acrylic resin with the null hypothesis that no difference would exist in the bond strength between them . the bond strength between heat polymerizing acrylic resin ( trevalon h ; dentsply , mumbai , india ) and silicone elastomer ( cosmesil m511 ; principality , uk ) was evaluated using 3 different commercially available bonding agents . g611 platinum primer ( principality medical ; newport , uk ) , a-330 gold platinum primer ( factor 2 ; phoenix , az , usa ) , and cyanoacrylates resin ( fevi kwik ; pidilite industries , mumbai , india . ) were used as bonding agents . the bond strength between silicone elastomer and heat polymerized acrylic resin substratewas tested using a acrylic resin blank as a test specimen with the dimension of 75 mm 10 mm 3 mm . silicone elastomer was bonded to a part of specified area on the acrylic resin blank . a total of 96 test specimens were fabricated , which were then divided into 4 main groups ( a , b , c and ct ) with 24 specimens each . primer g611 constituted the group a , primer a-330 constituted the group b , cyanoacrylate resin group c and the ct group represented the control group without any primer . these groups were further divided into subgroups 1 , 2 , and 3 with 8 specimens each . specimens of subgroup 1 had no surface alteration ( plain ) on the acrylic resin blank , subgroup 2 specimens had retentive beads on the area of acrylic resin blank where the silicone elastomer was bonded and specimens of the subgroup 3 had retentive holes . prefabricated acrylic sheet of 3 mm thickness was cut into required dimension of 75 mm ( length ) 10 mm ( width ) . the mold cavity , thus obtained was used to fabricate the heat polymerizing acrylic resin blank . the heat polymerizing acrylic resin was packed into the mold and the plain resin blanks without any surface alteration were fabricated for the subgroup 1 ( fig . each blank was measured and marking was done at a length of 25 mm where silicone had to be bonded . in the area of 25 mm10 mm of the blank , adhesive was applied for the retentive beads which were provided by the manufacturer and the measured amount ( 0.01 mg ) of retentive beads ( retentionen , renfert , chicago , il , usa ) were spread evenly throughout the marked area and allowed to dry . the modified sheets with beads were then flasked , packed , polymerized and polished ( fig . after the acrylic blanks were finished and polished , they were measured and marked for a length of 25 mm 10 mm , where silicone had to be bonded . horizontal lines were marked in this area at a distance of 3 mm and vertical lines were marked at a distance of 2.5 mm . at the intersection of these lines , 24 holes were made of diameter 1.5 mm and depth of 0.5 mm using a round tungsten carbide bur of diameter 1.5 mm ( fig .3 ) . on the acrylic resin blanks fabricated ( with and without surface characterization ) above , another acrylic blank of the same dimension ( 75 mm 10 mm 3 mm in length , width and thickness respectively ) was overlapped and the borders were sealed neatly with wax to seal the gap between the two blanks . the fused acrylic blanks were then flasked with the first pour covering till the junction of the two blanks . the plaster was allowed to set and later petroleum jelly was applied all over followed by which the second pour was done using dental stone and the flask was clamped and stone was allowed to set . later the flask was opened , dewaxed and the overlapped acrylic blank from the upper member of the flask was removed from the mold . the lower member of the flask contained the acrylic blank with the required surface characteristic and the upper member of the flask contained mold of overlaped resin blank in which silicone was packed . next , an adhesive tape was applied to define the area over which the silicone elastomer was to be bonded to the acrylic substrate . the tape covered an area of 50 mm 10 mm leaving an uncovered area of 25 mm10 mm ( surface characterization was done ) where the silicone had to be bonded to the acrylic substrate . the uncovered area of acrylic blank was cleaned with acetone and then left to air dry . different primers were applied to their corresponding group specimens according to the manufacturer 's instruction and cosmesil m511 silicone elastomer was packed and cured according to manufacturer 's instructions . only for the group c the silicone was packed without the application of primer . after finishing of the cured silicone strip , a uniform layer of cyanoacrylate resin was applied on the area of acrylic resin blank to be bonded to silicone and the cured silicone strip was immediately placed in its correct position on the acrylic resin blank and a weight of 1 kg was placed on the specimens for 15 minutes , then the silicone had bonded to the resin blank . all the test groups were subjected to an 180 peel strength test on hounsfeild universal testing machine ( ht - 400 ) . the test was carried out according to the astm d - 903 specifications . in each specimens , the silicone strip was bonded to acrylic denture base at one end ( 25 mm 10 mm 3 mm ) and left free at the other ( 50 mm 10 mm 3 mm ) . the free end of the strip was turned back at 180 so that the hard acrylic base was clamped in the lower clamp and the soft free silicone strip was gripped in the upper clamp ( fig . peel strength ( n / mm ) was determined using the formula peel strength = f / w ( 1 + / 2 + 1 ) where f = maximum force recorded ( n ) ; w = width of specimens ( mm ) ; = extension ratio of silicone elastomer ( the ratio of stretched to primary length ) the results obtained were then subjected to statistical analysis using a 43 general factorial analysis of variance ( 2 - way anova ) . pair wise comparison of 4 groups and 3 altered surfaces with respect to bond strength was analyzed by using scheff multiple comparison test procedures . the statistical analysis was performed using stata 10.0 ( stata corp lp , san diego , tx , usa ) statistical software . for each specimen , 0.01 mg of retentive beads of 0.6 mm diameter were used . prior to flasking the prefabricated acrylic sheet were modified . each blank was measured and marking was done at a length of 25 mm where silicone had to be bonded . in the area of 25 mm10 mm of the blank , adhesive was applied for the retentive beads which were provided by the manufacturer and the measured amount ( 0.01 mg ) of retentive beads ( retentionen , renfert , chicago , il , usa ) were spread evenly throughout the marked area and allowed to dry . the modified sheets with beads were then flasked , packed , polymerized and polished ( fig . after the acrylic blanks were finished and polished , they were measured and marked for a length of 25 mm 10 mm , where silicone had to be bonded . horizontal lines were marked in this area at a distance of 3 mm and vertical lines were marked at a distance of 2.5 mm . at the intersection of these lines , 24 holes were made of diameter 1.5 mm and depth of 0.5 mm using a round tungsten carbide bur of diameter 1.5 mm ( fig . on the acrylic resin blanks fabricated ( with and without surface characterization ) above , another acrylic blank of the same dimension ( 75 mm 10 mm 3 mm in length , width and thickness respectively ) was overlapped and the borders were sealed neatly with wax to seal the gap between the two blanks . the fused acrylic blanks were then flasked with the first pour covering till the junction of the two blanks . the plaster was allowed to set and later petroleum jelly was applied all over followed by which the second pour was done using dental stone and the flask was clamped and stone was allowed to set . later the flask was opened , dewaxed and the overlapped acrylic blank from the upper member of the flask was removed from the mold . the lower member of the flask contained the acrylic blank with the required surface characteristic and the upper member of the flask contained mold of overlaped resin blank in which silicone was packed . next , an adhesive tape was applied to define the area over which the silicone elastomer was to be bonded to the acrylic substrate . the tape covered an area of 50 mm 10 mm leaving an uncovered area of 25 mm10 mm ( surface characterization was done ) where the silicone had to be bonded to the acrylic substrate . the uncovered area of acrylic blank was cleaned with acetone and then left to air dry . the procedure mentioned abovedifferent primers were applied to their corresponding group specimens according to the manufacturer 's instruction and cosmesil m511 silicone elastomer was packed and cured according to manufacturer 's instructions . only for the groupc the silicone was packed without the application of primer . after finishing of the cured silicone strip , a uniform layer of cyanoacrylate resin was applied on the area of acrylic resin blank to be bonded to silicone and the cured silicone strip was immediately placed in its correct position on the acrylic resin blank and a weight of 1 kg was placed on the specimens for 15 minutes , then the silicone had bonded to the resin blank . all the test groups were subjected to an 180 peel strength test on hounsfeild universal testing machine ( ht - 400 ) . the test was carried out according to the astm d - 903 specifications . in each specimens , the silicone strip was bonded to acrylic denture base at one end ( 25 mm 10 mm 3 mm ) and left free at the other ( 50 mm 10 mm 3 mm ) . the free end of the strip was turned back at 180 so that the hard acrylic base was clamped in the lower clamp and the soft free silicone strip was gripped in the upper clamp ( fig . peel strength ( n / mm ) was determined using the formula peel strength = f / w ( 1 + / 2 + 1 ) where f = maximum force recorded ( n ) ; w = width of specimens ( mm ) ; = extension ratio of silicone elastomer ( the ratio of stretched to primary length ) the results obtained were then subjected to statistical analysis using a 43 general factorial analysis of variance ( 2 - way anova ) . pair wise comparison of 4 groups and 3 altered surfaces with respect to bond strength was analyzed by using scheff multiple comparison test procedures . the statistical analysis was performed using stata 10.0 ( stata corp lp , san diego , tx , usa ) statistical software . the groups of primers g611 and a-330 g failed either adhesively or cohesively while the control group and those of cyanoacrylate showed adhesive bond failure . the mean and standard deviations of the adhesion in peel force measurements are presented in table 1 . the primer a-330 g with retentive holes showed the maximum mean peel strength among all the groups ( 6.500.52 mpa ) . the control group without surface characterization / plain showed the least mean peel strength ( 0.150.23 mpa ) . table 2 represents the two way interactions between the primers and surface characterizations using 2 - way anova . there was statistically significant difference between the peel strengths of different primers used ( p = .0000 * ) at 5 % level of significance and also between the different surface characterizations used ( p = .0320 * ) at 5 % level of significance . this analysis also revealed that two way interaction , primers by surface characterizations was highly significant ( p = .0001 * ) at 5 % level of significance . further pair wise scheff multiple post hoc analysis was done for all the 4 primers . for all the surfaces , significant difference was seen between all the primers and control group ( p = .0000 * ) at 5 % level of significance . significant difference was also seen between primers g611 and a-330 g when compared to cyanoacrylate ( p = .0000 * ) at 5 % level of significance as displayed in table 3 . as presented in table 4 the pair wise comparison also revealed , significant difference between peel strength of retentive holes and that of plain surface of all the primers ( p = .0343 * ) at 5 % level of significance . the bond of elastomer to the acrylic resin component must be sufficiently tenacious to withstand the substantial forces acting upon the bond interface , not only during placement and removal of the prosthesis , but also during mold opening and deflasking procedures .2 however , the chemical structure of maxillofacial silicone elastomers ( dimethyl siloxane polymers ) and pmma denture base resin is different , exhibiting poor bond characteristics .2,11 hence , primers are provided to increase the bond strength between silicone elastomer and acrylic resin thereby preventing delamination of silicone and enhancing the longevity of the prosthesis . they increase the bond strength by activating the surfaces via etching or promoting hydrogen bonding and covalent coupling , increasing the wettability of the substrate and by impregnating the surface layer with the polymeric ingredients .5 bond strength can be measured and evaluated by tensile test , shear test and peel test .12 a horizontal component of detaching forces are generated when the patient removes the craniofacial implant retained prosthesis . this type of force is well simulated in the peel test .3,4 for this reason , 180 peel test was used in this study to evaluate the bond strength . in the present study , test showed that specimens of primer g - 611 and primer a-330 g were separated either cohesively or adhesively , whereas all test specimens of cyanoacrylate and control group showed adhesive type of bond failure . for cohesive failures , the peel bond strength between the silicone and the denture base was stronger than the strength of the silicone material . although the peel test has the advantage of being the only method in which failure proceeds at a controlled rate and the peel force is a direct measure of the work of detachment , cohesive peel bond test failures should be interpreted with caution . it is likely that the cohesive failures were initiated by small imperfections or voids in the silicone mixture . specimens with both the primer g - 611 and a-330 g showed good bond strength with mean peel strength of 5.11 n / mm and 5.21 n / mm , respectively . although previous study conducted by hatamleh and watts1 , showed lower bond strength of 1.30 n / mm and 2.36 n / mm , they stated a-330 g produced the maximum peel strength among the primers , which was in accordance with our study . the increased bond strength of a-330 primer could be due to increased chemical affinity in comparison to g - 611 as they vary in composition . specimens with cyanoacrylate produced bond strength of 2.65 n / mm which was significantly less than the bond strength produced by g - 611 and a-330 g primers . yet it produced satisfactory bond strength in which the result being 0.15 n / mm without the use of primers . in surface characteristics where retentive holes were used , the maximum peel bond strength was produced with primer g - 611 and primer a-330 g in comparison to plain acrylic resin substrate . this is in accordance with the study conducted by craig and gibbons .13 they advocated a roughened surface to improve the adhesive bond . they reported that adhesive values obtained by roughening were approximately double those of smooth surfaces because of a slightly irregular surface provided mechanical locking for the soft material . on the contrary jagger et al. 14 claimed that roughening the resin surface with an acrylic bur weakened the bond because of the stress concentration caused by discontinuities of the surface and entrapped air or gas at the interface , which could further weaken the bond by the created voids . however , if the surface roughening is done in a definite pattern , with adequate intervals of plain surface and roughness , then the possibility of stress concentration and weakening of the acrylic resin substrate may be reduced . also , if the packing of silicone into the mold is done with appropriate equalization of pressure ensuring the proper flow of silicone elastomer into the depressions created on the acrylic substrate , air or gas entrapment will be prevented . increase in bond strength with primer g - 611 and primer a-330 g with retentive holes could be due to the mechanical interlocking of peg like extension of silicone material into the holes made on acrylic substrate , also the provision of holes provided increased surface area for the silicone elastomer to bond with acrylic resin substrate . similarly , surface characteristics of retentive beads showed increased bond strength although it was not significant in comparison to plain surface with specimens of g - 611 and a-330 g , which is in accordance with a study conducted by taft et al. ,3 who found that the mean force required in adhesion in peel test for 1205 primer without beads was 35.7 n and for 1205 primer with beads was 40.2 n. the results showed increase in bond strength with beads but showed no statistical significance . decrease in the bond strength with surface characteristics in cyanoacrylate specimens could be due to the method of sample fabrication , where silicone is peeled from the acrylic substrate from the bonding area , bonding agent is applied and the silicone elastomer had to be placed back in the same original position so that the irregularities , elevations and depressions of the two materials will correspond to each other , which is highly difficult . this produced an area of voids and spaces between the acrylic and silicone elastomer , producing a weak bond between the two . this study gives scope for further research to evaluate , the biocompatibility of using cyanoacrylate as a bonding agent in maxillofacial prosthesis . since the prosthesis is worn extraorally the effect of outdoor weathering on the bond strength between silicone and acrylic resin with respect to the bonding agent need to be evaluated . depth of 0.5 mm holes was found to improve the bond strength , but further research is needed to evaluate the variation of bond strength as the depth of the retentive holes varies . further research is also required to evaluate the long term effect of cyanoacrylate on both acrylic resin and silicone elastomer along with its mode of bonding . coloring pigments added to silicone can change surface properties of silicone , which in turn , can affect its bond strength and therefore need to be evaluated as well . primers g - 611 and a-330 produced much better bond strength between silicone elastomer and acrylic resin than cyanoacrylate.amongst all the primers tested , a-330 g produced the highest bond strength and was the most compatible with cosmesil m511 silicone.among the primers , the use of retentive holes significantly increased the bond strength in comparison to specimens with no surface characteristics.surface characterization used in case of cyanoacrylate was found to decrease the bond strength unlike in case of primers g - 611 and a-330g . as satisfactory bond strength with cyanoacrylate was achieved though it was less than the primers g - 611 and a-330 g . primers g - 611 and a-330 produced much better bond strength between silicone elastomer and acrylic resin than cyanoacrylate . amongst all the primers tested , a-330 g produced the highest bond strength and was the most compatible with cosmesil m511 silicone . among the primers , the use of retentive holes significantly increased the bond strength in comparison to specimens with no surface characteristics . surface characterization used in case of cyanoacrylate was found to decrease the bond strength unlike in case of primers g - 611 and a-330 g . as satisfactory bond strength with cyanoacrylate\noutput:\n" }, { "from": "agent", "value": "purposethe aim of the study was to evaluate the effect of 3 silicone primers and 3 surface characterization of acrylic resin surface on bond strength between silicone elastomer and acrylic resin.materials and methods96 cosmesil silicones bonded to heat - curing acrylic resin were fabricated with the dimension of 75 10 3 mm . the 3 primers used in this study were g611 platinum primer , a-330 gold platinum primer , and cyanoacrylates resin . specimens without primer were used as control . the 3 types of surface characterization done were retentive holes with 1.5 mm in diameter and 0.5 mm deep , retentive beads of 0.6 mm diameter and the third type which was plain without any characterization . the specimens were then checked for bond strength by subjecting them to 180 peel test on a universal testing machine . the obtained results were then subjected to statistical analysis using 2 - way anova and scheff multiple post hoc procedures . the statistical significance was set at 5 % level of significance.resultsthe maximum bond strength was seen for samples in which a-330 g primer was used followed by g611 primer . the control group showed the minimum bond strength . surface characterization of retentive holes increased the bond strength considerably as compared to retentive beads and samples without any surface characterization.conclusionwithin the limitations of the study , a-330 g primer was more compatible with cosmesil m511 silicone and has better bonding of cosmesil to acrylic resin . retentive holes made on acrylic surface increased the bond strength considerably than those without any surface characterization ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: op is considered valuable in lowering the anxiety of new workplace , and can benefit both faculty and the new entrants . many medical colleges in india are running op of new mbbs entrants of varying duration of 13 days . we at our institute are also running 1 - day op for new entrants , on the first day of their joining the course , since year 2010 . the program has been structured around six core areas anti - ragging measures in the campus , time management , stress management , introduction to mentorship program , introduction to the ethical issue in medical practice and study skills and learning techniques . this program is running for last 6 years , but till date this program has never been evaluated from faculty or students perspectives . during one - to - one discussion , many a times , faculty members have shown their discontent with this 1 - day op . a constant need was being felt to evaluate this program from both faculty and students perspectives . accordingly program evaluation was conducted with the objectives of evaluating the op from faculty and students perspectives and to recommend any changes in the program if required . after the approval of the institutional research committee and university ethical committee , the program evaluation study was conducted between october 2014 and january 2015 . students of three mbbs batches , that is , admission batch 2012 , 2013 , and 2014 who participated in the current op in august 2012 , august 2013 , and september 2014 respectively were included in the study . an anonymous , pretested , semi - structured questionnaire ; designed on the basis of tools available for designing a questionnaire for evaluating a training program was given to the students to fill . questionnaire has eight questions on a likert scale ( to great extent = 3 , to some extent = 2 , not at all = 1 , cant say = 0 ) , five closed - ended and three open - ended questions . data from faculty involved in the implementation of the program and other first professional faculty was collected by conducting focused group discussion ( fgd ) . in total , three fgds were held . after collection of filled - questionnaire , data was analyzed using descriptive analysis and thematic content analysis . of the 439 students contacted , only 213 ( 48.5 % ) have attended current op in the institute . cant say was documented . the median for improvement in understanding for anti - ragging measure and ethical issues topic was three , for all others it was two . similarly for the questionhow important are these topics for medical student - career , median was two for mentorship program ; for all other topics it was three [ table 1 ] . students response to various questions on likert scale over - all rating of the program was good ( median 3 on a five point likert scale of excellent = 5 , very good = 4 , good = 3 , satisfactory = 2 , poor = 1 , cant say = 0 ) . op was marked as very good and good by 35.68 % and 37.09 % students , respectively . only 18.31 % stated that the objectives have been achieved to a great extent . a large number reportedno improvement in understanding on stress management ( 23 % ) , time management ( 22.09 % ) and study skills ( 19.72 % ) after program delivery [ figure 1 ] .19.72 % were not at all satisfied with the timings and 15.02 % were not at all satisfied with the duration of the program [ figure 2 ] . percentage response of the students to various questions percentage satisfaction of the students with the timings , duration and course - content of current orientation program major factors facilitating learning of the students during op were experienced speakers and good topics [ figure 3 ] ; while major factors hindering learning of the students during op werefactors facilitating learning of the students during orientation program factors hindering learning of students during orientation program of 213 students who have attended op in the institute and participated in the study , 147 ( 69.01 % ) students suggested changes , majority in timings ( 101 students ) and duration ( 93 students ) , while changes in the course content were suggested by 62 students only . in total , 37 students asked to conduct more activities during the op . as students were allowed to give suggestions in more than one field , so the numbers of suggestions ( 293 ) are more than the number of students ( 147 ) who gave suggestions . major student suggestions were : timings - conduct it after all have joined , conduct twice a year , conduct after 23 months of joining ; duration - should be 23 days program , on any day not more than 4 h ; course content - include topics such as communication skills , inter - personal relationship skills , and have more group activities and include other teaching methodologies [ figure 5 ] . thematic content analysis of the response of the students regarding suggested changes in the orientation program major patterns of fgds with faculty were : conduct main program after final counseling , make it a minimum 3 days program , include topics such as social etiquette , interpersonal relationships , communication skills , biomedical waste management , and overview of the whole mbbs curriculum . program evaluation is defined as the systematic process of collecting , analyzing , and interpreting information that enables judgments to be made about the value of a program and its effectiveness and / or efficiency in achieving a set of outcomes . program evaluation can help to improve the ongoing program in many ways , like - a program evaluation can find out what works and what does not work ; a program evaluation can showcase the effectiveness of a program to the community and to funders ; a program evaluation can improve staff 's frontline practice with participants ; a program evaluation can increase a program 's capacity to conduct a critical self - assessment and plan for the future ; and a program evaluation can build knowledge for the out - of - school time field . the currenthence , the need was felt to evaluate the program , keeping in mind students and faculty perspective , alike . as the op is being conducted on the first day of joining after first counseling , the students who got admission at the institute after 2 or 3 counseling are not able to attend the op . consequently , more than half of the students ( 51.5 % to be precise in this study ) never attended institutional op , thus being at a disadvantage to other students . though , overall rating of the op was good ; only 18.31 % stated that the objectives of the op have been achieved to a great extent . a large number reported no improvement in understanding on stress management , time management , and study skills after op .19.72 % were not at all satisfied with the timings and 15.02 % were not at all satisfied with the duration of the program . many students and faculty members suggested changes in the currently running op . based on these suggestionsa new op has been proposed to the authorities , to be implemented from the next academic session [ table 2 ] . proposed revised op for first year mbbs students hopefully , the new program will be able to fulfill the aspirations of the students and the faculty members . we will again review this proposed program ( if implemented ) , after running it for 23 years .\noutput:\n" }, { "from": "agent", "value": "context : one - day orientation program ( op ) for fresh mbbs entrants is running in our institute since 2010 , but has never been evaluated.aims and objectives : to evaluate the op from students and faculty perspectives and to recommend a revised program.methodology : totally 439 students of three mbbs batches were enrolled in the study . students were asked to fill an anonymous semi - structured , pretested questionnaire . views of faculty members were recorded by conducting three focus group discussions.results : more than half of the students have never attended the institutional op due to timings issue . overall rating of the program was good , but many students and faculty members suggested changes in the duration , timings and course content of the op . a revised op was proposed to the authorities.conclusion : the current institutional program though rated good , requires a lot of amendments . the revised proposed op should be implemented from the coming session ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: basic fibroblast growth factor ( bfgf ) is a multigene family member of structurally related peptide growth factors , and its function is mediated through high - affinity receptors . it is well known that bfgf is a multifunctional cytokine to participate in the process of wound healing , cell proliferation , and apoptosis . wound healing can be divided into three consecutive , partly overlapping phases : inflammation , proliferation , and tissue remodeling . the macrophage plays a pivotal role in the transition between wound inflammation and repair , since this cell both scavenges tissue debris and releases a plethora of biologically active substances that include growth factors like bfgf . during the remodeling phase , the number of blood vessels declines and apoptosis of fibroblasts results in scar tissue with a low cell density . apoptosis is a requisite event for maintaining kinetic homeostasis in continuously renewing tissues such as oral mucosa and skin , and it is suggested to play a crucial role in the repair of connective tissues . nevertheless , apoptosis is often involved in pathogenetic pathways . regarding the mechanism of apoptosis induced by bfgf treatment , it has recently been demonstrated that bfgf plays an important role in apoptosis during development of the neural retina . the apoptosis of fibroblasts treated with bfgf was enhanced in both in vivo and in vitro experiments . in dentistry , bfgf was reported to enhance the proliferation of human periodontal ligament ( pdl ) cells in beagle dogs . however , the mechanisms of apoptosis enhanced by bfgf , and the age difference still remains unclear . the purpose of this study was to investigate the effects of bfgf treatment on the metabolism of cultured gfs from different - aged hosts with a special reference to the expressions of caspase - 3 . these results support our hypothesis that the temporal activation of bfgf at the injury site results in effective apoptosis of granulation tissue fibroblasts , a process that is the initiation of wound remodeling phases . in this experiment , 40 - male - wistar rats aged 6 and 12 weeks were used . the rats were equally divided into two groups : a bfgf injection group and a control group . the protocol was approved by the animal care and use committee of hiroshima university . in the scar formation , rectangular strips of the bilateral one third of the hard palatal mucoperiosteum were excised under general anesthesia induced by intraperitoneal injection of sodium pentobarbital ( 1 mg / kg of nembutal , dainabot , osaka , japan ) . the exposed bone surface was wiped with a cotton pellet for complete removal of the periosteum . five days after excision , 10 l of bfgf solution ( 20 mg of bfgf / 10 l saline ) and 10 l of pbs were injected into the operated area , respectively . at 10 days after the excision , the specimens were decalcified in 22.5 % ethylenediaminetetraacetate ( edta ) and embedded in paraffin , and serial frontal sections of 7 m in thickness were prepared , stained with apoptag plus peroxidase in situ apoptosis detection kit ( millipore , billerica , ma ) , and observed by light microscopy . permission for a series of experiments in this study was granted by the ethics committee of hiroshima university . human gfs were isolated from healthy palatal gingival tissues obtained from 16 patients before and during orthodontic treatment ranging in the age from 9 to 35 years old according to the methods described previously .16 entries were divided into the young group from 9 to 12 years old ( n = 8 ; 2 male and 6 female ) and the adult group from 26 to 35 years old ( n = 8 ; 1 male and 7 female ) . the explants were cultured in 100 mm dishes ( corning , new york , ny ) with 10 ml dulbecco 's modified eagle medium ( dmem ; nissui pharmaceutical co. , tokyo , japan ) containing 10 % fbs ( mitsubishi - kasei , tokyo , japan ) , 32 u / ml penicillin - g ( sigma , st . louis , mo ) , 60 g / ml kanamycin ( meiji - seika , tokyo , japan ) , and 250 ng / ml amphotericin b ( icn biomedicals inc. , aurora , oh ) , under an atmosphere of 5 % co2 in a humidified incubator at 37c . the 5th8th passaged cells isolated from 16 different gingival tissues were used for the following experiments . proliferation of gfs was evaluated using a cell proliferation elisa brdu kit ( roche diagnostics , basel , switzerland ) . briefly , gfs were trypsinized , seeded at a density of 1.010 cells / well in 125 l dmem on a type - i collagen ( 10 g / ml ) coated 96 - well plate ( falcon , flanklin lakes , nj ) , and incubated overnight . gfs were washed three times with pbs and then incubated with or without bfgf ( 0.5 , 1.0 ng / ml ) ( peprotech , paris , france ) in the culture medium with 1 % fbs . gfs were washed three times with pbs and 10 l of 5 g / ml 5 - bromo -2-deoxyuridine was added to each well and then incubated for 2 hr . after the incubation , optical density was measured at a wavelength of 570 nm by a bio - rad microplate reader ( model 550 , bio - rad , hercules , ca ) . gfs cultured in incomplete medium without bfgf were used as negative controls , and gfs treated with bfgf alone in incomplete medium were used as positive controls for each experiment . after 72 hrs , elisa assay was performed , and the proliferation of gfs was compared by the percentage relative to negative controls . the mrna levels of fibronectin - 1 and type - i collagen were examined by a quantitative real - time pcr analysis using a lightcycler system ( roche diagnosics ) and quantitecttm sybr green pcr master mix ( qiagen , tokyo , japan ) . gfs were seeded at a density of 610 cells / well on 6 - well plates ( falcon ) . as the cells became 80 % confluent , gfs were incubated with bfgf ( peprotech ) at 0.5 or 1.0 ng / ml for 24 hrs and then washed excessively with pbs . total rna was extracted from the cell cultures using trizol reagent ( gibco brl , gaithersburg , md ) . first - strand cdna was synthesized from 1 g total rna using rever tra ace - ( toyobo , osaka , japan ) . the signals of fibronectin - 1 and type - i collagens were evaluated in a qualitative manner , relative to the glyceraldehyde 3 - phosphate dehydrogenase ( gapdh ) signals . gfs were seeded at a density of 110 cells / well on 96 - well plates ( falcon ) . as the cells became 70 % or 100 % confluent , gfs were incubated with bfgf ( peprotech ) at 0.5 or 1.0 ng / ml for 624 hrs and then washed excessively with pbs . after washing with pbs , pbs including nucview 488 caspase - 3 substrate ( biotium , sanfrancisco , ca ) of 20 l was added to each well and incubated at 37c for 1 hr . caspase - 3 activation was determined by fluorescence measurement using a fluorescence plate reader ( model : arvo sx ; perkinelmer , yokohama , japan ) at a wavelength of 520 nm . the experiments were repeated at least in triplicate . means and standard deviations were calculated from the data obtained , and differences in the means were examined by the use of a student 's t - test or one - way analysis of variance ( anova ) followed by a scheffe 's multiple comparisons test at a significant level of p 0.05 or p 0.01 in the young group , a significantly higher proliferation activity was shown when compared to the adult group on days 5 and 7 ( figure 1 ( a ) ) . meanwhile , the days that reached the peak were shortened on day 5 from day 7 by the treatment of bfgf ( figures 1 ( b ) and 1 ( c ) ) . after 1.0 ng / ml bfgf treatment , a significant difference in cell proliferation between young and adult groups was shown on day 5 ( figure 1 ( c ) ) . the fibronectin - 1 gene expression was not changed substantially by the treatment of bfgf ( figure 2 ( a ) ) . on the other hand , an increase in the type - i collagen gene expression was significantly induced by the treatment with bfgf in both young and adult groups . in addition , the type - i collagen gene expression was significantly ( p 0.01 ) up - regulated by bfgf in the young group than in the adult group ( figure 2 ( b ) ) . the caspase - 3 activity was enhanced significantly by the bfgf treatment for 12 hrs in human gfs at 100 % confluence , while the bfgf treatment had no significant effect on caspase - 3 activity in human gfs at 70 % confluence ( figure 3 ( a ) ) . especially , 0.5 ng / ml bfgf enhanced the level of caspase - 3 in gfs of the young group than that of the adult group ; however when human gfs was treated with 1.0 ng / ml bfgf , the activity of caspase - 3 was almost the same between young and the adult groups . meanwhile , the caspase - 3 activity in gfs at 100 % confluence increased in a time - dependent manner and reached a plateau at 12 hrs ( figure 3 ( b ) ) . in the injection group , more than 60 % of the cells in 6 weeks wistar rats had condensed nuclei and reduction of cytoplasm , which are typical of apoptosis ( figure 4 ( a ) ) , whereas less than 10 % of the cells had the features of apoptosis in the 12 weeks wistar rats ( figure 4 ( b ) ) . bfgf is widely known as a cellular growth factor and has a strong multiplication stimulating activity for various kinds of cells such as osteoblasts , fibroblastic cells , and vascular endothelial cells . it is documented that bfgf highly enhances the proliferation of immature human pdl cells while maintaining the differentiation potential and increases the size of stem cell clones in the human pdl . the injection of bfgf into skin wound sites reduced the degree of granulation tissue formation and increased apoptotic events . we have shown that the injection of bfgf into rat palate wound sites increased apoptotic events . from these results , bfgf enhances the apoptosis of fibroblasts in vivo and inhibits the scar tissue formation . in this study , bfgf was added to gfs until 80 % confluence to examine the entire proliferation activity , whereas gene expression of the extra cellular matrix ( ecm ) was examined at 80 % confluence . in the young group , a significantly higher proliferation activity was shown when compared to the adult group on days 5 and 7 , while there were no differences between two the groups on day 9 . the difference of proliferation of human gfs between two groups only appears during proliferation stage . on the other hand , bfgf treatment increased the proliferation of human gfs in both groups , and the days that reached the peak were shortened on day 5 from day 7 by the treatment of bfgf . in addition , gene expression of type - i collagen was increased by the addition of bfgf . in a previous study , when the difference in migratory competence was examined for fibroblasts from embryo and elderly subjects , the migratory capacity was lower in the adult cells than in the young origin cells . moreover , in experimental system to induce cell aging , a repeated subculture made a comparison between 10th and 20th passaged cells and demonstrated that rate of functional deterioration of migratory competence was 25 % and 17 % in 20th and 10th passaged cells . it is thus shown that cell activity reduces with aging . in addition , we investigated the apoptosis induction potency of bfgf . for the induction mechanisms of apoptosis , there are various apoptotic signal transduction pathways , in which the major one is through death receptors and mitochondria . mitochondria plays an essential role in many forms of apoptosis by releasing apoptogenic factors such as cytochrome c and apoptosis - inducing factor ( aif ) which activates death proteases called caspases . active effector caspases such as caspase - 3 , -6 , and -7 mediate the cleavage of an overlapping set of protein substrates , resulting in morphological features of apoptosis . it is considered that apoptosis is surely induced for the detection of revitalization , because the examination of apoptosis in the actual experiment observes reaction of caspase - 3 located in the final phase in the downstream . it is considered that apoptosis has been generated when the reaction of caspase - 3 increases . in this study , to clarify the influence of host ages on the apoptosis induction potency of bfgf , the induction of caspase - 3 by bfgf was examined . when 70 % confluent gfs was treated with bfgf , the caspase - 3 activity was significantly less than that of 100 % confluent gfs . moreover , 0.5 ng / ml bfgf significantly enhanced the level of caspase - 3 in gfs in the young group than in the adult group . however when human gfs was treated with 1.0 ng / ml bfgf , the activity of caspase - 3 was almost the same between the young and adult groups . in the previous study , fibroblast growth factor receptor ( fgfr ) - 1 gene expression decreased relevant to age . it is thus suggested that the cell response to bfgf was less in adult group than in the young group , and this difference was related to the dose of bfgf . it is reported that bfgf effectively induced caspase - 3 activation and apoptosis in transforming growth factor ( tgf ) -1-pretreated granulation tissue - derived fibroblasts ( gf - 1 ) . in our study , bfgf treatment induces apoptosis in human gfs without pretreatment of tgf - 1 , indicating bfgf has direct effect on apoptosis . on the other hand , our study showed that injection of bfgf into rat palate wound sites increased apoptotic events . it is reported that bfgf injection into wound site induced a rapid increase in tgf - 1 . thus , tgf - 1 and bfgf levels at the injury site lead the apoptosis in fibroblasts ; this result may contribute to the proliferative granulation tissue formation . it became clear that once the cells reached the confluence , the apoptotic activity was enhanced . the difference in the action of bfgf due to the cell density of fibroblasts is assumed to accelerate wound healing . that is , bfgf stimulates the fibroblasts with the physiologically active substance discharged from the white blood corpuscle and macrophage at the inflammation period . the tissue defect is filled with the granulation tissue , and then the number of proliferating cells is decreased by apoptosis at the restructuring period , resulting in excessive extracellular substratum . in conclusion , cell proliferation and matrix synthesisfurthermore , it is suggested that apoptosis in human gfs and rat palate was increased by the treatment with bfgf . from these findings , apoptosis induced by bfgf in fibroblasts may lead to granulation tissue formation and scar - less repair , moreover this effect of bfgf may be related to the host age .\noutput:\n" }, { "from": "agent", "value": "the purpose of this study was to investigate the effects of basic fibroblast growth factor ( bfgf ) treatment on the proliferation and apoptosis of cultured gingival fibroblasts ( gfs ) . human gfs were isolated from the palatal gingival tissues of 16 healthy volunteers ranging in the age from 9 to 35 years old . cultured gfs were subjected to the analyses for cell proliferation by elisa assay , gene expression by rt - pcr analysis , and apoptosis potency by caspase - 3 assay . the cell proliferation activity and gene expression of type - i collagen and caspase - 3 activity were enhanced significantly by the treatment with bfgf in cultured gfs . furthermore , the activity of caspase - 3 in cultured gfs from young subjects was significantly higher than that in gfs from adults . it is shown that bfgf significantly enhances the gene expression of type - i collagen in cultured fibroblasts from human gingival tissues . it also demonstrated that bfgf modulates the apoptosis of periodontal fibroblasts , and the effect is higher in young subjects , indicating a significant role of bfgf in the prevention of scar formation during wound healing ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: heterotopic calcification as a late complication of radiation therapy has been reported in cases of calcification related to radiation therapy , including breast cancer , seminoma , genitourinary malignancies , sarcoma , anal carcinoma , and lymphoma ( 1 - 5 ) . among these , only one case of subcutaneous calcification after radiotherapy in head and neck cancer has been described ( 6 ) . according to these reports , heterotopic calcification generally develops as a late complication no sooner than 1 year after therapy ( 1 ) . only one case report is available describing the long - term time course of heterotopic calcification following radiotherapy ( 4 ) . prevertebral soft tissue calcification as a late manifestation of a head and neck tumor has not been reported . we present a case of growing prevertebral soft tissue calcification that developed in a patient with previous tonsil cancer who underwent chemotherapy and radiotherapy . a 74 - year - old female with rheumatoid arthritis was admitted to the department of orthopedic surgery with pyogenic arthritis in her right elbow . she had a history of chemotherapy and radiotherapy due to tonsil cancer 21 years ago . she was referred for an otolaryngologic consultation due to chronic neck pain and swallowing difficulty on hospital day 7 . the patient 's complete blood cell count showed leukocytosis of 14.410 / mm ( normal range , 4.0 - 10.010 / mm ) on admission , which decreased gradually and normalized at the time of the otolaryngologic consultation . her c - reactive protein level was 16.9 mg / dl ( normal range , 0 - 0.3 mg / dl ) on initial examination and had fallen to 5.0 and 2.0 mg / dl on a follow up study performed on hospital days 5 and 8 , respectively . a neck computed tomography ( ct ) scan revealed symmetric fatty atrophy of both the parotid and submandibular glands that seemed to be associated with the previous radiation therapy . soft tissue swelling in the pharyngeal mucosal space , the retropharyngeal space , and the prevertebral space was observed with obliteration of the parapharyngeal space and fat planes around the carotid sheath . the radiation changes were most prominent at the c2 and c3 levels , so these areas were thought to be included in the radiation field . the chronic neck pain and swallowing difficulty seemed to be due to radiation - induced changes in the pharyngeal mucosa and radiation - induced sialoadenitis . however , prevertebral soft tissue calcification was observed with a curvilinear configuration at the level of c2 and c3 ( fig . prevertebral soft tissue thickening was noted at the c2 and c3 level ( at c2 : 9.1 mm ; at c3 : 8.2 mm ) . additional prevertebral calcification was found at the c3 - 4 and c6 - 7 intervertebral disc levels , and they were thought to be associated with degenerative changes in the intervertebral discs ( fig . the c2 and c3 bodies and posterior elements showed osteopenia and coarsening of trabeculae . suggesting radiation osteitis or osteoradionecrosis . a neck ct scan obtained 7 years ago demonstrated calcification at the same site ( fig . the calcification was about 0.90.51.5 cm in size and was ovoid - shaped and smooth - margined . the retropharyngeal and prevertebral soft tissue swelling was slightly more prominent compared with that of the later study . follow - up c - spine lateral radiography after 1 year showed no change in size or configuration of the calcification ( fig . although not histopathologically confirmed , the lesions were thought to be benign because they grew slowly and remained unchanged for at least 1 year . based on the clinical course and association with previous radiation therapy , the diagnosis was heterotopic calcification in the prevertebral space as a late complication of radiation therapy . heterotopic calcification is a condition in which calcium salts are deposited in previously normal or damaged tissues . heterotopic calcification is called \" metastatic calcification \" , and heterotopic ossification is called \" dystrophic calcification \" . however , the term \" ossification \" refers to bone formation ( calcification in a collagen matrix ) ( 7 ) . it can be caused by hypercalcemia , ischemia , trauma , inflammatory metabolic disorders , infection , or hereditary factors . for example , post - traumatic calcification usually stabilizes and may regress ( 8 ) , suggesting that heterotopic calcification is not part of the aging process but a result of intracellular and extracellular metabolic processes . some authors suggest that radiation - induced vascular damage may play a role in intracellular calcium deposits mediated by mitochondria ( 1 , 2 ) . acute complications include hematologic toxicity , epithelial damage , and edema that appear during radiotherapy . an early delayed complication refers to complications that occur within 6 months to 10 years after radiation exposure . hyperpigmentation , telangiectasia , atrophic dermatitis , fibrosis , necrosis , and ulcers are well known late complications of radiotherapy ( 2 , 3 ) . they are related to factors including total dose , fraction size , patient age , extent of disease , and pre - existing abnormalities ( 2 ) . radiation - induced changes in the head and neck include edema of superficial and deep soft tissues and thickening of the laryngeal and pharyngeal soft tissues in the acute phase . however , it can persist for several months or years after radiotherapy ( 9 ) . this type of calcification can occur in previously malignant tissue such as a pathologic lymph node in patients with hodgkin 's disease ( 5 ) . this generally develops no sooner than 1 year after radiation and often more than 5 years later . it seems to be similar to previously normal tissues incidentally radiated in the treatment . according to previous case reports , calcification tends to occur as a late complication of radiotherapy ( 1 , 2 , 4 , 6 ) . in a study by carl and hartmann ( 1 ) , which is the largest study of heterotopic calcifications as a late radiation effect , the time interval between radiotherapy and the occurrence of heterotopic calcification was 10 years , except for three cases ( median , 19 years ; range , 2 - 31 years ) . in that study , calcification was generally associated with other severe radiation damage , ulceration , and fibrosis following high radiation doses . a major differential diagnosis of prevertebral soft tissue calcification is calcific tendinitis of the longus colli muscle , also known as retropharyngeal calcific tendinitis . the longus colli muscle is located on the anterior surface of the vertebral body and extends from the level of the anterior tubercle of the atlas to the level of the t3 vertebral body . in most cases of retropharyngeal calcific tendintis , only a few cases of retropharyngeal calcific tendinitis involving vertical fibers at the c4 - c5 level have been reported . calcific deposits and soft tissue swelling in retropharyngeal calcific tendintis tend to resolve on follow - up imaging ( 10 ) . however , in our case , calcification had grown over 7 years and remained on a 1 year follow - up . prevertebral soft tissue swelling had decreased slowly for 7 years , suggesting that the condition is not an acute process . ossification of the anterior longitudinal ligament ( oall ) should be considered as a possible differential diagnosis . however , in reported cases of oall ( 11 ) , the ossifications are closely attached along the anterior aspect of vertebral bodies , whereas our case showed a gap between the calcification and the vertebral bodies . only one case report of soft tissue calcification in the neck is available following radiation therapy for laryngeal cancer ( 6 ) . in that case , calcification was located in the subcutaneous layer of the pectoralis major myocutaneous flap and had been growing slowly for 2 - 3 months . similarly , in most of the reported cases , calcification was located superficially , usually in subcutaneous tissues ( 2 , 3 ) . however , our case shows that calcification can also occur in the deep soft tissue included in the radiation field . in conclusion , we describe the first case of heterotopic calcification in the prevertebral space of the cervical spine as a late complication of irradiation , which increased in size during a 7 - year follow - up imaging study . we suggest that this case demonstrates the natural course of heterotopic calcification after radiation therapy .\noutput:\n" }, { "from": "agent", "value": "heterotopic calcification following head and neck irradiation has rarely been reported . it usually develops as a late complication of radiotherapy in patients with malignancies , including breast cancer , lymphoma , and genitourinary malignancies . the occurrence of heterotopic calcification in the prevertebral space of the cervical spine has not been described as a late complication of irradiation . here , we report a case of prevertebral heterotopic calcification in a patient with history of chemotherapy and radiotherapy for tonsil cancer 21 years ago ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: preterm labor ( ptl ) is referred to the occurrence or onset of delivery after the age of neonatal viability ( 20 - 28 weeks ) and prior to 37 weeks or 259 days of pregnancy . the ptl is determined by observable uterine contractions ( at least once in 10 min ) , rupture of the membranes , 2 cm cervical dilatation or the cervix length less than 1 cm . ptl is considered as the main confounding factor in the neonatal mortality ( 2 ) . the prevalence of the preterm labor in developed countries was 5 - 10 % in the past three decades . in some areas , a slight increase has been seen in the last 5 years ( 1 , 3 ) . this is partly due to the very premature infants that had no viability previously ( 1 ) and preterm indicated labors ( 2 ) . in the united states , about 11 % of babiesare born premature which causes respiratory problems , learning disabilities or even death ( 4 ) . preterm rupture of membranes and idiopathic preterm labor are the causes of 66 % of preterm labors . gestational hypertension and obstetric hemorrhage are other common causes that can lead to delivery or may be the reasons for indicated labor ( 1 ) . to reduce the complications and the costs associated with ptl , reducing the risk factors of preterm labor in the general population besides taking certain medications ( tocolysis ) for inhibiting initiated uterine contractions seem to be useful strategies . previous studies have shown that prolonging pregnancy , not tocolysis , improves the neonatal outcomes . this interval may allow the patients to be transferred to a tertiary center and corticosteroid can be prescribed for them . the american college of obstetrics and gynecology ( 2003 - 2008b ) concluded that despite a number of proposed treatment methods , the rate of preterm labor has not changed much over the past 40 years . the doubt on the best management of preterm labor continues up to now ( 2 ) . optimization of obstetric management besides tocolysis includes the stimulation of fetal lung maturation as a means of preventing respiratory distress syndrome in infant . thus , delaying the delivery for at least 24 - 48 hr is the primary goal ( 5 ) because the corticosteroid therapy will be effective in the reduction of respiratory distress and neonatal mortality if the delivery is delayed for a minimum of 24 hr after administration of betamethasone . tocolysis being used currently does not lead to greater receipt of corticosteroids and improvement of neonatal outcomes ( 2 ) . furthermore , tocolysis treatment along with regimen that is currently used is considered to be a risk factor for pregnant women ( 1 ) . magnesium sulfate is the most commonly used injecting drug for tocolysis in north america . however , a recent systematic review on over 2,000 women in 23 studies showed no sufficient evidence to support the use of magnesium sulfate . magnesium sulfate would not delay the delivery and does not prevent preterm labor ( 1 , 2 ) . the complications include vasodilatation , flushing , nausea , vomiting , heart palpitation and headache . careful monitoring is also required to avoid magnesium toxicity . due to lack of efficacy andbased on the aforementioned complications , it is difficult to justify the use of magnesium sulfate ( 1 ) . the studies on calcium channel blocking agents revealed no beneficial or harmful effects in using them . the previous studies have shown that although it delayed the delivery for 24 hr , it did not have any other advantages ( 2 ) . complications that have been confirmed in controlled studies include heart palpitation , tremors , chest pain , hyperglycaemia , hypocalcaemia and rarely but serious pulmonary edema . however , 2 agonists constitute the original treatment regimen although the use of other regimes is increasing due to the same effect and less complications ( 1 ) . nonsteroidal anti - inflammatory drugs ( nsaids ) : indomethacin is the most common drug in this group which acts through cyclooxygenase inhibition . its complications include peptic ulcer , gastrointestinal bleeding , and thrombocytopenia , allergic reaction to the medication and less common complications such as the risk of postpartum hemorrhage , kidney disorders and hypertension ( 1 ) . although the food and drug administration ( fda ) of america retracted its approval on its application , it is widely used in europe ( 2 ) . the results of several clinical trials have shown that the use of glyceryl trinitrate ( gtn ) patch is effective for inhibition of uterine contractions ( 5 ) , pregnancy prolongation , improvement of neonatal outcome and increasing the corticosteroid intake ( 3 , 6 , 7 ) without any significant complications ( 5 , 7 , 8 ) . however , in some studies , the effect of gtn on the delay of delivery and improvement of neonatal outcomes did not differ from placebo ( 1 , 2 , 6 , 9 , 10 ) . no is a very reactive signaling molecule which is produced by many cells endogenously ( 11 ) . no lowers intracellular ionized calcium and causes relaxation of the smooth muscle by increasing gmp . no is a very unstable molecule that is inactivated by superoxide free radicals ( 11 ) . thus , no releasing agents are compounds with short - term effect that their metabolism is often performed in the vascular wall and red blood cells ( 12 ) . the objective of the present study was to investigate the effect of gtn patch on delaying the delivery for 24 and 48 hr and its complication was compared to placebo . although the food and drug administration ( fda ) of america retracted its approval on its application , it is widely used in europe ( 2 ) . the results of several clinical trials have shown that the use of glyceryl trinitrate ( gtn ) patch is effective for inhibition of uterine contractions ( 5 ) , pregnancy prolongation , improvement of neonatal outcome and increasing the corticosteroid intake ( 3 , 6 , 7 ) without any significant complications ( 5 , 7 , 8 ) . however , in some studies , the effect of gtn on the delay of delivery and improvement of neonatal outcomes did not differ from placebo ( 1 , 2 , 6 , 9 , 10 ) . no is a very reactive signaling molecule which is produced by many cells endogenously ( 11 ) . no lowers intracellular ionized calcium and causes relaxation of the smooth muscle by increasing gmp . no is a very unstable molecule that is inactivated by superoxide free radicals ( 11 ) . thus , no releasing agents are compounds with short - term effect that their metabolism is often performed in the vascular wall and red blood cells ( 12 ) . the objective of the present study was to investigate the effect of gtn patch on delaying the delivery for 24 and 48 hr and its complication was compared to placebo . this was a single blind randomized controlled clinical trial conducted in the maternity unit of imam reza hospital ( kermanshah , iran ) during october 2011 to august 2012 . the study was registered in the iranian registry of clinical trials ( irct ) with registration identification of 201108054025n3 . this study was carried out on 84 women with singleton pregnancy aged 15 - 35 years who had symptoms of preterm labor between 27 - 35 weeks of gestation . the gestational age was calculated based on lmp ( first day of the last menstrual period ) or early pregnancy ultrasound findings . sample size was calculated according to the results of the previous studies with a confidence of 95 % and a power of 80 % ( 3 , 6 , 9 ) . inclusion criteria included regular uterine contractions equal or more than four contractions within 20 min or bishop score more than or equal to 3 . bishop score is an index in determining cervical ripening for delivery which is defined based on dilation , effacement , consistency , position and station of the cervix . exclusion criteria included any fetal or maternal indications for necessary termination of pregnancy , multiple pregnancy , preterm rupture of membranes ( prom ) , fetal anomalies , cervical dilatation equal or greater than 5 cm , treatment with other tocolytic agents 24 hr before delivery , previous cesarean delivery , susceptibility to nitroglycerin compounds or any contraindication of nitro compounds and evidence of chorioamnionitis ( maternal fever , leukocytosis , fetal tachycardia ) , maternal heart disease , placenta previa or vasa previa , vaginal bleeding except the minor bleeding caused by initial dilatation of the cervix ( bloody show ) . after hospitalization , the patients were divided into gtn patch or placebo groups according to the table of random numbers . at the start of the study , a fetal cardiograph was recorded using the electronic device for monitoring fetal heart rate for 20 min in both groups . blood pressure ( bp ) and maternal heart rate ( mhr ) were measured as well . the fetal heart rate ( fhr ) was calculated based on the baseline in the primary fetal cardiograph . for all cases , a therapeutic fluid containing 1 l of crystalloid ( normal saline ) was infused as a conservative treatment for preterm labor . two grams of intravenous ampicillin was administrated each 6 to 48 hr . furthermore , 12 mg / after randomization , informed consent was taken from the study group and then the drug ( 10 mg gtn patch , schering plough company ) or placebo ( sarang shahr art group company ) was applied on top of the navel without informing the patient . the blood pressure was measured every 15 min to an hour and then every 4 hr . one hour after treatment , the fetal cardiograph was recorded again ( for 20 min ) . women were examined in terms of redness and irritation of the patch location and 12 mg of betamethasone was administered . then two new patches were replaced . finally , the required variables such as the number of non - delivery cases within the first 24 and 48 hr of randomization , successful tocolysis ( non - delivery in the first 48 hr ) , the number of received corticosteroids doses , drug complications , the changes in maternal heart rate and blood pressure and the changes in the baseline of the fetal heart rate ( fhr ) prior and one hour after the application of gtn patch were studied . the data related to each patient were recorded on data collection forms . in the case of non - delivery , the treatment continued under the supervision of the relevant physician . in cases of patientsthe collected data were analyzed by spss 16 after coding using descriptive statistics ( mean , standard deviation and confidence interval ) and the chi square test and fisher 's exact test to examine the complications and the effects of other qualitative variables . moreover , from 84 subjects who entered the study , 4 patients were excluded due to an emergency cesarean delivery ( 2 patients in the intervention group due to preeclampsia and fetal distress and 2 patients in the control group due to meconium passage and fetal distress ) . the comparison of demographic variables and the maternal and fetal vital signs in both study and control groups showed that despite minor differences , randomization process was successfully done and there was no significant difference between any of the variables in both groups ( tables 1 and 2 ) . comparison of demographic characteristics on admission and time of delivery in gtn and control groups ( meansd ) comparison of received corticosteroids dose number and complications in two groups the comparison of full - dose corticosteroid intake and non - delivery within the first 24 and 48 hr and successful tocolysis in both groups showed no significant difference of the outcomes in the two groups . in the case of 31 people who delivered during the primary hospitalization , the delivery interval from the time of admission was in the range of 7 - 72 hr . the mean values in the intervention and control groups were 314.4 and 18.32.2 hr , respectively ( p = 0.01 ) . from the 49 patients discharged from hospital ( 27 patients in the gtn group and 22 patients in placebo group ) , 31 patients were followed ( 18 patients in the intervention group and 13 patients in the control group ) and they delivered 5 - 80 days after discharge . in the case of 62 patients who delivered at the time of final study ( within the primary hospitalization or after that ) , the average delivery times in the intervention and control groups were 20.64.2 and 16.33.9 days , respectively and the difference was not significant ( table 1 ) . regarding incidence of complications , despite minor differences in the drug and placebo groups ( table 2 ) , only headache had a statistically significant difference ( p = 0.007 ) . in the gtn group , systolic blood pressure ( sbp ) and mean arterial blood pressure ( map ) showed a significant drop after the use of medication ( p 0.001 ) . moreover , the maternal heart rate ( mhr ) indicated a significant increase ( p = 0.01 ) ( table 1 ) . moreover , the differences were compared between the mean values measured before and after use of patch in the drug and placebo groups ( table 3 ) . there was a significant difference between the mean systolic blood pressure ( p 0.001 ) , mean arterial blood pressure ( p = 0.001 ) and maternal heart rate ( p = 0.007 ) in the drug and placebo groups . comparison of the vital signs and fetal heart rate and the mean difference of the index before and one hour after using patch in gtn and placebo groupsthe aim of using tocolytic agents in preterm labor is to delay the delivery at least 48 hr , given the proven effectiveness of corticosteroids for improving neonatal outcomes . in addition to effectiveness , the evaluation of treatment includes complications , safety and risks that threaten the mother and the fetus as well . the results of most studies show that the treatment of acute tocolysis does not prevent preterm labor or does not reduce age - related neonatal complications ( 13 ) . a few studies have compared the effect of gtn with betamimetics or examined its effect descriptively . in these studies , the successful tocolysis ranges from 63 % to 85 % ( 3 , 7 , 9 , 14 ) . although these results are significant in descriptive studies ( 7 , 9 ) there was no significant difference between gtn and placebo or betamimetics in controlled trials ( 3 , 14 ) . in the present study , the proportions of non - delivery cases within the first 24 and 48 hr in the drug and placebo groups were 72.5 % and 62.5 % , respectively . but the difference was not significant . in the case of full - dose corticosteroids intake , no significant difference was observed as well ( p = 0.36 ) . in the case of all the people who were followed during the study , the average delivery times in the drug and placebo groups were 20.64.2 and 16.33.9 days , respectively ( p = 0.45 ) . the average delivery times in patients who delivered during the hospitalization were 314.4 and 18.32.2 hr in the drug and placebo groups , respectively ( p = 0.01 ) . this delayed time was significant as compared to placebo and it seems that tocolysis is efficient . because it is in the appropriate range of time , it results in the effectiveness of corticosteroid . smith 's trial also shows that gtn can reduce neonatal morbidity and mortality as a result of decreasing the risk of birth before 28 weeks ( 3 , 6 ) . the average prolongation of the pregnancy in the gtn group ranged from 9.5 days in the study conducted by bisits on prom and fibronectin - positive women ( 1 ) to 20.9 days ( 3 ) , 34 days ( 10 ) and 42 days ( 15 ) in studies where their inclusion criterion was uterine contractions . the observed difference is partly due to methodological differences and the inclusion criteria of patients in these studies . in a study by smith which was a fully controlled trial with the same methodology as the present study , despite the same pregnancy duration in the drug group ( 20.9 ) , the observed difference inthis significant difference was due to shorter interval of the admission to delivery in the placebo group ( 3 ) . in other controlled studies , no significant difference was observed in the prolongation of pregnancy between the gtn and placebo or betamimetics groups ( 10 , 12 , 15 ) . following a review of 5 clinical studies involving 466 women , the cochrane database concluded that the nitric oxide donors do not cause delayed delivery compared with placebo and other tocolysis . there is not enough evidence to show that whether nitric oxide can reduce preterm labor or not ( 16 , 17 ) . despite the benefits to the fetus , the use of any tocolytic agents is associated with risks for the mother and fetus . the complications are completely known in the case of magnesium sulfate , indomethacin , calcium channel blocking agents ( 1 , 2 ) and betamimetics ( 1 , 2 , 9 , 14 ) . however in most studies , these drugs did not improve the neonatal outcomes ( 2 ) . the most common complication was headache in 14 patients ( 35 % ) ( p = 0.007 ) . other complications including heart palpitation , nausea and skin irritation did not differ from placebo . vomiting , dizziness or the need for treatment termination were not observed . in the smith 's study , the most common complication was headache in 42 patients in the drug group ( p = 0.001 ) . in the case of local irritation , a significant difference was observed ( p = 0.04 ) ( 3 ) . in the study conducted by leszcynska , a transient headache was observed in 36.67 % of cases and there were no other complications ( like this study ) ( 5 ) . in bisits 's study , women who received gtn suffered from headache to a higher extent ( p 0.001 ) ( 14 ) . in the study conducted by perveen , other complications included local irritation ( 24 % ) , hypotension ( 8 % ) and flushing ( 4 % ) , respectively . fetal complications were not observed ( 7 ) . in the study conducted by rai , it was shown that the most common complication was headache ( 18 % ) and other complications were tachycardia ( 13.7 % ) , nausea ( 0.05 ) , hypotension ( 0.03 % ) and local irritation ( 0.017 % ) , respectively ( 9 ) . in a descriptive study conducted by lees , the headache occurred in 1/3 of patients ( 10 ) . in cochrane database , in a review on 5 clinical studies , the most common complication was headache ( 16 , 17 ) . the reduction of systolic blood pressure and mean arterial blood pressure and the increase of maternal heart rate have been observed previously and their differences were significant before using the gtn . however , hypotension and problematic tachycardia were not observed in the present study . in the similar studiesconsistent with the present study , although the reduction of systolic blood pressure and mean arterial blood pressure was observed , it was rarely in the range for an intervention . this is probably due to the dose , method of administration and fluid therapy that have been done before treatment ( 3 , 5 , 6 , 8 , 15 ) . human doppler studies have shown that gtn has no effect on placental uterine blood flow ( 5 , 8 ) . in the present study , the results of the present study showed that there was no significant difference between gtn and placebo groups in terms of non - delivery within the first 48 hr of admission and full dose corticosteroid intake . but the average delivery time after admission in the gtn group was longer than placebo group . this time interval is worthwhile regarding the injection and effectiveness of corticosteroids . in this study , this can be effective in the improvement of neonatal outcomes , especially in the case of very premature infants that their outcome depends on the effectiveness of corticosteroid intake . the effect of glyceryl trinitrate in the treatment of preterm labor is similar to the placebo without any serious complication . however , in delivery during the primary hospitalization , glyceryl trinitrate delays the delivery time . thus , further studies with larger sample size are needed to evaluate the exact effects of glyceryl trinitrate on preterm labor . this work was performed in partial fulfillment of the requirements for ph.d . , of parnian kord jam - shidi .\noutput:\n" }, { "from": "agent", "value": "backgroundpreterm labor ( ptl ) is one of the main causes of neonatal mortality and morbidity . ptl leads to serious complications especially in the gestational age prior to 24 - 26 weeks . the aim of this study was to investigate the effect of glyceryl trinitrate ( gtn ) patch on the treatment and complications of ptl.methodsin this clinical trial , 84 singleton pregnant women with gestational age of 27 - 35 weeks were surveyed . ptl was clinically diagnosed and the patients were randomly divided into two groups who were treated with gtn or placebo for 48 hr . the consequences , complications and changes in some parameters in both groups were compared . data were analyzed with chi square test , paired and unpaired t tests by spss software and p < 0.05 was considered significant.resultsno significant difference was observed between two groups in terms of successful tocolysis , receiving full dose of corticosteroids and the mean prolongation of the pregnancy . however , delivery times in patients who delivered during the hospitalization were 314.4 and 18.32.2 hr ( p = 0.01 ) , respectively . headache was more severe in control group ( p = 0.007 ) . the systolic and mean arterial blood pressure decrease ( p < 0.001 ) and maternal heart rate increase ( p = 0.01 ) were significant in gtn group . the changes of vital signs were not significant in placebo group.conclusionthe effect of gtn in the treatment of ptl is similar to the placebo without any serious complication . however , gtn delays the delivery time in delivery during the primary hospitalization . thus , further studies with larger sample size are needed to evaluate the exact effects of gtn on ptl ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: salmonella enterica ( 56 isolates ) and escherichia coli ( 24 isolates ) were selected from the hpa collection based on their resistance to amikacin ( breakpoint concentration routinely used in hpa salmonella reference unit = 4 g / ml ) . because 16s rrnamethyltransferases confer high - level resistance to amikacin , 13 s. enterica isolates were selected on the basis of ability to grow on isosensitest agar containing 500 g / ml amikacin , whereas none of the e. coli isolates grew under these conditions . further antimicrobial susceptibility testing by microdilution by using dehydrated sensititer plates following the clsi guidelines confirmed high - level resistance to 4,6 - disubstituted 2 - deoxystreptamines ( table 1 ) . pcr screening of the 13 isolates for arma , rmta , rmtb , rmtc , and rmtd ( 8 ) identified rmtc . nucleotide sequencing of the amplicons confirmed an rmtc gene with 100 % identity with those originally identified in proteus mirabilis strain ars68 isolated from an inpatient in japan ( 6 ) and p. mirabilis strain jie273 from australia ( 7 ) . to our knowledge , this is the third report of rmtc - bearing bacteria . isolates resistant to neomycin bore the aac ( 6 ) - ib gene cassette , whereas the dfra1 gene was responsible for resistance to trimethoprim . gen , gentamicin ; kan , kanamycin ; amk , amikacin ; tob , tobramycin ; arb , arbekacin ; neo , neomycin ; tmp , trimethoprim ; cpx , ciprofloxacin ; amp , ampicillin ; nd , not determined . twelve of the 13 s. enterica strains were originally isolated over a 4 - year period from patients with clinical infection ; 1 strain was obtained from frozen produce . seven of 12 strains were obtained from patients with histories of foreign travel ; 4 of the 7 patients had reported recent travel to india ( table 2 ) . p. mirabilis strain jie273 was also isolated from a patient who had recently returned from india ( 7 ) . investigations to ascertain the presence of rmtc genes in india are under way . to identify a possible link between the isolates , chromosomal dna was embedded in agarose plugs prepared according to the pulsed - field gel electrophoresis ( pfge ) protocol of pulsenet europe ( 10 ) . pfge patterns showed only 12 - band differences ( figure 1 ) and correlated with phage typing data ( table 1 ) . all clinical isolates were recovered from feces , except a blood isolate recovered from a patient with invasive salmonellosis ( table 2 ) . the temporal and geographic distribution of the isolates suggested independent acquisition of infections in most cases and possibly epidemiologically linked cases , e.g. , strains 9 and 10 ( table 2 ; figure 2 ) . pulsed - field gel electrophoresis patterns of rmtc - positive salmonella enterica serovar virchow isolates . lanes : b , s. braenderup h9812 size standard ; 1 , h051640340 ; 2 , h053660426 ; 3 , h060180151 ; 4 , h061360322 ; 5 , h063980463 ; 6 , h070780136 ; 7 , h073100210 ; 8 , h074680335 ; 9 , h074740467 ; 10 , h074960137 ; 11 , h075120259 ; 12 , h083540857 ; and 13 , h085120713 . map of united kingdom showing geographic location of the 13 salmonella enterica serovar virchow isolates bearing rmtc . each number represents 1 isolate in chronologic order of isolation as shown in table 2 . pcr with primers isecp1r - f and rmtc - down ( 7 ) showed that the rmtc gene and immediate upstream sequences ( genbank accession nos . fj984623fj984634 for human isolates and gq131574 for the food isolate ) were identical to those previously identified in p. mirabilis ( 6,7 ) , in which isecp1 has been shown to play a role in the expression and transposition of the rmtc gene ( 11 ) . however , the complete isecp1 element could not be amplified by using primers isecp15 and isecp1 reverse , which suggests either partial deletion of this element or involvement of a different isecp1 - like element in spread of rmtc in salmonella ( 6,12 ) . attempts to isolate rmtc by conjugal transfer to rifampin - resistant e. coli 20r764 were unsuccessful , as was electroporation into e. coli lmg194 and electromax dh10b cells ( both invitrogen , paisley , uk ) by using plasmid preparations . an 100 - kb rmtc - bearing plasmid was previously transferred from p. mirabilis ars68 by electroporation but could not be mobilized by conjugation ( 6 ) , and attempts to transfer the rmtc plasmid from p. mirabilis jie273 by electroporation and conjugation failed ( 7 ) . this finding contrasts with some qualities of the other methyltransferases , such as arma and rmtb , which are mostly located on conjugative plasmids ( 8,13 ) . the location of the rmtc gene was determined with pfge by using i - ceui nuclease treatment . agarose plugs were digested with 9.5 u i - ceui nuclease ( new england biolabs , beverly , ma , usa ) . separated dna fragments were transferred onto a nylon membrane ( ge healthcare , madrid , spain ) and hybridized with 16s rdna and rmtc probes labeled with dig -11-dutp . hybridization , labeling , and detection were performed according to the manufacturer s recommendations ( roche applied science , mannheim , germany ) . a dna band hybridized with both probes , showing that the rmtc gene was located on the chromosome . results of hybridization of plasmid extractions ( plasmid midi kit ; qiagen , inc . , chatworth , ca , usa ) with the rmtc probe were negative ( data not shown ) . we describe the occurrence of 16s rrna methyltransferase rmtc in salmonella isolates and the rmtc gene in europe . the overall isolation frequency of 16s rrna methyltransferase producing s. enterica is low ( 13/81 ,632 strains ) in the united kingdom , and these genes were absent in e. coli . however , spread of multidrug - resistant isolates that express 16s rrna methyltransferases , amplified by the association of these genes with the isecp1 element , raises clinical concern that further spread is likely . ongoing surveillance of 16s rrna methyltransferases in isolates found in food products and in humans and animals is crucial to delay the spread of resistance to these classes of antimicrobial agents . virchow isolate bearing the rmtc gene isolated from a child with a history of travel to india was reported in the united states ( 14 ) .\noutput:\n" }, { "from": "agent", "value": "we screened salmonella and escherichia coli isolates , collected 20042008 in the united kingdom , for 16s rrna methyltransferases . rmtc was identified in s. enterica serovar virchow isolates from clinical samples and food . all isolates were clonally related and bore the rmtc gene on the bacterial chromosome . surveillance for and research on these resistance determinants are essential ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: hypertension is more severe and associated with more severe sequelae in blacks when compared with subjects of caucasian extraction . studies have also shown that black subjects have lower plasma renin levels . it is thought that black subjects have inappropriately elevated levels of aldosterone relative to plasma renin activity . the activity of the renin - angiotensin - aldosterone system ( raas ) is thought to be the major contributor to the pathogenesis of hypertension and its sequelae . studies have shown that circulating aldosterone levels within the physiologic range are strongly related to increased risk of cardiovascular mortality , fatal stroke , and sudden cardiac death . it has also been shown that chronic administration of aldosterone in animal models leads to cardiac fibrosis and left ventricular hypertrophy ( lvh ) . subjects with primary aldosteronism have early and more severe development of lvh when compared with subjects with essential hypertension . though previous studies , on predominantly white subjects , had not been conclusive on the relationship between left ventricular mass and aldosterone , very few of these studies have been done on black subjects . this study therefore attempts to determine the relationship between aldosterone levels and left ventricular mass in black subjects with essential hypertension . subjects were newly diagnosed but untreated hypertensive subjects recruited from the clinics of the university college hospital , ibadan ; through community screening exercises ; and from among the staff of the university college hospital , ibadan . subjects with secondary hypertension , diabetes mellitus , symptomatic heart failure , and chronic kidney disease were excluded . informed consent was obtained from each subject , and ethical approval was obtained from the joint institutional review board ( irb ) of the college of medicine , university of ibadan / university college hospital , ibadan , nigeria . no caffeine - containing beverages , alcohol , or smoking was allowed for at least 2 h. subjects were not on any medications prior to sample collection . blood was collected into test tubes on ice after 30 minutes of rest in the supine position . a 24 h collection of urine was made the preceding day in plastic containers containing hcl ( 80 mmol / l final concentration ) . high - performance ( cation exchange ) liquid chromatography ( hplc ) was used to determine the plasma renin , plasma aldosterone . plasma and urinary sodium and potassium concentrations were measured using a flame photometric method . echocardiographic examination was done using a phillip aloka ssd 4000 ( aloka co. ltd . , tokyo , japan ) machine with a 2.55.0 mhz linear array transducer . two experienced physicians performed the echocardiography . in our laboratory , the intraobserver concordance correlation coefficient ranged from 0.76 to 0.98 while that of the interobserver concordance ranged from 0.82 to 0.96 . measurements of lv internal diameter ( lvidd ) , intraventricular septal thickness ( ivstd ) , and posterior wall thickness ( pwtd ) were obtained at end diastole . lv mass ( lvm ) was calculated using the formula published by devereux et al . : 0.8 ( 1.04 ( ( lvidd + pwtd + ivstd ) 3 lvidd3 ) ) + 0.6 , and lvm was indexed to the allometric power of height . relative wall thickness ( rwt ) was measured at end diastole as the ratio 2 ( pwt ) / lvid . data from continuous variables are presented as mean ( standard deviation ) or as medians with interquartile ranges while categoric data are expressed as percentages . all statistical tests were two - sided and carried out to a significance level ( p ) of 0.05 . student 's t - test for independent groups was used to compare normal continuous data while mann - whitney 's test was used to compare nonnormal data . tertiles of plasma aldosterone were generated and the aldosterone groups were compared with analysis of variance for continuous data , and test was used for categoric data . pearson correlation analysis was used to determine the correlation between plasma aldosterone and arr and the echocardiographic variables of lv structure . a stepwise linear regression model ( with backward elimination ) table 2 shows the biochemical , hormonal , and echocardiographic parameters of the subjects . plasma sodium and renin were lower in the hypertensive subjects . the left atrial , lv wall dimensions , and lv mass were higher in the hypertensives . the hypertensive subjects frequently had more hypertrophic lv geometric patterns when compared with the normal subjects . there were no differences in the plasma aldosterone levels and the urinary excretion of sodium and potassium . table 3 shows the biochemical , hormonal , and echocardiographic parameters of the subjects according to plasma aldosterone tertiles . there was no univariate association between the parameters of lv structure and the plasma aldosterone and aldosterone - to - renin ratio levels ( table 4 ) . in a multivariate model involving lv mass index and age , sex , body mass index ( bmi ) , aldosterone , plasma renin , pulse pressure , and systolic blood pressure ( sbp ) , only age ( p = 0.008 ) , bmi ( p = 0.046 ) , and systolic blood pressure ( p = 0.001 ) were independently associated with the lv mass index ( r = 0.15 , p 0.0001 ) . in this group of black african subjects , there was no association of plasma aldosterone with lv mass . also , no gender - specific differences in the relationship of lv mass index with plasma aldosterone were seen . only the age of the subjects , their body mass index , and the level of their blood pressure were associated with lv mass . previous studies on the association between lv mass and circulating aldosterone levels in subjects with essential hypertension had yielded conflicting results . . found no association between aldosterone levels and lv structure in hypertensive caucasians and nonobese black americans , and vasan et al . found no relationship between lv mass and serum aldosterone in the framingham cohort . other studies had noted associations between lv mass and blood aldosterone levels . these conflicting results could be due to differences in the study populations , that is , presence of other comorbidities such as diabetes mellitus , long - standing hypertension , differences in dietary salt intake , and the role of drugs that could alter the renin - angiotensin - aldosterone system . our study subjects were newly diagnosed and treatment - naive hypertensives ; subjects with elevated blood sugar and diabetes mellitus were excluded and were african subjects living in tropical environment . it is quite probable that significant racial differences exist in the relationship between aldosterone levels and lv mass . had documented a significant association between plasma aldosterone levels and lv posterior wall thickness and relative wall thickness but no relationship between lv mass index and aldosterone in women , while edelmann et al . reported a robust and consistent association between echocardiographic parameters of lv structure and serum aldosterone concentration exclusively in women . these gender differences had been thought to be due to differences in adaptation to pressure overload due to oestrogen signalling in the myocardium . in contrast to these studies , we did not find any gender related differences in the association of lv mass and plasma aldosterone levels . it is also probable that envirnomental and dietary factors play a significant role in the modulation of the effects of the renin - angiotensin - aldosterone system in native black africans . the influence of body mass index on lv mass had been noted in previous studies . mul et al . in their study among subjects with metabolic syndrome suggested that obesity might play a role in the association of lv mass with aldosterone levels . the influence of the level of the blood pressure especially systolic blood pressure on lv mass index had been previously described in several studies . this is supported by the findings from this study that shows the independent association of systolic blood pressure with lv mass index . the influence of systolic blood pressure on the development of left ventricular hypertrophy is thought to be a result of an increased end - systolic stress which is mostly related to the systolic blood pressure . this supports observations from previous studies that target organ damage in hypertension increases progressively with age . though our patients were newly diagnosed with hypertension , many of the subjects could have had longstanding but undiagnosed hypertension . working in south - west nigeria found that about 42 % of their subjects already had left ventricular hypertrophy at diagnosis of their hypertension . our study is limited in that only a single measurement of aldosterone was made and might be insufficient in estimating the daily exposure to aldosterone . the determination of 24 hr urinary aldosterone is better suited for the assessment of daily aldosterone load . in conclusion , in our group of black newly diagnosed hypertensive subjects , we did not find an independent association of lv mass index with plasma aldosterone concentration . further studies relating the 24 hr aldosterone load might be necessary to fully evaluate the association of aldosterone and measures of lv structure .\noutput:\n" }, { "from": "agent", "value": "background . hypertension is the most common cardiovascular disease worldwide and is a major cause of morbidity and mortality . studies have suggested that the activity of the renin - angiotensin - aldosterone system play a major role in the target organ damage such as left ventricular hypertrophy occuring in hypertension . we sought to determine the relationship between plasma aldosterone and left ventricular mass in untreated african hypertensives . methods . we recruited 82 newly diagnosed and untreated hypertensives and 51 normal controls . measurements obtained included echocardiographic lv mass index , plasma aldosterone and renin . results . the hypertensive subjects had lower renin levels ( 21.03 [ 6.974 ] versus 26.66 [ 7.592 ] ng.ml1 , p = 0.0013 ) , higher lv mass index ( 52.56 [ 14.483 ] versus 42.02 [ 8.315 ] g.m2 .7 p < 0.0001 ) when compared with the controls . there were no univariate associations between lv mass index and plasma aldosterone ( r = 0.0179 , p = 0.57 ) and between lv mass index and plasma renin ( r = 0.0887 , p = 0.61 ) . in a multivariate model involving lv mass index and age , sex , body mass index ( bmi ) , plasma aldosterone , plasma renin and systolic blood pressure ( sbp ) , only age ( p = 0.008 ) , bmi ( p = 0.046 ) , and sbp ( p = 0.001 ) were independently associated with the lv mass index . conclusions . in this group of hypertensive africans , there is no independent association of plasma aldosterone with lv mass . the height of the blood pressure , the body mass index and the age of the subjects determined the lv mass ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: bile complication after liver transplantation is one of the most important factors in transplant failure , such as anastomotic biliary stricture ( abs ) . the rate of non - anastomotic biliary stricture ( nabs , also called ischemic biliary stricture ) is as high as 9.60 % . there are many reasons leading to nabs , such as thrombus , infection , rejection , vascular variation , etc . meanwhile , it is still unclear about the physiological function , arterial supply and venous return of the liver . there is significant clinical liver transplantation data in liver transplantation center , beijing youan hospital affiliated to capital medical university , demonstrating that reserving the initial part of the gastroduodenal artery in the donor liver reduces the incidence of nabs after liver transplantation . however , the mechanism is not clear . in order to clarify the relationship between the blood supply of the extrahepatic bile duct system and gastroduodenal artery branch , selective hepatic artery angiography and a vascular casting techniquewere used to observe the gastroduodenal artery and its biliary supply branches , and the blood supply of the extrahepatic bile duct system , especially the microcirculatory distribution . the data about the microcirculatory distribution was collected , from which the anatomical basis for nabs was surveyed . the goal was to clarify the correlation between the blood supply of extrahepatic bile duct system and biliary complication , and to provide more evidence for reserving the initial part of gastroduodenal artery in the donor liver when preparing the donor liver . from january 1996 to november 2005 , imaging findings of 600 patients were obtained from beijing chaoyang and beijing youan hospitals , capital medical university , china . these patients ( 420 men and 180 women aged from 18 to 80 years old ) underwent selective hepatic angiography at department of invasive technology . the study protocol was approved by the institutional review board of capital medical university , and written informed consent was signed by all patients before starting the selective hepatic angiography . these authors assessed the existence of the gastroduodenal artery and its branching to the bile duct . thirty - three adult cadavers ( 29 men and 4 women , age from 40 to 80 years old ) with no hepatobiliary diseases were obtained from the department of anatomy , basic medical school , capital medical university , beijing , china . after ligation of the splenic artery and left gastric artery , the cadavers were injected with red synthetic latex via the common hepatic artery , and dissected 7 days later . the extrahepatic bile duct and the branches from the common hepatic artery were carefully dissected to visualize the gastroduodenal artery and its branching to the extrahepatic bile duct . summary of imaging findings in 49 patients type i : the gastroduodenal artery predominantly ; type ii : the gastroduodenal artery and the proper hepatic artery equally ; type iii : the proper hepatic artery predominantly ; bdst : bile duct supply type ; tt : trunk type ; bt : branching type ; btt : both the trunk types ; bbt : both branching types . according to imaging findings , the supply branches were divided into the trunk type ( the branch was thicker , larger blood vessels ) and branching type ( delicate vascular network ) . the selective hepatic angiographic findings showed that in 49 of the 600 patients ( 8.10 % ) , the branch to the bile duct from the gastroduodenal artery was observed originating within approximately 3 cm of the proximal point , and went upward to the hepatic portal in the hepatoduodenal ligament . in these 49 patients , three types of arterial supply to the extrahepatic bile ductwere observed : the gastroduodenal artery predominantly ( type i ) , the gastroduodenal artery and the proper hepatic artery equally ( type ii ) , and the proper hepatic artery predominantly ( type iii ) . type i was observed in 30 of the 49 patients ( 61.22 % ) . in 26 of these 30 patients , the bile duct branch from gastroduodenal artery showed the trunk type [ figure 1a ] , and the bile duct branch from proper hepatic artery showed the branching type in 26 patients . in the remaining 4 patients , images showed the ca ( black arrow ) , the ga ( blue arrow ) , the ga supply branch duct type ( red arrow ) , the pha ( white arrow ) , and the pha bile duct supply branch ( pink arrow ) . ( a ) ga bile duct supply branch showed the trunk type and ran upward . ( b ) both ga and pha bile duct supply branch showed the trunk type , and formed an arterial circle . ca : cystic artery ; ga : gastroduodenal artery ; pha : proper hepatic artery . type ii was evident in 12 of 49 patients ( 24.49 % ) . among these 12 patients , both bile duct branches from the gastroduodenal artery andthe proper hepatic artery showed the trunk type in 10 patients ( 20.41 % ) [ figure 1b ] , which included typical double trunk type ( from the gastroduodenal artery and the proper hepatic artery ) in 8 patients , the right hepatic artery in 1 patient and cystic artery in 1 patient . in the remaining 2 patients ( 4.08 % ) type iii was present in the remaining 7 patients ( 14.29 % ) , which included the proper hepatic artery predominantly in 6 patients and the right hepatic artery in 1 patient . the bile duct supply branches , from the proper hepatic artery ( the trunk type ) and from the gastroduodenal artery ( the branch type ) , showed an anastomotic network [ figure 1d ] . in all 33 specimen casts , the blood supply of extrahepatic bile duct was mainly obtained from the gastroduodenal artery , the proper hepatic artery , the right hepatic artery , the cystic artery and the posterior portal vein artery . the bile duct branch from gastroduodenal artery was present in 9 specimens [ 27.27 % , figure 2a ] . the blood supply to the superior and inferior parts of the extrahepatic bile ducts were from two groups of arteries , and the blood supply to the middle part was from another artery in some specimens . according to the origin of the blood supply , the blood supply to bile duct was divided into three types : ( 1 ) the cystic artery ( or the right gastric artery ) gastroduodenal artery type , ( 2 ) the cystic artery proper hepatic artery type , and ( 3 ) the posterior portal vein artery proper hepatic artery type . the superior part of the extrahepatic bile duct was mainly supplied by the branches of the cystic artery , the proper hepatic artery and the right gastric artery . the blood supply to the inferior part was mainly from the gastroduodenal artery and the lower branches of the proper hepatic artery . in the middle part , the blood supply could be from the posterior portal vein artery and the branches of the proper hepatic artery , or from the anastomotic branches of the upper and lower artery branches . ( a ) bile duct branch from ga showed the trunk type ( white arrow ) . ( b ) the arterial branches from the upper and lower origination formed a longitudinal anastomotic chain ( red color ) . the arteries ran closely along the longitudinal surface of the extrahepatic bile duct . in the upper part , the cystic artery , the proper hepatic artery and the right gastric artery formed an arterial network , which ran downward . in the lower part , the branches from the gastroduodenal artery and the lower branches of the proper hepatic artery traveled upward along the surface of the extrahepatic bile duct . in the middle part , the arterial branches from the upper and lower origins formed a longitudinal anastomotic chain [ figure 2b ] , in 23 of 33 specimens ( 69.70 % ) . in 6 of 33 specimens ( 18.18 % ) , the arterial branches from the proper hepatic artery and the posterior portal vein artery ran transversely . in 4 specimens ( 12.12 % ) , the arterial branch to the middle part was absent [ figure 2c ] . a summary of blood supply of the middle part of the extrahepatic bile duct in 33 specimens were shown in table 2 . summary of the blood supply in the middle part of the extrahepatic bile duct in 33 specimens ca : cystic artery ; pha : proper hepatic artery ; rga : right gastric artery ; ga : gastroduodenal artery ; ppva : posterior portal vein artery . summary of imaging findings in 49 patients type i : the gastroduodenal artery predominantly ; type ii : the gastroduodenal artery and the proper hepatic artery equally ; type iii : the proper hepatic artery predominantly ; bdst : bile duct supply type ; tt : trunk type ; bt : branching type ; btt : both the trunk types ; bbt : both branching types . according to imaging findings , the supply branches were divided into the trunk type ( the branch was thicker , larger blood vessels ) and branching type ( delicate vascular network ) . the selective hepatic angiographic findings showed that in 49 of the 600 patients ( 8.10 % ) , the branch to the bile duct from the gastroduodenal artery was observed originating within approximately 3 cm of the proximal point , and went upward to the hepatic portal in the hepatoduodenal ligament . in these 49 patients , three types of arterial supply to the extrahepatic bile ductwere observed : the gastroduodenal artery predominantly ( type i ) , the gastroduodenal artery and the proper hepatic artery equally ( type ii ) , and the proper hepatic artery predominantly ( type iii ) . type i was observed in 30 of the 49 patients ( 61.22 % ) . in 26 of these 30 patients , the bile duct branch from gastroduodenal artery showed the trunk type [ figure 1a ] , and the bile duct branch from proper hepatic artery showed the branching type in 26 patients . in the remaining 4 patients , images showed the ca ( black arrow ) , the ga ( blue arrow ) , the ga supply branch duct type ( red arrow ) , the pha ( white arrow ) , and the pha bile duct supply branch ( pink arrow ) . ( a ) ga bile duct supply branch showed the trunk type and ran upward . ( b ) both ga and pha bile duct supply branch showed the trunk type , and formed an arterial circle . ca : cystic artery ; ga : gastroduodenal artery ; pha : proper hepatic artery . type ii was evident in 12 of 49 patients ( 24.49 % ) . among these 12 patients , both bile duct branches from the gastroduodenal artery andthe proper hepatic artery showed the trunk type in 10 patients ( 20.41 % ) [ figure 1b ] , which included typical double trunk type ( from the gastroduodenal artery and the proper hepatic artery ) in 8 patients , the right hepatic artery in 1 patient and cystic artery in 1 patient . in the remaining 2 patients ( 4.08 % ) type iii was present in the remaining 7 patients ( 14.29 % ) , which included the proper hepatic artery predominantly in 6 patients and the right hepatic artery in 1 patient . the bile duct supply branches , from the proper hepatic artery ( the trunk type ) and from the gastroduodenal artery ( the branch type ) , showed an anastomotic network [ figure 1d ] . in all 33 specimen casts , the blood supply of extrahepatic bile duct was mainly obtained from the gastroduodenal artery , the proper hepatic artery , the right hepatic artery , the cystic artery and the posterior portal vein artery . the bile duct branch from gastroduodenal artery was present in 9 specimens [ 27.27 % , figure 2a ] . the blood supply to the superior and inferior parts of the extrahepatic bile ducts were from two groups of arteries , and the blood supply to the middle part was from another artery in some specimens . according to the origin of the blood supply , the blood supply to bile duct was divided into three types : ( 1 ) the cystic artery ( or the right gastric artery ) gastroduodenal artery type , ( 2 ) the cystic artery proper hepatic artery type , and ( 3 ) the posterior portal vein artery proper hepatic artery type . the superior part of the extrahepatic bile duct was mainly supplied by the branches of the cystic artery , the proper hepatic artery and the right gastric artery . the blood supply to the inferior part was mainly from the gastroduodenal artery and the lower branches of the proper hepatic artery . in the middle part , the blood supply could be from the posterior portal vein artery and the branches of the proper hepatic artery , or from the anastomotic branches of the upper and lower artery branches . ( a ) bile duct branch from ga showed the trunk type ( white arrow ) . ( b ) the arterial branches from the upper and lower origination formed a longitudinal anastomotic chain ( red color ) . the arteries ran closely along the longitudinal surface of the extrahepatic bile duct . in the upper part , the cystic artery , the proper hepatic artery and the right gastric artery formed an arterial network , which ran downward . in the lower part , the branches from the gastroduodenal artery and the lower branches of the proper hepatic artery traveled upward along the surface of the extrahepatic bile duct . in the middle part , the arterial branches from the upper and lower origins formed a longitudinal anastomotic chain [ figure 2b ] , in 23 of 33 specimens ( 69.70 % ) . in 6 of 33 specimens ( 18.18 % ) , the arterial branches from the proper hepatic artery and the posterior portal vein artery ran transversely . in 4 specimens ( 12.12 % ) , the arterial branch to the middle part was absent [ figure 2c ] . a summary of blood supply of the middle part of the extrahepatic bile duct in 33 specimens were shown in table 2 . summary of the blood supply in the middle part of the extrahepatic bile duct in 33 specimens ca : cystic artery ; pha : proper hepatic artery ; rga : right gastric artery ; ga : gastroduodenal artery ; ppva : posterior portal vein artery . in 1960 , michels dissected 200 cadavers and classified hepatic arteries into 10 types according to the blood supply , and this classification was approved . based on 1000 hepatic operations , hiatt and his group simplified the hepatic arteries into 6 types in 1994 . the variation of hepatic arteries is reported to be 20 % - 45 % . at present , origins of the blood supply to the extrahepatic common bile ducts are still unclear . kobayashi et al . found that the inner layers of comparatively large bile ducts are made up of capillaries , which open at the inferior surface of the epithelial layer and distribute regularly , just like chains . interlobular ducts and small bile ducts are surrounded by a vascular plexus forming from irregularly distributing small round cavity - like capillary . for the blood supply of the extrahepatic bile ducts , the extrahepatic bile duct artery might be derived from the cystic artery , common hepatic artery , gastroduodenal artery , posterior portal vein artery , and arteria pancreaticoduodenal superior posterior . for the blood distribution to extrahepatic bile ducts , gunji et al . and cho et al . investigated the intersegmental arterial communication between the right and left hepatic artery , using acrylic acid cast and latex resin cast specimens , respectively . chen et al . had analyzed the relationship between the blood supply of bile duct and duct hemorrhage , forwarding an opinion that the hepatic porta , and intraduodenal portions of the bile duct are abundantly supplied by an arterial network or arterial circle , and are prone to bleed . while for the common bile duct , the blood supply is derived from a longitudinal anastomotic chain , and forms from the upper and lower group of arteries , and tends to be ischemia . however , there are quite a few reports on the bile duct supply branch from gastroduodenal artery . at the transplantation center of beijing youan hospital , capital medical university , clinical studies indicated that the incidence of non - anastomotic biliary stricture is decreased after retaining the first part of gastroduodenal artery of donor liver . the present arteriography data of the common hepatic artery and its branches indicated that in about 8.10 % ( 49/600 ) of people , the first part of the gastroduodenal artery separated into branches to supply the bile ducts . using a microvascular latex cast method , the results showed that 27.27 % ( 9/33 ) of people 's bile duct blood supply was separate from the first part of the gastroduodenal artery . this different incidence data may be due to a variety of imaging samples from patients with hepatobiliary disease ; some patients had been treated with hepatic artery embolizations , which resulted in the hepatic arteriography displaying a false negative ; in addition , our group obtained other clinical data which also showed a lower incidence of nabs by an improved operation method which retained the gastroduodenal artery . in the few years , the newly ct angiography has improved the accuracy of the imaging . it is suggested that the real incidence of bile duct branches from gastroduodenal artery in the clinical cases may be higher than the incidence determined by imaging results . in addition , the results of latex resin cast specimens provided new evidence about the blood supply and the distribution characteristics of micrangium . in this study , the extrahepatic bile duct was divided into three portions , among which the medium part 's blood supply was more complicated . we not only found a longitudinal anastomotic chain forming from the upper and lower group of arteries in this portion , but also found 18.18 % of all cases had laterigrade branches from the posterior portal vein artery and the proper hepatic artery . for the hepatic artery supplying the medium part , there were also 12.12 % of the segments existing in a significant ischemic zone . the anatomical variations could serve as an anatomical basis for non - anastomotic biliary stricture in some of the patients after liver transplantation . andany reason causing an artery branch cut - off could further aggravate the local ischemia . so the extrahepatic bile duct was prone to disturbance of the blood supply resulting from an arterial variation or destroyed vascular net . since the 1990s , with the progress of liver transplantation techniques and reduction of other complications such as rejection , non - anastomotic biliary stricture has attracted an increasing amount of attention by scholars from all over the world . except for some of the donor liver factors ( age , gender , fatty degeneration and preservation of donor liver , etc ) and surgical problem ( operative injury , ischemia - reperfusion , etc . ) , it is agreed that some arterial problems ( variation of hepatic artery , thrombogenesis , hepatic arterial stricture , hypoperfusion of small artery on the wall of bile ducts , etc . ) our experiment has clearly elaborated the micrangium on the wall of bile ducts and its travelling characteristic through latex resin cast specimens , further providing the anatomical basis for ischemic biliary complication , especially non - anastomotic stricture . as we know , the donor 's live bile duct blood supply from their own hepatic artery and branches is mainly from the hepatic artery and gastroduodenal artery . the liver transplantation connects to the hepatic artery ; however , many micro - arterial anastomosis of the blood supply chain is still unopened around the extrahepatic bile duct that is liable to cause ischemia of its local region . beijing youan hospital is one of the largest liver transplant centers in china . in the past 4 years , nearly 1000 in - patients with hepatocarcinoma and 300 liver transplant patients are hospitalized in beijing youan hospital every year . based on our study on liver transplantation practice , we highly recommended that it is necessary to reserve the initial segment of the gastroduodenal artery to avoid a poor blood supply , and we try our best to protect the vascular net around the extrahepatic bile ducts during liver surgery .\noutput:\n" }, { "from": "agent", "value": "background : liver transplantation has become the treatment of choice for patients with end - stage acute or chronic hepatic disease . bile duct complications are common events after liver transplantation . the aim of this study was to evaluate the blood supply of the human bile duct and identify the underlying mechanisms of bile duct complications after liver transplantation.methods : the duct supply branches from gastroduodenal artery and blood supply of extrahepatic bile duct system were re - evaluated through selective hepatic angiography from 600 patients . in addition , 33 cadavers were injected with latex casting material into the common hepatic artery , then the extrahepatic bile duct and the branches from the common hepatic artery were carefully dissected to visualize the gastroduodenal artery and its branching to the extrahepatic bile duct.results : the bile duct artery arose from the branch of the gastroduodenal artery in 8.1 % ( 49/600 ) . of these 49 individuals , the bile duct artery was supplied by the gastroduodenal artery ( 61.22 % , 30/49 ) , the proper hepatic artery ( 14.29 % , 7/49 ) , or both the gastroduodenal artery and the proper hepatic artery ( 24.49 % , 12/49 ) . in our study of 33 cadavers , the percentage that the bile duct artery arose from the gastroduodenal artery was 27.27 % . the blood supply to the bile extrahepatic bile ducts was divided into different segments and formed longitudinal and arterial network anastomosed on the walls of the duct.conclusions : there is a close relationship between the duct supply branches from gastroduodenal artery and the blood supplying patterns of the extrahepatic bile duct system . in liver transplant surgery , the initial part of the gastroduodenal artery is preferred to be preserved in the donor liver . it is of great significance to improve the success rate of operation and reduce complications ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: one might well think that ordinary commercial 0.9 % saline solution for infusion would be neutral , with a ph of 7 . in fact it is quite acidic : ph being reported as low as 4.6.1 why does this simple solution have a ph so far removed from the physiology it is designed to support ? and should junior doctors be concerned about what impact this in vitro acidity has on their patients ? it is widely recognized that resuscitation with 0.9 % saline can cause acidaemia , but oddly enough the natural assumption that this is because of the intrinsic acidity of the infusion fluid turns out to be wrong . as we shall see , and counter - intuitively , the metabolic acidosis caused when we infuse 0.9 % saline has little to do with its intrinsic acidity . there are basically three kinds of factors that affect the ph of a commercial saline solution : the atmosphere , the ions in solution , and the container . . however , in contact with the atmosphere , carbon dioxide is absorbed and the ph falls . co2 makes up approximately 0.036 % of the atmosphere , and its solubility coefficient s in water is approximately 0.034 mol.l.atm at 25c . henry 's law then tells us that the concentration of co2 is the product of s and pco2 , or about 0.012 mmol.l . of this dissolved co2bicarbonate further dissociates to carbonate , liberating a second hydrogen ion ( though the dissociation constant for this reaction in water , saline or dextrose solution is negligible - seven orders of magnitude lower than that of carbonic acid ) . unlike in plasma , the hydrogen and bicarbonate ions arising from dissolved carbon dioxide in water or saline exist at equal concentrations , so : from this , we can work out that the ph of water exposed to atmospheric pco2 should be approximately 5.65 ; this is indeed close to what we find for both water and 0.9 % saline solutions . all that is fine for pure water , but in saline solution some other factors need to be considered . co2 solubility depends on the lone electron pair on its oxygen atom attracting the positively charged face of a hydrogen atom of water ; but other electrolytes in the solution compete for the hydrogen , reducing the stability of the co2 in solution . as a result , secondly , the presence of electrolytes in the solution favours dissociation of h2co3 by stabilising the daughter ions , increasing the dissociation constant for carbonic acid ,2 and therefore the acidity . thirdly , positive and negative ions - na , cl , h and hco3 alike - cluster around one another in a thermodynamically favourable arrangement , imposing a structured charge distribution that affects the properties of the ions .3 the activities of the ions are then no longer proportional to their pure concentration : the activity of h in particular is significantly reduced in the presence of saline .4 to summarise , sodium chloride decreases the solubility of co2 , and reduces the activity of the hydrogen ions ; but it also increases the dissociation of carbonic acid . the net effect is a small reduction in ph ( by about 0.01 ) .1 in addition , chemists note that many cations in solution generate acid solutions in water . for example , al or fe are electrophilic , and attracted to the electron - rich oxygen atoms of surrounding water molecules . as the electron cloud around the oxygenis drawn towards the cation , these electrons relinquish their contribution to the o - h bond , allowing the hydrogen ion to drift off and lowering the ph . however , the low positive charge and relatively large atomic radius of the sodium ion limits its electronegativity ; the hydrated sodium ion attracts electrons too weakly to behave as an acid .5 finally , hydrogen ions do not exist freely in solution , but in a hydrated state as the oxonium ion h3o . the oxonium ion has been found to be remarkably nimble , being far more mobile than other , similarly sized ions . the reason is thought to be the ' grotthuss ' mechanism : rather than jostling to get past water molecules , a proton hops from one water molecule to another6 , rather as a pail of water can be swiftly passed along a chain of firefighters - a ' proton wire ' is an elegant analogy .7 the presence of electrolytes such as na and cl has a marked disordering effect on local water structure altering hydrogen ion conductance8 and it has been suggested in the medical literature that this could manifest a reduction in ph by interfering with the grotthuss mechanism .9 however , a theoretical basis for such an effect has not been developed and evidence that electrolytes actually alter the ph of a solution through the grotthuss mechanism is not established in the physical chemistry literature ( prof . pvc can liberate diethylhexyl phthalate ( dehp ) , a comprehensively studied and controversial ester that serves as a plasticizing agent .10 in addition , formic and acetic acid - decomposition products formed by oxidation during autoclaving11 - have been identified in pvc packaged fluids whilst sterilisation with gamma irradiation generates free radicals that may lead to the formation of hydrochloric acid .12 studies comparing ( i ) the theoretical ph of saline derived using the principles outlined above , ( ii ) the ph of saline prepared in the laboratory in the absence of pvc , and ( iii ) clinical grade saline from a widely used commercial source packaged in pvc based material revealed that whilst prepared samples had a very similar ph to that predicted ( median 5.47 ) , the median ph of the pvc packaged saline was 4.6 . interestingly , the ph of saline in polypropylene packaging was 5.71 , suggesting a particular property of pvc to be culpable .1 of interest , concerns that constituents and degradation products of pvc / dehp packaging might have endocrine disrupting effects have meant that polyethylene and polypropylene containers for intravenous solutions are increasingly favoured in their stead10 . in conclusion , most of the deviation from neutral ph can be attributed to the co2 dissolved in the saline , and this is true for any infusion solution . there may also be a significant contribution from the degradation products of pvc - packaging . interactions between saline and carbonic acid and the intrinsic lewis acidity of the sodium ion , whilst interesting to the enthusiast , are probably less important . infusion of 0.9 % saline solution is a common cause of normal anion gap metabolic acidaemia . on the face of it , one might assume this to be the logical consequence of infusing an acid solution , but the reality is more complex . although ph indicates the free acid activity of a solution - the abundance of h3o ions - it does not reflect the hydrogen ion reservoir associated with , or buffered by , weak acid anions . this can be measured by titration to ph 7.4 with sodium hydroxide , giving the titratable acidity . for 0.9 % saline solutionsthis is minuscule , ranging from 0.126 - 0.152 meq / l. 13 in other words , the buffering capacity of saline is negligible . blood , on the other hand , contains quantities of weak anions , such as bicarbonate or albumin which can associate with or liberate protons according to the prevailing [ h ] , effectively ' buffering ' the ph around the dissociation constant of that acid anion . since the high effective hydrogen ion activity of 0.9 % salineis not backed up by a significant reservoir of dissociable hydrogen ions to replenish those consumed , when mixed with the formidable buffering capacity of plasma , the infused solution is rapidly and comprehensively titrated to physiological ph . the answer lies again in buffering . whilst buffering limits the effect of adding free acid of low titratable acidity , what is less easily accommodated is interference with the buffer system itself . administration of a 0.9 % saline solution , containing no buffer base , dilutes the endogenous buffer systems in the plasma . in vivothe important co2 / hco3 buffer system is open : under normal physiological conditions [ co2 ] is independently regulated by the respiratory system ( this is why the co2 / hco3 buffer system is so effective , not being limited by accumulation or availability of h2co3 ) . hence , whilst the bicarbonate buffer base is diluted by saline infusion , the buffer acid , co2 , remains constant , unaffected by blood volume dilution - it is the unbalanced effect on the acid and base buffer partners that causes dilutional acidaemia . experimentally , acidification of a plasma - like solution ( containing an open co2 / hco3 buffer system and comparable weak acid activity ) by normal saline can be explained in terms of dilution of bicarbonate in a constant co2 environment14 ; the reduced plasma concentration of the basic bicarbonate anion tends towards acidaemia . the process can be described using a number of alternative approaches , including stewart 's strong ion difference ( sid ) model15 , 16 , however , it must be remembered that such mathematical descriptions do not imply mechanism . hartmann 's solution contains no buffer base , only strong electrolytes , with in vitro ph reported by the manufacturer as low as 5 . however , infusion is not complicated by acidaemia since the metabolism of lactate involves the regeneration of bicarbonate .16 infusing fluids of similar ph such as hartmann 's and normal saline has , therefore , quite different effects on plasma ph , again emphasising the insignificance of in vitro acidity . it is worth noting that although the plasma concentration of buffer base is about 42mmol / l , to keep plasma ph unchanged a balanced infusion solution must have a [ buffer base ] / ( sid ) of just 24mmol / l . this is because crystalloid infusion can bring about acid base changes in two ways : firstly by altering [ buffer base ] , and secondly by diluting weak acid . an infusion solution with buffer base 42mmol / l would maintain plasma [ buffer base ] but reduce plasma [ weak acid ] , favouring alkalaemia . a properly balanced solution must generate a fall in [ buffer base ] / sid which exactly counters the alkalaemia caused by weak acid dilution .17 all this goes to show how important it is to ground fluid therapy in robust appreciation of the underlying science . in vitro the salting out effect and the influence of electrolytes on carbonic acid dissociation and proton activityappear to be quantitatively negligible , whilst the reduction in ph associated with dissolved co2 and pvc degradation are the predominant sources of the acidity of infusion solutions . on the other hand , in vivo , the buffering capacity of plasma and low titratable acidity of saline solutions mean that the in vitro acidity is largely irrelevant . instead , the metabolic acidaemia engendered by saline infusion results from buffer base dilution and is not directly related to the ph of the infusion solution at all . for example , a recent prospective study has associated administration of chloride - rich fluid with poor renal outcomes17 . the chloride restrictive vs chloride liberal treatment strategies involved the administration of fluids varying not only in chloride content but also their in vitro ph and in vivo acidifying effect ( chloride restriction involved the use of more balanced solutions ) . in order to critically appraise the data from such studies , and propose a mechanistic basis , clinicians need to understand the chemistry of intravenous infusion fluids , specifically distinguishing the striking , but arguably unimportant in vitro acidity of these fluids from the numerically less arresting , but clinically more significant acidification they bring about through buffer base dilution in vivo . the mechanisms summarised here may help to inform the perpetually lively debate concerning the selection of infused solutions and how they challenge our patient 's homeostasis .\noutput:\n" }, { "from": "agent", "value": "commercial 0.9 % saline solution for infusion has a ph around 5.5 . there are many reasons for this acidity , some of them still obscure . it is also true that infusion of normal saline can lead to metabolic acidaemia , yet the link between the acidity of saline solution and the acidaemia it can engender is not straightforward . this commentary draws together the known and putative sources of acidity in saline solutions : it turns out that the acidity of saline solution is essentially unrelated to the acidaemia complicating saline infusion ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: helminths have developed a unique evolutionary dialogue with their hosts ' immune system due to their longevity within the host , their complex life cycles , and multicellular nature . these pathogens induce very different immune responses in comparison to bacteria , fungi , viruses , or protozoa . cells of the innate and adaptive immune system are important for the initiation of type 2 immunity , which characterises the response to helminth infection , as well as allergic reactions . the key players in t helper ( th ) 2 - type immunity are cd4 th2 cells and involve the cytokines interleukin ( il - ) 4 , il - 5 , il - 9 , il - 10 , and il - 13 and immunoglobulin ( ig ) e . cd4 th2 cells also express some of the cytokines mentioned above as well as the chemokine ligand ccl11 and the chemokine receptor ccr3 . these factors lead to recruitment and infiltration of eosinophils , basophils and mast cells , and expansion of alternatively activated macrophages . notably , th2 - type immune responses are composed of three major features : inflammation , wound repair , and , most importantly , resistance to helminths . parasites have developed various strategies to modulate the immune system and ultimately suppress host protective th2 - type immune responses for example , by induction of innate and adaptive regulatory cells , anti - inflammatory cytokines and specific inhibitory antibody isotypes ( reviewed by anthony et al . ) . hence , helminth parasites are master regulators of immune responses in order to ensure life - long persistence in the host . one strategy of immune regulation that has evolved is the secretion of a wide range of immunoregulatory molecules , which are able to target various host cells and alter them to induce a highly directed host response known as athis response is designed to limit a possibly detrimental th2 immune response , thus restraining the extreme symptoms that are often observed in allergy or in aspects of helminth diseases such as fibrosis in schistosoma mansoni . in immunological terms , the modified th2 response is defined by the development of specific antibody isotypes , including induction of igg4 accompanied by a decrease in ige , as well as il - 4 and il - 5 , while il - 10 levels from different regulatory cell sources increase . these mechanisms can lead to attenuation of pathology and clinical symptoms , tolerance , and ultimately persistence of the worm , which is associated with a hyporesponsive immune system . asymptomatic infection assures long - term survival of the parasite within the host and therefore sustains parasite feeding , completion of the life cycle , and successful reproduction . many studies of animal and human helminth infections have shown their potential for downregulating the immune system . moreover , relevant epidemiological studies have observed that helminth - infected populations exhibit lower levels of immunopathological diseases such as th1 - related autoimmune diseases or abberrant th2 - related diseases for example , asthma or allergic rhinitis . these observations indicate an inverse global distribution of allergy / autoimmune diseases and helminth infections , the first being an expanding problem of developed and industrialized countries , while the latter being a feature in developing countries . such findings support the hypothesis that the immune system has coevolved to operate in the presence of immunomodulatory helminth infections , while in the absence of exposure to helminths , the immunoregulatory components that would normally prevent allergy and autoimmune disease become weakened . here , we focus on recent advances in cellular mechanisms that are employed and modulated during helminth infections as well as on reports from field research and studies on animal models . these studies have identified helminths and helminth - derived products that play a role either in induction of th2 responses and immune modulation in parasitic infections ( reviewed in table 1 ) or in downregulation of bystander th2 - type immunopathologies like allergic asthma , allergic inflammation and airway hyperreactivity , food allergy , eczema , atopic dermatitis ( th1 / th2 ) , or anaphylaxis ( reviewed in table 2 ) . it has long been known that helminths induce a specific immune phenotype in the majority of persons that allows for establishment of infection while simultaneously preventing or reducing signs of disease in the host . antigen - specific cellular hyporesponsiveness was described for filarial infections more than 30 years ago by ottesen et al . studying a population in the cook islands endemic for lymphatic filariasis . in this studylymphocytes from adults infected with the filarial species wuchereria bancrofti showed significantly lower levels of proliferation in response to filarial antigen compared with endemic controls who were negative for all signs of infection or disease but constantly exposed to infection and , therefore , putatively consistently exposed to the antigens . later , another study from the same group made the distinction between microfilariae ( mf ) positive asymptomatically infected persons and mf negative patients showing clinical symptoms of filariasis ( e.g. , elephantiasis or hydrocoele ) . the resulting data suggested that the outcome of disease depends on the host response together with a mechanism of immune modulation induced by the parasite ( reviewed by ottesen ) . epidemiological studies of helminth - infected persons recognise distinct clinical outcomes that depend on immune regulation induced by the parasite in conjunction with the genetic background of the host ( reviewed by maizels and yazdanbakhsh ) . resistant individuals are constantly exposed to the parasite but show no signs of infection or disease ; this group develops an appropriate response , defined by equal proportions of th1 , th2 , and t regulatory ( treg ) cells with a balance of igg4 and ige levels . a second group develops a hyporesponsive phenotype characterised by asymptomatic infection , which tolerates the presence of fecund adult worms . this group has high levels of regulatory cells and il - 10 , leading to a modified th2 response . finally , a small proportion of patients develops a hyperresponsive phenotype ( characterised by an immunopathological response ) . in s. mansoni , w. bancrofti , and brugia malayi infections , the main pathological response is a result of overreactive t cell responses that cause inflammation and injure the host . this group exhibits increased ige responses , and the treg compartment is greatly diminished . in w. bancrofti and b. malayi infections , this can result in elephantiasis , whereby the lymphatic tissue becomes dilated and hypertrophic . parasite death leads to the release of antigenic material that causes lymphatic obstruction in the vessels and chronic inflammation . a second , rare result of these infections is tropical pulmonary eosinophilia characterised by chronic lung obstruction , peripheral blood eosinophilia , and extremely elevated levels of ige , greater than in elephantiasis . in onchocerca volvulus infectionthe rare chronic hyperreactive form , known as sowda , is also defined by high levels of ige . this is accompanied by strong th2 responses , including il - 4 , il - 5 , and il - 13 . thus a fine balance of different aspects of immunity is required to develop a response beneficial to the host . therefore , immune modulation acts in favour of persistent infection and continuous transmission while simultaneously enabling the host to tolerate infection by diminishing clinical symptoms . coinfection studies of helminths with other diseases provide supporting evidence that helminths have great ability to modulate immune responses , some aspects of which may then affect bystander infections . in fact , protective inflammatory immune responses that typically develop in bacterial or intracellular parasitic infections can be downregulated when a coinfecting helminth is present , resulting in increased susceptibility in the host to the former infection . for example , individuals coinfected with latent tuberculosis ( tb ) and w. bancrofti showed lower levels of tb - protective proinflammatory cytokines in vitro than tb patients without filarial infection . research focusing on individuals coinfected with multiple filarial species and plasmodium falciparum demonstrated a modulation of the antimalarial immune response by helminths that increased anti - inflammatory responses . after stimulation with malaria antigen , filarial - infected individuals demonstrated significantly lower levels of interferon ( ifn ) - , tumour necrosis factor ( tnf ) - and il - 17a , and higher levels of il - 10 from cd4 t cells compared with filarial - uninfected individuals . similarly , a study examining the effect of helminth infections on responses to oral cholera vaccine demonstrated that ascaris lumbricoides infection was associated with lower cholera antigen - specific il - 2 cytokine responses . these epidemiological studies demonstrate the ability of helminths to modulate immune responses to themselves as well as to concurring and unrelated infections . eradication of helminth infections in industrialised countries in the past 30 years has had a great impact on the prevalence of diseases associated with inappropriate immune responses . the observed increase in the appearance of allergy - related diseases might be a result of this and altered hygienic measures in everyday life . one possible explanation is the hygiene hypothesis , which includes a number of factors like improved public health , use of antibiotics and vaccines that in consequence reduce the occurrence of viral , bacterial or helminth infections early in life , contributing to higher numbers of individuals with allergic , and / or autoimmune disorders . there are numerous cohort studies determining allergic disease status and immune responses to parasite - specific antigens or environmental allergens of helminth - infected individuals in parasite - endemic areas ( reviewed by others ) . however , when interpreting this data it is important to take into consideration the time of first infection , duration and intensity of infection , helminth species , as well as host genetic and environmental factors . infections with trematodes , whipworms and hookworms were described to be negatively correlated with the allergen skin prick test . results from a study of gabonese school children tested for skin reaction to house dust mites ( hdms ) and other allergens , for schistosoma eggs in urine and microfilariae of loa loa and mansonella perstans in blood , showed lower prevalence of a positive skin test to hdms in children with urinary schistosomiasis . moreover , schistosome antigen - specific concentrations of il - 10 were significantly higher in infected children and concentrations of il - 10 were negatively associated with a positive skin test result . several population studies done in endemic areas of schistosoma infections in brazil and of ascaris , trichuris , and ancylostoma in ecuador revealed a strong inverse association between helminth infections and immediate skin test reactivity to common environmental aeroallergens . cooper et al . reported a negative association between very high levels of ige antibodies and allergen skin test reactivity . it is possible that anti - helminth - ige competes for the same high - affinity ige receptors targeted by allergen - specific ige . although other studies from africa reported on a reverse association between hookworm infections and sensitization to hdm dermatophagoides pteronissinus ( der p 1 ) , they did not show a significant association between skin test sensitivity to hdms , allergen - specific iges and between total serum ige levels and helminth - specific iges . the contribution of helminth infections to the inverse correlation with allergy - related diseases was demonstrated in studies with anthelminthic treatment . results from a randomized , controlled trial on the effect of repeated treatment with anthelminthics on a population of gabonese school children showed a significant increase in the rate of developing skin sensitivity to hdms . this was in part mediated by reductions of ascaris and / or trichuris infections , directly pointing to the importance of a presence of live worms to suppress allergic responses during infection and also preventing allergy later in life . lynch et al . also reported an effect of anthelminthic treatment on the allergic reactivity of children in the tropics in venezuela . the authors showed that the effective elimination of intestinal helminth infection resulted in significantly decreased total serum ige levels . however , immediate - hypersensitivity skin test reactivity and serum levels of specific ige antibody against common allergens were significantly increased in treated children . also other studies reported that anthelminthic treatments increase allergen skin reactivity to environmental allergens . rodrigues et al . reported that brazilian children with heavy infection in early childhood with trichuris trichiura had a lower prevalence of allergen skin test reactivity to a wide spectrum of common environmental allergens ( hdms , blomia tropicalis , fungi , animal , and cockroach allergens ) later in childhood , even when the helminth infection was no longer present . additionally , a population study in taiwan showed that schoolchildren bearing pinworm enterobius were diagnosed with lower prevalence of asthma and allergic rhinitis ; moreover , these children had reported an infection of pinworms early on in life . thus , early exposures and infections with helminths may have a protective effect and suppress allergic inflammation later during life . additionally , host genetic factors may play a role in prevalence of helminth infections and allergies . notably variants of genes involved in th2 immune responses like il13 or stat6 were associated with increased risk of asthma and allergy . studies among african - americans shed a light on the limited understanding we have on asthma genetics . polymorphisms in candidate genes associated with asthma showed higher frequency among certain ethnic backgrounds that developed strong th2 immune responses . thus , genes , which in the evolution of the immune system were initially responsible for induction of th2 - type immune responses and for parasite expulsion , now cause problems with allergy - related diseases when living in sterile and modern societies . in contrast to population studies reporting a negative correlation between allergy and helminth infections as discussed above , various studies from south america , europe , and asia on a. lumbricoides infections and allergy reported increased rather than decreased prevalence of asthma . for example , two cross - sectional surveys among schoolchildren in former east germany revealed that children with low doses of helminthic antigens ( low worm burden ) but ascaris - ige seropositivity had higher levels of total ige and higher prevalence of allergic rhinitis and asthma to inhalant allergens . it was proposed that heavy parasitic infections might generate immune suppressive mechanisms , whereas mild worm exposure and low - level contact with helminths may enhance reactivity to environmental allergens or even potentiate the th2 immune response that in some cases may promote allergic inflammation . as ascaris infection has been well - documented as a risk factor for asthma ( described elsewhere ) , there are two main hypotheses why ascaris promotes allergic reactions . the first relates to the specific pulmonary phase in the ascaris life cycle that causes inflammation and eosinophilia , which results in ige - mediated asthma with high total - and specific - ige titres against larvae and adult worms . the second hypothesis of increased allergy in ascaris infection is explained by cross - reactivity of ascaris - specific molecules with environmental allergens like hdms or the storage mites b. tropicalis that induce allergen - specific iges leading to strong th2 - type responses and therefore contributing to overall pathogenesis . moreover , ascaris - tropomyosin , a pan allergen , induced wheal and flare in skin prick tests and histamine release from basophils of asthmatics and nonasthmatics . these results suggest that ascaris - tropomyosin in some allergic individuals potentiates the pathogenesis of asthma and other allergic diseases . interestingly , the promotion of atopy can also be observed in parasitic infections where the human is not the definitive host and , therefore , chronic infection is not established , for example , toxocara spp . . in addition , the nematode anisakis simplex , regularly infecting marine mammals as definitive hosts but accidentally also leading to gastrointestinal ( gi ) infections in humans , who ingest raw fish , was described to cause allergic reactions . allergy to a. simplex is being recognised as an occupational disease with a wide spectrum of allergic reactions ( rhinitis , asthma urticaria , allergic contact dermatitis , and anaphylactic shock ) . as both parasites cause accidental and infrequent infections , in case of infection the immune system may be exposed to th2 - inducing events rather than to immunomodulatory mechanisms that occur in chronic infections . it is important to keep in mind that variations in epidemiological studies may have many confounding factors like types of parasitic infections , intensity and timing of the infection , other coinfections , first exposure to allergen as compared to parasitic infection , types of allergens , nutritional status of the patients , medication received , and genetic background . current research has focused particularly on identifying the cells targeted by parasitic immune modulation , and the exact helminth - derived molecules responsible for this . immune modulation by the parasite occurs through production of specific parasite - derived molecules that target mammalian host immune cells and signaling pathways . during infectionthis is strictly dependent on live parasites as shown by the recovery of cellular hyporesponsiveness in patients treated with anthelminthic chemotherapy . in addition , a study by da ' dara and harn demonstrated that killing of schistosome parasites could reinstate immune responses to a bystander vaccine targeting human immunodeficiency virus - 1 , which were greatly diminished in the presence of the parasite . similarly , another study demonstrated that prior elimination of intestinal helminths in patients vaccinated with bacille calmette - guerin resulted in greater protective responses to the vaccine compared with patients who did not receive anthelminthic chemotherapy . during active infection , both gi and tissue - dwelling helminths can establish long - term chronic infections and have many immunomodulatory molecules in common , which , despite the different anatomical locations target similar host cells employing comparable regulatory mechanisms . thus , experimental models together with human studies have helped to elucidate the mechanisms and cell targets underlying parasite - induced immune modulation . in this section , presenting cells ( apcs ) required in priming the adaptive immune response , dendritic cells ( dcs ) are an essential driving force of th2 induction in helminth infections and in allergy - related diseases . the field of research on dcs targeted by parasite - induced immune modulation is as vast as that on macrophages , and there is definitive evidence of a specific dc phenotype that develops in helminth infection , demonstrating modulation by the parasite to deviate host inflammatory responses . several groups could show that in helminth infection , dcs mature only selectively or show impaired functions in terms of tlr responsiveness . as dcs are the main messenger cells to communicate with t cells and initiate an immune response , interference with their functions represents a key mechanism for helminths to induce an environment conducive to their survival . the downregulation of proinflammatory cytokines appears to be a frequent feature in helminth - mediated modulation of the th2 - type response . murine dcs stimulated with lipids from s. mansoni eggs matured to induce specifically tregs that produced il - 10 , reducing th1 responses whilst producing a modulated th2 response . dcs that have been previously exposed to helminth products can also effectively prime th2 cells . s. mansoni soluble egg antigen ( sea ) is a particularly strong inducer of th2 responses , and importantly the glycoprotein omega - 1 was identified as the main th2 - inducing component in sea . human dcs exposed to b. malayi mf showed higher levels of apoptosis and decreased production of il - 12 and il - 10 . in fact when human monocytes that were being differentiated to dcs in vitro were stimulated with b. malayi mf antigen , they produced significantly decreased levels of il - 12p40 , il - 12p70 , and il - 10 in response to bacterial adjuvant . massacand et al . also demonstrated how dcs exposed to excretory - secretory ( es ) products from both nippostrongylus brasiliensis and heligmosomoides polygyrus had reduced expression of the proinflammatory cytokine il - 12 / 23p40 . similarly , balic et al . reported that bone - marrow - derived dcs exposed to n. brasiliensis es ( nes ) products actively matured and could induce a th2 response when transferred into nave mice . high levels of il - 4 , il - 5 , and il - 10 were detected after reexposure to nes . in vitro , these dcs produced high levels of il - 6 and il - 12p40 but full production of il - 12p70 was blocked . finally it was shown that murine lipopolysaccharide - ( lps - ) or cpg - matured dcs exposed to es products from taenia crassiceps showed diminished responses to stimulation through tlrs 4 and 9 . these dcs significantly decreased levels of proinflammatory cytokines , including il - 12p40 and il - 12p70 , as well as tnf - and il - 15 . thus , downregulation of proinflammatory cytokines seems to be a frequent mechanism in immune modulation by helminths . combined with suppression of proinflammatory cytokines , a key aspect in modulation of dcs is the downregulation of costimulatory molecules , leading to induction of a th2 response . . illustrated that stimulation of murine bone - marrow - derived dcs with a. lumbricoides pseudocoelomic body fluid ( abf ) influenced dc maturation by inducing expression of il - 6 , il - 12p40 , and macrophage inflammatory protein 2 . however , dc maturation was only partial as levels of costimulatory molecules cd80 , cd86 , cd40 , ox40l , and major histocompatibility complex ( mhc ) class ii were not affected . furthermore , when dcs were cultured in the presence of ovalbumin ( ova ) with abf and then transferred into nave mice , restimulation resulted in significantly increased levels of il - 4 , il - 5 , and il - 10 compared to dcs cultured without abf . coculturing of es products but not adult worm antigen from h. polygyrus with lps - treated dcs induced a semimature phenotype with moderate expression of cd40 , cd86 , and mhc class ii . in fact when dcs were treated with es and ova and subsequently cultured with ova - specific t cells , the t cells developed a regulatory phenotype , expressing cd25 and high levels of il - 10 . furthermore , a novel subset of dcs expressing low levels of cd11c have also recently been identified in mice chronically infected with h. polygyrus . in this infection setting , dcs acted as efficient apcs and induced high numbers of cd4 t cells expressing foxp3 but only low numbers of cd4 effector t cells . this population of dcs was suggested to be one of the main target cells involved in inducing an immunoregulatory environment in h. polygyrus infection , allowing the establishment of chronic infection . nevertheless , dcs are clearly essential for efficient priming of the th2 response , as depletion of cd11c cells during development of the adaptive cd4 t cell response in s. mansoni infection drastically impaired the th2 response . macrophages that are activated by the th2 - type cytokines il - 4 and il - 13 develop an alternatively activated phenotype and have a well - described role in helminth infections ( reviewed by hoerauf et al . ) . alternatively activated macrophages ( aams ) are recruited in large numbers to the sites of helminth infection where they can proliferate , as recently shown . aams are characterised in mice by expression of specific markers , including arginase - 1 , resistin - like molecule ( relm ) - ( also known as found in inflammatory zone , fizz1 ) , ym - 1 , ym - 2 , acidic mammalian chitinase ( amcase ) , and mannose receptor c type ( mrc ) - 1 . aams are important in tissue homeostasis , downregulation of the adaptive immune system , acting as effector cells against parasites , and to reduce or heal any ensuing damage caused by infection . aams recruited during b. malayi infection have been demonstrated to drive cd4 th2 responses , deviating the immune system from inducing a proinflammatory th1 response that could be detrimental to parasite survival . monocytes from b. malayi asymptomatically infected patients have also been described to show an alternatively activated phenotype , expressing the aam - specific markers arginase - 1 , mrc - 1 , resistin , and ccl18 as well as the downregulatory cytokines transforming growth factor ( tgf ) - and il - 10 ( similar to what has been described for mouse aams ) . however , translation of characterised markers into the human system in general should be done with caution , as reports indicate arginase - 1 may not be a reliable marker for aams in humans as it is found in other cell types . furthermore , human monocytes do not express arginase - 1 after stimulation with il - 4 and il - 13 , unlike mouse macrophages ( reviewed by raes et al . ) . this indicates that the translation from murine to human data can be difficult , and reliable markers for alternative activation in human monocytes should be further investigated . macrophages from b. malayi infected mice were shown to be fully capable of processing and presenting antigen and providing costimulation for t cells , however the resulting antigen - specific t cell population remained suboptimal with cell proliferation but not th2 cell cytokine production being impaired . these macrophages were il -4-dependent and required direct contact with t cells to induce hyporesponsiveness . in a mouse model of s. mansoniinfection , arginase - expressing macrophages played an essential role in host protection by suppressing expression of the classical inflammatory cytokines il - 12 and il - 23 . removal of these cells resulted in an accumulation of parasite eggs in the intestines and intestinal haemorrhage , thus preventing the eggs from being excreted . large numbers of aams were shown to accumulate in n. brasiliensis infection in the gut , characterised by expression of arginase - 1 , relm - and ym - 1 , in an il - 4 - and il -13-dependent manner . macrophage depletion resulted in impaired worm expulsion from the small intestine and prevented smooth muscle hypercontractility . relm - was shown to be essential in regulating lung inflammation , granuloma size and fibrosis in mice challenged with s. mansoni eggs . moreover , pesce et al . illustrated that challenge of relm - deficient mice with s. mansoni eggs resulted in elevated eosinophil levels and ige titres . in the same study relm - deficient mice challenged with n. brasiliensis infection produced increased th2 responses , manifested by elevated lung pathology and expulsion of adult worms . importantly , addition of exogenous relm - reversed the pathological th2 responses in this infection . this represents relm - as a key host - derived molecule induced by helminth infection to allow prolonged parasite survival . these studies point at a host protective role for aams in specific tissue dwelling and gi helminth infections . among the cell types targeted during helminth infections , natural cd4 tregs develop in the thymus and express the transcription factor foxp3 , the il - 2 receptor chain ( cd25 ) , ctla - 4 , and a range of immunosuppressive proteins including il - 10 and tgf - . additionally , other adaptive cd25 treg populations exist in the periphery that develop from nonregulatory t cell subsets , with their expression of il - 10 and tgf - distinguishing them from activated cd4cd25 nonregulatory t cells . tregs are important in reducing pathology in the host via suppression of both th1 and th2 responses , thus preventing disease symptoms as demonstrated by evidence of treg involvement in both th2 - mediated allergies and th1 - mediated autoimmunity ( reviewed by else ) . in a murine model of schistosomiasis cd4cd25 t cells expressing high quantities of il - 10 were shown to play a significant role in reducing immunopathology , especially in the chronic stage of infection . mckee and pearce illustrated that in s. mansoni - infected mice cd4cd25foxp3 cells produced significant levels of il - 10 that were required to prevent dc - derived il - 12 , thereby suppressing th1 responses . in fact , isolated schistosome eggs were demonstrated to be capable of modulating th2 responses , without the need for the former life cycle stages that develop during infection . schistosome eggs injected into mice were shown to induce a population of foxp3 cells that expanded to control the cd4 t cell response , preventing inflammatory th1 responses while modulating th2 responses to prevent th2 - mediated immunopathology . both natural and adaptive tregs have been described in filarial - infected persons , with the adaptive treg population producing high levels of il - 10 . our group has shown that in h. polygyrus infection , foxp3 tregs are a requirement for limiting immunopathology and represent a potential source of il - 10 . thus , while treg depletion did not affect worm burdens , the th2 response was greatly accelerated and augmented , with high levels of il - 4 and il - 13 being produced . the uncontrolled th2 response led to increased immunopathology in the intestine , demonstrating that tregs were essential in regulating this response . foxp3 tregs were also induced after stimulation with h. polygyrus es products , reducing proliferation of effector cells by activating the tgf - signaling pathway . during infection , tregs may therefore be seen as important effector cells required to prevent or reduce pathology in the host by modulating the ensuing th2 response , thereby simultaneously allowing establishment of chronic infection . host protection as well as regulation by antibodies and b cells is being recognised as an essential component in th2 responses in helminth infections . in s.mansoni - infected mice , where the dominant isotypes are igg1 and ige , blockade of b cell production resulted in high levels of the proinflammatory cytokines ifn - and il - 12 but low levels of the th2 cytokines il - 4 and il - 10 in acute infection . moreover mice deficient in b cells could not downregulate granuloma formation in the chronic stage of infection , and this mechanism was mediated by fcr , indicating a role for antibodies in down modulation of pathology . in fact , antibody isotypes are demonstrated to have an important role in determining the outcome of helminth infection in the host . the cytokines il - 4 and il - 13 act on b cells to induce both igg1 and ige in mice and igg4 and ige in humans . high levels of igg4 but low levels of ige are found in the blood of hyporesponsive , asymptomatic persons infected with b. malayi , w. bancrofti , and o. volvulus . igg4 correlates with high levels of il - 10 and the presence of adult worms in hyporesponsive persons . in bancroftian filariasis , high levels of igg4 but low levels of ige were found in mf positive individuals compared to patients with clinical disease ( elephantiasis or tropical pulmonary eosinophilia ) . ige is known to activate degranulation of mast cells ( mcs ) , basophils and eosinophils and induce antibody - dependent cell - mediated cytoxicity ( adcc ) . igg1 in mice and igg4 in humans compete with ige for binding sites and therefore may inhibit such processes . thus , inhibitory igg4 may prevent immunopathological responses in helminth asymptomatically infected individuals and can simultaneously provide an indication of the clinical outcome in infected persons . regulatory b cells have been first described in autoimmune diseases , where the main mediator of suppression is il - 10 . helminth infections can also induce specific b cell phenotypes with regulatory properties as shown in infection with s. mansoni and h. polygyrus . in s. mansoni infection , a particular subset of b cells has been described that are cd1d and express high levels of il - 10 ( defined as cd19il - 10cd1dcd5cd21cd23igdigmcells ) . transfer of these cells into ova - sensitized mice reduced ova - induced allergic airway inflammation via induction of foxp3 tregs ; the effect was tgf - independent as showed in anti - tgf - mab treatment experiments . furthermore , another group demonstrated that transfer of il -10-producing b cells from il - 4 deficient mice infected with s. mansoni provided complete resistance to experimentally induced anaphylaxis when applied to nave mice . thus , absence of il - 4 was essential to prevent exacerbation of this allergic response . in another study , the same group proved that the protective response of s. mansoni infection was entirely dependent on b cells as depletion of igm b cells resulted in mice becoming completely susceptible to anaphylaxis . interestingly , adoptive transfer of a population of cd19cd23 b cells from h. polygyrus - infected mice could reduce the effects of allergic airway inflammation of ova - sensitized mice , however , in an il - 10 independent manner . these mesenteric lymph node b cells reduced secretion of il - 5 and infiltration of eosinophils into the airways , suppressing allergen - induced pathology . thus , b cells from helminth infections exhibit regulatory capacity in unrelated diseases and are of therapeutic interest in allergies , therefore their phenotype and functional aspects should be further investigated . there are numerous studies examining the effects of different helminth infections ( e.g. , s. mansoni , h. polygyrus , n. brasiliensis , trichinella spiralis , and litomosoides sigmodontis ) on allergy - related diseases in experimental animal models , where helminths show the capacity to suppress abberrant th2 immune responses . in addition , es products either from h. polygyrus or n. brasiliensis were described to have similar beneficial immunoregulatory effects . furthermore , helminths act through various cell types and can interfere with allergy symptoms in animal models via distinct mechanisms including tregs , b cells , and induction of regulatory cytokines like il - 10 or tgf - , as discussed in the previous section and reviewed in table 2 . these and other studies led to the discovery of specific immunomodulatory helminth - derived molecules and products that induce a microenvironment beneficial to the parasite , while at the same time preventing immune - related pathology associated with vigorous th2 responses ( figure 1 ) . however , as mentioned earlier , persistence of the parasite is not obligatory to reduce allergic symptoms in later life . moreover , these functionally and structurally diverse molecules are expressed throughout the parasite life cycle and interact directly with host cells . a summary of helminth - derived immunomodulatory molecules and products is given in table 1 . we focus here on molecules that are relevant for human disease , established animal models of host - parasite interactions , and defined molecules that downregulate unrelated th2 inflammation . the existence of parasite - derived homologues of host mammalian anti - inflammatory cytokines reveals an apparent evolutionary struggle between the parasite and the host , whereby the parasite has evolved mechanisms to establish chronic infection . for example , two tgf - homologues found in brugia species , bm - tgh - 1 and bm - tgh - 2 , have been well characterised , the second of which is thought to have an immunomodulatory role . tgh - 2 is secreted by adult worms and in its recombinant form was shown to bind the human tgf - receptor , thus potentially influencing treg development . s. mansoni male worms express a member of the tgf - receptor family known as smrk - 1 for which mammalian tgf - may be a ligand involved in worm development . h. polygyrus es contains remarkable tgf -- like activity , inducing foxp3 expression in nave t cells and modulating immune functions , thereby maintaining worm burdens to induce chronic infection . the beneficial role of homologues of mammalian chemokines such as macrophage migration inhibitory factor ( mif ) is less apparent . mif homologues have been described in multiple helminth species ( reviewed elsewhere ) . helminth mif has direct chemotactic effects on human monocytes but appears to be associated with anti - inflammatory , modified th2 - type responses . in a murine model of asthma , a recombinant mif - like protein from a. simplex ( as - mif ) was described to have a protective effect and to suppress the th2 - type response , reduce production of il - 4 , -5 and -13 in the bronchoalveolar lavage fluid ( bal ) , inhibit eosinophilia , goblet cell hyperplasia , and ameliorate lung hyperreactivity . the effect of as - mif was possibly mediated by il - 10 and tgf - production in the bal as well as via treg induction in the lungs of as - mif - treated animals when compared to asthmatic controls . another helminth - derived molecule with structural similarities to mammalian chemokines is ancylostoma - secreted protein - 2 ( na - asp - 2 ) secreted by the infective larvae of necator americanus hookworm . recombinant na - asp - 2 was shown to recruit high numbers of neutrophils when injected into an air pouch ( a sterile inflammatory setting ) in mice . the influx of neutrophils was suggested to create permeability in host vessels , thus facilitating larval migration . hence , cytokine homologues seem to be exploited by the parasite for efficient immune evasion ; however more work is needed to assess which of those molecules participate in suppression of unrelated inflammation . the cystatins and serpins are the best - characterised protease inhibitors of helminths that have immunomodulatory potential . mammalian cysteine proteases are essential for efficient processing and presentation of antigen on mhc class ii to induce an appropriate adaptive t cell response . mammalian cystatins play a vital role in regulating these pathways ; however , helminth cystatins from acanthocheilonema viteae , b. malayi , n. brasiliensis , and o. volvulus have been shown to interfere with this process to dampen antigen - dependent immune reactions ( reviewed by klotz et al . ) . bm - cpi - 2 , a cystatin from b. malayi , was illustrated to interfere with antigen processing , which led to a reduced number of epitopes presented to t cells in vitro . studies from our own group have demonstrated that onchocystatin ( rov17 ) from o. volvulus reduced antigen - driven proliferation of peripheral blood mononuclear cells in a monocyte - dependent manner . recombinant avcystatin ( rav17 ) from a. viteae has potent immunomodulatory roles illustrated by its ability to reduce antigen - specific and unspecific t cell responses . avcystatin is recognised by macrophages and upon uptake induces phosphorylation of the mitogen - activated protein kinase signaling pathways erk1 / 2 and p38 in macrophages . this led to tyrosine kinase - dependent il - 10 production in macrophages . furthermore , we could show in an ova - induced airway hyperreactivity mouse model that avcystatin - treated asthmatic mice exhibited amelioration of the disease . avcystatin administered intraperitoneally ( i.p . ) during the sensitization phase as well as before challenge with ova , suppressed recruitment of eosinophils into the lungs , ova - specific and total ige levels , and reduced allergen - specific il - 4 production . il - 10 is a key element in avcystatin - induced immunomodulation , as blocking of il - 10 with an anti - il - 10r mab reversed the beneficial effect on cell recruitment and production of ige . moreover , depletion of macrophages with clodronate liposomes before airway allergen challenge diminished the antiallergic effect of avcystatin . the rodent filarial species l. sigmodontis secretes a cystatin at various stages of the life cycle , which after injection via microosmotic pumps into the peritoneal cavity of l. sigmodontis - infected mice greatly decreased nitric oxide production and proliferation of antigen - specific spleen cells . similarly , recombinant cystatin from the es product of the gi nematode n. brasiliensis ( named nippocystatin , nbcys ) was shown to inhibit cathepsins l and b , and suppressed antigen processing by apcs . furthermore , ova - sensitized and nbcys - treated mice showed decreased ova - specific spleen cell proliferation , reduced ova - specific ige levels and cytokine production due to inhibition of cathepsin b and l - dependent antigen processing . similar to cystatins , serpins ( serine protease inhibitors ) have important roles in mammalian biological processes including regulation of complement activation , inflammatory pathways , and cell interactions . bm - spn - 2 is a serpin expressed by b. malayi microfilariae , which could inhibit proteases of human neutrophils , thereby interfering with and potentially circumventing the most abundant leukocyte to encounter mf in the bloodstream . however , another study by stanley and stein contests the enzymatic activity of bm - spn - 2 . taken together , protease inhibitors such as cystatins are a class of molecules found in numerous helminths that have important immunomodulatory functions . a secreted 62 kda glycoprotein from a. viteae known as es - 62 is one of the best - characterised helminth immunomodulators . es - 62 has been shown to exhibit a plethora of well - documented anti - inflammatory properties and contains phosphorylcholine moieties , which are largely responsible for immunomodulation ( reviewed by harnett et al . ) . ova - specific cd4 t cells exhibited lower levels of proliferation and il - 2 production after challenge with es - 62 , as well as inhibition of il - 4 and il - 13 . it was also shown that es - 62 acts on macrophages to inhibit production of il - 12 if the cells were subsequently exposed to lps and ifn - . es - 62 could also be shown to act on bone - marrow - derived precursors of dcs to inhibit a proinflammatory response induced by lps and b cells by modulating t and b cell interactions . it directly inhibited fcri - induced release of allergy mediators from human mcs by selectively blocking key signal transduction events . es - 62 also interfered with mcs in vivo in a mouse model of immediate - type hypersensitivity to oxazolone , thereby diminishing ear swelling and mc - dependent hypersensitivity , as well as ex vivo mc degranulation in mice that were previously injected with the molecule . moreover , es - 62 ameliorated ova - induced murine airway inflammation , airway hyperresponsiveness , lung pathology , and eosinophilia by suppression of mc function . thus , es - 62 is likely to be a key mediator of filarial - induced immunoregulation , and its properties might be used to dampen overwhelming unrelated inflammation in the future . schistosome soluble egg antigen ( sea ) and es products released by the egg stage of the parasite contain potent th2 - inducing and immunomodulatory activity . sea from s. mansoni was shown to be an extremely strong inducer of th2 responses without the need for live infection or the addition of adjuvant . recently it was shown that omega - 1 , a hepatotoxic ribonuclease , is one of the key players in this response . omega - 1 is a glycoprotein , which was demonstrated to polarise human monocyte - derived and cd11c murine dcs in a direction supporting th2 responses even in the presence of lps . in fact , sea depleted of omega - 1 was not able to sufficiently induce a th2 response in vitro . however , the th2 - suppressive actions of schistosome - derived antigens clearly highlight the ability of this helminth to modulate host immune responses . es - or omega -1-treated dcs display the typical modulated phenotype that is critical for induction of a th2 response , including reduced expression of costimulatory molecules and a lowered efficiency in participating in dc - t cell conjugates . in fact , this study demonstrated that omega - 1 was shown to alter the morphology of dcs , possibly preventing t cell activation . ipse / alpha - 1 is another glycoprotein present in sea and abundant in es , which could induce il - 4 production from human basophils in an ige - dependent but antigen - independent mechanism . demonstrated that glycan - containing sea could induce high levels of il - 5 , ige production , and eosinophilia when administered intranasally into mice . the same group was subsequently able to show that s. mansoni sea contained the carbohydrate lacto - n - fucopentaose iii ( lnfpiii ) , which induced high levels of il - 4 , il - 5 , and il - 10 by nasal lymphocytes bypassing the need for an adjuvant . dcs are also targeted by lyso - phosphatidylserine ( lyso - ps ) present in sea , to dampen the th2 response . lyso - ps was shown to act on dcs via the tlr2 pathway , endowing them with the ability to induce il -10-producing treg cells . whole sea , as well as sea - derived molecules , has been described to interfere with animal models of allergy - related diseases . yang et al . used s. japonicum sea to test its effect in experimentally induced asthma in mice . sea increased il - 10 production and expression of foxp3 on cd4cd25 t cells , both with immunosuppressive activity , while at the same time decreasing the expression of th2 ( il - 4 and il - 5 ) cytokines , suppressed antigen - induced airway inflammation , recruitment of inflammatory cells into the lungs , and development of asthma . s. mansoni egg - secreted chemokine - binding protein ( smckbp ) was reported to significantly diminish ear swelling of hapten - sensitized mice in a contact hypersensitivity model . isolation of the inflammatory infiltrate from hapten - treated ears of smckbp - treated mice showed reduction of neutrophilia when compared to cells isolated from the ears of control animals . showed that smckbp has specific in vivo activity , suppressing immediate or local inflammation . additionally , three s. mansoni antigens sm22 .6 ( soluble protein associated with the s. mansoni tegument ) , piii ( a multivalent antigen of s. mansoni adult worms ) , and sm29 ( a membrane bound glycoprotein on the s. mansoni adult worm tegument ) were evaluated in the ova - induced airway inflammation mouse model . all three antigens showed a beneficial immunomodulatory effect in this allergy model characterised by suppression of airway inflammation , reduced eosinophilia in the lungs , decreased ova - specific ige levels , and lower th2 - specific cytokine production in bal when compared to asthmatic animals . sm22 .6 significantly induced higher levels of il - 10 , while both sm22 .6 and piii lead to increased expression of cd4foxp3 t cells suggesting that treg cells might be involved in the modulation of this aberrant th2 inflammation . although ascaris infections are described to support allergic inflammation ( section 2.3 ) , products from a. suum have also been described to contain immunomodulatory activity , in particular the 200 kda protein pas - 1 . administration of pas - 1 to mice that had been injected with lps into sterile air pouches resulted in a significant decrease in neutrophil migration as well as suppressing proinflammatory cytokines il - 6 , tnf - , and il - 1 . itami et al . used a murine model of asthma induced by another a. suum - molecule , apas - 3 that promotes ige production , to test the suppressive effect of pas - 1 . in this experimental model of asthma induced by apas - 3 , pas -1-treated mice showed decreased eosinophil migration into the lungs , lower il - 4 , il - 5 , ccl11 and rantes production in the bal , as well as reduced airway hyperreactivity . moreover , il - 10 production was considerably increased after pas - 1 treatment when compared to apas -3-immunized controls . thus , a. suum has allergenic components as well as suppressive products that downregulate allergic responses . more recently , a study from the same group showed suppressive effect of pas - 1 also in ova - induced airway inflammation . in line with previous findings , pas - 1 reduced eosinophilia , decreased production of th2 associated cytokines in the bal and ova - specific ige and igg1 levels in serum . moreover , the effect was observed in il - 12 - but not in il - 10 - and ifn -- deficient animals , thus il - 10 and ifn - played a role in the immunomodulatory effect of pas - 1 . furthermore , the authors reported that the immunomodulatory effect of pas - 1 was mediated by cd4cd25 and cd8 t cells as shown by adoptive cell - transfer into ova - sensitized and challenged mice . recipients of pas -1-primed cd4cd25 t cells had increased levels of il - 10 / tgf - whereas mice with transferred pas -1-primed cd8 t cells showed prominent ifn - production . those three cytokines were described to play important roles in the suppression of allergic diseases and reported to be strongly induced during successful allergen - specific immunotherapy in humans as reviewed by holgate and polosa . helminths have had millions of years to evolve regulatory mechanisms that circumvent the mammalian immune response and allow for the longevity characteristically observed during infection . thus , understanding of this coevolutionary nature is important in order to comprehend the immunomodulatory potential of helminth - derived molecules . this will better allow the development of therapeutical targets in symptomatic disease in helminth infections and help to break transmission of infection in endemic countries . furthermore , the genetic basis underlying differences in responses of different individuals to helminth infections should be examined to develop a full understanding of these parasites , and current studies are beginning to address this . in particular , relevant experimental models for filarial disease are required to study both asymptomatic and pathological responses . the epidemiological data reported in this paper together with experimental studies clearly support the view of the immunomodulatory potential of helminth - derived products to interfere with and even prevent aberrant allergic inflammation . research should focus on studying the immunomodulatory effects of helminth - derived products on allergy and strive to develop new therapeutic strategies by identifying the mechanisms and pathways utilised by such molecules in mediating their immunomodulatory effects .\noutput:\n" }, { "from": "agent", "value": "helminths are master regulators of host immune responses utilising complex mechanisms to dampen host protective th2 - type responses and favour long - term persistence . such evasion mechanisms ensure mutual survival of both the parasite and the host . in this paper , we present recent findings on the cells that are targeted by helminths and the molecules and mechanisms that are induced during infection . we discuss the impact of these factors on the host response as well as their effect in preventing the development of aberrant allergic inflammation . we also examine recent findings on helminth - derived molecules that can be used as tools to pinpoint the underlying mechanisms of immune regulation or to determine new anti - inflammatory therapeutics ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: transseptal puncture is commonly performed to achieve left atrial ( la ) access for a variety of common cardiac procedures , including catheter ablation of atrial fibrillation ( af ) , accessory pathways and ventricular tachycardia , la appendage closure , and mitral valve procedures . historically , a conventional brockenbrough needle has been used to mechanically puncture the fossa ovalis , but adoption of a newer transseptal needle using radiofrequency ( rf ) energy applied to an insulated blunttipped electrode has increased despite a prospective trial comparing the 2 strategies . although the conventional needle may provide more immediate tactile feedback and has a longer track record of success , the rf needle may be more effective in cases of an elastic , aneurysmal , or thickened interatrial septum . in addition , safety concerns have been raised as more plastic particle shavings were observed after introduction of the brockenbrough versus the rf needle through the dilator and sheath , suggesting that there may be a risk of plastic particle embolization with the conventional needle . a large retrospective study found that the rf needle was faster , more effective , and safer in achieving la access , but a randomized prospective comparison to the conventional needle has not been performed . the purpose of this study was to examine the effectiveness and safety of an rf needle compared with a conventional brockenbrough needle for transseptal la access in a prospective , randomized trial . the conventional transseptal needle versus radiofrequency energy needle puncture for left atrial access ( traversela ) study was a singleblinded , randomized , controlled trial to compare the effectiveness and safety of transseptal puncture using an rf needle versus a conventional brockenbrough in patients undergoing catheter ablation procedures requiring la access . between january 2011 and november 2012 , 72 patients were randomized in a 1:1 , singleblinded fashion to 1 of 2 transseptal needle groups . patients undergoing catheter ablation procedures involving a planned transseptal puncture were included if they were 18 years of age and able to consent to the research study . patients were excluded from the study if transesophageal echocardiography performed before the procedure revealed a patent foramen ovale large enough to alter the strategy for transseptal la access ( such as the planned use of the ablator to probe the interatrial septum ) . the study protocol was approved by the committee on human research of the university of california , san francisco . the transseptal puncture was performed by a cardiac electrophysiology fellow and attending electrophysiologist via right femoral venous access . intracardiac echocardiography ( ice ) using a 9f ultra ice catheter ( boston scientific ) or an 8f acunav ultrasound catheter ( biosense webster ) guided the transseptal puncture . patients randomized to the rf needle group underwent transseptal puncture with a large , preformed curve 71cmc1 or 98cmc118gauge nrg needle ( baylis medical ) through a 63 cm fastcath sl1 sheath ( st . jude medical ) or a 71 cm large curl agilis nxt steerable introducer sheath ( st . sheaths were selected at the discretion of the operating physician prior to knowledge of treatment assignment . the rf needle diameter was 18 gauge proximally and 21 gauge distally and had a blunt distal uninsulated electrode tip for rf energy transmission . the rfp 100115 rf puncture generator ( baylis medical ) was attached to the grounding pad and rf needle using a connector cable and was set to an output power of 10 w for 2 seconds . the generator produced continuous monopolar rf power output at a fixed frequency of 500 khz . patients randomized to the conventional needle group underwent transseptal puncture with either a large , preformed curve 71 or 98 cm 18gauge brk1 needle ( st . the brk1 needle had a shoulder 3 mm proximal to the introducer tip , designed to prevent the needle from advancing too far . in preprocedural ex vivo testing of both needle groups , the transseptal needle and sheath were flushed with heparinized saline before use , and the transseptal needle was placed through the dilator and sheath until the tip of the needle could be visualized . the transseptal needles were not modified or manually shaped prior to placement through the dilator and sheath . in the conventional needle arm , the inner stylet was removed prior to advancement through the dilator and sheath . the transseptal needle was then removed , and the dilator and sheath were flushed again . operators and study personnel looked for any evidence of grossly visible plastic particles , recorded as yes versus no ( a yes answer required agreement between the operator and study personnel present ) . the transseptal sheath and dilator were then advanced to the superior vena cava over a guidewire under fluoroscopic visualization . the guidewire was removed , and the contents of the dilator were evacuated and then flushed with heparinized saline . the transseptal needle was then flushed with heparinized saline , inserted into the dilator and sheath , and advanced under fluoroscopic guidance until the needle tip was located 2 to 5 mm proximal to the dilator tip . the needle , dilator , and sheath were pulled down as a unit ( beginning of the time of measurement for the primary outcome ) until tenting of the fossa ovalis was confirmed using ice . contrast injection and fluoroscopy were also used to verify the needle location . holding the dilator and sheath still , the needle was then advanced out of the dilator , and contrast was injected . if la access was not obtained after initial needle advancement in the conventional needle arm , the entire apparatus was advanced as a unit to puncture the septum with the needle ; for the rf needle arm , rf energy was applied at 10 w for 2 seconds . if necessary , additional applications of rf energy were delivered to obtain la access . la access was confirmed by the operators on the basis of contrast media visualized in the la under fluoroscopy and microbubbles observed in the la with ice . the dilator and sheath were then advanced over the needle into the la under fluoroscopic and ice visualization ( end of the time of measurement for the primary outcome ) . the initial study protocol allowed application of monopolar rf energy using an electrosurgical pencil ( covidien ) or bovie set to cut at 35 w and applied to the proximal needle handle of the brk1 needle in those who failed transseptal la access with mechanical attempts . however , the protocol was amended after enrollment of the 10th patient to exclude this practice after the publication of a study suggested that application of electrocautery to the brk1 needle may result in coring and embolizaton of septal tissue . the primary outcome was total time required for la access for the first transseptal puncture , defined as time from the first pulldown of the needle / sheath / dilator apparatus in the superior vena cava to first entrance of the sheath into the left atrium . secondary outcome measures included other efficacy measures ( failure of the assigned needle type , time from interatrial septum engagement to sheath advancement , and time from needle advancement to sheath advancement ) and safety measures ( presence of visible plastic dilator shavings from needle introduction and any procedural complication plausibly related to transseptal puncture ) . procedural complications plausibly related to transseptal needle puncture included aortic puncture , pericardial effusion , stroke or systemic embolization , and death . the assigned needle type was determined to fail when further attempts to achieve la access were deemed to be either futile or unsafe per the discretion of the operator . we targeted a sample size of 72 ( 36 in each randomization group ) in order to achieve 80 % power to detect a 5minute reduction in total transseptal puncture time ( assuming a standard deviation of 7.5 minutes ) using a 2sided alpha level of 0.05 . an exploratory perprotocol analysis restricted to participants who maintained their initial needle assignment ( ie , excluding crossover patients ) was also performed . normally distributed continuous variables are expressed as means and standard deviations , whereas continuous variables with skewed distributions are expressed as medians and interquartile ranges ( iqrs ) . baseline patient characteristics and outcome measures were compared between assigned needle groups using the test for categorical variables and t tests or the wilcoxon ranksum test for continuous variables , as appropriate . a linear regression analysis using logtransformed transseptal time ( due to rightskewed data ) was used to identify predictors of transseptal time . covariates were selected for inclusion in multivariable models if their univariate association with the outcome reached p 0.20 . the conventional transseptal needle versus radiofrequency energy needle puncture for left atrial access ( traversela ) study was a singleblinded , randomized , controlled trial to compare the effectiveness and safety of transseptal puncture using an rf needle versus a conventional brockenbrough in patients undergoing catheter ablation procedures requiring la access . between january 2011 and november 2012 , 72 patients were randomized in a 1:1 , singleblinded fashion to 1 of 2 transseptal needle groups . patients undergoing catheter ablation procedures involving a planned transseptal puncture were included if they were 18 years of age and able to consent to the research study . patients were excluded from the study if transesophageal echocardiography performed before the procedure revealed a patent foramen ovale large enough to alter the strategy for transseptal la access ( such as the planned use of the ablator to probe the interatrial septum ) . the study protocol was approved by the committee on human research of the university of california , san francisco . the transseptal puncture was performed by a cardiac electrophysiology fellow and attending electrophysiologist via right femoral venous access . intracardiac echocardiography ( ice ) using a 9f ultra ice catheter ( boston scientific ) or an 8f acunav ultrasound catheter ( biosense webster ) guided the transseptal puncture . patients randomized to the rf needle group underwent transseptal puncture with a large , preformed curve 71cmc1 or 98cmc118gauge nrg needle ( baylis medical ) through a 63 cm fastcath sl1 sheath ( st . jude medical ) or a 71 cm large curl agilis nxt steerable introducer sheath ( st . sheaths were selected at the discretion of the operating physician prior to knowledge of treatment assignment . the rf needle diameter was 18 gauge proximally and 21 gauge distally and had a blunt distal uninsulated electrode tip for rf energy transmission . the rfp 100115 rf puncture generator ( baylis medical ) was attached to the grounding pad and rf needle using a connector cable and was set to an output power of 10 w for 2 seconds . the generator produced continuous monopolar rf power output at a fixed frequency of 500 khz . patients randomized to the conventional needle group underwent transseptal puncture with either a large , preformed curve 71 or 98 cm 18gauge brk1 needle ( st . the brk1 needle had a shoulder 3 mm proximal to the introducer tip , designed to prevent the needle from advancing too far . in preprocedural ex vivo testing of both needle groups , the transseptal needle and sheath were flushed with heparinized saline before use , and the transseptal needle was placed through the dilator and sheath until the tip of the needle could be visualized . the transseptal needles were not modified or manually shaped prior to placement through the dilator and sheath . in the conventional needle arm , the inner stylet was removed prior to advancement through the dilator and sheath . the transseptal needle was then removed , and the dilator and sheath were flushed again . operators and study personnel looked for any evidence of grossly visible plastic particles , recorded as yes versus no ( a yes answer required agreement between the operator and study personnel present ) . the transseptal sheath and dilator were then advanced to the superior vena cava over a guidewire under fluoroscopic visualization . the guidewire was removed , and the contents of the dilator were evacuated and then flushed with heparinized saline . the transseptal needle was then flushed with heparinized saline , inserted into the dilator and sheath , and advanced under fluoroscopic guidance until the needle tip was located 2 to 5 mm proximal to the dilator tip . the needle , dilator , and sheath were pulled down as a unit ( beginning of the time of measurement for the primary outcome ) until tenting of the fossa ovalis was confirmed using ice . holding the dilator and sheath still , the needle was then advanced out of the dilator , and contrast was injected . if la access was not obtained after initial needle advancement in the conventional needle arm , the entire apparatus was advanced as a unit to puncture the septum with the needle ; for the rf needle arm , rf energy was applied at 10 w for 2 seconds . if necessary , additional applications of rf energy were delivered to obtain la access . la access was confirmed by the operators on the basis of contrast media visualized in the la under fluoroscopy and microbubbles observed in the la with ice . the dilator and sheath were then advanced over the needle into the la under fluoroscopic and ice visualization ( end of the time of measurement for the primary outcome ) . the initial study protocol allowed application of monopolar rf energy using an electrosurgical pencil ( covidien ) or bovie set to cut at 35 w and applied to the proximal needle handle of the brk1 needle in those who failed transseptal la access with mechanical attempts . however , the protocol was amended after enrollment of the 10th patient to exclude this practice after the publication of a study suggested that application of electrocautery to the brk1 needle may result in coring and embolizaton of septal tissue . the primary outcome was total time required for la access for the first transseptal puncture , defined as time from the first pulldown of the needle / sheath / dilator apparatus in the superior vena cava to first entrance of the sheath into the left atrium . secondary outcome measures included other efficacy measures ( failure of the assigned needle type , time from interatrial septum engagement to sheath advancement , and time from needle advancement to sheath advancement ) and safety measures ( presence of visible plastic dilator shavings from needle introduction and any procedural complication plausibly related to transseptal puncture ) . procedural complications plausibly related to transseptal needle puncture included aortic puncture , pericardial effusion , stroke or systemic embolization , and death . the assigned needle type was determined to fail when further attempts to achieve la access were deemed to be either futile or unsafe per the discretion of the operator . we targeted a sample size of 72 ( 36 in each randomization group ) in order to achieve 80 % power to detect a 5minute reduction in total transseptal puncture time ( assuming a standard deviation of 7.5 minutes ) using a 2sided alpha level of 0.05 . an exploratory perprotocol analysis restricted to participants who maintained their initial needle assignment ( ie , excluding crossover patients ) was also performed . normally distributed continuous variables are expressed as means and standard deviations , whereas continuous variables with skewed distributions are expressed as medians and interquartile ranges ( iqrs ) . baseline patient characteristics and outcome measures were compared between assigned needle groups using the test for categorical variables and t tests or the wilcoxon ranksum test for continuous variables , as appropriate . a linear regression analysis using logtransformed transseptal time ( due to rightskewed data ) was used to identify predictors of transseptal time . covariates were selected for inclusion in multivariable models if their univariate association with the outcome reached p 0.20 . we enrolled a total of 72 patients undergoing planned la access via a transseptal puncture ; 36 patients were randomly assigned to the rf needle and 36 to the conventional brk1 needle ( figure 1 ) . there were no significant differences in baseline patient demographic and clinical characteristics between the 2 study arms ( table 1 ) . twentytwo patients ( 30.6 % ) had a previous transseptal puncture a median of 536 days ( iqr , 173 to 1167 days ) before the index procedure . contrary to the protocol , 3 conventional needle patients were initially unsuccessful and ultimately resulted in la access only after electrocautery energy was applied to the proximal needle handle . these patients were included in all analyses as part of the conventional needle arm and were not considered failures or crossover patients . baseline patient , operator , and procedural characteristics values are reported as meansd or n ( % ) . proportions were calculated on the basis of patients with echocardiographic data available in each arm . * patients available for analysis of the primary outcome of time of first transseptal puncture . as seen in figure 2 , the median transseptal puncture time was 68 % shorter using the rf needle compared with the conventional needle ( 2.3 minutes [ iqr , 1.7 to 3.8 minutes ] versus 7.3 minutes [ iqr , 2.7 to 14.1 minutes ] , p = 0.005 ) . in additional analyses , the mean transseptal puncture time trended toward a shorter overall time using the rf needle compared with the conventional needle ( 5.210.2 versus 9.08.2 minutes , p = 0.086 ) . median transseptal puncture times were also shorter in the rf needle arm from engagement of the fossa ovalis to the long sheath in the la and needle tip out of the long sheath to the long sheath in the la ( table 2 ) . of the 36 patients randomized to the rf needle arm , 27 ( 75.0 % ) required rf application an average of 1.20.6 times to achieve la access . perprotocol analysis ( ie , excluding crossovers ) showed statistically significantly shorter median transseptal puncture times in the rf needle arm from engagement of the fossa ovalis ( 1.3 minutes [ iqr , 0.7 to 1.9 minutes ] versus 2.4 minutes [ iqr , 1.2 to 4.7 minutes ] , p = 0.003 ) and from first advancing the needle out of the long sheath ( 0.8 minutes [ iqr , 0.4 to 1.2 minutes ] versus 1.5 minutes [ iqr , 0.7 to 2.2 minutes ] , p = 0.012 ) . iqr indicates interquartile range ; la , left atrium ; rf , radiofrequency ; sd , standard deviation . box plots show the median ( white line ) and interquartile range ( from top to bottom of the box plot ) . failure to achieve transseptal la access with the assigned needle was less common using the rf needle compared with the conventional needle ( 0/36 [ 0 % ] versus 10/36 [ 27.8 % ] , p 0.001 ) . although a larger proportion of patients with a previous transseptal puncture failed with the conventional needle , this did not reach statistical significance ( 4/10 [ 40 % ] versus 6/26 [ 23.1 % ] , p = 0.31 ) . in all 10 failures , crossover occurred because of an inability to puncture the interatrial septum despite forward pressure and tenting , leading to concern that further effort might lead to perforation of the free ( lateral ) la wall . of the 7 operators who enrolled patients in the study , 5 operators experienced failure of the assigned conventional needle . the 7 operators differed in their preference of and experience with each type of needle prior to study initiation ( table 3 ) . in the rf needle arm , transseptal la access was initially unsuccessful in 1 patient despite engagement of the interatrial septum and application of the rf pulse , resulting in crossover to the conventional needle . however , after failure of the conventional needle , the rf needle was attempted again , this time resulting in successful la access after 1 rf pulse . operator characteristics before and during transseptal needle study i d indicates identification ; rf , radiofrequency . with ex vivo preprocedural testing involving advancement of the assigned transseptal needle through the plastic dilator and sheath , the rf needle created grossly visible plastic shavings less often than the conventional needle ( 0 [ 0 % ] versus 12/36 [ 33.3 % ] , p 0.001 ) . an example of plastic dilator shavings seen after introduction of the conventional needle through the dilator and long sheath is shown in figure 3 . pictured is an example of grossly visible particles that were produced after the introduction of a conventional needle through the dilator and long sheath . procedural complications were no different between the rf and conventional needle groups ( 1/36 [ 2.8 % ] versus 1/36 [ 2.8 % ] , p = 1.000 ) . in the rf needle arm ,1 patient was found to have a pericardial effusion detected by ice after conclusion of the la ablation procedure ( 3 hours after the transseptal puncture ) . in the conventional needle arm ,1 patient experienced a transient ischemic attack with brain magnetic resonance imaging consistent with embolic etiology . multivariable linear regression analysis revealed that older patient age , increased attending physician experience , use of the conventional needle , and radialview ice were each significantly associated with longer transseptal time ( table 4 ) . the coefficient from regression analyses represents the percent increase in transseptal time per unit increase of continuous predictor variables or as associated with individual categorical variables . covariates failing to meet criteria for inclusion in the multivariable model ( as described in the methods and results section ) . we enrolled a total of 72 patients undergoing planned la access via a transseptal puncture ; 36 patients were randomly assigned to the rf needle and 36 to the conventional brk1 needle ( figure 1 ) . there were no significant differences in baseline patient demographic and clinical characteristics between the 2 study arms ( table 1 ) . twentytwo patients ( 30.6 % ) had a previous transseptal puncture a median of 536 days ( iqr , 173 to 1167 days ) before the index procedure . contrary to the protocol , 3 conventional needle patients were initially unsuccessful and ultimately resulted in la access only after electrocautery energy was applied to the proximal needle handle . these patients were included in all analyses as part of the conventional needle arm and were not considered failures or crossover patients . baseline patient , operator , and procedural characteristics values are reported as meansd or n ( % ) . proportions were calculated on the basis of patients with echocardiographic data available in each arm . * patients available for analysis of the primary outcome of time of first transseptal puncture . as seen in figure 2 , the median transseptal puncture time was 68 % shorter using the rf needle compared with the conventional needle ( 2.3 minutes [ iqr , 1.7 to 3.8 minutes ] versus 7.3 minutes [ iqr , 2.7 to 14.1 minutes ] , p = 0.005 ) . in additional analyses , the mean transseptal puncture time trended toward a shorter overall time using the rf needle compared with the conventional needle ( 5.210.2 versus 9.08.2 minutes , p = 0.086 ) . median transseptal puncture times were also shorter in the rf needle arm from engagement of the fossa ovalis to the long sheath in the la and needle tip out of the long sheath to the long sheath in the la ( table 2 ) . of the 36 patients randomized to the rf needle arm , 27 ( 75.0 % ) required rf application an average of 1.20.6 times to achieve la access . perprotocol analysis ( ie , excluding crossovers ) showed statistically significantly shorter median transseptal puncture times in the rf needle arm from engagement of the fossa ovalis ( 1.3 minutes [ iqr , 0.7 to 1.9 minutes ] versus 2.4 minutes [ iqr , 1.2 to 4.7 minutes ] , p = 0.003 ) and from first advancing the needle out of the long sheath ( 0.8 minutes [ iqr , 0.4 to 1.2 minutes ] versus 1.5 minutes [ iqr , 0.7 to 2.2 minutes ] , p = 0.012 ) . iqr indicates interquartile range ; la , left atrium ; rf , radiofrequency ; sd , standard deviation . box plots show the median ( white line ) and interquartile range ( from top to bottom of the box plot ) . failure to achieve transseptal la access with the assigned needle was less common using the rf needle compared with the conventional needle ( 0/36 [ 0 % ] versus 10/36 [ 27.8 % ] , p 0.001 ) . although a larger proportion of patients with a previous transseptal puncture failed with the conventional needle , this did not reach statistical significance ( 4/10 [ 40 % ] versus 6/26 [ 23.1 % ] , p = 0.31 ) . in all 10 failures , crossover occurred because of an inability to puncture the interatrial septum despite forward pressure and tenting , leading to concern that further effort might lead to perforation of the free ( lateral ) la wall . of the 7 operators who enrolled patients in the study , 5 operators experienced failure of the assigned conventional needle . the 7 operators differed in their preference of and experience with each type of needle prior to study initiation ( table 3 ) . in the rf needle arm , transseptal la access was initially unsuccessful in 1 patient despite engagement of the interatrial septum and application of the rf pulse , resulting in crossover to the conventional needle . however , after failure of the conventional needle , the rf needle was attempted again , this time resulting in successful la access after 1 rf pulse . operator characteristics before and during transseptal needle study i d indicates identification ; rf , radiofrequency . with ex vivo preprocedural testing involving advancement of the assigned transseptal needle through the plastic dilator and sheath , the rf needle created grossly visible plastic shavings less often than the conventional needle ( 0 [ 0 % ] versus 12/36 [ 33.3 % ] , p 0.001 ) . an example of plastic dilator shavings seen after introduction of the conventional needle through the dilator and long sheath is shown in figure 3 . pictured is an example of grossly visible particles that were produced after the introduction of a conventional needle through the dilator and long sheath . procedural complications were no different between the rf and conventional needle groups ( 1/36 [ 2.8 % ] versus 1/36 [ 2.8 % ] , p = 1.000 ) . in the rf needle arm ,1 patient was found to have a pericardial effusion detected by ice after conclusion of the la ablation procedure ( 3 hours after the transseptal puncture ) . in the conventional needle arm , 1 patient experienced a transient ischemic attack with brain magnetic resonance imaging consistent with embolic etiology . multivariable linear regression analysis revealed that older patient age , increased attending physician experience , use of the conventional needle , and radialview ice were each significantly associated with longer transseptal time ( table 4 ) . the coefficient from regression analyses represents the percent increase in transseptal time per unit increase of continuous predictor variables or as associated with individual categorical variables . covariates failing to meet criteria for inclusion in the multivariable model ( as described in the methods and results section ) . traversela is the first randomized comparison of an rf versus conventional needle for transseptal puncture . the rf needle significantly reduced time to transseptal la access , resulted in less failure of the assigned needle , and produced fewer visible plastic shavings from introduction of the needle through the dilator and sheath . transseptal puncture for la access is becoming more common because of the growing adaptation of catheter ablation and structural heart procedures involving leftsided access . however , the transseptal puncture procedure can be time consuming and can result in important complications . prolonged transseptal procedures may increase total procedure times and ionizing radiation exposure to the patient and operator because of the highintensity fluoroscopy that is often employed . finally , personnel and electrophysiology laboratory time may become both clinically and financially relevant at the extremes of differences in transseptal time , particularly if it means staffing overtime is used or the next case is postponed for another day . an observational study describing the initial experience using the rf needle reported a 97.2 % success rate ( 35 of 36 ) in achieving transseptal access , but no comparator group was included . subsequently , a larger observational study suggested that the rf needle may result in shorter procedure times , better efficacy of achieving la access , and decreased complications . however , data were analyzed retrospectively , and patients were not randomized to needle therapy . as the rf needle was used more recently and therefore potentially in a more experienced electrophysiology laboratory , the results may have been biased in favor of the rf needle . we found that rf compared with conventional needle use resulted in a 68 % shorter median time to transseptal la access ; this amounted to an absolute 5minute median difference and more than a 10minute upper quartile difference in transseptal puncture time between the 2 arms . however , the absolute time difference may not be particularly large in light of the whole procedure . indeed , we observed no difference in total procedure or fluoroscopy time between groups . of note , the rf application itself was quite short ; the 75 % of patients who required rf usage for transseptal la access needed an average of 1.20.6 applications , translating into an approximate mean of 2.41.2 seconds of total rf application time . subanalyses examining several points during the first transseptal puncture , including time from fossa ovalis engagement to long sheath across and needle out of the sheath to long sheath across , found that the rf needle consistently resulted in shorter transseptal times in both intentiontotreat and perprotocol analyses . it is interesting to note that the variability of transseptal time appeared to be largest in the conventional group ( as can be seen in figure 2 ) , suggesting that the timing differences were driven primarily by the more difficult cases in the conventional group versus a more uniform experience in the rf group . to assess predictors of transseptal time , we constructed multivariable models with covariates plausibly associated with the outcome . after adjustment , use of the rf needle was one of the strongest predictors of a shorter transseptal time . use of radialview ice was associated with longer transseptal times , suggesting that the higherresolution view of the fossa ovalis obtained with phasedarray ice rather than the more global atrial view obtained with the radialview system may be particularly useful during these procedures . older patient age also predicted longer transseptal times , perhaps because of more distorted cardiac anatomy or more interatrial septal fibrosis . counter to expectations , increased attending physician experience was also associated with longer transseptal times , perhaps related to a more cautious approach taken by experienced operators . randomization to the rf needle resulted in success in all patients , whereas randomization to the conventional needle resulted in 10 crossover patients , all of whom were subsequently successful using the rf needle . because this was a singleblinded study and the operator made the final decision to crossover based on safety reasons , inadvertent bias may have occurred . however , we found that crossover of patients from the conventional to rf needle was distributed across operators , many of whom personally preferred to use the conventional needle prior to the study ( table 3 ) . therefore , it is not clear why bias ( or lack of blinding ) would not have similarly led to more crossovers from the rf to the conventional needle . although the proportion of patients who failed transseptal puncture with the conventional needle was higher than reported in previous studies , it is noteworthy that all previous studies on the subject have been retrospective . it is important to emphasize that this is the first study to prospectively enroll and then follow transseptal puncture patients with research personnel in the room before and throughout the case to carefully track successes and failures . it is possible that difficult or failed transseptal puncture attempts in previous retrospective studies were not included or missed . finally , although not statistically significant , 40 % of those who failed with the conventional needle ( and succeeded with the rf needle ) had a previous transseptal puncture , a previously established predictor of a difficult procedure . however , given this large difference and previous evidence that repeat transseptal punctures are more challenging , the rf needle may be particularly preferred in the repeat transseptal puncture population . in fact , we used a conservative estimate when designating failure of the assigned transseptal needle : 3 additional patients assigned to the conventional needle had difficulty in achieving la access despite forward pressure and tenting , and based on operator discretion , application of electrocautery to the conventional needle was performed against protocol , each time resulting in success . although successful transseptal puncture has been described in the literature based on this technique , we changed the study protocol to preclude this practice after the study was already under way based on evidence of tissue coring and the theoretical risk of embolism that can occur with this technique . we found that the rf needle was less likely to produce visible plastic shavings after introduction into the dilator and sheath . the most plausible mechanism for this difference is that the conventional needle has a sharp tip , whereas the rf needle tip is blunt . feld et al reported that the production of plastic shavings measured by light microscopy occurred less commonly with rf needles than with conventional needles . our study is the first prospective , randomized trial to confirm these findings and quantitate the prevalence of this phenomenon in a clinical setting . in the conventional needle arm , we performed ex vivo testing without the stylet in the needle , which is the standard of care at our institution . we performed shaving in this manner to mimic the course of the needle through the dilator / sheath outside the patient 's body . in fact , our method of conventional needle introduction without the stylet and with forward flushing is the most common method employed in published reports , and is reflected in the original report of shaved visible particles . we acknowledge that the frequency of plastic shavings might be reduced if the stylet is left in place until the needle / stylet tip is close to the dilator tip ; however , removing the stylet within the body may increase the risk of air embolism and does not preclude unseen shaving production from the unprepared distal portion of the dilator . future studies are needed to evaluate whether plastic shavings are dislodged during transseptal procedures , even after the dilator and sheath are prepped in the absence of the stylet , potentially leading to clinical sequelae . it is important to emphasize that ice was used to guide transseptal puncture in all cases in this trial and that risks may be higher if the rf needle is used in the absence of ice . we calculated the sample size necessary to meet the primary outcome of the study a priori , and a lack of power should not result in spurious falsepositive results . however , lack of power could result in failure to detect certain real relationships , such as important predictors of transseptal time in multivariable models . second , the reasons for the high rate of la access failure in the conventional needle study arm are unclear and could represent unique aspects of the patient population studied that may not be generalizable to general practice . conventional needles manufactured by different companies may have other characteristics that could affect transseptal puncture success . fourth , our study did not involve other novel protocols in the event of conventional needle failure , such as use of electrocautery applied to a conventional needle or a nitinol guidewire ( safesept , pressure products inc ) through the lumen of the conventional needle . finally , despite finding that use of the rf needle resulted in shorter transseptal puncture time , less failure , and fewer plastic shavings , the rf needle is generally more expensive than the conventional needle , suggesting that a formal costeffectiveness study is warranted . we calculated the sample size necessary to meet the primary outcome of the study a priori , and a lack of power should not result in spurious falsepositive results . however , lack of power could result in failure to detect certain real relationships , such as important predictors of transseptal time in multivariable models . second , the reasons for the high rate of la access failure in the conventional needle study arm are unclear and could represent unique aspects of the patient population studied that may not be generalizable to general practice . conventional needles manufactured by different companies may have other characteristics that could affect transseptal puncture success . fourth , our study did not involve other novel protocols in the event of conventional needle failure , such as use of electrocautery applied to a conventional needle or a nitinol guidewire ( safesept , pressure products inc ) through the lumen of the conventional needle . finally , despite finding that use of the rf needle resulted in shorter transseptal puncture time , less failure , and fewer plastic shavings , the rf needle is generally more expensive than the conventional needle , suggesting that a formal costeffectiveness study is warranted . use of an rf needle resulted in shorter time to transseptal la access , less failure in achieving transseptal la access , and fewer visible plastic shavings .\noutput:\n" }, { "from": "agent", "value": "backgroundtransseptal puncture is a critical step in achieving left atrial ( la ) access for a variety of cardiac procedures . although the mechanical brockenbrough needle has historically been used for this procedure , a needle employing radiofrequency ( rf ) energy has more recently been approved for clinical use . we sought to investigate the comparative effectiveness of an rf versus conventional needle for transseptal la access.methods and resultsin this prospective , singleblinded , controlled trial , 72 patients were randomized in a 1:1 fashion to an rf versus conventional ( brk1 ) transseptal needle . in an intentiontotreat analysis , the primary outcome was time required for transseptal la access . secondary outcomes included failure of the assigned needle , visible plastic dilator shavings from needle introduction , and any procedural complication . the median transseptal puncture time was 68 % shorter using the rf needle compared with the conventional needle ( 2.3 minutes [ interquartile range { iqr } , 1.7 to 3.8 minutes ] versus 7.3 minutes [ iqr , 2.7 to 14.1 minutes ] , p = 0.005 ) . failure to achieve transseptal la access with the assigned needle was less common using the rf versus conventional needle ( 0/36 [ 0 % ] versus 10/36 [ 27.8 % ] , p < 0.001 ) . plastic shavings were grossly visible after needle advancement through the dilator and sheath in 0 ( 0 % ) rf needle cases and 12 ( 33.3 % ) conventional needle cases ( p < 0.001 ) . there were no differences in procedural complications ( 1/36 [ 2.8 % ] versus 1/36 [ 2.8 % ] ) . conclusionsuse of an rf needle resulted in shorter time to transseptal la access , less failure in achieving transseptal la access , and fewer visible plastic shavings.clinical trial registrationurl : http://www.clinicaltrials.gov . unique identifier : nct01209260 ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: pneumonia , sepsis , meningitis due to infection with gbs are common causes of morbidity , mortality , and long - term neurological sequelae in neonates . vaginal smears of up to 40 % of pregnant women show colonization with s. agalactiae , 50 to 70 % of their children will be colonized postpartum ; up to 2 newborns per 1000 live births will develop gbs infection , which is characterized by unspecific clinical signs such as temperature instability , respiratory distress , palor , and abdominal symptoms . the majority of neonates develop early onset sepsis within the first 24 hours of life , which rapidly progresses in septic shock and hemorrhage . depending on the gestational age , case fatality rate can increase up to 30 percent in preterm infants 32 weeks of gestation . more than 50 % of affected newborns suffer from neurological deficencies like sight or hearing loss and mental retardation . in addition 19,000 cases of gbs disease occur annually in the united states , and up to 35 % of the symptomatic infections in elderly and immunosuppressed patients suffer from chronic diseases . gbs has characteristic virulence factors , including the ability to bind to extracellular matrix components , such as fibronectin , fibrinogen , and laminin , allowing to pass cellular barriers and to become invasive . following bacteremia , immune response is partially insufficient , presumably due to immature innate immunity of the neonate . lipopolysaccharides of gram negative bacteria are able to modify the barrier function of endothelial cells . could previously demonstrate that gbs are able to penetrate the blood - brain barrier by targeting human brain microvascular endothelial cells . however it is unclear if gbs is also able to invade human coronary artery endothelial cells . endothelial dysfunction is a major component in the pathophysiology of septicemic gbs infection . therefore , analysis of the interaction between gbs and endothelial cells is of major interest , especially the septic and haemorrhagic complications in newborns . genome wide expression profiling allows detailed insights in the pathogenesis of gbs sepsis and helps to better understand the underlying pathophysiological mechanisms . we studied the interaction between human coronary artery endothelial cells ( hcaecs ) and s. agalactiae by genome wide high density microarrays . the results of this study indicate that gbs are able to regulate transcription of a wide range of genes , involved in infection , inflammation , and apoptosis . streptococcus agalactiae lancefield 's group b ( atcc13813 strain lehmann and neumann , serotype v , septic , nonhemolytic ) was obtained from atcc ( lgc promochem , wesel , germany ) . bacteria were grown overnight on tryptic - soy agar plates supplemented with 5 % sheep blood ( institut fr hygiene und medizinische mikrobiologie , university of wuerzburg , germany ) and cultured in 20 ml lysogeny broth ( lb ) medium , supplemented with 1 % trypton , 0,5 % yeast extract , and 1 % nacl at 37c for 90 minutes . a final bacteria concentration of 2 to 410 / ml was achieved after adjustment of the optical density at 600 nm . primary human coronary artery endothelial cells ( hcaecs , cryopreserved , third passage ) were obtained from lonza ( basel , switzerland ) and cultured in ebm2 medium ( lonza ) , and supplemented with egm -2-mv singlequots ( lonza ) with 5 % fbs . all cells were subcultured at a 1 : 6 ratio and were used for experiments from passages 5 to 16 . after reaching 80 % confluence , endothelial cells were washed three times with phosphate buffered saline ( pbs ) and detached from culture flasks using trypsin - edta solution . the reaction was stopped with tns solution ( cambrex ) , and cells were resuspended in complete medium . gbs , diluted in lb medium , were added in multiplicity of infection ( moi ) of 20 to hcaec . , cells were trypsinised , resuspended in trypsin neutralization solution ( tns , cambrex ) , and centrifuged at 800 rpm for 5 minutes after 6 hours of infection , because preliminary data have shown that the maximum of gene regulation occurs between 4 and 8 hours . for additional conformation experiments , confirmation of gene array data was selectively carried out by real - time rt - pcr , western blot analysis , and elisa at different time points . for real - time rt - pcr hcaecswere detached from cell culture dishes by a cell scraper , snap - frozen and stored at 80c until rna isolation . for westernblotting , protein extracts were prepared by detaching cells , followed by centrifugation at 800 rpm for 5 minutes . cell pellets were carefully washed once with 4 ml phosphate buffered saline solution ( pbs ) and centrifuged again . cells were resuspended in 100 l pbs and 100 l sds stop solution ( 200 mm trizma - base ph 6.7 , 15 % glycerin , 0,03 % bromphenole blue , 6 % sodium dodecyl sulfate ( sds ) , - mercaptoethanol , 9 : 1 , 95c ) for 5 minutes at 95c . until further analysis , protein extracts were stored at 20c . in parallel , cell culture supernatants were collected and frozen at 20c until further analysis by elisa ( upa ) . for il - 8 and cxcl - 6 elisa , cells were detached in 150 l pbs , snap - frozen , and stored at 80c . for rna extraction , cell pelletswere resuspended in - mercaptoethanol and rlt lysis buffer ( qiagen , hilden , germany ) . for disruption and homogenization lysateswere loaded on qiashredder spin columns ( qiagen ) and centrifuged at 13.000 g for 2 min . rna purification was carried out using rneasy spin columns ( qiagen ) according to the protocol of the manufacturer . rna was eluted in 35 l rnase - free water , and rna concentration was determined photometrically ( nanodrop nd - 1000 , nanodrop technologies , wilmington , usa ) . for gene array analysis , quality of rna was determined using a bioanalyzer ( agilent technologies , waldbronn , germany ) , and rna integrity numbers ( rins ) were between 9.6 and 9.7 . two g of total rna were reverse transcribed , performing second strand synthesis ( one - cycle cdna synthesis kit , affymetrix , santa clara , usa ) . synthesis of biotinylated cdna was carried out using the ivt labelling kit ( affymetrix ) . fifteen g of the fragmented , labelled crna were hybridized to affymetrix hg - u133 plus 2.0 arrays . fluorescence intensity was measured by a genechip scanner 3000 ( affymetrix ) . for normalization and data analysis , after normalization by variance stabilization , data quality was verified by density plots , degradation plots , and box plots . resulting genes were functionally clustered according to gene ontology using gene ontology tree machine ( gotm ) ( http://dbmi.mc.vanderbilt.edu/ ) . for real - time rt - pcr , cdna synthesis was performed using the quantitect reverse transcription kit ( qiagen ) for 25 minutes at 42c and 3 minutes at 95c . quantitative real - time rt - pcr for cxcl6 , tlr2 , and tlr4 quantification was carried out using the lightcycler instrument . to normalize real - time pcr data , serially diluted cdna copies of the housekeeping gene - aminolevulinic acid synthase ( h - alas ) were coamplified . analysis was performed comparing the number of cdna copies of the samples with the h - alas copies in each sample , respectively .45 cycles of repeated denaturation ( 95c 9 sec ) , annealing ( 54c 15 sec ) , and elongation ( 72c 25 sec ) were performed . the pcr mastermix ( lightcycler fast start master hybridization , roche , mannheim , germany ) contained 0,125 m of each primer ( cxcl6 : 5 - ttgcacttgtttacgcgtt , 5 - tcagtttttcttgtttccactgt ; tlr2 : 5 - tgtcttgtgaccgcaatggta , 5 - gcttgaaccaggaagacgat ; tlr4 : 5 - ggagccctgcgtggaga , 5 - tatgccccatcttcaattgtc ) and 0,15 m of the hybridization probes ( cxcl6 : 5 - gcaagtttgtctggacccgga - fl , 5 - lc640 - gccccttttctaaagaaagtcatccagaa - p ; tlr2 : 5 - ctacagaggtgtgtgaacctccaggc - fl , 5 - lc640 - ctggtgctgacatccaatggaattaac - p ; tlr4 : 5 - cccttcaccccgattccattgct - fl , 5 - lc640 - cttgctaaatgctgccgttttatcacg - p ) , labeled with fluorescein and lc red 640 , respectively . cellular proteins were loaded onto sds - polyacrylamid stacking gels ( 3 % ) , separated in running gels ( 12 % ) , and run for 1 hour at 160 v in tris - sds - glycine electrophoresis buffer according to laemmli . ( immobilion - p 45 m , millipore , bedford , usa ) at 1 a for 60 minutes at 4c . after being blocked for one hour in trisbuffered saline / tween ( 25 mm tris ph7 .6 , 150 mm nacl , 0,05 % tween20 ) containing 6 % dry milk , membranes were incubated with primary antibodies ( hmox - 1 : 1 : 250 , milk , mouse , bd bioscience pharmingen , san jose , usa ; bim : 1 : 100 , milk , rabbit , bd bioscience pharmingen ) overnight at 4c . membranes were washed briefly and incubated with horse - raddish - peroxidase - conjugated antirabbit or antimouse igg ( goat anti - mouse / rabbit hrp , 1 : 3000 , milk , goat , bio - rad , munich , germany ) for one hour at room temperature . immunoreactivity was detected using an ecl or ecl - plus detection kit ( amersham pharmacia biotech , freiburg , germany ) . the protein bands on x - ray films ( fuji photo film gmbh , dsseldorf , germany ) were scanned , and the intensity of bands was analyzed using nih image software ( version 1.61 ) . loading control was performed with - actin ( 1 : 20 , milk , rabbit , santa cruz biotechnology inc . , , michigan , usa ) , il - 8 ( quantikine kit , r & d systems , wiesbaden , germany ) , and upa ( imubind , american diagnostica , stamford , usa ) levels were quantified by elisa , according to the suppliers protocol . mean fluorescence was quantified by measurement of optical density , using the softmax system ( molecular devices gmbh , ismaning , germany ) . in total , 124 genes were differentially expressed ( 89 upregulated , 35 downregulated ) based on a more than 3-fold difference to control hcaec ( see supplementary material available online at doi : 10.1155 / 2011 / 971502 ) . signal log ratios ( base e ) varied between 2.7 and 1.5 comparing control cells versus hcaec after 6 hours of coincubation with s. agalactiae . the highest level of induction was observed for genes encoding transcriptional regulation ( 14.3-fold upregulated ) ; the highest level of inhibition was achieved in genes involved in dna - specific binding ( 4.5-fold downregulated ) . differencial expression of selected genes ( table 1 ) was validated by one additional method , including western blots , real - time rt pcr , and elisa assays . we selected regulated genes , which are involved in apoptosis , hemostasis , oxidative stress response , infection , and inflammation for further analysis . previously , we could demonstrate cleavage of caspases 3 and 8 after infection of hcaec with s. agalactiae ( data unpublished ) . bim protein levels were increased by 1.3-fold after 4 hours , 1.5-fold after 8 hours , and 2.6-fold after 24 hours of infection , compared to uninfected cells ( figure 1 ) . heme oxygenase 1 plays an important role in the regulation of apoptosis and cell protection during inflammatory processes . expression of hmox - 1 is species - and cell - specific , induced by oxidative stress , due to lps , ischemia , or cytokines . infection of hcaec with the septicemic s. agalactiae strain atcc 13813 led to hmox - 1 upregulation , compared to unstimulated cells ( 2.3-fold after 4 hours , 4.7-fold after 8 hours , and 6.6-fold after 24 hours of infection , figure 2 ) . cxcl6 is a strong mediator of inflammation , attracting mainly neutrophils , but also eosinophils , lymphocytes , and monocytes . cxcl6 production can be induced by il - 1 - , tnf - alpha , hypoxemia , and lps . downregulation of cxcl6 after gbs stimulation was observed ( 2-fold after 4 hours and 12.9-fold after 8 hours of infection ) . tlr 2 and tlr4 are major receptors of the human innate immune response against various pathogens , interacting with lipoteichoic acid and bacterial lps , respectively . tlr4 expression was reduced after gbs stimulation ( 3.4-fold after 4 hours , 2.9-fold after 8 hours , and 11-fold after 24 hours of infection ) . we also observed downregulation of tlr2 ( 4.3-fold after 4 hours , 3.8-fold after 8 hours , and 1.2-fold after 24 hours of infection , figure 4 ) . interleukin 8 , a member of the cxc chemokine superfamily , attracts neutrophils and monocytes to sites of inflammation . production of il - 8 can be induced by different cytokines , viral infections , or gram negative bacteria . il - 8 secretion was reduced by factor of 2.5 ( 4 h ) , 1.7 ( 8 h ) , and 1.5 ( 24 h ) . therefore , hemorrhagic dysregulation , observed in gbs infected neonates might be enhanced from the observed upregulation of urokinase . we found upregulation in urokinase levels in hcaec cell culture supernatants ( 1.6-fold after 4 hours , 2.6-fold after 8 hours , and 3.7-fold after 24 hours of infection , figure 5 ) . cox2 is induced during inflammation among others in macrophages , monocytes as well as in endothelial cells . we observed a weak upregulation of cox2 expression after 8 hours of infection ( 1.5-fold ) , whereas cox2 levels remained unchanged after 4 and 24 hours of infection compared to uninfected hcaec . the present study demonstrates the use of cdna microarray technology to characterize transcriptional responses in hcaec coincubated with gbs . ( ii ) gbs leads to upregulation of the proapoptotic bcl2 - like - interacting protein ( bim ) and of heme - oxygenase - 1 ( hmox - 1 ) . ( iv ) urokinase ( upa ) and cyclooxygenase - 2 ( cox2 ) were activated after gbs infection . doran et al . performed a study analyzing the interaction between s. agalactiae and human brain microvascular endothelial cells . in contrast to our study , this group used a haemolytic strain and revealed - hemolysin / cytolysin as the most important pathophysiological player in a murine model of hematogenous meningitis . our data show that the proapoptotic protein bim is upregulated during the course of gbs infection . one reason for bim upregulation during infection with s. agalactiae could be elevated levels of cytokines and chemokines in hcaec . bim might cause the release of mitochondrial cytochrome c , activating the intrinsic way of apoptosis induction . our own previous results ( data unpublished ) indicate that gbs can cause a breakdown of the mitochondrial membrane potential in hcaec , reflecting an initiation of programmed cell death . activation of toll - like receptors leads to an augmented phosphorylation and inactivation of bim , which in consequence avoids apoptosis . our group was able to demonstrate a downregulation of tlr2 and tlr4 after infection with the septicemic gbs strain atcc 13813 after 4 h , 8 h , and 24 h , respectively , compared to unstimulated cells . gbs - induced downregulation of tlr4 might be responsible for bim - induced apoptosis , which might support tissue invasion of gbs . according to smith et al . , who observed an upregulation of hmox - 1 after stimulation with streptococcus pneumoniae , we could demonstrate activation of hmox - 1 in hcaec coincubated with streptococcus agalactiae . after activation , hmox - 1 cleaves hemoglobin into carbon monoxide ( co ) , iron ( fe ) , and biliverdin , followed by conversion into bilirubin . upregulated expression of hmox - 1 could reflect a protective mechanism against thrombotic complications after infection with gbs . in addition , overexpression of hmox - 1 might lead to elevated bilirubin levels , potentially interfering the change from fetal to adult hemoglobin . hyperbilirubinemia might be responsible for neurological long - term sequelae , observed after gbs newborn infections . furthermore hmox - 1 could indirectly and directly inhibit apoptosis by minimizing reactive oxygen species ( ros ) and by regulation of nfb signaling . in summary , induction of hmox - 1 by gbscould represent a response of hcaec to gbs - induced pathomechanisms such as apoptosis and inflammation . cxcl6 , which encodes a strong chemotactic protein mainly for neutrophils , was markedly downregulated in hcaec after infection with s. agalactiae . impaired cxcl6 levels could be responsible for lower neutrophil recruitment and activation during gbs sepsis . in addition , cd4 positive t - cells , activated by cxcl6 , secrete augmented levels of igg , leading to opsonisation of microorganisms and thereby to facilitated phagocytosis . in parallel to cxcl6 , a further chemokine , il - 8 , was downregulated after gbs infection , potentially leading to impaired chemotaxis of monocytes and neutrophiles . futhermore , our own data revealed that production of a third chemotactic protein , monocyte chemoattractant protein ( mcp ) - 1 , was downregulated after incubation with s. agalactiae unpublished . taken together , these results indicate either a mechanism of the host to avoid excessive inflammation or a bacterial strategy to suppress innate immune response . the serine protease urokinase plays an important role in fibrinolysis by activating plasminogen to plasmin . urokinase - type plasminogen activator upregulation might explain the simultaneously observed hemorrhagic and thrombotic complications during gbs sepsis . cocultivation of hcaec with s. agalactiae revealed marked upregulation of urokinase , as determined by elisa assays . elevated urokinase levels could lead to resolution of platelet - bacteria - thrombi resulting in facilitated tissue invasion of gbs . in parallel to urokinase , we found a second thrombolytic factor , cyclooxygenase 2 , to be upregulated during gbs infection , whereas cox1 is known to be constantly expressed . imbalance of prostacyclin ( produced by cox2 ) and thromboxane a2 ( produced by cox1 ) might be responsible for hemorrhagical complications . infection with a highly septicemic bacteria strain leads to marked increase of cyclooxygenase 2 expression . our data demonstrates that s. agalactiae might be able to escape innate immune mechanisms and to induce hemorrhagical complications in hcaec . induction of apoptosis , bleeding , and vasodilatation could explain the invasive growth during gbs sepsis . knowledge of molecular mechanisms during gbs infection will contribute to a broader understanding of the interaction of streptococci with the endothelium and , in consequence , will support the development of new therapeutical strategies against this severe complication .\noutput:\n" }, { "from": "agent", "value": "early onset sepsis due to group b streptococcus leads to neonatal morbidity , increased mortality , and long - term neurological deficencies . interaction between septicemic gbs and confluent monolayers of human coronary artery endothelial cells ( hcaecs ) was analyzed by genome wide expression profiling . in total , 124 genes were differentially expressed ( 89 upregulated , 35 downregulated ) based on a more than 3-fold difference to control hcaec . regulated genes are involved in apoptosis , hemostasis , oxidative stress response , infection , and inflammation . regulation of selected genes and proteins identified in the gene array analysis was confirmed by real - time rt - pcr assay ( granulocyte chemotactic protein 2 ) , elisa ( urokinase , cyclooxygenase 2 , granulocyte chemotactic protein 1 ) , and western blotting ( heme oxygenase1 , bcl2 interacting protein ) at various time points between 4 and 24 hours . these results indicate that gbs infection might influence signalling pathways leading to impaired function of the innate immune system and hemorrhagic and inflammatory complications during gbs sepsis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in mammals , dna methylation contributes to the establishment and maintenance of cell - type - specific gene expression programmes , imprinting , x - chromosome inactivation and genome stability ( bird , 2002 ) . the majority of genomic methylation occurs at cytosine residues within cpg dinucleotides and is catalysed by the dna methyltransferases ( dnmt ) 1 , 3a and 3b . dnmt1 is responsible for maintaining genomic methylation , whereas dnmt3a and dnmt3b are mainly involved in de novo establishment of methylation patterns during cellular differentiation ( leonhardt et al , 1992 ; li et al , 1992 ; lei et al , 1996 ; okano et al , 1999 ; spada et al , 2007 ) . nuclear protein of 95 kda ( np95 ; also known as uhrf1 ) has recently been identified as an essential co - factor for maintaining genomic methylation ( bostick et al , 2007 ; sharif et al , 2007 ; achour et al , 2008 ) . dnmt1 and np95 embryonic stem cells ( escs ) and embryos have similar reduced levels of dna methylation . in addition , np95 interacts with dnmt1 , binds hemi - methylated cpg sites through its set and ring associated ( sra ) domain and both np95 and dnmt1 accumulate at replication sites ( uemura et al , 2000 ; bostick et al , 2007 ; papait et al , 2007 ; arita et al , 2008 ; avvakumov et al , 2008 ; hashimoto et al , 2008 ) . thus , it has been proposed that np95 mediates maintenance of genomic methylation by recruiting dnmt1 to hemi - methylated cpg sites generated during replication . here , we investigated a possible involvement of np95 in epigenetic regulation beyond its role in dnmt1 - mediated maintenance of dna methylation . we found that np95 interacts with the de novo methyltransferases , dnmt3a and dnmt3b , and mediates promoter silencing before dna methylation is detected . immunoprecipitation experiments showed that different isoforms of both de novo methyltransferases dnmt3a and dnmt3b interact with np95 in wild - type ( wt ) escs , including the more abundant dnmt3a2 and dnmt3b1 ( fig 1a ) . furthermore , using a green fluorescent protein ( gfp ) trap ( rothbauer et al , 2008 ) , we co - immunoprecipitated endogenous dnmt1 and isoforms of dnmt3a and dnmt3b with a gfpnp95 fusion construct transiently expressed in np95 escs and , vice versa , endogenous np95 co - immunoprecipitated with gfp dnmt3a or gfp dnmt3b1 fusions in dnmt3a and 3b double knockout ( dko ) escs ( supplementary fig s1a , b online ) . in addition , we observed co - immunoprecipitation of endogenous dnmt3b and inverted ccaat box binding protein of 90 kda the human homologue of np95from human embryonic kidney 293 t ( hek293 t ) cell extracts ( supplementary fig s1c online ) . we confirmed the interaction of np95 with dnmt3a / b by using a recently developed fluorescent two hybrid assay ( f2h ; zolghadr et al , 2008 ) . dnmt3 fusion constructs were used as bait by tethering them to a lac operator array present in baby hamster kidney ( bhk ) cells , so that the array was visible as a distinct nuclear spot of enriched gfp fluorescence ( fig 1b ) . a cherrynp95 fusion ( prey ) accumulated at this spot only when gfp fusions of full - length dnmt3a and dnmt3b1 or their amino - terminal regions were used as bait and not when their isolated carboxy - terminal catalytic domains were used . we further mapped the interaction of np95 with dnmt3a / b through co - immunoprecipitation of deletion constructs and isolated domains transiently expressed in hek293 t cells ( supplementary fig s2 online ) . the results were consistent with those produced by f2h : the n - terminal regions of dnmt3a and dnmt3b1 , but not their c - terminal catalytic domains , interacted with np95 . deletion of the phd or pwwp domains of dnmt3a and dnmt3b did not eliminate the interaction with np95 . we found that the sra domain and the n - terminal 298 amino acids of np95 , which include the ubiquitin - like domain , interacted with dnmt3a and dnmt3b1 , whereas the phd domain and the c - terminal 132 amino acids , including the ring domain , did not . furthermore , we observed co - immunoprecipitation of endogenous np95 with gfp dnmt3a and gfpdnmt3b transiently expressed in dnmt1 escs , indicating that dnmt3a and dnmt3b interact with np95 independently of dnmt1 ( supplementary fig s1d online ) . to compare the relative association between endogenous np95 and dnmts , we re - probed the blot in fig 1a with a dnmt1 antibody and observed a substantially weaker signal for the co - immunoprecipitated dnmt1 relative to the input than in the case of dnmt3a2 and dnmt3b1 ( supplementary fig s3a online ) . to compare further the stability of np95 interactions with the dnmts , we transiently co - expressed np95 - his with gfpdnmt3a or gfp dnmt3b1 in hek293 t cells and immunoprecipitated with the gfp trap in the presence of different salt concentrations ( fig 1c ; supplementary fig s3b online ) . interestingly , under high salt conditions , the interaction between np95 - his and gfp dnmt1 was lost , whereas co - immunoprecipitation of gfpthese data clearly indicate that np95 interacts more strongly with the de novo methyltransferases , dnmt3a and dnmt3b , than with dnmt1 . as dna methylation has a central role in epigenetic silencing , we investigated the requirement of dna methyltransferases and np95 for promoter silencing in escs . we found that , on transient transfection of wt escs , constructs driven by the cytomegalovirus ( cmv ) promoter were rapidly silenced , as opposed to longer - lasting expression of constructs driven by the chimeric cmv early enhancer / chicken actin ( cag ) promoter ( fig 2 ) , which is consistent with the popularity of the cag promoter for stable transgene expression in escs and mice . escs were co - transfected with two distinct plasmids , one expressing monomeric red fluorescent protein ( mrfp ) under the cmv promoter , the other expressing gfp driven by the cag promoter . mrfp and gfp expression was monitored after transfection for up to ten days by using automated image acquisition and quantification of fluorescent signals ( supplementary fig s4a online ) . the ratio between mrfp and gfp expression declined steadily in wt escs , reflecting preferential silencing of the cmv promoter ( fig 2 ) . by contrast , dko escs and escs lacking all three major dna methyltransferases ( dnmt1 , 3a and 3b triple knockout ) showed no preferential silencing of the cmv promoter . surprisingly , np95 escs were also unable to silence the cmv promoter , whereas dnmt1 escs showed only partly reduced silencing under these conditions . similar results were obtained on swapping gfp and mrfp reporter sequences , ruling out potential artefacts due to differences in their coding sequences or stability of the reporter proteins ( supplementary fig s4b online ) . thus , despite expressing a full complement of dna methyltransferases , escs lacking np95 are as deficient in promoter silencing activity as escs lacking all three major dnmts . interestingly , promoter methylation was detected only ten days after transfection and was lower in np95 than in wt escs , whereas none of the dnmt mutant escs showed appreciable dna methylation ( fig 3 ; supplementary fig s5a online ) . at the same timeno obvious methylation was detected in any of the esc lines within the cpg island of the cag promoter construct ( supplementary fig s5b online ) . thus , cmv promoter silencing depends on the presence of both np95 and de novo dnmts , but ensues well before de novo methylation of the promoter is detected . this prompted us to investigate the involvement of repressive histone methylation as a possible mechanism for the observed silencing . we found that in the absence of histone h3 lysine 9 methyltransferases ( h3k9mts ) , g9a or suv39h1 / 2 , silencing of the cmv promoter was completely abolished or reduced , respectively , indicating that g9a and , in part , suv39h1 / 2 are also required for silencing ( fig 2b ) . the results shown here indicate that np95 interacts with dnmt3a and dnmt3b and mediates silencing of the cmv promoter by mechanisms that are , at least initially , independent of de novo dna methylation . importantly , our data also show the involvement of h3k9mts , g9a and suv39h1 / 2 in cmv promoter silencing . h3k9mts were reported to associate with de novo dnmts , and major satellite repeats were found to be hypomethylated in escs lacking either suv39h1 / 2 or dnmt3 enzymes . however , major satellite transcript levels were altered only in suv39h1 / 2 - deficient cells and not in dnmt3 - deficient cells ( fuks et al , 2003 ; lehnertz et al , 2003 ; martens et al , 2005 ) . a recent study showed that g9a , dnmt1 , dnmt3a and dnmt3b are required for normal methylation at long terminal repeats of endogenous retrotransposable elements , although transcription of these elements was increased in dnmt - deficient escs , but not g9a - deficient escs ( dong et al , 2008 ) . furthermore , recent studies have shown that g9a interacts with dnmt3a and dnmt3b and mediates de novo methylation of the oct4 , nanog and dnmt3l promoters on retinoic - acid - induced differentiation of escs ( feldman et al , 2006 ; li et al , 2007 ; epsztejn - litman et al , 2008 ) . however , two of these studies showed that neither g9a nor de novo dnmts are required to silence the oct4 promoter , and g9a was also found to be dispensable for silencing the nanog and dnmt3l promoters ( feldman et al , 2006 ; epsztejn - litman et al , 2008 ) . in the third study , nanog , but not oct4 , was shown to be silenced in differentiating escs lacking both dnmt3a and dnmt3b ( li et al , 2007 ) . we found that silencing of oct4 during embryoid body differentiation is largely independent from the presence of np95 as well as all three major dnmts , and occurs in the absence of dna methylation ( d.m . these data , together with our findings on silencing of the cmv promoter in escs , indicate that dnmts , np95 and h3k9mts mediate silencing through many mechanisms that do not necessarily involve dna methylation and might depend on the presence of different cis elements and an intricate interplay with other epigenetic and transcription factors . interestingly , np95 was recently shown to interact with g9a ( kim et al , 2009 ) and here we show that silencing of the cmv promoter in escs strictly depends on np95 and on de novo dnmts as well as g9a . taken together these observations suggest that np95 , de novo dnmts and g9a might be involved in a common silencing pathway . in summary , our data clearly support a crucial role of np95 in epigenetic silencing mediated by de novo dna and histone methyltransferases , and make np95 an attractive target for epigenetic reprogramming strategies . immunoprecipitation experiments showed that different isoforms of both de novo methyltransferases dnmt3a and dnmt3b interact with np95 in wild - type ( wt ) escs , including the more abundant dnmt3a2 and dnmt3b1 ( fig 1a ) . furthermore , using a green fluorescent protein ( gfp ) trap ( rothbauer et al , 2008 ) , we co - immunoprecipitated endogenous dnmt1 and isoforms of dnmt3a and dnmt3b with a gfpnp95 fusion construct transiently expressed in np95 escs and , vice versa , endogenous np95 co - immunoprecipitated with gfp dnmt3a or gfp dnmt3b1 fusions in dnmt3a and 3b double knockout ( dko ) escs ( supplementary fig s1a , b online ) . in addition , we observed co - immunoprecipitation of endogenous dnmt3b and inverted ccaat box binding protein of 90 kda the human homologue of np95from human embryonic kidney 293 t ( hek293 t ) cell extracts ( supplementary fig s1c online ) . we confirmed the interaction of np95 with dnmt3a / b by using a recently developed fluorescent two hybrid assay ( f2h ; zolghadr et al , 2008 ) . dnmt3 fusion constructs were used as bait by tethering them to a lac operator array present in baby hamster kidney ( bhk ) cells , so that the array was visible as a distinct nuclear spot of enriched gfp fluorescence ( fig 1b ) . a cherrynp95 fusion ( prey ) accumulated at this spot only when gfp fusions of full - length dnmt3a and dnmt3b1 or their amino - terminal regions were used as bait and not when their isolated carboxy - terminal catalytic domains were used . we further mapped the interaction of np95 with dnmt3a / b through co - immunoprecipitation of deletion constructs and isolated domains transiently expressed in hek293 t cells ( supplementary fig s2 online ) . the results were consistent with those produced by f2h : the n - terminal regions of dnmt3a and dnmt3b1 , but not their c - terminal catalytic domains , interacted with np95 . deletion of the phd or pwwp domains of dnmt3a and dnmt3b did not eliminate the interaction with np95 . we found that the sra domain and the n - terminal 298 amino acids of np95 , which include the ubiquitin - like domain , interacted with dnmt3a and dnmt3b1 , whereas the phd domain and the c - terminal 132 amino acids , including the ring domain , did not . furthermore , we observed co - immunoprecipitation of endogenous np95 with gfp dnmt3a and gfpdnmt3b transiently expressed in dnmt1 escs , indicating that dnmt3a and dnmt3b interact with np95 independently of dnmt1 ( supplementary fig s1d online ) . to compare the relative association between endogenous np95 and dnmts , we re - probed the blot in fig 1a with a dnmt1 antibody and observed a substantially weaker signal for the co - immunoprecipitated dnmt1 relative to the input than in the case of dnmt3a2 and dnmt3b1 ( supplementary fig s3a online ) . to compare further the stability of np95 interactions with the dnmts , we transiently co - expressed np95 - his with gfpdnmt3a or gfp dnmt3b1 in hek293 t cells and immunoprecipitated with the gfp trap in the presence of different salt concentrations ( fig 1c ; supplementary fig s3b online ) . interestingly , under high salt conditions , the interaction between np95 - his and gfp dnmt1 was lost , whereas co - immunoprecipitation of gfpthese data clearly indicate that np95 interacts more strongly with the de novo methyltransferases , dnmt3a and dnmt3b , than with dnmt1 . as dna methylation has a central role in epigenetic silencing , we investigated the requirement of dna methyltransferases and np95 for promoter silencing in escs . we found that , on transient transfection of wt escs , constructs driven by the cytomegalovirus ( cmv ) promoter were rapidly silenced , as opposed to longer - lasting expression of constructs driven by the chimeric cmv early enhancer / chicken actin ( cag ) promoter ( fig 2 ) , which is consistent with the popularity of the cag promoter for stable transgene expression in escs and mice . escs were co - transfected with two distinct plasmids , one expressing monomeric red fluorescent protein ( mrfp ) under the cmv promoter , the other expressing gfp driven by the cag promoter . mrfp and gfp expression was monitored after transfection for up to ten days by using automated image acquisition and quantification of fluorescent signals ( supplementary fig s4a online ) . the ratio between mrfp and gfp expression declined steadily in wt escs , reflecting preferential silencing of the cmv promoter ( fig 2 ) . by contrast , dko escs and escs lacking all three major dna methyltransferases ( dnmt1 , 3a and 3b triple knockout ) showed no preferential silencing of the cmv promoter . surprisingly , np95 escs were also unable to silence the cmv promoter , whereas dnmt1 escs showed only partly reduced silencing under these conditions . similar results were obtained on swapping gfp and mrfp reporter sequences , ruling out potential artefacts due to differences in their coding sequences or stability of the reporter proteins ( supplementary fig s4b online ) . thus , despite expressing a full complement of dna methyltransferases , escs lacking np95 are as deficient in promoter silencing activity as escs lacking all three major dnmts . interestingly , promoter methylation was detected only ten days after transfection and was lower in np95 than in wt escs , whereas none of the dnmt mutant escs showed appreciable dna methylation ( fig 3 ; supplementary fig s5a online ) . at the same timeno obvious methylation was detected in any of the esc lines within the cpg island of the cag promoter construct ( supplementary fig s5b online ) . thus , cmv promoter silencing depends on the presence of both np95 and de novo dnmts , but ensues well before de novo methylation of the promoter is detected . this prompted us to investigate the involvement of repressive histone methylation as a possible mechanism for the observed silencing . we found that in the absence of histone h3 lysine 9 methyltransferases ( h3k9mts ) , g9a or suv39h1 / 2 , silencing of the cmv promoter was completely abolished or reduced , respectively , indicating that g9a and , in part , suv39h1 / 2 are also required for silencing ( fig 2b ) . the results shown here indicate that np95 interacts with dnmt3a and dnmt3b and mediates silencing of the cmv promoter by mechanisms that are , at least initially , independent of de novo dna methylation . importantly , our data also show the involvement of h3k9mts , g9a and suv39h1 / 2 in cmv promoter silencing . h3k9mts were reported to associate with de novo dnmts , and major satellite repeats were found to be hypomethylated in escs lacking either suv39h1 / 2 or dnmt3 enzymes . however , major satellite transcript levels were altered only in suv39h1 / 2 - deficient cells and not in dnmt3 - deficient cells ( fuks et al , 2003 ; lehnertz et al , 2003 ; martens et al , 2005 ) . a recent study showed that g9a , dnmt1 , dnmt3a and dnmt3b are required for normal methylation at long terminal repeats of endogenous retrotransposable elements , although transcription of these elements was increased in dnmt - deficient escs , but not g9a - deficient escs ( dong et al , 2008 ) . furthermore , recent studies have shown that g9a interacts with dnmt3a and dnmt3b and mediates de novo methylation of the oct4 , nanog and dnmt3l promoters on retinoic - acid - induced differentiation of escs ( feldman et al , 2006 ; li et al , 2007 ; epsztejn - litman et al , 2008 ) . however , two of these studies showed that neither g9a nor de novo dnmts are required to silence the oct4 promoter , and g9a was also found to be dispensable for silencing the nanog and dnmt3l promoters ( feldman et al , 2006 ; epsztejn - litman et al , 2008 ) . in the third study , nanog , but not oct4 , was shown to be silenced in differentiating escs lacking both dnmt3a and dnmt3b ( li et al , 2007 ) . we found that silencing of oct4 during embryoid body differentiation is largely independent from the presence of np95 as well as all three major dnmts , and occurs in the absence of dna methylation ( d.m . these data , together with our findings on silencing of the cmv promoter in escs , indicate that dnmts , np95 and h3k9mts mediate silencing through many mechanisms that do not necessarily involve dna methylation and might depend on the presence of different cis elements and an intricate interplay with other epigenetic and transcription factors . interestingly , np95 was recently shown to interact with g9a ( kim et al , 2009 ) and here we show that silencing of the cmv promoter in escs strictly depends on np95 and on de novo dnmts as well as g9a . taken together these observations suggest that np95 , de novo dnmts and g9a might be involved in a common silencing pathway . in summary , our data clearly support a crucial role of np95 in epigenetic silencing mediated by de novo dna and histone methyltransferases , and make np95 an attractive target for epigenetic reprogramming strategies . hek293 t cells , bhk cells and escs were cultured and transfected as described by schermelleh et al ( 2007 ) , except fugene hd ( roche , mannheim , germany ) was used for transfection of escs . the dnmt1 j1 escs used in this study were homozygous for the c allele ( lei et al , 1996 ) . bhk cells were co - transfected on glass coverslips with gfp dnmt3 and cherrynp95 constructs using transfectin ( bio - rad , munich , germany ) according to the manufacturer 's instructions . cell fixation and microscopy were carried out as described by zolghadr et al ( 2008 ) . escs and hek293 t cell extracts were prepared in lysis buffer ( 20 mm trishcl ( ph 7.5 ) , 0.5 mm edta , 2 mm phenylmethyl sulphonyl fluoride and 0.5 % np40 ) containing 150 or 300 mm nacl ( high - salt condition ) and diluted with lysis buffer without np40 . gfp trap ( rothbauer et al , 2008 ) and a specific rabbit antiserum ( citterio et al , 2004 ) were used for immunoprecipitation of gfp fusions and endogenous np95 , respectively . gfp trap and protein g beads ( sigma , taufkirchen , germany ) were washed with dilution buffer containing increasing salt concentrations ( 150 and 300 mm , or 300 and 500 mm nacl for the high - salt condition ) and re - suspended in sdsthe following mouse monoclonal antibodies were used for immunoblotting : anti - his ( c - terminal , invitrogen , karlsruhe , germany ) , anti - dnmt3a ( clone 64b1446 , imgenex , san diego , ca , usa ) and anti - dnmt3b ( clone 52a1018 , abcam , cambridge , uk ) . np95 was detected with the same antiserum used for immunoprecipitation and a rabbit antiserum was used for detection of dnmt1 ( grohmann et al , 2005 ) . horseradish peroxidase - conjugated rabbit anti - mouse or goat anti - rabbit secondary antibodies ( sigma ) and ecl plus reagent ( ge healthcare , munich , germany ) were used for detection . escs were co - transfected with pcag - egfp - ib and pcmv - mrfp as described above and images from live cells were acquired at the indicated time points with an incell analyser 1000 ( ge healthcare ) using a 20 air objective ( na = 0.45 ) and standard filter settings for gfp and rfp . a total of 90150 images were acquired for each channel , using the same exposure time throughout the time course . pictures were processed using a gaussian blur algorithm ( radius ( sigma ) = 2 ) , and a threshold for maximal signal and minimal background coverage was adjusted and applied to each channel ( supplementary fig s4a online ) . the threshold was converted into area selection and the total size of the selected area was measured . escs were transfected as in the silencing assay with pcag - egfp - ib and pcmv - mrfp , and gfp - positive cells were sequentially sorted with a facsvantage or facsaria ii ( becton dickinson , heidelberg , germany ) at days 2 , 6 and 10 after transfection . after each sorting , total dna was isolated using the qiamp dna mini kit ( qiagen , hilden , germany ) and bisulphite treated with the ez dna methylation - gold kit ( zymo research , orange , ca , usa ) . the following primers were used for pcr amplification : cmv - forward tgggatttttttatttggtagt ; cmv - reverse atgggagtttgttttggtatta ; cag - forward ggagaggtgaggaggtagttaattaga and cag - reverse ccccaaacccctcaaaactt .\noutput:\n" }, { "from": "agent", "value": "recent studies have indicated that nuclear protein of 95 kda ( np95 ) is essential for maintaining genomic methylation by recruiting dna methyltransferase ( dnmt ) 1 to hemi - methylated sites . here , we show that np95 interacts more strongly with regulatory domains of the de novo methyltransferases dnmt3a and dnmt3b . to investigate possible functions , we developed an epigenetic silencing assay using fluorescent reporters in embryonic stem cells ( escs ) . interestingly , silencing of the cytomegalovirus promoter in escs preceded dna methylation and was strictly dependent on the presence of either np95 , histone h3 methyltransferase g9a or dnmt3a and dnmt3b . our results indicate a regulatory role for np95 , dnmt3a and dnmt3b in mediating epigenetic silencing through histone modification followed by dna methylation ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the differential diagnosis of paediatric skull and scalp lesions is broad and includes congenital , inflammatory , traumatic and neoplastic lesions . neoplasms of the scalp and skull in children comprise a heterogeneous assemblage which is quite different from that seen in adults . the incidence of malignant neoplasms in the scalp and scalp ranges from 0 to 7.7 % , a great majority of them are in fact believed to be metastatic rather than primary neoplasms . malignant fibrous histiocytoma ( mfh ) is the most common primary soft tissue sarcoma of late adult life and its occurrence is rare in the pediatric population . we present an unusual case of a primary mfh involving the scalp of a 5 - year - old child and discuss its unusual clinical presentation and its management . reviewing the literature of primary mfh of scalp , our patient , to the best of our knowledge , is probably the youngest case reported so far . a 5 - year - old girl child was brought to our centre by her caretakers for an increasing soft tissue swelling involving the right temporal region of her scalp for just about a year . clinical examination revealed a 108 cm soft tissue swelling , which was fixed to the underlying right temporal bone . the summit of the swelling showed a 64 cm necrotic ulcer with scabbing and occasional serous discharge . the swelling extended 3 cm lateral to the lateral canthus of the right eye in its medial aspect and was seen displacing the right pinna downwards in its inferior aspect . [ figure 1 ] a computerized tomography ( ct ) scan of the head and neck revealed the large extra cranial well enhancing soft tissue mass in the right temporal region which was seen eroding both the outer and the inner tables of the right temporal bone , but without any intra - dural or intracranial extension . [ figure 2 ] a trucut biopsy from the lesion suggested a diagnosis of a high grade mfh . a ct scan of the chest was normal and so were other hematological and biochemical parameters . she was taken her for an upfront radical surgery which entailed an enbloc wide excision of the tumor along with the underling temporal bone . the resultant soft tissue and bony defect was reconstructed by a scalp rotation flap and a skin graft to cover the donor site . [ figure 3a d ] the final histopathology revealed a fleshy tumor measuring 108.58 cm which on microscopy revealed a tumor consisting of sheets and fascicles of oval to spindle cells with moderate cytoplasm and hyper chromatic nuclei surrounded by collegenizedstroma . the final diagnosis with immunohistochemistry correlation was that of a spindle cell sarcoma high grade consistent with a mfh . [ figure 4a d ] the patient was offered adjuvant radiotherapy but her caretakers were not keen on the same . clinical photograph at presentation axial computerized tomography scan of the head and neck revealing the large extra cranial well enhancing soft tissue mass in the right temporal region which was seen eroding the right temporal bone a : intra operative photograph following wide excision of the tumor , ( bc ) specimen photograph showing the fleshy tumor excised with wide margins , ( d ) post operative clinical photograph following reconstruction with the local rotation flap ( a ) h and e x 20 - tumor consisting of sheets and fascicles of oval to spindle cells with moderate cytoplasm and hyper chromatic nuclei surrounded by collegenisedstroma , ( b ) ihc x 40 - tumor cells showing immunopositivity to vimentin , ( c ) ihc x 40 - tumor cells showing immunopositivity to cd 68 , ( d ) ihc x 40 - 40 % tumor cells showing immunopositivity to ki - 67mfh is a pleomorphic sarcoma of uncertain origin and is reported to be the most common soft - tissue sarcoma in adults with a peak incidence in the seventh decade . non - rhabdomyosarcoma soft tissue sarcomas which include mfh are a heterogeneous group of tumors , accounting for only about 3 % of all childhood malignancies . mfh is commonly known to arise in the extremities and the trunk although it can occur almost anywhere in the body because of its mesenchymal origin . there is paucity of literature with regards to the prevalence of scalp and skull neoplasms both in children and in adults . in a review of 75 pediatric patients with scalp and skull lesions , the common pathologic entities were langerhans cell histiocytosis , epidermal cysts , epidermoid / dermoids , hemangiomas , and neurofibromas , in descending order . the presenting symptoms of the various scalp and skull lesions are quite similar , regardless of the primary pathology . the most common presenting complaint is a visible or palpable mass or an ulcerated nodule . mfh typically exhibits a broad range of diversity in its histopathological appearances and has been classified into five subtypes : storiform - pleomorphic , giant cell , inflammatory , myxoid and angiomatoid types . the tumor subtype in our patient was storiform - pleomorphic , which accounts for up to 70 % of all the reported cases . the approach to the management of mfh in children , being rare is by and large extrapolated from the adult experience . surgery in the form of wide excision is the primary modality of management of mfh . adjuvant radiotherapy and chemotherapy have been used either alone or in various combinations in an attempt to better the survival outcomes ; however , no firm conclusions can be drawn with regards to their effectiveness . they have been more commonly used in patients with large unresectable tumors and in the setting of metastatic disease . the tumor cells in mfh have a tendency to grow along facial planes , thus making them more prone for local recurrences ; involvement of the skeletal muscle heightens the chances of local recurrences from 27 % to about 43 % . metastatic disease has been reported in 0 - 43 % of the pediatric mfh and 5 - 41 % of adult mfh , the most common site of metastasis being the lung ( 90 % ) , followed by lymph nodes , ( 35 % ) bones ( 8 % ) and liver ( 1 % ) . the adverse prognostic factors include high histological grade , tumor size of 5 cm and deep seated tumors . interestingly the survival rates in children with mfh is better than that in their adult counterparts . in conclusion , a primary mfh should to be considered as a rare differential in the evaluation of pediatric skull and scalp lesions ; such a clinical scenario warrants an aggressive surgical approach with selected use of adjuvant therapies and a prolonged surveillance .\noutput:\n" }, { "from": "agent", "value": "malignant fibrous histiocytoma ( mfh ) a pleomorphic sarcoma of uncertain origin was first described by obrien and stout in 1964 . it is the most common primary soft tissue sarcoma of late adult life ; its occurrence is rare in the pediatric population . mfhs are commonly known to arise in the extremities and the trunk although it can occur almost anywhere in the body . mfh of the scalp is extremely rare ; moreover , there is paucity of literature with regards to prevalence of scalp and skull neoplasms . we present an unusual case of a primary mfh involving the scalp of a 5 - year - old child and discuss its unusual clinical presentation , histology with immunohistochemistry correlation and its management . reviewing the literature of primary mfh of the scalp , our patient to the best of our knowledge , is probably the youngest case reported so far ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: high blood pressure is commonly found in patients with chronic kidney disease and renovascular hypertension is a common form of secondary hypertension and frequently resistant to pharmacologic treatment . in the two - kidney , one clip ( 2k1c ) goldblatt model , renovascular hypertension is induced by unilateral renal artery stenosis , which reduces renal perfusion of the clipped kidney and causes increased renin release and circulating angiotensin ii ( ang ii ) . ang ii , which is the main effector peptide of the renin - angiotensin system ( ras ) , has marked hemodynamic , cardiac , and renal effects , as previously observed by our laboratory in mice . in addition , it also exerts tissue - specific responses as it can be locally synthesized . although it is controversial , the existence of a local bone marrow ( bm ) ras has been demonstrated in rats . because the bm is a highly organized , complex organ , that is , the principal hematopoietic tissue in adults , locally bm - formed ang ii may be an autocrine or paracrine peptide that affects physiological and pathological hematopoiesis . studies have demonstrated that ang ii plays a role in oxidative stress development in the spontaneously hypertensive rat and in the renovascular hypertensive rat . reactive oxygen species ( ros ) play a crucial role in ras signaling in bm cells . in addition , studies in experimental animals have shown that augmented ros , particularly superoxide ( o2 ) , can interact with dna , which results in oxidative damage and dna fragmentation - mediated cellular injury . taken together , this evidence strongly supports the importance of the 2k1c murine experimental model to investigate the influence of hypertension on dna damage . therefore , in the present study , we tested the hypothesis that 2k1c - mediated hypertension increases ros production and induces dna damage in murine bm mononuclear cells ( mnc ) . experiments were performed in male c57bl / 6 ( c57 ) mice , which present a single renin gene , weighing 23 g on average , and that were bred and maintained in the laboratory of transgenes and cardiovascular control animal facility ( vitoria , es , brazil ) . animals were housed in individual plastic cages with controlled temperature ( 22c ) and humidity ( 60 % ) and were exposed to a 12 : 12 h light - dark cycle . all of the experimental procedures were performed in accordance with the national institutes of health ( nih ) guidelines , and study protocols were previously approved by the institutional animal care and use committee ( ceua - emescam protocol no . we used a mouse model of 2k1c angiotensin - dependent hypertension , as previously described . briefly , the animals were anesthetized ( ketamine / xylazine 91/9 .1 mg / kg , i.p . ) and kept on a heating pad that maintained the body temperature at 37c to avoid hypothermia . the left renal artery was exposed through a retroperitoneal flank incision and was carefully isolated from the renal vein , nerves , and connective tissues . a u - shaped stainless steel clip with a 0.12 mm opening width was placed around the renal artery close to the abdominal aorta , which resulted in partial renal perfusion occlusion . the wound was sutured , and the animal received a single injection of benzylpenicillin benzathine ( 7 mg / kg , i.m . ) followed by recovery under care for 24 h. control mice underwent the same surgical procedure except for the renal artery clip placement ( sham ) . fourteen days after the renal artery clipping ( 2k1c ) or sham operations , the animals were anesthetized with a combination of ketamine / xylazine ( 91/9 .1 mg / kg , i.p . ) and the right common carotid artery was exposed and isolated through a cervical incision . a catheter ( 0.040 mm od 0.025 mm i d ; micro - renathane ; braintree scientific ) was filled with heparin solution ( 50 ui / ml saline ) and prior to insertion into the right carotid artery , which was subcutaneously tunneled and brought out at the nape of the neck . immediately after surgery , animals received a single benzylpenicillin benzathine ( 7 mg / kg , i.m . ) injection . the catheter was connected to a pressure transducer ( cobe laboratories , usa ) , which was plugged into a pressure - processor amplifier and data acquisition system ( mp100 , biopac systems , usa ) for mean arterial pressure ( map ) and heart rate ( hr ) recordings . after 48 hours , map and hr direct recordings were obtained while the animals were conscious and moving around freely in their cage . after hemodynamic measurements , blood was drawn through the arterial line into tubes containing edta and protease inhibitor cocktail ( product no . p2714 , sigma - aldrich ) ; the samples were centrifuged at 9.5 g for 15 min in a refrigerated centrifuge ( 4c ) to remove plasma for later analysis . plasma ang ii was quantified by reverse phase high - performance liquid chromatography ( hplc ) . briefly , peptides were initially separated in a reverse phase aquapore ods 300 column 7 m ( 4.6250 mm ) ( applied biosciences , foster city , ca , usa ) using a linear mobile phase gradient from 5 to 35 % ( acetonitrile in 0.1 % phosphoric acid ) for 40 min using a 1.5 ml / min flow rate . ang iii ( 320 ng ) was added to each sample as an internal standard , and the peptides were detected at 214 nm absorbance . ang ii was extracted using sep - pack - c18 column chromatography ( millipore , ma , usa ) and was activated with 5 ml methanol , 5 ml tetrahydrofuran , 5 ml hexane , and 10 ml h2o ( milliq ) . after activation , the samples were run through the column and eluted with ethanol : acetic acid : h2o ( 90 : 4 : 6 , v / v ) . the last phase eluate containing ang ii was evaporated in a speed vac sc 110 ( savant instruments , holbrook , ny , usa ) and reconstituted with 500 l 0.1 % phosphoric acid in 5 % acetonitrile , filtered , and injected onto the hplc analytical column . retention time was used to identify peaks of interest , which had been previously determined by standard peptide elution . the calculations were based on peak area , and ang ii concentration was expressed as pmol / ml blood . mice were euthanized with a sodium thiopental overdose ( 100 mg / kg , i.p . ) and marrow samples were collected from femurs and tibias that had been dissected and cleaned of all soft tissues . after removing the epiphyses and gaining access to the marrow cavities , whole bm was flushed out using a 26 - gauge needle attached to a 1 ml syringe filled with dulbecco 's modified eagle medium ( dmem ; sigma , st . mncs were isolated by density - gradient centrifugation ; the bm suspension in 4 ml dmem was loaded on 4 ml histopaque 1083 ( sigma - aldrich ) and centrifuged for 30 min at 400 g. the bm - mnc fraction was subsequently collected and washed in phosphate - buffered saline ( pbs ) . a small volume of the resulting suspension was mixed with 0.4 % trypan blue to perform cell count and viability analysis . lymphocytes and undifferentiated cells were analyzed using a neubauer chamber . bone marrow mnc dna damage was analyzed by the alkaline comet assay as described by singh et al . with minor modifications . regular microscope slides were precoated with 200 l 1.5 % normal melting point agarose in distilled water , at 60c ( sigma - aldrich ) , dried overnight at room temperature , and then stored at 4c until use . subsequently , 210 mncs were mixed with 100 l 1 % low melting point agarose in pbs at 37c ( invitrogen , spain ) and spread on the agarose - coated slides using a coverslip . after gelling at 4c for 20 min , coverslips were removed , and the slides were immersed in freshly prepared cold lysis solution ( 2.5 m nacl , 100 mm edta , 10 mm tris at ph 1010.5 , with freshly added 1 % triton x-100 and 10 % dmso ) at 4c for 1 h. after a 5 min wash in cold distilled water , the slides were placed in an electrophoresis chamber , which was then filled with fresh alkaline buffer ( 300 mm naoh , 1 mm edta , ph 13 ) for 20 min at 4c . electrophoresis was performed at 300 ma and 25 v for 30 min . the slides were washed three times for 5 min with 0.4 m tris buffer , ph 7.5 , for neutralization . finally , 100 l 20 g / ml of ethidium bromide ( sigma - aldrich ) was added to each slide , covered with a coverslip , and analyzed at a 20x magnification using a fluorescence microscope ( olympus bx60 , united kingdom ) that had been equipped with excitation ( 510550 nm ) and barrier ( 590 nm ) filters . dna damage was evaluated using visual classification of comets into five levels according to comet tail size from 0 ( undamaged with no tail ) to 4 ( maximally damaged with long tail ) . three hundred randomly selected cells ( 100 cells from each of three replicate slides ) were analyzed from each animal , and three au values were generated for each animal , which were averaged to obtain the final result per animal . the group damage index ( di ) ranged from 0 , in which all of the cells were undamaged ( 300 cells 0 ) , to 1200 , in which all of the cells were maximally damaged ( 300 cells 4 ) . the damage frequency ( % ) was calculated based on the number of cells with tails versus those without tails and the % dna damage was the fraction of each damage level relative to all of the comets that were analyzed . hydroethidine is freely cell permeable and is rapidly oxidized by superoxide to ethidium , which binds to dna and amplifies the red fluorescence signal . to estimate the o2 content in the cell suspension , 10 bm - mncs were stained with 160 m dhe , followed by a 30 min incubation at 37c in the dark to facilitate dye loading . dhe - loaded cells were treated with 10 mm h2o2 to oxidize the dye as a positive control . after 5 min of h2o2 treatment , the bm - mncs were washed with pbs and cellular ros levels were analyzed immediately with a facscanto ii flow cytometer ( becton dickinson , san juan , ca , usa ) . ten thousand events were recorded from each sample , and forward and side scatter gates were used to select single cells from clumps and debris . specific fluorescence intensity was expressed as the median fluorescence intensity from the average of at least three repeated experiments in a.u . red fluorescence was detected between 564 and 606 nm using a 585/42 bandpass filter . the flow cytometry data are expressed as median fluorescence intensity ( mfi ) coefficient of variation ( cv ) of 3 repeated and statistically reproducible ( friedman test ) measurements of at least five independent animals . statistical analysis was performed using student 's t - test for comparison of two independent groups , and two - way analysis of variance ( anova ) followed by the bonferroni 's post hoc test was used for comparison of more than 2 groups . the mann - whitney test was used to compare the rank sum for the mfis from the oxidative stress experiments . initial body weight was statistically similar among the groups . at the end of the experiments , body weight was reduced and ventricular weight was increased in the hypertensive group compared with the sham group ( table 1 ) . the hypertensive group also showed a significant increase in ventricular weight compared with the sham group . fourteen days after clip application , the left kidney was atrophic , while the right kidney displayed compensatory hypertrophy in the 2k1c mice . figure 1 shows the average values of direct resting map and hr measurements in conscious animals 14 days after renal artery clipping . as expected , map was 40 % higher ( p 0.01 ) in the 2k1c than in the sham mice . hypertension in the 2k1c mice was accompanied by tachycardia when compared with the sham mice . plasma ang ii concentration was 4.5-fold greater ( p 0.01 ) in the 2k1c than in the sham mice as measured by hplc . we first assessed the effect of ang ii - dependent hypertension on bm - mnc viability and number using a neubauer chamber after bm separation with a density gradient . cell viability was assessed using the trypan blue exclusion method , and no differences were found between the groups ( sham : 970.54 % versus 2k1c : 960.54 % ) . to investigate whether the mnc number was reduced in the 2k1c mice compared with the sham mice , we quantified lymphocytes and undifferentiated cells . as shown in figure 2 , the 2k1c mice had increased lymphocyte counts ( 62 % ) with a simultaneous reduction in undifferentiated cell number ( 18 % ) compared with the control animals . the comet assay is a versatile and sensitive method for quantifying and analyzing dna fragmentation in individual cells that can be used to assess oxidative dna damage . the basic principle of the comet assay is dna electrophoresis in an agarose matrix . because the fragmented dna migrates , the cells look like a comet under microscope with a head containing intact dna and a tail containing dna fragments . genomic dna fragmentation incidence was visually analyzed according to comet appearance . to elucidate ang ii - dependent hypertension effects on bm - mnc , dna damage was scored into five classes according to tail size and the relative tail dna content indicates the amount of dna damage . a significant predominance of low genotoxicity levels 0 and 1 in the sham animals ( level 0 : 283.4 and level 1 : 402.4 % ) compared with the 2k1c mice ( level 0 : 74.4 and level 1 : 71 % ) was observed . in contrast , severe genotoxicity levels 3 and 4 prevailed in the 2k1c mice ( level 3 : 363.2 and level 4 : 276 % ) compared with the sham mice ( level 3 : 70.4 % and level 4 : 20.4 % ) . moreover , dna fragmentation was quantified using the dna damage index and frequency ( figures 3 ( a ) and 3 ( b ) ) . the 2k1c mice had increased dna damage as indicated by a higher damage index ( sham : 34519 versus 2k1c : 80655 a.u . ) and frequency ( sham : 723 % versus 2k1c : 934 % ) . the above findings led us to further investigate the effects of ang ii - dependent hypertension on ros production in bm - mnc . dhe is a membrane - permeable blue fluorescent dye that rapidly accumulates in the cytoplasm , where it is oxidized by o2 , resulting in red nuclear fluorescence that can be measured by flow cytometry . in figure 4 , representative histograms ( figure 4 ( a ) ) and average ( bar graphs ) o2 production values are shown . as demonstrated by the right shift and in the bar graph , dhe median fluorescence intensity ( mfi ) values were significantly higher in the 2k1c than in the sham group ( 168565809 versus 2051336 a.u . , the main finding of this study was marked dna fragmentation in bm - mnc from ang ii - dependent hypertensive mice , most likely because of augmented o2 production and consequent oxidative stress . further studies including other experimental models should be designed to discriminate the relative influence of hypertension and ang ii on this process . renal artery clipping is accompanied by activation of the ras and hemodynamic alterations . higher levels of plasma renin and ang ii in 2k1c mice have been observed between 7 and 14 days after clipping and have returned to normal values by day 28 . based on these observations and on a previous publication from our laboratory2k1c mice exhibited high blood pressure levels accompanied by tachycardia , in agreement with previous studies . in this study , we confirmed the high plasma ang ii , corroborating the concept that ras activation plays a pivotal role in hypertension development in this murine model . in addition to the pressor and positive chronotropic effects , ang ii also stimulates cardiomyocyte protein synthesis , which in addition to hypertension may explain the cardiac hypertrophy that we observed in the 2k1c hypertensive mice . on the other hand , future studies should consider the measurement of protein levels of the ventricles as an index of hypertrophy . taken together , these data suggest that the 2k1c mouse exhibits the main features of endogenous ang ii - dependent hypertension at this time point . in addition to the systemic actions of the ras , many tissues and organs have a local ras , which can have paracrine , autocrine , and intracrine functions . bm is the major reservoir for adult organ - specific stem cells , including endothelial progenitor cells ( epcs ) , hematopoietic stem cells ( hscs ) , and mesenchymal stem cells ( mscs ) . in this context , the presence of a complete local bm ras that affects physiological and pathological blood cell production was hypothesized by haznedaroglu et al . andhas recently been confirmed . in our study , we found augmented lymphocytes and diminished numbers of undifferentiated bm cells in 2k1c hypertensive mice . considering the presence of ras components in hscs and stromal / mscs , it is reasonable to propose that ras may also be locally activated in bm of ang ii - dependent hypertensive mice . accumulating evidence suggests that the local ras is actively involved in bm cells proliferation , differentiation , and death . of note , ang ii affects the entire bm - mnc pool , such as epcs , hscs , and mscs . as recently demonstrated , ang ii consistently decreases the number of cultured epcs through activation of at1 receptors and induction of apoptosis . in addition and considering that 2k1c hypertensive mice exhibit endothelial dysfunction , ang ii could activate inflammatory cells or cytokine production , which may be responsible for cell recruitment in inflammation . moreover , this vasoactive peptide directly stimulates erythropoiesis by augmenting erythropoietin hormone production , which regulates erythrocyte differentiation , through at1 receptors . accordingly , da cunha et al . and cassis et al . reported that angiotensin converting enzyme ( ace ) inhibitors and at1 receptor antagonist treatments cause anemia , demonstrating hematopoietic side effects of ras blockers and indicating that ang ii plays an important role in hematopoiesis . taken together , experimental evidence suggests that ang ii exhibits important hematopoietic effects by stimulating erythroid , myeloid , and lymphoid differentiation , resulting in augmented lymphocyte number and simultaneously diminished undifferentiated cell number . there is growing evidence that increased oxidative stress , which results in excessive ros generation , plays a role in cardiovascular diseases including hypertension , as recently reviewed by us and others . because there is a link between ros and ras signaling , a key mechanism by which ang ii influences heart and vessel function could be via its ability to activate ros production . we observed pronounced dhe mfi augmentation in bm - mnc in the 2k1c hypertensive mice compared with sham normotensive mice . the relationship between oxidative stress and increased blood pressure has been reported in many hypertensive animal models , including the shr , doca - salt , the 2k1c , and the 1k1c , which have excessive o2 production due to augmented nad ( p ) h oxidase activity . interestingly , in the p47phox knockout mouse with concurrent 2k1c hypertension augmented ros production occurs via expression of this nad ( p ) h oxidase subunit . this enzyme can be activated by hemodynamic forces and vasoactive agonists , for example , ang ii , which is a powerful vasoconstrictor involved in hypertension pathogenesis that uses ros as an intracellular signaling mediator . in addition , it seems that ang ii induces the increase of ros production in epcs and that this oxidative stress accounts for the ang ii - mediated reduction of epc number , as this effect can be blocked by cotreatment with an antioxidant and it increases gp91phox expression in epcs , which may contribute to oxidative stress . as discussed above , the role of ang ii goes beyond controlling circulatory homeostasis as discussed above in the impact of this peptide in ros production , which is stimulated by nad ( p ) h oxidase activation . recent experimental studies have shown that , at high concentrations , ross such as o2 are capable of direct protein and lipid oxidation , which causes dna fragmentation . dna damage , which frequently occurs in cells exposed to oxidative stress , is a form of cellular injury that contributes significantly to the development and progression of cardiovascular disorders . the comet assay has been used to determine dna fragmentation in blood cells in murine models of spontaneous atherosclerosis and renovascular hypertension . however , this is the first time that the comet assay has been used to assess dna fragmentation in bm - mnc from 2k1c mice . our results clearly demonstrated augmented dna fragmentation in bm - mnc from the 2k1c mice compared with the sham mice . augmenteddna damage has also been demonstrated in other animal models of hypertension , including kidney cells from doca - salt rats and mouse infused with ang ii . furthermore , dna damage caused by ros occurs more commonly in hypertensive than in normotensive patients and can be reduced by antioxidant drugs . of note , in the perfused mouse kidney , dna damage was caused by ang ii , not by induced vasoconstriction , since another vasoconstrictor did not cause dna damage . moreover , ang ii induces genomic damage in cultured kidney cells most likely via oxidative mechanisms , which can be prevented by at1 receptor antagonists and by antioxidants . the 2k1c mice had increased o2 production , which is a highly reactive and short - lived radical that is responsible for ros generation and can interact with nearby molecules , such as dna ; thus , our data suggest that ros plays a key role by inducing dna oxidative damage in this model of ang ii - dependent hypertension . in conclusion , we demonstrated that arterial hypertension induced by endogenous ras activation by clipping the renal artery for two weeks ( the 2k1c mouse model ) results in a marked increase in ros production with consequent bm - mnc dna damage . we speculate that ang ii effects may be due to circulating and local bm ras ; therefore , both systems may play a crucial pathobiological role in the dna damage observed in bm - mnc of 2k1c hypertensive mice . taking into account that bm - derived cells are responsible of maintaining , generating , and replacing differentiated cells as a consequence of physiological cell turnover or tissue damage due to injury , the data obtained by this study suggested that comorbidities , specifically ang ii - dependent hypertension , have to be particularly considered if autologous transplantation is intended , since the donor tissue ( i.e. , bone marrow ) might be altered in its functionality .\noutput:\n" }, { "from": "agent", "value": "it has been proposed that the nonhemodynamic effects of angiotensin ii are important for the damage observed in the two - kidney , one - clip ( 2k1c ) renovascular hypertension model . much evidence confirms that angiotensin ii is directly involved in nad ( p ) h oxidase activation and consequent superoxide anion production , which can damage dna . the current study was performed to examine the effects of angiotensin - ii - dependent hypertension in bone marrow mononuclear cells ( bm - mnc ) ; dihydroethidium staining was used to assess reactive oxygen species ( ros ) production , and the comet assay was used to assess dna fragmentation in 2k1c hypertensive mice 14 days after renal artery clipping . in this study we demonstrated that 2k1c hypertensive mice have an elevated lymphocyte count , while undifferentiated bm - mnc counts were diminished . 2k1c mice also showed an augmented ros production and marked bm - mnc dna fragmentation . in conclusion , endogenous renin angiotensin system activation - induced arterial hypertension is characterized by excessive ros production in bm - mnc , which might cause marked dna damage ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cutaneous head and neck melanoma is a challenging disease owing to its aggressive nature and often times advanced stage at presentation . age , sex , and subsite are three prognostic indicators which can be determined prior to treatment or testing , and can allow the practitioner to counsel the patient before initiating therapy . it appears that patients older than 65 have a decreased overall 5 year survival compared to their younger counterparts . male patients have poorer prognosis compared to female patients as noted by the decreased overall survival , decreased disease specific survival , and shorter time to distant metastasis . scalp subsite was most uniformly accepted as having the worst prognosis in the head and neck , and may even serve as an independent prognostic indicator . advanced age , male sex , and scalp subsite all portend poor prognosis in patients with cutaneous head and neck melanoma . melanoma is a malignant tumor of the melanocytes , cells responsible for producing the pigment melanin ( 1 ) . while it has been described to affect both cutaneous and mucosal surfaces , cutaneous melanoma has been examined more closely than its mucosal counterpart , and more information has been reported in the oncologic literature . cutaneous melanoma is most commonly found in the head and neck region and accounts for up to 20 % of all cutaneous melanoma each year ( 2 - 5 ) . risk factors for the development of cutaneous head and neck melanoma ( chnm ) include sun exposure , lighter skin tone , and number of nevi ( 6 - 9 ) . immunosuppression , environmental exposures , and personal history of non - melanoma skin cancer have also been suggested to increase risk ( 10 , 11 ) . in the united states and other industrialized countries , the incidence of cutaneous melanoma has been increasing , especially in the caucasian population ( 12 ) . although the exact reason for this increase is unknown , it has been suggested that increased amounts of leisure time in industrialized countries has led to greater time spent outdoors . despite the known risk of skin cancer , a study by scerri et al . reported that 48 % of people feel that sun tanning and increased sun exposure is not harmful as long as sunburn does not occur ( 13 ) . careful examination of the asymmetry , border , color , diameter , and evolution of skin lesions are all crucial in determining the likelihood of pigmented lesions being melanomatous ( 6 ) . of these , irregular border has been shown to be the strongest predictor of malignancy ( 14 ) . typically , excisional biopsy with wide margins is recommended ; however , in the case of larger lesions , a core biopsy may suffice . as chnm poses a significant challenge to the patient and practitioner alike , prognostic factors can be extremely helpful in determining a thoughtful , patient - centered care plan . ulceration , melanoma sub - type , tumor thickness , and presence of distant metastasis all portend a poor prognosis ( 15 ) . multiple studies of sentinel lymph node status in head and neck melanoma have suggested a shortened disease free survival in patients with positive sentinel lymph nodes and as such , have recommended sentinel node biopsy for certain lesions for staging and prognostication ( 15 , 16 ) . recently , specific studies addressing the prognostic value of age , sex , and subsite were performed and have suggested significant prognostic value in each of the abovementioned parameters . as these three sources of information are readily apparent at the initial examination , they could provide valuable information for patient counseling prior to initiating therapy . this paper seeks to collate the recent literature and provide a succinct discussion of the value of age , sex , and subsite in the prognosis of chnm . a full discussion of all prognostic factors is beyond the scope of this paper ; the reader is referred to the oncologic literature for a comprehensive reading source . using keywords such as melanoma , head and neck , prognosis , age , sex , and subsite , a thorough pubmed search was conducted to find high quality articles pertaining to the central theme of this paper . articles from the past 10 years were gleaned for pertinent information , and subsequently reviewed by each of the authors . articles deemed to provide valuable information to the topic were isolated for further analysis and included in the content of the current study . understanding the prognostic value of age , sex , and subsite allows the practitioner to counsel melanoma patients prior to undergoing treatment . although there are many other prognostic factors as previously mentioned , these are among the few factors that do not require any additional workup or testing . age is often times not reported as a prognostic factor , but rather as an epidemiologic marker of certain malignancies .17 ) report that chnm typically occurs in patients older than 70 . despite the greater incidence in this age group , previously there were no studies done analyzing age at presentation and outcome . stokes et al . ( 18 ) performed a study using the surveillance , epidemiology , and end results ( seer ) database examining age , sex , site , stage , and histology . patients were grouped into 3 age categories , 1 - 44 , 45 - 64 , and 65 + . they were also classified as being early ( stages 1 and 2 ) or late ( stages 3 and 4 ) . their study included 12,195 patients with chnm , and revealed that patients older than 65 more commonly presented with early stage chnm compared with the two younger groups ( p 0.001 ) ( 18 ) . it also appeared that the 45 - 64 and 65 + categories were male dominated . overall survival was calculated as compared to age - matched cancer free controls and reveals a statistically significant drop in 5 - year overall survival for each consecutive age group compared to the previous . using a multivariate regression model , the study found that increased age is an independent poor prognostic variable for chnm ( 18 ) . in a review of head and neck melanoma , cheriyan ( 6 ) state that men are at higher risk for chnm than women ( 6 , 19 , 20 ) . however , similar to age , sex has never been independently studied as a prognostic variable in chnm . in a 2014 study by arce et al . ( 21 ) , 13,507 patients with chnm were examined , of which approximately 30 % were female and 70 % male . males were found to present with higher stage tumors ( p 0.001 ) and at more advanced ages ( p 0.001 ) than their female counterparts ( 21 ) . interestingly , the 5 - year disease specific survival for females was 90.4 % compared to 87.1 % for males . females were found to be 23 % less likely to die from chnm than males ( 21 ) . in a study of approximately 27,000 patients with chnm , tseng et al . ( 4 ) found similar findings , also suggesting that female sex was associated with a better overall survival and prognosis compared to male patients . ( 22 ) specifically analyzed overall survival difference between men and women with cutaneous melanoma . although their study was not limited to chnm , they concluded that female gender conferred significantly improved overall survival , disease specific survival , and time to distant metastasis . studies suggest that cutaneous melanoma affecting the head and neck already has a worse prognosis than cutaneous melanoma of the remainder of the body with significantly lower overall survival ( 5 , 23 - 25 ) . to specifically analyze prognosis of subsite within the head and neck , de giorgi ( 26 ) reviewed 67 patients with chnm and stratified them into one of two groups , those with scalp lesions ( 8 patients ) and those with face or neck lesions ( 59 patients ) . the 5 - year overall survival for patients with scalp chnm was 66.7 % while the 5 - year overall survival for patients with face / neck chnm was 81.8 % . patients with scalp malignancy had an increased risk of death compared to other subsites ( 26 ) . ( 27 ) examined a series of 83 patients with chnm stratified by stage , location , and thickness . they found that ear and scalp chnm portended the worst prognosis in chnm ( 5 - year approximately survival 30 % - 40 % ) compared to 78 % for face chnm and 58 % survival for neck chnm ( 27 ) . an independent study from md anderson cancer center in 1970 stated that the scalp subsite has the poorest prognosis and is an independent poor prognostic factor in chnm ( 28 ) . in 2006 , these findings were further delineated by leong et al . who claimed that scalp chnm had the highest recurrence rate and had three times greater mortality than any other subsite of the head and neck ( 29 ) . lachiewicz seer database study of 50,000 patients revealed that scalp and neck chnm were the poorest prognostic indicators when compared to other head and neck subsites ( 25 ) . based on articles over the past 25 years , it appears that advanced age greater than 65 , male sex , and scalp subsite are poor prognostic indicators in patients with cutaneous head and neck melanoma . practitioners should be aware of these indicators of outcome and provide appropriate information to patients during their pre - treatment counseling . it appears that age , sex , and subsite are important prognostic factors when evaluating patients with cutaneous head and neck melanoma . male sex , age greater than 65 , and scalp subsite confer poor prognosis and lower 5 year overall survival when compared to females , patients younger than 65 , and those with cutaneous melanoma of the face or neck . patients with ear chnm have also been reported to have poor prognosis , but the literature is less robust than the claims made for scalp chnm .\noutput:\n" }, { "from": "agent", "value": "contextcutaneous head and neck melanoma is a challenging disease owing to its aggressive nature and often times advanced stage at presentation . age , sex , and subsite are three prognostic indicators which can be determined prior to treatment or testing , and can allow the practitioner to counsel the patient before initiating therapy.evidence acquisitiona pubmed search was conducted utilizing various terms relating to the subject matter . articles over the past 25 years were analyzed and appropriately selected for review.resultsit appears that patients older than 65 have a decreased overall 5 year survival compared to their younger counterparts . male patients have poorer prognosis compared to female patients as noted by the decreased overall survival , decreased disease specific survival , and shorter time to distant metastasis . scalp subsite was most uniformly accepted as having the worst prognosis in the head and neck , and may even serve as an independent prognostic indicator.conclusionsadvanced age , male sex , and scalp subsite all portend poor prognosis in patients with cutaneous head and neck melanoma ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it usually presents at , or soon after birth with hyperkeratotic verrucous dark - brown ridges . porcupine men and systematized epidermal naevus have also been used to describe these lesions . based on the pattern of distribution , five clinical variants namely brocq type , lambert type , curth - macklin type , rheydt type and bfverstedt type have been described . we report a case of curth - macklin variant of ichthyosis hystrix with the absence of family history . it has been described to run in families as an autosomal dominant trait , very few sporadic cases of the entity have been described in the literature . an 11 - year - old male child presented with asymptomatic , dark - brown , spiny , hyperkeratotic , verrucous scales and ridges all over body since birth . the patient gave history that scales shed after scrubbing and reappear in 5 - 7 days . there was no history of parental consanguinity , collodion presentation at birth , blistering or erythroderma . the affected skin showed symmetrically distributed , generalized , thickened , verrucous , dark - brown cobblestone - like lesions [ figure 1a ] . there was sparing of scalp and central part of face with involvement of ear [ figure 1b ] . axillary region , dorsum of hand , popliteal fossa and antecubital fossa were less markedly affected [ figures 1a and 2a ] . ( a ) generalized dark - brown , spiny , hyperkeratotic , verrucous scales and ridges . ( b ) involvement of ear with sparing of central part of face ( a ) spiny scales with relative sparing of dorsum of hand . nails are normal ( b ) keratoderma and fissuring of sole skin biopsy ( h and e staining ) showed hyperkeratosis , acanthosis and papillomatosis with thick granular layer [ figure 3a ] . perinuclear vacuolization and coarse keratohyaline granules were seen in upper spinous layers [ figure 3b ] . ( a ) h and e staining , 40 showing hyperkeratosis , acanthosis and papillomatosis with thick granular layer ( b ) h and e staining , 100 showing hyperkeratosis with perinuclear vacuolization and coarse keratohyaline granules seen in an upper spinous layerichthyosis hystrix is a poorly defined entity which encompasses disorders displaying striking hyperkeratotic verrucous brown ridges . it is an extremely rare disorder , reported in only a few families and sporadic cases . five clinical variants have been described : brocq type , lambert type , curth - macklin type , rheydt type and bfverstedt type . the distinctive distribution of lesions , associated abnormalities and inheritance patterns help to differentiate between these forms . in brocqbfverstedt type was described in a single case which had striking follicular hyperkeratosis and mildly affected palms . lambert type , seen in the lambert family with 11 affected members across four generations , has no blistering with sparing of face , palms and soles . two large families with autosomal dominant inheritance and very few sporadic cases have been reported since its first description in 1954 . it results from heterozygous frameshift mutation in keratin 1 gene ( krt1 ) , and a new mutation for this disease has recently been reported . recently , it has been suggested to rename the entity as ichthyosis curth - macklin and group it under keratinopathic ichthyoses , along with epidermolytic ichthyosis and superficial epidermolytic ichthyosis . there is wide variability in its time of onset and clinical presentation , which varies even within families . it is characterized by massive palmo - plantar keratoderma leading to deep , bleeding , and painful fissures . there is development of hyperkeratotic , ridged or cobblestoned plaques over the large joints and / or hyperkeratotic papules on trunk and extremities . histopathological features include hyperkeratosis , acanthosis , and papillomatosis , along with the characteristic findings of perinuclear vacuolization and binucleate keratinocytes . the clinical and histopathologic findings in our patient were consistent with those of ichthyosis curth - macklin . this can be further confirmed by electron microscopy which also reveals keratin intermediate filaments aggregated into continuous , peripheral shells , without keratin clumping typical for epidermolytic hyperkeratosis . the same could not be performed in our patient due to lack of such facilities . however , it was ruled out by absence of history of blistering at birth and presence of very thick palmoplantar hyperkeratotic scales . our case , with severe palmoplantar keratoderma , generalized involvement with relative sparing of face and scalp , along with absence of blistering , erythroderma and deafness , and no family history of ichthyosiform disease , are suggestive of sporadic type of ichthyosis curth - macklin which is a very rare entity .\noutput:\n" }, { "from": "agent", "value": "ichthyosis hystrix is a rare autosomal dominant genodermatosis , characterized by persistent spiny hyperkeratotic scales which cover a significant part of the skin surface . based on the pattern of distribution , five clinical variants namely brocq type , lambert type , curth - macklin type , rheydt type and bfverstedt type have been described . we report the case of an 11 - year - old male child with spiny , hyperkeratotic scales all over the body since birth with sparing of scalp and central part of the face . palmoplantar keratoderma was also present . these clinical features are suggestive of ichthyosis curth macklin , which has been typically described in families . however , family history was negative in our patient . the case is being reported on account of rarity of the disease , that too with a very rare sporadic presentation ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: domestic cattle , or bos taurus , are useful organisms for genomic studies . as ruminants , they occupy an important position in the evolutionary tree and display interesting phenotypic characteristics . additionally , domestic cattle have been bred under human - enforced selection for centuries ; thus , the well - studied variations among breeds and recorded lineage provide a supplement to genetic data . one obvious point to begin genomic analysis of domestic cattle is the digestive system . like other ruminants , bos taurus has four stomach - like compartments , as opposed to the single stomach in many other mammals . this particular morphologic / phenotypic characteristic of ruminants and the physiological studies resulting from its prominence provide hypotheses for genetic analysis . the bovine genome sequencing project ( bgsp ) is developing a number of genetic resources for bos taurus in addition to sequencing the bovine genome . one of these resources , the national center for biotechnology information 's ( ncbi ) unigene database , contains data on gene expression localized to selected body sites , which mostly correspond to organs , of bos taurus . this expression data , when coupled with the mean stochastic rate of mutation assumed in evolutionary genomics , provides insight on selection constraint , evolutionary age , and evolutionary relationships among these body sites . in addition , this data provides information on specific expressional differences among body sites . when linked by annotated information with unigene data obtained from other species , this data provides insight into evolutionary relationships and specific expressional differences among the body sites of different species . a number of physiological and genetic studies of the evolutionary relationships between the members of artiodactyla have been published ; however , the exact nature of these relationships is still disputed . current theory maintains that artiodactyla diverged into multiple groups . of these groups , only ruminantia and camilidaeare considered true ruminants , and they are considered to be a case of convergent evolution . suborder ruminantia diverged into pechora and tragulina ; among other differences , the former has a fully developed omasum and the latter has a poorly developed , pseudo - omasum . due to physiological characteristics of ruminant digestion , physiological comparisons among members of ruminantia , and genetic sequence analysis , it is believed that the abomasum is evolutionarily the oldest stomach compartment and that the omasum is evolutionarily the youngest stomach compartment . additionally , it is suggested that the stomach - like organ and the foregut underwent a period of relaxed selective constraint shortly after the evolutionary foregut formation event . in this study , the evolutionary relationships among the organs of the bovine digestive system were examined and compared against a set of control body sites consisting of tissues and organs . in addition , cross - species comparisons were conducted against homo sapiens and mus musculus using unigene data linked by annotated information . this analysis confirms the relative evolutionary ages of the four stomach - like organs of the bovine digestive system suggested by langer . additionally , this analysis indicates a period of relaxed selective constraint , lends support to a potential mechanism for rumination , and elucidates some differences in gene expression among digestive organs in the three species . the evolutionary relationships among the digestive organs of the ruminants have been previously suggested . however , little evidence for these relationships has been provided at the molecular and functional level . taking advantage of the recently developed gene expression database for b. taurus , the evolutionary relationships among different functional compartments , that is , organs and tissues , can be determined using gene expression profiles and the assumption of a mean , stochastic rate of evolution . recent work has indicated that gene expression divergence is subject to purifying selection and possibly positive selection . while previous data indicates a rate of gene expression divergence that is significantly less regular than the rate of gene sequence divergence , it does not reveal any regularity in the rate of gene expression divergence for tissue - specific profiles . it is noted that an inverse relationship between gene expression intensity and protein evolution rate exists . this is consistent with the previously suggested relaxed selective constraint of the digestive tract of foregut fermenters . nevertheless , it is still expected that compartments which are closely related , in evolutionary terms , will express sets of genes with higher set similarity than compartments that are more distantly related . thus , measurements of set similarity will provide some quantitative and qualitative evaluation of the evolutionary distance between functional compartments . due to the stochastic nature of gene expression data and due tothe unrecorded variation in experimental procedures used to obtain the expression data , the focus is on performing a qualitative analysis of the expression data . summary statistics for all available unigene data used in this analysis are provided in table 1 . for the selected body sites , excluding the spleen , homo sapiens has the largest number of unigene entries and b. taurus has the fewest unigene entries . for spleen , mus musculus has the largest number of unigene entries and bos taurus has the fewest . however , comparison of the percentages of entries that have been annotated with entrez identifiers indicates that h. sapiens has the lowest percentage of annotated entries , while m. musculus has the highest percentage of annotated entries . first , given that h. sapiens is fairly wellstudied , this indicates that there are a greater number of unknown transcripts that have not been characterized at the gene level . second , given that m. musculus is considered to be better studied than h. sapiens , this indicates that the characterization of the m. musculus genome has less uncertainty than that of h. sapiens or b. taurus . comparison of the mean expression level , using transcripts per million ( tpm ) , indicates that , for almost all body sites , h. sapiens has the lowest level of expression , followed by m. musculus and b. taurus , respectively . there is also a negative correlation between number of unigene entries in a body site and mean expression level . this indicates that in all species , and especially in m. musculus , that unannotated unigene entries are expressed at low levels . limitations of the current unigene database are also highlighted in these summary statistics . when compared to unigene data for h. sapiens or m. musculus , the unigene data for b. taurus has a higher percentage of entries annotated with entrez identifiers or sequence similarity information but usually has a far lower number of entries per body site . this is indicative of an experimental bias towards gene products that are better understood and away from novel genes unique to b. taurus . additionally , comparing the body sites of b. taurus , it is noted that some of these body sites , many of which , notably , are digestive organs , have significantly fewer entries than others . this will cause an increase in perceived distances between organs , but given the size of the samples and barring an experimental bias , this increase should be proportional in all body sites . however , in some cases , such as the omasum , the number of entries might be insufficient for any conclusion . no information on experimental methods or on normalization procedures applied to the experimental data is included in the ncbi unigene database . one must also consider the possibility of experimental bias via incomplete data , for example , a large number of entries from a single point in a large organ of composite structure combined with relatively few entries from other points in this organ . the intestine is an example of one of these organs ; there is some evidence of this type of error discussed in the results . these caveats must be borne in mind whilst drawing any conclusions from this data . due to stochastic noiseinherent in gene expression data and unknown but potentially differing experimental procedures used in collecting this data , the data was normalized by categorizing unigene clusters into groups based on percentiles , or bins , by expression level , using threshold values obtained from the distribution of expression levels in each body site . although analyses using different numbers of bins were conducted , for analysis of expression level differences , it proved sufficient to use only two bins representing expressed genes , that is , expression level greater than zero , and unexpressed genes , that is , expression level of zero . to qualitatively evaluate the similarity between compartments in b. taurus , pairwise comparisons between digestive body sites and selected control body sitesa jaccard value closer to 1 indicates more similarity between compared compartments ; a jaccard value closer to 0 indicates less similarity between compared compartments . the binary state , that is , expressed or unexpressed , for each gene was considered , with expressed genes having an expression level greater than 0 and unexpressed genes having an expression level of 0 . pairwise similarity comparisons of b. taurus digestive body sites , shown in table 2 , indicate that the abomasum and intestine are the most similar ( j = 0.3492 ) and the omasum and intestine are least similar ( j = 0.00793 ) . the omasum tends to have lower similarity scores when compared to any body site , but this is at least partly due to insufficient data for that body site . the control body sites generally show higher similarity scores , with the exception of the spleen . this is counterintuitive , as it would be expected that older , more established organs would show less similarity than the newer digestive organs . however , there are more unigene entries for the control body sites , which indicate a bias in the data collection process towards uniquely expressed entries in the digestive body sites that enhances differences between digestive body sites . these pairwise comparisons indicate that the abomasum , rumen , and intestine are closely related , and that the reticulum is more closely related to the rumen than other organs . no conclusions can be drawn for the omasum , which is likely due to insufficient data . the raw numbers of genes expressed in each body site , portrayed in a venn table appendix 1 , support these conclusions and also give evidence as to the evolutionary ages of the digestive body sites . the large numbers of uniquely expressed genes in the abomasum and rumen provide evidence either to support greater evolutionary age of both organs or evidence of relaxed selective constraint on both organs . the large numbers of genes shared among these two organs and the intestine also give evidence for their close relationship , but do not provide any additional information due to the relatively small number of genes from the abomasum and rumen as compared to the number of genes from the intestine . while the pairwise comparisons provide some evidence about the relationships among different compartments , they do not provide a complete picture . the jaccard values were used to construct distance trees using both upgma and neighbor - joining algorithms . these trees , shown in figure 1 , indicate that the intestine and abomasum are most closely related , with the rumen being the next most closely related , followed by the reticulum and omasum , respectively . these results correspond to proposed evolutionary relationships among ruminant digestive organs suggested by previous physiological and genetic studies . pairwise comparisons of h. sapiens and m. musculus , shown in table 3 , indicate that body sites are related within a species but are also closely related to body sites of a similar type across species . the jaccard values for h. sapiens stomach are curious but could indicate experimental bias in sampling , since the body site intestine as given in the unigene database is not an accurate term in the physiological sense . the average similarity values are higher for all body site comparisons which , given the larger number of unigene entries for h. sapiens and m. musculus , provides more evidence of experimental bias in favor of uniquely expressed entries in b. taurus digestive body sites . pairwise comparisons of the digestive body sites of b. taurus and the digestive body sites of h. sapiens and m. musculus are presented in table 4 . because this part of the analysis was performed on entries that had sequence similarity annotation to the other species , this analysis utilized a fewer number of unigene entries and is likely biased against novel genes . the trends of similarity of body sites within species and similarity by body site across species also hold for this comparison . however , b. taurus intestine is most similar to the intestine of h. sapiens and m. musculus , while the similarity scores of h. sapiens intestine and stomach are much higher than those for other body sites . the cause of this is unknown , but it could again be the result of sampling error in the unigene data . the similarity scores for b. taurus reticulum and omasum are low when compared to other b. taurus body sites , but this may be due to insufficient data . a number of highly expressed genes of biological relevance in each body site of b. taurus were identified . some genes were unique to one body site while others were shared among body sites . analyses using the bingo plug - in for the cytoscape software package were performed for each group of genes in order to find statistically enriched functions . table 5 contains a list of go functions corresponding to groups of highly expressed genes that are statistically significant ( hypergeometric test , significance level 0.05 ) and are of known biological relevance . identification of groups of genes with biologically relevant function that are shared between bos taurus digestive organs provides evidence to support an evolutionary timeline for ruminant digestive system development . as depicted in table 5 , the abomasum and the rumen both share categories of genes related to muscle development and contractionas both the rumen and abomasum make use of contracting muscle fibers in the course of proper functioning , this indicates inherited function from one digestive organ to the other ; it is likely that this function in the rumen was inherited from the abomasum as the abomasum - like stomach is common in other vertebrates . the reticulum and rumen share genes related to fatty acid transport and the urea cycle . this again indicates a relationship based on inherited function as the rumen and reticulum are closely related physiological function . the gene arg1 ( 383 ) , which is involved in urea metabolism , is highly expressed in both the rumen and reticulum . in addition , when genes expressed in bovine digestive organs at low and medium levels were examined , the enzymes ass ( 445 ) and asl ( 435 ) , both involved in the urea cycle , were found to be expressed in the rumen , reticulum , or intestine . the presence of a mechanism for urea metabolism is suggested by the ingestion of nitrogenous compounds from soil by ruminants . the omasum and rumen share genes involved in cross - membrane transport and in muscular activity and development . the omasum serves to absorb fluids , reflects particulate matter back to the rumen and absorb products of cellulose degradation , and also utilizes contracting muscle fibers in the course of proper functioning . the results of the functional analysis also uncovered some results that have been noted in previous studies on bovine molecular biology . as shown in appendix 3 , homo sapiens stomach and bos taurus abomasum share the lysozyme genes lyz3 ( entrez - gene : 281289 ) and lyz ( entrez - gene : 781349 ) . however , when viewing genes shared among the human stomach , bovine abomasum , and various other digestive organs that are expressed at various levels , the genes lyz1 ( entrez - gene : 281287 ) and lyzl2 ( entrez - gene : 119180 ) are listed , which indicate the presence of more shared lysozyme genes . it is likely that the analysis techniques used are not sensitive to detect the expected variation in expression noted in other studies . analysis of the action of selective constraint on gene expression levels in the digestive system of bos taurus reveals results that correspond to current theories on ruminant evolution . there is evidence of relaxed selective constraint or greater evolutionary age in the abomasum and the rumen as indicated by the large number of genes expressed uniquely in both organs , and this analysis also indicates appropriate evolutionary ages for other digestive organs . additionally , similarity measurements provide a sequence of evolution that corresponds to theories proposed based on previous genetic and physiological studies . the abomasum and intestine are closely related , as are the stomach and intestine in nonruminants , and the rumen is closely related to the abomasum and intestine as well as the reticulum and omasum . these results , plus previous reviews that suggest that foregut evolution is evolutionarily easy , indicate an early foregut evolutionary event stemming from the intestine and later development of compartments stemming from a subsequently evolved rumen . given that the evolution of rumination is believed to have occurred separately in camilidae and ruminantia , and that the starting point for this development , foregut fermentation , appears to be relatively simple , this generates some interesting questions regarding the evolutionary mechanisms of complex organs and organ systems . future work in the genomics , using camelids and true ruminants as a model for convergent evolution , might yield insight into the nature of these processes . several biological relevant enriched go clusters were noted . some of these clusters reinforce relationships noted elsewhere in the paper . as shown in table 5 , the abomasum and rumen share genes involved in muscle development and involuntary muscle activity , while the reticulum and rumen share genes involved in lipid and fatty acid transport . given the relationships noted elsewhere , these shared genes reinforce the idea that the abomasum and rumen are evolutionarily closely related and that the reticulum and rumen are evolutionarily closely related . additionally , the omasum and rumen share genes involved in involuntary muscle activity and signaling . these shared genes indicate both a close evolutionary relationship and confirm known physiology of the rumen and omasum . evidence of a mechanism for urea metabolism is indicated by the expression of the arg1 gene in the rumen and reticulum and the expression of ass and asl genes in other bovine digestive organs . the functional analysis also supported the results of previous studies of bovine molecular biology . lysozyme genes lyz , lyz1 , lyz2 , and lyz3 were identified as being expressed in human and bovine digestive organs ; however , the techniques used were not sensitive enough to determine differences in expression level as shown in previous studies . additional lysozyme genes lyzl4 and lyzl6 were identified but were marked as not being expressed in any digestive organs . the unigene datasets for bos taurus , homo sapiens , and mus musculus were downloaded from the ncbi ftp site on 16 february 2008 . the intestine was selected for all organisms , the stomach was selected for homo sapiens and mus musculus , and the abomasum , omasum , reticulum , and rumen were selected for bos taurus . both types were selected for ubiquity and in order to provide a representation across type and function . selected control tissues were blood , skin , muscle , and brain . selected control organs were liver , kidney , ovary , and spleen . for each organism , statistical properties were computed for the unigene entries expressed in each body site using the r statistical language . as shown in table 1 , the numbers of data points for the omasum , reticulum , blood , and spleen in bos taurus are low . in addition , the variance in mean expression values of the omasum body sites for bos taurus indicates inconsistent normalization procedures , which introduces unquantifiable errors into the analysis . to minimize errors generated by different experimental and data processing procedures , the first approach used a binary criteria ; if gene expression was greater than 0 transcripts per million ( tpm ) , the gene was considered to be expressed in the body site . otherwise , the gene was considered to be not expressed in the body site . the second approach used two computed critical values to categorize the level of gene expression into three levels : low , medium , and high . unigene entries in the top 10 percent of expression level in any given body site were considered to be highly expressed , and entries in the bottom 75 percent of expression level were considered to be lowly expressed , with those falling in between those two values considered to be moderately expressed . the two critical values were computed independently for each body site in order to reduce the effects of inconsistent normalization . the upper and lower critical values were taken from the expression values of the elements on the 10 % and 75 % boundaries ( see in supplementary material available online at doi : 10.4061 / 2009 / 803142 . table 2 that contains the critical expression values in tpm ) . all subsequent comparisons between body siteswere performed using the values obtained from the two approaches and the results were found to be qualitatively similar . therefore , for the sake of brevity , only the results obtained using the binary approach are presented . the unigene expression data was mined using custom batch files for the postgres sql server and the psql client software . binary venn tables were constructed by testing all entries for expression across all selected body sites . entries were either expressed in a body site , in which case their expression values were greater than zero , or were not expressed in a body site , in which case their expression values were equal to zero or contained no data . the jaccard index measures the degree of similarity between two sets , with the maximum value of 1 and minimum value of 0 . higher jaccard indices between two body sites indicate a greater similarity between the two sets of genes that are expressed in the two body sites . species - species cross - linking was accomplished by joining the entries of two species , using the sql join algorithm , through sequence similarity score annotations . if properly annotated , each unigene entry is annotated with a sequence similarity score corresponding to a reference protein identifier and a list of sequence similarity scores corresponding to protein identifiers in other organisms . two lists of cross - linked entries were created for each species - species cross using these annotations ; one list used the organism - specific protein identifier for the first species and the reference protein identifier for the second species to link entries , while the second list used the organism - specific protein identifier for the second species and the reference protein identifier for the first species to link entries . this technique posed problems due to the poor annotation of bos taurus entries and required manual analysis of the data obtained from these subsets . in order to study the functional relationships among the genes expressed in body sites , the cytoscape plug - in bingo was used to perform a gene ontology - ( go - ) based analysis on each set of genes shared among body sites or unique to a single body site . bingo maps a gene set of interest to the go hierarchical graph and determines the go terms that are statistically over - or underrepresented in the gene set using either hyper - geometric or binomial tests . to minimize the influence of stochastic noise and difference in techniques among the different experiments used to generate unigene data , functional analysis was restricted to highly expressed genes in order to get the most distinctive differences between body sites . genes with expression values in the highest 5 % of the expression values of all genes in the body site were considered to be highly expressed .\noutput:\n" }, { "from": "agent", "value": "although the nature of ruminant evolution is still disputed , current theory based on physiology and genetic analysis suggests that the abomasum is the evolutionarily oldest stomach compartment , the rumen evolved some time after the abomasum , and the omasum is the evolutionarily youngest stomach compartment . in addition , there is some evidence of relaxed selective constraint in the stomach - like organ and the foregut shortly after the foregut formation event . along with the assumption of a mean , stochastic rate of evolution , analysis of differences in genetic profiles among digestive body organs can give clues to the relationships among these organs . the presence of large numbers of uniquely expressed entries in the abomasum and rumen indicates either a period of relaxed selective constraint or greater evolutionary age . additionally , differences in expression profiles indicate that the abomasum , rumen , and intestine are more closely related to each other , while the reticulum and omasum are more closely related to the rumen . functional analysis using gene ontology ( go ) categories also supports the proposed evolutionary relationships by identifying shared functions , such as muscle activity and development , lipid transport , and urea metabolism , between all sections of the digestive tract investigated ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: activation of the patients immune system is one of several promising therapeutic methods for controlling cancer progression , because tumor cells have often avoided presenting their own antigens to t cells . so although tumors in cancer patients , which have treated by chemotherapy , surgery , and radiotherapy , regress , in many cases , they have also often metastasized . one of the major goals of tumor immunotherapy was generating tumor - specific t cells that finally contributed to the tumors eradication . superantigens ( sags ) were bacterial and viral proteins that could activate a large number of t cells irrespective of their antigen specificity , resulted in a massive release of cytokines from t cells and monocytes , they have increased the antitumor activity of the immune system and prevent tumor growth and metastasis . to date , there have been 21 identified se and staphylococcal - like enterotoxin ( se l ) genes , including sea to see , seg to sev . in this study , among sags , we have chosen the bacterial superantigen staphylococcal enterotoxin b ( seb ) that was a potent inducer of cytotoxic t - cell activity and cytokine production in vivo . most anticancer agents , such as radiation and cytostatic drugs , have worked by affecting or preventing cell division . because they were nonspecific , all dividing cells have affected the results in adverse side effects , that occur as a result of toxicities to normal tissues so anticancer chemotherapeutics have often given at suboptimal doses , resulted the eventual failure of therapy , that has often accompanied by ( go along with or couse ) the drug resistance development , and tumor metastasis . several approaches for improving the selective toxicity of anticancer therapeutics , and reducing their side effect have been following at present , such as delivery of anti - neoplastic drugs to cancer cells , by associating the drugs with molecules ( mabs ) that bound to antigens or ligands , and bound to receptors that are either uniquely expressed or overexpressed on the target cells relative to normal tissues . ligand - targeted therapeutics ( ltts ) had advantages to mabs , and then tumor - related ligand was less antigenic than mabs , as well as non - antibody ligands were often readily available , inexpensive to manufacture and easy to handle , then facilitate drug penetration into solid tumors . generally , the targeted antigen or receptor should have a high density on the surface of the target cells so we have chosen the epidermal growth factor receptor ( egfr ) , as a suitable receptor for the design of ligand - targeted therapeutics in cancer immunotherapy . egfr was a 170kda transmembrane protein consisting of an extracellular egf binding domain , a short transmembrane region , and an intracellular domain with ligand - activated tyrosine kinase activity . egfr could be activated by two ligands : epidermal growth factor ( egf ) and transforming growth factor - alpha ( tgf ) . ligand binding to egfr has resulted in receptor homo - or hetero - dimerization ( with one of the her family of receptor tyrosine kinases ) that has followed by auto phosphorylation of the tyrosine kinase domain , then phosphorylated tyrosine residues have served as binding sites for the recruitment of signal transducers and activators of intracellular substrates . the phosphatidyl inositol 3 ' kinase pathway , and the ras - raf mitogen - activated protein kinase , and akt pathway were the major signaling routes for the her ( human epidermal growth factor receptor ) family , including egfr . these pathways have controlled several important biological events , including cellular proliferation , angiogenesis and inhibition of apoptosis . overexpression of egfr protein has described in various human carcinomas including breast , head , neck , esophageal , gastric , pancreatic , colorectal , prostate , bladder , renal , ovarian and non - small cell lung cancer ( nsclc ) and has generally reported as an adverse prognostic marker [ 9 - 11 ] moreover , the degree of egfr over - expression has associated with an advanced tumor stage , and then resistance to standard therapies . the conjugate composed of ligand and superantigen has presumed to kill several types of tumor . human transforming growth factor alpha ( htgf ) was a native ligand co - overexpressed with its receptor egfr in many human tumors ; which had three isoform 1 , 3 and 4 , that have expressed in keratinocytes and tumor - derived cell lines . htgf has consisted of three loops , the third of which ( tgfl3 ) retained the binding ability to egfr . in this study , after selecting tgf - as a legend , for preventing ligand / receptor induced internalization , we have bound seb superantigen to third loop of tgf ( tgfl3 ) that retained the binding ability to egfr . moreover , in comparison to mabs , tgfl3 was presumably less antigenic , thereby maintaining a longer circulating half - life . these properties have enabled tgfl3 to be an attractive targeting molecule for the superantigens , also which has only occurred in time of presence on the surface of the cells . we have used in silico techniques to design construct , optimized for expression in suitable host , predicted physicochemical and structural properties and stability , then identified mhc binding and t cell epitopes to allow accelerating the strong antigenic and immune responses , and finally ligand - receptor interaction . an unguided experimental has searched for antigenic and immunogenic regions was basically laborious and resource intensive . the computational approaches could speed up the process , then with the potential for simplifying the evaluation presses to a great extent . hence , the novel tgfl3 - seb fusion protein has determined as a candidate for cancer immunotherapy , could rapidly identified in silico , then have subjected to in vitro and in vivo confirmatory studies . protein retrieval and sequence analysis the protein sequence of seb and tgfl3 protein has retrieved from uniprot knowledgebase data , have also used accession no . p01552 and p01135 respectively . design of the construct and gene optimization recombinant tgfl3 - seb and seb - tgfl3 sequences have constructed by fusing the c - terminal of seb and the n - terminal of tgfl3 ( tgfl3 - seb ) and n - terminal of seb and the c - terminal of tgfl3 ( seb - tgfl3 ) , have been using hydrophobic ggsgsggg amino acid linker . to optimize the multiparameter chimeric gene , the in silico analysis has used online data bases such as gene bank codon data base , the codon database , swissprot reverse translation online tool , and stand - alone softwares such as dnasis max ( hitachi software ) . after verification of the construct s properties by gen - script ( nj , usa ) , the chimeric gene has synthesized by shinegene molecular biotech , inc . ( shanghai , china ) mrna structure prediction the messenger rna secondary structure of the chimeric gene has analyzed by the program mfold . primary structure prediction for physiochemical characterization , theoretical isoelectric point ( pi ) , molecular weight , total number of positive and negative residues , extinction coefficient , instability index , aliphatic index and grand average hydropathy ( gravy ) have computed using the expasy protparam server . secondary structure prediction gor secondary structure prediction method version iv has employed for computing and analyzing the secondary structural features of tgfl3 - seb fusion protein sequence .3 d structure prediction using homology approach the 3d model of the recombinant tgfl3 - seb protein has generated using the i - tasser online server which generates 3d models along with their confidence score ( c - score ) . energy minimization has determined by analysis of 3d structural stability of the chimeric protein using swiss - pdbviewer . solvent accessibilities of the protein residues have evaluated with the online program asa , . evaluation of model stability after generating 3d model , energy minimization has performed by gromos96 force field in a swiss - pdbviewer . structural evaluation and stereo chemical analyseshave performed by using prosa - web , z - scores and procheck ramachandran plot . furthermore , superimposition of query and template structure , and visualization of generated models have performed by using the swiss - pdbviewer . prediction of cleavage sites proteasome cleavage sites of the chimeric protein have predicted by netchop 3.1 , mappp and pcps . prediction of t - cell epitopes and mhc binding peptides affinity the amino acid sequence has analyzed by using four web - based t - cell epitope prediction algorithms ; netctl , syfpeithi ( http://www.syfpeithi.de/ ) , ctlpred and netmhc . briefly , at first the chimeric protein has analyzed for mhc - presented epitopes and mhc - specific anchor and auxiliary motifs using netctl , syfpeithi and ctlpred ; then the netmhc server , which has produced a neural network prediction of binding affinities for mhc . ligand - receptor docking using hex the docking of tgfl3 with tgfr has performed by using hex , in order to investigate the protein - ligand interactions and investigate the application of the models for ligand binding potency prediction . design and construction of chimeric gene to evaluate the effect of tgfl3 fusion on seb in silico superantigenic activity , two sets of constructs , tgfl3 - seb and seb - tgfl3 , have designed for further in silico analysis ( figure 1 ) . we have chosen the 17 amino acids from the amine - terminus of third loop of transforming growth factor alpha ( tgfl3 ) that have reported to be involved for binding to its receptor egfr , and for the second fragment ; a whole length of staphylococcal enterotoxin type b , 239 amino acids ( lacking 27 amino acids of signal sequence from the n - terminal of the protein ) has selected and inserted one time in the carboxy - terminus of chimeric fusion protein to design tgfl3 - seb , and then another time in the amino - terminus of chimeric fusion protein to design seb - tgfl3 construct . these two parts have joined by a linker consisting of 8 amino acids ( ggsgsggg ) . the amino acid composition of tgfl3 - seb and seb - tgfl3 sequences have computed by using the tool clc free workbench . codon adaptation analysis of the wild type and optimized synthetic gene both the wild type and the synthetic chimera have analyzed for their codon bias and gc content . the optimized gene has shown a codon bias for e.coli , bacterial expression host , and has contained no rarely used codon . this has also reflected by the codon adaptation index ( cai ) , which was a measurement of the relative adaptiveness of the codon usage of a gene , that in comparison with the codon usage of highly expressed genes . the chimeric gene has shown a cai of 0.85 , that has compared to the wild type gene , which was only 0.5 . the overall gc content has reduced from 45.83 to 44.06 % , which could increase the overall stability of mrna from the synthetic gene . furthermore , the necessary restriction enzyme sites ( bamhi and hindiii ) have introduced at the ends of the sequence for cloning purpose . mrna structure prediction a genetic algorithm - based rna secondary structure prediction has combined with comparative sequence analysis to determine the potential folding of the chimeric gene . the 5 ' terminus of the gene has folded in the way typical of all bacterial gene structures . the minimum free energy for secondary structures that has formed by rna molecules has also predicted . all 29 structural elements that have obtained in this analysis have revealed folding of the rna construct . the data has shown the mrna was stable enough for efficient translation in the new host . primary structure prediction protparam has used to find out the physiochemical properties of a protein sequence . the physicochemical properties of the protein have revealed the number of amino acids to be 264 , molecular weight : 30708.5 and theoretical isoelectric pointed as 7.72 . the maximum number of amino acids , which have been present in the sequence , has been the lysine ( 12.5 % ) , and the least was the pyl ( o ) and sec ( u ) ( 0.0 % ) . the total number of positively charged residues ( arg + lys ) was 39 , and total number of negatively charged residues ( asp + glu ) was 38 . the n - terminal of the sequence has considered as the f ( phe ) . therefore estimatedhalf - life was ; 100 hours ( mammalian reticulocytes , in vitro ) , 20 hours ( yeast , in vivo ) , and finally 10 hours ( escherichia coli , in vivo ) . protein secondary structure prediction the secondary structure of the chimeric protein has predicted by online software and random coils has found to be frequent ( 46.59 % ) , followed by extended strand ( 28.03 % ) and alpha helix has found to be less frequent ( 25.38 % ) . this was graphically represented in figure 2 . tertiary structural prediction for the chimeric protein chimeric protein 3d models , have been produced by i - tasser ( figure 3 ) , uploaded to the swiss - pdbviewer server to depict the tertiary structural illustrations . evaluation of model stability the profile of energy minimization has calculated by spdbv ( swiss - pdbviewer ) - 6107.159 kcal / mol indicating that the recombinant protein had acceptable stability . furthermore , the structural stability of the chimeric protein has confirmed based on data generated by a ramachandran plot ( figure 4 ) . solvent accessibility prediction the solvent accessibility distributions have characterized using the major hydrophobic and polarity properties of residual patterns . these patterns have shown that the mean residue accessible surface area ( asa ) have given a high solvent accessibility value , approximately fifty percent ( data have not shown ) . prediction of the cleavage site cleavage site analysis on the construct protein has performed using net chop server , an improved neural network training strategy . this server has produced neural network predictions for cleavage sites of the human proteasome using two different methods ; c - term 3.0 and 20s 3.0 . the net chop neural network - based method was the best presently - available system for cleavage site predictions . the new version of net chop has predicted approximately 75 % of cleavage sites correctly with false positives near 15 % . cleavage sites on the construct protein have analyzed with net chop ( data not shown ) . prediction of binding affinity of tap binder in tgfl3 - seb fusion protein has done by tappred that is a svm based quantitative method for predicting peptide tap affinity binding ( table 1 ) prediction of t - cell epitopes netctl 1.2 server has predicted ctl epitopes in the chimeric protein sequence . the server has predicted ctl epitopes , restricted to 12 mhc class i supertypes using anns . the scores from the individual prediction methods have integrated , and thresholds for the integrated scores of each peptide have translated into sensitivity and specificity values ( table 2 ) . also the syfpeithi epitope prediction algorithm has used . this server has allowed quantification of the ligation strength to a defined hla type for a sequence of amino acids , and the probability of the peptide being processed and presented has given in order to predict t - cell epitopes . the maximum score for hla - a * 0201peptides was 27 ( data have not shown ) . ctlpred , a direct method for prediction of ctl epitopes , has also used . this method has based on elegant machine learning techniques like an ann and support vector machine . the scores of ctlpred - predicted epitopes for the chimeric protein have shown in table 3 . the default cutoff score was 0.51 , in which the sensitivity and specificity of prediction methods were highly similar . mhc binding peptides affinity t lymphocytes have played a central role in the generation of a protective immune response in many microbial infections . the binding strength of t cell epitopes to major histocompatibility complex ( mhc or hla ) molecules was a key determinant in t cell epitope immunogenicity . this has allowed the epitopes with higher binding affinities , to be more likely to be displayed on the surface of the cells , where they have recognized by their corresponding t cell receptor ( tcr ) . netmhc 3.2 server has predicted peptide binding to a number of different hla alleles using anns . for ann prediction , values have given in nm ic50 values so that high - binding peptides had ic50 values below 50 nm , and weakly - binding peptides had ic50 values below 500 nm ( 22 ) . mhc class - ii binding peptide prediction in tgfl3 - seb fusion protein ( with 51 alleles query ) has done by propred i online server ( table 5 ) . we have uploaded a pair of epidermal growth factor receptor and tgfl3 - seb fusion protein as a ligand structures in pdb format in hex server . default parameters have used for carrying out the jobs . to be able to analyze the docking , the e - values have obtained using the hex software . the docking process has been more efficient , related to the negative e - value . when we have viewed the visualization tool like spvbv , the docking between receptors of proteins and the ligand could be clearly observed as shown in figure 5 . the staphylococcal sags were potent t cells mitogens ( 27 ) , antitumor activity of superantigens have proven in many studies [ 1 , 8 , 33 - 35 ] and staphylococcal enterotoxins , especially type b ( seb ) , were classic models of superantigens ( sags ) , so in this study we have chosen seb as an antitumor agent . furthermore , avoiding the side effects that have occurred as a result of toxicities to normal tissues , we have brought the seb on the surface of tumor cells by ligand - targeted technique . ligand - targeted therapy has made possible tumor specificity , and limited toxicity , and has shown promise in the development of cancer novel therapies . it could carry higher doses of a drug to the tumor tissue and might overcome obstacles presented by cytotoxic chemotherapy . since egfrs have over - expressed in a variety of human tumor cells , including breast , head , neck , gastric , colorectal , esophageal , prostate , bladder , renal , pancreatic , ovarian and non - small cell lung cancer ( nsclc ) moreover , the degree of egfr over - expression has associated with an advanced tumor stage and resistance to standard therapies , we have selected its ligand ( tgf ) to fuse with seb by genetically fusing the third loop of transforming growth factor alpha ( tgfl3 ) to staphylococcal enterotoxin b as an new antitumor candidate . due to the limitations in experimental methods for determining binary interactions and structure determination of protein complexes , the request has existed for computational models to fill the increasing gap between genome sequence information and protein annotation , so before starting experimental study by the aim of in - silico techniques , we have predicted physicochemical properties , structures , stability , mhc binding properties and ligand - receptor interaction of this chimeric protein by means of computational bioinformatics tools and servers . here the recombinant tgfl3 - seb and seb - tgfl3 sequences have constructed by fusing the c - terminal of seb and the n - terminal of tgfl3 ( tgfl3 - seb ) and n - terminal of seb and the c - terminal of tgfl3 ( seb - tgfl3 ) using hydrophobic ggsgsggg amino acid linker . the folding of two structures ( tgfl3 - seb and seb - tgfl3 ) has analyzed and the tgfl3 - seb construct have shown that tgfl3 was more accessible and has not hidden in seb structure , so we have continued our study on tgfl3 - seb fusion protein . in silico studies have confirmed efficient transcriptional and translational , as well as the quality expression of the proposed construct in host expression vectors . codon adaptation index ( cai ) was the major factor that has used for gene optimization ( 24 ) , with a range of 0 - 1 , and an ideal value of 1.0 . since our objective was to design a fusion protein that expressed in escherichia coli as a host expression vector so codon usage table of escherichia colihas selected for the back - translation of the sequence and optimal expression of the construct . in our gene cai indexhas increased from 0.5 in the wild type sequences to 0.85 in the chimeric optimized gene . moreover , the overall gc content has reduced from 45.83 to 44.06 % , which should increase the overall stability of mrna from the synthetic gene . in addition , the required restriction enzyme sites have added to the ends of the designate gene for future assays . codon optimization has given us assurance that synthetic construct expressed well in desired host vector . the mrna structure has optimized based on low g and energy of the start codon . for prediction of rna secondary structure , a genetic algorithm - based rna secondary structure prediction has combined with comparative sequence analysis to determine the potential folding of the chimeric gene . the 5 ' terminus of the gene has folded in the way typical of all bacterial gene structures . the minimum free energy for secondary structuresthe messenger rna secondary structure of the chimeric gene has analyzed by the program mfold with the parameters : linear rna folding at 5 % , window = 12 , max folds = 50 . all 29 structural elements have obtained in this analysis have revealed folding of the rna construct at 370c with initial g ranging from -225.00 to -214.00 kcal / mol . the best structure that had g = -225.00 kcal / mol.the data has shown the mrna was stable enough for efficient translation in the new host . the results of primary structure analysis have suggested that tgfl3 - seb fusion protein was hydrophilic in nature due to the presence of high polar residues content . the presence of 4 cys residues in tgfl3 - seb has indicated the presence of disulphide bridges ( ss bonds ) in this fusion protein . moreover , the primary structure analysis has suggested that the average molecular weight of tgfl3 - seb has calculated 30.708 kda . isoelectric point ( pi ) was the ph at which the surface of protein has covered with charge , but net charge of the protein is zero . at pi proteins were stable and compact . the computed pi value of tgfl3 - seb was 7.72 ( pi 7 ) , that has indicated that this fusion protein was basic in character . the computed isoelectric point ( pi ) would be useful for developing buffer systems for purification by isoelectric focusing method . although expasy s protparam has computed the extinction coefficient for a range of ( 276 , 278 , 279 , 280 and 282 nm ) extinction coefficient of tgfl3 - seb at 280 nm was 38530 m - 1 cm - 1 with respect to the high concentration of cys , trp and tyr , indicated that this fusion protein could be analyzed using uv spectral methods . both of the computed protein concentration , and extinction coefficients could help in the quantitative study of protein - protein and protein - ligand interactions in solution . the bio computed half - life of most of the tgfl3 - seb was greater than 10 h. on the basis of instability index expasy s protparam have classified the tgfl3 - seb fusion protein as stable ( instability index 40 ) . the aliphatic index ( ai ) which has defined as the relative volume of a protein occupied by aliphatic side chains ( a , v , i and l ) has regarded as a positive factor for the increase of thermal stability of globular proteins . the lower thermal stability of tgfl3 - seb was indicative of a more flexible structure with comparison to very high aliphatic index that has inferred stability for a wide range of temperature . the very low gravy index of this fusion protein infers that tgfl3 - seb could result in a better interaction with water . the secondary structural analysis of the protein has done with the help of gor iv program ( figure 2 ) and random coil has found to be most frequent ( 46.59 % ) , followed by extended strand ( ee ) ( 28.03 % ) alpha helix that has found to be less frequent ( 25.38 % ) . the very high coil structural content of tgfl3 - seb ( 4659 % ) was due to the rich content of more flexible glycine and hydrophobic proline amino acids . proline had a special property of creating kinks in polypeptide chains and disrupting ordered secondary structure . the three - dimensional ( 3d ) structure details of proteins were of major importance in providing insights into their molecular functions . the three - dimensional model of the recombinant tgfl3 - seb protein has generated using the i - tasser online server which generates 3d models along with their confidence score ( c - score ) . five models have generated by this server with c - scores : - 0.42, - 0.84, - 0.92, - 2.50, - 2.87 respectively , among the 5 models , model 1 has selected for further analysis as it contained the highest c - score . after generating 3d model , energy minimization has determined by analysis of 3d structural stability of the chimeric protein using swiss - pdbviewer . the percentage of residues was 80.5 % favored region , 14.5 % allowed , and 5.0 % in outlier region so evaluation of model stability by ramachandran plot have shown that most residues of the chimeric model were in a stable zone . the model has analyzed by different protein analysis programs including procheck for the evaluation of the ramachandran plot quality . the proteasome has produced the exact c - terminus of ctl epitopes and the n - terminus with a possible extension . ctl responses could be reduced if the epitopes have destroyed by proteasomes ; therefore , prediction of proteasome cleavage sites was valuable for identification of potential immunogenic regions in the chimeric protein . based on these rules we have designed the chimeric protein , and then predicted its proteasome cleavage sites using web - based software . the result has shown that the highest - scored cleavage positions have located at overall the whole fusion protein ( data not shown ) . prediction of binding affinity of tap binder in tgfl3 - seb fusion protein has done by tappred . there was only one additional tap binding sequence in tgfl3 - seb fusion protein belongs to ligand part in comparison with seb protein ( table 1 ) . netctl 1.2 server has predicted ctl epitopes in the chimeric protein sequence . the server has predicted ctl epitopes restricted to 12 mhc class i super types using anns . the scores from the individual prediction methods have integrated , and thresholds for the integrated scores of each peptide have translated into sensitivity and specificity values ( table 2 ) .15 same mhc ligands have identified in both seb and tgfl3 - seb fusion protein by this server . also the syfpeithi epitope prediction algorithm has used . this server has allowed quantification of the ligation strength to a defined hla type for a sequence of amino acids , and the probability of the peptide being processed and presented has given in order to predict t - cell epitopes . because of highly polymorphic nature of mhc , different patients typically have bounded different repertoires of peptides ; hence it was crucial to identify the optimal set of peptides for a vaccine , given constraints such as mhc allele probabilities in the target population and maximum number of selected peptides . it has investigated that the most common hla in the general population is hla - a * 0201 , which accounts for 30 - 40 % of the major ethnicities . the scoring system of syfpeithi has evaluated each amino acid in the peptides . the maximum score for hla - a * 0201 peptides was 36 and the maximum scores for epitopes of both seb and tgfl3 - seb chimeric protein was 27 ( data not shown ) . this method has based on elegant machine learning techniques like an ann and support vector machine . the scores of ctlpred - predicted epitopes for the chimeric protein have shown in table 3 . the default cutoff score was 0.51 ( at which the sensitivity and specificity of prediction methods were highly similar ) . superantigens ( sags ) were microbial proteins with the capacity to activate a large fraction of t cells . the cellular receptors for sags were major histocompatibility complex ( mhc ) class ii molecules and t - cell antigen receptors ( tcr ) . sags could bind to the tcr b subunit , and then could activate t cells independently of their cd4 or cd8 phenotype , when presented by mhc class ii molecules . activated t cells have secreted a variety of cytokines , such as tnfa , infg , il - 1 , il - 2 , il - 6 , il - 8 and il - 12 . in this assay , to determine whether fusing of tgfal3 in n - terminal of the tgfl3 - seb construct has negatively affected on mhc binding , and subsequently super antigenic activity , we have predicted the binding affinity oftgfl3 - seb fusion protein to mhc , in comparison to seb , as a classic superantigen . netmhc 3.2 server has predicted peptide binding to a number of different hla alleles using artificial neural networks ( anns ) trained on c terminals of known epitopes . for ann analysis , predicted mhc / peptide binding was a log transformed value , has related to the ic50 values in nm units so that high - binding peptides had ic50 values below 50 nm , and weakly - binding peptides had ic50 values below 500 nm . seven same peptide sequences with high log score have identified as strong mhc binder in both seb and tgfl3 - seb fusion protein . these peptides had strong binding affinity to hla - a0211 , hla - b1517 , hla - a8001 , hla - a0212 , hla - a0211 , hla - a2902 , hla - a2403 alleles . also propred , a graphical web tool for predicting class ii binding regions in antigenic protein sequences has also accessed by selecting all the 51 alleles present in the tool . the sequence in single letter amino acid code has given as input by using default parameters of the server for the prediction of class - ii epitopes . eight same peptide sequences in seb and tgfl3 - seb fusion protein with the highest score in binding to mhc ii allles ( allele : drb1 - 0701 , allele : drb1 - 1502 , allele : drb1 - 0301 , allele : drb1 - 1501 , allele : drb1 - 0301 , allele : drb1 - 0817 , allele : drb1 - 0817 , allele : drb1 - 1501 ) have tabulated in table 5 . our result have shown not only fusing of tgfal3 in n - terminal of the tgfl3 - seb construct , had no effects on mhc binding and subsequently superantigenic activity , but also based on the prediction results , the selected epitopes of our chimeric construct also have shown high - affinity binding to mhc molecules , and acceptable sensitivity and specificity have been recognized by ctls . epitope binding to mhc and recognition of such complexes ( epitope / mhc ) by ctls was a critical step for inducing a significant immune response . to investigate whether the third ( tgfal3 ) of human transforming growth factor alpha ( htgfa ) that was a native ligand co - overexpressed with its receptor egfr in many human tumors , has retained its binding ability to bring seb to tumors over expressing egfr , we have checked its binding ability by ligand - receptor docking . hex was an interactive molecular graphics program for calculating and displaying feasible docking modes of pairs of protein and dna molecules and also calculates protein ligand docking , assuming the ligand was rigid , and it could superpose pairs of molecules using only knowledge of their 3d shapes . hex was still one of the few docking programs which have built - in graphics to view the results . also , it was the first protein docking program to be able to use modern graphics processor units ( gpus ) to accelerate the calculation . it has given an e - value of -119.96 which was an acceptable e - value for docking results . our result has shown the binding ability of tgfal3 was strong enough to its receptor , so tgfl3 - seb could be a new antitumor candidate in cancer immunotherapy . here we have evaluated the ability of tgfl3 - seb fusion protein as a new antitumor candidate . since it was important to establish the structure - function relation of tgfl3 - seb fusion protein before starting experimental studies , the tgfl3 - seb fusion protein has analyzed by various tools and softwares . our results propose tgfl3 - seb was a stable fusion protein with proper affinity to its receptor that overexpress in various human carcinomas so it could generate potent immune response towards tumors . multiple different approaches have been used to activate the immune system against breast cancer . heresince it was important to establish the structure - function relation of tgfl3 - seb fusion protein before starting experimental studies , the tgfl3 - seb fusion protein has analyzed by various tools and softwares . our results propose tgfl3 - seb was a stable fusion protein with proper affinity to its receptor that overexpress in various human carcinomas so it could generate potent immune response towards tumors .\noutput:\n" }, { "from": "agent", "value": "backgroundbacterial superantigen staphylococcal enterotoxins ( ses ) , has stimulated polyclonal t cells irrespective of their antigen specificity , resulted a massive release of cytokines , and suggested that they could be assigned as a candidate of new antitumor agents . recent attempts have done to specifically target superantigens towards tumors , subsequently monoclonal antibodies and tumor - related ligands have employed as targeting molecules of superantigen for the preclinical treatment of different tumors . here , we have evaluated tgfl3 - seb fusion protein as a new antitumor candidate by genetically fusing the third loop of transforming growth factor alpha ( tgfl3 ) to staphylococcal enterotoxin type b.methodsan in silico techniques have launched to characterize the properties and structure of the protein , before initiating the experimental study , we have predicted physicochemical properties , structures , stability , mhc binding properties and ligand - receptor interaction of this chimeric protein by means of computational bioinformatics tools and servers.resultsour results have indicated codon adaptation index of tgfl3 - seb fusion gene has increased from 0.5 in the wild type sequences to 0.85 in the chimeric optimized gene . the mfold data has shown the tgfl3 - seb mrna was stable enough for efficient translation in the new host . based on ramachandran plot tgfl3 - seb has classified as a stable fusion protein . our result has shown fusing of tgfal3 in n - terminal of the tgfl3 - seb construct , had no effects on mhc binding and subsequently superantigenic activity of seb . finally based on ligand - receptor docking the binding ability of tgfal3 was strong enough to its receptor , so tgfl3 - seb could be assigned as a new antitumor candidate in cancer immunotherapy.conclusionour results have proposed that tgfl3 - seb was a stable fusion protein with proper affinity to its receptor that overexpressed in various human carcinomas , so it could generate potent immune response towards tumors ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: fractures of metacarpals and phalanges are the most common fractures of the upper extremity .1 the outer rays of the hand are most commonly injured .1 unfortunately , the metacarpal and phalangeal fractures are often neglected or regarded as trivial injuries .2 the proximal phalanx of the fingers is fractured more frequently than the middle or even distal phalanges . the deformity with considerable displacement is typical when the proximal phalanx is fractured .34 most fractures are functionally stable either before or after closed reduction and do well with protective splintage and early mobilisation .12 the closed treatment has gained a poor reputation due to problems of malunion , stiffness and sometimes loss of skin or other soft tissues .12 certain fractures ( angulation 20 in anteroposterior view and 15 in lateral view , 50 % bony contact , rotational deformity , collapse and multiple fractures ) require operative fixation . operative fixation must be used judiciously and with the expectation that the ultimate outcome should be better than the outcome after nonoperative management .1 selection of the optimum treatment depends on a number of factors including fracture location , fracture geometry , deformity , whether open or closed and fracture stability .3 appropriate treatment is necessary for phalangeal fractures or else it will lead to stiffness . to prevent this disastrous complication , it is necessary to achieve a stable fracture fixation and early mobilization . in order to achieve this goal , one should closely understand the safe portals / corridors in hand for k - wire entry for fractures of the phalanges . safe corridor in a finger is an area where a k - wire can be passed with minimal soft tissue damage and without impaling major soft tissue structures such as the extensor expansion , neurovascular structures and flexor tendons , thus allowing relatively pain - free active range of movements and preventing stiffness . we did a pilot cadaveric study in hand and passed multiple k - wires in each phalanx [ figure 1 by visually identifying the extensor expansion and mapped the safe portal avoiding any tethering of the same . this is further tested by manual pulling of flexor and extensor tendons for full flexion and extension of fingers so that there was no restriction of movements . after a pilot study in cadavers by transfixing k - wires in phalanx [ figure 1 ] and checking the range of motion , we have defined a safe portal / corridor for k - wires [ figure 2a - c ] by marking them in green . . clinical photograph of dissection on cadaveric finger showing multiple k - wire passed through safe corridors under direct vision safe corridors marked in each phalanx in flexion ( green color ) . ( c ) safe corridors in the distal phalanx based on our pilot , cadaveric study on placement of k - wires the present clinical study was started . mapping was done in each phalanx both in flexion and extension of the fingers and the safe corridor was identified . safe corridor can be transcutaneously identified in proximal phalanx base by identifying the central tendon at metacarpo - phalangeal joint dorsally . on either side of this tendon , there is a triangular , wide area of a safe zone dorsolaterally and dorsomedially on either side of the extensor tendon in the base of the proximal phalanx . shaft of proximal phalanx is a dangerous zone , it has ligaments all around ( lumbrical and interossei tendon ) and neurovascular structures on the volar side . in the head ( in this study we call condyle of phalanx as head ) of proximal phalanx , dorsomedial and dorsolateral small triangular area is safe in flexion and this corridor gets obliterated in extension . in middle phalanx base , there is a small triangular safe corridor in flexion of the pip joint dorsomedially and dorsolaterally , between the central slip and the lateral band . shaft of the middle phalanx is usually dangerous area to pass k - wires because lateral band and oblique retinacular ligament pass there . head of the middle phalanx has a wide safe zone dorsomedially and dorsolaterally in both flexion and extension . in distal phalanx , the tip is safe and the only dangerous zones are the dorsal and volar insertions of long extensor and flexor tendons respectively . a prospective study was conducted on 50 patients with 64 phalanx fractures treated with closed reduction and k - wire fixation in the year 2011 . they were followed up for a minimum period of 12 months and a maximum of 18 months . there were 38 proximal phalanx fracture , 14 distal phalanx fracture and 12 middle phalanx fracture with absolute indications for closed reduction and percutaneous k - wire fixation . little finger was most commonly involved ( 28 ) , ring ( 16 ) , middle ( 10 ) , index ( 7 ) , thumb ( 3 ) in order of frequency . transverse and spiral pattern of fractures were common ( 20 ) , oblique were the next common ( 10 ) , followed by comminuted and avulsion fractures 8 , 6 , respectively . base of the phalanx was most commonly involved ( 28 ) followed by shaft ( 22 ) , then neck ( 10 ) and least involved was neck ( 4 ) . easy surgical tip of finding the base of proximal phalanx is by flexing metacarpophalangeal joint and lifting the shaft of phalanx [ figure 3 ] fracture needs perfect reduction and k - wires are placed parallel to each other [ figure 4a - c ] . we need to know the safe zones before passing the k - wires in each phalanx [ figure 5 ] . after the procedure , all patients underwent testing range of motion in the operating room - on - table active finger movement test , as all of them had surgery under local anesthesia . clinical photograph showing surgical tip to visualize by lifting the base of proximal phalanx as shown for easy introduction of k - wire ( a ) x - ray of hand oblique view showing displaced proximal phalanx fracture . ( b and c ) clinical photograph showing introduction of two k - wires from the base of proximal phalanx and performance of full flexion and extension - on - table active finger movement test . postoperative x - ray anteroposterior ( a ) and oblique view ( b ) of hand showing phalanx fracture fixed with k - wire ( a ) x - ray anteroposterior view of hand showing distal phalangeal fracture ( b ) x - ray of little finger lateral view showing distal phalangeal fracture ( c ) postoperative x - ray showing k - wire in distal phalangeal fracture ( d ) lateral view of postoperative showing k - wire in position ( a ) line diagram depicting k - wires all patients had weekly followup for regular physiotherapy and pin tract care . these patients were followed regularly biweekly for 3 months and monthly thereafter for 1 - year . the functional outcome after fracture treatment was assessed by calculating disabilities of the arm , shoulder and hand ( dash ) 5 score and total active range of motion6 ( tam ) . tam was calculated by adding the active flexion at metacarpo - phalangeal , pip and distal interphalangeal joints , after subtracting the sum of extension deficit at these three joints . recovery is calculated as percent regained motion compared to the normal range of digital motion ( 260 ) . according to this , patient with 85100 % of the movement are classified as excellent ; 7084 % as good ; 5069 % as fair and 50 % as poor . safe corridor can be transcutaneously identified in proximal phalanx base by identifying the central tendon at metacarpo - phalangeal joint dorsally . on either side of this tendon , there is a triangular , wide area of a safe zone dorsolaterally and dorsomedially on either side of the extensor tendon in the base of the proximal phalanx . shaft of proximal phalanx is a dangerous zone , it has ligaments all around ( lumbrical and interossei tendon ) and neurovascular structures on the volar side . in the head ( in this study we call condyle of phalanx as head ) of proximal phalanx , dorsomedial and dorsolateral small triangular area is safe in flexion and this corridor gets obliterated in extension . in middle phalanx base , there is a small triangular safe corridor in flexion of the pip joint dorsomedially and dorsolaterally , between the central slip and the lateral band . shaft of the middle phalanx is usually dangerous area to pass k - wires because lateral band and oblique retinacular ligament pass there . head of the middle phalanx has a wide safe zone dorsomedially and dorsolaterally in both flexion and extension . in distal phalanx , the tip is safe and the only dangerous zones are the dorsal and volar insertions of long extensor and flexor tendons respectively . a prospective study was conducted on 50 patients with 64 phalanx fractures treated with closed reduction and k - wire fixation in the year 2011 . they were followed up for a minimum period of 12 months and a maximum of 18 months . there were 38 proximal phalanx fracture , 14 distal phalanx fracture and 12 middle phalanx fracture with absolute indications for closed reduction and percutaneous k - wire fixation . little finger was most commonly involved ( 28 ) , ring ( 16 ) , middle ( 10 ) , index ( 7 ) , thumb ( 3 ) in order of frequency . transverse and spiral pattern of fractures were common ( 20 ) , oblique were the next common ( 10 ) , followed by comminuted and avulsion fractures 8 , 6 , respectively . base of the phalanx was most commonly involved ( 28 ) followed by shaft ( 22 ) , then neck ( 10 ) and least involved was neck ( 4 ) . easy surgical tip of finding the base of proximal phalanx is by flexing metacarpophalangeal joint and lifting the shaft of phalanx [ figure 3 ] fracture needs perfect reduction and k - wires are placed parallel to each other [ figure 4a - c ] . we need to know the safe zones before passing the k - wires in each phalanx [ figure 5 ] . after the procedure , all patients underwent testing range of motion in the operating room - on - table active finger movement test , as all of them had surgery under local anesthesia . clinical photograph showing surgical tip to visualize by lifting the base of proximal phalanx as shown for easy introduction of k - wire ( a ) x - ray of hand oblique view showing displaced proximal phalanx fracture . ( b and c ) clinical photograph showing introduction of two k - wires from the base of proximal phalanx and performance of full flexion and extension - on - table active finger movement test . postoperative x - ray anteroposterior ( a ) and oblique view ( b ) of hand showing phalanx fracture fixed with k - wire ( a ) x - ray anteroposterior view of hand showing distal phalangeal fracture ( b ) x - ray of little finger lateral view showing distal phalangeal fracture ( c ) postoperative x - ray showing k - wire in distal phalangeal fracture ( d ) lateral view of postoperative showing k - wire in position ( a ) line diagram depicting k - wires all patients had weekly followup for regular physiotherapy and pin tract care . the functional outcome after fracture treatment was assessed by calculating disabilities of the arm , shoulder and hand ( dash ) 5 score and total active range of motion6 ( tam ) . tam was calculated by adding the active flexion at metacarpo - phalangeal , pip and distal interphalangeal joints , after subtracting the sum of extension deficit at these three joints . recovery is calculated as percent regained motion compared to the normal range of digital motion ( 260 ) . according to this , patient with 85100 % of the movement are classified as excellent ; 7084 % as good ; 5069 % as fair and 50 % as poor . we had 86 patients with phalangeal fractures , and 50 patients underwent k - wire fixation due to various indications like unstable phalangeal fractures , fractures with rotations and angular deformity , multiple phalangeal fractures in the same hand and avulsion fractures ( e.g. central slip avulsion , mallet finger ) . rest of the patients ( 36 ) were treated either conservatively or eliminated due to the following reasons : open fractures ( 5 ) , stable fractures ( 5 ) , extreme age groups ( age 17 years and 70 years ) ( 7 ) , with comorbid conditions such as diabetes , peripheral vascular disease ( 7 ) , polytrauma patients ( 6 ) ipsilateral arm fractures ( 4 ) , intraarticular fractures and volar plate avulsion fractures ( 2 ) .32 patients sustained fracture due to road traffic accident , 10 patients had an industrial accident , and 8 were sports injuries . in our study , little finger is most commonly injured digit , more frequently proximal phalanx fracture was observed , transverse and spiral type of fracture was more frequent , base of the phalanx fracture were common in our study [ table 1 , figure 6 ] . at the end of 3 months , dash score and objective hand score assessment ( tam ) were excellent in 95 % ( 47 patients ) of cases , and 2 patient had a good result in spite of not attending physiotherapy , one patient had pin tract infection leading to early removal of wire and poor compliance leading to mild residual stiffness in little finger resulting in fair score [ table 2 ] . clinical details of patients x - rays of hand anteroposterior view ( a ) and lateral view ( b ) showing fracture of middle phalanx ( c and d ) postoperative x - rays showing middle phalanx fixed with k - wire dash and tam scores in the studythe incidence of metacarpal and phalangeal fractures is the most common in males and peaks at young age as they are prone to road traffic accident , athletic injury , and industrial exposure as shown in our study . in our study , the most common age group is between 20 and 35 years ( 42 fractures ) . this age group is comparable gupta et al. 7 study which has 36 years as the mean age . in our study , the male to female ratio was 7:3 while ahmad et al. 8 reported this ratio to be 6:1 . adjacent finger fractures were seen most common in the middle and ring fingers and in the ring and little fingers . almost equal percentage of right and left sided digits were involved in our study which is similar to ahmad et al. 8 study . consistent with the study by kar et al. 9 we also found rta as the most common mode of injury . in our study , the common site of fracture was base of the phalanx ( 42 % ) and transverse and spiral fracture pattern ( 65 % ) was most common and singh et al. 10 had basal fractures as most common ( 41.7 % ) site and transverse pattern was ( 34.5 % ) common in his study . our patients who had k - wire fixations had excellent scores ( 95 % ) compared to other studies , the reason being safe portal entry of k - wires and on - table active finger movement test was performed in all cases to assess tethering . reported an average tam of 265 . to our best of knowledge , no study in the past has elaborated the importance of placement of k - wire , checking the active range of movement on - table for a better outcome which is directly proportional to the end result . most of the papers do comparative results of conservative versus surgical treatment k - wire , external fixator , internal fixation with a plate , stainless steel wire swg 216 for only the closed fractures of phalanges of the hand . most of them considered all tubular bones of the hand together , both open and closed fractures together and all type of fixations together . this might be a confounding factor for the purpose of comparison of results with our study . for most stable fractures , conservative treatment modalities are sufficient , but for most unstable fractures , surgical treatment gives the best results . complication of malunion , stiffness and secondary loss of reduction can be reduced by focusing on the technique of k - wire fixation . this study highlights the importance of placement of k - wire in each phalanx through the safe zones . the main advantage is it does not need much expertise , understanding of proper anatomy is enough and is relatively very simple and safe technique . it has added advantages of early mobilization , lesser infection rate due to least tethering of soft tissues , decreased incidence of malunion and no implant in situ after healing . strict adherence to safe portal k - wire pinning gives the best chance for full functional recovery .\noutput:\n" }, { "from": "agent", "value": "background : unstable phalangeal fractures are commonly treated with k - wire fixation . operative fixation must be used judiciously and with the expectation that the ultimate outcome should be better than the outcome after nonoperative management . it is necessary to achieve a stable fracture fixation and early mobilization . in order to achieve this goal , one should closely understand the safe portals / corridors in hand for k - wire entry for fractures of the phalanges . safe corridors were defined and tested using a pilot cadaveric and a clinical case study by assessing the outcome.materials and methods : in our prospective case series , 50 patients with 64 phalangeal fractures were treated with closed reduction and k - wires were inserted through safe portals identified by a pilot cadaveric study . on table active finger movement test was done and the results were analyed using radiology , disabilities of the arm , shoulder , and hand ( dash ) score and total active motion ( tam ) . in our study , little finger ( n = 28 ) was the most commonly involved digit . in fracture pattern , transverse ( n = 20 ) and spiral ( n = 20 ) types were common . proximal phalanx ( n = 38 ) was commonly involved and the common site being the base of the phalanx ( n = 28 ) . results : 47 ( 95 % ) patients had excellent tam and the mean postoperative dash score was 58.05 . all patients achieved excellent and good scores proving the importance of the safe corridor concept.conclusion : k - wiring through the safe corridor has proved to yield the best clinical results because of least tethering of soft tissues as evidenced by performing on - table active finger movement test at the time of surgery . we strongly recommend k - wiring through safe portals in all phalangeal fractures ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: although the australian health system aims to provide universal access to all aspects of health care to all australians , non - indigenous australians now have a life expectancy of 78 to 83 years , whereas the life expectancy of australia s indigenous population may be up to 18 years less . this gap in life expectancy is predominantly due to rising rates of non - communicable diseases such as diabetes , cardiovascular disease , cancers , digestive diseases and their subsequent complications . international research has demonstrated many fields in which a disparity in the level of care of patients based on race has existed , including differences in emergency department management , and has also examined areas such as the management of chest pain , the management of head injury and the provision of analgesia . evidence from the us suggests that racial and ethnic disparities exist in the provision of health care . in 2002 , a report titled unequal treatment : confronting racial and ethnic disparities in health care outlined that minority groups such as african americans , hispanics and american indians experienced higher rates of heart disease , diabetes , carcinomas and liver disease disproportionate to the size of the population . additionally , these patients were less likely to have health insurance and more likely to use the hospital emergency department as their primary medical provider . these patients were also more likely to experience direct and indirect discrimination in medical management . while the demonstrated health status of australia s indigenous population appears to be similar to that demonstrated above , it is unknown if aboriginals and torres strait islanders are more likely to experience discrimination in medical management . even though there have been demonstrated disparities in the us , it must also be remembered that many of these disparities may be due to the level of insurance coverage of the patient as the united states health system is different from that of australia . new zealand , however , has a similar health - care system to australia , and mori patients were found in one study by davis et al . to receive a slightly poorer level of hospital care than non - mori patients . additionally , mori patients were found to be ten times more likely to have experienced racial discrimination in health management than those new zealanders of european origin . a study performed in the northern territory in 2000 investigated potential disparity in the management of acute myocardial infarction between indigenous and non - indigenous people . while there was a significant difference in the provision of thrombolysis between the two groups , it was found that the only statistically significant reason for this disparity was the delay in presentation of the individual . in 2001 , a study at the royal darwin hospital investigated potential disparity based upon race in the triage process at the emergency department . it accounts for approximately 16 % of indigenous deaths , 20 % of which are due to head injury . emergency departments in the us treat approximately 2 million patients with head injury annually . in australia , the aim of this study was to determine if a disparity exists between australians of indigenous descent and other australians in the assessment and management of minor head injury in the emergency department , and in the decision to perform ct head scans . this was a retrospective , structured , medical record review of adult patients presenting with minor head injury to the townsville hospital , a tertiary public hospital in north queensland , australia . it is the only emergency department in the townsville - thuringowa area caring for a population of 190,000 , approximately 6.5 % of whom identify themselves as indigenous . the townsville hospital also serves a greater population of 615,000 people as a tertiary referral centre for cardiothoracic surgery and neurosurgery . additionally , the townsville hospital serves as a teaching hospital for the james cook university medical school . ct scans are available at the townsville hospital 24 hours a day if clinically indicated . approval to perform this study as a quality improvement audit was granted by the townsville health service district human research ethics committee . the ed database ( edis version 9.34.1022 pai ) was used to identify all patients with a minor head injury aged 18 to 65 presenting from 1 september 2004 to 30 april 2007 with the following diagnoses : concussion , minor head injury , post concussional syndrome , post traumatic amnesia , scalp contusion and loss of consciousness . minor head injury was defined as a witnessed loss of consciousness , definite amnesia or witnessed disorientation in a patient with gcs 1415 following blunt head trauma . patients were excluded from the study if the mechanism of injury recorded was not consistent with blunt trauma , if other significant injuries co - existed and if their gcs on arrival was less than 14 . additionally , patients with significant radiological findings on ct scan , thus implicating an alternative diagnosis ( e.g. , subdural haematoma , cerebral contusion and skull fracture ) , were excluded . data extracted from edis included demographic data such as : age , gender , indigenous status , aboriginal and not torres strait islander , torres strait islander and not aboriginal , aboriginal and torres strait islander andneither aboriginal nor torres strait islander ( this was subsequently recorded as indigenous yes / no ) . indigenous status , aboriginal and not torres strait islander , torres strait islander and not aboriginal , aboriginal and torres strait islander andneither aboriginal nor torres strait islander ( this was subsequently recorded as indigenous yes / no ) . aboriginal and not torres strait islander , torres strait islander and not aboriginal , aboriginal and torres strait islander and neither aboriginal nor torres strait islander ( this was subsequently recorded as indigenous yes / no ) . this information is routinely collected by clerical staff . other data extracted included : ed triage category , waiting time ( time from presentation until seen by a medical practitioner ) , medical provider level ( consultant , registrar or rmo ) andpatient disposition . waiting time ( time from presentation until seen by a medical practitioner ) , medical provider level ( consultant , registrar or rmo ) and variables extracted from the charts included : mechanism of injury consistent with blunt trauma ( yes / no ) ; gcs recorded by triage nurse on arrival.clinical variables were as outlined in the canadian ct head rule by stiell et al . , specifically , high - risk features : failure to achieve gcs 15 within 2 h of presentation to the emergency department , suspected open skull fracture , clinical signs of basal skull fracture , csf otorrhoea or rhinorrhoea , mastoid ecchymosis or battle s sign , periorbital ecchymosis or raccoon eyes , hemotympanum , vertigo , reduced hearing or deafness andseventh nerve palsy . vomiting on at least two occasions post head injury ; age 65 or older.moderate risk factors were : amnesia before the time of impact greater than 30 min ; dangerous mechanism of injury . pedestrian struck by motor vehicle ; assault with a blunt object ; fall from a height of greater than 1 m / five stairs ; heavy object falling onto the head ; high - speed motor vehicle collision . mechanism of injury consistent with blunt trauma ( yes / no ) ; gcs recorded by triage nurse on arrival . clinical variables were as outlined in the canadian ct head rule by stiell et al . , specifically , high - risk features : failure to achieve gcs 15 within 2 h of presentation to the emergency department , suspected open skull fracture , clinical signs of basal skull fracture , csf otorrhoea or rhinorrhoea , mastoid ecchymosis or battle s sign , periorbital ecchymosis or raccoon eyes , hemotympanum , vertigo , reduced hearing or deafness andseventh nerve palsy . csf otorrhoea or rhinorrhoea , mastoid ecchymosis or battle s sign , periorbital ecchymosis or raccoon eyes , reduced hearing or deafness and seventh nerve palsy . vomiting on at least two occasions post head injury ; moderate risk factorswere : amnesia before the time of impact greater than 30 min ; dangerous mechanism of injury . pedestrian struck by motor vehicle ; assault with a blunt object ; fall from a height of greater than 1 m / five stairs ; heavy object falling onto the head ; high - speed motor vehicle collision . amnesia before the time of impact greater than 30 min ; dangerous mechanism of injury . pedestrian struck by motor vehicle ; assault with a blunt object ; fall from a height of greater than 1 m / five stairs ; heavy object falling onto the head ; high - speed motor vehicle collision . pedestrian struck by motor vehicle ; assault with a blunt object ; fall from a height of greater than 1 m / five stairs ; heavy object falling onto the head ; high - speed motor vehicle collision . if an item was not specifically documented in the medical record , it was assumed to be absent . the primary outcome measure was the evidence of any disparity , based on race , in the performance of ct head scans in cases of minor head injury when clinically indicated . for the purposes of this study , performance of a ct head scan was deemed clinically indicated if any high or moderate risk factors outlined in the canadian ct head rule were present . of note , the canadian ct head rule states that ct head scans should be considered in the presence of moderate risk factors . secondary outcomes included examination of potential disparity in waiting times in addition to determining what percentages of patient waiting times were within established recommended triage parameters according to the australasian college of emergency medicine ( acem ) policy , the decision to test for serum ethanol , level of the medical practitioner providing care and patient disposition . collected data were entered into an excel spreadsheet ( microsoft corporation version 2002 ) and subsequently into a format suitable for statistical analysis , utilising the public domain statistics program . mean ages and waiting times were not normally distributed and hence were compared using the mann - whitney test . comparisons of performance of ct , in the presence or absence of being clinically indicated , were performed using two - by - two tables and fisher 's exact test . the 95 % confidence intervals are presented , and statistical significance was defined as p 0.05 . finally , agreement and inter - rater reliability were assessed using a randomly selected sample of 10 % of the included subjects . this was determined by calculating a kappa statistic for the overall outcome of whether or not a ct head scan was clinically indicated , thus demonstrating the strength of agreement and reproducibility of data . collected data were entered into an excel spreadsheet ( microsoft corporation version 2002 ) and subsequently into a format suitable for statistical analysis , utilising the public domain statistics program . mean ages and waiting times were not normally distributed and hence were compared using the mann - whitney test . comparisons of performance of ct , in the presence or absence of being clinically indicated , were performed using two - by - two tables and fisher 's exact test . the 95 % confidence intervals are presented , and statistical significance was defined as p 0.05 . finally , agreement and inter - rater reliability were assessed using a randomly selected sample of 10 % of the included subjects . this was determined by calculating a kappa statistic for the overall outcome of whether or not a ct head scan was clinically indicated , thus demonstrating the strength of agreement and reproducibility of data . of these , 76 were indigenous and 571 were non - indigenous . from this group , all 76 indigenous patients were selected , and 200 non - indigenous patients were randomly selected by utilising microsoft excel spreadsheet programming to rearrange the identified patient ur numbers randomly for inclusion in this study . a total of seven patients were excluded from the study either due to insufficient clinical information or failure to meet selection criteria . further demographic data are demonstrated in table 2 . while there was a statistically significant difference in mean age , this was unlikely to be of clinical significance . overall , there was no statistically significant disparity in the performance of ct head scans between indigenous and non - indigenous patients . table 1comparison of performance of ct scan with respect to clinical indicationindigenous ( percentage ) non - indigenous ( percentage ) por95 % cict scan performed when clinically indicated12 ( 80 % ) 46 ( 92 % ) 0.34 ( fisher s exact test ) 0.350.07 to 1.77 ct scan not performed when clinically indicated3 ( 20 % ) 4 ( 8 % ) ct scan performed when not clinically indicated2 ( 3 % ) 12 ( 8 % ) 0.36 ( fisher s exact test ) 0.40.09 to 1.84 ct scan not performed when not clinically indicated56 ( 97 % ) 134 ( 92 % ) p = 0.34 ( fisher s exact test ) , or 0.35 ( 95 % ci = 0.07 to 1.77 ) p = 0.36 ( fisher s exact test ) , or 0.4 ( 95 % ci = 0.09 to 1.84 ) comparison of performance of ct scan with respect to clinical indication p = 0.34 ( fisher s exact test ) , or 0.35 ( 95 % ci = 0.07 to 1.77 ) p = 0.36 ( fisher s exact test ) , or 0.4 ( 95 % ci = 0.09 to 1.84 ) secondary outcomes are outlined in table 2 . while a statistically significant difference in waiting time was demonstrated , that difference was only 13.5 min . indigenous patients were found to be 2.6 times more likely to have serum ethanol levels tested , which was a statistically significant result . demographic data : mean ages , waiting times , serum ethanol testing and dispositionindigenousnon - indigenousp valueor95 % cimean age ( years ) ( sd ) 32.7 ( 9.45 ) 29.4 ( 10.58 ) 0.005 sex m / f38 / 35111 / 850.58 mean waiting time ( minutes ) ( sd ) 44.6 ( 49.6 ) 31.1 ( 36.4 ) 0.02 seen within recommended triage time n ( % ) 54 ( 74 % ) 160 ( 82 % ) 0.180.630.341.21 consultant n ( % ) 10 ( 13.5 % ) 21 ( 11 % ) registrar n ( % ) 22 ( 30 % ) 80 ( 41 % ) 0.27 resident n ( % ) 41 ( 56 % ) 95 ( 48 % ) serum ethanol tested n ( % ) 16 ( 22 % ) 19 ( 9.7 % ) 0.0132.61.265.42 admitted n ( % ) 13 ( 17.8 % ) 36 ( 18.4 % ) 0.25 left against medical advice n ( % ) 3 ( 4 % ) 2 ( 1.5 % ) * mann - whitney test , # fisher s exact test , $ chi - square comparative test summary of results . demographic data : mean ages , waiting times , serum ethanol testing and disposition * mann - whitney test , # fisher s exact test , $ chi - square comparative test there was no statistically significant disparity demonstrated between indigenous and non - indigenous patients regarding treatment either in allocated triage times or in the level of the medical practitioner attending the patient . finally , inter - rater reliability calculations for the outcome of a ct head scan being clinically indicated resulted in of 0.8 , thus demonstrating good data reproducibility . regarding head injuries , two studies have been performed investigating racial disparities in the emergency department care of patients with traumatic brain injuries . both studies compared hispanics with non - hispanics and african americans with non - african americans . like our study , these both focussed on blunt head trauma.wall et al . investigated all traumatic brain injuries , whereas bazarian et alboth studies , like ours , discovered no statistically significant disparity in the decision to perform a ct head scan when clinically indicated . however , bazarian found that hispanic patients were more likely to have significantly longer waiting times to see a doctor and were more likely to leave the emergency department before being seen . hispanic patients were also more likely to have serum ethanol levels performed than non - hispanic patients , which correlates with our findings regarding indigenous patients . while the disparity in waiting time of 13.5 min discovered in our study was found to be statistically significant , it is unlikely that this time frame would be of clinical significance . although our study and the study by bazarian et al . demonstrated that indigenous patients were more likely to have serum ethanol levels tested than non - indigenous patients , another us study demonstrated no such difference . in a study by marcin et al . , the frequency of alcohol and drug screening between caucasian and african - american patients was the same . our finding that indigenous patients were 2.6 times more likely to have serum ethanol tested was interesting as evidence suggests that serum ethanol has no impact upon gcs in traumatic brain injury and therefore should not impact decision making . the difference in the mean age of the two groups was rated as statistically significant , but unlikely to be of clinical significance . with the development of the ct head rule by stiell et al . , it was determined that the need for the performance of ct head scans in cases of minor head injury was only affected by age in those 65 and older . intuitively , one would suppose that any bias because of age would favour the ordering of ct head scans in older patients where our study found indigenous patients less likely to receive a ct head scan despite a higher mean age . the major limitation of this study is in its design , namely , a retrospective medical record review , with all the well - known weaknesses of this methodology . the most significant weakness is that the absence of documentation of clinical findings in the chart does not necessarily mean that that they were looked for , or indeed , absent . also , the limited size and specifically the small number of ct head scans performed mean our study was only powered to find very large differences between the two groups for this outcome . the selected time period was chosen as this was the commencement time for edis at this centre , enabling more accurate data collection than the previous system . additionally , this particular centre was not working to a set minor head injury protocol during the time period studied . it should be noted that this study did not test or allow for all potential confounders ; for example , daily patient loads , timing of presentations , access block or staffing levels at times of presentation may have contributed to the increased waiting times for patients . finally , with regard to external validity , ours was a single - centre study and therefore not necessarily representative of the state or national population . this study demonstrated no statistically significant disparity in the decision to perform ct head scans for indigenous patients with minor head injuries . statistically significant secondary outcome findings included longerthis single - centre , retrospective study requires confirmation with a multi - centre , prospective study .\noutput:\n" }, { "from": "agent", "value": "background / aiminternational research has demonstrated disparities in the emergency department care of patients of certain racial or ethnic backgrounds . the management of minor head injuries requires a careful clinical assessment to determine the requirement of a ct scan of the head . the aim of this study was to determine if there was any disparity , based on race , in the management of minor head injury.methodsthis was a retrospective , structured , medical record review of patients presenting to the townsville hospital emergency department , between september 2004 and april 2007 , with minor head injury . the main outcome measure was whether or not patients received a ct head scan when clinically indicated . the canadian ct head rule was considered the standard for clinical indication for a ct head scan . secondary outcome measures included triage category , waiting time , level of care provider , disposition and serum ethanol.resultsa total of 270 patients ( 73 indigenous and 196 non - indigenous ) were enrolled . there was no statistically significant difference in ordering ct head scans when clinically indicated between indigenous and non - indigenous patients . however , a trend indicating that indigenous patients were less likely to receive a ct head scan when clinically indicated ( or 0.35 ; 95 % ci = 0.07 to 1.77 ) was noted . indigenous patients had a mean waiting time of 44.6 min ( sd 49.6 ) compared to non - indigenous with 31.1 min ( sd 36.4 ; p = 0.02 ) . conclusionthis study concluded that there was no statistically significant disparity based upon race in the management of minor head injuries with regard to decision to perform a ct head scan . there is some evidence that indigenous patients waited longer to be seen . a multi - centre prospective study is necessary to confirm these findings ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: dogs and other canidae such as foxes serve as definitive hosts , while snails and slugs act as intermediate hosts . it has a worldwide distribution and in europe it is considered enzootic in certain areas in france , denmark , ireland and the uk [ 2 - 4,9 ] . the adult metastrongyle ( 13 - 21 mm ) resides in the pulmonary arteries and the right side of the heart . first - stage ( l1 ) larvae migrate through the respiratory system via the trachea to the gastrointestinal - tract and are excreted in faeces . the migration of the l1 larvae through the blood - air barrier and the subsequent verminous pneumonia and pulmonary thrombosis causes the clinical signs ( i.e. , cough , exercise intolerance , dyspnoea ) that are commonly associated with the pulmonary system . haematological changes such as neutrophilia , thrombocytopaenia and anaemia have been reported whereas the most frequent changes in biochemistry are increased globulin levels and decreased fructosamine . a fatal outcome of infection is often associated with coagulation disorders . suggested echanisms behind the coagulopathy are induced immune - mediated thrombocytopaenia , disseminated intravascular coagulation ( dic ) or secretion of anticoagulants by the adult worms . clinical presentation of associated bleeding disorders may vary between petechial or ecchymotic bleeding on mucosal surfaces , dermis or sclera to intracranial or cns bleeding . to the authors ' knowledge , this is the first reported case of haemoabdomen associated with an a. vasorum infection . a one - year - old intact female danish shorthaired pointer ( body weight 25 kg ) was referred to the emergency service at the department of small animal clinical sciences at the university of coprnhagen with a history of acute collapse and pale mucous membranes . the owner had noted the dog to be less active over the past month , but with no other clinical signs more commonly related to canine angiostrongylosis such as cough , dyspnoea or exercise intolerance . the dog presented with a temperature of 37.1 c , pulse 120 / min , respiration rate of 28 / min and pale pink , dry mucous membranes with a prolonged capillary refill time greater than two seconds . the most predominant changes in haematological and biochemical profiles were neutrophilia , packed cell volume ( pcv ) of 24 % , elevated urea and creatinine and reduced fructosamine ( table 1 ) . haematological , biochemical and coagulation parameters at time of diagnosis * aggregates seen on blood smear at 40 magnification . an ultrasound examination of the abdomen ( figure 1 ) suggested a large amount of free fluid with no obvious cause such as neoplasia or splenic rupture . abdominocentesis was performed and the aspirate had the macroscopic appearance of blood , a pcv of 35 % and no signs of infection or neoplasia on a cytological examination . the coagulation profile showed prolonged prothrombin time ( pt ) and increased d - dimer ( table 1 ) . phytomenadion ( konakion , roche a / s , hvidovre , denmark ) treatment was initiated due to potential coumarin poisoning and for initial stabilisation , the dog received two transfusions ; one unit of full blood ( 18 ml / kg ) and one unit of fresh frozen plasma ( 9 ml / kg ) . however , in the present case , the authors chose to carry out the procedure as a continuing loss of blood could not be ruled out at this stage . urinalysis of a voided sample was unremarkable except that a single a. vasorum l1 larva was detected on microscopy . subsequently , multiple l1 larvae were revealed using a direct faecal smear technique . due to the rapid establishment of the diagnosisthe dog was treated with fenbendazole 25 mg / kg orally once daily for 20 days following a protocol known to be efficient in the treatment of a. vasorum infections . to avoid possible anaphylactic reactions , prednisolone acetate at 1 mg / kg ( prednisolon dak , nycomed , roskilde , denmark ) was administered once daily for 12 days . the dog stabilised on this treatment and was discharged after two days of hospitalisation and monitoring . four weeks later , a complete resolution of clinical signs and normalisation of haematological and coagulation blood parameters were found . haemoabdomen associated with canine angiostrongylosis has not been reported before , although spontaneous bleeding at other sites has been reported . in the present case , neoplasia could not be demonstrated and treatment with phytomenadion was initially started in case of a rodenticide poisoning , although the owner reported it unlikely that the dog had been in contact with such compounds . coumarin poisoning is not usually associated with neutrophilia and decreased fructosamine , as in this case , but could account for the prolonged pt . increased d - dimer indicates formation of thrombi , but is non - specific regarding the underlying cause . prolonged pt and elevated d - dimer could be indicative of disseminated intravascular coagulation ( dic ) as is often reported in cases of canine angiostrongylosis . immune - mediated thrombocytopaenia has been reported in association with a. vasorum infection . however , with a platelet count of 9010 / l and aggregates present on the blood smear , it was considered unlikely to have caused the bleeding , since bleeding caused by low platelet number usually occurs only with platelet count below 4010 / l . the acute onset of clinical signs might also have been caused by a ruptured small vessel . aberrant migration of adult worms probably occurs frequently and rupture of the femoral artery has been reported previously in a case report of an experimentally infected dog . finally , the possible role of the parasites secreting an anticoagulant may contribute to the development of bleeding problems this mechanism , however , needs to be further investigated . the finding of l1 larvae in the urinalysis may be explained by ectopic l1 larvae or faecal contamination of the voided urine sample . however , due to the presumed hypocoagulable state of the dog , sampling by cystocentesis was not performed . abdominal ultrasound of a dog diagnosed with a. vasorum . a large amount of free intraabdominal fluid was observed . haemoabdomen is a clinical sign where surgical intervention is often considered an integral part of the diagnostic investigation ( i.e. , laparotomy ) or treatment . failing to make the diagnosis of canine angiostrongylosis before performing surgeryin conclusion , in areas where a. vasorum is enzootic , a baermann test and a direct faecal smear should be included in the initial diagnostic investigation of all dogs presenting with bleeding disorders of unknown origin .\noutput:\n" }, { "from": "agent", "value": "a one - year - old intact female , danish shorthaired pointer was referred to the emergency service with a history of acute collapse and pale mucous membranes after a month of reduced activity but with no other clinical signs . an ultrasound examination of the abdomen indicated the presence of a large amount of free fluid with no obvious cause such as neoplasia or splenic rupture . fluid analysis had the macroscopic appearance of blood with no signs of infection or neoplasia . multiple angiostrongylus vasorum l1 larvae were revealed on a direct rectal faecal smear . the dog was treated with fenbendazole 25 mg / kg orally once daily for 20 days and given supportive treatment . the dog was stabilised on this treatment . haemoabdomen is a clinical sign where surgical intervention is often considered an integral part of the diagnostic investigation ( i.e. , laparotomy ) or treatment . failing to make the diagnosis of canine angiostrongylosis before performing surgery may have a serious adverse affect on the outcome . consequently , in areas where a. vasorum is enzootic , a baermann test and a direct faecal smear should be included in the initial diagnostic investigation of all dogs presenting with bleeding disorders of unknown origin ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cytology laboratories in large centers treating cancer patients occasionally come across meningeal carcinomatosis or neoplastic meningitis ( nm ) , in which there is diffuse seeding of the csf by metastatic carcinoma cells . detection of exfoliated malignant cells in csf due to the meningeal carcinomatosis may sometimes be the first diagnostic clue in patients with diverse neurological symptoms . while csf cytology is highly specific ( 95 % ) in detection of cancer cellsin addition , the detection of metastatic carcinoma cells in csf of patients suffering from an extracranial carcinoma also has important therapeutic and prognostic implications . nm is a clinically important condition and numerous reports on cytology are available in literature ; however , mostly from early 80s and late 90s . the central nervous system ( cns ) is becoming a more common site of involvement as cancer patients live longer due to improvements in systemic therapies and advancement in neuroimaging studies . moreover , many chemotherapeutic agents do not cross the blood brain barrier , leaving the cns / meninges as a potential tumor hideout . this is increasing the importance of effective detection methods of cancer cells in the csf as early management can increase the therapeutic benefit . there are three methods to detect nm , which include clinical signs and symptoms , magnetic resonance imaging ( mri ) of the brain and spine and csf cytology . mri sensitivity and specificity vary with the type of primary cancer with a detection rate of nm in fewer than 50 % of patients . on the other hand , csf cytology has a high specificity ( 95 % ) but associated with less sensitivity . this retrospective study was undertaken to evaluate the utility of csf cytopathology for the diagnosis of metastatic malignancies and to describe cytomorphologic features of various tumors , which help in diagnosis of nm . this study was a retrospective analysis of all csf samples , obtained by spinal tap exclusively and received in the cytopathology laboratory over a period of 20 years from january 1993 to june 2012 . in most cases , csf samples were processed by cytocentrifugation technique ( cytospin ) and stained by papanicolaou and may grunwald giemsa ( mgg ) stains . in nine cases , immunostaining with cytokeratin ( ck ) ( thermo scientific , ca , usa ) and epithelial membrane antigen ( ema ) ( thermo scientific , ca , usa ) was carried out in four cases . all cases reported positive and suspicious for metastatic carcinoma cells were included in the study . clinically , these patients presented with neurologic deficits and thus were subjected to csf cytologic examination . imaging details such as mri features were not available due to the retrospective nature of the study . slides were reviewed by four cytopathologists ( gs , srm , vki , dj ) and classified based on the consensus into negative , positive and suspicious categories ; when multiple csf samples had been examined for a patient , the highest category of cytologic classification was selected . a total of 15,430 csf samples were evaluated during the study period of 20 years . three hundred thirty five of these specimens from 292 patients were positive or suspicious for malignant non - lymphoreticular tumors , whereas 755 specimens from 548 patients were positive or suspicious for lymphoreticular tumors [ tables 1 and 2 ] . non - lymphoreticular neoplasms detected by cytologic examination of csf lymphoreticular neoplasms detected by cytologic examination of csf the most common non - lymphoreticular tumors were primary cns neoplasms ( 72.9 % ) followed by metastatic carcinomas ( 22.6 % ) . the most common lymphoreticular tumors were all ( 60.2 % ) followed by non - hodgkins lymphomas ( 29.1 % ) .36 ( 54.6 % ) patients had already been diagnosed with systemic malignancy whereas 45.4 % of the cases presented with neurological symptoms . in the former , the most common primary was breast ( 28.7 % ) followed by ovary ( 6 % ) and lung ( 4.5 % ) [ table 3 ] . types of metastatic tumors in csf cytology the age of patients with nm ranged from 22 years to 79 years with a mean of 50.5 years . there were 22 males and 44 females ( m : f ratio of 1:2 ) . csf smears of patients with metastasis from breast carcinoma were highly cellular [ figure 1a ] . the tumor cells were arranged mainly singly [ figure 1b ] , although an occasional small cohesive cluster of tumor cells could be seen in most samples . a cell in cell appearance with one cancer cell engulfing an adjacent cancer cell ( cellular cannibalism ) was seen in most of the cases [ figure 1d ] . the cells contained central nuclei with a moderate amount of dense cytoplasm with only occasional cell showing fine peripheral vacuolation [ figure 1e ] . prominent eosinophilic nucleoli most often multiple were seen in all cases [ figure 1f ] . cerebrospinal fluid cytospin preparation from a case of carcinoma breast shows highly cellular smear ( a ) with largely dyscohesive atypical cells ( b ) ; frequent multinucleation ( c ) and cellular cannibalism is evident ( d ) . individual cells show fine cytoplasmic vacuolations ( e ) and prominent nucleoli ( f ) . ( a : may grunwaldgiemsa , 200 , b : pap , 400 , c - f : pap , 400 ) the cellularity of cytospin csf preparation was high with an abundance of cell clusters , which in the majority of cases exhibited papillary pattern [ figure 2a ] . case of carcinoma ovary shows tight papillary clusters ( a : pap , 400 ) and cytoplasmic vacuolation ( b : may grunwaldgiemsa , 400 ) singly lying cells with high nuclear cytoplasmic ratio and hyperchromatic nuclei were seen [ figure 3a ] . intracytoplasmic coarse black granular pigment was identified in a significant number of tumor cells as well as within histiocytes , which failed to stain with iron ( prussian blue ) stain [ figure 3b ] and positive for melanin bleach stain . cytospin preparation of csf of a case of melanoma displays large atypical cell with high nuclear cytoplasmic ratio present within hemorrhagic background ; coarse black pigment is seen in the cytoplasm of an adjacent degenerated cell ( a : may grunwaldgiemsa , 400 ) . increase cellularity of singly lying atypical cells is observed in majority of cases of unknown primary site of cancer ( c : pap , 400 ) lung ( 4 ) , stomach ( 2 ) , gallbladder ( 1 ) , prostate ( 1 ) and neurondocrine carcinoma ( 1 ) : no specific features were identified due to a small number of cases . the tumor cells mainly showed a dyscohesive pattern with singly lying cells having moderate cytoplasm . one case each of tonsillar carcinoma and papillary carcinoma of thyroid could not be analyzed due to poor staining and cellular preservation . the tumor cells were present singly in a majority ( 25 ) of the cases [ figure 3c ] . the site of primary was suggested based on subtle morphologic features ; however , no follow - up could be obtained and exact primary remained unknown . the tumor cells had moderate cytoplasm and centrally placed nuclei showing mild to moderate nuclear pleomorphism . this pattern was largely seen in metastatic breast and lung carcinoma [ figure 4a ] . a case of adenocarcinoma of lung shows singly lying cells with pleomorphic nuclei ( a : pap , 400 ) . milipore membrane filtration preparation shows a cluster of atypical cells from another case of pulmonary adenocarcinoma ( b : pap , 400 ) . immunocytochemistry for cytokeartin shows strong cytoplasmic positivity in a case of ovarian carcinoma ( c ) pattern ii consisted of large cells with abundant cytoplasm with frequent cell groupings and clusters . pattern iii was characterized by the presence of necrotic debris , inflammatory background with a few tumor fragments . few lung carcinomas , melanomas and cases of unknown primary showed pattern iii [ figure 4b ] . immunocytochemistry ( icc ) for ck and ema was performed in 4 cases of breast ( 2 ) and ovarian ( 2 ) carcinoma . in other cases , icc could not be carried out due to either scanty cellularity or a limited number of diagnostic slides . further icc for diagnosis of primary site could also not be attempted in any of the cases as the quantity of csf sample obtained was always limited . csf smears of patients with metastasis from breast carcinoma were highly cellular [ figure 1a ] . the tumor cells were arranged mainly singly [ figure 1b ] , although an occasional small cohesive cluster of tumor cells could be seen in most samples . a cell in cell appearance with one cancer cell engulfing an adjacent cancer cell ( cellular cannibalism ) was seen in most of the cases [ figure 1d ] . the cells contained central nuclei with a moderate amount of dense cytoplasm with only occasional cell showing fine peripheral vacuolation [ figure 1e ] . prominent eosinophilic nucleoli most often multiple were seen in all cases [ figure 1f ] . cerebrospinal fluid cytospin preparation from a case of carcinoma breast shows highly cellular smear ( a ) with largely dyscohesive atypical cells ( b ) ; frequent multinucleation ( c ) and cellular cannibalism is evident ( d ) . individual cells show fine cytoplasmic vacuolations ( e ) and prominent nucleoli ( f ) . ( a : may grunwaldgiemsa , 200 , b : pap , 400 , c - f : pap , 400 ) the cellularity of cytospin csf preparation was high with an abundance of cell clusters , which in the majority of cases exhibited papillary pattern [ figure 2a ] . case of carcinoma ovary shows tight papillary clusters ( a : pap , 400 ) and cytoplasmic vacuolation ( b : may grunwaldgiemsa , 400 ) singly lying cells with high nuclear cytoplasmic ratio and hyperchromatic nuclei were seen [ figure 3a ] . intracytoplasmic coarse black granular pigment was identified in a significant number of tumor cells as well as within histiocytes , which failed to stain with iron ( prussian blue ) stain [ figure 3b ] and positive for melanin bleach stain . cytospin preparation of csf of a case of melanoma displays large atypical cell with high nuclear cytoplasmic ratio present within hemorrhagic background ; coarse black pigment is seen in the cytoplasm of an adjacent degenerated cell ( a : may grunwaldgiemsa , 400 ) . increase cellularity of singly lying atypical cells is observed in majority of cases of unknown primary site of cancer ( c : pap , 400 ) lung ( 4 ) , stomach ( 2 ) , gallbladder ( 1 ) , prostate ( 1 ) and neurondocrine carcinoma ( 1 ) : no specific features were identified due to a small number of cases . the tumor cells mainly showed a dyscohesive pattern with singly lying cells having moderate cytoplasm . one case each of tonsillar carcinoma and papillary carcinoma of thyroid could not be analyzed due to poor staining and cellular preservation . the tumor cells were present singly in a majority ( 25 ) of the cases [ figure 3c ] . the site of primary was suggested based on subtle morphologic features ; however , no follow - up could be obtained and exact primary remained unknown . the tumor cells had moderate cytoplasm and centrally placed nuclei showing mild to moderate nuclear pleomorphism . this pattern was largely seen in metastatic breast and lung carcinoma [ figure 4a ] . a case of adenocarcinoma of lung shows singly lying cells with pleomorphic nuclei ( a : pap , 400 ) . milipore membrane filtration preparation shows a cluster of atypical cells from another case of pulmonary adenocarcinoma ( b : pap , 400 ) . immunocytochemistry for cytokeartin shows strong cytoplasmic positivity in a case of ovarian carcinoma ( c ) pattern ii consisted of large cells with abundant cytoplasm with frequent cell groupings and clusters . marked cytoplasmic vacuolation was a frequent finding in this group [ figure 2b ] . pattern iii was characterized by the presence of necrotic debris , inflammatory background with a few tumor fragments . few lung carcinomas , melanomas and cases of unknown primary showed pattern iii [ figure 4b ] . immunocytochemistry ( icc ) for ck and ema was performed in 4 cases of breast ( 2 ) and ovarian ( 2 ) carcinoma . in other cases , icc could not be carried out due to either scanty cellularity or a limited number of diagnostic slides . further icc for diagnosis of primary site could also not be attempted in any of the cases as the quantity of csf sample obtained was always limited . leptomeningeal metastasis is a serious complication of cancer that occurs in 5 - 10 % of patients with solid tumors and is observed most commonly in patients with breast cancer , lung cancer or melanoma . nearly , 20 % of patients with neurological symptoms and signs are found to have meningeal carcinomatosis at autopsy . tumor cells reach the leptomeninges by hematogenous spread or by direct extension from lesions and are then disseminated throughout the nervous system by the flow of the csf . unfortunately , false negative results are common . it has been suggested that false negative results can be minimized by withdrawing more csf for cytologic analysis , processing the csf specimen immediately and repeating the procedure if the initial cytology is negative . although there are ancillary markers or techniques available , which are helpful in detection of csf dissemination such as csf levels of protein , glucose and tumor markers or contrast - enhanced mri , none of these have shown a definite increase in the diagnostic yield compared to the cytological examination . mri plays an important confirmatory role and can demonstrate involved sites , even in cytology negative cases . however , almost similar character of enhancement in the presence of infective , inflammatory or neoplastic process is the reason for the restricted specificity of mri . on comparative analysis , mri is found to have equal sensitivity to csf cytology , but suffers from lesser specificity . several reports in the literature deal with a comparison of various techniques . in our experience , smears made by cytospin cytocentrifuge technique and one slide each stained by papanicolaou and mgg technique gives the maximum information . filter membrane preparation may be reserved for cases with low yield or diagnostic problems . in our laboratory , we use filter membrane preparation for the diagnosis of primary cns neoplasms where low yield is expected ; however , this method suffers from the drawbacks of exhaustion of complete fluid ; hence , further ancillary studies can not be carried out . thin monolayer technology has been suggested as an appropriate diagnostic method for metastatic tumors in csf . a number of large series have described the statistical information regarding the prevalence of various primary carcinoma sites , which cause nm . few studies have documented the morphologic peculiarities of carcinoma cells found in the csf depending on the primary sites . the diagnosis of meningeal involvement is relatively easy when the patient has a history of carcinoma . patients with neurological signs and symptoms of nm without any known primary site are more difficult to diagnose on cytology unless there is a high index of suspicion . similar to several previous reports , the most common sites were breast , lung , stomach and melanoma . we did not come across any squamous cell carcinoma , which is considered a rare diagnosis in csf cytology . cns metastases occur in approximately 35 % of patients with breast cancer , which is associated with poor survival and only 50 % of patients with leptomeningeal carcinomatosis are diagnosed . morphologic analysis of breast carcinoma patients was characterized by the presence of singly scattered isolated cells with minimal aggregation . this pattern was without characteristics of the original tumor architecture and signifies extensive involvement of the subarachnoid space . in contrast to earlier reports , characteristic indian file pattern was not conspicuous in our cases . ovarian cancer does not commonly involve the nervous system . leptomeningeal metastasis is an even rarer complication of ovarian cancer with only a handful cases reported in the literature . we have identified four cases of ovarian carcinoma in the present series with characteristic cytomorphologic features . ovarian malignancies showed largely grouping of cells with papillary architecture ( pattern ii ) and prominent cytoplasmic vacuolation , which was degenerative in nature . pattern iii was characterized by the presence of necrotic material with a few large tumor fragments and the presence of an inflammatory background , which may represent intraparenchymal metastasis ; however , it could not be correlated with imaging studies . we have identified the same pattern in lung carcinomas , melanomas and cases of unknown primary malignancies . although , exact site of primary was not identified due to either lack of follow - up or early demise of the patient due to disseminated malignancy , report of positive cytology helped the clinician in the overall management and prognostication of patient . multidisciplinary therapy , such as radiation and chemotherapy can improve quality - of - life in patients of meningeal metastasis . role of icc in diagnosis of nm is limited and is of minor help in the problem of false negative cytology . combined use of conventional cytology and icc leads to a slight increase of sensitivity in detecting malignant cells compared with cytology alone . an overview of research tools in the field of csf cancer detection reveals a variety of technologies that can be used to understand the biology of metastatic cancer . methods currently under investigation include new icc methods and flow cytometry for detection of cells . in addition , polymerase chain reaction , fluorescence in situ hybridization and mass spectrometry are being tested for assessment of the non - cellular biomarkers in csf . in primary cns neoplasms ( ependymoma retinoblastoma , medulloblastoma and pineoblastomas ) , the malignant cells appear in groups of cells , which seldom allow for the histological identification of the original tumor . however , age of the patient , known diagnosis , high nuclear cytoplasmic ratio and nuclear molding were helpful features to distinguish these from carcinoma cells . in these cases , the csf cytology is useful only for confirmation of the presence of malignant cells and has no role in histological definition . leukemia and lymphoma cells retain original characteristics of the tumor and the severity of the disease is not reflected necessarily in the csf cellularity , which may vary from scanty to elevated . a positive csf cytology result , especially in cases of metastatic non - lymphoreticular neoplasmstherefore , an attempt must be made to differentiate primary cns neoplasms from metastatic tumors on the basis of cytomorphology of tumor cells . identification of the type of metastatic neoplasm facilitates the detection of the site of the primary neoplasm in such cases . this study presents cases of nm diagnosed over a period of 20 years at a tertiary care referral center ; however , limited by follow - up information of cases , in which primary site of malignancy remained unknown . cytologic examination of csf is an important modality to diagnose meningeal involvement by the systemic malignancies . there are cytomorphologic clues by which this condition is diagnosed and site of primary cancer may be identified . srm and vki contributed in the design of study , acquisition of data , analysis and interpretation of data . dj has been involved in drafting the manuscript , revising it critically for important intellectual content , analysis and interpretation of data . all authors take the responsibility of maintaining relevant documentation of records , slides and other data of cases used in this study on archival material as per the institutional policy . to ensure the integrity and highest quality of cytojournal publications , the review process of this manuscript was conducted under a double - blind mode ( authors are blinded for reviewers and vice versa ) through automatic online system\noutput:\n" }, { "from": "agent", "value": "background : neoplastic meningitis ( nm ) is a condition characterized by leptomeningeal involvement by metastatic carcinoma . detection of exfoliated malignant cells in cerebrospinal fluid ( csf ) due to meningeal metastasis is frequently associated with diverse neurologic presentations.materials and methods : in this retrospective study of all cases of nm diagnosed in csf samples over a 20 - year period at a tertiary care referral center , the cytomorphologic features were reviewed.results : sixty six cases of nm were identified of which 36 already had an established diagnosis of malignancy while in 30 patients , there was no previously known tumor . the most common known primary in the former group was breast followed by ovary . single cell pattern , cellular cannibalism , moderate cytoplasm and rounded nuclei were seen in breast and lung tumors . papillary architecture and cytoplasmic vacuolation were seen in the ovarian primaries . melanin pigment was seen in malignant melanoma.conclusion : csf cytology is an important tool for diagnosis of nm . cytomorphologic features helped in diagnosis and for prediction of the primary site . correct identification of this condition is important as it has therapeutic and prognostic implications ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: today , dengue fever is the most important mosquito - borne viral disease in the world . in the last 50 yearsnearly , 2.5 billion people live in over 100 endemic countries , where dengue viruses can be transmitted . before 1970 , only 9 countries had experienced cases of dengue hemorrhagic fever ( dhf ) ; since then , the number has been increased more than 4-fold and continued to rise . according to world health organization ( who ) and center for diseases control and prevention ( cdc ) reports , there is no report of dengue fever from iran . in this report , we described the first iranian imported case of dengue fever in 58 - year - old women from iran after returning from southeast asia . a 58 - year - old woman was referred to mehr hospital in tehran with fever and body pain associated with skin rashes from 4 days prior to admission , which no response to outpatient therapy . she was febrile ; oral t = 40c , pulse rate was 95 / min , respiratory rate was 20 / min and blood pressure was 100/80 mmhg . physical examination of heart , lungs , abdomen , extremities and neurologic examination were normal . she had mild dehydration and few maculopopular skin rashes over the trunks were appeared since 1 day before admission . laboratory analysis on admission was as follow : hemoglobin = 12.4 g / dl , hematocrit = 38 % , white blood cell count ( wbc ) = 1600 / mm with 42 % neutrophil and 58 % lymphocytes , platelet count ( plt ) = 99,000 / mm , esr = 15 mm / h , urine analysis ( u / a ) showed microscopic hematuria , liver function test was normal , wright and 2me tests were negative . she was under close observation for vital signs , fluid and electrolyte balance and bleeding precaution . complete blood count showed : wbc = 2200 , plt = 91000 , hct = 39 % and u / a was normal . on the third day , her general condition gradually improved and platelet count increased to 123,000 / mm and wbc count to 3500 / mm . the result was as follow : the patient was positive for immunoglobulin m ( igm ) and negative for immunoglobulin g ( igg ) antibodies to dengue by elisa . the patient was discharged on the fourth day with good general condition and platelet count of 127,000 / mm and wbc count of 4400 . dengue is the most common mosquito - borne viral disease of humans and the most common arboviral infection in travelers . dengue is more prevalent than malaria among travelers returning to the united states from the caribbean , south america , south - central asia and southeast asia . furthermore , the range of areas of dengue transmission has expanded significantly in recent years . hyperendemicity has been established in many urban centers of the tropics where rapid development has favored vector proliferation . increasing international travel , ineffective vector control measures , and the lack of a vaccinea recent commentary in jama asserted that widespread appearance of dengue in the continental united states is a real possibility . dengue infections have been reported in over 100 countries and are widespread in most tropical countries of the south pacific , asia , the caribbean , the americas , and africa ( map 1 ) . the geographic spread of dengue infections is similar to that of malaria , but unlike malaria , dengue infections are often found in the urban areas of tropical nations , including thailand , singapore , taiwan , indonesia , philippines , india , and brazil . dengue infections may be asymptomatic , or manifest as a non - specific febrile illness , dengue fever ( df ) , dengue hemorrhagic fever ( dhf ) , or dengue shock syndrome ( dss ) . according to the who guidelines , dengue fever is an acute febrile illness of 2 - 7 days duration with two or more of this manifestations : headache , retro - orbital pain , myalgia , arthralgia , rash , hemorrhagic manifestation and leukopenia . dhf should meet the following 4 criteria : acute onset of high fever , hemorrhagic manifestation , thrombocytopenia 100,000 / mm , and evidence of increased capillary permeability or plasma leakage . dss , defined as dhf plus signs of circulatory failure , is associated with very high mortality . the variability in clinical illness associated with dengue infection and its non - specific symptomatology emphasize the need for laboratory confirmation of all suspected cases . a high index of suspicions required for the diagnosis , especially in areas of nonendemic in travelers . the others hematologic signs , such as thrombocytopenia and atypical lymphocytosis , similarly detected in this case are also helpful for the diagnosis . serologic diagnosis depends on the presence of igm antibody or a rise in igg antibody titer in paired acute and convalescent phase serum . currently , the most widely used igm assay is elisa . if sample positive for igm capture elisa , it should be reported as a probable dengue , not a confirmed dengue , since igm antibody may persist at detectable levels for two or more months after infection . a suspected case of dengue infection can be laboratory confirmed by one of the following means : identification of serum or autopsy tissue samples by rt - pcrseroconversion from negative to positive or a four - fold or greater change in anti - dengueantibody titer in paired serum samplesdengue viral antigen identification in autopsy tissue samples by immunofluorescence or immunohistochemical analysis . identification of serum or autopsy tissue samples by rt - pcr seroconversion from negative to positive or a four - fold or greater change in anti - dengue antibody titer in paired serum samples dengue viral antigen identification in autopsy tissue samples by immunofluorescence or immunohistochemical analysis . this case was suspected dengue infection by igm seroconversion and confirmed by positive rt - pcr in serum sample . to our knowledge\noutput:\n" }, { "from": "agent", "value": "dengue fever , a mosquito - borne flavivirus infection , is endemic in southeast asia . currently , incidences have been increasing among adults . there have been no published reports of dengue fever from iran . widespread connection between different countries may predispose them for acquisition of infection . the patient was a 58 - year - old iranian woman with acute unexplained high - grade fever for 4 days , associated with skin rash , after returning from southeast asia . cbc showed wbc = 1600 / mm3 and platelet count 99,000 / mm3 . the patient also had hematuria . elisa immunoglobulin m ( igm ) antibodies to dengue and serum rt - pcr for dengue virus was positive . the patient managed with conservative treatment and due to good general condition and improvement specific antiviral treatment was not started . she became afebrile at the 3rd day of hospitalization and discharged with good general condition on fourth day . she was afebrile after two weeks follow - up . dengue fever has been increasing among adults . it should be suspected , when a patient presents with acute febrile illness and skin rashes returning from endemic region . conservative treatment may be conducted in uncomplicated cases ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: overall the prognosis in patients with differentiated thyroid cancers ( dtc ) is good . with appropriate treatment , the majority of these patientsget cured except in patients with metastasis where the prognosis is worse . management of patients with differentiated thyroid cancer involves total thyroidectomy followed by radioactive iremnant ablation ( rra ) , except in patients with intrathyroidal tumor 1 cm in size . the rra may also be avoided in low risk well - differentiated thyroid cancer with postsurgical stimulated thyroglobulin ( stg ) 1 ng / ml , an approach not yet approved by american thyroid association ( ata ) . the theoretical goals of adjuvant ablation are ( a ) to destroy any residual microscopic disease , ( b ) to enhance sensitivity of diagnostic whole body iodine scan ( wbis ) and specificity of serum thyroglobulin ( tg ) which facilitates follow - up and early detection of recurrence or metastatic disease , and ( c ) to use postablative wbis which is more sensitive than diagnostic wbis for detection of nodal or distant functioning metastases . according to ata guidelines , stg and neck ultrasound with or without diagnostic wbis should be done 612 months after rra in these patients to see the presence or absence of disease . an area of ongoing controversy is the optimal dose of rai required to successfully ablate remnant tissue after total or near - total thyroidectomy with a single administration in low risk group . this can be achieved by either dosimetry method introduced by benua et al . or by fixed empiric activity of rai . , about 30,000 rad ( 300 gy ) radiation dose to thyroid bed was required for successful ablation and bal cs and padhy found 50 mci ( 1850 mbq ) of rai to deliver this required dose to thyroid bed after total thyroidectomy . however , due to cumbersomeness of dosimetry method , the majority of treating physicians have adopted fixed empiric activity of rai ( 30200 mci or 11107400 mbq ) with no consensus about adequate ablative dose in low risk patients . due to these variable results , there has been lack of consensus among various thyroid organizations on the optimum rai dose for remnant ablation in low risk group . the british thyroid association 's 2007 guidelines recommend the use of high dose rai . national comprehensive cancer network ( nccn ; 2010 guidelines ) , the american thyroid association ( ata ; 2009 guidelines ) , and european thyroid cancer task force consensus report ( etctf ; consensus report , 2006 ) advise that clinicians can choose between the low dose and the high dose due to lack of reliable evidence from large randomized studies . tg is a well - recognized marker in the follow - up of patients with differentiated thyroid cancers after thyroidectomy for persistent disease , distant metastasis , or disease recurrence . stg before rra is a good predictor of successful ablation in these patients . its levels can be influenced by tumor staging and tsh levels as well as other factors . therefore we did this study using tsh to correct the predictive value of stg in success of rra . our objective was to see whether stg / tsh ratio can be used as a good predictor of successful rra and to compare its predictability with stg . patients . we retrospectively reviewed the medical record of all patients with dtc treated at the section of endocrinology , an approval was obtained from ethical review committee of aga khan university hospital for this study . our inclusion criteria were as followed : ( 1 ) all adult patients with dtc ; ( 2 ) those who underwent total thyroidectomy ; ( 3 ) those having stimulated tsh ( stsh ) , stg , and anti - tg antibodies ( anti - tg ) 3 - 4 weeks after thyroidectomy without thyroxine replacement ; ( 4 ) those who received rra ; ( 5 ) those having posttherapeutic wbis ; ( 6 ) those having neck ultrasound , diagnostic wbis , and stg ; and ( 7 ) anti - tg at 612 months after rra . we excluded patients with ( 1 ) less then total thyroidectomy , that is , subtotal thyroidectomy or lobectomy ; ( 2 ) diagnostic wbis done before rra because of possible stunning effect and low sensitivity ; ( 3 ) anti - tg 40 iu / ml prior to rra as it might influence the absolute value of stg . all 75 patients were treated as per following protocol : ( 1 ) they underwent total thyroidectomy ; ( 2 ) they were without thyroxine replacement for 3 - 4 weeks following surgery ; ( 3 ) they were on low iodine diet for 2 weeks prior to rra ; ( 4 ) they got their stsh , stg , and anti - tg done approximately 2 - 3 days prior to rra ; ( 5 ) they received rra of 30 to 100 mci in ata low risk , 150 mci in ata intermediate risk , and 200 mci in ata high risk groups ; ( 6 ) they got their posttherapeutic wbis done 3 to 5 days after rra ; ( 7 ) they were started on thyroxine after rra to suppress tsh below 0.1 in intermediate and high risk group and below 0.5 in low risk group ; and ( 8 ) they get their stsh , stg , anti - tg , neck ultrasound , and diagnostic wbis 612 months after rra . diagnostic wbis was performed 48 hours after giving 2 mci of i. we used dual head digital gamma camera ( ecam , siemens , germany ) for both posttherapeutic and diagnostic wbis . we assessed the following variables as a possible predictor of successful ablation : stg before rra , stg / tsh ratio before rra , age , sex , rra dose , postablative wbis findings , tnm staging , and histology ( follicular or papillary ) . successful ablation is defined as stg 2 ng / ml with negative anti - tg antibodies , no evidence of tumor on diagnostic wbis as well as on neck ultrasound 612 months after rra . tsh was measured using chemiluminescent assays with analytical sensitivity of 0.008 uiu / ml , functional sensitivity of 0.008 uiu / ml , and reportable range of 0.008 to 150 uiu / ml . tg was measured using chemiluminescent assays with analytical sensitivity of 0.2 ng / ml and functional sensitivity of 0.9 ng / ml interassay for values higher than 2 ng / ml . anti - tg antibodies were measured using chemiluminescent assays with analytical sensitivity of 2.2 iu / ml , interassay precision of 4.65.8 % , and intra - assay precision of 3.24.9 % with reportable range of 203000 iu / ml and normal range 40 iu / ml . comparative analysis was done using student 's t - test or wilcoxon rank sum test for continuous variables and chi - square test for categorical variables . cutoff values of serum preablation stg and stg / tsh were determined and receiver operating characteristic ( roc ) curves were generated using roc analysis . univariate and multivariate logistic regression were performed to see the predictors of successful ablation . for the analysis p valuerecords of 75 patients who fulfilled our criteria were retrieved . out of these 60 % ( 45 ) had successful ablation , while 40 % ( 30 ) had unsuccessful ablation . there was no significant difference between two groups , that is , patients with successful ablation and unsuccessful ablation with respect to age and gender . most of the tumors were papillary carcinomas 91.9 % and 90 % in successful and unsuccessful groups , respectively . similarly no statistically significant differences were found between the two groups in size of tumor , capsular invasion , pathological and tnm tumor stages , lymph node involvement , ata risk , and the dose of radioactive iodine given . however more distant metastasis was seen in unsuccessful group as compared to successful group and this difference was statistically significant . there was also significant difference in lower median levels of stg and stg / tsh ratio in patients with successful and unsuccessful ablation ; that is , lower median level of stg is 3.05 ( 0.2014.5 ) among patients with successful ablation , whereas it is 140 ( 17.65689 ) among patients with unsuccessful ablation . similarly lower median level of stg / tsh ratio is 0.067 ( 0.0050.26 ) among patients with successful ablation compared to 2.84 ( 0.36622.61 ) among unsuccessful ablation group .76.6 % of unsuccessful group patients had stg levels 18 ng / ml as compared to 24.4 % in successful group . similarly more of unsuccessful group patients , that is , 80 % of unsuccessful group patients , had stg / tsh ratio 0.35 against 20.5 % in successful group ( table 1 ) . cutoff value for stg to predict successful and unsuccessful ablation was 18 ng / ml with 76.7 % sensitivity and 79.1 % specificity , while for stg / tsh cutoff was 0.35 with 81.4 % sensitivity and 81.5 % specificity . roc curve for accuracy is illustrated in figure 1 , showing sensitivity and specificity for different cutoff values of stg and stg / tsh ratio ( figure 1 ) . univariate logistic regression found no significant association of ablation outcome with age , gender , tumor size , capsular invasion , distant metastasis , and eta risk . however lymph node involvement , stg levels 18 ng / ml , and stg / tsh ratio 0.35 were significantly associated with unsuccessful ablation ( table 3 ) . similar trend persisted in multivariate analysis and only stg levels and stg / tsh ratio remained significantly associated with unsuccessful ablation . association was stronger for stg / tsh ratio with aor 11.64 ( 2.4355.61 ) than for stg with aor 5.42 ( 1.1824.88 ) ( table 4 ) . unsuccessful ablation may adversely affect the prognosis of patients with dtc ; therefore , identifying the factors that affect the success of ablation is very important in the management of patients with dtc . thyroglobulin is a large glycoprotein with molecular weight of 660,000 daltons containing 3000 amino acids . it is produced in the endoplasmic reticulum of thyroid follicular cells and stored in the golgi apparatus to be secreted in thyroid follicular lumen . tsh stimulation leads to intracellular reuptake of thyroglobulin and its proteolytic degradation into active forms of thyroid hormones , that is , triiodothyronine and thyroxine . initially tg was thought to exist in the thyroid gland only but in 1961 its presence was demonstrated in the peripheral circulation too as a byproduct of thyroid hormone synthesis . in healthy individuals , small amount of tg is released physiologically into the circulation but in dtc it is actively released into circulation . as tgis actively released into circulation by dtc , therefore its level in circulation following total thyroidectomy is an established method of detecting recurrent or persistent disease particularly when performed after thyroxine withdrawal or recombinant tsh administration . measurement of serum tg becomes an important parameter for residual or recurrent disease in the follow - up of patients with dtc following total thyroidectomy and rra . predicting the outcome of ablation in patients with dtc is important as this can help make appropriate decisions for patient 's management . previous studies have focused on stg only as a laboratory parameter for predicting the ablation outcome . a recent retrospective study conducted on 133 patients revealed that a preablation stg 8.55 ug / l predicted disease remission after 1824 months of rra with sensitivity of 88 % , specificity of 72 % , positive predictive value ( ppv ) of 47 % , and negative predictive value ( npv ) of 95 % . another study conducted on 96 patients in brazil found that patients with stg levels 18 ng / ml before rra had 5.89 times greater chance of successful ablation compared to those with stg 18 ng / ml ( p 0.0001 ) with sensitivity of 71.4 % , specificity of 70.2 % , ppv of 71.4 % , and npv of 70.2 % . another recent study conducted in china showed that in patients with dtc who underwent total thyroidectomy , stg and its ratio with tsh before rra might be considered as predictive markers for metastasis . we used diagnostic wbis as an exclusion criterion due to its low impact on the decision to ablate and because of concerns over i induced stunning of normal thyroid remnants and distant metastases from thyroid cancer . this is first attempt to assess the association of stg / tsh ratio with ablation outcome , which was found to be significantly associated with ablation outcome than stg . in this study , factors such as age , gender , type of tumor , size of tumor , and capsular invasion were not found to be significantly associated with rra outcome , while stg levels are significantly associated , a finding which is consistent with other studies . important finding of our study is association of stg / tsh ratio with ablation outcome . we found that stg / tsh ratio had stronger association with ablation outcome than stg . as stg / tsh ratio was found to be significantly associated with ablation outcome ; therefore , it can help us in predicting the success of rra and we hypothesized that it might also help in adjusting the dose of i. this adjustment in the dose of iremnant ablative dose might be very important particularly in low risk dtc where there is still no consensus on optimal dose . cutoff value of 18 ng / ml for stg from our study is consistent with other studies from brazil , but our sensitivity and specificity are higher than those reported earlier for cutoff value of 18 ng / ml . since no cutoff value for stg / tsh ratio was available ; therefore , we also determined cutoff value for stg / tsh ratio , that is , 0.35 for predicting ablation outcome . these cutoff values for stg and stg / tsh ratio in our study have high sensitivity and specificity in predicting the outcome . this study is one of its kinds , investigating the association of stg / tsh ratio with ablation outcome in patients with dtc . we found that patients with stg / tsh ratio 0.35 before rra had 11.64 times greater chance of successful ablation compared to those with stg / tsh ratio 0.35 with sensitivity of 80.0 % and specificity of 81.4 % ( p. however limitation of our study was its retrospective nature ; therefore , we could retrieve data of only 75 patients who fulfilled our inclusion criteria . many of the previous studies regarding role of stg in predicting rra outcome were also retrospective in nature . another limitation of this study is use of different ablative doses in low , intermediate , and high risk groups which could have an impact on success of ablation as british thyroid association 2007 guidelines favor use of high dose for rra . our data do not show a significant impact of dose of rra upon outcome and this is in concordance with two recently published prospective trials claiming no difference in outcomes in patients treated with 30 and 100 mci rra ( 32,33 ) . because of its smaller sample size , the result of this study should be interpreted cautiously and we recommend further studies not only to validate the cutoff levels that we have set but also to confirm the other findings of this study . our study adds to the value of preablation stg and establishes the role of preablation stg / tsh ratio in predicting the ablation outcome . one of the suggestions that came out from this study is that preablation stg / tsh ratio might be used for risk stratification , as till now there is no laboratory parameter in the risk stratification of the ata and eta for dtc before ablation . so patients with stg / tsh ratio 0.35 can be placed in ata and eta high risk categories as stg / tsh ratio has even more significant association with rra outcome than size and capsular invasion . however considering the limited sample size in this study , further studies are warranted to confirm these findings .\noutput:\n" }, { "from": "agent", "value": "background . about 90 % of thyroid cancers are differentiated thyroid cancers . standard treatment is total thyroidectomy followed by radioactive i131remnant ablation and tsh suppression with thyroxine . unsuccessful ablation drastically affects the prognosis of patients with dtc particularly high risk individuals ; therefore , identifying the factors that affect the success of ablation is important in the management of patients with dtc . stg is a good predictor of successful ablation in dtc . its levels can be influenced by tumor staging and tsh values , as well as other factors . therefore , we did this study using tsh to correct the predictive value of stg in success of rra . methods . we retrospectively reviewed the records of 75 patients with dtc , who underwent total thyroidectomy followed by rra and tsh suppression . results . preablation stg and stg / tsh ratio are significantly associated with ablation outcome . cutoff value for stg to predict successful and unsuccessful ablation was 18 ng / ml with 76.7 % sensitivity and 79.1 % specificity , while for stg / tsh cutoff was 0.35 with 81.4 % sensitivity and 81.5 % specificity ( p < 0.001 ) . association was stronger for stg / tsh ratio with adjusted odds ratio ( aor ) 11.64 ( 2.4355.61 ) than for stg with aor 5.42 ( 1.1824.88 ) . conclusions . preablation stg / tsh ratio can be considered as better predictor of ablation outcome than stg , tumor size , and capsular invasion ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a large number of studies on the prevalence of malocclusion in different populations have been published .110 since the early 1900 s , when orthodontics became a recognized specialty of the dental profession , much has been written on the incidence and / or prevalence of malocclusion in the different populations .1,4,5,11 different ethnic groups have been investigated ; including , amerindian ,2,3 caucasian ,4,5 non - hispanic black ,69 non - hispanic white ,8 and italian .10 analysis of the prevalence of occlusal traits in isolated human populations can provide valuable information regarding the aetiology of malocclusions and other complex traits .11 the reported incidences vary from 30 to 93 percent , making it clear that the majority of children have irregular teeth . this divergence in prevalence figures may depend on differences for specific ethnic groups , but also on wide ranges in number , as well as in age , among the subjects examined . however , differences in registration methods , i.e. the criteria for the recorded items , are probably the most important factors explaining this differences .3 there are several methods that may be used to evaluate , describe and classify occlusion . these can be classified basically as qualitative and quantitative .12 qualitative variables define only the presence or absence of a selected malocclusion criterion . a series of malocclusion studies have been undertaken using qualitative methods of assessment .4,1315 the most examined topics are antero - posterior relationships .3,16,17 angle s classification has been widely used as a qualitative epidemiological tool for malocclusion assessment .17 despite the amount of literature on the subject , which has been summarized by thilander et al ,3 there are few epidemiologic studies on turks .1820 the aim of the present survey was , therefore , to document the prevalence of individual traits of malocclusion , including sagittal relationship , overbite - open bite , overjet , posterior crossbite - scissors bite , irregularity score for upper and lower incisors , and midline diastema , in a sample of central anatolian adolescents aged 1217 years who are representing most common orthodontic treatment age group . furthermore , the association between gender and the above traits was evaluated . the documents will be useful for the forecasts of the need for orthodontic treatment among turkish population which is important for planning public orthodontic and dental services , and to show the way for further works needed to be done regarding aetiology and / or environmental and genetic interactions . a sample of 2329 subjects ( 1125 males , 1204 females ; age range , 12.517.4 years ; mean age , 14 years and 6 months ) was randomly selected from a population that attended the dental health center of krkkale in the centre of anatolia , turkey . the sample was derived from general dental health control demanded subjects not only seeking the orthodontic treatment . family origin , registered in order to determine the turkish racial composition of the sample , was found to be representative of anatolian ancestry from the central part of the country . all male and female patients who met the following criteria were included in the sample : ( 1 ) age 12 to 18 years , ( 2 ) secondary dentition present with no remaining deciduous teeth , ( 3 ) no multiple missing teeth , ( 4 ) presence of first permanent molars and canines , and ( 5 ) no previous history of orthodontic treatment . findings were classified in the following categories ; occlusal anteroposterior relationships : normal occlusion , class i malocclusion , class ii division 1 , class ii division 2 , and class iii malocclusion . patients with an occlusal pattern that deviated from the class i relationship as described by angle ,21 ( including crowding , spacing , rotations and abnormal overbite and overjet ) were categorized as class i malocclusion . thus , the class i normal category was limited to patients with occlusions that were ideal or near ideal . patients with a different angle classification of occlusion on each side were categorized into a single class based on the predominant pattern of occlusion and / or canine relationship .3,17,22 the overbite was considered normal if the maxillary central incisors overlapped the incisal third of the crown of the mandibular central incisors . the overbite was classified as increased if the overlap exceeded the middle third of the crown of the mandibular central incisors and reduced if it was less than incisal third of the crown . an edge - to - edge incisor relationship was noted if the maxillary and mandibular incisors occluded on their incisal edges . anterior open bite was diagnosed when there was a vertical gap between the maxillary and mandibular incisor edges with the teeth in centric occlusion .3,17 overjet was defined as the horizontal distance in millimeters between the labial surfaces of the maxillary and mandibular central incisors . for this purpose , the subject was positioned with the frankfort plane horizontal , and the distance was measured with a ruler . overjet values between 2 and 3 mm were considered normal , greater than 3 mm was considered increased , and less than 1 mm was taken as edge to edge . the term negative overjet was used if both the left and right maxillary central incisors were in lingual occlusion .3,17 posterior crossbite and scissors bite were registered as bilateral , right and left .3,23 anterior crowding was recorded for the incisor segment of each jaw ( 13 mm = mild ; 46 mm = moderate ; 6 mm = severe ) .3,17 midline diastema was diagnosed when there was a space of at least 1 mm between the central incisors in either arch .3,17 the examinations were completed in about one and a half years by the same examiner ( ieg ) . intraexaminer reliability , tested by re - examining 40 subjects after an interval of 2 to 4 weeks , was high ( r = 0.95 ) . the ratio of the sample , as a maximum estimate of the proportion of individual traits of malocclusion in the whole population was calculated for the total sample and for girls and boys separately . number of subjects with diagnosed anomaly ( n ) and its prevalence ( n / n x 100 , where n is the number of subjects examined ) was determined . the data were coded , entered into a computer , and analyzed with the spss software package ( version 13.0 , spss inc . , the chi - square statistic was used to assess the statistical significance between boys and girls while taking p values of less than 0.05 as statistically significant . the ratio of the sample , as a maximum estimate of the proportion of individual traits of malocclusion in the whole population was calculated for the total sample and for girls and boys separately . number of subjects with diagnosed anomaly ( n ) and its prevalence ( n / n x 100 , where n is the number of subjects examined ) was determined . the data were coded , entered into a computer , and analyzed with the spss software package ( version 13.0 , spss inc . , the chi - square statistic was used to assess the statistical significance between boys and girls while taking p values of less than 0.05 as statistically significant . as will be noted from table 1 , class i malocclusion was found in 812 subjects , which represented 34.9 % of the 2329 individuals examined . class ii malocclusion was diagnosed in 1041 individuals ; 40.0 % of all patients were division 1 and 4.7 % of all patients were division 2 . normal overbite was the most common ( 53.5 % ) , mostly observed in girls ( p .001 ) . the prevalence of edge - to - edge and anterior open bite values were found in 5.6 % and 8.2 % , respectively . prevalence of increased overjet ( 25.1 % ) was found to be higher than negative overjet ( 10.4 % ) and edge to edge ( 5.6 % ) values . crossbite was found more frequently on the right than left side , but occurred on both sides in 4.0 % . scissors bite was rare , being recorded in only 0.3 % of the subjects ( table 4 ) .17.9 , 9.1 and 38.1 % of those had crowding in the upper arch , the lower arch and both arches , respectively . it was observed mostly in girls , but no statistically significant relationship was found ( table 6 ) . although many studies have been published that describe the prevalence and types of malocclusion , it is difficult to compare and contrast these findings ; in part , because of the varying methods and indices used to assess and record occlusal relationships , age differences of the study populations , examiner subjectivity , specific objectives , and differing sample sizes .22 the method used in this study was collected from different studies .3,10,17,22 our results will be discussed with the findings from other geological regions because there have been few epidemiologic surveys in turkey . gray et al18 used the treatment priority index , and found 72.26 % of 483 primary school students from konya district ( anatolia ) required orthodontic treatment . uur et al20 found a 59.62 % prevalence of malocclusions in 610 - year - old 572 turkish primary school children in anatolia . our study included a wide adolescent sample and malocclusion was found in 89.9 % ( table 1 ) . this rate was higher than reported by gray et al18 and uur et al. 20 this higher rate could have arisen from the large number of examined persons and different age group according to the other studies .1820 uur et al20 and proffit et al24 have reported that orthodontic treatment needs increases with age . also age group of our study population was higher than the other studies .1820 although angle s classification is limited in that it does not incorporate vertical and transverse abnormalities , it is a universally accepted system that is reliable and repeatable and minimizes examiner subjectivity .17 in this study , class i malocclusion was found in 34.9 % of the sample . this class i occlusion figure included individuals with incisor crowding and dental malalignment and thus did not imply ideal class i occlusion . onyeaso17 found that class i malocclusion was more common in nigerian adolescents ( 50 % ) . in a study bysilva and kang ,22 latin adolescents demonstrated a higher rate of class i malocclusion of 69.4 % . the prevalence of class ii division 1 ( 40.0 % ) in the present study was greater than the rates reported by onyeaso17 ( 12.3 % ) , thilander et al3 ( 14.9 % ) , haynes25 ( 12.5 % ) , silva and kang22 ( 20.3 % ) , and foster and day26 ( 27.2 % ) . compared with the data from the american , asian , australian , and european populations ,27 the anatolian sample also showed a relatively high prevalence of class ii malocclusions . lauc28 found that class ii malocclusion was more common in their population ( 45.1 % ) , and explained this figure by a genetic influence on the incidence of class ii malocclusions . the prevalence of class ii division 2 ( 4.7 % ) in the present study complied with thilander et al3 ( 5.9 % ) , but greater than the rates reported by onyeaso17 ( 1.4 % ) and silva and kang22 ( 1.2 % ) . the prevalence of class iii malocclusion ( 10.3 % ) determined in this study is very close to the rates determined by silva and kang22 and onyeaso ,179.1 % and 11.8 % , respectively . however , goose et al29 ( 2.91 % ) , haynes25 ( 2.5 % ) , foster and day26 ( 3.5 % ) , proffit et al24 ( 5.7 % ) , thilander et al3 ( 5.8 % ) and lauc28 ( 4.8 % ) reported lower rates . the present study confirmed that the predominant antero - posterior relationship of the arches in turkish adolescents was class ii division 1 . of the vertical anomalies , increased overbite was more than twice as frequent as anterior open bite . our results were similar to the rates reported by thilander et al3 and lauc28 who also reported a deep bite was often associated with a class ii malocclusion and more common in boys . but , onyeaso17 reported a lower rate of deep bite , but higher rate of class i malocclusion in their population . increased overjet showed high percentage as increased overbite in this study ; this is a reflection of the higher prevalence of class ii malocclusion among central anatolian turks . our findings agree with those of thilander et al3 in bogotanian adolescents and ciuffolo et al10 in italian adolescents where high rates of increased overjet in the permanent dentition were reported . in a nigerian population , onyeaso17 stated that increased overjet was not as great as it was in white people . in this study , uni / bilateral posterior crossbite was more frequent than scissor bite and was observed in 9.5 % of the sample . this rate was similar to the findings of ciuffolo et al ,10 was higher than thilander et al. 3 crowding in the anterior segment of one or both arches was the most frequent of all anomalies recorded ( 65.2 % ) . this finding complied with the results of thilander et al3 and lauc .28 nevertheless , other studies have reported lower rates of anterior crowding located in the mandibular anterior segment .17,25,26 however , anterior crowding was greater in the upper arch than the lower arch , in this study . the national health and nutrition survey iii undertaken in the united states between 1989 and 1994 showed a frequency of crowding ranging from 42.3 % at ages 811 to 54.5 % at ages 1217 which was lower than the frequencies observed in this investigation .24 thilander et al3 found the prevalence of median diastema in their population to be 13.5 % in the early mixed and 4 % in the permanent dentition . in contrast , this rate for our study was 7 % and the frequency of diastema in nigeria was 24 % .17 onyeaso indicated that diastema is not regarded as a malocclusion among nigerians but as a mark of natural beauty .17 it is obvious that several genetic and environmental interacting factors are related to the aetiology of malocclusions . soft diet , mouth breathing , tongue trusting , sleeping posture , sucking , and other habits as well as specific factors ( skeletal growth disturbances , muscle dysfunction , disturbances in embryologic and dental development ) interact with heredity in the development of major types of malocclusion .24 the difficulty in separating these factors is obvious : in terms of gene environment interactions , intraoral environmental change may be a decisive factor but this change may also reveal previously masked genetic effects .30 the results of this investigation show that class ii division 1 malocclusion is the most prevalent occlusal pattern among central anatolian adolescents and the high values of increased overjet and overbite are a reflection of the high prevalence of class ii malocclusion . in relation to gender , girls had significantly more normal overbite than the boys while boys significantly had more increased overbite than the girls . it is proposed that the genetic influence on development of these occlusal attributes in the connatural population of anatolia should be the subject of future investigations . further studies are required to clarify the findings and to provide accurate estimates of the orthodontic treatment need in turkish adolescents .\noutput:\n" }, { "from": "agent", "value": "objectivesthe objective of this study was to describe the prevalence of malocclusion in a population of central anatolian adolescents in relation to gender.methodsthe sample comprised 2329 teenagers ( 1125 boys and 1204 girls ) , aged between 12 and 17 years ( mean age : 14.6 yrs ) . occlusal anteroposterior relationships were assessed using the angle classification . other variables examined were overjet , overbite , crowding , midline diastema , posterior crossbite , and scissors bite.resultsthe results showed that about 10.1 % of the subjects had normal occlusions , 34.9 % of the subjects had class i malocclusions , 40.0 % had class ii division 1 malocclusions , 4.7 % had class ii division 2 malocclusions and 10.3 % had class iii malocclusions . over 53.5 % had normal overbites , and 18.3 % , 14.4 % , 5.6 % , and 8.2 % had increased , reduced , edge - to - edge or anterior open bite values , respectively . overjet relationship was normal in 58.9 % , increased in 25.1 % , reversed in 10.4 % , and edge - to - edge in 5.6 % . a posterior crossbite registered in 9.5 % and scissors bite in 0.3 % . anterior crowding was present in 65.2 % of the sample and midline diastema in 7.0 % . no clear gender differences were noted , except for normal overbite ( most frequent in girls , p < .001 ) and increased overbite ( most frequent in boys , p < .05 ) . conclusionsclass ii division 1 malocclusion is the most prevalent occlusal pattern among the central anatolian adolescents and the high values ( 25.1 % and 18.3 % ) of increased overjet and overbite were a reflection of the high prevalence of class ii malocclusion ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: severe congenital neutropenia ( scn , also known as kostmann disease ) includes a heterogeneous group of disorders characterized by chronic low absolute neutrophil counts ( anc ) ( below 0.510 / l ) in the peripheral blood , early onset of bacterial infections , and mostly a maturation arrest of the myelopoiesis in the bone marrow at the level of promyelocyte / myelocyte stage . heterozygous mutations in the elane gene ( formerly named ela2 ) , encoding the neutrophil primary granule protease , neutrophil elastase , were demonstrated in approximately 5060 % of patients with scn , whereas homozygous mutations in the hax1 gene , encoding the mitochondrial antiapoptotic protein hs1 - associating protein x-1 ( hax - 1 ) , were identified in about 15 % of patients . in addition , around one third of the patients with scn is still uncharacterized by any gene mutation . cyclic neutropenia ( cyn ) is another hereditary form of severe chronic neutropenia in which the neutrophil count oscillates and patients present less severe clinical symptoms compared to scn . in the majority of cases with cyn , patients with scn or cyn currently receive recombinant human granulocyte colony - stimulating factor ( g - csf ) therapy and more than 90 % of patients respond to this treatment with increased peripheral neutrophil level , diminished vulnerability to bacterial infections and much improved quality of life . however , there are still patients who exhibit unsatisfactory periodontal health despite having g - csf - normalized neutrophil levels and receiving regular professional dental care . the pathogenesis of gingivitis and periodontitis is multifactorial and includes complex interactions between oral microbes and host defense . neutrophils are key immune cells for oral health and neutrophil deficiency or dysfunction often results in periodontal disease . besides low levels of anc patients with scn also exhibit deficiencies in neutrophil granule - associated proteins , including the antimicrobial peptides pro - ll - 37 ( or hcap - 18 ) with its active peptide ll - 37 , and human neutrophil peptides 13 ( hnp13 ) . the lack of ll - 37 and / or hnp suggests that these neutrophils are functionally deficient with respect to their antimicrobial capacity . such deficiency in periodontal neutrophils may influence the subgingival microbiota composition in the periodontal pocket , and as a consequence , contribute to the pathogenesis of periodontal breakdown . although it has long been recognized that patients with scn or cyn often suffer from early onset of severe periodontitis , the correlation between genotype and phenotype in terms of gene mutations in scn and periodontal health is still unclear . previous studies have demonstrated that elane mutations correlate with more severe disease manifestation in patients with scn , and that patients with elane mutations require higher doses of g - csf compared to patients with hax1 mutations . in light of these findings , we hereby address the hypothesis that elane gene mutations are associated with the occurrence of periodontitis in subjects with scn . the underlying parameters that are believed to contribute to periodontitis were studied , including subgingival microbiota composition , proinflammatory cytokines , as well as innate immune components hnp13 and pro - ll - 37 / ll - 37 . from 2006 to 2008 , patients with scn ( n = 13 ) or cyn ( n = 1 ) were recruited from karolinska university hospital , sweden and numbered periodontitis neutropenia ( pn ) 1 - to - 14 according to recruitment date . the subjects ranged in age from 6 to 50 years with various forms of scn or cyn . ethical permission was granted by the local ethical committee at karolinska university hospital ( 2006/176 - 31/4 ) . all subjects or their parents provided informed consent before participating in this study . the clinical examination involved recording visible plaque index ( % ) , bleeding on probing ( bop , % ) , probing depth ( mm ) , and radiographs which were taken in order to determine the occurrence of alveolar bone loss . the distance between enamel cement junction and marginal bone ( mm ) was measured on the radiographs and alveolar bone loss was diagnosed when the distance exceeded 3.0 mm . based on the clinical examination , the patients were categorized as either being healthy , suffering from gingivitis or periodontitis , or edentulous , respectively . gingivitis was diagnosed when bop exceeded 25 % , while periodontitis was diagnosed when the patient exhibited both alveolar bone loss for more than three teeth and periodontal pockets exceeding 4 mm for the same teeth . plasma was gathered from the top layer and subsequently stored at 80c in aliquots . for each subject , gcf was collected from the mesial surface of an incisor or for pn2 from a deciduous molar by inserting a paper strip ( periopaper , oralflow inc . ) into the gingival sulcus for 15 s. the strip was then analyzed using a periotron model 8000 ( oralflow inc . ) , and the volume was calculated by interpolation from a standard curve . individual strips were then placed into a sterile tube containing 120 l pbs buffer ( ph = 6.8 ) , 0.01 m edta , 0.3 % bovine globulin , 0.005 % triton x-100 , and 0.05 % sodium azide . subgingival bacteria samples were collected using a paper strip from the distal surface of an incisor or from a deciduous molar for pn2 . since there was lack of data and references in the literature regarding the subgingival microbiota assessed using 454 pyrosequencing , we collected subgingival bacterial samples from nine systemically healthy individuals aged from 5 to 19 years , with three samples from sites of periodontitis and six from healthy sites or those of gingivitis , in order to provide references for samples from neutropenic cases in the 454 analysis . plasma and gcf samples were analyzed for il - 1 , il - 4 , il - 6 , il - 17 , ifn - , and tnf - concentrations using fluorescent bead - based luminex cytokine immunoassays , which were performed using the bio - plex system ( bio - rad laboratories ) . samples were thawed on ice and homogenized in a vortex mixer for 1 min before analysis . the cytokine concentrations were determined using a human cytokine lincoplex kit ( millipore ) according to the manufacturer s instructions and were expressed as ng / ml in gcf and pg / ml in plasma . plasma and gcf samples were analyzed for pro - ll - 37 and mature ll - 37 peptide content using western blotting . the gcf samples were treated with 60 % acetonitrile containing 1 % trifluoroacetic acid for 2 h on a shaker at 4c to extract small peptides from the periopaper . following centrifugation , the extraction supernatant was then transferred into a sterile tube , kept at 80c , and lyophilized until dry . the gcf extract and plasma were dissolved in nupage sds sample buffer ( invitrogen ) and electrophoresed in 1.0 mm 412 % nupage bisimmunoblotting was performed as previously described using the following antibodies : rabbit anti - ll - 37 ( innovagen , sweden ) , mouse anti - alpha defensin 1 + 2 + 3 antibody ( abcam ) , goat anti - rabbit , and goat anti - mouse immunoglobulins ( dako , denmark ) . the microbiota of subgingival bacterial samples from the patients and reference individuals was analyzed using a 454 flx pyrosequencing facility according to previously described methods with minor modifications . briefly , dna extraction was performed using dneasy blood and tissue kit ( qiagen ) with proteinase k treatment at 56c for 16 h. for each extracted dna sample , three 50 l pcr mixes were prepared containing 1 pcr buffer , 200 m dntp purepeak dna polymerization mix ( pierce nucleic acid technologies ) , 0.5 m of each primer , 0.5 u phusion f - 530l enzyme ( finnzyme ) , and 2 l template - dna . the primer pairs , amplifying the hypervariable 16s rrna gene v3 - v4 regions , were : 341f ( 5 cctacgggnggcwgcag ) with adaptor b and 805r ( 5 gactachvgggtatctaatcc ) with adaptor a and a sample - specific sequence barcode . the pcr conditions were 95c for 5 min , 26 cycles of 95c for 40 s , 58c for 40 s , and 72c for 1 min , followed by 72c for 7 min . a pcr reaction without template was also used as a control for each primer pair . after analyses in agarose gel ( 1 % w / v in tbe buffer ) , the samples with the same barcode were pooled and pcr reactions were purified using an agencourt ampure system ( beckman coulter genomics ) . the dna concentrations were measured using qubit ( invitrogen ) , and the quality control was performed with a bioanalyzer 2100 using the dna 1000 chip ( agilent technologies ) . the samples were diluted to 3 ng / l , and 5 l of each sample was pooled . region v4 was sequenced using 454 pyrosequencing with a standard amplicon kit and run in the 454 - flx ( roche , switzerland ) . sequences were excluded if there was no perfect match with the primer or barcode , ambiguous nucleotides , or the sequence was shorter than 200 nucleotides excluding the primer / barcode . non - redundant reads with the primer / barcode removed were aligned and sorted into operational taxonomic units ( otu ) using complete linkage clustering and a 3 % distance threshold , which was performed using the pyrosequencing pipeline at ribosomal database project ( rdp ) . the otus were blast searched against the database with a 95 % identity threshold over at least 180 nucleotides . the different sequence identification levels were analyzed and visualized with regards to relative abundance as a heat map using multieperiment viewer v4 .6 software . principal coordinate analysis ( pcoa ) was performed and visualized in fast unifrac ( http://bmf.colorado.edu/fastunifrac/ ) using normalized weighted abundance . the shannon diversity index was calculated using the r package vegan ( http://cran.r-project.org/package=vegan ) for each sample , and the significance was tested using the wilcoxon rank sum test . from 2006 to 2008 , patients with scn ( n = 13 ) or cyn ( n = 1 ) were recruited from karolinska university hospital , sweden and numbered periodontitis neutropenia ( pn ) 1 - to - 14 according to recruitment date . the subjects ranged in age from 6 to 50 years with various forms of scn or cyn . ethical permission was granted by the local ethical committee at karolinska university hospital ( 2006/176 - 31/4 ) . all subjects or their parents provided informed consent before participating in this study . the clinical examination involved recording visible plaque index ( % ) , bleeding on probing ( bop , % ) , probing depth ( mm ) , and radiographs which were taken in order to determine the occurrence of alveolar bone loss . the distance between enamel cement junction and marginal bone ( mm ) was measured on the radiographs and alveolar bone loss was diagnosed when the distance exceeded 3.0 mm . based on the clinical examination , the patients were categorized as either being healthy , suffering from gingivitis or periodontitis , or edentulous , respectively . gingivitis was diagnosed when bop exceeded 25 % , while periodontitis was diagnosed when the patient exhibited both alveolar bone loss for more than three teeth and periodontal pockets exceeding 4 mm for the same teeth . plasma was gathered from the top layer and subsequently stored at 80c in aliquots . for each subject , gcf was collected from the mesial surface of an incisor or for pn2 from a deciduous molar by inserting a paper strip ( periopaper , oralflow inc . ) into the gingival sulcus for 15 s. the strip was then analyzed using a periotron model 8000 ( oralflow inc . ) , and the volume was calculated by interpolation from a standard curve . individual strips were then placed into a sterile tube containing 120 l pbs buffer ( ph = 6.8 ) , 0.01 m edta , 0.3 % bovine globulin , 0.005 % triton x-100 , and 0.05 % sodium azide . subgingival bacteria samples were collected using a paper strip from the distal surface of an incisor or from a deciduous molar for pn2 . since there was lack of data and references in the literature regarding the subgingival microbiota assessed using 454 pyrosequencing , we collected subgingival bacterial samples from nine systemically healthy individuals aged from 5 to 19 years , with three samples from sites of periodontitis and six from healthy sites or those of gingivitis , in order to provide references for samples from neutropenic cases in the 454 analysis . plasma and gcf samples were analyzed for il - 1 , il - 4 , il - 6 , il - 17 , ifn - , and tnf - concentrations using fluorescent bead - based luminex cytokine immunoassays , which were performed using the bio - plex system ( bio - rad laboratories ) . samples were thawed on ice and homogenized in a vortex mixer for 1 min before analysis . the cytokine concentrations were determined using a human cytokine lincoplex kit ( millipore ) according to the manufacturer s instructions and were expressed as ng / ml in gcf and pg / ml in plasma . plasma and gcf samples were analyzed for pro - ll - 37 and mature ll - 37 peptide content using western blotting . the gcf samples were treated with 60 % acetonitrile containing 1 % trifluoroacetic acid for 2 h on a shaker at 4c to extract small peptides from the periopaper . following centrifugation , the extraction supernatant was then transferred into a sterile tube , kept at 80c , and lyophilized until dry . the gcf extract and plasma were dissolved in nupage sds sample buffer ( invitrogen ) and electrophoresed in 1.0 mm 412 % nupage bisimmunoblotting was performed as previously described using the following antibodies : rabbit anti - ll - 37 ( innovagen , sweden ) , mouse anti - alpha defensin 1 + 2 + 3 antibody ( abcam ) , goat anti - rabbit , and goat anti - mouse immunoglobulins ( dako , denmark ) . the microbiota of subgingival bacterial samples from the patients and reference individuals was analyzed using a 454 flx pyrosequencing facility according to previously described methods with minor modifications . briefly , dna extraction was performed using dneasy blood and tissue kit ( qiagen ) with proteinase k treatment at 56c for 16 h. for each extracted dna sample , three 50 l pcr mixes were prepared containing 1 pcr buffer , 200 m dntp purepeak dna polymerization mix ( pierce nucleic acid technologies ) , 0.5 m of each primer , 0.5 u phusion f - 530l enzyme ( finnzyme ) , and 2 l template - dna . the primer pairs , amplifying the hypervariable 16s rrna gene v3 - v4 regions , were : 341f ( 5 cctacgggnggcwgcag ) with adaptor b and 805r ( 5 gactachvgggtatctaatcc ) with adaptor a and a sample - specific sequence barcode . the pcr conditions were 95c for 5 min , 26 cycles of 95c for 40 s , 58c for 40 s , and 72c for 1 min , followed by 72c for 7 min . a pcr reaction without template was also used as a control for each primer pair . after analyses in agarose gel ( 1 % w / v in tbe buffer ) , the samples with the same barcode were pooled and pcr reactions were purified using an agencourt ampure system ( beckman coulter genomics ) . the dna concentrations were measured using qubit ( invitrogen ) , and the quality control was performed with a bioanalyzer 2100 using the dna 1000 chip ( agilent technologies ) . the samples were diluted to 3 ng / l , and 5 l of each sample was pooled . region v4 was sequenced using 454 pyrosequencing with a standard amplicon kit and run in the 454 - flx ( roche , switzerland ) . sequences were excluded if there was no perfect match with the primer or barcode , ambiguous nucleotides , or the sequence was shorter than 200 nucleotides excluding the primer / barcode . non - redundant reads with the primer / barcode removed were aligned and sorted into operational taxonomic units ( otu ) using complete linkage clustering and a 3 % distance threshold , which was performed using the pyrosequencing pipeline at ribosomal database project ( rdp ) . the otus were blast searched against the database with a 95 % identity threshold over at least 180 nucleotides . the different sequence identification levels were analyzed and visualized with regards to relative abundance as a heat map using multieperiment viewer v4 .6 software . principal coordinate analysis ( pcoa ) was performed and visualized in fast unifrac ( http://bmf.colorado.edu/fastunifrac/ ) using normalized weighted abundance . the shannon diversity index was calculated using the r package vegan ( http://cran.r-project.org/package=vegan ) for each sample , and the significance was tested using the wilcoxon rank sum test . the medical history of the patients ( n = 14 ) is presented in table i. all patients except pn14 were diagnosed before 11/2 years of age . of all the patients with scn , six exhibited elane mutations , four hax1 mutations , and three unknown mutation ( s ) . two patients ( pn8 and pn9 ) had received hsct before they were recruited into the study , and three patients ( pn7 , pn8 , and pn9 ) had not received g - csf treatment by the time the clinical examinations were performed . table imedical background of the patients with congenital neutropeniasubjectsagesexdiagnosisgene mutationage at diagnosisanc ( 10 / l ) g - csf / duration / dose ( g / kg / day ) other important clinical findingselanehax1pn114mscnd89hwt4 months2 .1 yes / since diagnosis / 7.8 bronchial asthmapn26mscnc122swt1 week0 .9 yes / since diagnosis / 25g - csf resistant ; t - s prophylaxispn317mscnc26swt1 week0 .5 yes / since 1991/5 .0 t - s prophylaxispn450fscnc26swt3weeks0 .5 yes / since 1991/2 .5 pn519fscnc26swt3 months0 .2 yes / since 1991/4 .5 atopic dermatitispn617mscnwtw44x11 / 2 years1 .5 yes / since diagnosis / 4.3 ureter reflux and kidney infectionpn714mscnwtq190x and e31kfsx542 months1 .0 nopn823mscn ( hsct ) wtq190x2 months1 .7 nohsct at 7 months of age ; epilepsy ; adhdpn931fscn ( hsct ) l92hwt2 weeks3 .1 nodeveloped g - csfr mutations ; hsct 2004pn1021fcynwtwt11 months9 .2 sporadicallypn1119fscnwtq190x13 months7 .0 yes / since 1991/3 .0 developed g - csfr mutations ; epilepsypn128mscnwtwt14 months1 .6 yes / since diagnosis / 9.0 motor proficiency difficultiespn1317mscnwtwt1 year5 .7 yes / since diagnosis / 4.2 special school ; splenomegalypn1427fscnwtwt5 years1 .2 yes / since 1991/1 .5 pn periodontitissulfamethoxazole , g - csfr g - csf receptor , adhd attention deficit hyperactivity disorderhsct before participating in this study . pn8 had mixed chimerism and had been treated with low dose ( 0.5 g / kg / day ) of g - csf until adult age ; pn9 had 100 % donor and normal anccompound heterozygous hax1 ( chax1 ) mutations reference range is 2.08.0 g - csf treatment started in sweden in 1991 medical background of the patients with congenital neutropenia pn periodontitisneutropenia , wt wildtype , t - s trimethoprim sulfamethoxazole , g - csfr g - csf receptor , adhd attention deficit hyperactivity disorder hsct before participating in this study . pn8 had mixed chimerism and had been treated with low dose ( 0.5 g / kg / day ) of g - csf until adult age ; pn9 had 100 % donor and normal anc compound heterozygous hax1 ( chax1 ) mutations reference range is 2.08.0 g - csf treatment started in sweden in 1991 the periodontal conditions of the patients are described in table ii . except for pn4 and pn9 who were edentulous andpn11 who underwent professional dental care 1 year previously , the other patients had had a last dental visit between 2 - to - 6 months prior to the clinical examination . of all the patients with scn , four were classified as being periodontally healthy , two as having gingivitis , five as having periodontitis , and two subjects as edentulous due to periodontitis at an early age . of the six patients with elane mutations , five were diagnosed with periodontitis or edentulous . conversely , within scn cases , the subjects with hax1 or unknown mutations were mostly ( six out of seven ) classified as being healthy or having gingivitis . elane mutations are significantly correlated with the occurrence of periodontitis / edentulism compared to hax1 or unknown mutations ( p = 0.025 ; table iii ) . the single patient with cyn displayed a healthy periodontium . table iiperiodontal status of the patients with congenital neutropeniasubjectsgene mutationfull mouthperiodontal statustested siteelanehax1vpi ( % ) bop ( % ) pd 4 mmtoothpd ( mm ) ecj - mb ( mm ) pn1d89hwt 5050nogingivitis41 , 3132pn2c122swt 5050yesperiodontitis55 , 854 , 34 , 3pn3c26swt 5050yesperiodontitis41 , 3169pn4c26swtedentulouspn5c26swt 5050yesperiodontitis41 , 3165pn6wtw44x 5050yesperiodontitis41 , 3143.5 pn7wtq190x and e31kfsx54150nohealthy41 , 3122pn8wtq190x 2515nohealthy41 , 3121.5 pn9l92hwtedentulouspn10wtwt 1515nohealthy41 , 3122pn11wtq190x00nohealthy41 , 3121.2 pn12wtwt 1515nohealthy41 , 3122pn13wtwt 5050yesperiodontitis41 , 3143.5 pn14wtwt 2525yesgingivitis41 , 3132.5 pn periodontitisneutropenia , wt wildtype , vpi visible plaque index , bop bleeding on probing , pd probing depth , ecj - mb enamel cement junctionmarginal bonesubgingival microbiota analysis from tooth 41 , or from tooth 55 in pn2 ; cytokine and amp analysis from tooth 31 , or from tooth 85 in pn2table iiiperiodontal status of patients with scn harboring different genetic mutationsvariableselane mutations ( n = 6 ) hax1 or unknown mutations ( n = 7 ) p valuereceiving g - csf55periodontal statushealthy04gingivitis11periodontitis / edentulous520 .025 due to periodontitisspearman correlation test periodontal status of the patients with congenital neutropenia pn periodontitisneutropenia , wt wildtype , vpi visible plaque index , bop bleeding on probing , pd probing depth , ecj - mb enamel cement junctionmarginal bone subgingival microbiota analysis from tooth 41 , or from tooth 55 in pn2 ; cytokine and amp analysis from tooth 31 , or from tooth 85 in pn2 periodontal status of patients with scn harboring different genetic mutations spearman correlation test subjects who had received hsct and the edentulous patients ( n = 3 ) were excluded from the gcf analysis . hsct - transplanted patients ( n = 2 ) were excluded from the plasma analysis . neither anc ( p = 0.116 ) , plasma pro - ll - 37 ( p = 0.106 ) , gcf - defensin ( p = 0.703 ) , or gcf pro - ll - 37 / ll - 37 ( p = 0.450 ) levels were significantly different in patients with elane mutations compared to hax1 or unknown mutations . however , an interesting observation was that patients with unknown gene etiology exhibited low levels of both hnp13 and ll - 37 , maybe reflecting a similar gene defect . the ll - 37 levels in all but one patient with scn were 10 - to -1,000-fold lower than in those two patients ( pn8 and pn10 ) that exhibited normal anc levels without g - csf treatment at the time of sampling ( tables i and iv ) . table ivantimicrobial peptides in gcf and plasma from patientsdiagnosisgene mutationsubjectsperiodontal statusgcf hnp13 ( g / ml ) gcf pro - ll - 37 and ll - 37plasma pro - ll - 37 scnelanepn1gingivitis1920 .250.01 pn2periodontitis4280 .820.01 pn3periodontitis 410.560.01 pn5periodontitis 40.050.01 hax1pn6periodontitis406 .210.03 pn7healthy 46.930.01 pn11healthy24778 .180.17 unknownpn12healthy50 .080.06 pn13periodontitis40 .380.10 pn14gingivitis40 .130.09 scn ( hsct ) hax1pn8healthy840324 .00.31 cynunknownpn10healthy227132 .80.54 pn periodontitis neutropeniatwo edentulous patients were excludedhsct before participating in this studyrelative to reference plasmarange in healthy individuals is 0.351.5 antimicrobial peptides in gcf and plasma from patients pn periodontitis neutropenia two edentulous patients were excluded hsct before participating in this study relative to reference plasma range in healthy individuals is 0.351.5 in addition , the level of il - 1 ( p = 0.038 ) in gcf was significantly higher in the elane mutation group compared to hax1 or unknown mutation group ( table v ) . although the levels of il - 17 , il - 6 , and tnf - were not statistically different in the gcf , it may be noted that mean and median values in elane mutation group are higher than in hax1 or unknown mutation group . the gcf cytokine levels of ifn - and il - 4 were both below the detection limit in all samples . moreover , there was no significant difference in terms of the cytokine levels in plasma between the two subgroups of patients . table vcytokines in gcf from patients with scn harboring different genetic mutationscytokines ( ng / ml ) elane mutations ( n = 5 ) hax1 or unknown mutations ( n = 6 ) p valuemedianmean sdmedianmean sdil - 19.313.19.32.95.16.80.038il - 170.50.50.40.10.20.10.131il - 63.03.83.80.80.80.50.186tnf - 0.50.50.40.010.030.050.089 mannwhitney test cytokines in gcf from patients with scn harboring different genetic mutations we generated 8,810 high - quality 16s rrna gene sequences from 12 subgingival bacterial samples ( pn4 and pn10 were excluded due to edentulism ) . the sequences represented seven major phyla : actinobacteria ( 19.5 % ) , bacteroidetes ( 19.5 % ) , firmicutes ( 22.2 % ) , fusobacteria ( 16.6 % ) , proteobacteria ( 15.9 % ) , spirochaetes ( 2.0 % ) , and candidate domain tm7 ( 1.3 % ) . the predominant genera were fusobacterium , streptococcus , rothia , prevotella , corynebacterium , neisseria , veillonella , capnocytophaga , and leptotrichia , which in total accounted for 66 % of all sequences . the shannon diversity index was similar in patients with elane mutations and hax1 or unknown mutations according to wilcoxon rank sum test ( p = 0.788 ) . to illustrate subgingival microbiota composition of individuals , a heat map was generated to reveal the abundance of different taxa in samples from both patients with neutropenia and references ( fig . 1 ) . a sample tree was also created using hierarchical clustering using pearson correlation of absolute distance and complete linkage clustering ( fig . 1 ) .2 ) , three out of four samples from patients with elane mutations were clustered together with all reference samples of periodontitis .2 principal coordinate analysis ( pcoa ) of microbiota in individual subjects using 1 % distance threshold with normalized weighted abundance . the scatterplots are for the first two principal components ( pc1 and pc2 ) ; each point represents a sample . the color scale of relative abundance ranges from 0 % ( black ) to 30 % ( red ) . the dominant taxa ( genus level , except tm7 ) are displayed according to the relative abundance per sample . the sample tree was generated using hierarchical clustering with pearson correlation of absolute distance and complete linkage clustering . r represents reference samples and patient pn10 ( cyn ) principal coordinate analysis ( pcoa ) of microbiota in individual subjects using 1 % distance threshold with normalized weighted abundance . the scatterplots are for the first two principal components ( pc1 and pc2 ) ; each point represents a sample . the heat map depicts the abundance of the different taxa in individual subgingival samples . the color scale of relative abundance ranges from 0 % ( black ) to 30 % ( red ) . the dominant taxa ( genus level , except tm7 ) are displayed according to the relative abundance per sample . the sample tree was generated using hierarchical clustering with pearson correlation of absolute distance and complete linkage clustering . the medical history of the patients ( n = 14 ) is presented in table i. all patients except pn14 were diagnosed before 11/2 years of age . of all the patients with scn , six exhibited elane mutations , four hax1 mutations , and three unknown mutation ( s ) . two patients ( pn8 and pn9 ) had received hsct before they were recruited into the study , and three patients ( pn7 , pn8 , and pn9 ) had not received g - csf treatment by the time the clinical examinations were performed . table imedical background of the patients with congenital neutropeniasubjectsagesexdiagnosisgene mutationage at diagnosisanc ( 10 / l ) g - csf / duration / dose ( g / kg / day ) other important clinical findingselanehax1pn114mscnd89hwt4 months2 .1 yes / since diagnosis / 7.8 bronchial asthmapn26mscnc122swt1 week0 .9 yes / since diagnosis / 25g - csf resistant ; t - s prophylaxispn317mscnc26swt1 week0 .5 yes / since 1991/5 .0 t - s prophylaxispn450fscnc26swt3weeks0 .5 yes / since 1991/2 .5 pn519fscnc26swt3 months0 .2 yes / since 1991/4 .5 atopic dermatitispn617mscnwtw44x11 / 2 years1 .5 yes / since diagnosis / 4.3 ureter reflux and kidney infectionpn714mscnwtq190x and e31kfsx542 months1 .0 nopn823mscn ( hsct ) wtq190x2 months1 .7 nohsct at 7 months of age ; epilepsy ; adhdpn931fscn ( hsct ) l92hwt2 weeks3 .1 nodeveloped g - csfr mutations ; hsct 2004pn1021fcynwtwt11 months9 .2 sporadicallypn1119fscnwtq190x13 months7 .0 yes / since 1991/3 .0 developed g - csfr mutations ; epilepsypn128mscnwtwt14 months1 .6 yes / since diagnosis / 9.0 motor proficiency difficultiespn1317mscnwtwt1 year5 .7 yes / since diagnosis / 4.2 special school ; splenomegalypn1427fscnwtwt5 years1 .2 yes / since 1991/1 .5 pn periodontitissulfamethoxazole , g - csfr g - csf receptor , adhd attention deficit hyperactivity disorderhsct before participating in this study . pn8 had mixed chimerism and had been treated with low dose ( 0.5 g / kg / day ) of g - csf until adult age ; pn9 had 100 % donor and normal anccompound heterozygous hax1 ( chax1 ) mutations reference range is 2.08.0 g - csf treatment started in sweden in 1991 medical background of the patients with congenital neutropenia pn periodontitisneutropenia , wt wildtype , t - s trimethoprim sulfamethoxazole , g - csfr g - csf receptor , adhd attention deficit hyperactivity disorder hsct before participating in this study . pn8 had mixed chimerism and had been treated with low dose ( 0.5 g / kg / day ) of g - csf until adult age ; pn9 had 100 % donor and normal anc compound heterozygous hax1 ( chax1 ) mutations reference range is 2.08.0 g - csf treatment started in sweden in 1991 the periodontal conditions of the patients are described in table ii . except for pn4 and pn9 who were edentulous andpn11 who underwent professional dental care 1 year previously , the other patients had had a last dental visit between 2 - to - 6 months prior to the clinical examination . of all the patients with scn , four were classified as being periodontally healthy , two as having gingivitis , five as having periodontitis , and two subjects as edentulous due to periodontitis at an early age . of the six patients with elane mutations , five were diagnosed with periodontitis or edentulous . conversely , within scn cases , the subjects with hax1 or unknown mutations were mostly ( six out of seven ) classified as being healthy or having gingivitis . elane mutations are significantly correlated with the occurrence of periodontitis / edentulism compared to hax1 or unknown mutations ( p = 0.025 ; table iii ) . the single patient with cyn displayed a healthy periodontium . table iiperiodontal status of the patients with congenital neutropeniasubjectsgene mutationfull mouthperiodontal statustested siteelanehax1vpi ( % ) bop ( % ) pd 4 mmtoothpd ( mm ) ecj - mb ( mm ) pn1d89hwt 5050nogingivitis41 , 3132pn2c122swt 5050yesperiodontitis55 , 854 , 34 , 3pn3c26swt 5050yesperiodontitis41 , 3169pn4c26swtedentulouspn5c26swt 5050yesperiodontitis41 , 3165pn6wtw44x 5050yesperiodontitis41 , 3143.5 pn7wtq190x and e31kfsx54150nohealthy41 , 3122pn8wtq190x 2515nohealthy41 , 3121.5 pn9l92hwtedentulouspn10wtwt 1515nohealthy41 , 3122pn11wtq190x00nohealthy41 , 3121.2 pn12wtwt 1515nohealthy41 , 3122pn13wtwt 5050yesperiodontitis41 , 3143.5 pn14wtwt 2525yesgingivitis41 , 3132.5 pn periodontitisneutropenia , wt wildtype , vpi visible plaque index , bop bleeding on probing , pd probing depth , ecj - mb enamel cement junctionmarginal bonesubgingival microbiota analysis from tooth 41 , or from tooth 55 in pn2 ; cytokine and amp analysis from tooth 31 , or from tooth 85 in pn2table iiiperiodontal status of patients with scn harboring different genetic mutationsvariableselane mutations ( n = 6 ) hax1 or unknown mutations ( n = 7 ) p valuereceiving g - csf55periodontal statushealthy04gingivitis11periodontitis / edentulous520 .025 due to periodontitisspearman correlation test periodontal status of the patients with congenital neutropenia pn periodontitisneutropenia , wt wildtype , vpi visible plaque index , bop bleeding on probing , pd probing depth , ecj - mb enamel cement junctionmarginal bone subgingival microbiota analysis from tooth 41 , or from tooth 55 in pn2 ; cytokine and amp analysis from tooth 31 , or from tooth 85 in pn2 periodontal status of patients with scn harboring different genetic mutations spearman correlation testsubjects who had received hsct and the edentulous patients ( n = 3 ) were excluded from the gcf analysis . hsct - transplanted patients ( n = 2 ) were excluded from the plasma analysis . neither anc ( p = 0.116 ) , plasma pro - ll - 37 ( p = 0.106 ) , gcf - defensin ( p = 0.703 ) , or gcf pro - ll - 37 / ll - 37 ( p = 0.450 ) levels were significantly different in patients with elane mutations compared to hax1 or unknown mutations . however , an interesting observation was that patients with unknown gene etiology exhibited low levels of both hnp13 and ll - 37 , maybe reflecting a similar gene defect . the ll - 37 levels in all but one patient with scn were 10 - to -1,000-fold lower than in those two patients ( pn8 and pn10 ) that exhibited normal anc levels without g - csf treatment at the time of sampling ( tables i and iv ) . table ivantimicrobial peptides in gcf and plasma from patientsdiagnosisgene mutationsubjectsperiodontal statusgcf hnp13 ( g / ml ) gcf pro - ll - 37 and ll - 37plasma pro - ll - 37 scnelanepn1gingivitis1920 .250.01 pn2periodontitis4280 .820.01 pn3periodontitis 410.560.01 pn5periodontitis 40.050.01 hax1pn6periodontitis406 .210.03 pn7healthy 46.930.01 pn11healthy24778 .180.17 unknownpn12healthy50 .080.06 pn13periodontitis40 .380.10 pn14gingivitis40 .130.09 scn ( hsct ) hax1pn8healthy840324 .00.31 cynunknownpn10healthy227132 .80.54 pn periodontitis neutropeniatwo edentulous patients were excludedhsct before participating in this studyrelative to reference plasmarange in healthy individuals is 0.351.5 antimicrobial peptides in gcf and plasma from patients pn periodontitis neutropenia two edentulous patients were excluded hsct before participating in this study relative to reference plasma range in healthy individuals is 0.351.5 in addition , the level of il - 1 ( p = 0.038 ) in gcf was significantly higher in the elane mutation group compared to hax1 or unknown mutation group ( table v ) . although the levels of il - 17 , il - 6 , and tnf - were not statistically different in the gcf , it may be noted that mean and median values in elane mutation group are higher than in hax1 or unknown mutation group . the gcf cytokine levels of ifn - and il - 4 were both below the detection limit in all samples . moreover , there was no significant difference in terms of the cytokine levels in plasma between the two subgroups of patients . table vcytokines in gcf from patients with scn harboring different genetic mutationscytokines ( ng / ml ) elane mutations ( n = 5 ) hax1 or unknown mutations ( n = 6 ) p valuemedianmean sdmedianmean sdil - 19.313.19.32.95.16.80.038il - 170.50.50.40.10.20.10.131il - 63.03.83.80.80.80.50.186tnf - 0.50.50.40.010.030.050.089 mann whitney test cytokines in gcf from patients with scn harboring different genetic mutationswe generated 8,810 high - quality 16s rrna gene sequences from 12 subgingival bacterial samples ( pn4 and pn10 were excluded due to edentulism ) . the sequences represented seven major phyla : actinobacteria ( 19.5 % ) , bacteroidetes ( 19.5 % ) , firmicutes ( 22.2 % ) , fusobacteria ( 16.6 % ) , proteobacteria ( 15.9 % ) , spirochaetes ( 2.0 % ) , and candidate domain tm7 ( 1.3 % ) . the predominant genera were fusobacterium , streptococcus , rothia , prevotella , corynebacterium , neisseria , veillonella , capnocytophaga , and leptotrichia , which in total accounted for 66 % of all sequences . the shannon diversity index was similar in patients with elane mutations and hax1 or unknown mutations according to wilcoxon rank sum test ( p = 0.788 ) . to illustrate subgingival microbiota composition of individuals , a heat map was generated to reveal the abundance of different taxa in samples from both patients with neutropenia and references ( fig . 1 ) . a sample tree was also created using hierarchical clustering using pearson correlation of absolute distance and complete linkage clustering ( fig . 1 ) .2 ) , three out of four samples from patients with elane mutations were clustered together with all reference samples of periodontitis .2 principal coordinate analysis ( pcoa ) of microbiota in individual subjects using 1 % distance threshold with normalized weighted abundance . the scatterplots are for the first two principal components ( pc1 and pc2 ) ; each point represents a sample . the color scale of relative abundance ranges from 0 % ( black ) to 30 % ( red ) . the dominant taxa ( genus level , except tm7 ) are displayed according to the relative abundance per sample . the sample tree was generated using hierarchical clustering with pearson correlation of absolute distance and complete linkage clustering . r represents reference samples and patient pn10 ( cyn ) principal coordinate analysis ( pcoa ) of microbiota in individual subjects using 1 % distance threshold with normalized weighted abundance . the scatterplots are for the first two principal components ( pc1 and pc2 ) ; each point represents a sample . the color scale of relative abundance ranges from 0 % ( black ) to 30 % ( red ) . the dominant taxa ( genus level , except tm7 ) are displayed according to the relative abundance per sample . the sample tree was generated using hierarchical clustering with pearson correlation of absolute distance and complete linkage clustering . although the prognosis and quality of life of patients with congenital neutropenia were improved dramatically following the introduction of g - csf therapy 20 years ago , some patients still suffer from frequent periodontal infections despite efficient and adequate oral hygiene . in the current study , we demonstrate for the first time a link between mutations affecting elane encoding neutrophil elastase and the occurrence of periodontitis . the periodontal condition of the patients in the present study varied from healthy to severe periodontitis and two patients were edentulous due to periodontitis , indicating great variation of the chronic inflammatory response in the periodontium among patients with congenital neutropenia . recent genetic studies have identified multiple gene mutations in scn , with the most common mutations affecting the elane ( ela2 ) gene . to date , more than 45 distinct elane mutations have been described in scn and cyn . our current findings demonstrate a correlation between elane mutations and periodontitis in patients with scn , concurring with the view that elane mutations are correlated with more severe disease manifestations and having a relatively poorer response to g - csf treatment . however , the number of patients in our study is limited since scn is a rare disease . further investigation involving a larger cohort will be needed to confirm our findings . many of the patients with elane mutations had low anc and therefore may be expected to have more severe periodontal disease . however , it is both neutrophil functionality and neutrophil counts over time that can affect the outcome of periodontal disease . moreover , factors such as oral hygiene and diet may influence the outcome of oral health , which we have attempted to account for by using questionnaires for patients and their dentists . the antimicrobial peptides hnp13 and ll - 37 are produced during neutrophil maturation in the bone marrow and are stored as pro - peptides in neutrophil granules . the pro - ll - 37 ( hcap18 ) is also detectable in plasma from healthy individuals . we previously demonstrated that plasma pro - ll - 37 levels were low in patients with scn in spite of g - csf elevated neutrophil levels , thus reflecting impaired neutrophil development . in the current study , pro - ll - 37 levels in plasma were low in all patients with scn and did not differ between the elane mutation group compared to hax1 or unknown mutation group . in gcf , elevated levels of both hnp13 and ll - 37 have been reported in subjects with chronic periodontitis , most likely due to enhanced neutrophil influx . in our study , the gcf levels of hnp13 and ll - 37 did not appear to be statistically different between patients harboring different mutations , possibly due to the wide range of values in both groups . the - defensins hnp13 are stored in primary granules in neutrophils , and the gcf levels of hnp13 have been reported to vary widely in healthy subjects . the considerable difference of gcf hnp13 in the present study is compatible with our previous observation that hnp13 levels vary from deficiency to normal levels in neutrophils from patients with scn . to date , gingival ll - 37 has been demonstrated to have two main sites of origin , neutrophils and epithelial cells . in the absence of neutrophil - derived ll - 37 in the gcf of patients with scn , it was possible to determine the epithelial contribution to ll - 37 levels , which was found to be noticeably low . ll - 37 levels below bactericidal concentrations have been demonstrated to serve as a chemoattractant or modulator of host inflammatory responses in concert with other epithelial - derived cytokines . thus , in the absence of efficient neutrophil antibacterial clearance due to deficiency of neutrophil granule peptides , epithelial - derived peptides might even augment periodontal inflammation . in the current study , we demonstrated that il - 1 levels were significantly higher in gcf samples from subjects with mutant elane . in addition , the mean and median levels of il - 17 , il - 6 , and tnf - in patients with elane mutations were higher than in hax1 or unknown mutations although these differences did not reach statistical significance , most likely due to the small size of the cohort and great variations within groups . it is known that elevated levels of il - 1 , il - 6 , tnf - , and il - 17 in gcf are associated with severe periodontal disease , and that these cytokines may also be elevated in chronic periodontitis tissue . thus , the gcf from patients with elane mutations displays the presence of the strong proinflammatory cytokine il - 1 , which might be expected in the inflamed periodontium . oral microbiota in the healthy population has been determined using high - throughput 16s rdna pyrosequencing in several studies , providing a rather comprehensive view of the oral commensal microbial community . to our knowledge , this is the first time that the 16s rdna pyrosequencing technique has been employed to map subgingival microbiota in subjects with a congenital immunodeficiency . the predominant taxa from periodontal sites of individuals with scn were similar to the microbiota previously reported from healthy subjects . although two patients with elane mutations were not included in microbiota analyses due to edentulism , hierarchical clustering and unifrac pcoa analysis revealed that three out of four samples from the elane mutation group were clustered with the periodontitis reference individuals . the skewed periodontal microbiota in both periodontitis references and the elane mutation group of scn cases indicates that periodontal pathogens of the genera fusobacterium , prevotella , treponema , and tm7 domain are more likely to grow in the gingival crevices in patients with elane mutations compared to hax1 or unknown mutations . as an outlier , pn2 did not cluster with other individuals with elane mutations that may partly be explained by the fact that periodontal pathogens of young children may differ from those of adolescent or adults . the neutropenia of patients with scn arises as a consequence of bone marrow neutrophil precursor accelerated apoptosis . hax - 1 is a mitochondrial protein involved in maintaining the mitochondrial membrane potential , signal transduction , and cell survival . the hax1 mutations in scn result in hax -1-deficient neutrophils and neutrophil precursors , which have been demonstrated to show enhanced apoptosis . the mechanism by which elane mutations result in apoptosis of neutrophil precursors is less obvious , but it has been suggested that the accumulation of misfolded elastase proteins activates the unfolded protein response , leading to apoptosis . although rescued by g - csf treatment , the neutrophils with elane mutations still carry mutated elastase proteins that may be aberrant in their localization and functions such as proteolytic processing of other proenzymes or cytokines , which in turn may affect the local periodontal immune response . thus , it is possible that in addition to the antimicrobial peptide deficiency that is shared by all patients with scn , the elane mutations may confer an additional neutrophil dysfunctionality , leading to more severe periodontal disease . we herein report that patients with scn that harbor mutations in the gene elane coding for neutrophil elastase present with more severe periodontal disease as compared to patients with hax1 mutations or with unknown mutations . the periodontal pockets of the former group display a skewed microflora and elevated levels of proinflammatory cytokine il - 1 . the correlation between elane mutations and periodontal disease indicates that the serine protease elastase may have an important role in the local defense in the gingival pocket .\noutput:\n" }, { "from": "agent", "value": "backgroundpatients with severe congenital neutropenia ( scn ) often develop periodontitis despite standard medical and dental care . in light of previous findings that mutations in the neutrophil elastase gene , elane , are associated with more severe neutropenic phenotypes , we hypothesized an association between the genotype of scn and development of periodontitis.methodsfourteen swedish patients with scn or cyclic neutropenia harboring different genetic backgrounds were recruited for periodontal examination . peripheral blood , gingival crevicular fluid ( gcf ) , and subgingival bacterial samples were collected . the levels of cytokines and antibacterial peptides were determined in gcf and plasma by multiplex immunoassay and immunoblotting , respectively . subgingival bacterial samples were analyzed using 16s rdna pyrosequencing.resultselane mutations correlated with more severe periodontal status than the hax1 or unknown mutations in patients with scn . the subjects with mutant elane had higher levels of il - 1 in gcf . using principal coordinate analysis of the subgingival microbiota , patients with elane mutations and reference subjects with periodontitis tended to cluster differently from patients with hax1 or unknown mutations and non - periodontitis reference subjects.conclusionthis study demonstrates an association between elane mutations in scn and the development of periodontitis with skewed subgingival microbiota , indicating a potential role of elane mutations in the pathogenesis of periodontitis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: palliative systemic chemotherapy is the cornerstone , with response rates of 2030 % and median overall survival generally lower than 12 months . in thissetting , a subgroup of patients with limited metastatic disease may derive benefit from more aggressive , multidisciplinary strategies . for instance , patients undergoing complete resection of pulmonary metastases may achieve a median survival of 1933 months , which was significantly better than the results accomplished with systemic chemotherapy alone . however , selected patients with overt metastatic disease may also be treated with intensive approaches , as illustrated here . a 47 - year - old woman presented with a 1 - month complaint of a painless mass in the neck . the patient was at performance status ( ps ) of 1 , had no weight loss , and her medical records included a previous hysterectomy due to uterine myomas , and prosthetic breast implants . at the physical examination , a complex of enlarged lymph nodes measuring 3.52.7 cm was noted in the right supraclavicular fossa . the cervical mass was totally resected in december 2011 and histopathologic examination confirmed the diagnosis of metastatic , well - differentiated leiomyosarcoma , with immunopositivity for vimentin , desmin , hhf - 35 , cd68 , and immunonegativity for cd34 and s100 . positron emission tomography ( pet ) / computed tomography ( ct ) was performed for staging ( fig .1 ) , and multiple hypodense hepatic lesions were detected , the most avid located in segments viii ( maximum standardized uptake value suvmax of 9.3 ) , iv ( suvmax 5.4 ) , and vi ( suvmax 7.1 ) . a retroperitoneal mass measuring 5.14.7 cm , located near the inferior pole of the right kidney ( suvmax 8.6 ) was also noted , suggesting a conglomerate of metastatic lymph nodes ( fig .2 ) . figure 1morphologic ( top ) and metabolic ( bottom ) evolution of the liver metastasis before ( left ) and after ( right ) treatment , including chemotherapy and tace . figure 2morphologic ( top ) and metabolic ( bottom ) evolution of the retroperitoneal mass before ( left ) and after ( right ) treatment , including chemotherapy and tumor ablation . although mild residual fluorodeoxyglucose uptake ( suvmax 2.1 ) was observed in the medial aspect of the node after treatment , this finding was not considered qualitatively significant . morphologic ( top ) and metabolic ( bottom ) evolution of the liver metastasis before ( left ) and after ( right ) treatment , including chemotherapy and tace . morphologic ( top ) and metabolic ( bottom ) evolution of the retroperitoneal mass before ( left ) and after ( right ) treatment , including chemotherapy and tumor ablation . although mild residual fluorodeoxyglucose uptake ( suvmax 2.1 ) was observed in the medial aspect of the node after treatment , this finding was not considered qualitatively significant . she was started on systemic chemotherapy with doxorubicin 20 mg / m on days 13 , and ifosfamide 1500 mg / m on days 14 , both intravenously , every 3 weeks . primary prophylaxis was used for febrile neutropenia with 5 days of filgrastim , 300 g / day as subcutaneous injection . after 5 cycles , an abdominopelvic ct scan revealed partial response in the liver and in the retroperitoneum , and further therapeutic options were discussed with the patient , and in a multidisciplinary setting . given the severity of the metastatic disease to the liver , hepatic transarterial chemoembolization ( tace ) was recommended to achieve better local control . the first tace infusion was carried out in july 2011 using 150 mg of doxorubicin divided into 2 vials of drug - eluting beads ( dc - beads , terumo ) . a superselective approach with coaxial microcatheters ( progreat , terumo ) the patient had mild to moderate acute toxicities , including grade 2 nausea , vomiting , and fatigue . one month later , an abdominopelvic ct demonstrated a major response in all hepatic lesions ( fig .3 ) , and most of them became avascular after contrast enhancement , suggesting necrotic transformation . figure 3abdominal contrast - enhanced ct before ( top ) and after ( bottom ) the first hepatic tace procedure , showing a robust response in the metastatic hepatic lesions during the arterial phase . abdominal contrast - enhanced ct before ( top ) and after ( bottom ) the first hepatic tace procedure , showing a robust response in the metastatic hepatic lesions during the arterial phase . at this time , the retroperitoneal mass was the only site of active disease , and a partial response was maintained , measuring 3.02.3 cm . hence , ct - guided percutaneous radiofrequency ablation ( rfa ) was indicated in october 2011 . during this procedure , under sedation , a cooled saline infusion catheter was placed in the right ureter to avoid rfa damage , because of its proximity to the retroperitoneal lymph node mass . for the same reason , a prophylactic double j stent was inserted at the end of the procedure . for the rfa , the procedure was performed using 15 - cm cool - tip electrodes ( valleylab ) with 3 - cm active tips . energy was delivered to reach tissue temperatures higher than 70c for a nearly 10 - min ablation cycle . subsequently , the probe was repositioned and a second cycle was performed using the same protocol . technical success was immediately confirmed with the demonstration of no tumor enhancement on a contrast ct scan . in the immediate post - operative period , an uncomplicated urinary infection was diagnosed , which was effectively treated with intravenous antibiotics ( ciprofloxacin 400 mg every 12 h ) . during surveillance , . 1 and 2 ) , and complete morphologic and metabolic responses were observed , both in the liver and in the retroperitoneum . only a mild residual fluorodeoxyglucose uptake ( suvmax 2.1 ) was observed in the medial aspect of the retroperitoneal lymph node , which was not considered qualitatively significant . even thought pet was totally negative , 2 more tace infusions were recommended because the abdominal ct scan still showed very slight enhancement in some hepatic lesions . the same protocol used in the first session was followed in the subsequent infusions , with a 3 - month interval between each . the patient currently remains at ps 0 , with great quality of life , and without evidence of disease activity after 18 months from the diagnoses . tace is an established procedure for the treatment of patients with primary and metastatic liver tumors ; it enables a high chemotherapy delivery despite a low systemic toxicity profile , achieving robust tumor control in selected cases . therefore , diffuse or unresectable metastatic disease to the liver may still be effectively controlled . the use of tace in metastatic sarcomas is only rarely mentioned in the literature , although favorable responses have been reported . in the present case , completemorphologic and metabolic responses were obtained after a first tace infusion , corroborating its effectiveness in this context . rfa is a method of thermal ablation mostly used for small tumors ( ideally 3 cm ) , especially in the liver . in well - differentiated sarcomas , rfa has been used to treat pulmonary metastases in patients who are suboptimal surgical candidates . the outcomes with this strategy may approach those reported with pulmonary metastasectomy , especially when complete ablation is accomplished . however , a wider range of indications has been suggested , including ablation of retroperitoneal masses . in the reported case , a complete response was achieved in the retroperitoneal lymph node conglomerate , which was confirmed at a post - therapy pet / ct . moreover , aggressive therapies including tace and rfa should be considered in fit patients , where tumor response to induction chemotherapy might be a reasonable selection factor .\noutput:\n" }, { "from": "agent", "value": "abstractmetastatic leiomyosarcoma has a dismal prognosis , and therapy mainly consists of palliative systemic chemotherapy . a selected subgroup of patients with limited metastatic disease may eventually derive benefit from more aggressive strategies , including resection of isolated metastasis . we report here the successful use of hepatic transarterial chemoembolization and retroperitoneal lymph node radiofrequency ablation in a patient with advanced leiomyosarcoma metastatic to the liver and retroperitoneum ." } ]